text
stringlengths
0
868k
Vinyl - substituted cyclopropanes are readily accessible intermediates that are commonly used in synthesis . Release of the cyclopropane ring strain provides a driving force for a variety of radical and metal - mediated transformations . The archetypical transformation is the rearrangement of vinylcyclopropanes to cyclopentenes at high temperatures (often 300 c or more), hereafter called the vinylcyclopropane rearrangement (figure 1a). Rearrangement reactions of vinylcyclopropanes and divinylcyclopropanes . Among the various substituted vinylcyclopropanes, 1,2-divinyl - cyclopropanes are important precursors for 3,3-sigmatropic reactions like the cope rearrangement (figure 1b). Such rearrangements typically occur at more accessible temperatures (<100 c) than vinylcyclopropane rearrangements provided that the vinyl groups are disposed 1,2-cis . At higher temperatures, cis and trans isomers often equilibrate, opening a path from the trans isomer to the cope product . The parent 1,1-divinylcyclopropane has been studied in detail by dolbier, and undergoes the vinylcyclopropane rearrangement to give vinylcyclopentene at about 250 c (figure 1c). We recently used complex yet readily available 1,1-divinyl - cyclopropanes as key intermediates for tandem radical cyclizations to make meloscine and a variety of analogs . In a typical example (figure 2), treatment of 1 with tributyltin hydride produced tetracycle 2, which was further converted to the natural products epi - meloscine 3a (in 3 steps) and meloscine3b (in one more step). While studying the radical - mediated rearrangements of 1,1-divinylcylopropanes with phenyl substituents, we began to encounter facile rearrangements that occurred without radical initiators . Radical rearrangement of a 1,1-divinylcyclopropane is a key step in a short synthesis of epi - meloscine, meloscine, and analogs . Here we report that suitably substituted 1,1-divinyl-2-phenyl - cylopropanes undergo a variety of thermal rearrangements in an accessible temperature regime . These include the vinylcyclopropane rearrangement, a tandem aromatic cope - ene rearrangement, and a retro - ene reaction followed by either tautomerization or claisen rearrangement . Taken together, the results suggest that substituted 1,1-divinylcylopropanes have a rich and controllable rearrangement chemistry . We first encountered pure thermal rearrangements of 1,1-divinyl-2-phenylcylopropanes during study of the tandem radical cyclization of benzyl allyl amide 9a, whose synthesis and onward radical and thermal reactions are shown in schemes 1 and 2 . Regioselective cyclopropanation of the diethylphosphate ester of buta-2,3-dien-1-ol4 with ethyl 2-phenyldiazoacetate was catalyzed by rh2(esp)2 to provide stable methylenecyclopropane 5 in 70% yield . Addition of vinyl magnesium bromide (c2h3mgbr) to a solution of cucn (0.2 equiv), licl (0.2 equiv), and 5 followed by workup and chromatography provided a 62% yield of 1,1-divinylcyclo - propane ester 6 resulting from sn2 displacement of the phosphate . Also isolated in 22% yield was regioisomer 7 resulting from sn2 displacement . Despite the minor sn2 product, this two - step route to the divinylcyclopropane 6 is more direct and more efficient than the five - step route used for the divinylcyclopropanes in the meloscine work . Base - promoted hydrolysis of hindered ester 6 in ether with excess potassium tert - butoxide and a limited amount of water (3 equiv) provided acid 8 after standard workup . This is important because standard saponification of the hindered ester of 7 did not occur at room temperature . Heating gave multiple products, some of which we later understood to arise from thermal rearrangements (see below). Acid 8 became a pivotal intermediate in synthesis of substrates for the rearrangement studies, so the crude product was purified by flash chromatography to provide a high quality sample in 77% yield . Reaction of 8 with the 1-chloro - n, n-2-trimethyl-1-propenylamine (ghosez reagent), 4-(n, n - dimethylamino)-pyridine (dmap), and allylbenzylamine provided amide 9a in 69% yield . In a typical tandem radical reaction experiment (scheme 2a), a benzene solution of 9a and diphenyl disulfide was irradiated with a uv lamp at room temperature . This product presumably results from the sequence of elementary steps summarized in scheme 2a . Addition of phs to one of the vinyl groups of 9a induces cyclopropane opening to give dienyl sulfide 11 . This undergoes two successive 5-exo radical cyclizations to give bicyclic -thiophenyl radical 12, which in turn fragments to provide 10 and give back phs. In reactions of 9a with various radical - generating species (phssph, bu3snh) conducted above room temperature, we consistently observed two new products by tlc analysis alongside 10 . This was reminiscent of the above attempts at thermal saponification, which also gave unexpected products . So we hypothesized that background thermal chemistry was occurring . In a control experiment shown in scheme 2b, after 2 h, both precursor 9a and tandem radical product 10 were absent by tlc analysis; the spots for the two new thermally formed products were the only ones present . This is the product of a vinylcyclopropane rearrangement in which one of the vinyl groups of the divinylcyclopropane participates and the other is a substituent . The rearrangement is regioselective with migration to the more - substituted cyclopropane carbon atom (the one bearing the amide and phenyl groups). The major product was a more deeply rearranged tricyclic spirolactam 14a, isolated in 71% yield as a single stereoisomer . The structure of 14a was assigned by a series of 1d and 2d nmr experiments (see supporting information). The upfield chemical shift of the protons of the methyl substituent on the lactam ring (d, 0.55 ppm) shows that this group is cis to the adjacent phenyl ring . Spirolactam 14 forms by an aromatic cope rearrangement followed by an ene reaction, as discussed in more detail below . The conversion of 9a to 13a and 14a occurs at slower but still significant rates at temperatures as low as 40 c (about 40% conversion after 36 h). Storage for a few days at ambient temperatures does not give much rearrangement, but a freezer is recommended for long - term storage of 9a and related divinylcyclopropanes . We next studied both of these rearrangement pathways with the aid of readily available acid 8 as a common precursor for a dozen assorted substrates . (here we focus on the rearrangement chemistry; see the supporting information for full details on substrate preparation and characterization .) To study the vinylcyclopropane rearrangement, we used precursors shown in table 1 either without a pendant enophile (acid 8 itself and the saturated ester 16a and amide 9b) or precursors with an enophile that is held in an unfavorable geometry for an ene reaction (allyl ester 16b and cyclic allyl amides 9c and 9d). After automated flash chromatography . As shown by the results in table 1, these substrates all provided solely the products of regioselective vinylcyclopropane rearrangements in good yields . For example, heating of parent acid 8 in refluxing toluene for 2 h, followed by cooling, evaporation, and flash chromatography, provided ring expanded vinylcyclopentenyl acid 15 in 86% yield (table 1, entry 1). Likewise, the derived esters 16a, b and amides 9b d provided the corresponding ring - expanded products 17a, b and 13b d in spot - to - spot reactions and with uniformly good isolated yields (7391%, entries 26). Returning to the major spirolactam product 14a of scheme 1b, we suggest that this forms by the back - to - back sigmatropic reactions shown in figure 3 . First, the phenyl ring and the adjacent cis - vinyl group combine in a 3,3-sigmatropic reaction that is a rare example of an aromatic cope rearrangement to give 18a (figure 3a). This rearrangement may be endothermic, but the release of strain energy of the cyclopropane at least partially compensates for the loss of aromaticity of the phenyl ring . Spirolactam 14a forms by a rare and probably reversible aromatic cope rearrangement followed by an irreversible ene reaction . The exomethylene cyclohexadiene in 18a is a highly reactive enophile, and the ensuing intramolecular ene reaction provides the aromatized spirolactam 14a (figure 3b). The geometry of the ene reaction necessitates that the new ch3 group in the product is cis to the aromatic ring . To further study the aromatic cope - ene path, we prepared the four amides 9e h shown in scheme 3 . Like 9a, each of these substrates has an accessible ene component of an ene reaction (alkene or alkyne) present on the amide n - substituent . As usual, these precursors were made in good yields from the pivotal acid 8 . Heating of n, n - diallylamide 9e at reflux in toluene for 2 h, followed by evaporation and chromatography, provided spirolactam 14e in 65% again as a single isomer . Likewise, the phenyl - substituted diallyl amide 9f provided 14f as a single stereoisomer in 45% yield . In this and the following examples, we stopped targeting isolation of the minor vinylcyclopentene products, but these were present in small amounts prior to the chromatography . Thermal reactions of the two n - propargyl amides 9 g and 9h gave similar ratios of spirolactams - to - vinylcyclopentenes, roughly 6/1 according to h nmr integration of the crude products . The major spirolactams 14 g and 14h were isolated in 73% and 53% yield, respectively . In the case of propargyl silane 9h, the alkenyl silane product 14h was a single z - isomer, again resulting from the geometry of the intramolecular ene reaction . To learn about chirality transfer in these rearrangements, we selected diallyl amide 9e because two reactions (aromatic cope and vinylcyclopentene rearrangements) can be probed in one experiment . Racemic 9e was resolved into its component enantiomers by chiral hplc (see supporting information), and then these enantiomers were heated individually under the usual conditions . Starting from highly enriched precursors 9e (er 96/4 and 1/99), the cope - ene products 14e showed low levels of enantioenrichment (58/42 and 35/65) while the vinylcyclopentene products 13e were racemic (50/50). Further, chiral hplc analysis of starting material at partial conversion showed that racemization of 9e competed efficiently with its onward reactions . In a typical experiment, the conversion of 9e at 60 min was 76% and the er of remaining 9e was 54/46 (initial er 96/4). The starting divinylcyclopropane 9e or ent-9e opens to a diradical (boxed intermediate) that is either achiral or more likely chiral but racemic due to rapid -bond rotations . Both components of the diradical are well stabilized by conjugation, accounting for the relatively low temperature of bond cleavage . Reclosure of the diradical in a 1,1-fashion racemizes the precursor while closure in a 1,3-fashion provides the fully racemic vinylcyclopropane rearrangement product 13e . Possible mechanistic scenario for competing vinylcyclopropane and cope - ene rearrangement paths with a focus on stereochemistry . The aromatic cope rearrangement could be concerted and stereospecific with 9e giving 18e and ent-9e giving ent-18e . (a boat transition state with both -groups endo to the cyclopropane ring is expected .) However, this rearrangement is probably reversible and either it or the ensuing ene reaction competes ineffectively with the racemization of the precursor 9e in refluxing toluene . It is also possible that the aromatic cope rearrangement is not concerted, but instead, product 18e arises by 3,3-closure of the diradical . However, recall that the vinylcyclopropane product 13e is racemic but that the cope - ene product 14e is not . This suggests that the diradical may not be a common intermediate in their formation . Instead, the partial (but not complete) racemization of the precursor may better account for the low (but not zero) level of chirality transfer from 9e to 14e . The types of products that we observe provide an interesting contrast to recent observations by stephenson and co - workers . They generated vinyl phenylcyclopropanes like 19 in situ by radical cyclizations and observed that these underwent rearrangements to 21, presumably by an aromatic cope rearrangement to 20 followed by rearomatization by 1,3-hydrogen shift . Stephenson observed no vinylcyclopropane rearrangement products at all, and our substrates never gave products of aromatic cope rearrangements followed by hydrogen shift . This is surprising because rearomatization by 1,3-shift is a common reaction of exomethylene cyclohexadienes . The concerted shift is thermally forbidden, but deprotontation / reprotonation or other stepwise mechanisms are possible . In our substrates, the vinylcyclopropane rearrangement competes with the cope - ene rearrangement of 9a and 9e h as indicated by the consistent observation minor cyclopentene products 13a and 13e h (schemes 2 and 3). With the substrates in table 1, where onward ene reactions are either impossible or disfavored by geometry, we isolate only the vinylcyclopropane rearrangement products . For example, the reaction of 16a did not produce any rearomatized aromatic cope product 23 (figure 5b), only vinylcyclopentene 17a . Contrasts with the results of stephenson . Still, the reversible aromatic cope rearrangement must be occurring at least to some extent with 16a and related substrates because they are so structurally similar to amides 9a and 9e g (only the amide or ester group differs). As they reflect this similarity, all the precursors react under the same conditions independent of which products are finally formed . Evidently then, rearomatization of the transient aromatic cope rearrangement products like 22 cannot compete with either the onward ene reaction (when available) or the vinylcyclopropane rearrangement . In an effort to induce rearomatization by hydrogen - shift, we heated ester 16a in toluene with either acid (cf3co2h, 2 equiv) or base (ipr2net, 2 equiv); however, no new rearomatization product 23 was observed (figure 5b). Instead, the usual vinylcyclopentene 17a was the only apparent product, and it was formed at about the same rate as in the experiment with no additive (table 1, entry 2). Finally, to learn about the role of the carbonyl group in these acid, ester, and amide substrates, we prepared alcohol 24 by reduction of ester 6 with lithium aluminum hydride (91% yield, see supporting information), then converted this to allyl ether 28 with nah and allyl bromide (67% yield). To start, both 24 and 28 were stable in refluxing toluene for several hours . So, the carbonyl group is an important activator in the acid, ester, and amide substrates even though it is not a direct participant in either the vinylcyclopropane or aromatic cope rearrangements . The reduced substrates 24 and 28 both underwent clean rearrangements at 250 c in dmf in a microwave apparatus to give new types of products . Rearrangement of alcohol 24 (scheme 4a) provided dienyl aldehyde 25 in 59% yield as a 6/1 mixture of e / z isomers alongside 21% of the vinylcyclopropane rearrangement product 26 . Aldehyde 25 probably arises from the retro - ene reaction of 24 via ts-24 to form enol 27, which then tautomerizes . Allyl ether 28 was then prepared because it has the requisite functionality to undergo all three types of thermal rearrangements observed so far . These are (1) the aromatic cope - ene rearrangement (the allyl group of the ether is the potential ene component of 28); (2) the vinylcyclopropane rearrangement; and (3) the retro - ene reaction . In the event, heating of allyl ether 28 at 250 c provided a mixture of a major aldehyde product 29a and a minor vinylcyclopropane rearrangement product 30 . These products could not be separated by direct flash chromatography, so the mixture was exposed to sodium borohydride . This reduced the aldehyde 29a to the more polar alcohol 29b, which was then isolated in 50% yield by flash chromatography . The less polar vinylcyclopropane rearrangement product 30 survived the nabh4 reduction, and was isolated in 21% yield . Aldehyde 29a presumably arises from an initial retro - ene reaction through ts-28 that gives allyl vinyl either 31 . Subsequent 3,3-sigmatropic rearrangement of this intermediate (a claisen rearrangement) provides the major product 29a . The aromatic cope - ene product from this substrate would be a spiro ether, but there is no evidence for its formation . These results suggest that 1,1-divinyl-2-phenylcyclopropanes are a class of substrates that have an especially rich array of rearrangement reactions . Figure 6 summarizes the different pathways observed herein . Starting from derivatives of a single divinylcyclopropane acid 8, we have isolated the products of tandem radical reactions, vinylcyclopropane rearrangements, aromatic cope - ene rearrangements, and retroene rearrangements followed by either tautomerization or claisen rearrangement . Common acid precursor 8 provides a diverse set of rearrangement products in 13 steps . Each of the structure types can be formed as the major (though not always exclusive) product . The default thermal reaction seems to be the vinylcyclopropane rearrangement, which gives vinylcyclopentene products in high yields when the other paths are disfavored or impossible . However, the other paths are easily dialed in by choice of r group and reaction conditions . In contrast, all three types of thermal reactions produce 1,3-dienes that directly result from the divinylcyclopropane . However, the structural setting of these dienes is very different depending on the reaction . The versatility of the reactions and the diversity of the products suggest that substituted 1,1-divinylcyclopropanes could be useful intermediates in synthesis, perhaps even on par someday with their much more well studied monovinyl- and 1,2-divinylcyclopropane relatives.
As depicted in figure 1a, the cortical activation necessary to maintain wakefulness is supported by an extensive network of subcortical structures and pathways . Major neurochemicals of this ascending arousal system include excitatory norepinephrine arising from the locus ceruleus (lc), serotonin from the midline raphe nuclei, histamine from the tuberomammillary nucleus, dopamine from the ventral periacqueductal gray matter, acetylcholine from the pedunculopontine tegmentum, and the laterodorsal tegmentum of the pons and orexin from the perifornical area . Despite their apparent redundancy, normal behavioral functioning may require all of these arousing systems . For example, it is now clear that narcolepsy results from a selective loss of orexin - releasing neurons in the forebrain, accounting for the excessive daytime sleepiness, fragmented sleep, and cataplexy (sudden muscle weakness without loss of consciousness) associated with this disorder . Panel a depicts key elements of the ascending arousal systems, with diffuse excitatory projections to the cortex . Panel b shows pathways arising from the hypothalamus that inactivate the ascending arousal system during sleep . Ach, acetylcholine; da, dopamine; gaba, gamma amino - butyric acid; gal, galanin; ha, histamine; ldt, laterodorsal tegmentum; ne, norepinephrine; orx, orexin; pef, perifornical region; ppt, pedunculopontine tegmentum; tmn, tuberomammillary nucleus; vpag, ventral periaqueductal gray matter; 5-ht, 5-hydroxytryptamine . Initiation and maintenance of sleep require suppression of activity in the ascending arousal systems . This is accomplished by inhibitory neurons of the ventrolateral pre - optic area (vlpo; figure 1b), which remain active throughout sleep (3). The molecular triggers that activate the vlpo and initiate sleep onset have not been fully defined, but a substantial body of evidence points to extracellular adenosine as a candidate . Adenosine accumulates in basal forebrain during wakefulness and diminishes with ongoing sleep (4). Adenosine receptors are expressed in the vlpo and adenosine activates vlpo neurons in vivo (5), making it a reasonable candidate for the sleep switch . Caffeine and theophylline are potent adenosine receptor antagonists, which may form the basis for their well - known alerting effects . Despite this evidence, it is almost certain that other molecules also play important signaling roles controlling the initiation and maintenance of sleep . The monoaminergic arousal centers project to the vlpo and may serve to inhibit its activity (6). This creates the concept of flip - flop control of behavioral state, in which, at any given time, activity of either arousal - producing or sleep - producing neurons dominates and suppresses the other (3). In addition, the vlpo receives important circadian modulation from the suprachiasmatic nucleus the central circadian clock (3). There exist two fundamentally distinct types of sleep: rapid eye movement (rem) sleep, which is associated with active dreaming, and non rapid eye movement (nrem) sleep . Switches between nrem and rem sleep appear to be controlled by reciprocal inhibition between monoaminergic neurons and a specific subset of cholinergic neurons within the brainstem (7). These rem - on cholinergic neurons exhibit reciprocal inhibitory connections to noradrenergic (lc) and serotonergic (raphe) neurons (8). When rem sleep is triggered, rem - on cholinergic neurons become maximally active, while noradrenergic and serotonergic neurons become virtually silent . The switching between activity and inhibition of these neurons results in a characteristic cycling between nrem and rem during the sleep period . Assessment of sleep / wake states can be made by behavioral observation, physiological monitoring, or a combination of the two . Behaviorally, sleep in adults is characterized by loss of consciousness and by relative immobility in a recumbent posture with the eyes closed . During nrem sleep, there is reduced tonus of large skeletal muscles that progresses to complete or near - complete atonia with a transition to rem sleep . Throughout sleep, there is a relative sparing of activity among respiratory pump muscles . Visual, olfactory, auditory, somatosensory, and even nociceptive sensory responses all are diminished but not eliminated during sleep (9). Physiologically, the gold standard for assessment of sleep and wake states is the laboratory polysomnogram (psg). To conduct a psg, these sensors include multiple skin electrodes, which record brain activity (electroencephalogram [eeg]), eye movements, submental muscle tone, leg movements, and electrocardiogram (ecg). Thoracic and abdominal strain gauges, oral and nasal airflow sensors, and a finger probe to measure arterial oxygen saturation are also attached to the subject to help monitor respiration during sleep . In addition to wakefulness and rem sleep, current clinical guidelines for scoring psgs identify three stages of progressively deepening nrem sleep: stages n1n3 (10). These stages are recognized and scored based on characteristic rhythms and events observed in the psg waveforms, but a detailed presentation of the scoring process is beyond the scope of this article (11). Briefly, alert wakefulness is associated with a low - amplitude mixed frequency eeg pattern . As illustrated in figure 2, drowsy wakefulness is associated with alpha waves seen as a rhythm with peaks in the 8- to 13-hz range . Drowsiness also is associated with slow rolling eye movements that may persist into light sleep . The lightest stage of nrem sleep (n1) is characterized by a loss of alpha rhythm and presence of theta waves with a characteristic frequency of 47 hz . Stage n2 sleep is marked by the expression of spindles (burst - like trains of waves in the 11- to 16-hz range with a total duration 0.5 seconds) and k - complexes (well - defined biphasic waves lasting 0.5 seconds and usually maximal over the frontal cortex). Deep nrem sleep (stage n3) is associated with large (75 v) slow (0.53 hz) waves known as delta waves . Typically, skeletal muscle activity exhibits progressively decreasing amplitude with transitions from wakefulness to n1, n2, and n3 sleep . Rem sleep is associated with the lowest skeletal muscle tone and with either sharp theta waves (sawtooth waves) or wake - like eeg patterns (figure 2). Eeg features of sleep / wake stages (left) and typical temporal organization of healthy nocturnal sleep in an adult (right). For scoring purposes, an overnight psg recording is divided into 30-second epochs, and a stage score is assigned to each epoch . Visualizing this sequence of stage scores graphically as a hypnogram highlights the temporal structure of the sleep process (figure 2). During a normal night, the sleep process is cyclical, with sleep onset being followed by a rapid descent to deep stage n3 sleep within the first hour . This is followed by cyclical alternations between nrem and rem sleep occurring every 6090 minutes throughout the rest of the night . Typically, most n3 sleep occurs during the first half - night, whereas most rem sleep occurs during the second half - night (figure 2). The full biological and clinical relevance of this ultradian cycling of sleep depth remains to be determined . Psg data also are amenable to quantitative and continuous analysis using various signal processing techniques . Because the eeg rhythms associated with differing levels of alertness and nrem sleep can be differentiated according to characteristic frequencies, eeg power spectrum analysis has become a very popular sleep research tool (12). Sleep and sleep quality also can be assessed subjectively, by self - report of the individual patient or research subject . Various mobile phone application based, web - based, or paper sleep and activity logs have been developed and can be useful adjuncts to laboratory or home testing for both clinical and research purposes . Although numerous standardized survey instruments have been developed to assess sleep quality, two have been very widely used: the pittsburgh sleep quality index (13) and the functional outcomes of sleep questionnaire (14). In - home psg testing has been performed without monitoring (15), with remote monitoring (16), and with in - home monitoring by a trained technician (17). The frequency of technically unacceptable recordings using these approaches ranges from about 10% to about 30%, and it is unclear whether any consistent cost savings accrue . Numerous other methods for home sleep testing have been developed that do not incorporate eeg monitoring . The simplest of these is actigraphy, in which the subject wears a device typically the size and shape of a wristwatch on the nondominant wrist . The device contains multiple accelerometers and can record movements continuously for periods of up to several weeks . These movement profile data are then used to discriminate sleeping and waking periods, and their overall agreement with psg - based determinations is good, although results of individual validation studies have varied (18). This approach has been popular in research studies, allowing collection of many days of sleep / wake patterns in a natural environment . Some actigraphic devices also contain light intensity meters and event - logging buttons, allowing subjects to note when they go to bed and when they arise . For clinical applications, cardiorespiratory monitoring devices based on a wide array of technologies increasingly are being employed, but a thorough review is beyond the scope of this article . Typically, these devices monitor heart rate and its variability, respiratory effort and airflow, and arterial oxygen saturation . These systems are commonly used to screen for clinically significant sleep apnea syndrome (19). Plasma levels of most hormones exhibit significant 24-hour rhythms (20,21), pointing to the importance of both the circadian clock and sleep - specific influences on their release and/or metabolism . Some hormones are little influenced by sleep versus wakefulness, including adrenocortotropic hormone, cortisol, and melatonin; some are strongly influenced by sleep, such as thyroid - stimulating hormone (tsh) and prolactin; and some are affected by particular sleep stages, such as growth hormone (20). Under normal conditions, studies using daytime naps or sudden changes in sleep schedule have shown that sleep onset, regardless of time of day, is associated with a stimulation of prolactin release (22). It has been suggested that a negative association exists between eeg delta activity and pulsatile prolactin release (20). Growth hormone also exhibits a strong sleep - dependent rhythm, with secretion being specifically associated with stage n3 sleep (20). There is a strong association between the power of eeg delta activity and the rate of growth hormone secretion during sleep (23). Furthermore, when ritanserin (a serotonin receptor antagonist) was used to augment deep sleep, the drug - related increase in eeg delta activity was associated with a proportional increase in the rate of growth hormone secretion (22). These findings strongly suggest that the mechanisms regulating delta wave production and growth hormone secretion are closely coupled, but these mechanisms have not been fully defined . This is of potential relevance to the pathogenesis and management of diabetes, because the sleep - related increase in growth hormone secretion relates directly to reduced insulin sensitivity and increased plasma glucose levels during sleep (24). Cortisol also exhibits a significant 24-hour pattern, but, unlike growth hormone, this appears to be primarily a result of circadian influences rather than of sleep per se (20). Also in contrast to growth hormone, which peaks early during the sleep period, cortisol is at its nadir early during a nocturnal sleep period and peaks toward the end of sleep or in the early morning hours (24). There is some evidence that the sleep process does exert some inhibitory effect on cortisol release, and this may contribute to its nadir early in the sleep period . This cortisol pattern also may contribute to increased glucose levels late in the sleep period, as cortisol may inhibit insulin release (24). Tsh exhibits low daytime values, increasing during the evening and peaking around the time of sleep onset . Sleep, and especially stage n3 sleep, appears to exert an inhibitory influence on tsh secretion (20). N3 sleep is consistently associated with falling tsh levels, whereas awakenings are associated with rising tsh levels (25). This may be significant in diabetes pathogenesis, as tsh level has been negatively associated with various measures of insulin sensitivity . However, cause - and - effect relationships remain to be determined (26). In summary, sleep is an actively regulated process significantly modulated by homeostatic influences that accumulate during ongoing wakefulness and dissipate during sleep and by circadian effects entrained to the 24-hour day . Sleep has a typical underlying architecture characterized by a rhythmic alternation between nrem and rem stages, and the transitions among sleep / wake states are orchestrated by a well - defined subcortical network of brain structures . Sleep and wake states also are characterized by distinct hormonal patterns that exert potential significant influences on metabolism and glucose homeostasis.
Studies that only infuse oxytocin into participants and then make claims about human behavior are suspect . This approach does not identify what the brain itself is doing during social interactions, including neurochemical promotion and inhibition of oxytocin synthesis and dose - response relationships between oxytocin and behavior . The key question is whether the brain produces its own oxytocin during the behavior being studied; if so, the causal relationship between oxytocin and a particular behavior can be demonstrated via an infusion study . But the reverse is not true: infusing oxytocin or any drug into the brain and observing a change in behavior does not mean that this is how the brain works it simply means that a drug has changed behavior, as many drugs do . My studies complete the causal circle by measuring what the brain does naturally and then intervening in this system pharmacologically to show that the behavior can be provoked . After years of experiments, i now consider oxytocin the neurologic substrate for the golden rule: if you treat me well, in most cases my brain will synthesize oxytocin and this will motivate me to treat you well in return . This is how social creatures such as humans maintain themselves as part of social groups: they play nice most of the time . (why people do not play nice is a fascinating story we also have studied; see zak, 2012 for evidence). But i m a skeptic at heart, so i always want to measure the behavioral effects of oxytocin rather than simply ask people s opinions about how they feel . The experience i had watching million dollar baby caused me to wonder if movies, in addition to direct personal interactions, would cause oxytocin release . To test this, my colleague jorge barraza edited a set of a short video clips that we obtained with permission from st . One version shows a father talking to the camera while his 2-year - old son, ben, who has terminal brain cancer, plays in the background . The story has a classic dramatic arc in which the father is struggling to connect to and enjoy his son, all the while knowing that the child has only a few months to live . The clip concludes with the father finding the strength to stay emotionally close to his son until he takes his last breath . We also developed a video of the same father and son spending a day at the zoo . This version does not mention cancer or death, but the boy is bald (from his chemotherapy) and is called miracle boy once during the clip . This video lacks the tension induced by the typical story form but includes the same characters . This version was used as a control story to see what the brain does when any video is being watched . In our first study of narratives, we took blood before and after participants watched one of the two versions of the video.11 we found that the narrative with the dramatic arc caused an increase in cortisol and oxytocin . Tellingly, the change in oxytocin had a positive correlation with participants feeling of empathy for ben and his father . Heightened empathy motivated participants to offer money to a stranger who was in the experiment . Flat narrative of ben and his father at the zoo did not increase oxytocin or cortisol, and participants did not report empathy for the story s characters . These findings suggest that emotionally engaging narratives inspire post - narrative actions in this case, sending money to a stranger ., we did not know for sure that oxytocin was the reason participants cared about the people in the video, just that oxytocin and empathy were correlated . Our previous study pointed to oxytocin as the biological instrument that puts people in thrall to a story . To assess the causal impact of oxytocin on narrative immersion, we ran a study using public service announcements (psas) in which participants received intranasal infusions of synthetic oxytocin or a placebo . This time around, we decided to test a larger set of video narratives . We wanted stories that most people would not have seen before and ones that could elicit a prosocial action at a cost (such as a donation). We found a rich trove of public service announcements from the united kingdom that are well - produced and engaging . The experiment used sixteen psas that ran for thirty or sixty seconds on four topics: smoking, drinking to excess, speeding, and global warming . To incentivize people to pay attention to the videos, each of the participants was paid five dollars if they could correctly answer a factual question about the ad immediately after watching it . For example, was there a car in the video? Then, our software asked participants if they would like to donate some of the five dollars they had just earned to a charity associated with the cause shown in the psa . None of the psas solicited donations, they simply told stories about social issues . Computer software presented all the videos and post - video questions and we used random participant identifiers so that one s donation behavior was kept private . Forty people received either 40 iu of oxytocin or an equivalent amount of normal saline (placebo). Participants started watching the videos after an hour - long period during which the synthetic oxytocin diffuses from the sinuses into the brain . We found that those who received oxytocin donated, on average, 56 percent more money to charity compared with participants who received the placebo.12 this confirmed the causal role of oxytocin on post - narrative prosocial behavior . We discovered that participants who were given oxytocin showed substantially more concern for the characters in the psas . This increased concern motivated them to want to help by donating money to a charity that could alleviate the suffering these stories depicted . It is as if the brain is lazy and is using a monkey see, monkey do approach to assess appropriate social behaviors . (indeed, the brain seeks to conserve energy by using default pathways a kind of laziness .) The psas seemed to persuade viewers that (for example) nowadays the humans are very concerned about drinking too much, so as a human, i, too, should be concerned . Such responses are what social creatures with social brains do . And yet, participants understand that the stories are fictional and are portrayed by professional actors . The money donated to charity cannot help these actors out of their fictional binds . The money might help prevent the harm depicted in the psas from happening to an unknown other person, but this is a big if . Nevertheless, oxytocin makes people want to help others in costly and tangible ways . In another experiment,12 we sought to replicate our earlier study by taking blood samples before a group of forty - two participants (who were not in the oxytocin infusion study) watched one of the uk psas . We measured the change in oxytocin and in a fast - acting arousal hormone with a long name that is abbreviated acth . When the psa elicited an increase in both acth and oxytocin, donations were 261 percent higher than when one or both of these biomarkers did not rise . The change in acth correlated with the amount of attention people paid to the story . This finding makes sense: if we do not attend to a story, it will not pull us into its narrative arc . Attention is a scarce neural resource because it is metabolically costly to a brain that needs to conserve resources . If a story does not sustain our attention, then the brain will look for something else more interesting to do . We also found that the change in oxytocin was associated with concern for the characters in the story, replicating our earlier finding . If you pay attention to the story and become emotionally engaged with the story s characters, then it is as if you have been transported into the story s world . This is why your palms sweat when james bond dodges bullets . And why you stifle a sniffle when bambi s mother dies . Narratives that cause us to pay attention and also involve us emotionally are the stories that move us to action . More generally, stories with a dramatic arc fit the requirements for high - impact narratives . This structure sustains attention by building suspense while at the same time providing a vehicle for character development . The climax of the story keeps us on the edge of our neural seats until the tension is relieved at the finish . Theorists including aristotle (poetics, 335 bce), gustav freytag (die technik des dramas, 1863), and joseph campbell (the hero with a thousand faces, 1949) have contended that the rising and falling tension of dramatic performances facilitate the audience s emotional connection to the characters . Now let s get down to brass tacks: why are there so many dreadful movies? Humans have known about the three - act structure and mythos, pathos, and ethos for 2,500 years . Department of defense wanted to know why narratives are persuasive and supported our research and that of other labs as well . Attention is easy to measure rapidly, via a quickened heartbeat or sweat coming from eccrine glands in the skin . Nature provided a solution . While we were mostly interested in oxytocin in the brain, the stimulus - induced co - release of oxytocin in the brain and blood meant we could measure changing activity in regions with densities of oxytocin receptors . The vagus nerve (the longest cranial nerve, which innervates the heart and gut) is chock - full of oxytocin receptors . With a bit of algorithmic fiddling, scientists can measure the activity of the vagus using an electrocardiogram (ecg). We confirmed that the change in oxytocin in blood correlates with changes in vagus nerve activity . We returned to the story of the dying child ben because it is a reliable way to stimulate oxytocin release . This time we measured cardiac activity using an ecg and sweat using an electrodermal sensor on the fingers . Because we were developing a system that might be used in a war zone, we built in redundancies . Attention was measured using both heart rate and skin conductance changes from sweat on the fingers; emotional resonance was quantified using two measures of changes in the brain s relaxation response driven by the vagus nerve . The exciting part was that we could measure both effects up to one thousand times a second with off - the - shelf wireless technologies . But it is not so simple to isolate the effects of a story from everything else the brain is doing to keep you upright, breathing, and conscious . All neuroscience studies need to extract the neurologic signal produced by a stimulus during an experiment from the background noise of all other neural activity . To give you a sense of the scope of this problem, for every thirty people we test for an hour each, we collect a terabyte of peripheral neurologic data . Most of this data is not relevant to understanding why people respond to stories, but the faint traces that are relevant must be extracted and processed with extraordinary care . Once we did all this, the data told us several interesting things.13 first among them is that the brain does not work like the hypothetical story structure known as freytag s pyramid, in which strictly rising action leads to a climax, and then strictly falling action occurs as the story resolves . Even for the one - hundred - second ben video, one s attention waxes and wanes . The brain is attending to the story and then doing a quick search of the rest of the environment, and then refocusing on the story as the tension rises . Nevertheless, the peak attentional response occurs in the climax, when ben s father reveals that ben is dying . That s a bombshell to which people pay attention . After about thirty seconds, vagal activity begins to increase as viewers get to know and then begin to empathize with ben and his father . Not only were we able we track what the brain is doing millisecond by millisecond during a story, we used the neurologic data to build a predictive model of donations to a childhood cancer charity our measure of story impact . The statistical model we built predicts whether a participant would donate money with 82 percent accuracy . That is, by measuring how your peripheral nervous system responds to a story, we can almost perfectly predict what you ll do before you do it . The participants who, for whatever reason, either lost interest in the video or did nt form an emotional connection to ben and his father almost never donated money to charity . The money will not save ben and it wo nt offer relief to his father . It seems that once we are attentive and emotionally engaged, our brains go into mimic mode and mirror the behaviors that the characters in the story are doing, or might do . As social creatures we are biased toward engaging with others, and effective stories truth be told, ben s story is as near to a perfect high - impact narrative as there is . We wondered if neurologic data could identify bad stories, too . And what about stories that may be distasteful but that are still desirable to watch? I m glad i did, but i do nt have much desire to watch it again . Our next study tested stories about hot - button issues to see how people reacted to potentially disagreeable topics . We used first - person narratives from storycorps, a nonprofit that collects and distributes personal stories . We choose six stories on racism, gun control, and the terrorist attacks of september 11 . For our narrative impact measure, we invited participants to donate some of their earnings to a charity associated with the topic of the story . Just as in the ben story, we confirmed that stories that sustain attention and generate emotional resonance produce post - narrative donations even stories on difficult topics . To the brain, good stories are good stories, whether first - person or third - person, on topics happy or sad, as long as they get us to care about their characters . Psycholinguists have shown that effective stories induce transportation into the narrative.14 transportation happens when one loses oneself in the flow of the story just like i did while watching million dollar baby . To understand the psychological effects of stories, we included surveys of narrative transportation and concern for story characters in the storycorps study . This shows why stories affect behavior after the story has ended: we have put ourselves into the narrative . Even a week after the experiment, accurate story recall was predicted by a single measure: narrative transportation . You may be thinking that we have a money - centric approach to assessing when people are moved by a story . Let s try a different approach: we ll have thousands of people rate stories instead . The stories we used were tv commercials . Conveniently, this is just what usa today asks readers to do on super bowl sunday: vote for the commercials they like the best . About five thousand people voted for their favorite commercials in 2014, and the style and content of these short narratives vary from the unusual to poignant to just plain silly . This gave us a chance to further refine our algorithms and test them against what people say they like . Usa today does not simply provide a ranking of commercials; it has its readers rate them on a one to ten scale . My group derived a quantification of narrative engagement using neurologic data so we, too, could rate story quality . We estimated the relative contribution of attention and emotional resonance on story impact from our corpus of studied stories . We call this measure a story s zest (for zak engagement statistic). By estimating each super bowl ad s zest, we could compare the usa today readers ad likability with the zest measure of brain activity . Three days after the 2014 super bowl, sixteen participants watched the top ten super bowl commercials in random order in my lab while we measured their peripheral neurologic activity . There was no correlation at all between what usa today readers said they liked and a commercial s zest . So we ran another study using usa today s top ten 2013 super bowl commercials and found exactly the same thing: zero correlation . These findings suggest that people are unable to articulate what they like and do not like . Perhaps this should not surprise us . In a classic study, psychologist and economics nobel laureate daniel kahneman found that people s preferences for things they have not experienced are largely unformed.15 watching the super bowl commercials myself, i sensed why it is hard to articulate what one likes . The best super bowl commercial in 2014, according to usa today readers, produced for budweiser beer . In the first ten seconds, one sees a puppy nuzzling the nose of a clydesdale horse . One immediately recognizes the clydesdale as the budweiser icon, and this tells viewers what they can expect from the ad . The suspense is gone, and our neurologic measures show that people s attention wanders starting fifteen seconds into the commercial . Without attention, the hoped - for emotional resonance with the ad s characters (and presumably the brand) fails to occur . But ask people what they like and, gosh, they see puppies and horses and wide open country and, well, of course we love these images . The commercial is dull . In all our studies we ruled out effects that might influence zest, including movement, cars, buildings, attractive men and women, and many other factors . Department of defense s funding of the emerging science of narrative jump - started the field.16 17 storytellers have always known that attention and emotion are important to develop during a narrative, but now we have ways to measure these responses directly rather than rely on incohate impressions such as entertaining or fascinating . Yet, even with millennia of practice, creating a great story is difficult . The emerging science of narrative can guide the art, but it cannot replace it . The narrator in million dollar baby describes the heroine, maggie s, desire to be a boxer as...the magic of risking everything for a dream that nobody sees but you.
Gaucher's disease is a progressive, debilitating, and some times life threatening disease . Symptoms of gaucher's disease can appear at any age, often at a very late age . It is the most common lysosomal storage disorder, gene defect leads to deficiency or decreased activity glucocerebrosidase followed by accumulation of glucosylceramide . This being a genetic disorder and is transmitted from parent to child, both parents must be carriers; the carrier rate in general population is approximately 1 in 100 . There is autosomal recessive transmission leading to varied clinical manifestations and may present with various clinical symptoms, often with some uncommon features . Therefore, it is very important to diagnose the disease early so as to give the best treatment and prevent further progress of the disease, as early onset of clinical symptoms and signs predispose patients to severe phenotype with irreversible complications . Here we have reported two cases with unusual presentations case 1 was nonneuropathic (type 1), which has the highest prevalence and also the greatest variability . The signs and symptoms of type 1 disease demonstrated marked heterogeneity . A one and half years old boy presented with weakness, pallor gradually increasing abdominal girth, and a swelling in the right axilla . There was no neurological manifestation . On examination, there was hepatomegaly and huge splenomegaly . The axillary swelling appeared like an enlarged lymph node, but there was no other nodal enlargement, sternal tenderness was also absent . Blood examination revealed a total leukocyte count of 3,200 cells / m; a normal differential count; platelets were reduced (1 lakh / m); hemoglobin was 7.6 gm / dl, abnormal cells were not detected in peripheral blood and liver function test was within normal limits . Fine needle aspiration cytology (fnac) was done from the axillary mass and smears showed sheets of mature lymphocytes, immature mononuclear cells and occasional megakarycytes along with few large histiocyte like cells [figure 1]. The smears were stained with periodic acid schiff (pas) and positivity of the histiocyte like cells with pas stain suggested our diagnosis to be gaucher's disease with extra medullary hematopoiesis . Fine needle aspiration cytology from axillary mass showing gaucher's cells (h and e,400) final confirmation was done by doing the liver biopsy and demonstrating sheets of gaucher's cells with abundant crumpled tissue paper like cytoplasm . A five - year - old boy from bihar presented with low grade fever, increasing pallor and weakness . On examination blood examination revealed a normal picture except that the erythrocyte sedimentation rate (esr) was very high108 mm in the first hour . Bone marrow examination revealed very low cellularity with m: e ratio within normal limits . All cell lines showed normal maturation except erythroid series, which showed partial megaloblastic change and plasma cells were increased . Most important finding was presence of extra and intra cellular leishmania donovan (l.d) bodies . Serological tests were performed, the aldehyde test was positive, rk-39 was also positive, and the patient was diagnosed and treated for kala azar . A splenic puncture was then performed, the smears from which showed plenty of gaucher's cells . A one and half years old boy presented with weakness, pallor gradually increasing abdominal girth, and a swelling in the right axilla . There was no neurological manifestation . On examination, there was hepatomegaly and huge splenomegaly . The axillary swelling appeared like an enlarged lymph node, but there was no other nodal enlargement, sternal tenderness was also absent . Blood examination revealed a total leukocyte count of 3,200 cells / m; a normal differential count; platelets were reduced (1 lakh / m); hemoglobin was 7.6 gm / dl, abnormal cells were not detected in peripheral blood and liver function test was within normal limits . Fine needle aspiration cytology (fnac) was done from the axillary mass and smears showed sheets of mature lymphocytes, immature mononuclear cells and occasional megakarycytes along with few large histiocyte like cells [figure 1]. The smears were stained with periodic acid schiff (pas) and positivity of the histiocyte like cells with pas stain suggested our diagnosis to be gaucher's disease with extra medullary hematopoiesis . Fine needle aspiration cytology from axillary mass showing gaucher's cells (h and e,400) final confirmation was done by doing the liver biopsy and demonstrating sheets of gaucher's cells with abundant crumpled tissue paper like cytoplasm . A five - year - old boy from bihar presented with low grade fever, increasing pallor and weakness . On examination blood examination revealed a normal picture except that the erythrocyte sedimentation rate (esr) was very high108 mm in the first hour . Bone marrow examination revealed very low cellularity with m: e ratio within normal limits . All cell lines showed normal maturation except erythroid series, which showed partial megaloblastic change and plasma cells were increased . Most important finding was presence of extra and intra cellular leishmania donovan (l.d) bodies . Serological tests were performed, the aldehyde test was positive, rk-39 was also positive, and the patient was diagnosed and treated for kala azar . But even after adequate therapy there was only mild reduction in splenic size . A splenic puncture was then performed, the smears from which showed plenty of gaucher's cells . The type i gaucher's disease may present in infancy, typically showing anemia, thrombocytopenia, splenomegaly, and bone lesions . Extramedullary hematopoiesis (emh) generally occurs in patients with deficient bone marrow hematopoiesis secondary to either peripheral red cell destruction or marrow replacement . Rarely emh presents as a solitary mass posing a diagnostic dilemma . In the first case we saw the child presenting with axillary mass mimicking lymphadenopathy, but ultimately diagnosed as a case of emh in gaucher's disease . Aspirated smears demonstrate tri lineage hematopoisis and in the present case the authors also found gaucher's cells in the aspirate . The second case of gaucher's disease had another type of pathology, kala azar, which masked the typical clinical features . Splenomegaly was the most important clinical feature in both the cases and pancytopenia in the first one . Although gaucher's disease is well known in adult patients but about two - thirds of the patients present before the age of 20 and onset in childhood is predictive of severe and progressive phenotype . The authors have emphasized the early diagnosis high lighting the uncommon presentations so that early treatment by enzyme replacement therapy can be started delaying the complications . However, confirmation for the typing of the cases can only be done by studying the genetic mutations and development of gene therapy (reintroduction of missing dna sequence) hints the real causal therapy of the disease.
A 23-year - old male with no significant prior medical history underwent arthroscopic surgery due to a cruciate ligament injury five months before being referred to the department of thoracic & cardiovascular surgery in busan paik hospital . After surgery, a pulsatile mass was palpable around the previous surgical wound in the superomedial part of the right knee, and was observed to be growing continuously . He was therefore referred to our department . On physical examination, a 64-cm pulsatile oval - shaped mass was detected . The mass was clinically suspected to be an aneurysm, and computed tomography (ct) angiogram of the lower extremities was therefore performed . The angiogram revealed a 2.2-cm pseudoaneurysm of the descending genicular artery and a fistula with the superficial vein of the right vastus medialis (figs . 1, 2). We did not consider endovascular treatment because the patient was young and the mass was near the knee joint, leading to the possibility of stent - related and coil - related complications during his lifetime . We performed pseudoaneurysmectomy and ligation of the arteriovenous fistula (avf). During the operation 3). After surgery, we confirmed the flow of the right popliteal artery using doppler imaging . The patient s postoperative course was unremarkable, and he was discharged on the seventh postoperative day . Pseudoaneurysm has been reported as a complication after arthroscopy, arthroplasty, ligament repair, synovectomy, penetrating knee trauma, and intramedullary nailing of the tibia . The most common cause of pseudoaneurysm has been found to be total knee replacement, and the most common site of pseudoaneurysm has been found to be the popliteal artery . However, pseudoaneurysms of the descending genicular artery, sural artery, and arterial branches to the vastus medialis muscle and the medial head of the gastrocnemius muscle have also been reported . Wilson et al . Found that the incidence of vascular lesions among patients undergoing elective orthopedic surgery was 0.005% . In 1986, committee on complications of the arthroscopy association of north america reported that nine patients out of 375,000 cases developed pseudoaneurysms after knee arthroscopy . Nonetheless, no case of pseudoaneurysm combined with an avf of the descending genicular artery has yet been reported . Pseudoaneurysm generally occurs after acute trauma, which may or may not be surgical, or after chronic repeated trauma . Theoretically, an injury to the arterial wall appears to be necessary for a pseudoaneurysm to develop . In some cases, pseudoaneurysms have been observed to form after knee arthroscopy without penetration of the knee capsule or direct injury to the vessel wall . One possible explanation for this is the shear stress on the knee structures and arteries during surgery . Pseudoaneurysm can be diagnosed by physical examination, ultrasonography (usg) with vascular doppler imaging, ct, magnetic resonance imaging, and angiography . Symptoms and signs may include a range of pain from no discomfort to aggravated pain, the presence of a pulsating mass or a large hematoma with audible bruit or thrill, and space - occupying effects such as nerve compression, neuralgia, venous compression, and thrombosis . If a pseudoaneurysm presents subcutaneously or grows to the point of being palpable, as occurred in our case, it can be suspected clinically . Usg with doppler imaging is a non - invasive technique that can confirm the abnormal anatomical relationship of the artery . Moreover, small pseudoaneurysms can be treated by usg - guided compression or usg - guided thrombin injection . Ct angiography with three - dimensional reconstruction is now relatively easy to perform in korea . It is helpful for confirming the anatomic structures around the pseudoaneurysm, and it takes less time than other methods such sonogram, conventional angiography, magnetic resonanse imaging . Mri has similar characteristics to ct, but has the advantage of avoiding radiation exposure . Angiography was historically considered the gold standard, but it was also considered to be more invasive than other imaging modalities . Some researchers have reported successful results by observing small aneurysms until spontaneous thrombosis, as well as the use of thrombin injection or usg - guided compression therapy . Open surgical repair with excision, ligation of the pseudoaneurysm, inverted saphenous interposition grafting or bypass, and primary repair of the defect have been reported . Some studies have reported the use of endovascular repair with embolization and stent insertion to treat popliteal pseudoaneurysms or avf . The studies that reported the endovascular repair of popliteal pseudoaneurysms showed that stent implantation has the advantage of avoiding the complications of open repair, such as wound infection, the need for general anesthesia, and a hospital stay . Endovascular repair can lead to complications such as displacement, fracture, occlusion of the stent, or endoleak; however, the above studies did not report stent - related complications over the course of 24 months of follow - up . Reported that thrombosis can occur spontaneously or be induced by compression from the echography probe in aneurysms smaller than 2 cm . For aneurysms less than 5 cm, it may be sufficient to ligate the defect in the arterial wall or to administer a percutaneous injection of thrombin into the aneurysmal sac along with therapeutic embolization by means of coils or thrombin injection . For bigger lesions, surgical exclusion of the aneurysm should be performed and blood flow should be restored via bypass surgery . In our case, the pseudoaneurysm was too close to the knee joint and was accompanied by an avf; therefore, we chose surgical treatment in order to avoid the possible complications of endovascular treatment . In conclusion, pseudoaneurysm is a rare complication after arthroscopy that may lead to serious complications . If a pseudoaneurysm is suspected clinically, usg, ct, or magnetic resonance imaging are helpful imaging modalities for arriving at a diagnosis . Once the diagnosis of pseudoaneurysm is confirmed, a choice must be made between endovascular repair and surgical repair.
The use of acid - suppressive medication is rapidly increasing . In the western world, proton pump inhibitors (ppis) are second only to statins in expenditures, and antisecretory medication constitutes a substantial part of the medical budget in the denmark and other western countries [13]. Most of the increased use of antisecretory medication is accounted for by long - term users [4, 5]. Antisecretory medication is highly effective for the treatment of peptic ulcer and reflux disease, but it has only sparse effect in the treatment of patients with functional dyspepsia . In primary care, the most used strategy when investigating and treating dyspeptic patients is empirical treatment with antisecretory drugs . As no data exist regarding the optimal treatment period, and as there is a poor correlation between initial treatment response and continued effect, some patients might have an unnecessary continued use of antisecretory medication . In a swedish study, bjrnsson et al . Found that discontinuation of antisecretory mediation was successful in 27% of long - term users of ppi . Placebo - controlled discontinuation studies of antisecretory medication with interventions carried out in primary care are however not yet published . The aim of the present study was therefore in a placebo - controlled randomised design to investigate if patients on long - term antisecretory medication need to continue treatment to control symptoms in a primary care setting . A total of 146 general practitioners in denmark were visited, introduced to, and educated in study procedures and signed in as coinvestigators on the required forms from the danish medicines agency (protocol i d: 2612 - 2176). Eligible patients were evaluated, enrolled, and followed by their general practitioner from january 2003 to september 2006 . Patients older than 17 years with a use of antisecretory treatment (proton pump inhibitors or histamine-2-receptor - antagonists) for at least 56 days during the previous six months were included . Exclusion criteria were alarm symptoms (gastrointestinal bleeding, iron deficiency anemia, progressive unintentional weight loss, progressive dysphagia, persistent vomiting, and epigastric mass on palpation), drug or alcohol abuse, serious or terminal diseases, planned hospitalization during follow - up, allergy to trial medication, and pregnant or fertile females not using safe contraception . Furthermore, patients suffering from oesophagitis, having had prior complicated peptic ulcer, and patients with prior endoscopically verified ulceration and ongoing use of nonsteroidal anti - inflammatory drugs (nsaids)/acetylic salicylic acid (asa) were not eligible . Long - term users of antisecretory treatment were randomised to continued antisecretory treatment or placebo . Esomeprazole (nexium, astrazeneca) 40 mg or identical placebo was used as the randomised trial medication with a maximum of one tablet a day mimicking the patient's usual treatment . When trial medication was discontinued due to insufficient symptom control, reinstitution of usual antisecretory treatment was left to the gps' discretion . Both active medication and placebo were manufactured and packed by astrazeneca, mlndal, sweden, in accordance with good manufactory practice (gmp). Trial drug was delivered in identical, sealed containers holding 100 tablets . The local university hospital pharmacy (fyns amts centralapotek, j. b. winslws vej 13, dk-5000 odense c, denmark) labelled and randomised the trial drug accordingly using a computer - generated random number block randomisation with a fixed block size of four and a placebo / treatment ratio of one . The pharmacy kept the sequence of allocation concealed throughout the one - year follow - up, thus blinding patients, general practitioners, and researchers . Following seven days of discontinuation of usual antisecretory treatment with allowance of antacids as rescue treatment, helicobacter pylori status was investigated with a c - urea breath test performed in general practice . During the seven days of discontinuation symptoms, demographics and clinical baseline characteristics of participants eradication therapy was given to any helicobacter - positive patient (amoxicillin, clarithromycin, and esomeprazole, alternatively metronidazole if allergic to penicillin). The study was monitored according to good clinical practice (gcp) by the gcp unit at odense university hospital, denmark (project number 02 - 004). Primary endpoint was the time to discontinuation with trial medications (esomeprazole or placebo) due to the participants' need to change back to their usual antisecretory medication, that is, failure to control symptoms with the trial medication at any time point in the one - year follow - up . The proportion of patients stopping trial medication during the one - year follow - up was estimated . Additional analysis was carried out using health - related quality - of - life (mos short form-36) and generic dyspeptic quality - of - life (gastrointestinal symptom rating scale) questionnaires . We assumed 1520% of long - term users to be suffering from peptic ulcer disease, 4045% to be suffering from nonerosive reflux disease, and approximately 40% to be suffering from functional dyspepsia . Based on these diagnoses, we estimated the recurrence of symptoms in 10% in the esomeprazole group and 30% in the placebo group and given a type i error of 5% and a type ii error of 20% at least 111 patients in each group were needed . During data analysis, patients remained in the two arms of the study without revealing the intervention, thus allowing a blinded data analysis of the primary endpoint . Assumptions that dropouts in both groups had insufficient control of symptoms and therefore were analysed as having stopped with trial medication were made . A total of 171 patients found eligible by their general practitioners were accepted to participate in the study (figure 1); 17% were helicobacter pylori - positive . During the one - year follow - up, six patients were lost to follow - up; no adverse events were seen, except for one patient developing a black discoloration of the tongue during helicobacter pylori eradication treatment . No differences were found between gps not including participants compared with active coinvestigators with regard to sex, single - handed or partnership practice, and number of long - term users, data not shown . At the one - year follow - up, the stop of the trial medication had occurred more frequently (p <0.0001, log - rank) in the placebo group compared with the group receiving esomeprazole . A total of 18/86 (21%) of participants treated with esomeprazole had stopped the trial medication compared to 62/85 (73%) of participants treated with placebo (figure 2). Gastrointestinal symptom scores improved in both groups during the trial, but no statistically significant differences were found between the two groups after one year (table 2). Quality - of - life scores were unchanged, and no differences were found between groups after one year (data not shown). Table 3 shows a comparison between patients continuing placebo versus patients who stopped treatment with placebo . Statistically significantly more men stopped placebo treatment during follow - up (p = 0.003). A statistically nonsignificant tendency towards a more successful continuation with placebo treatment was found for patients with less gastrointestinal symptoms (total gsrs score, p = 0.07). The subscore regarding reflux symptoms (heartburn and regurgitation) did, however, show less influence on continued placebo treatment (p = 0.29). The present study provides estimates from primary care on the need for continued antisecretory treatment among long - term users . In a randomised, placebo - controlled trial, long - term users of antisecretory treatment were randomised to either continued antisecretory treatment (esomeprazole 40 mg) or placebo . We found that 27% of participants receiving placebo did not stop the trial medication during the complete follow - up . To our knowledge, this study was the first nonindustry initiated drug trial conducted in a primary care setting, which was gcp monitored by a public gcp unit . The randomised design and blinding in the design hindered any contamination between participants in the same practice and allowed a blinded data analysis . The primary care setting is important as 90% of antisecretory drugs are prescribed in primary care and the findings may be applicable to patients managed in primary care in similar settings . Recruitment of patients for the study tended to be slower than expected and only 38% of the coinvestigators (gps) recruited participants for the study . No differences were, however, found between gps not including participants compared with active coinvestigators . Based on register data, a large group of persons met the definition of long - term use of antisecretory treatment, but only a minority of the persons was included in this particular study . However, the register data do not provide information about indications for the prescription of antisecretory medication and some of the persons in the registers were probably meeting one or more of the exclusion criteria defined for the study . However, we cannot rule out the possibility that some of the persons, who were not included, had already tried to discontinue their antisecretory treatment . Due to the absence of consensus on the optimal treatment duration, the design of a discontinuation study was chosen and the discontinuation of trial drug was the primary outcome measure . The fluctuation of dyspepsia symptoms is well known and severity as well as symptoms may vary in the same patient over time . This may give rise to reflections on whether disappearance of symptoms due to the natural history of symptom fluctuation would allow participants receiving placebo to continue the trial drug . However, discontinuation of the trial drug largely took place during the first two months of follow - up and no discontinuation occurred during the last six months in the placebo group . Rebound acid secretion following discontinuation may occur [1720]. In this study, a potential rebound effect may have been an important factor and would result in an underestimation of the proportion of participants who succeeded in a continuation of placebo . . However, the study also elucidated that if symptoms do not recur within the first 60 days of ppi withdrawal they are unlikely to recur . No endoscopy was performed prior to inclusion, which might be a limitation, as patients with uninvestigated dyspepsia on long - term treatment with ppi could in principle suffer from erosive esophagitis and therefore should probably not have withheld treatment . This is the first placebo - controlled study on discontinuation of an acid - suppressive drug in a group of long - term users, with intervention carried out in primary care, but the results are in line with those of bjrnsson et al ., who found that discontinuation was successful in 27% of long - term users . Their patients had symptom profiles very similar to those of our patients, but patients were allocated to taper down or constant dose before discontinuation and placebo was not introduced . A number of studies examined discontinuation of ppi but without inclusion of a placebo group . A recent study by murie et al . Included patients with a diagnosis of gastroesophageal reflux disease or functional dyspepsia for prospective intervention of patient education given at specialist nurse clinic . Ppi was successfully discontinued in 34% and more than half of the patients reduced the ppi dose . In a study by krol et al ., gps were randomized to give usual care or sending a simple information leaflet about dyspepsia to patients treated with ppi for at least 12 weeks . A higher discontinuation rate (24%) was demonstrated in the intervention group, but the difference between groups did not persist after 20 weeks . It may be objected that placebo treatment is not equivalent to absence of therapy and that 5060% of patients with gastroesophageal reflux disease are satisfied with placebo on demand . On the other hand, the perception of placebo is changing [24, 25] and in the present study symptoms were controlled for more than 6 months on placebo . Thus, on balance, it seems reasonable to consider stopping use of acid - suppressive drugs in a substantial number of long - term users without complicated peptic ulcer, severe oesophagitis, or need for protection against nsaids . Considerable savings could be expected if these results are applicable to the entire population of long - term users and future studies should concentrate on delineating factors predictive of successful discontinuation of proton pump inhibitors . We recommend that symptom - based long - term antisecretory treatment in general practice should be interrupted by attempts at discontinuation . In our placebo - controlled study, one in five patients treated with esomeprazole had even unsatisfactory symptom control and discontinued trial medication . Deleterious effects of antisecretory drugs have been reported [5, 2730], and unnecessary treatment may lead to polypharmacy and unnecessary expenses for the patient and society . Randomised, controlled discontinuation trials, such as the study presented in this paper, are uncommon, but they may be useful in other areas of medicine (e.g., treatment with nsaids).
Combination antiretroviral therapy (cart) has raised the life expectancy, reduced the incidence of opportunistic infections and improved the quality of life of hiv-1-infected individuals . Aids - related mortality in children has decreased significantly with the wide availability of cart . During recent years, multiple studies have suggested the benefit of early administration of cart in every hiv-1-infected infant [14]. Therefore, international guidelines are now recommending initiation of cart in all hiv-1-infected infants aged less than one year regardless of clinical and immunological conditions (http://whqlibdoc.who.int/publications/2010/9789241599801.eng.pdf; and http://aidsinfo.nih.gov/contentfiles/lvguidelines/pediatricguidelines.pdf). Hiv-1 infection is still a chronic infection with a great number of associated complications and cart needs to be administrated life - long . Two different forms of cure have been defined: (i) a sterilising cure, in which all replication - competent virus and infected cells are eliminated (such as in the berlin patient), and (ii) a functional cure, represented by elite controllers who permanently control hiv-1 replication without cart (such as in the mississippi baby case). Both the berlin patient and the mississippi baby hiv-1 infection has been eradicated in the berlin patient, while the mississippi baby maintained a low level of inactive latent virus, only detectable using sensitive droplet digital pcr . Eradication in the berlin patient was achieved after a complex medical process, while the mississippi baby was the first case of a potential hiv-1 cure achieved using a only pharmacological cart . The reason for the success of this approach, which is known to be ineffective in adults, could rely on the particularities of the immune system that hiv-1 encounters in a fetus or a newborn . The main obstacle in achieving functional cure is the persistence of a viral reservoir, a pool of the hiv-1 genome integrated into long - living tcells, and probably in other haematopoietic cells such as macrophages . Although cart achieves undetectable plasma viral rna and the normalisation of cd4 t cell levels in almost every patient, several studies have shown that hiv-1 remains incurable owing to the persistence of latently infected cells [1012]. The majority of these cells are resting memory and nave cd4 tcells, and cells belonging to the monocyte / macrophage lineage that contain integrated provirus within their genome . These cells are the main force behind hiv-1 persistence under cart, which only impacts on actively replicating viruses and is therefore unable to eradicate the infection . For this reason, the most recent approaches to hiv cure are focused on the definition of new drug families that do not target the replication of hiv but rather the transcription of proviruses in cd4 t cells . In combination with cart this may be achieved by implementing both pharmacological and immunological strategies to reactivate hiv-1 from latently infected cells . Reinforcing hiv-1-specific immune responses and blocking potential new events of viral replication will probably help in reaching the final goal of eradication, or the alternative objective of a in hiv-1-infected adults, the pool of latently infected resting cd4 + t cells has been the most intensely analysed hiv-1 reservoir, and is widely recognised as one of the major barriers to achieving eradication or functional cure of hiv-1 infection [1316]. First, the absence of consensus on stability of the viral reservoir caused a storm of controversy concerning the possibility that residual hiv-1 replication in subsets of cd4 + t cells in the lymphoid tissue may contribute to replenishment of the hiv-1 reservoir [1721]. Secondly, hiv-1 infects cd4 t cells and requires some level of immune activation to replicate . Hiv-1 infects mostly memory cells, in particular cells from gut - associated lymphoid tissue (galt), which concentrates most of the activated ccr5-expressing memory cd4 + t cells . Various groups have drawn attention to galt as a major hiv-1 reservoir in individuals receiving cart, since cd4 + t cell recovery is poorer in galt, and viral replication remains higher with respect to peripheral blood . This persistent viral replication in galt probably contributes to maintenance of the reservoir despite peripheral viral suppression [17,2224]. Galt depletion is a major pathogenic event in hiv-1 infection and is associated with the establishment of a long - lived viral reservoir and disease progression in hiv-1-infected adults . In contrast, in the immunological setting of a fetus, memory cells are virtually absent from the cd4 t cell compartment and galt is anatomically immature, since it requires commensal bacteria for full development . In the absence of an optimal setting for replication, hiv-1 may be unable to establish a long - lived latent reservoir and therefore, under this particular situation, very early treatment could have an additional beneficial effect that cannot be observed in chronically hiv-1-infected adults . Hiv - infected children who initiate cart soon after birth do not display hiv-1-specific antibodies or cellular responses, thus indicating early control of viral replication . Nevertheless, hiv-1 infection quickly establishes a viral reservoir, mainly in resting memory cd4 + tcells . Although the memory tcell population in peripheral blood is small in newborns, although ready to develop later in childhood, recent findings have shown the presence of hiv-1-susceptible memory cd4 + tcells in the gut of newborns with predominantly thelper- (th) 1 and th17 phenotype, highlighting that extensive adaptive immunity is present before birth and the gut mucosa is the preferential site for memory cd4 + t cells . The limitations to establishing a viral reservoir facilitated by early cart in children could play a critical role in achieving natural control of viral replication upon discontinuation of cart, which could be defined as functional cure [31,3336]. On the other hand, viral reservoirs could provide a persistent source of recrudescent viraemia despite temporary remission of hiv-1 infection after withdrawal of cart, as observed in the mississippi baby . Intensification of effective cart has been proposed as a strategy to control residual replication and to diminish the hiv-1 reservoirs . Despite some studies having failed to show any effect of art intensification on the residual hiv-1 viraemia in patients with a history of chronic infection receiving cart, a study of 48 weeks' intensification with maraviroc has been associated with a trend towards a decrease in the size of the latent hiv-1 reservoir in memory tcells in chronically hiv-1-infected patients on cart . Ccr5 receptor antagonists in the pipeline are of particular interest because of their mechanisms of action, which could provide a beneficial anti - inflammatory effect beyond their antiviral activity . This immunomodulation represents an added benefit because it could improve the treatment of hiv - associated chronic immunoactivation . This condition increases the risk for serious non - aids - related illnesses, such as heart disease, metabolic complications, kidney problems and others . Interestingly, potentially important anti - inflammatory effects have been highlighted for cenicriviroc, which inhibits the ccr2 receptor regulating rapid monocyte mobilisation . A body of evidence from phase ii / iii clinical trials of investigational ccr5 antagonists (maraviroc and vicriviroc) in treatment - experienced hiv-1 adults indicates a 30 cells/l [95% confidence interval (ci) 1942] greater increase in cd4 + t cell count in individuals using ccr5 antagonists (maraviroc or vicriviroc) than in groups not using ccr5 antagonists, despite baseline plasma hiv-1 rna and virological suppression . Robust immunological effects were also observed in antiretroviral - nave subjects included in the merit clinical trial, when the group randomised to receive maraviroc showed greater increases in cd4 + t cell count than did those receiving efavirenz . The efficacy of cart intensification with the addition of maraviroc has also been studied in individuals with incomplete cd4 + t cell recovery, due to the potential role of maraviroc on immunological recovery . This intensification is clinically relevant mainly for subjects with low cd4 + t cell count, to avoid overall hiv-1-related mortality and morbidity [4446]. While some researchers reported that 24 weeks of maraviroc intensification was not associated with a cd4 + t cell gain of at least 20 cells/l, others researchers observed immunological benefits . Although the mechanism of this effect is still unknown, the blockage of the ccr5 receptor with maraviroc was associated with an increase in circulating levels of ccr5 ligands [4850]. Because these ligands may also signal through alternative chemokine receptors, such as ccr1, ccr3 and ccr4 [5153], the maraviroc - mediated activation of immune cells through alternative chemokine receptors requires further investigation . Interestingly, the results of two clinical trials showed the dynamics of the hiv-1 latent reservoir after discontinuation of the intensification of cart . The effects of cart intensification with maraviroc or raltegravir persisted at least 24 weeks after discontinuation of the drug . However, it is very important to note the emergence of cxcr4-using hiv-1 variants in a minority of hiv-1-infected patients following treatment with the ccr5 antagonist maraviroc, which probably developed from a pre - treatment cxcr4-using viral reservoir . Because, in vertically hiv-1-infected children, the emergence of cxcr4-using variants occurs very early, the use of ccr5 antagonists in these children as intensification therapy may not be the best alternative . The establishment of long - lived latent hiv-1 reservoirs involves multiple processes and is mainly due to transcriptional gene silencing in resting memory cd4 + tlymphocytes and other non - dividing cell types, including monocytes . New compounds targeting transcriptional repression have been recently proposed as pharmacological agents for purging latent hiv-1 from cellular reservoirs in individuals on cart . These pharmacological compounds should be coupled with very potent cart, which will prevent reactivated virus from infecting new host cells, while viral cytopathic effects and immune clearance will eliminate hiv-1-infected cells . Treatments for eradicating hiv-1 are focused on the activation of viral production from latently infected cells to purge and clear hiv-1 reservoirs . This strategy involves the use of a wide range of small molecules called latency - reversing agents (lras). These drugs include: (i) histone deacetylase inhibitors (hdacis); (ii) disulfiram, postulated to involve nuclear factor kb cells (nf-b); (iii) the bromodomain - containing protein 4 (brd4) inhibitor jq1, which elicits effects through positive transcription of the elongation factor (p - tefb); and (iv) protein kinase c (pkc) activators such as ingenols, prostratin, 1,2-diacylglycerol analogues and bryostatin-1 [6668]. The interest in these drugs has increased greatly and there are several clinical trials in progress investigating the safety and the effect of lras as disruptors of hiv latency . Hdacis are the most advanced in clinical testing as hiv-1 anti - latency agents, due mainly to the synthesis in recent years of novel and more specific pan - hdacis such as givinostat, belinostat and panobinostat and newly synthesised class i selective hdacis that include oxamflatin, nch-51 and romidepsin . Recently published results from a clinical trial of the safety and the effect of panobinostat on hiv-1 expression in patients on suppressive cart postulated this compound as a promising reactivator of hiv-1 latency . Both panobinostat and romidepsin show an efficient reactivation profile in j89gfp cells (figure 1a), which is a lymphocyte hiv-1-latently infected cell line regarded as an experimentally tractable and relevant model to study post - integration hiv-1 latency and reactivation . Moreover, the effects on primary cd4 tcell activation, measured as the surface expression imfi (integrated median fluorescence intensity) of cd38 and cd69 activation markers, has been assessed (figure 1b). Although minimal effects in comparison with the conventional phytohaemagglutinin (pha) or pma / ionomycin treatments were observed after panobinostat or romidepsin exposure, a combinatorial strategy could lead to a reduction in the concentrations of lras used in vivo, resulting in a reduction of adverse effects, limiting the local injuries, the toxicity, and the inflammation . (a) j89gfp cells were treated with pnb (dark coloured) and rmd (light coloured) at the indicated concentrations . After 24 hours, hiv-1 reactivation was analysed by flow cytometry as egfp expression (imfi). (b) purified cd4 + t cells from healthy subjects were treated with the indicated concentrations of panobinostat and romidepsin or with pha or pma / ionomycin for 1 (dark bars) and 3 (light bars) days . The surface expression of the activation markers cd38 and cd69 in viable cd4 + t cells were analysed by flow cytometry and expressed as imfi . Results represent the arithmetic mean+sem of at least three independent experiments egpf: enhanced green fluorescent protein; imfi: integrated median fluorescence intensity; pha: phytohaemagglutinin; pma / iono: pma / ionomycin; pnb: panobinostat; rmd: romidepsin to date, several clinical trials involving hiv-1-infected adults are ongoing with the aim of evaluating the safety, tolerability and the potency of these potential antiviral latency agents [7577]. However, no data regarding potential anti - latency drugs in hiv-1 paediatric patients are available . Therefore, owing to the established differences between paediatric and the adult hiv infection, we cannot be certain about the impact of these drugs in hiv paediatric patients and whether they will help to establish a functional cure in hiv-1-infected paediatric patients . The effect of panobinostat has been studied in children ranging from age 8 to 21 years with refractory haematological malignancies (https://clinicaltrials.gov/ct2/show/nct01321346), and also in children older than 16 years with relapsing hodgkin lymphoma (https://clinicaltrials.gov/ct2/show/nct01169636). On the other hand, romidepsin has been used in patients younger than 21 years with recurrent solid tumours or leukaemias (https://clinicaltrials.gov/ct2/show/nct00053963). These data suggest that it might be reasonable to design a clinical trial using these drugs in combination with cart in hiv-1 infected children and adolescents . In summary, although there are still many obstacles before achieving a sterilising cure for hiv-1-infected paediatric patients, a functional cure could be close . Different approaches may be used to achieve it, although haematopoietic stem cell transplantation may not be used as a standard approach due to the elevated risks it carries . In recent infections, early cart may reduce the size of long - lived cd4 + t cell viral reservoirs that can be established, but the answers to several questions, such as the best cart and the optimum length of cart administration, remain elusive . Finally, in chronically hiv - infected paediatric patients, anti - latency drugs could have an important role but more information about the safety of these drugs in this population is required . This work has been (partially) funded by the rd12/0017/0037, project as part of the plan nacional r+d+i and co - financed by isciii- subdireccin general de evaluacin y el fondo europeo de desarrollo regional (feder), retic pt13/0010/0028, fondo de investigacion sanitaria (fis) (pi13/02016), comunidad de madrid (grant number s-2010/bmd-2332], penta, cyted 214rt0482 . Ciber - bbn is an initiative funded by the vi national r+d+i plan 20082011, iniciativaingenio 2010, the consolider program, and ciber actions and financed by the instituto de salud carlos iii with assistance from the european regional development fund . This work has been (partially) funded by the rd12/0017/0037, project as part of the plan nacional r+d+i and co - financed by isciii- subdireccin general de evaluacin y el fondo europeo de desarrollo regional (feder), retic pt13/0010/0028, fondo de investigacion sanitaria (fis) (pi13/02016), comunidad de madrid (grant number s-2010/bmd-2332], penta, cyted 214rt0482 . Ciber - bbn is an initiative funded by the vi national r+d+i plan 20082011, iniciativaingenio 2010, the consolider program, and ciber actions and financed by the instituto de salud carlos iii with assistance from the european regional development fund.
Filarial nematodes of the genus setaria comprise more than 40 species of veterinary importance (sonin, 1977). The life cycle of setaria spp . Requires mosquitoes as obligate vectors that take up first stage microfilaria when blood - feeding on infected ungulates (anderson, 2000). Several mosquito species, mainly of the genus aedes, are potential vectors for the transmission of setaria (laaksonen et al ., 2009). In mosquitoes, the microfilariae develop into the infective third stage larvae that are released during subsequent blood meals (bain and babayan, 2003). Scarce information is available on the development and migration of the nematodes in definitive hosts (anderson, 2000), but setaria spp . Generally inhabit the abdominal cavity causing focal areas of mild chronic peritonitis (rehbinder, 1990). Setaria tundra was first described in russian reindeer (rajewsky, 1929). In europe, infections with s. tundra in roe deer were previously reported from austria (kutzer and hinaidy, 1969), switzerland (andrews et al ., 1974), germany (rehbein et al ., 2001), italy (favia et al ., 2003), and france (ferri et al ., 2009); and recent reports have identified the parasite in hungary (kemenesi et al ., 2015, zittra et al ., 2015), spain (angelone - alasaad et al ., 2016) and poland (kowal et al ., 2013, masny et al ., 2013). In the seventies, outbreaks of peritonitis caused by s. tundra were reported in swedish and norwegian reindeer (rehbinder et al ., 1975) and in finland, s. tundra has been associated with an emerging epidemic disease causing serofibrinous peritonitis, severe morbidity and mortality in reindeer and moose (laaksonen et al ., 2007). The majority of roe deer infections are subclinical, hence these ungulates are considered reservoirs of the parasite (rehbinder et al ., 1975, rehbinder, 1990, laaksonen et al ., 2007). Prior to our study, no findings of s. tundra have been reported from denmark . However, roe deer are widespread throughout the country with an estimated population of 400,000 in 2002 an increase of 250,000 since 1984 (burbait and csnyi, 2009). Here further, the danish isolates were compared with previously published european isolates by phylogenetic analyses . The roe deer described in the present study were analysed as part of the general surveillance program of danish wildlife conducted by the national veterinary institute, technical university of denmark . Of which all nematodes were collected and identified morphologically and a subset were further characterized by molecular typing . In contrast supplementary coprological analyses were carried out to give an impression of the general health and the overall parasitological burden of the animals . In october 2010 a male fawn was shot near assentoft, in east jutland (fig . 1, a). It was severely emaciated with no fat deposits, but the fur was in good condition despite the presence of several adult and nymphal stages of ixodes ricinus . Post - mortem examination revealed the presence of lungworms and chronic bronchopneumonia, and histological analysis demonstrated perivascular mononuclear cell infiltration of the heart . More than 20 slender, white s. tundra worms of approximately 5 cm long were actively swimming in the peritoneal cavity . Mcmaster analysis (roepstorff and nansen, 1998) revealed low - grade excretion of trichuris spp . (> 10,000 cysts per gram) were detected by immunofluoroscent staining of faecal smears (crypto / giardia cel reagent (rr2), cellabs pty, ltd . A female fawn was shot in may 2011 near tappernje, in southwestern zealand (fig . 1, d). The autopsy revealed congested areas in the dorso - caudal parts of the lungs but no lungworms were detected macroscopically . Other visceral organs were normal . A single s. tundra worm approximately 8.2 cm long was found free in the peritoneal cavity . Faecal examination detected strongyle eggs (100 eggs / g) and eimeria oocysts (<1000/g) whereas no cryptosporidium oocysts or giardia cysts were observed . Adult female was hunted in december 2012 in, rude, northern zealand (fig . 1, c). The hunter noticed the presence of several worm - like objects (n = 12) lying underneath the transparent liver capsule (fig . 2, e) and forwarded only the liver to the national veterinary institute for pathological examination . According to the hunter no worms could be found in the peritoneal cavity and the visceral organs appeared normal . The recovered worms were very fragile and could not be isolated in toto for morphological analysis, but dna was successfully extracted for molecular typing . These two cases were male fawns approximately one year old, shot in may 2013 near sklskr, south zealand (fig . 1, b). The animals were in good body condition and the autopsy demonstrated no pathological changes in the internal organs of either deer, but worms were detected in the abdominal cavity of both fawns . Single male and female s. tundra were found in one deer, and two females and one male were found in the second deer . One female worm had tens of thousands microfilariae that were subjected to morphological examination (fig . 2, d). Ectoparasites were not detected and coprological examination revealed no parasitic eggs / oocysts or larvae . A male fawn was shot due to severe diarrhoea and emaciation in march 2014 in tllse, central zealand (fig . 1, e). Gross macroscopic examination showed the presence of internal and external parasites including many lice, ticks, and lungworms . Four adult s. tundra (68 cm) were found free in the peritoneal cavity and identified based on morphology . Oocysts (14,800 oocyst / g), strongyle eggs (830 eggs / g), trichuris spp . Eggs (410 eggs / g), and lungworm larvae (not speciated or quantified). Microscopic examination and identification was performed according to rajewsky (1929) and nikander et al . Dna extraction, pcr amplification and sequencing of fragments of the mitochondrial 12s rrna and the cytochrome c oxidase subunit i (cox1) genes was performed on single worms from four of the above cases following standard procedures as described by casiraghi et al . Pcr amplicons were sequenced in both directions using abi prism big dye terminator v 3.1 sequencing kit (applied biosystems, foster city, ca), and the sequences analysed with genetic analyzer 3130 (applied biosystems, appiera denmark) as per manufacturer's instructions . Consensus 12s rrna and cox1 sequences were subjected to blastn analysis (http://blast.ncbi.nlm.nih.gov) and compared to all s. tundra nucleotide sequences available in current databases . Subsequently, the consensus sequences were aligned with a selected subset of closely related sequences of the genus setaria . Phylogenetic relationships were inferred based on analyses employing the neighbor - joining (nj) method using mega7 (kumar et al ., 2016). The morphology of worms isolated from the peritoneal cavity was identical to s. tundra by light microscopy (fig . 2). This was confirmed by sequences of the 12s rrna and cox1 genes, which were 99.199.8% identical to previously published s. tundra isolates from germany, france, italy, spain and finland . Phylogenetic trees constructed based on 12s rrna and cox1 sequences were similar in topology and therefore only one tree is presented (fig . Accordingly, the danish isolates described here were clearly grouped with other isolates of s. tundra from europe in one node that had high bootstrap values for nj (0.99). However, sequence analysis showed slight variability within the danish isolates, which was reflected in their topology in the phylogenetic tree . For example, the danish isolates 2013 - 410 - 1 & 2, which geographically originated from zealand (an island) were more closely related to the isolate 2010 - 1233 that originated from jutland (a peninsula) than the other isolate (2012 - 1665) from zealand . The danish isolate 2012 - 1665, with worms encapsulated in the liver capsule, had 0.5% variation in the cox1 compared to other danish isolates, but had a lower level of variability (0.20.3%) and was phylogenetically more closely related to other european isolates (fig . 3). Despite the low bootstrap values, the general topology of the setaria spp . Resembles a previously published tree by alasaad et al . Worms of setaria transcaucasica were earlier recovered from 41 out of 76 roe deer (53.9%) collected from the island ls in denmark (korsholm, 1988). In that study, the worms recovered from younger animals were encapsulated in different visceral organs and tissues, whereas in older animals the worms were found free in the peritoneal cavity . It is hard to determine if the proposed identification of the parasites was valid in the study by korsholm (1988) because of the similar position of the worms in the subcapsular layer of visceral organs in that study in comparison to the current case 3 (isolate 2012 - 1665) and scarce information can be found in the literature about the vectors, mode of transmission or morphology for s. transcaucasica . Indeed thus it is possible that these findings were actually s. tundra . Certainly, considering the presence of s. tundra to the north and east of the country it is unlikely that the parasites found in the current study represent very recent introductions into denmark . Nonetheless, the existence of an isolated island with a remarkably high prevalence of a vector - borne filarial nematode may present a model for studying the transmission dynamics of that parasite . Infections with s. tundra are of particular interest to game meat and fur retailers (rehbinder, 1990, laaksonen et al ., 2007). Reports from finland linked poor body condition, under - developed fur in winter, dry fur, and reduced mean slaughter weight of reindeer infected with s. tundra (laaksonen et al ., 2007). In roe deer, most infections with s. tundra have less impact on meat and coat quality but if animals are severely afflicted approximately 152 metric tons of game meat (dvfa, 2012), at an approximate value of 8,8 million euros could be potentially affected . In denmark, the annual hunting yield of roe deer is over 125,000 (asferg, 2012). Infected viscera from reindeer may be condemned at meat inspection, but the carcass is considered fit for human consumption even without heat treating (laaksonen et al ., 2007). Based on the present results we consider the findings of s. tundra incidental and not associated with the emaciation, which was observed in three of the six cases (1, 2 & 6). In one animal (case 1) only a single s. tundra was uncovered in the third animal (case 2) and no obvious parasitological explanation could be found for the observed enteritis and emaciation . Therefore the clinical signs may have been caused by other non - parasitic pathogens . Due to the low number of animals and the protracted study period it is worth noticing though that the zoonotic pathogens cryptosporidium spp . And giardia spp . 2013) and/or i. ricinus, which is an important vector for several zoonotic agents (kauffmann et al ., 2016, scheid et al ., 2016), were detected in all of the emaciated roe deer . The spatio - temporal distribution and transmission of vector - borne diseases are highly affected by climatic change (hoberg et al ., 2008). Previous outbreaks of setariosis in scandinavia have been associated with unusually warm weather, and given the right circumstances the parasite has demonstrated its capacity to increase its geographic range considerably (rehbinder et al ., 1975, additional mosquito species (coquillettidia richiardii and ochlerotatus annulipes) not previously known as s. tundra vectors have been observed to carry the parasite in hungary, potentially increasing the vector species this parasite utilizes and it is likely that s. tundra is not vector specific (laaksonen et al ., 2009, angelone - alasaad et al ., 2016). This expected plasticity in vector species is concerning considering the likelihood that global warming will expand the range of various mosquito species into northern latitudes (dupouy - camet, 2016). While surveillance is based on voluntary submissions to the national veterinary laboratory nothing is known about prevalence of s. tundra in roe deer, fallow deer (dama dama) and red deer (cervus elaphus) (the three cervid species present in denmark), although the distant geographical origin of the current cases in conjunction with their relatively diverse molecular characterization is further indicative of a well - established population . This does not preclude, however, increasing prevalence in the future as a response to climate change . The distribution and abundance of hosts and vectors can explain the spatio - temporal presence of s. tundra . The outbreak of setariosis in the 1970s in scandinavia was reported a few years after the introduction of roe deer into the same area (haugerud, 1989), which suggest a likely role of roe deer in the dissemination of this parasite (rehbinder et al ., 1975, the species is considered to be the predominant reservoir in finland, and in germany where prevalence ranges from 1.6% in north rhine - westphalia to up to 12.3% in northern bavaria in roe deer (czajka et al ., 2012). With a reported mean daily range of 8.5 ha in roe deer (jeppesen, 1990) and an open land border between jutland and germany, frequent crossings are likely to occur and are an obvious possible route of the parasite into the country . How the parasite was introduced onto the island of zealand is not clear but the heterogeneous genetic profiles found on the island could indicate multiple introductions . In northern finland the increased prevalence of s. tundra in slaughtered reindeer (laaksonen et al ., 2007) was linked to aggregation of reindeer in herds in mosquito - rich wetlands (laaksonen et al ., 2009). The risk for transmission is highly enhanced when susceptible hosts are aggregated (opara and fagbemi, 2008). Given that s. tundra is not vector specific, higher rate of transmission of this parasite is accordingly expected in woodlands that are close to water, where ungulates are aggregated in large numbers.
Diabetes mellitus is a metabolic disease characterized by hyperglycemia, which results from defects in insulin secretion from pancreatic beta cells, insulin resistance in peripheral tissues, and increased glucose production by the liver [13]. The liver plays a critical role in the maintenance of glucose homeostasis by balancing the uptake, storage, and release of glucose . However, elevated hepatic glucose production is associated with the pathogenesis of type 2 diabetes [6, 7]. In this process, glucose-6-phosphatase (g6pase) catalyzes the terminal step in the glycogenolytic and gluconeogenic pathways, and phosphoenolpyruvate carboxykinase (pepck) is a key regulatory enzyme driving gluconeogenesis [8, 9]. Insulin suppresses gluconeogenesis by inhibiting the transcription of pepck and g6pase [10, 11]. Arsenic trioxide has a long history as biomedical interest and is approved by the food and drug administration (fda) for treatment of certain leukemias [12, 13]. Sodium meta - arsenite (sa, kml001) has entered phase ii clinical trials for the treatment of solid tumors and hematopoietic malignancies . In addition, sodium meta - arsenite (sa) is reported to have insulin - mimetic effects on glucose homeostasis . Sa inhibits forskolin / dexamethasone - induced pepck and g6pase gene expression in hepatic cell lines and rat primary hepatocytes [14, 15]. Sa activates amp - activated protein kinase [15, 16], which in turn induces small heterodimer partner (shp) which inhibits the expression of hepatic gluconeogenic genes, and this repression is abolished by shp inhibition . Sa also suppresses dexamethasone - induced pepck transcription in 14-day chick embryo livers in vivo . Despite the demonstrated effects of sa in reducing the expression of gluconeogenesis genes, the antidiabetic effect of sa in type 2, we examined the therapeutic effect of sa in diabetic db / db mice, an animal model of human type 2 diabetes, as well as the mechanisms involved in the improvement of hepatic gluconeogenesis . Db / db mice were obtained from the korea research institute of bioscience and biotechnology (daejeon, korea) and c57bl/6 mice were obtained from the orient bio inc . (gyeonggi, korea) and maintained in specific pathogen - free conditions at the animal facility at gachon university of medicine and science under a 12 h light: 12 h dark photoperiod . The db / db male mice (aged 68 weeks) were monitored for the development of hyperglycemia using a glucometer (one touch ultra; lifescan inc ., pair - fed diabetic db / db mice were given the same daily amount of food as that eaten by the corresponding sa - treated group during the previous day . All animal experiments were carried out under a protocol approved by the institutional animal care and use committee at the gachon university of medicine and science . Six- to eight - week - old diabetic male db / db mice (random blood glucose levels> 300 mg dl for 3 consecutive days) were orally intubated with sa (10 mg kg body weight / day; komipharm, seoul, korea) or phosphate buffered saline (pbs) for 8 weeks . After 4 and 8 weeks of treatment, glucose levels were measured following the removal of food for 14 h. all animal groups were body weight - matched with the sa - treated group at the beginning of each experiment . After 8 weeks of sa treatment, mice were not fed for 4 h, and blood samples were drawn into heparinized capillary tubes from the periorbital veins . The whole blood was used for hba1c measurements, and serum was used for alanine aminotransferase (alt) and aspartate aminotransferase (ast) measurements using the au480 chemistry system (beckman coulter life sciences, california, usa). After 4 and 8 weeks of sa treatment, mice were not fed for 14 h, and then a glucose solution (2 g kg body weight) was injected intraperitoneally . Blood glucose levels were measured at 0, 30, 60, 90, 150, and 180 min after glucose injection at 9:00 a.m. for insulin tolerance tests, mice were not fed for 4 h and were injected with insulin (2 units kg body weight, i.p . ), and blood glucose levels were measured at 0, 30, 60, and 90 min after insulin injection at 1:00 p.m. for pyruvate tolerance tests, c57bl/6 mice were orally intubated with sa (10 mg kg body weight) or pbs and then fasted overnight . Fifteen hours after oral intubation, mice were injected i.p . With 1 g kg body weight of sodium pyruvate in pbs, and blood glucose levels were measured at 0, 15, 30, 60, 90, and 120 min after pyruvate injection at 9:00 a.m. total rna was isolated from the liver of sa - treated mice or hepatocytes from c57bl/6 mice, and cdna was synthesized using the primescript first - strand cdna synthesis kit (takara bio, inc ., otsu, japan). Pcr was carried out in a 7900ht fast real - time pcr system (applied biosystems, carlsbad, ca) at 95c for 10 min, followed by 40 cycles at 95c for 15 s, 60c for 1 min . As an internal control, the specific pcr primers were g6pase: sense 5-gtgttgacatcggccc-3, antisense 5-aactgaagccggttag-3; pepck: sense 5-cgcaagctgaagaaatatgacaa3, antisense 5-tcgatcctggccacatctc-3; hepatocyte nuclear factor-4 (hnf-4): sense 5-ccaacctcaattcatccaaca-3, antisense 5-cccggtccgccacagat-3; shp: sense 5-agg aacctgccgttccttctg-3, antisense 5-tgg ctt cct cta gca gga tc-3; sirt1: sense 5-ttggtggtacaaacaggtattga-3, antisense 5-cagtgagaaaatgctggccta-3; agrp: sense 5-tgctactgccgcttcttcaa-3, antisense 5-ctttgcccaaacaacatcca-3; pomc: sense 5-gaggccactgaacatctttgtc-3, antisense 5-gcagaggcaaacaagattgg; mc4r: sense 5-tgctggtgagcgtttcga-3, antisense 5-ggcatccgtatccgtact-3; and cyclophilin: sense 5-tggagagcaccaagacagaca-3, antisense 5-tgccggagtcgacaatgat-3. The relative copy number was calculated using the threshold crossing point (ct) as calculated by the 7900ht fast real - time pcr software combined with the delta delta ct calculations . For the hepatic glucose production assay, hepatocytes were seeded in 6-well plates at a density of 2 10 cells 2 ml / well and cultured in hepatozyme sfm media (gibco) for 24 h; unattached cells were discarded . Hepatocytes were then treated for 24 h with sa (5 or 10 m). After 24 h of culture, cells were washed with pbs and then cultured in glucose - free dmem supplemented with 20 mm sodium lactate and 2 mm sodium pyruvate for 2 h. glucose concentration in the media was measured by a glucose assay kit (biovision research products, mountain view, ca). Hepatocyte cell lysates were preparedand subjected to sodium dodecyl sulfate - polyacrylamide gel electrophoresis . Membranes were incubated with anti - sirt1, anti - acetyl - foxo1, or anti - foxo1 antibodies (santa cruz biotechnology, santa cruz, ca) overnight at 4c . After washing, membranes were incubated with a horseradish peroxidase - conjugated secondary antibody (anti - rabbit igg, chemicon international, temecula, ca) for 1 h at room temperature . Reactive bands were detected by enhanced chemiluminescence (thermo fisher scientific, rockford, il). A comprehensive animal metabolic monitoring system (clams; columbus instruments, columbus, oh) was used to evaluate energy expenditure, respiratory exchange ratio, and locomotor activity . The respiratory exchange ratio was computed as carbon dioxide output (vco2) divided by oxygen consumption (vo2). Locomotor activity was measured on x- and z - axis by using infrared beams to count the beam breaks during 72 h. for cytotoxicity and proliferation assays, hepatocytes were seeded in 96-well plates at a density of 2 10 cells 100 l / well and incubated for 24 h. the cells were then incubated in culture medium containing sa (5 or 10 m). Following 24 h of incubation, cell viability was determined using a cell counting kit-8 (dojindo laboratories, kumamoto, japan) according to the manufacturer's protocol . For the h - thymidine incorporation assay, hepatocytes were seeded and incubated as described above with the addition of h - thymidine (1 ci / well). After 24 h of incubation, the cells were washed with pbs and then analyzed for h - thymidine incorporation using a scintillation beta - counter, 1450 lsc and luminescence counter microbeta trilux (perkin elmer). After 8 weeks of sa treatment, mice were not fed for 14 h, and then a glucose solution (2 g kg body weight) was injected intraperitoneally . The concentration of serum insulin was measured by an ultrasensitive mouse insulin enzyme immunosorbent assay kit (alpco, windham, nh). Statistical significance of the difference between two groups was analyzed by unpaired student's t - test for comparison of two groups or anova followed by fisher's protected least significant difference test for multiple groups . To investigate the effects of sa on a type 2 diabetic mouse model, we orally intubated diabetic db / db mice with sa daily and measured hba1c levels, glucose levels, food intake, and body weight . We found that hba1c levels of sa - treated mice were significantly lower compared with the untreated, pbs - treated, and pair - fed control groups at 8 weeks of treatment (figure 1(a)). Blood glucose levels were unchanged among groups at 4 weeks of treatment but were significantly lower in the sa - treated group at 8 weeks, compared with the control groups (figure 1(b)). Fasting blood glucose levels were also significantly decreased in sa - treated mice compared with untreated, pbs - treated mice, and pair - fed mice at 8 weeks of treatment (figure 1(c)). Interestingly, food intake in sa - treated mice was significantly decreased compared with pbs - treated mice (figure 1(d)), but body weight gain was significantly increased at 8 weeks of sa treatment (figure 1(e)). In contrast, the pair - fed group had significantly lower body weights as compared with the pbs - treated group (figure 1(e)). In addition, the blood concentrations of alt and ast, indicators of liver damage, were not different between sa- and pbs - treated db / db mice (see supplementary figure 1 in supplementary material available online at http://dx.doi.org/10.1155/2014/961732). These results suggest that treatment with 10 mg kg of sa for 8 weeks may not have toxic effects in db / db mice . In low concentrations,, we also found that sa in low doses (5 m) stimulated hepatocyte cell growth and did not show cell toxicity, even at 10 m (supplementary figure 2). To determine whether blood glucose levels are properly controlled in sa - treated db / db mice, we performed intraperitoneal glucose tolerance tests at 4 and 8 weeks of sa treatment . Blood glucose levels in sa - treated mice were significantly lower at all time points following glucose injection compared with pair - fed mice and significantly lower after 90 min compared with pbs - treated mice at 4 weeks (figure 2(a)). At 8 weeks of treatment, blood glucose levels of sa - treated mice were significantly reduced at all time points compared with pbs - treated and pair - fed mice (figure 2(b)). Blood glucose levels in the pair - fed group were not significantly different from the untreated or pbs - treated groups at any time point, except at 60 min after glucose loading (figure 2(b)). The area under the curve was significantly reduced in sa - treated mice compared with pbs - treated and pair - fed mice at both 4 and 8 weeks of treatment (figures 2(c) and 2(d)). To address whether sa treatment improves insulin sensitivity, we performed insulin tolerance tests at 4 and 8 weeks of sa treatment . Glucose reduction in sa - treated mice was not different from untreated, pbs - treated, or pair - fed mice at 4 weeks or 8 weeks of treatment (figures 3(a) and 3(b)). Similarly, the area under the curves was not different among groups (figures 3(c) and 3(d)). To measure insulin secretion in sa - treated mice, we analyzed glucose - stimulated insulin secretion after 8 weeks of sa treatment . Insulin secretion was not different between the sa- and pbs - treated groups (supplementary figure 3). To determine whether sa treatment affects the expression of genes involved in glucose production, we examined the expression of g6pase and pepck mrna, which are involved in gluconeogenesis in the liver . The expression of both g6pase and pepck mrna was significantly decreased in the liver of sa - treated db / db mice compared with pbs - treated mice at 8 weeks (figures 4(a) and 4(b)). To investigate gluconeogenic fluxes in vivo, c57bl/6 mice were orally intubated with sa or pbs . After 15 h later from oral intubation, mice were injected i.p . With sodium pyruvate, and blood glucose levels were measured . Sa treatment significantly inhibited blood glucose level at 15 min after pyruvate injection (figure 4(c)). To investigate the direct effects of sa on hepatic gluconeogenesis in vitro, we treated hepatocytes isolated from c57bl/6 mice with sa and then measured glucose production . Sa treatment significantly decreased glucose production approximately 70% and 90% at 5 and 10 m, respectively, as compared with untreated hepatocytes (figure 4(d)). In addition, the expression of g6pase and pepck mrna was significantly decreased in sa - treated hepatocytes (figures 4(e) and 4(f)). The promoter activity of g6pase and pepck is regulated by the transcription factors hnf-4, hnf-3, and foxo1 [9, 19]. Small heterodimer partner (shp) has been shown to downregulate g6pase and pepck via the repression of hnf-4, hnf-3, and foxo1 [20, 21]. Thus, we measured the expression of hnf-4 and shp mrna in sa - treated hepatocytes . Sa treatment significantly decreased the expression of hnf-4 mrna and significantly increased shp mrna (figures 4(g) and 4(h)). Foxo1 activity is known to be regulated by phosphorylation and acetylation [22, 23]. Sirt1 increases foxo1 dna - binding ability by deacetylating foxo1 and potentiating its transcription activity . Thus, we determined the expression of sirt1 and acetylated foxo1 in sa - treated hepatocytes . The expression of sirt1 mrna and protein in sa - treated hepatocytes was significantly decreased compared with untreated control hepatocytes (figures 5(a) and 5(b)). In addition, acetylated foxo1 was increased in sa - treated hepatocytes compared with untreated cells (figure 5(b)). Sa - treated mice showed a significant increase in body weight in spite of a significant reduction in food intake (figures 1(d) and 1(e)). To investigate whether the body weight gain is due to metabolic changes induced by sa treatment, we measured food intake, oxygen consumption, carbon dioxide output, energy expenditure, and respiratory exchange ratio by a metabolic monitoring system over 72 h at 8 weeks of sa treatment . Food intake was significantly decreased in sa - treated mice compared with untreated mice (figure 6(a)). Oxygen consumption (figure 6(b)), carbon dioxide output (figure 6(c)), and energy expenditure (figure 6(d)) were significantly decreased in sa - treated mice compared with untreated or pair - fed groups . The respiratory exchange ratio was not different in sa - treated or pair - fed mice compared with untreated mice (figure 6(e)). Feeding behavior is regulated by a system with the hypothalamus at the centre, and energy homeostasis is maintained through regulation of food intake and energy expenditure [25, 26]. Therefore, we investigated the expression of hypothalamic molecules known to be involved in appetite regulation, agrp, proopiomelanocortin (pomc), and a pomc receptor, melanocortin 4 receptor (mc4r), in sa - treated mice . Interestingly, the expression of agrp mrna, but not pomc and mc4r mrna, was significantly increased in sa - treated mice compared with pbs - treated controls and pair - fed group (figures 7(a)7(c)). The liver is an important organ in the regulation of glucose homeostasis in fed and fasting conditions . Excess gluconeogenesis and glycogenolysis in the liver lead to elevated hepatic glucose production, which is a major cause of hyperglycemia in type 2 diabetes [6, 7]. Sa has been previously shown to downregulate the expression of the hepatic gluconeogenic genes, g6pase and pepck, in hepatic cell lines, rat hepatocytes, and embryonic chick liver [14, 15, 17]. In this study, we report that sa reduces hepatic gluconeogenesis in diabetic db / db mice, an animal model of human type 2 diabetes . Sa - treated diabetic db / db mice showed decreased blood glucose levels under fed and fasting conditions and improved glucose tolerance . In addition, the expression of gluconeogenesis - related genes was downregulated in sa - treated db / db mice liver and mouse hepatocytes . This pathway is catalyzed by several enzymes, first and last ones being pepck and g6pase . Sa suppressed the expression of pepck promoter - driven luciferase constructs in a rat hepatoma h4iie cell line . Sa also repressed forskolin / dexamethasone - stimulated pepck and g6pase gene expression and induced shp gene expression via amp - activated protein kinase to inhibit gluconeogenic enzyme gene expression in hepatic cell lines . In our study, g6pase and pepck mrna levels were significantly reduced in sa - treated diabetic db / db mice liver . In addition, hba1c and fed and fasting glucose levels were significantly decreased in sa - treated diabetic db / db mice . These results suggest that sa could improve hyperglycemia in type 2 diabetes through the reduction of gluconeogenesis . Shp has been shown to inhibit numerous nuclear receptors and transcription factors as transcriptional corepressor . The induction of shp has been shown to downregulate g6pase and pepck through the repression of hnf-4-, hnf-3-, and foxo1-mediated transcriptional activity [20, 21]. In our study, the expression of shp mrna was significantly increased in sa - treated hepatocytes, and hnf-4 mrna was decreased by sa in a dose - dependent manner in mouse hepatocytes . This suggests that sa - induced increases of shp work as repressor to inhibit hnf-4 expression and subsequently g6pase and pepck production . Foxo1 is a transcription factor that has an important function in the regulation of gluconeogenesis . Its transcriptional activity is regulated through phosphorylation or acetylation of multiple residues . When foxo1 is phosphorylated, it is excluded from the nucleus, resulting in decreased transcription of g6pase and decreased hepatic gluconeogenesis . Foxo1 transcriptional activity is also regulated by acetylation, which inhibits the ability of foxo1 to interact with the g6pase promoter by decreasing the stability of the foxo1-dna complex . Sirt1 reverses this acetylation process of foxo1 and has been shown to play critical roles in glucose homeostasis in liver . However, sirt1 has been shown to confer both positive and negative effects on hepatic gluconeogenesis . The transcriptional activity of foxo1 is increased by sirt1 through deacetylation; on the other hand, sirt1 suppresses the ability of hnf-4 to downregulate gluconeogenic gene expression . In our study, the expressions of sirt1 mrna and protein levels were significantly decreased depending on sa concentration . It was reported that sa induces nf-b activation, which enhances the expression of mir-34a, a tumor suppressor gene . And sa treatment increases mir-34a expression in tk-6 cells, which downregulates the expression of sirt1 . Thus, the decrease of sirt1 mrna by sa in our study may be mediated by the nf-b / mir-34a pathway . Taken together, all these results suggest that sa decreases sirt1, thus reducing the deacetylation of foxo1 and reducing its transcriptional activity, which contributes to the reduced expression of hepatic gluconeogenic genes . Interestingly, sa - treated db / db mice showed reduced food intake over the 8 weeks of the experiment; however, sa - treated mice gained more body weight compared with pbs - treated and pair - fed mice . In addition, sa - treated mice showed decreased consumption of oxygen and production of carbon dioxide, energy expenditure, and locomotor activity compared with pair - fed mice . In the brain, the hypothalamus is a primary center in which feeding behavior and energy metabolism are regulated [34, 35]. Agrp is a neuropeptide produced in the hypothalamus by the agrp / neuropeptide y (npy) neuron . Agrp treatment for 7 days' intracerebroventricular administration in rat decreased oxygen consumption and energy expenditure . In our study, the expression of agrp mrna was significantly increased in sa - treated mice compared with pbs - treated mice, whereas the pair - fed mice were not different from the pbs group . These results suggest that sa decreases energy expenditure and increases weight gain via the induction of agrp expression in hypothalamus . It is known that foxo1 regulates agrp transcription in the hypothalamus, and decreased foxo1 activity is associated with decreased agrp expression . However, we found that mrna expression of agrp was increased although foxo1 transcriptional activity was decreased by sa treatment . The expression of agrp may be regulated by several molecules as well as foxo1 and further studies are needed for the detailed molecular mechanisms . It is paradoxical that food intake decreased in sa - treated db / db mice in spite of an increase in agrp, which might be expected to stimulate appetite . In addition, the appetite - stimulating effects of agrp are inhibited by leptin, but db / db mice are deficient for the leptin receptor gene . Therefore, the increase of agrp expression may not affect the appetite in sa - treated db / db mice . In conclusion, our studies show that sa improves glucose metabolism in a type 2 diabetic mouse model . Sa directly inhibits hepatic glucose production via regulation of gluconeogenesis - related genes and protein expression, such as pepck, g6pase, shp, sirt1, and acetylated foxo1 . In addition, sa increases body weight via decreasing energy expenditure due to induction of agrp gene expression in hypothalamus.
Familial lecithin - cholesterol acyltransferase deficiency (fld) and fish eye disease (fed) are autosomal recessive disorders arising out of mutation in the lcat gene, which encodes for the enzyme lecithin - cholesterol acyltransferase . Patients with classic fld develop nephrotic syndrome progressing to end - stage renal disease (esrd), corneal opacities, dyslipidemia and hemolytic anemia . We report a family where one member was affected with classic fld while two others were found to have fed [figure 1]. Pedigree chart of the family depicting the affected members of the family with lecithin - cholesterol acyltransferase deficiency or fish eye disease a 37-year - old male presented with progressive swelling of feet and facial puffiness for 6 months . On physical examination, he had mild pallor, moderate pedal edema and cloudy cornea with a peripheral arcus in both eyes [figure 2]. Clinical and histological images of the patient with lecithin - cholesterol acyltransferase (lcat) deficiency . Panel a - photograph showing the cloudy cornea of the patient characteristic of lcat deficiency . Panel b - photomicrograph of h and e, stained kidney biopsy specimen (40) demonstrating mesangial expansion with thickening of glomerular capillary loops and vacuolization of basement membrane (solid arrow). Panel c - photomicrograph of silver stained kidney biopsy specimen (40) demonstrating thickened glomerular basement membrane laboratory investigations revealed hemoglobin of 8 g / dl with erythrocytes in peripheral blood film examination; serum haptoglobin of 64 mg / dl (normal range: 70200 mg / dl), total cholesterol 215 mg / dl, high - density lipoprotein cholesterol (hdl - c) 10 mg / dl, and triglycerides 385 mg / dl . Renal biopsy showed glomerulomegaly with mild mesangial expansion and foam cell infiltration in mesangium and glomerular basement membrane (gbm) [figure 2]. Tubules also showed foamy changes with focal tubular atrophy, and interstitium showed the presence of foam cells . In view of the clinical profile, characteristic dyslipidemia (high triglyceride, very low hdl) and histological changes, plasma lcat activity was determined at pacific biomarkers, seattle, usa . The cholesterol esterification rate was undetectable indicating complete lack of lcat in plasma . Clinical evaluation of family members revealed corneal opacities and dyslipidemia in patient's mother and his younger sister . However, there was no renal, hematological or other systemic involvement in both of them . Genetic testing of the proband and serum lcat activity of the other affected members could not be done due to financial constraints . Based on the clinical manifestations, the proband was diagnosed to have classic fld while his mother and sister were diagnosed to have fed . Familial lcat deficiency is an autosomal recessive disorder caused by mutations in lcat gene, which is located in the chromosome 16q22 . It has a prevalence of <1:1,000,000 and about 70 families with this condition have been reported worldwide . The disorder was first reported in 1967 in a norwegian family . The mutation underlying this disorder was identified in 1992 the disorder is characterized clinically by corneal opacity, hemolytic anemia, proteinuria and renal dysfunction . Wherein two siblings were found to be affected with this disease, and one of them developed esrd requiring renal transplant . Lecithin - cholesterol acyltransferase is an enzyme that is expressed primarily in the liver and secreted into the plasma compartment . The enzyme plays an important role in esterification of free cholesterol in lipoproteins leading to maturation of hdl that helps in reverse cholesterol transport . The esterification of free cholesterol by lcat primarily occurs at the surface of hdl, and this is called alpha - lcat activity . However, about 25% of lcat activity is also detected in other lipoproteins such as low - density lipoprotein and very low - density lipoprotein, called beta - lcat activity . Thus, alpha and beta lcat activities are two functional aspects of the same protein . There are two clinical syndromes that arise out of mutations in lcat gene namely fld and fed . In fed, there is a loss of alpha - lcat activity while the beta - lcat activity is preserved . The patients may present with hdl - c deficiency, corneal opacification, hemolytic anemia, hypertension, hypertriglyceridemia, and proteinuria frequently progressing to esrd . The difference in clinical and bio - chemical features between fld and fed is summarized in table 1 . The renal involvement in fld comparison of clinical and bio - chemical features of fld and fed light microscopic examination of kidney biopsy usually reveals mild mesangium expansion with thickening of gbm, deposition of foamy lipids in the thickened gbm . Careful examination of the biopsy specimen is crucial, as cholesterol deposition may sometimes be focal and can be missed . Reported a case of lcat deficiency wherein the findings were missed in a patient's initial two kidney biopsies and a third kidney biopsy picked up the foam cell deposition in various compartments of kidney tissue . Corneal opacification in lcat deficiency due to phospholipid accumulation usually starts early in life and often is the presenting symptom of this disease . Anemia in these patients is caused by unesterified free cholesterol and phosphatidylcholine deposition in erythrocyte membrane . The disease is to be suspected whenever a young patient with nephrotic syndrome has the following constellation of clinical and biochemical parameters - cloudy cornea, disproportionate anemia (hemolytic), hypertension, dyslipidemia with high triglycerides and extremely low hdl and other findings as mentioned in table 1 . Clinical evaluation and urine examination of other family members are very important as significant phenotypic variations are seen within the same family carrying the same mutation . Classic biopsy findings support the diagnosis . However, definitive diagnosis requires measurement of lcat activity that is generally undetectable in cases of classic lcat deficiency and partially lost in patients with fed though exact cut - off levels are not available . Genetic testing helps in identifying the underlying mutations but is done only in highly specialised labs . Our patient is being conservatively managed with low fat and low salt diet, angiotensin converting enzyme inhibitor and statins . There is a theoretical role of gene therapy or liver transplantation in this disorder but so far they have not been tried . In patients who progress to esrd, renal transplantation is the treatment of choice . Recurrence of the disease in the allografts is known to occur between few months to as late as 42 months posttransplant and progression to esrd is apparently faster than in native kidneys . But the recurrence rate is very unpredictable, and the disorder is not a contraindication for renal transplant . Whether combined liver - kidney transplant will prevent recurrence or not needs to be studied . In the family that we have reported, the proband who was first evaluated satisfied the criteria for classic fld while the patient's sister and mother satisfied the criteria for fed . It is interesting to note that despite being in the same family, (and probably having the same mutation), the clinical presentation and biochemical studies show significant phenotypic variability . We report this case to highlight the importance of taking a detailed family history and doing a thorough physical examination in every case of the nephrotic syndrome . The disease should be suspected when a patient with the nephrotic syndrome has cloudy cornea, disproportionate anemia, very low hdl levels and a positive family history.
The quest for a therapeutic to ameliorate ischemic and traumatic brain injury is certainly a noble ideal, but, thus far, a futile endeavor . In the previous issue of critical care, loetscher and colleagues provided further evidence that the inert, noble gases may have ameliorative properties in the setting of acute neuronal injury . Stimulated by a shared interest in the neuroprotective properties of another noble gas, xenon [2 - 4], they have shifted their focus to argon, a gas that is more abundant and cheaper to obtain . In their current investigation, they demonstrate that argon is neuroprotective when applied after an oxygen - glucose deprivation (ogd) or traumatic injury in organotypic hippocampal slice cultures in vitro . The models the authors employ are robust; the cultured slices have intact synaptic networks, replicating the in vivo setting well; ogd is a well - described simulation of ischemic brain injury; similarly, the trauma model replicates the clinical situation . Loetscher and colleagues report a dose - responsive neuroprotective effect, with 50% argon appearing to be the optimal concentration for neuroprotection . Furthermore, argon was even neuroprotective when administered 3 hours after the injury . Although this report used only in vitro models, it is a foundation on which to base further studies that may further reveal argon's potential in a field largely bereft of interventions to improve neurological outcome from ischemic or traumatic brain injury . We recently reported that argon (75%) prevented neuronal injury from ogd in vitro but that the protection afforded was inferior to that of xenon . Xenon has been shown to be neuroprotective in multiple models and species and has now entered clinical trials for neonatal hypoxic - ischemic brain injury (tobyxe; nct00934700). If argon is also to be exploited clinically, it too must undergo rigorous examination in different animal models, species, laboratories, and clinically relevant injury settings . While at this stage argon fulfills some criteria, it would be imprudent, in the absence of in vivo data, to hail argon as the elusive neuroprotective agent . Why has there been a cascade of studies exploring the clinical utility of noble gases [1 - 5, 7,8]? Helium, neon, argon, krypton and xenon, the first five noble gases in the periodic table, contain a full outer shell of electrons, precluding the formation of covalent bonds under biological conditions; thus, they are chemically inert . Due to the uncharged and non - polar nature of their chemical composition, these gases are able to easily partition into the brain and are able to fit snugly into amphiphilic binding cavities within proteins . Depending on the properties of the surrounding electrons, some of the noble gases can create an instantaneous dipole in the atom from a charged binding site, thereby promoting a biological effect, including induction of anesthesia . Neon and helium are thought to create an unfavorable balance between binding energies and repulsive forces and therefore do not produce anesthesia and other biological effects . In the case of xenon, there are several candidate molecules that may be capable of producing the cytoprotective properties, including the nmda (n - methyld- aspartic acid) subtype of the glutamate receptor, the atp - sensitive potassium channel, the two - pore potassium channel, and an as - yet - unidentified protein that is upstream of mtor (mammalian target of rapamycin). A reduced ability to form induced dipoles with argon (due to its smaller size) may limit the number of available protein - binding sites when compared with xenon . Indeed, there are important pharmacodynamic differences between xenon and argon; in particular, xenon is an anesthetic at atmospheric pressure, argon is not . Nonetheless, argon's lack of sedative properties may actually be beneficial as it allows administration to patients with acute, focal neurological injury (such as stroke), who would not necessarily benefit from sedation . Xenon's cost necessitates administration through cumbersome recirculating and recycling systems; argon is substantially cheaper and thus may be feasibly administered through open circuits . However, a decade of investigation of the effects of xenon has led to a clinical trial that may yet change clinical care of perinatal asphyxia . The findings of loetscher and colleagues should encourage the pursuit of argon as a neuroprotective alternative / supplement to xenon . Mm has received consultancy fees and funding from air products (allentown, pa, usa) and air liquide sant international (paris, france) concerning the development of clinical applications for medical gases, including xenon . Rds has received consultancy fees from air liquide sant international concerning the development of clinical applications for xenon.
Design and use of oligomers for pcr and hybridization is a common practice in molecular biology . The other possibility is a de novo design, using one of the numerous stand - alone softwares or web tools, such as primers 3 (1), primique (2) and oligo 7 (3). In many cases, primers specific for group of sequences are looked for, while related (similar) nontarget sequences should not be recognized . Some design softwares consider such nontarget sequences, but only check for exact matches, or simply use blast to estimate specificity . The problem is that some mismatches do not significantly decrease the melting temperature (tm) resulting in specificity problems . Also, the goal is to calculate and compare the theoretical tm for every sequence including nonperfect matches . Finally, in the presence of many primers and sequences, the end result presented as a text file can be very difficult to analyze . Oligoheatmap (ohm) not only provides such complete text files of tm values and additional information, but also graphical representations that are easier to analyze . The main window contains four frames: one to load oligomers, one to load aligned sequences, one for providing chemical options and one for outputs . The tm is calculated using the nearest - neighbor method and the thermodynamic data published by santalucia et al . The salt correction method used is based on wetmur (7). Because the goal of ohm is to compare oligomers and not to precisely calculate tm, users are encouraged to have other estimation of tm by using tools like melting (8), oligocalc (9) or dnamate (10), since different methods or tools can result in significant differences in the estimates of the tm of the duplex (11,12). Sequence(s) of oligonucleotide(s) is the only required input, either through manual input or through upload of a file (clustal, fasta, mase or tabulated format). A set of aligned sequences can also be provided (manual entry or file upload), in this case at least one sequence should contain the primer(s). Sequences have to be aligned because ohm extracts and compares the areas of hybridization (see the online help for more information on how to align sequences). If no sequence is provided, calculated tm will be only for self - hybridization (dimers of primers) and invert - complement (primer on target). Results are available under two forms: view alignments: a display of information related to the position of each oligomer within the data set of aligned sequences (if provided) as well as information for any possible amplicon.view tm: a display of information concerning the tm of each oligomer on each sequence, as well as images showing how each oligomer will hybridize on each sequence of the alignement . View alignments: a display of information related to the position of each oligomer within the data set of aligned sequences (if provided) as well as information for any possible amplicon . View tm: a display of information concerning the tm of each oligomer on each sequence, as well as images showing how each oligomer will hybridize on each sequence of the alignement . Primers are shown in the order they were loaded or can be sorted by positions (figure 1, bottom). Other data are the date of analysis, exact locations of primers along sequences, primers not found in aligned sequences (if any). A series of files can also be downloaded: download html page and download gif file are the two files that save results described earlier . Alternatively, the entire web page can be saved.extract hybridization areas (fasta) and extract hybridization areas (gif) will work for a primer selected from a dropdown list (selected primer 1). This will produce a fasta file or an image with the primer sequence, the corresponding domain in each sequence and a number (adjustable) of additional nucleotides to display at both ends . This is very useful to rapidly check that sequences are well aligned at each primer location.extract pcr product provides a fasta file corresponding to the pcr product generated by a couple of primers selected using the drop down lists; it contains products for every sequence contained in the alignment . The selection of a couple of primers is facilitated as their positions in sequences are visible on screen . Useful for a rapid analysis of pcr product size and possible differences in length and composition . Figure 1.analysis of primers found in papers for the amplification of the dota gene in bacteria legionella pneumophila (pubmed pmids: 11914343, 11927981, 12962307, 14563861, 7891566, 16000746, 16495539). Top, from left to right, the phylogenetic tree obtained using aligned dota sequences (identified by accession numbers), the heat map (primers in columns, identified by numbers), list of primers, correspondence between colours and predicted tm . For example, we can clearly see that primer 9 (df_18) is specific of upper clade . The bottom of this figure shows an image generated with ohm and imported in treedyn (primers location with their strands and orientations along a consensus of sequences used in this example). Download html page and download gif file are the two files that save results described earlier . Extract hybridization areas (fasta) and extract hybridization areas (gif) will work for a primer selected from a dropdown list (selected primer 1). This will produce a fasta file or an image with the primer sequence, the corresponding domain in each sequence and a number (adjustable) of additional nucleotides to display at both ends . This is very useful to rapidly check that sequences are well aligned at each primer location . Extract pcr product provides a fasta file corresponding to the pcr product generated by a couple of primers selected using the drop down lists; it contains products for every sequence contained in the alignment . The selection of a couple of primers is facilitated as their positions in sequences are visible on screen . Useful for a rapid analysis of pcr product size and possible differences in length and composition . Analysis of primers found in papers for the amplification of the dota gene in bacteria legionella pneumophila (pubmed pmids: 11914343, 11927981, 12962307, 14563861, 7891566, 16000746, 16495539). Top, from left to right, the phylogenetic tree obtained using aligned dota sequences (identified by accession numbers), the heat map (primers in columns, identified by numbers), list of primers, correspondence between colours and predicted tm . For example, we can clearly see that primer 9 (df_18) is specific of upper clade . The bottom of this figure shows an image generated with ohm and imported in treedyn (primers location with their strands and orientations along a consensus of sequences used in this example). Results provided are thermodynamic values (enthalpy, entropy and melting temperature) for each oligomer on each sequence (including mismatches). A graphical representation of hybridization appears on screen when the cursor is moved over a sequence . R, if present, means that the oligomer was found as invert - complement . The following files can be downloaded: excel or text file: these files provide the predicted tm of each oligomer on each sequence.map of temperatures: an image file that displays, for each oligomer and each sequence, the predicted tm as color - coded squares (i.e. A heat map).matches: a file that provides an overview of results, easy to use for designing degenerated primers when necessary . For any given primer, it shows how many degenerated positions are necessary to match every sequence, as well as how many sequences match each of these modified oligomers.treedyn files: one of the goal of ohm is to provide an easy overview of how each primer hybridizes to each sequence of a data set . Representation of these sequences as a phylogenetic tree is useful, since hybridization is often required for a clade but not for related clades (gene families, pathogenic bacteria, etc . ). Treedyn, a powerful tree editor (13) has been modified to take annotation files produced by ohm . These annotations include the computed tm as color squares (from yellow for high tm to blue for low tm) as shown in figure 1 . Excel or text file: these files provide the predicted tm of each oligomer on each sequence . Map of temperatures: an image file that displays, for each oligomer and each sequence, the predicted tm as color - coded squares (i.e. A heat map). Matches: a file that provides an overview of results, easy to use for designing degenerated primers when necessary . For any given primer, it shows how many degenerated positions are necessary to match every sequence, as well as how many sequences match each of these modified oligomers . Treedyn files: one of the goal of ohm is to provide an easy overview of how each primer hybridizes to each sequence of a data set . Representation of these sequences as a phylogenetic tree is useful, since hybridization is often required for a clade but not for related clades (gene families, pathogenic bacteria, etc . ). Treedyn, a powerful tree editor (13) has been modified to take annotation files produced by ohm . These annotations include the computed tm as color squares (from yellow for high tm to blue for low tm) as shown in figure 1 . This output displays oligomer's locations and strand orientations according to the alignment provided . Primers are shown in the order they were loaded or can be sorted by positions (figure 1, bottom). Other data are the date of analysis, exact locations of primers along sequences, primers not found in aligned sequences (if any). A series of files can also be downloaded: download html page and download gif file are the two files that save results described earlier . Alternatively, the entire web page can be saved.extract hybridization areas (fasta) and extract hybridization areas (gif) will work for a primer selected from a dropdown list (selected primer 1). This will produce a fasta file or an image with the primer sequence, the corresponding domain in each sequence and a number (adjustable) of additional nucleotides to display at both ends . This is very useful to rapidly check that sequences are well aligned at each primer location.extract pcr product provides a fasta file corresponding to the pcr product generated by a couple of primers selected using the drop down lists; it contains products for every sequence contained in the alignment . The selection of a couple of primers is facilitated as their positions in sequences are visible on screen . Useful for a rapid analysis of pcr product size and possible differences in length and composition . Figure 1.analysis of primers found in papers for the amplification of the dota gene in bacteria legionella pneumophila (pubmed pmids: 11914343, 11927981, 12962307, 14563861, 7891566, 16000746, 16495539). Top, from left to right, the phylogenetic tree obtained using aligned dota sequences (identified by accession numbers), the heat map (primers in columns, identified by numbers), list of primers, correspondence between colours and predicted tm . For example, we can clearly see that primer 9 (df_18) is specific of upper clade . The bottom of this figure shows an image generated with ohm and imported in treedyn (primers location with their strands and orientations along a consensus of sequences used in this example). Download html page and download gif file are the two files that save results described earlier . Extract hybridization areas (fasta) and extract hybridization areas (gif) will work for a primer selected from a dropdown list (selected primer 1). This will produce a fasta file or an image with the primer sequence, the corresponding domain in each sequence and a number (adjustable) of additional nucleotides to display at both ends . This is very useful to rapidly check that sequences are well aligned at each primer location . Extract pcr product provides a fasta file corresponding to the pcr product generated by a couple of primers selected using the drop down lists; it contains products for every sequence contained in the alignment . The selection of a couple of primers is facilitated as their positions in sequences are visible on screen . Useful for a rapid analysis of pcr product size and possible differences in length and composition . Analysis of primers found in papers for the amplification of the dota gene in bacteria legionella pneumophila (pubmed pmids: 11914343, 11927981, 12962307, 14563861, 7891566, 16000746, 16495539). Top, from left to right, the phylogenetic tree obtained using aligned dota sequences (identified by accession numbers), the heat map (primers in columns, identified by numbers), list of primers, correspondence between colours and predicted tm . Grey squares when the predicted tm is below 48c . Note that none of these published primers will well amplify every sequence . For example, we can clearly see that primer 9 (df_18) is specific of upper clade . The bottom of this figure shows an image generated with ohm and imported in treedyn (primers location with their strands and orientations along a consensus of sequences used in this example). Results provided are thermodynamic values (enthalpy, entropy and melting temperature) for each oligomer on each sequence (including mismatches). A graphical representation of hybridization appears on screen when the cursor is moved over a sequence . R, if present, means that the oligomer was found as invert - complement . The following files can be downloaded: excel or text file: these files provide the predicted tm of each oligomer on each sequence.map of temperatures: an image file that displays, for each oligomer and each sequence, the predicted tm as color - coded squares (i.e. A heat map).matches: a file that provides an overview of results, easy to use for designing degenerated primers when necessary . For any given primer, it shows how many degenerated positions are necessary to match every sequence, as well as how many sequences match each of these modified oligomers.treedyn files: one of the goal of ohm is to provide an easy overview of how each primer hybridizes to each sequence of a data set . Representation of these sequences as a phylogenetic tree is useful, since hybridization is often required for a clade but not for related clades (gene families, pathogenic bacteria, etc . ). Treedyn, a powerful tree editor (13) has been modified to take annotation files produced by ohm . These annotations include the computed tm as color squares (from yellow for high tm to blue for low tm) as shown in figure 1 . Excel or text file: these files provide the predicted tm of each oligomer on each sequence . Map of temperatures: an image file that displays, for each oligomer and each sequence, the predicted tm as color - coded squares (i.e. A heat map). Matches: a file that provides an overview of results, easy to use for designing degenerated primers when necessary . For any given primer, it shows how many degenerated positions are necessary to match every sequence, as well as how many sequences match each of these modified oligomers . Treedyn files: one of the goal of ohm is to provide an easy overview of how each primer hybridizes to each sequence of a data set . Representation of these sequences as a phylogenetic tree is useful, since hybridization is often required for a clade but not for related clades (gene families, pathogenic bacteria, etc . ). Treedyn, a powerful tree editor (13) has been modified to take annotation files produced by ohm . These annotations include the computed tm as color squares (from yellow for high tm to blue for low tm) as shown in figure 1 . Ohm is running since september 2007 and used within the framework of a european project . Most of computing is done by the computer of the client (via javascript), this server can support many users at the same time . Local install is possible since sources are available for download (see link in help). An online help is provided (http://bioinfo.unice.fr/softwares/ohm/help/help.html), it contains tutorials and examples of use . A demonstration data set is also available from the main ohm page (http://bioinfo.unice.fr/ohm, click on the data test link to directly import sequences in ohm). This software has already been used and results have been experimentaly checked (primers for specific amplification of 16s rrna gene sequences of some bacterial species).
More detail on the design of the underlying effectiveness trial and its clinical outcomes can be found in a companion publication11 and at http://clinicaltrials.gov/ct2/show/nct00718796 . In brief, the trial recruited workers aged 25 to 65 years, with a current primary care physician from three canada post corporation worksites (edmonton, toronto, and vancouver). Then, 246 of those with the highest risk consented to be randomized to either enhanced usual care (euc: three 1-hour biometric screening and data collection visits) or naturopathic care plus euc (nc+euc; the above plus an individualized mix of lifestyle counseling and nutritional and botanical medicine offered during the data collection visits plus up to four additional 30-minute visits over the year). Both groups received care in an on - site clinic from licensed naturopathic doctors, and were asked to continue to see their family physician as needed for their general health care needs . After consent to the trial and before randomization, participants were asked to provide separate informed consent to have their sick leave and medical claims data extracted from company databases . This economic evaluation is based on the subset of patients who provided this consent and these data . The study was approved by the research ethics board of the canadian college of naturopathic medicine . The collection of biometric and self - report data occurred at baseline and 6 and 12 months . The medical claims and sick leave data for each participant were extracted at study end for the period 6 months before baseline through the full study year . The claims data covered prescription medications and visits to chiropractors, physiotherapists, massage therapists, and acupuncturists, and included the total dollar amounts of the claims submitted and paid . Participants reported on visits to their conventional doctors (covered by provincial insurance) and their use of natural health products (nhps) on a cost questionnaire . Presenteeism (ie, productivity while at work) was captured using the health and performance questionnaire.12 quality - adjusted life years (qalys) were calculated on the basis of sf-6d scores.13 costs are reported in 2008 canadian dollars . Unit costs for health care utilization and productivity losses are shown in table 1 . Laboratory costs for the biometric screenings were identical between groups and ignored in this analysis . Nhp costs were obtained from on - line sites such as drugstore.com . * average of range of $125 to $180 per hour from the canadian association of naturopathic doctors web site (http://www.cand.ca/index.php?39), accessed on - line september 10, 2010 . Personal telephone communications on august 30 and september 10, 2010, with representative of total wellness, a large company providing biometric screening in the united states and canada . Cost of a repeat consultation (a006) from the schedule of benefits for physician services, ontario health insurance program (http://health.gov.on.ca/english/providers/program/ohip/sob/physserv/a_consul.pdf), accessed on - line september 10, 2010 . Average employee cost (salary and 20% benefits) per hour provided by canada post . Cost - effectiveness is calculated from the societal and employer perspectives . Effectiveness for both perspectives is measured in terms of qaly gains over the 1-year study period and reductions in 10-year cvd event and mortality risk . Quality - adjusted life years are calculated as the area under the sf-6d score curve over the year . Individuals' 10-year cvd event risk was calculated using an algorithm on the basis of sex, age, total cholesterol, high - density lipoprotein cholesterol, systolic blood pressure, hypertension medication use, smoking status, and diabetes diagnosis.14 the 10-year risk of cvd death used a different algorithm with the same variables.15 because of the 1-year timeframe of the study, neither costs nor effects are discounted . This analysis follows intent - to - treat principles . Missing self - report and biometric data were handled using multiple imputation methods.16,17 because cost data tend to be highly skewed, bias - corrected and accelerated bootstrap estimates are used to determine confidence intervals for costs (1000 replications).18,19 the bootstrapped societal cost cvd risk pairs are also shown on a cost - effectiveness plane.20 univariate sensitivity analyses were conducted to examine the effects of missing data imputation, including participants with different baseline cvd risks (low risk versus moderate / high risk), and including actual rather than allowed visits . Baseline between - group differences were analyzed using t tests (continuous variables) and chi - squared tests (frequencies). All calculations used excel 2007 sp2 (microsoft corporation, redmond, wa) or spss statistics 17.0 (spss, inc ., chicago, il). Approximately 400 workers with the highest cvd risk were contacted after screening and 246 consented to the effectiveness trial . This economic evaluation is limited to the 156 of these (77 or 63.1% of those randomized to the euc group and 79 or 63.7% of those randomized to the nc+euc group) who also consented to having their medical claims and sick leave data accessed . When those who did and did not consent to these data were compared, no statistically significant differences were found across baseline characteristics, outcomes, or tendency to miss study visits . Only two comparisons (out of the 44 tested) had p values of less than 0.05 . At baseline, almost twice as many participants in the nc+euc group were taking hypertensive medications (p = 0.050) and had had a visit with their physician in the past month (p = 0.022). Nevertheless, given the number of comparisons, these unadjusted p values are not indicative of statistical significance . Flow of participants through the study . * average score from the health and performance questionnaire item asking how productive a participant was while at work in past month on a scale ranging from 0 to 10 . Values reported represent the mean number of visits per participant after the number of participants reporting visits (n). Resource use over the study year for each group (net of baseline use) and health - related quality - of - life scores are shown in table 3 . The intervention hours for both groups do not include study protocol time (eg, time used to consent participants, explain the study, and collect self - report study data), do not include the 12-month visit (which did not affect 12-month study outcomes), and include time to collect and explain biometric screening data to participants (20 minutes per screening times two visits). The main differences seen between groups in resource use other than intervention costs were reductions in conventional doctor visits (4 fewer visits over the year, 95% confidence interval: 1.3 to 7.0) and in hours lost to presenteeism (55 fewer hours lost, not statistically significant) for the nc+euc group . * bias - corrected and accelerated bootstrap 95% confidence interval . Standard error - based 95% confidence interval adjusted for missing data imputation estimate variance . The mean incremental cost of naturopathic care to society is $1138 (ie, a net saving of $1138 compared to euc alone) per participant (table 4). As can be seen in tables 3 and 4, a vast majority of the cost savings are attributable to reductions in productivity losses, specifically losses because of reduced productivity while at work (presenteeism). Naturopathic care also results in a net saving of $1187 to employers per participant, assuming that the employer pays the full cost of naturopathic care and would have paid for the biometric screenings . These cost savings are associated with significant reductions in cvd disease and mortality risk . Cardiovascular disease event risk over the next 10 years was reduced by 3.3 percentage points (ie, 3.3 fewer workers out of 100 expected to have a cvd event; number needed to treat = 30) and cvd mortality risk by 0.9 percentage points (ie, almost one fewer worker out of 100 dying of cvd in the next 10 years). Figure 2 shows the cost cvd event risk reduction plane for the societal perspective . Across the 1000 bootstrapped societal cost cvd risk estimate pairs, all show a reduction in cvd risk and 85% show cost savings . * all confidence intervals for costs are bias - corrected and accelerated bootstrap generated 95% confidence intervals . Total employer costs are calculated as the sum of lost productivity costs, other (ie, chiropractic, physical therapy, massage, and acupuncture) visit costs and medication costs paid by the employer, and depending on group assignment, the cost of naturopathic care or biometric screening . These values represent percentage point changes of risk (ie, changes in absolute risk). The similarity of the first two columns in the sensitivity analysis results (table 5) indicates the success of the missing data imputation methods used . The last two columns show the results of the analyses by baseline cvd event risk . Overall, both average incremental costs and risk reductions are higher for the moderate / high - risk participants . Incremental direct costs for moderate / high - risk participants are lower than for low - risk participants (mainly because of reductions in conventional doctor visits), but the difference in lost productivity costs more than offsets this . The average reduction in productivity losses in the treatment group is similar no matter what the baseline risk level (an average reduction of $1296 per participant for low - risk participants and $1417 for moderate - to - high risk). Nevertheless, low - risk participants in the control group had an average increase of $1165 per participant in lost productivity and moderate - to - high risk participants had an average reduction of $1612 . * all confidence intervals for costs are bias - corrected and accelerated bootstrap generated 95% confidence intervals . All health outcome confidence intervals are standard error - based 95% confidence intervals . Both types of confidence intervals are adjusted for missing data imputation estimate variance . All cost and health outcome estimates are incremental (ie, nc+euc values minus euc values). These values represent percentage point changes of risk (ie, changes in absolute risk). Cvd, cardiovascular disease; euc, enhanced usual care; nc, naturopathic care . The cvd event risk reductions for moderate - to - high risk participants are substantially higher (number needed to treat = 18) than for low - risk participants (number needed to treat = 60) and the base case . Nevertheless, there is no real difference in qalys across risk groups . Because participants generally attended all their visits, using actual visits rather than the total number allowed (which was done here) did not appreciably change base case results . On average both the nc+euc and the euc groups attended 1.86 of their two allowed data collection visits, and the nc+euc group attended on average 3.30 of their allowed four additional visits . The similarity of the first two columns in the sensitivity analysis results (table 5) indicates the success of the missing data imputation methods used . The last two columns show the results of the analyses by baseline cvd event risk . Overall, both average incremental costs and risk reductions are higher for the moderate / high - risk participants . Incremental direct costs for moderate / high - risk participants are lower than for low - risk participants (mainly because of reductions in conventional doctor visits), but the difference in lost productivity costs more than offsets this . The average reduction in productivity losses in the treatment group is similar no matter what the baseline risk level (an average reduction of $1296 per participant for low - risk participants and $1417 for moderate - to - high risk). Nevertheless, low - risk participants in the control group had an average increase of $1165 per participant in lost productivity and moderate - to - high risk participants had an average reduction of $1612 . * all confidence intervals for costs all cost and health outcome estimates are incremental (ie, nc+euc values minus euc values). These values represent percentage point changes of risk (ie, changes in absolute risk). Cvd, cardiovascular disease; euc, enhanced usual care; nc, naturopathic care . The cvd event risk reductions for moderate - to - high risk participants are substantially higher (number needed to treat = 18) than for low - risk participants (number needed to treat = 60) and the base case . Nevertheless, there is no real difference in qalys across risk groups . Because participants generally attended all their visits, using actual visits rather than the total number allowed (which was done here) did not appreciably change base case results . On average both the nc+euc and the euc groups attended 1.86 of their two allowed data collection visits, and the nc+euc group attended on average 3.30 of their allowed four additional visits . The addition of naturopathic care to usual care plus biometric screening for this postal worker population results in reductions in cvd risk and in total societal and employer costs . On average this population, whose baseline risk of a cvd event in the next 10 years was just more than 10%, reduced their risk by one third . In addition, the risk of cvd death was reduced by half (average baseline risk was 1.8%). The average reduction in risk was even higher for participants who started the study with a moderate - to - high (10%) cvd event risk . These risk reductions were achieved at a small increase in direct costs, but with substantial decreases in indirect / productivity costs . A recent review of primary prevention interventions for cvd reported 10-year healthy years of life - saved per 100 participants (hyls/100) estimates for aspirin of 9.2 in 50-year - olds with moderate risk of a cvd event and 18.1 for those with high risk.21 for statin therapy these estimates were 10.6 and 20.2 . On the basis of the reductions in cvd risk seen in this study, the addition of naturopathic care to euc resulted in an average of 18.2 hyls/100 across all participants and 30.3 hyls/100 for participants with moderate to high risk . For example, an intervention consisting of biometric screening plus up to 60 minutes per year of telehealth lifestyle counseling for participants with moderate - to - high cvd risk resulted in a risk reduction of 1.8 percentage points compared with usual care alone.22 another study targeted participants with baseline 10-year cvd event risks similar to this study, provided biometric screening to both groups, and used a fairly intensive intervention (1 year of counseling sessions plus group activities focused on physical activity and nutrition).23 it resulted in a 0.3 percentage point reduction in 10-year coronary heart disease risk in low - income women . A 3-year study of diet and exercise for the reduction of cvd risk in moderate - to - high - risk individuals also found no significant change in qalys during the first year, but a significant gain by year 3.24 the naturopathic intervention was more expensive in terms of direct medical costs ($302 per participant more; table 4) than biometric screening alone . Nevertheless, this cost compares favorably to the annual wholesale cost of statin drugs alone which, according to one source, ranges from $347 to $818 in 2006 canadian dollars.25 the impact of naturopathic care on indirect (productivity loss) costs was more dramatic, especially in terms of presenteeism . Other studies have shown that various illnesses can have a larger impact on presenteeism than absenteeism.26 nevertheless, with the focus on reducing future disease risk, the size of the impacts is surprising, but not unprecedented . See, for example, a worksite health promotion study that found similar - sized presenteeism gains ($1364 over a year).27 on average presenteeism improved across the year (lost productivity costs decreased) in the nc+euc group and worsened in the euc group . Nevertheless, sensitivity analyses show that those in the euc group with moderate - to - high baseline cvd risk had a substantial improvement in presenteeism, whereas those with low risk worsened substantially . It is unclear why presenteeism was so different for euc group members with different baseline cvd risks . As discussed previously, changes in health - related quality - of - life were minimal during the study year . One possible explanation is that because all participants were encouraged to share their biometric screening results with their conventional doctors, those in the euc group with moderate - to - high baseline cvd risk may have received more physician attention than those with low risk . The moderate - to - high - risk group did have about four times the number of conventional doctor visits than those with low baseline risk . Those with moderate - to - high risk may also have been more motivated to make improvements in their health, which could improve presenteeism . The cvd event and mortality risk estimates were based on equations developed from the framingham heart study.14,15 the accuracy of these equations has been tested in different populations and found to be fairly high.28 nevertheless, validation in canadian populations is limited.29 although claims data were available for prescription medications and visits to other practitioners, the use of nhps and conventional doctor visits relied on self - report . Similarly, company records of sick leave were available for absenteeism, but presenteeism was self - report . Finally, some of the nhps used in this study were provided to participants at a discount, and those prices paid were used in the cost analysis . Nevertheless, because retail costs for nhps vary widely depending on brand and outlet, these discounted prices were still representative of the full retail price paid for similar products elsewhere . Strengths of the study include the availability of electronic medical claims and sick leave data for the majority of the effectiveness study participants, and the similarity between participants who did and did not consent to these data . Retention of participants was high (91% and 88% of the nc+euc and euc groups, respectively, attended two of three data collection visits), missing data were rigorously addressed, and the intervention was individualized, evidence - based, and could be applied by a wide variety of practitioner types . In conclusion, this pragmatic, multi - worksite randomized trial demonstrates that a naturopathic approach to the primary prevention of cvd has the potential to significantly reduce cvd risk for those with a wide range of baseline risk . These risk reductions come at a small increase in medical costs, but with the potential for substantial improvements in worker productivity . Further research into similar nonpharmacological, whole - person approaches to cvd prevention is justified.
Female nod / ltj and nod.scid mice were obtained from the jackson laboratory (bar harbor, me) and maintained under pathogen - free conditions . Nod mice were screened for hyperglycemia at 12 weeks of age and diagnosed with diabetes when two consecutive glucose levels were> 200 mg / dl (2). Glucose levels were measured in whole blood from the tail vein using a glucometer elite xl (bayer, elkhart, in). Prediabetic nod mice were treated with intradermal phloridzin (phz) injections at 0.4 mg / kg per day for 14 days (15). Glycosuria induced by phz was detected for as long as 9 h after the injection . Diabetic nod mice were treated with 10 g / day intraperitoneally (i.p .) Of the mab 145 - 2c11 (anti - mouse cd3) for 5 days beginning at the onset of hyperglycemia, as previously described (2). Reversal of diabetes was defined when random glucose levels were <200 mg / dl for 2 weeks after diagnosis and persisted for> 10 days . Glucose was injected i.p . At a dose of 4 g / kg per day . Anti - cd3treated mice with reversed hyperglycemia for at least 10 days received daily injections of glucose or vehicle for 14 days . On day 14, mice were subjected to an intraperitoneal glucose tolerance test (ipgtt), and sera and pancreata were collected for additional analysis . In a separate set of experiments, nondiabetic 12- to 14-week - old nod.scid mice and 8- to 10-week - old nod mice were subjected to 14 days of either glucose or vehicle treatment . Whole - blood glucose levels were measured from the tail vein taken before and 15, 30, 60, and, in some experiments, 120 min after the injection . After fixation, pancreatic tissue was placed in a sucrose gradient and snap frozen in liquid nitrogen . Noncontiguous 14-m pancreatic sections were stained with antibodies to insulin (invitrogen, carlsbad, ca), 4,6-diamidine-2-phenylindole dihydrochloride (dapi), cd31 (bd biosciences, san jose, ca), and either ki67 or vegf (abcam, cambridge, ma). The bound antibodies were detected by immunofluorescent secondary antibodies (jackson immunoresearch, west grove, pa). For whole - tissue sections, 5 images were captured using mosaix software (carl zeiss, thornwood, ny). Numbers of single - color and dual - color labeled cells were counted using functions in imagej (colocalization, watershed, and analyze particles). The total pancreatic section area and insulin cells were measure using imagej (16). Insulin concentration was measured on a continuous scale using automated quantitative analysis (aqua), as has been previously described (17). In brief, a series of high - resolution monochromatic images were captured using an automated microscope platform (pm-2000tm; historx, new haven, ct). Fluorescent chromagens (dapi, cy3-insulin) were used to demarcate insulin cells within each whole - section image . Dapi staining of cell nuclei was used to generate the nuclear compartment . Subtracting the generated nuclear compartment from the masked cell area created a nonnuclear compartment, which included both the cytoplasm and the membrane . To generate an aqua score, each pixel was recorded on a scale of 0 (black) to 255 (white), and pixel intensity was defined using the following equation: (target pixel intensity) (compartment pixel intensity/255). Using the target and compartment pixel intensities, the following equation was generated: (sum of all target pixel intensities)/(sum of all compartment pixel intensities/255) = the aqua score . All scores are normalized for image - exposure time and bit depth, allowing direct comparison of different histospot / whole - section scores . Islets were isolated from nod or nod.scid mice after digestion with collagenase (liberase; roche, indianapolis, in) (18). Islets were handpicked twice with an inverted microscope . To examine the effects of increasing glucose concentrations on vegf expression, islets were cultured in 10% fetal calf serum glucose - free rpmi (mediatech, manassas, va) supplemented with indicated glucose concentrations for 24 h. in some experiments, preconditioned islet culture media was collected and added to cultures of freshly isolated nod.scid islets . After incubation, islets were harvested and total rna was extracted using an rnaeasy kit according to the manufacturer s protocol (qiagen, valencia, ca). Purified islets from either nod or nod.scid donors were incubated with 5 or 10 mmol / l glucose for 7 days and then dispersed using trypsin digestion . We used bs-1 rather than cd31 for identification of endothelial cells because of cd31 sensitivity to trypsin digestion . Examination of vegf-120, vegf-164, and vegf-188 levels was quantitated by real - time pcr using sybr green (qiagen, valencia, ca) on the iq-5 multicolor real - time pcr system (bio - rad, hercules, ca). Pcr primer pairs were as follows: gapdh: forward ctgcaccaccaactgcttag, reverse gatggcatggactgtggtcat; and vegf: exon 3 common forward primer atcttcaagccgtcctgtgtgc, 120 reverse ttggcttgtcacatttttctgg, 164 reverse caaggctcacagtgattttctgg, and 188 reverse atcttcaagccgtcctgtgtgc . Prediabetic nod mice were treated with intradermal phloridzin (phz) injections at 0.4 mg / kg per day for 14 days (15). Glycosuria induced by phz was detected for as long as 9 h after the injection . Diabetic nod mice were treated with 10 g / day intraperitoneally (i.p .) Of the mab 145 - 2c11 (anti - mouse cd3) for 5 days beginning at the onset of hyperglycemia, as previously described (2). Reversal of diabetes was defined when random glucose levels were <200 mg / dl for 2 weeks after diagnosis and persisted for> 10 days . Glucose was injected i.p . At a dose of 4 g / kg per day . Anti - cd3treated mice with reversed hyperglycemia for at least 10 days received daily injections of glucose or vehicle for 14 days . On day 14, mice were subjected to an intraperitoneal glucose tolerance test (ipgtt), and sera and pancreata were collected for additional analysis . In a separate set of experiments, nondiabetic 12- to 14-week - old nod.scid mice and 8- to 10-week - old nod mice were subjected to 14 days of either glucose or vehicle treatment . Mice undergoing an ipgtt were fasted overnight . They received a 2 g / kg i.p . Whole - blood glucose levels were measured from the tail vein taken before and 15, 30, 60, and, in some experiments, 120 min after the injection . Noncontiguous 14-m pancreatic sections were stained with antibodies to insulin (invitrogen, carlsbad, ca), 4,6-diamidine-2-phenylindole dihydrochloride (dapi), cd31 (bd biosciences, san jose, ca), and either ki67 or vegf (abcam, cambridge, ma). The bound antibodies were detected by immunofluorescent secondary antibodies (jackson immunoresearch, west grove, pa). For whole - tissue sections, 5 images were captured using mosaix software (carl zeiss, thornwood, ny). Numbers of single - color and dual - color labeled cells were counted using functions in imagej (colocalization, watershed, and analyze particles). The total pancreatic section area and insulin cells were measure using imagej (16). Insulin concentration was measured on a continuous scale using automated quantitative analysis (aqua), as has been previously described (17). In brief, a series of high - resolution monochromatic images were captured using an automated microscope platform (pm-2000tm; historx, new haven, ct). Fluorescent chromagens (dapi, cy3-insulin) were used to demarcate insulin cells within each whole - section image . Dapi staining of cell nuclei was used to generate the nuclear compartment . Subtracting the generated nuclear compartment from the masked cell area created a nonnuclear compartment, which included both the cytoplasm and the membrane . To generate an aqua score, each pixel was recorded on a scale of 0 (black) to 255 (white), and pixel intensity was defined using the following equation: (target pixel intensity) (compartment pixel intensity/255). Using the target and compartment pixel intensities, the following equation was generated: (sum of all target pixel intensities)/(sum of all compartment pixel intensities/255) = the aqua score . All scores are normalized for image - exposure time and bit depth, allowing direct comparison of different histospot / whole - section scores . Islets were isolated from nod or nod.scid mice after digestion with collagenase (liberase; roche, indianapolis, in) (18). Islets were handpicked twice with an inverted microscope . To examine the effects of increasing glucose concentrations on vegf expression, islets were cultured in 10% fetal calf serum glucose - free rpmi (mediatech, manassas, va) supplemented with indicated glucose concentrations for 24 h. in some experiments, preconditioned islet culture media was collected and added to cultures of freshly isolated nod.scid islets . After incubation, islets were harvested and total rna was extracted using an rnaeasy kit according to the manufacturer s protocol (qiagen, valencia, ca). Purified islets from either nod or nod.scid donors were incubated with 5 or 10 mmol / l glucose for 7 days and then dispersed using trypsin digestion . We used bs-1 rather than cd31 for identification of endothelial cells because of cd31 sensitivity to trypsin digestion . Examination of vegf-120, vegf-164, and vegf-188 levels was quantitated by real - time pcr using sybr green (qiagen, valencia, ca) on the iq-5 multicolor real - time pcr system (bio - rad, hercules, ca). Pcr primer pairs were as follows: gapdh: forward ctgcaccaccaactgcttag, reverse gatggcatggactgtggtcat; and vegf: exon 3 common forward primer atcttcaagccgtcctgtgtgc, 120 reverse ttggcttgtcacatttttctgg, 164 reverse caaggctcacagtgattttctgg, and 188 reverse atcttcaagccgtcctgtgtgc . Examination of prediabetic mice showed impaired glucose tolerance in 13-week - old nod mice when compared with 9-week - old nod mice (fig . 1a; area under the curve at 9 weeks = 8,702 vs. at 13 weeks = 11,195; p <0.05). Previous studies have described a decline in islet vascular area in nod mice during the progression of diabetes (9), but the relationship between these changes and the impairment of glucose tolerance in nod mice has not been directly evaluated . We therefore studied the islet vascular area in prediabetic mice and after recovery from hyperglycemia in diabetic nod mice that were treated with anti - cd3 mabs . Reduced cd31 area was evident as early as 9 weeks of age when compared with nonautoimmune nod.scid animals (fig . Although there was not a direct relationship between changes in glucose tolerance and islet vasculature during prediabetes, there was a sharp decline in cd31 area in the islets at the time of diabetes onset (fig . Anti - cd3treated diabetic nod mice fail to normalize their ipgtts and endothelial cell area in the islet . A: ipgtts of prediabetic mice at the ages of 9, 11, and 13 weeks (n = 5 each group) and after anti - cd3 treatment (n = 12). B: quantitative histomorphic analysis of cd31 in pancreatic sections (n = 3 and four mice of islets from prediabetic, diabetic, and anti - cd3treated nod mice and n = 3 and four mice at each time point) (mean se). The cd31 area in the islets was compared with the same in nonautoimmune nod.scid mice by anova (top line, p <0.0001) and by the dunnett multiple comparison test (* p <0.05; * * * p <0.001) and with mice with new - onset diabetes (bottom line, anova p <0.0001 and * * p <0.01; * * * p <0.001). C: immunofluoresence staining samples of representative islets from 13-week - old nonautoimmune nod.scid mice, prediabetic nod mice, and nod mice with new - onset diabetes . Blue, dapi; red, insulin; green, cd31 . (a high - quality digital representation of this figure is available in the online issue .) Next, we treated newly diabetic nod mice with anti - cd3 mabs and found that the nonfasting glucose levels returned to nondiabetic levels of <200 mg / dl for a period> 2 consecutive weeks (154.9 8.2 mg / dl). However, when challenged with an ipgtt, these mice showed glucose intolerance when compared with 9-week - old nod mice (fig . 1a; area under the curve at 9 weeks = 8,702 vs. anti - cd3treated = 16,578; p <0.0001). In addition, the endothelial cell density was not normalized after anti - cd3 mab therapy and remained significantly reduced when compared with nod.scid or 9-week - old nod mice (fig . These results show a loss of endothelial cells in the islet during prediabetes that is concomitant with deterioration of glucose tolerance, both of which are not fully corrected following anti - cd3 treatment . To determine the relationship between changes in glucose and the cd31 cell density, we treated prediabetic nod mice with normal (8 weeks old) or impaired (12 weeks old) results from the ipgtt with daily injections of phz for a period of 14 days . First, we tested phz effects on glucose load in normoglycemic balb / c during the ipgtt . Phz injection increased clearance of blood glucose, as indicated by a more rapid return to baseline glucose levels (supplementary fig . Daily phz injections of 12-week - old nod mice reduced endothelial cell density when compared with vehicle - treated mice (fig . Interestingly, phz also decreased the rates of -cell proliferation (table 1 and supplementary fig . 3), which is consistent with the previously described effects of glucose on -cell proliferation in prediabetic mice (13). In contrast, phz treatment of 8-week - old nod mice, with normal ipgtt results, did not reduce endothelial cell density (fig . Histomorphic analysis of pancreata (n 3 per group) cd31 area in 8-week - old (a) and 12-week - old (b) prediabetic nod mice after daily injections of phz for a period of 14 days (* p <0.04). C: endothelial cell area in diabetic and anti - cd3treated nod mice receiving either vehicle or glucose injections for 14 days . D: as in c but with immunodeficient nod.scid mice . * p <0.05; * * p <0.001 . Proliferation levels in islets of prediabetic and anti - cd3treated mice data are means se . We also tested whether an increase in glucose in mice with impaired glucose tolerance would have the opposite effect . Recovered anti - cd3treated nod mice showing a minimum of 10 consecutive days of basal euglycemia received daily injections of glucose (4 mg / kg i.p .) For 14 days . Glucose injections significantly increased endothelial cell density to a density similar in prediabetic nod mice when compared with vehicle - treated controls (fig . In contrast, similar treatment of nod.scid mice with daily glucose injections failed to increase endothelial cell density in islets (fig . These data suggest that fluctuation in daily glucose may modulate endothelial cell density under the conditions of islet inflammation . Next, we tested the physiological consequences of increased endothelial cell density in glucose - treated anti - cd3treated nod mice . Interestingly, despite the presence of impaired glucose tolerance before treatment, glucose - treated anti - cd3 mice showed improved ipgtt results when compared with vehicle - treated mice (fig . 3a and b; p <0.05). Fasting insulin levels in glucose - treated mice were higher than in placebo - treated mice (vehicle = 0.61 ng / ml vs. glucose = 0.90 ng / ml; p <0.06); however, no increase in -cell mass was detected (fig . 3c). Therefore, to examine the effect of glucose on insulin content in individual -cells, we used the aqua score to measure the content of insulin . The aqua score has been validated for protein quantization in histological section of malignant tissues in which good reproducibility and linearity with protein content of tissues has been validated (1823). Aqua score analysis revealed increased levels of insulin staining per -cell in glucose - treated mice (fig . Glucose treatment of anti - cd3treated mice did not increase -cell proliferation, albeit proliferation was at relatively high levels in both vehicle- and glucose - treated mice (table 1).these results suggest that increased islet endothelial cell density may promote -cell function by increasing insulin content rather than -cell proliferation after treatment with anti - cd3 antibodies . Daily glucose injections improve glucose tolerance and increase insulin content in anti - cd3treated nod mice . A: representative ipgtts of anti - cd3treated mice with normal basal glucose levels receiving daily injections of either vehicle (left panel) or glucose (right panel) intraperitoneally (, pretreatment;, posttreatment). B: summary of changes in ipgtt results of anti - cd3treated diabetic mice with normal basal glucose levels after a 14-day challenge of daily injections of either glucose or vehicle . * p <0.04 (n = 12 per group). Stained pancreatic section of vehicle- and glucose - treated mice for insulin cells . D: aqua scores of insulin levels per -cell as described in research design and methods . * p <0.03 . Ins, insulin . To understand the basis for increased endothelial cell density after glucose treatment, we measured vegf production in the islets of glucose - treated anti - cd3treated mice by histomorphic analysis . Preliminary immunofluorescence staining revealed an increase in vegf levels in prediabetic nod islets compared with nod.scid islets (supplementary fig ., daily glucose injections resulted in increased vegf expression in the islets when compared with vehicle - treated mice (fig . 4a; p <0.02), suggesting that vegf production by resident or infiltrating islet cells can promote islets in response to glucose . To directly examine the effects of glucose on endothelial cell numbers, we incubated purified islets from either nod or nod.scid donors at either 5 mmol / l or 10 mmol / l glucose for 7 days followed by fluorescence - activated cell sorter analysis of bs-1 endothelial cells . Nod islets incubated at 10 mmol / l glucose showed better maintenance of endothelial cells when compared with islets incubated at 5 mmol, high glucose levels failed to maintain endothelial cell levels in islets derived from nod / scid mice when compared with islets incubated at 5 mmol 4b). Quantitative pcr analysis of purified endothelial cells from nod islets cultured at 10 mmol / l glucose showed a 4.2-fold increase in the expression of the antiapoptotic bcl - xl gene (cycle difference from gapdh: nod = 1.87 0.73 vs. nod.scid = 0.44 0.07; p = 0.10), whereas ki67 gene expression remained unchanged (data not shown). High glucose levels stimulate vegf expression under the conditions of islet inflammation . A: histomorphic analysis of islets from the pancreatic section of vehicle- or glucose - treated anti - cd3treated nod mice (p <0.02). B: purified islets from 8- to 10-week - old nod or nod.scid mice were incubated in either 5 or 10 mmol / l glucose for 7 days . After incubation, islets were dispersed and endothelial cell frequency was analyzed using fluorescence - activated cell sorter of bs-1 cells as described in research design and methods . Left panel: a representative histogram depicting a sample of two nod or nod.scid islet cultures stained for bs-1 . Right panel: summary of the percentage of bs-1 cells after culture in 5 or 10 mmol / l glucose . C: purified islets from 8- to 10-week - old nod (left) or nod.scid (right) mice as in b were incubated with increasing concentrations of glucose . Quantitative rt - pcr was done for vegf-120 and vegf-164 isoforms in the islets (* p <0.05). N 3 per group . Because vegf - a is the main regulator of endothelial cell maintenance, we tested whether increased glucose had a differential effect on vegf production by islets from nod and nod.scid mice ex vivo . Purified islets from 8- to 10-week - old mice were incubated with increasing concentrations of glucose for 24 h followed by mrna extraction . Rt - pcr analysis of vegf-120, vegf-164, and vegf-188 mrna isoforms revealed a fivefold increase in vegf-120 and vegf-164 production in the islets of nod mice, whereas vegf-188 was undetectable (fig . This increase was evident at glucose concentrations of 5, 10, 20, and 40 mmol / l (fig . In contrast, hyperglycemia did not induce vegf production in cultured islets form nod.scid mice (fig . These findings were consistent with the lack of an effect of glucose on vascular area in nod.scid mice treated with glucose but left open the possibility that during inflammation, islets could acquire the ability to produce vegf after direct immune injury or in response to soluble factors produced by the infiltrating cells . To test this, we cultured nod.scid islets with supernatants collected after a 72-h incubation of nod islets in 10 mmol / l glucose and measured vegf production by real - time pcr . There was a significant increase in vegf-120 and vegf-164 after incubation with islets from nod but not control nod.scid mice (fig . This increase was more pronounced in the vegf-164 isoform, suggesting that the vegf-120 isoform may derive from a non - islet resident cell (fig . These data suggest that inflammation can promote the production of vegf - a in the islet by a yet - unidentified soluble factor . Examination of prediabetic mice showed impaired glucose tolerance in 13-week - old nod mice when compared with 9-week - old nod mice (fig . 1a; area under the curve at 9 weeks = 8,702 vs. at 13 weeks = 11,195; p <0.05). Previous studies have described a decline in islet vascular area in nod mice during the progression of diabetes (9), but the relationship between these changes and the impairment of glucose tolerance in nod mice has not been directly evaluated . We therefore studied the islet vascular area in prediabetic mice and after recovery from hyperglycemia in diabetic nod mice that were treated with anti - cd3 mabs . Reduced cd31 area was evident as early as 9 weeks of age when compared with nonautoimmune nod.scid animals (fig . Although there was not a direct relationship between changes in glucose tolerance and islet vasculature during prediabetes, there was a sharp decline in cd31 area in the islets at the time of diabetes onset (fig . Anti - cd3treated diabetic nod mice fail to normalize their ipgtts and endothelial cell area in the islet . A: ipgtts of prediabetic mice at the ages of 9, 11, and 13 weeks (n = 5 each group) and after anti - cd3 treatment (n = 12). B: quantitative histomorphic analysis of cd31 in pancreatic sections (n = 3 and four mice of islets from prediabetic, diabetic, and anti - cd3treated nod mice and n = 3 and four mice at each time point) (mean se). The cd31 area in the islets was compared with the same in nonautoimmune nod.scid mice by anova (top line, p <0.0001) and by the dunnett multiple comparison test (* p <0.05; * * * p <0.001) and with mice with new - onset diabetes (bottom line, anova p <0.0001 and * * p <0.01; * * * p <0.001). C: immunofluoresence staining samples of representative islets from 13-week - old nonautoimmune nod.scid mice, prediabetic nod mice, and nod mice with new - onset diabetes . Blue, dapi; red, insulin; green, cd31 . (a high - quality digital representation of this figure is available in the online issue .) Next, we treated newly diabetic nod mice with anti - cd3 mabs and found that the nonfasting glucose levels returned to nondiabetic levels of <200 mg / dl for a period> 2 consecutive weeks (154.9 8.2 mg / dl). However, when challenged with an ipgtt, these mice showed glucose intolerance when compared with 9-week - old nod mice (fig . 1a; area under the curve at 9 weeks = 8,702 vs. anti - cd3treated = 16,578; p <0.0001). In addition, the endothelial cell density was not normalized after anti - cd3 mab therapy and remained significantly reduced when compared with nod.scid or 9-week - old nod mice (fig . These results show a loss of endothelial cells in the islet during prediabetes that is concomitant with deterioration of glucose tolerance, both of which are not fully corrected following anti - cd3 treatment . To determine the relationship between changes in glucose and the cd31 cell density, we treated prediabetic nod mice with normal (8 weeks old) or impaired (12 weeks old) results from the ipgtt with daily injections of phz for a period of 14 days . First, we tested phz effects on glucose load in normoglycemic balb / c during the ipgtt . Phz injection increased clearance of blood glucose, as indicated by a more rapid return to baseline glucose levels (supplementary fig . Daily phz injections of 12-week - old nod mice reduced endothelial cell density when compared with vehicle - treated mice (fig . Interestingly, phz also decreased the rates of -cell proliferation (table 1 and supplementary fig . 3), which is consistent with the previously described effects of glucose on -cell proliferation in prediabetic mice (13). In contrast, phz treatment of 8-week - old nod mice, with normal ipgtt results, did not reduce endothelial cell density (fig . Histomorphic analysis of pancreata (n 3 per group) cd31 area in 8-week - old (a) and 12-week - old (b) prediabetic nod mice after daily injections of phz for a period of 14 days (* p <0.04). C: endothelial cell area in diabetic and anti - cd3treated nod mice receiving either vehicle or glucose injections for 14 days . D: as in c but with immunodeficient nod.scid mice . * p <0.05; * * p <0.001 . Proliferation levels in islets of prediabetic and anti - cd3treated mice data are means se . We also tested whether an increase in glucose in mice with impaired glucose tolerance would have the opposite effect . Recovered anti - cd3treated nod mice showing a minimum of 10 consecutive days of basal euglycemia received daily injections of glucose (4 mg / kg i.p .) For 14 days . Glucose injections significantly increased endothelial cell density to a density similar in prediabetic nod mice when compared with vehicle - treated controls (fig . In contrast, similar treatment of nod.scid mice with daily glucose injections failed to increase endothelial cell density in islets (fig . These data suggest that fluctuation in daily glucose may modulate endothelial cell density under the conditions of islet inflammation . Next, we tested the physiological consequences of increased endothelial cell density in glucose - treated anti - cd3treated nod mice . Interestingly, despite the presence of impaired glucose tolerance before treatment, glucose - treated anti - cd3 mice showed improved ipgtt results when compared with vehicle - treated mice (fig . 3a and b; p <0.05). Fasting insulin levels in glucose - treated mice were higher than in placebo - treated mice (vehicle = 0.61 ng / ml vs. glucose = 0.90 ng / ml; p <0.06); however, no increase in -cell mass was detected (fig . 3c). Therefore, to examine the effect of glucose on insulin content in individual -cells, we used the aqua score to measure the content of insulin . The aqua score has been validated for protein quantization in histological section of malignant tissues in which good reproducibility and linearity with protein content of tissues has been validated (1823). Aqua score analysis revealed increased levels of insulin staining per -cell in glucose - treated mice (fig . Glucose treatment of anti - cd3treated mice did not increase -cell proliferation, albeit proliferation was at relatively high levels in both vehicle- and glucose - treated mice (table 1).these results suggest that increased islet endothelial cell density may promote -cell function by increasing insulin content rather than -cell proliferation after treatment with anti - cd3 antibodies . Daily glucose injections improve glucose tolerance and increase insulin content in anti - cd3treated nod mice . A: representative ipgtts of anti - cd3treated mice with normal basal glucose levels receiving daily injections of either vehicle (left panel) or glucose (right panel) intraperitoneally (, pretreatment;, posttreatment). B: summary of changes in ipgtt results of anti - cd3treated diabetic mice with normal basal glucose levels after a 14-day challenge of daily injections of either glucose or vehicle . * p <0.04 (n = 12 per group). Stained pancreatic section of vehicle- and glucose - treated mice for insulin cells . D: aqua scores of insulin levels per -cell as described in research design and methods . * p <0.03 . Ins, insulin . To understand the basis for increased endothelial cell density after glucose treatment, we measured vegf production in the islets of glucose - treated anti - cd3treated mice by histomorphic analysis . Preliminary immunofluorescence staining revealed an increase in vegf levels in prediabetic nod islets compared with nod.scid islets (supplementary fig ., daily glucose injections resulted in increased vegf expression in the islets when compared with vehicle - treated mice (fig . 4a; p <0.02), suggesting that vegf production by resident or infiltrating islet cells can promote islets in response to glucose . To directly examine the effects of glucose on endothelial cell numbers, we incubated purified islets from either nod or nod.scid donors at either 5 mmol / l or 10 mmol / l glucose for 7 days followed by fluorescence - activated cell sorter analysis of bs-1 endothelial cells . Nod islets incubated at 10 mmol / l glucose showed better maintenance of endothelial cells when compared with islets incubated at 5 mmol in contrast, high glucose levels failed to maintain endothelial cell levels in islets derived from nod / scid mice when compared with islets incubated at 5 mmol 4b). Quantitative pcr analysis of purified endothelial cells from nod islets cultured at 10 mmol / l glucose showed a 4.2-fold increase in the expression of the antiapoptotic bcl - xl gene (cycle difference from gapdh: nod = 1.87 0.73 vs. nod.scid = 0.44 0.07; p = 0.10), whereas ki67 gene expression remained unchanged (data not shown). High glucose levels stimulate vegf expression under the conditions of islet inflammation . A: histomorphic analysis of islets from the pancreatic section of vehicle- or glucose - treated anti - cd3treated nod mice (p <0.02). B: purified islets from 8- to 10-week - old nod or nod.scid mice were incubated in either 5 or 10 mmol / l glucose for 7 days . After incubation, islets were dispersed and endothelial cell frequency was analyzed using fluorescence - activated cell sorter of bs-1 cells as described in research design and methods . Left panel: a representative histogram depicting a sample of two nod or nod.scid islet cultures stained for bs-1 . Right panel: summary of the percentage of bs-1 cells after culture in 5 or 10 mmol / l glucose . C: purified islets from 8- to 10-week - old nod (left) or nod.scid (right) mice as in b were incubated with increasing concentrations of glucose . D: supernatants from nod or nod.scid islets incubated at 10 mmol / l glucose for 72 h were added to freshly purified nod.scid islets . Quantitative rt - pcr was done for vegf-120 and vegf-164 isoforms in the islets (* p <0.05). N 3 per group . Because vegf - a is the main regulator of endothelial cell maintenance, we tested whether increased glucose had a differential effect on vegf production by islets from nod and nod.scid mice ex vivo . Purified islets from 8- to 10-week - old mice were incubated with increasing concentrations of glucose for 24 h followed by mrna extraction . Rt - pcr analysis of vegf-120, vegf-164, and vegf-188 mrna isoforms revealed a fivefold increase in vegf-120 and vegf-164 production in the islets of nod mice, whereas vegf-188 was undetectable (fig . This increase was evident at glucose concentrations of 5, 10, 20, and 40 mmol / l (fig ., hyperglycemia did not induce vegf production in cultured islets form nod.scid mice (fig . These findings were consistent with the lack of an effect of glucose on vascular area in nod.scid mice treated with glucose but left open the possibility that during inflammation, islets could acquire the ability to produce vegf after direct immune injury or in response to soluble factors produced by the infiltrating cells . To test this, we cultured nod.scid islets with supernatants collected after a 72-h incubation of nod islets in 10 mmol / l glucose and measured vegf production by real - time pcr . There was a significant increase in vegf-120 and vegf-164 after incubation with islets from nod but not control nod.scid mice (fig . This increase was more pronounced in the vegf-164 isoform, suggesting that the vegf-120 isoform may derive from a non - islet resident cell (fig . These data suggest that inflammation can promote the production of vegf - a in the islet by a yet - unidentified soluble factor . The improvement in insulin secretion that is seen after immune therapy in nod mice and most likely during the honeymoon of type 1 diabetes reflects the functional recovery of existing -cells, possibly with growth of new cells, but the factor(s) that controls these responses is not well understood (3). In this study, we have confirmed previous findings that in addition to -cells, the islet vasculature density is reduced prior to the presentation of diabetes and that a significant decrease in -cell mass and islet endothelial cells after presentation of diabetes in nod mice further promote glucose intolerance . Moreover, treatment with the anti - inflammatory anti - cd3 mabs, which reverse frank hyperglycemia, fails to correct the impaired ipgtt results, which are associated with reduced cd31 cells . In addition, we have found that glucose is a regulator of islet vascular density both in the prediabetic period and after treatment of diabetic mice with anti - cd3 mabs, where glucose treatment augments cd31 density within the islets . This increase in islet vasculature occurs in conjunction with an increase in vegf production, resulting in enhanced insulin content and islet vasculature, but not -cell proliferation, in islets that have recovered or been spared destruction by the immune attack . The increase in endothelial cell density may be a result of decreased rates of cell death because the levels of the antiapoptotic gene bcl - xl were increased in inflamed endothelial cells under the condition of hyperglycemia . Susceptibility to the effects of glucose is induced by soluble factor(s) secreted by the inflamed islets in response to hyperglycemia . This soluble factor produced by inflamed islets controls vegf production by resident islet cells . The ongoing immunological assault on insulin - producing -cells in the islet during the progression of diabetes not only leads to the amplification of the immune response to islet antigens but also results in a gradual deterioration of glucose tolerance in prediabetic nod mice . This increase in metabolic demand imposes a new challenge for remaining -cells to compensate for increased glucose levels, as seen in situations of type 2 diabetes and during pregnancy (12). Our finding showing the ability of treatment with the glycosuric agent phz to reduce islet vasculature suggests that glucose levels may control the islet vasculature in the prediabetic state by increasing it with hyperglycemia and conversely by contracting it with reduced glucose load . The control of islet capillaries by glucose would be predicted because their unique structure, which consists of a basement membrane and fenestrations and is important for the control of glucose flow to the endocrine cells (25). Islet endothelial cells are highly sensitive to changes in glucose levels because increased glucose levels in gk rats can increase islet capillary blood pressure (26). (8) have recently shown that islet blood flow is regulated by glucose in normal mice without insulitis . In their studies (8), blood flow to the islet was dramatically increased after the hyperglycemic clamp . However, the effects of inflammation on imparting sensitivity of the islet vasculature to glucose had not been previously identified . In anti - cd3 mab treated mice, which show improved basal glucose levels but exhibit impaired glucose tolerance, islet vasculature improves modestly following anti - cd3 treatment . This recovery of endothelial cell density is enhanced by daily glucose injections, leading to improved glucose tolerance and increased insulin content per -cell . Based on our previous studies (27), it is likely that the improved islet vasculature increases the insulin content of recovered degranulated -cells, which accounts for the majority of -cell mass recovery after treatment with anti - cd3 (2). Inflammation has been suggested as a stimulant of -cell replication because -cell proliferation is increased in prediabetic nod mice and is highest at the time of the greatest -cell destruction (2,28). In addition, the microvasculture is also dependent on inflammation and can increase by a variety of cytokines . These permissive roles of inflammation on -cell proliferation and islet vasculature are supported by our findings showing no increase in -cell replication and islet vasculature after glucose treatment of immunodeficient nod.scid mice . Our new findings suggest that inflammation also affects the islet vasculature and that soluble products from inflamed islets render islet cells themselves responsive to glucose because nod.scid islets cultured with supernatants from nod islets acquired responsiveness of vegf production to glucose . One candidate cytokine capable of stimulating vegf production and vessel remodeling is tumor necrosis factor (tnf)- (29). The addition of tnf or its closely related family member, lymphotoxin, can lead to increased vegf production and stimulation of angiogenesis (30). The ability of the islet endothelium to respond to increasing vegf levels may relate to increased expression of vegf receptors on endothelial cells during inflammation . The addition of tnf to endothelial cells in culture can indeed result in increased vegfr2 expression, leading to altered endothelial cell morphology and angiogenesis (31), which, when combined with increased glucose levels, can lead to increased vasculature . The effects of the inflammatory response on the extracellular matrix (ecm) also must be considered . Normal endothelial cell interactions are largely mediated via integrins, suggesting that inflammation may alter these conditions . Recently, the role of matrix metalloproteinase-9 was documented in mediating the release of vegf, thus increasing the effective concentration of vegf-165 at the site of inflammation (32). The breakdown of the ecm may further potentiate angiogenesis and endothelial cell survival under the conditions of inflammation (33). Based on our finding of different proportions of vegf isoforms produced in response to glucose by nod islets and nod.scid islets cultured with nod culture supernatants, we speculate that both the islet and immune cells are the sources of vegf in inflamed islets stimulated with glucose, and the possibility of ecm disturbance and increased accessibility of vegf to activated endothelial cells require additional investigation . Our findings with phz are consistent with a recent report by pechhold et al . (13) in which islet transplantation or insulin treatment reduced -cell proliferation in nod mice . However, we were unable to detect an increase in -cell replication when we treated previously diabetic mice with glucose or even in prediabetic mice that were treated with glucose (data not shown). One factor that may account for these discrepancies may be the way in which glucose was administered . In addition, the rates of -cell replication were already high in our prediabetic and postdiabetic mice treated with glucose, and, thus, it may not have been possible to increase the rates of replication further . Our data suggest a novel role for glucose in the maintenance of islet vasculature during the progression of and recovery from diabetes and the effects of inflammation on imparting sensitivity to these effects . The factor(s) that render the islet vasculature susceptible to glucose may identify a means of increasing -cell function and/or mass in settings where -cell mass is compromised.
Polycystic kidney diseases (pkds) are a large family of disorders characterized by the formation and growth of renal cysts often leading to end - stage renal disease (esrd). The most common inherited pkds can be transmitted as autosomal dominant or autosomal recessive traits . Autosomal dominant polycystic kidney disease (adpkd) occurs with an incidence of 1: 1000 and is characterized by the development of fluid - filled cysts in the kidneys, liver, pancreas and other organs, accounting for up to 10%ofesrdcases . Adpkd is a systemic disorder with cardiovascular manifestations including cardiac valve abnormalities, cardiac hypertrophy and intracranial aneurisms . Complications include hypertension, abdominal pain, hematuria and urinary tract infections [2, 3]. The disease manifests in adulthood, with 50% of patients developing renal failure by age 60 [4, 5]. Autosomal recessive polycystic kidney disease (arpkd) is a less frequent childhood disease with an incidence of 1: 20 000 . Arpkd is characterized by cystic kidneys and congenital hepatic fibrosis with a high level of mortality in affected newborns . . A smaller number of patients display later onset of disease with portal hypertension or cholangitis . There are several other less common inherited recessive cystic diseases including nephronophthisis (nphp), bardet - biedl syndrome (bbs), joubert syndrome (jbts) and meckel - gruber syndrome (mks) that will not be discussed here and are described in other excellent reports [710].this review will mainly focus on recent advances in understanding the molecular pathogenesis of pkds and development of novel therapeutic options . Approximately 85% of all adpkd cases are caused by mutations in the pkd1 gene, encoding polycystin-1, which maps to human chromosome 16p13.3 [11 14]. The remaining 15%can be attributed to the pkd2 gene, encoding polycystin-2, which maps to 4q21 [15, 16]. Clinical presentations of the pkd1 and pkd2 mutations are very similar, although the disease phenotype in the latter is significantly milder . Typically, individuals with pkd2 display later mean age at diagnosis, hypertension and esrd [17, 18]. Heterogeneity is also seen within families in age of onset, rate of cystic disease progression and extrarenal manifestations, suggesting the role of genetic and environmental factors . The pkd1 genomic region of 53 kb is organized into 46 exons encoding a 14 kb mrna . The pkd1 genomic region contains a number of unusual structural features, including high gc content and multiple simple repeats . Such lengthy polypyrimidine elements may interfere with replication, transcription or rna processing . Because of the complex structure of the pkd1 gene, comprehensive mutation screening is difficult . Most mutations are predicted to produce truncated protein and are unique to a single family, although missense mutations have also been identified . While genotype / phenotype correlations in thepkd1gene suggest that mutations in the 5 portion of the gene are associated with a more severe phenotype, no obvious correlations have been found in the pkd2 gene . The combination of the unique unstable structural elements in the pkd1 gene with intrafamilial heterogeneity and the focal nature of cyst formation has led to the two - hit hypothesis for cyst formation, which suggests that cysts form in cells with an inherited mutation in one allele and a somatic mutation occurring in the other allele . This hypothesis received experimental support through identification of somatic mutations in a subset of kidney cysts [23, 24]. A similar mechanism was also found to play a role in pkd2 renal and hepatic cystogenesis . Cystogenesis in humans and mice occurs in trans - heterozygotes with pkd1 and pkd2 mutations [26, 27]. It is possible that reduced expression of the normal pkd1 allele below a critical level due to genetic or environmental factors may lead to cyst formation in the kidneys of adpkd patients . On the other hand, over - expression of polycystin-1 in transgenic animals these data suggest that abnormal levels of polycystin-1 expression can trigger pathogenic mechanisms leading to cyst formation . Genetic data have shown that mutations in a single gene, pkhd1, located on chromosome 6p21 (encoding fibrocystin / polyductin) cause arpkd [31, 32]. The pkhd1 gene spans a region of 500 kb, consists of 67 exons and encodes a large 16 kb mrna . Genotype / phenotype correlations show that individuals with two truncating mutations die in the perinatal period, while one or two missense changes are associated with milder disease . This finding was further supported by a study of neonatal survivors in which no two truncating mutations were identified, suggesting that missense mutations are required for survival of newborns . The majority of pkhd1 mutations are unique to a single family, with no obvious hot spots identified . Polycystin-1, the product of the pkd1 gene, is a large transmembrane protein with an estimated molecular weight of 500 kd (fig . The large extracellular n - terminal region contains several specific motifs including leucine - rich repeats (lrrs), c - type lectin domain, ldl - a region, multiple ig - like domains (or pkd domains), rej domain and gps domain . It has 11 transmembrane domains, with a plat domain located in the first cytoplasmic loop and a small cytoplasmic tail with a g - protein - binding motif and coiled - coil region (fig . The 16 ig - like domains are segmented such that the first ig - like domain is localized between the lrrs and the c - type lectin domain, while the remaining 15 iglike domains are clustered together between ldl - a and rej domains . This ig - like domain cluster forms strong homophilic interactions that are important for cell - cell adhesion [36, 37]. Polycystin is likely a multifunctional protein with important roles in cell - cell / matrix adhesion and ciliary functions [10, 38]. Polycystin-1 undergoes partial cleavage at the gps domain such that n - terminal and c - terminal polypeptides remain non - covalently linked [39, 40]. It is subsequently cleaved at the second site, which releases its c - terminal tail . This signaling function of polycystin-1 is regulated by polycystin-2 and may possibly be initiated by mechanical stimuli . Figure 1the structure of polycystin-1, polycystin-2 and fibrocystin (lrr, leucine - rich repeats; wsc, cell wall integrity and stress response component 1; pkd (ig - like), ig - like domains; ldl, low density lipoprotein domain; rej, receptor for egg jelly; gps, proteolytic g protein - coupled receptor proteolytic site; plat, lipoxygenase domain; ef, ef hand domain; tig, immunoglobulin - like domains; tmem2, homology with tmem2 protein). The structure of polycystin-1, polycystin-2 and fibrocystin (lrr, leucine - rich repeats; wsc, cell wall integrity and stress response component 1; pkd (ig - like), ig - like domains; ldl, low density lipoprotein domain; rej, receptor for egg jelly; gps, proteolytic g protein - coupled receptor proteolytic site; plat, lipoxygenase domain; ef, ef hand domain; tig, immunoglobulin - like domains; tmem2, homology with tmem2 protein). Polycystin-2 is a protein of 110 kd with six transmembrane domains and cytoplasmic n- and c - terminal domains (fig . 1). Polycystin-2 (or trpp2) is thought to be a new member of the transient receptor potential (trp) family of ion channels . It was shown to be a cation channel with some selectivity for ca and functions in multiple subcellular locations including plasma membrane [43, 44], endoplasmic reticulum and the primary cilia . Polycystin-1 and -2 can function together as a complex as well as independently in a variety of subcellular compartments . Direct interaction between the cytoplasmic tails of the polycystins has been shown using yeast two - hybrid assay [47, 48]. Fibrocystin is a large receptorlike membrane - associated protein of 450 kd with a single transmembrane domain, large extracellular n - terminal region and small cytoplasmic c - terminal tail . Its extracellular portion consists of several tig domains (immunoglobulin - like) and a short cytoplasmic c - terminus with putative phosphorylation sites (fig . 1) [49, 50]. Based on similarities with other tig - containing proteins such as the hepatocyte growth factor receptor and the plexins, fibrocystin was suggested to function as a receptor or a ligand, since secreted forms may be generated from alternatively spliced transcripts . Fibrocystin is expressed in cortical and medullary collecting ducts of the kidney as well as biliary and pancreatic ducts in a pattern consistent with the histologic features seen in arpkd . Similar to polycystins, fibrocystin is expressed in multiple subcellular locations including the basolateral membrane, cytoplasm and cilia . It has been shown that fibrocystin can undergo notch - like processing with release of the ectodomain from primary cilia . An independent study also showed cleavage of the ectodomain of fibrocystin as well as generation of a cytoplasmic fragment that translocates to the nucleus . Such proteolytic cleavage can be elicited by stimulation of intracellular ca release or protein kinase c activation . Fibrocystin may form a complex with polycystin-2 to regulate calcium responses in kidney epithelia, but its exact role in normal and cystic epithelia is not known . The formation and growth of cysts in pkd is accompanied by increased proliferation and apoptosis of cyst - lining epithelia, loss of epithelial polarity and de - differentiation, dysregulation of cell / matrix interactions and transformation of the absorptive epithelial phenotype to a secretory phenotype [54 56]. Epidermal growth factor (egf), transforming growth factor (tgf) alpha and egf receptor (egfr) play important roles in promoting cystic epithelial proliferation . In human pkds and several animal models, apoptosis is also essential for cystogenesis: deletion of the anti - apoptotic bcl-2 and ap-2 genes and overexpression of the pro - apoptotic gene c - myc in mice results in renal cyst formation . Cystic fluid is derived from glomerular filtrate in the early stages of adpkd, when cysts are still attached to the parent tubule . Cysts separate from the tubule of origin when they reach 200 m in diameter and continue to expand through a transepithelial chloride secretion mechanism mediated by camp . Chloride enters cells via the basolateral na - k - cl cotransporter and accumulates in the cytoplasm . A chloride channel in the apical membrane, cftr, mediates movement of chloride into the cystic lumen . Chloride secretion drives sodium into the cystic cavity through paracellular mechanisms; this causes movement of water through aguaporins . In contrast to adpkd, cysts in arpkd do not separate from affected collecting ducts . Therefore, proliferation but not transepithelial secretion is a major component causing cystic kidney volume enlargement in arpkd . Impaired cell - cell / matrix adhesion . The overlapping expression and localization patterns of polycystin-1 and both proteins are found in basolateral membranes and the primary cilium, where they may act together to regulate cellular adhesion and ca signaling . On the other hand, polycystin-2 is mainly expressed in endoplasmic reticulum, where it functions as a ca release channel . In addition, polycystin-1 is highly expressed during development, with significant down - regulation of its expression in adult tissues . In contrast, expression of polycystin-2 seems to persist into adult life . Experimental evidence from several groups has established an important role for polycystins in epithelial cell morphogenesis, including differentiation and maturation in vivo [63, 64]. Studies using in vitro models of tubulogenesis and cystogenesis based on mdck cells demonstrated that expression of polycystin-1 at cell - cell junctions at controlled levels is critical for proper tubular differentiation . It has been shown that polycystin-1 is directly involved in intercellular adhesion via formation of strong homophilic interactions of its pkd (ig - like) domains as shown in fig . A direct role for ig - like domains in cell - cell adhesion was demonstrated by specific perturbation of intercellular adhesion using antibodies against ig - like domains in cell cultures [36, 37]. Polycystin-1 was localized to the cell - cell adhesion complexes with adherens junctions and desmosomal junctions in epithelial cells of different origin [65 67]. Because alterations in polycystin-1-mediated adhesion may cause the abnormal epithelial cell phenotype observed in adpkd cells, including dedifferentiation and loss of epithelial polarity, several studies examined cell - cell adhesion junctions in primary cells derived from adpkd kidneys [37, 68, 69]. As shown in fig . 2, abnormal adherens and desmosomal junctions were found in adpkd: intracellular junctions were devoid of desmosomal cadherins and associated proteins, which were sequestered to the cytoplasmic pools, and adherens junctions appeared disrupted, accompanied by a great reduction of ecadherin expression and partial compensatory expression of n - cadherin . (a) polycystin-1 (pc-1) mediates cell - cell adhesion through homophilic interactions of its ig - like domains . The components of djs are shown: desmoplakin (dp), desmogleins (dsg), desmocollins (dsc) and plakoglobin (pg). Ajs consist of e - cadherin (e - cad) as well as, and -catenins (catenins). The aj complex provides a linkage to the actin cytoskeleton, and dj link together intermediate filaments (if) of epithelial cells . In adpkd epithelial cells, dysfunctional pc-1 (crossed red lines) and desmosomal proteins are lost from cell - cell contacts and remain in intracellular vesicles . In addition, e - cadherin expression is reduced, resulting in compensatory expression of n - cadherin (n - cad). Thus, ajs and djs are disrupted in adpkd cells, while tight junctions (tj) remain intact . (b) expression of pc-1 in cell - matrix focal adhesion contacts . In normal epithelial cells, pc-1 is found in a complex with talin (tal), paxillin (pax), vinculin (vinc), focal adhesion kinase (fak), c - src (src), p130-cas (cas), nephrocystin (nph1) and tensin (ten). (a) polycystin-1 (pc-1) mediates cell - cell adhesion through homophilic interactions of its ig - like domains . The components of djs are shown: desmoplakin (dp), desmogleins (dsg), desmocollins (dsc) and plakoglobin (pg). Ajs consist of e - cadherin (e - cad) as well as, and -catenins (catenins). The aj complex provides a linkage to the actin cytoskeleton, and dj link together intermediate filaments (if) of epithelial cells . In adpkd epithelial cells, dysfunctional pc-1 (crossed red lines) and desmosomal proteins are lost from cell - cell contacts and remain in intracellular vesicles . In addition, e - cadherin expression is reduced, resulting in compensatory expression of n - cadherin (n - cad). Thus, ajs and djs are disrupted in adpkd cells, while tight junctions (tj) remain intact . (b) expression of pc-1 in cell - matrix focal adhesion contacts . In normal epithelial cells, pc-1 is found in a complex with talin (tal), paxillin (pax), vinculin (vinc), focal adhesion kinase (fak), c - src (src), p130-cas (cas), nephrocystin (nph1) and tensin (ten). Interestingly, co - immunoprecipitation studies in adpkd cells using an anti - polycystin-1 antibody showed that e - cadherin was lost from the complex, while beta - catenin remained associated with polycystin-1 . Moreover, beta - catenin was still expressed at the plasma membrane despite the loss of e - cadherin, suggesting the presence of an alternative cadherin . N - cadherin, but not k - cadherin, was overexpressed in adpkd cells and formed a complex with beta - catenin . In normal kidney, e - cadherin is expressed in distal segments of the nephron, while ncadherin is expressed in proximal tubules . In the adpkd kidney, n - cadherin is markedly increased in cysts of distal origin . However, the expression of n - cadherin in place of e - cadherin in adpkd cells was not sufficient to maintain epithelial cell - cell adhesion [37, 69]. 2) [54, 71]. Abnormalities in the basement - membrane composition and expression of matrix metalloproteases and their inhibitors were identified in pkd kidneys . Interestingly, the inactivation of tensin and insertional mutation in laminin alpha five result in cystogenesis [72, 73]. It has been shown that polycystin-1 interacts with focal adhesion complex molecules including 12 integrin, vinculin, paxillin, p130-cas, talin and focal adhesion kinase (fak). In adpkd cells, the focal adhesion complex polycystins, fibrocystin and numerous other proteins or cystoproteins such as nephrocystin-1, -3, -4, -5, inversin, alms1, ofd1, bbs1 - 8, cystin, polaris and nek8, which cause pkd in humans and animals, were recently discovered in a distinct subcellular compartment, the primary cilium [10, 74, 75]. Cilia are microtubule - containing organelles that project from the surface of most eukaryotic cells . The primary (non - motile) cilia are known to transduce sensory stimuli such as concentrations of growth factors, osmolarity and fluid flow . They primary cilia are formed in fully differentiated cells during interphase and grow out of the basal bodies (fig . The ciliary basal body is formed by the centrosomes, more specifically by the mother centriole that moves to the membrane where the axoneme, the structural core, is formed . Construction and maintenance of the axoneme requires a bidirectional intraflagellar transport system (ift) to deliver structural components from the cell body to the tip of the cilium . It was recently discovered that defects in ciliary structure or function underlie multiple human diseases with diverse phenotypes, including retinal degeneration, neural tube defects, obesity, polydactyly and pkd . Mutations in the lov-1 and pkd-2 genes of c. elegans, which are closely related to human polycystins, were associated with mechanosensation defects of ciliated sensory neurons . Direct evidence linking defects in ciliogenesis and pkd came from the study of renal tissue - specific inactivation of kif3a, a subunit of kinesin - ii essential for cilia formation: inactivation of kif3a in renal tubular epithelial cells resulted in development of pkd . It was demonstrated that the primary cilia in the cystic kidney of mice with a mutation in the tg737 gene (homologous to the ift gene of chlamydomonas, ift88) are shorter than normal . On the other hand, the primary cilia of cystic epithelial cells in jck mice were found to be significantly longer than the cilia in wild - type mice; this study suggested that ciliary protein nek8, which is mutated in the jck mice, may play a role in control of ciliary length . Cilia and mechanosensation in pkd . A number of studies support a role for the primary cilium as a mechanosensor in kidney tubular epithelia . Reported that the primary cilia of renal epithelial mdck cells can serve as a flow sensor . Bending the authors concluded that the primary cilium in mdck cells is mechanically sensitive and responds to flow by increasing intracellular calcium . A subsequent study demonstrated that polycystins can serve as flow - sensitive ciliary mechanosensors in kidney epithelia . More specifically, ciliary polycystin-1 and polycystin-2 function together with ryanodine receptors to mediate mechanotransduction into the intracellular ca signaling response (fig . The influx of ca across the plasma membrane constitutes the initial response to mechanical stimulation, and downstream signaling is mediated through intracellular ca release . It is possible that polycystin-1 functions as a sensor of ciliary bending, while polycystin-2 transduces themechanical signal into a calcium response . Changes in intracellular ca concentration are known to regulate multiple cellular functions including gene expression, cell cycle, differentiation and apoptosis . Cells with mutated polycystin-1 fail to respond to the fluid flow: it was shown that in adpkd - derived cells, the ciliary mechanosensation of fluid - flow shear stress by poly - cystins is absent . Figure 3ciliary functions of cystoproteins: mechanosensation and cell cycle control . Polycystin-1 (pc-1), polycystin-2 (pc-2) and other cystoproteins (not shown) are expressed in primary cilia, basal bodies or centrosomes . The primary cilium forms in fully differentiated cells in the g0 phase of the cell cycle . A cilium protrudes from the basal body (centrosome) formed by two centrioles, a mother centriole (blue cylinder) and a daughter centriole (orange cylinder). As cells enter the cell cycle, the cilium is resorbed, and the centrosome can act as a mitotic spindle pole organizer . Flow - induced bending of cilia in renal epithelial cells triggers ca influx mediated by pc-2 in association with pc-1.the role of ciliary proteins in cell cycle control is supported by several findings: (1) in the normal state, pc-2 sequesters id2 [proproliferative helix - loop - helix (hlh) protein] in the cytoplasm, preventing it from entering the nucleus . In pkd, when pc-1 or pc-2 are inactivated, id2 translocates to the nucleus and interacts with e - protein, blocking its ability to induce growth - suppressive genes and resulting in increased activity of cdk2 and activation of cell proliferation; (2) pc-1 can activate the jak / stat signaling pathway, resulting in the induction of p21 and cell cycle arrest in g0 and g1; (3) the intraflagellar transport component ift88/polaris is capable of controlling g1/s transition of the cell cycle . Ift88/polaris remains associated with the centrosome throughout the cell cycle, where it forms a complex with che-1, thus modulating its binding to rb protein . Polycystin-1 (pc-1), polycystin-2 (pc-2) and other cystoproteins (not shown) are expressed in primary cilia, basal bodies or centrosomes . The primary cilium forms in fully differentiated cells in the g0 phase of the cell cycle . A cilium protrudes from the basal body (centrosome) formed by two centrioles, a mother centriole (blue cylinder) and a daughter centriole (orange cylinder). As cells enter the cell cycle, the cilium is resorbed, and the centrosome can act as a mitotic spindle pole organizer . Flow - induced bending of cilia in renal epithelial cells triggers ca influx mediated by pc-2 in association with pc-1.the role of ciliary proteins in cell cycle control is supported by several findings: (1) in the normal state, pc-2 sequesters id2 [proproliferative helix - loop - helix (hlh) protein] in the cytoplasm, preventing it from entering the nucleus . In pkd, when pc-1 or pc-2 are inactivated, id2 translocates to the nucleus and interacts with e - protein, blocking its ability to induce growth - suppressive genes and resulting in increased activity of cdk2 and activation of cell proliferation; (2) pc-1 can activate the jak / stat signaling pathway, resulting in the induction of p21 and cell cycle arrest in g0 and g1; (3) the intraflagellar transport component ift88/polaris is capable of controlling g1/s transition of the cell cycle . Ift88/polaris remains associated with the centrosome throughout the cell cycle, where it forms a complex with che-1, thus modulating its binding to rb protein . The basal bodies / centrosomes of the cilia act as organizers of the mitotic spindle poles during cell division, directly connecting ciliogenesis with cell cycle regulation, and cilia are resorbed when cells enter the cell cycle (fig . A number of cystoproteins causing pkd in humans and animals are expressed, at least partially, in cilia or the basal body of the cilia . Polycystins and other cystoproteins may play an important role in connecting the mechanosensory function of the cilia to the centrosome and thus influence cell cycle control . Disruption of cystoproteins associated with cilia or basal bodies could, therefore, lead to dysregulation of the cell cycle and proliferation, resulting in cystic disease . Several lines of evidence support this hypothesis: overexpression of exogenous polycystin-1 in cultured cells resulted in growth arrest in g0/g1 phase of the cell cycle (fig . Polycystin-1 activates the jak - stat pathway, thereby up - regulating p21waf1 and inducing cell cycle arrest in g0/g1 . Other cystoproteins localized to cilia have also been recently shown to directly regulate the cell cycle . For example, the ift88/polaris protein, a component of the ift, was shown to be tightly associated with the centrosome during cell cycle transitions . Similar to polycystin-1, overexpression of polaris resulted in cell cycle arrest at the g0/g1 stage (fig . Polycystin-2 has been shown to participate in cell cycle regulation as well: it can associate with the helix - loop - helix protein id2 and block its translocation to the nucleus, preventing proliferation . The translocation of id2 in cells with mutated polycystins is associated with downregulation of p21 expression, leading to an increase in cdk2 activity and cell cycle progression (fig . 3). Thus, evidence of a direct link between cystoproteins, ciliary dysfunction and cell cycle dysregulation continues to accumulate . As we discussed previously, pkds in humans and animals can be caused by different cystogenes and can be distinguished by the patterns of inheritance and clinical manifestation . On the other hand, cyst formation in these disorders common cellular abnormalities of cystic epithelia include increased proliferation, apoptosis, loss of epithelial polarity accompanied by missorting of proteins and intracystic fluid secretion . Ciliary dysfunction may also constitute one of the common features for cystic diseases, since most known cystoproteins are associated with cilia / centrosome . For example, polycystin-2 was found to directly interact with fibrocystin to regulate calcium responses in the kidneys . Genetic interaction between murine genes encoding polycystin-1 and fibrocystin was shown, suggesting that polycystin-1 and fibrocystin function in the same molecular pathway to maintain tubular integrity . In addition, genetic interaction was also identified between cystogenes encoding polycystin-1 and nek8 (mutated in the jck mouse model of pkd) (natoli et al ., unpublished observations). Therefore, elucidation of common pathogenic mechanisms involved in pkds is an important step toward developing new therapies for effective treatment of cystic diseases . Studies using in vitro - cultured cells from adpkd cysts and animal models of pkd have revealed an important role for camp - activated pathways . Camp was shown to block proliferation of normal kidney epithelial cells through inhibition of the ras / raf / mek / erk pathway . In sharp contrast, camp was able to induce proliferation of adpkd - derived cystic epithelial cells through activation of the b - raf / mek / erk pathway . This switch from conventional camp - induced inhibition of growth to the camp - induced stimulation of growth in cystic epithelia was mediated by decreased intracellular calcium levels . Mutated polycystins disrupted ca signaling, which led to abnormal camp - stimulated proliferation of cystic cells . Cystic kidneys were shown to accumulate high levels of camp inmultiple models of pkd, making it plausible that activated camp pathways lead to both the increased proliferation and fluid secretion seen in cystic epithelia [86, 88, 89]. Wnt signaling in pkd . Activated wnt signaling was initially implicated in pkd through studies demonstrating that overexpression of the cytoplasmic tail of polycystin-1 stabilizes endogenous beta - catenin and stimulates tcf - dependent gene transcription in vitro . Microinjection of the polycystin-1 cytoplasmic tail induced dorsalization in zebrafish, suggesting that polycystin-1 is involved in modulating wnt signaling during renal development . Other studies supported this finding by connecting dysregulation of the beta - catenin pathway with pkd . Overexpression of beta - catenin in transgenic animals or inactivation of apc resulted in the development of cystic kidneys [91, 92]. Canonical beta - catenin - dependent wnt signaling is required for kidney development, while constitutive beta - catenin signaling in maturing tubules leads to formation of cysts . Flow - induced signaling switches the wnt pathway to a non - canonical beta - catenin - independent pathway through increased expression of inversin, a protein mutated in nephronophthisis type ii . This, in turn, results in reduced levels of the cytoplasmic dishevelled protein that activates destruction of the beta - catenin complex . The pkd1 gene is located in close proximity to the tsc2 gene, which encodes the tuberin protein responsible for the tuberous sclerosis complex (tsc), in a tail - to - tail orientation . A functional link between polycystin-1 and tuberin was established by a study showing that tuberin is required for membrane trafficking of polycystin-1 . Polycystin-1 appeared to form a complex with tuberin and regulate the activity of mtor, an important regulator of protein synthesis and cellular differentiation . Activation of mtor was also found in animal models of recessive pkd such as the bpk and orpk - rescue, suggesting that mutations in polycystin-1 are not critical form mtor activation . It is possible that signaling through other membrane receptors could lead to stimulation of mtor pathway, which is likely to be a late stage of the cystogenesis cascade . Greater understanding of the molecular mechanisms of cyst formation and growth has led to the discovery of novel potential therapeutic targets . Animal models of pkd have been critical in supporting studies of disease pathogenesis and in testing potential therapies . The availability of well - characterized and disease - relevant models is instrumental for successful development of viable therapies . Several preclinical pkd models have been described, some with spontaneous mutations and others generated through chemical / genetic manipulations . No existing model is ideal for preclinical testing in pkd; however, each represents a facet of human pathobiology (table 1). In general, an ideal pkd model should carry a mutation in a gene orthologous to the human disease - carrying gene.the development of the disease in such orthologous models should reproduce human pkd relative to the severity, segmental origin of kidney cysts, extrarenal manifestations and known cellular and molecular abnormalities including increased proliferation, apoptosis, camp, protein missorting as well as activation of known signaling pathways such as wnt, b - raf / mek / erk and mtor . A dozen different mouse models with targeted disruption of the pkd1 gene have been created, including animals with conditional gene inactivation (reviewed in). Mice with heterozygous pkd1 and pkd2 mutations develop a very mild and heterogeneous kidney cystic disease late in life and therefore are not suitable for therapeutic testing . Homozygous animals develop renal and pancreatic cysts at embryonic day 15.5 and die during embryogenesis . Mice with conditional inactivation of the pkd1 gene develop kidney and liver cysts, but disease is too mild to be informative in preclinical testing . An interesting mouse model with a mutation in the pkd2 gene (pkd2) carrying an unstable allele combined with a pkd2-null allele although these animals develop kidney and liver cystic disease that mimics human adpkd, the model has not been widely used for therapeutic testing due to a very high degree of phenotypic heterogeneity in combination with a slow course of progression with no measurable loss of renal function as late as 46 months of age . The pkd2 model should be most useful as a secondary confirmatory model rather than the primary model for proof of concept therapeutic testing . Several spontaneous mouse models of pkd, such as cpk, bpk and orpk, resemble human recessive disease with respect to cyst localization and the rapid rate of disease progression (table 1). Cystic disease in the pcy mouse and han: sprd rat is slowly progressive with cyst formation similar to adpkd . The jck mouse model is characterized by the development of cysts in multiple nephron segments and, despite the autosomal recessive mode of inheritance, resembles human adpkd phenotypically and can be used for relatively rapid therapeutic testing . Since no single model fully recapitulates all aspects of human pkd pathogenesis, it is important to test a potential therapy in more than one pkd model to determine its utility for clinical testing . Table 1rodent models of polycystic kidney diseases used in therapeutic intervention studies.modelgeneproteinprogressionrenal pathologykidney phenotypemousecpkcys1cystinrapidpt, cdarpkdbpkbicc1bicaudal crapidpt, cdarpkdorpktgn737polarisrapidpt, cdarpkdpcynphp3nephrocystin-3slownephron cdadpkdjcknek8nek8moderatelh, dt, cdadpkdpkd1pkd1polycystin-1el arpkdpkd2pkd2polycystin-2slowpt, lh, dt, cdadpkdrathan: sprd - cypkdr1samcystinslowptadpkdpckpkhd1fibrocystinslowcdarpkdpt, proximal tubule; dt, distal tubule; cd, collecting duct; lh, loop of henle; el, embryonic lethal . Pt, proximal tubule; dt, distal tubule; cd, collecting duct; lh, loop of henle; el, embryonic lethal . An important role for epidermal growth factor (egf) and its receptor (egfr) in contributing to cystic epithelial proliferation has been demonstrated . In human pkd and multiple animal models, egfr is overexpressed and mislocalized to the apical membrane in cystic epithelial cells . Transforming growth factor alpha (tgf alpha), a member of egf family, also signals through egfr . The role of tgf alpha in cystogenesis was addressed by renal expression of a tgf alpha transgene in the mouse . Preclinical studies showed that inhibition of egfr tyrosine kinase activity significantly reduced cystogenesis in mouse models of pkd, including bpk and orpk, as well as in the han: sprd rat model [99, 100], all models characterized by overexpression and mislocalization of egfr to the apical membrane . However, no therapeutic effect was detected in the pck rat; interestingly, although the pck rat is an orthologous model of arpkd, egfr was not found to be mislocated to the apical membrane of cystic cells, which may explain the lack of therapeutic efficacy in this model . Growth of cysts in 3-d collagen cultures of epithelial cells in vitro proceeds with increased apoptosis . Moreover, deletion of the anti - apoptotic bcl-2 and ap-2 beta genes as well as overexpression of pro - apoptotic c - myc in mice leads to renal cyst formation [103, 104]. To test the effect of inhibition of apoptosis in pkd this study showed inhibition of pkd progression and attenuation of the loss of renal function . The critical role of the camp - activated b - raf / mek / erk pathway was confirmed by the successful preclinical testing of a mek inhibitor: oral administration the map / erk kinase inhibitor pd184352 to pcy mice significantly decreased kidney weight, serum creatinine levels and water intake and significantly increased urine osmolality . Thus, inhibitors of the b - raf / mek / erk pathway may prove to be promising agents for pkd therapy . Studies were conducted to specifically target the cystogenic camp and vasopressin pathways using vasopressin v2 receptor (vpv2r) inhibitors, and efficacy was shown in four different pkd animal models . Treatment with tolvaptan (human vpv2r antagonist, otsuka pharmaceutical) resulted in significant lowering of camp levels in pck rat kidneys and inhibition of renal cystogenesis and fibrosis . Tolvaptan has entered human clinical trials in adpkd, and phase ii results have shown that it is well tolerated, with thirst and polyuria as side effects [88, 108]. It is important to note that effective reduction of plasma vasopressin levels through increased water intake decreased vpv2r expression and slowed pkd progression in pck rats . As somatostatin is capable of inhibiting camp - stimulated fluid secretion, it constitutes an alternative approach to the targeting of abnormal camp signaling in cysts . In a randomized placebo - controlled human adpkd trial, the benefit of a 6-month treatment with long - acting somatostatin (octreotide - lar, 40 mg intramuscularly every 28 days) was assessed . Treatment of the bpk and orpk - rescue mouse models with the mtor inhibitor rapamycin showed effective inhibition of pkd . Similar results were previously observed in a separate study with rapamycin performed in han: sprd rats . Treatment of human adpkd transplant recipient patients with rapamycin resulted in a significant reduction in polycystic kidney volumes . Several clinical trials are currently underway to test the efficacy of rapamycin and everolimus in adpkd patients . An important role of ciliary dysfunction in pkd pathology is highlighted by findings of the disrupted connection between cilia and the cell cycle . This dysregulation between cilia and cell cycle progression seems to occur early in cystogenesis and represents an attractive therapeutic target . The cdk inhibitor roscovitine was tested in cystic assay in vitro and in the preclinical pkd mouse models jck and cpk . Roscovitine (seliciclib, cyc202) is a potent and remarkably selective inhibitor of cdk2/cyclin e, cdk7/cyclin h, cdk9/cyclin t1 and cdk5/p35-p25 [112, 113]. Robust inhibition of pkd was shown in the jck mouse model of slowly progressive disease as well as in the cpk mouse model of aggressive pkd . Pulse treatment resulted in a persistent long - lasting effect such that continuous daily administration of the drug was not required to achieve efficacy . Roscovitine was equally effective against cysts formed in different segments of the nephron, a desirable feature for a potential drug against adpkd, where cysts are formed in multiple parts of the nephron . The effect of roscovitine at the molecular level was mediated through cell cycle blockade, transcriptional inhibition and apoptotic arrest . Thus, the apparent therapeutic benefit of cdk inhibition for pkd may be due to integrative effects on several key aspects of disease pathology . Seliciclib, an orally bioavailable compound, is currently in clinical trials as a cancer drug candidate . Known adverse events include transient elevations in serum creatinine, transient hypokalemia and reversible elevations in liver enzymes . The deregulation of ca signaling in cystic cells is believed to be mediated by polycystin-2 in complex with polycystin-1 . The first example of a therapeutic strategy to promote an increase in cytosolic ca in pkd has been demonstrated by treatment with triptolide, an active diterpene used in traditional chinese medicine . Triptolide treatment of pkd1-null homozygous embryos via maternal administration of the drug resulted in arrest of cellular proliferation and inhibition of cyst formation through restoration of ca signaling . The majority if not all of the drugs successfully tested in animal models so far were not specifically designed to treat pkd but rather were originally developed for other indications . Some of these drugs may require further optimization to achieve efficacy / toxicity profiles that are more appropriate for the pkd patient population . Because multiple optimized analogues would need to be tested, direct assessment of their efficacy in animal models is not feasible . The availability of high - throughput in vitro screening assays that are disease - relevant, robust, rapid and reproducible is crucial . In addition, such assays can be directly used for discovery of pkd - specific compounds that antagonize cyst development . It has been shown that mdck cysts grown in a 3-d collagen matrix in vitro adequately reflect several aspects of cystogenesis in vivo and can be successfully used for drug testing (fig . 4) [65, 116, 117]; the cystic assay can be used directly for high - throughput screening of a compound library or as a drug optimization assay . Recently it was shown that an embryonic cystic kidney organ culture assay can be a very valuable testing platform for rapid assessment of efficacy as well as preliminary testing for organ toxicity before entering into time- and material - consuming trials in animals (and t. natoli, unpublished results) (fig . 4). With the availability of such a screening cascade and successful candidates already emerging from preclinical testing, the field is poised to suggest viable therapeutic options for the treatment of pkd . High - throughput drug screening (hts) of a small compound library can be performed using an in vitro assay of cystogenesis . Identified hits (active drugs) can then be rapidly assayed for preliminary efficacy and organ toxicity using a readily available cystic kidney organ culture assay that utilizes pkd1 animals . Effective compounds can be selected for in vivo efficacy testing in animal models of pkd . Further optimization of compounds using medicinal chemistry and sar (structure - activity relationship) can proceed through the same screening platforms . The discovery process can also be initiated through proof of concept in vivo testing (drug candidate validation), followed by the drug optimization cycle . High - throughput drug screening (hts) of a small compound library can be performed using an in vitro assay of cystogenesis . Identified hits (active drugs) can then be rapidly assayed for preliminary efficacy and organ toxicity using a readily available cystic kidney organ culture assay that utilizes pkd1 animals . Effective compounds can be selected for in vivo efficacy testing in animal models of pkd . Further optimization of compounds using medicinal chemistry and sar (structure - activity relationship) can proceed through the same screening platforms . The discovery process can also be initiated through proof of concept in vivo testing (drug candidate validation), followed by the drug optimization cycle . Several potential therapies, including tolvaptan, sirolimus, everolimus and octreotide (as discussed above), are being tested in ongoing adpkd clinical trials . In addition, a large clinical trial (halt - pkd) has been implemented to address the benefit of inhibition of the renin - angiotensin system; this trial will test whether using ace inhibitors and angiotensin receptor blockers in combination is beneficial in comparison with ace inhibitors alone . The main challenge in adpkd clinical trials because disease develops slowly over several decades, renal function begins to decline late in the course of the disease when significant and likely irreversible damage to the kidney occurs . More beneficial early intervention trials require availability of reliable endpoints predictive of the subsequent renal function decline . Results of the crisp (consortium for radiologic imaging studies of pkd) study have demonstrated that measurement of kidney volume by magnetic resonance imaging (mri) can be a reliable indicator of clinical outcome . Recent advances in our fundamental understanding of the molecular pathogenesis of pkd have allowed selection of disease - relevant targets for therapeutic testing . Several successful studies in animal models that are currently being translated into human clinical trials strengthen the need to further explore disease - specific therapeutic targets . A rapidly growing number of well - characterized in vitro and in vivo models of cystic disease open opportunities for systematic drug discovery efforts . The availability of magnetic resonance imaging techniques to accurately measure pkd progression and, subsequently, the effect of therapeutic agents in a short period of time greatly enhances options for clinical trial design . It is likely that future treatment for pkd will require a combination therapy integrating several key pathways of cystogenesis.
A central question in neuroscience is the mechanism by which memories can be preserved for years . Long - term memories are at least in part encoded as specific patterns, or engrams, of strengthened synapses [1, 2], and long - term synaptic potentiation (ltp) persists for months in vivo . How can specific groups of synapses remain strong for months or years despite turnover of macromolecules and fluctuations in the size and shape of synaptic structures? Numerous mathematical models have been developed that describe maintenance of long - term memory (ltm) as dependent on bistability of synaptic weights, mediated by positive feedback loops of biochemical reactions, typically thought of as operative in dendritic spines . Proposed feedback mechanisms have relied on self - sustaining autophosphorylation of cam kinase ii [4, 5], persistent phosphorylation of ampa receptors by protein kinase a, enhanced translation of protein kinase m, or self - sustaining clustering of a translation activator, cytoplasmic polyadenylation element binding protein . With these models, ltp switches a synapse from a state of low basal weight to a high weight state and turns on the positive feedback loop . The loop then operates autonomously to keep the synapse in the high weight state indefinitely . However, despite extensive investigation, empirical evidence of a bistable distribution of two distinct synaptic weight states has not, in fact, been obtained . Although some studies [9, 10] have suggested two distinct strength states for synapses, as measured by the amplitude of excitatory postsynaptic currents before and after a stimulus protocol, these studies have only examined the early phase of ltp (<1 h), which does not depend on protein synthesis or other processes necessary for long - term memory storage . Therefore, those data do not address the dynamics of long - term memory storage . In addition, a demonstration of synaptic bistability would require not only finding two distinct synaptic strength states but also finding that a set of different protocols for ltp induction (e.g., different patterns of stimuli, or localized application of pharmacological agents) commonly switched synaptic weights between the same two stable states . In addition, modeling suggests that stochastic fluctuations of macromolecule numbers within a small volume such as a spine head are likely to destabilize steady states of biochemical positive feedback loops, causing randomly timed state switches (; see for an opposing view). Finally, in hippocampal neuron cultures, continuous and extensive fluctuations of postsynaptic density (psd) morphology are observed and are driven in part by synaptic activity . Such dynamics would seem difficult to reconcile with only two, or a few, stable weight states . Empirical distributions of the weights of excitatory synapses onto cortical or hippocampal pyramidal neurons appear unimodal (a single peak) rather than bimodal and are commonly heavy - tailed (skewed towards high weights) [1318]. Some histograms are based on relatively small numbers of measurements, so that some bimodality might be present but hidden in variability among bins . However, the weight distribution of song et al . Is based on measurements of several hundred excitatory postsynaptic potential (epsp) amplitudes and appears to particularly disfavor the bimodal hypothesis . A large number of measurements are fit well by a log - normal distribution (i.e., a normal distribution with the logarithm of the volume on the x - axis). In addition, a histogram of the volume of dendritic spines, based on a large number of individual measurements (~10,000) in mouse auditory cortex, is clearly unimodal, heavy - tailed, and approximately log - normal . Spine volume is approximately proportional to the postsynaptic density size [2022] and to the number of postsynaptic ampa receptors as well as to the amplitude of the epsc measured following localized glutamate uncaging . Thus it is plausible, and we assume that increases / decreases in spine volume can serve as a proxy for ltp / ltd . If synaptic weights and correlated spine volumes are not in fact bistable, how can patterns of strong synapses be maintained for very long times? Two observations support a mechanism based on metastability of small clusters of large dendritic spines, corresponding to groups of strong synaptic contacts . The first observation is that although spine volumes fluctuate, some large spines are extremely stable, existing for months (in sensory cortex or in motor cortex). The second is that induction of late, protein synthesis - dependent ltp (l - ltp) at a spine facilitates l - ltp expression at nearby spines, on the same dendritic branch, that coincidentally receive stimuli too weak to support l - ltp if given alone . This observation supports the clustered plasticity hypothesis in which clusters of spines on a single dendritic branch, rather than single spines, may serve as primary functional units for storage of ltm . For example (1) in motor cortex, learning induces coordinated formation of small spine clusters on a given dendritic branch (2) morphologically, spines are grouped into small clusters on pyramidal dendrites and (3) in rat hippocampal slice cultures, spontaneous coactivation of dendritic spines is frequent and is clustered, occurring more often for spines within 8 m of each other . Here an initial, relatively phenomenological model is developed describing synaptic weight changes due to competing processes of ltp (corresponding to spine growth) and long - term synaptic depression (ltd) (corresponding to spine shrinkage). Assuming volume changes are a proxy for weight changes, weight changes are simulated for discrete intervals of 1 day, over times of months or years . The discrete intervals were chosen to simulate the dynamics observed in experiments where volumes are imaged at intervals of ~1 day [19, 32]. In the model each day the magnitude of ltp is governed by a gaussian random variable, as is that of ltd (methods). These magnitudes are also approximately proportional to the preexisting weight . As suggested by recent data ([24, 25, 32] but see), a volatility factor was introduced so that the weights of larger synapses fluctuate less . This factor proved necessary for large synapses to remain stable for months (see discussion). Model parameter sensitivity was lessened when synapses were modeled as coupled into small clusters (~10 spines, modeled as on the same dendritic branch and able to interact). In accordance with data [32, 33], the model also incorporates disappearance or silencing of small synapses and compensatory regeneration of new synapses . When the dynamics of 1,000 small clusters were simulated, the weight distribution of the entire ensemble of individual synapses converged to a steady - state, log - normal form . Individual clusters remained stable for many years, with the average number of active synapses maintained in a range consistent with empirical data . The magnitude of daily changes in synaptic weight approximated a normal distribution except for an extra peak at w = 0, which constitutes a model prediction . If a subset of synapses was reinitialized to have large weights, this subset maintained large average weights for ~2 yrs, corresponding to persistence of a pattern of strong synapses that might serve as the engram for a memory . Some memories however persist for even longer times . In support of the clustered plasticity hypothesis, our simulations suggest that such memories might be encoded as a pattern of specific, stable clusters of active synapses . In simulations, each cluster consists of ncl synapses, corresponding to ncl individual spines . At a given time, most of these synapses are active, with synaptic weight w ranging from ~0.2 to 10 . The remaining synapses are silent, with a very low, basal weight of 0.05 . Weight evolution is simulated using discrete, large time steps t, considered to correspond to 24 h. at each time step, all weights are synchronously updated . The size and direction of a weight update at a given synapse are assumed uncorrelated with that at a neighboring synapse and with the preceding update at the given synapse ., two independent processes change synaptic weights during each time step . An ltp process increases w and an ltd process decreases w. strong synapses consume more resources for maintenance, corresponding to locally available mrnas / proteins . The model thus assumes that the more strong synapses present in a cluster, the fewer resources are available to support synaptic growth (ltp). Thus, the model assumes that the amplitude of ltp is also proportional to a volatility factor that decreases as w increases (1)-(2) as is that of ltd (3). Ltp and ltd add to give the net change in w per time step (4). For each time step, the ltp and ltd amplitudes are proportional, respectively, to gaussian random variables r1 and r2 . These variables have respective means a1 and a2, and sd1 and sd2 are the standard deviations . A1 and a2 are substantially larger, by a fixed factor of 4, than are sd1 and sd2 . Thus r1 and r2 are very rarely negative, but if either becomes negative it is reset to zero . The average ltp amplitude a1 is a decreasing function of the number of strong synapses in a given cluster, denoted as nst . With ncl the total number of synapses in a cluster, the average ltp amplitude a1 decreases linearly with nst, from a maximum amplitude x2 (for nst = 0) to a minimum x1 (for nst = ncl). For the simulation of figure 2(b) with this amplitude decrease removed, a1 and thus sd1 are fixed parameters . For comparison, simulations were also carried out in which r1 and r2 were drawn from exponential distributions . With exponential distributions r1 and r2 are always nonnegative, with probability densities that peak at 0 and decay exponentially for increasing positive values . Ltp and ltd are also proportional to a volatility factor vow, decreasing with w:(1)vow = vhivhivloww+wmed.from (1), vow decreases from the parameter vhi (for w = 0) to vlo (for w wmed). When w = wmed, vow is midway between vhi and vlo . Ltp and ltd amplitudes are also multiplied by the preexisting value of w. to keep w bounded the ltp amplitude is also multiplied by a decreasing function of w that has two parameters, khi and whi . Combining factors ltd amplitude is(3)altd = wr2vow.at each time step, for each active synapse,(4)wnew = wold+altpaltd.if w falls below a threshold twk, the synapse is reset to be silent . For each silent synapse at each time step, the probability for regeneration pact increases with the number of strong synapses in its cluster, to a maximal value pbas:(5)pact = pbasnstncl.in addition, regeneration only occurs if an adjacent synapse is strong . In a cluster, synapse 1 can only switch to active if synapse 2 is strong, and synapse 5 can only switch if synapse 4 and/or 6 is strong . A switch resets w to wreset, above twk . For all simulations, to ensure initial weight, distributions were at steady state and distributions and other quantities were computed only after 50,000 simulated days . It is necessary that simulated time steps plausibly correspond to the common empirical interval of 1 day between spine imaging sessions . Therefore, it was necessary to scale ltp and ltd amplitudes so that for a time step the simulated per cent change in w, averaged over all synapses, agreed with an average daily empirical change in w. empirically yasumatsu et al . Presented a piecewise - linear relationship between spine volume v and its change v (figure 7(b) of) under control conditions (normal synaptic activity). This model, which they denote c-1, was also able to predict an empirical steady - state spine volume distribution (figure 8(e) of). Is(6)v=0.16v+0.01 for v0.25 m3 (most spines),v=0.12v0.06 for 0.25 m3<v0.5 m3,v=0 for v>0.5 m3.from this relationship, combined with the plotted volumes in figures 1(b) and 1(c) of, it can be inferred that the average percent daily change in v lies within the range of ~1420% . One cannot infer a more precise value from these data . For comparison, in the model's steady - state weight distribution of figure 2(a), the percent change in w during a time step, averaged over all 10,000 synapses, is 16.5% . Assuming v is a proxy for w, this qualitative agreement between simulated and empirical average weight changes suggests that the fixed time step in figures 25, which is otherwise arbitrary, can be taken to correspond to approximately 1 day of weight dynamics . Let xi denote the total set of n synaptic weights at a reference time, with i the indexing variable from 1 to n. for 1,000 10-synapse clusters, n = 10, 000 . As t increases from the reference time, yi will evolve and r will decline from 1 . Let x-, y- denote the means of xi, yi . The standard equation was used:(7)r=i=1nxixyiyi=1nxix2i=1nyiy2.standard parameter values, used in all simulations unless stated otherwise, are as follows:(8)ncl=10, wreset=0.4, twk=0.08,tst=0.8, vhi=4.0, vlo=0.2,wmed=0.4, x1=0.144, x2=0.18,a2=0.16, khi=0.05, whi=20.0, pbas=0.1.in supplementary material (available online at http://dx.doi.org/10.1155/2015/185410), a java program is given that executes simulations from figures 24 . Figure 2(a) illustrates the approximately log - normal distribution of synaptic weights obtained at steady state . Here, 1,000 clusters of synapses were simulated, with ncl = 10 . The black trace is the resulting histogram of synaptic weight w; the red trace is a log - normal distribution fitted to the histogram . The range of w spans approximately 5 natural log units (i.e., a multiplicative factor of ~150). This range is similar to data describing the range of dendritic spine volumes [19, 32]. In this steady state, the relative synaptic weight change per time step, averaged over all synapses, is 16.5% . This agreement is necessary for the model time step to represent the empirical interval of 1 day between imaging sessions . To prevent this distribution from being overly sensitive to the average daily ltp amplitude, the model assumes this amplitude decreases with the number of strong synapses in the cluster to which the synapse belongs . Starting from figure 2(a), when the mean ltp amplitude was decreased by 5%, the mean of w decreased by only 16% . In contrast, figure 2(b) illustrates that in a model variant with mean and standard deviation of the ltp amplitude fixed, the weight histogram was shifted to the right of the log - normal distribution from figure 2(a) and has a shape clearly distorted from log - normal with a much steeper cutoff at high w. to attempt to improve the histogram, the mean ltp amplitude was decreased by 2% . This small change resulted in a large shift of the histogram to the left (blue trace), and 56% of the synapses became silent (not included in the histogram). A similar distribution, with extreme sensitivity to mean ltp amplitude, resulted from a model variant in which synaptic clustering was deleted by fixing the mean and standard deviation of the ltp amplitude and also fixing the synapse regeneration probability pact (5). The distribution is strongly bimodal, with almost 50% of synapses silenced at the low basal weight, unable to regenerate, and the remainder in a narrow distribution centered at very high weights . One other model variant was also simulated, in which the gaussian random variables r1 and r2 that govern the amplitudes of individual ltp and ltd increments were replaced by random variables drawn from exponential distributions (methods). However, these simulations failed to produce synaptic weight distributions that resembled experimental data . If the decay rate constants for the two exponential distributions differed by more than twofold, almost all synaptic weights either ran to infinity (if the mean ltp amplitude was greater) or converged to a low basal synaptic weight imposed as a floor in the model (if the mean ltd amplitude was greater). If the rate constants were similar a positive synaptic weight distribution could be obtained, but the shape of this distribution was itself exponential . All following results are therefore based on the first model variant described above, that of figure 2(a), with synaptic regeneration and an ltp amplitude that decreases with the number of strong synapses in a cluster . Equations and parameter values are in methods . Typical time courses for clusters with regeneration are illustrated in figures 3(a) and 3(b). Strong synapses are much more stable on average, in agreement with data demonstrating that large dendritic spines are more persistent [32, 34, 35]. Strong synapses often maintain high values of w for a year or more, whereas weak synapses show much larger relative (percent) fluctuations in w. weak synapses often drop to a very low basal weight . Silent synapses can regenerate, evident as vertical jumps in time courses near the bottom of figures 3(a)-3(b) (e.g., arrowheads below x - axes). Figure 3(c) illustrates a typical time course for the number of strong synapses nst in a cluster (with weights greater than a threshold tst = 0.8). Clusters are very stable in that, for ncl = 10 synapses per cluster, nst almost always remains between 4 and 7 for years . Simulations with ncl = 15 or 20 also had very stable clusters . However, for a smaller ncl = 5, the model no longer simulated a log - normal synaptic weight distribution at steady state . Recorded synaptic dynamics for many days in cortical neuron cultures . Rather than spine volume, they examined variations in the size of psd-95:gfp puncta, that is, localized concentrations, with a size corresponding to spines, of the postsynaptic density protein psd-95 fused to a gfp fluorophore . Their dynamics are qualitatively consistent with those illustrated in figures 2(a) and 3 in that (1) new synapses were continually formed, (2) synapses whose size was reduced beneath some threshold, analogous to the model threshold twk, were eliminated, and (3) large synapses tended to shrink and small synapses to grow . In accordance with (3), stability of a simulated steady state, unimodal distribution such as that of figure 2(a) requires that individual synapses with weights above the peak of the distribution decrease their weight on average and vice versa for those with low weights . Empirically matsuzaki et al . Found that smaller spines are more likely to undergo stable enlargement in response to an ltp induction protocol . Figure 4(a) illustrates a simulated histogram of the amplitudes of the daily changes in synaptic weight, w, at steady state . The majority of the histogram is fitted well by a normal distribution with the clear exception of the narrow peak close to w = 0 . A scatter plot of w versus w revealed that over almost the entire range of w, the amplitude of w varied from near zero to a peak value of ~0.30.5 . The plot is qualitatively linear, which is not surprising because, in the model, the average daily ltd and ltp amplitudes contain terms proportional to w (methods, (2), (3)). However, the plot further illustrates that the average change in w varies much less than does w itself . As w increases from 0.05 to 2.0, the absolute value of w increases only from ~0.05 to 0.12 . Thus, the relative change in w (i.e., w / w) decreases substantially as w increases . This prediction of the model appears in accordance with the data from yasumatsu et al . But not with the data of loewenstein et al . For which this relative change appears nearly constant (see discussion). However, what if the weight distribution is altered by an imposed large perturbation that sets high weights for a specified subset of synapses? Such a perturbation might correspond to formation of a specific, long - term memory engram . Will the subset of strong synaptic weights remain elevated for months, corresponding to long - lasting storage of a memory? Starting from the distribution of figure 2(a), for all of the 1000 10-synapse clusters, synapses 15 were reset to a high weight of 5.0 at t = 200 days . This weight is well above the steady - state mean w. the other 5 synapses were reset to a low weight (0.5). After the reset, the weights fluctuate but 400 days later, all but one of the strong synapses have maintained w above the steady - state average . Figure 5(b) illustrates the time course of resetting and decay for all 5,000 synapses that were reset to w = 5.0 . Their average weight decays slowly such that 700 days after reset this average is still about twice the steady - state average of w. the lower red trace, one standard deviation below the average weight, is also still above the steady - state average . If the steady - state distribution of w is evolved without any perturbation, the time scale for decorrelation of synaptic weights from their specific values at a given time is, perhaps surprisingly, quite long, similar to the time scale for the decay of perturbed synaptic weights . Starting from the distribution of figure 2(a), the pearson correlation coefficient between the weights of the 10,000 synapses decays with a time constant of approximately 500 days (figure 5(c)), similar to the dynamics of figure 5(b). With simulations of isolated, uncoupled synapses (figure 2(b)), weight distributions were extremely sensitive to model parameters . This model variant was therefore not a plausible description of synaptic dynamics, because biophysical parameters are expected to vary somewhat between spines, dendritic branches, and individual neurons . This sensitivity was eliminated when synapses were modeled as coupled into clusters (~10 synapses). In the model have reported similar spine clusters on primate cortical pyramidal neurons . On a scale of ~410 m along dendritic branches, numerous clusters of 515 spines were identified algorithmically . This distance scale and cluster number appears to correspond to the observations of takahashi et al . That spontaneous coactivation of dendritic spines is clustered, occurring more often for spines within 8 m of each other . We do note recent analysis by a different group failed to support clustering of this type and scale . With coupling into clusters of ~10 synapses, when the dynamics of 1,000 clusters were simulated, the weight distribution of individual synapses converged to a stable steady - state, log - normal form (figure 2(a)). Data illustrates that spines compete for ltp expression; that is, local resources (possibly amounts of key proteins) are limited such that the amount of ltp at a given spine decreases if ltp is simultaneously induced at multiple spines close together on the same dendritic branch . Our mechanism of coupling synapses into clusters is similar in that it corresponds to an additional form of resource competition . However, in the model, competition is generated by ongoing maintenance of multiple synapses rather than only by simultaneous ltp of multiple synapses . Thus, the mean magnitude of ltp at a given synapse during a simulated day was assumed to be a decreasing function of the number of other large synapses in the same cluster (methods). Ongoing maintenance of large spines is assumed to consume resources (proteins, rna) that would otherwise be available for strengthening of neighboring spines, so that their mean ltp magnitude decreased . The competition described by govindarajan et al . Occurs over a distance scale of 1020 m, comparable to, although slightly larger than, the scale of 510 m posited by yadav et al . For clusters of ~510 spines . However, they did determine this rate for another measure of synaptic cross talk, the ability of a weakly stimulated spine to capture plasticity - related factors synthesized in response to strong stimulation of a nearby spine (synaptic tagging and capture, resulting in ltp at the weakly stimulated spine). These data suggest that, for clusters of ~10 spines as simulated here, distance between spines might not limit the efficacy of resource competition . However, these data do not address whether competition could occur over a longer distance scale, for example, 50 m . To assess this question groups of spines spaced along a dendritic branch would need to be concurrently stimulated, and ltp quantified . To simulate a distribution spanning a broad range of synaptic weights, as is observed empirically, it was critical to model synaptic regeneration . To obtain distributions similar to that of figure 2(a), synapses that fell to a low basal weight needed to have, on successive days, a probability of weight reset to a higher, active value . This method of simulating regeneration was chosen to maintain equal average numbers of synaptic loss and regeneration events within any given cluster . Empirically, the number of active spines in a cluster is relatively low (~37). Thus for clusters with low numbers of active spines to serve as functional memory storage units, as suggested by the clustered plasticity hypothesis, the average cluster size would need to be stable to avoid disappearance of clusters . An important question in neuroscience is how the observed regeneration of spines avoids disrupting stored memories or forming spurious memories . It is plausible that new, or regenerated, spines are generically not strong (as in our model) and therefore cannot participate in memory storage unless they are potentiated by stimuli that induce long - term memory . However, further empirical investigation of this question, in conjunction with modeling, is needed . The model of loewenstein et al . Simulates daily changes in the volume of dendritic spines and obtains a steady - state log - normal distribution of spine volumes very similar to the empirical distribution found by these authors . These important results have clarified the necessity of reconciling unimodal weight distributions with stable storage of long - term memory . Their model consists of an ornstein - uhlenbeck stochastic process in which the logarithm of the volume of any given spine is directly incremented each day . The model presented here may constitute a further advance, in that it represents more biophysical elements, such as synapse loss / regeneration and synapse clustering . The ltp and ltd processes in the model (1) act directly on the synaptic weight rather than on its logarithm and (2) can be thought of as due to a large number of individual biochemical events occurring during a simulated day and corresponding to insertion and removal of individual molecular complexes or slots . Point (2) connects the current model with the more detailed molecular model of lisman and raghavachari, in which ltp and ltd correspond, respectively, to insertion and removal of slot complexes, each consisting of a small number of ampa receptors together with associated scaffolding proteins and, possibly, kinases or other signaling proteins . Additional elements of our model that may be consistent with that of lisman and raghavachari are as follows . If over a day, the time intervals between individual insertions of slot complexes as well as the intervals between removals of complexes follow poisson distributions, and if there are on average more than ~20 insertions and removals / day, then by the central limit theorem the sums of these poisson processes will approximate gaussian random variables . These gaussian variables would correspond to the model's gaussian random variables r1 and r2, to which the daily ltp and ltd amplitudes are proportional (2), (3). Similarly, if the individual time intervals were gaussian random variables, their sum would be gaussian . It also appears plausible that average numbers of slot insertions and removals are proportional to the preexisting size of a spine, corresponding to the model assumption that mean ltp and ltd amplitudes are approximately proportional to synaptic weight . Recent data are consistent with these ideas and also suggest such slot complexes include presynaptic components and release sites . Current data has not directly examined whether there is spatial clustering of presynaptic boutons at the distance scale of ~5 m that corresponds to putative postsynaptic spine clusters . However, at this distance scale, such clusters would correspond to a single axon and spines in a cluster would thus be coactivated by a common input, consistent with the hypothesis that such clusters constitute functional units in the formation and storage of specific memories . In the model, the average relative (percent) change in w over a day decreases substantially as w increases (figure 4(b)). This result is essential for the model to represent stable long - term memory storage, because selective stability of strong synapses is only found if the relative change in w decreases in this manner . Are these dynamics supported by current data? Relevant data describes the relationship of spine volume changes v to v. these data are, however, contradictory . Illustrate a substantially larger relative variation in v (figure 4(c) of), such that v and v appear approximately proportional . However, yasumatsu et al . Show a different relationship, for which smaller spines have an average v similar to large spines (figure 1(c) of). It is plausible that the difference in synaptic dynamics in these studies was generated, at least in part, by substantial differences in experimental conditions . Imaged ca1 pyramidal neurons in cultured rat hippocampal slices at postnatal days 1723, whereas loewenstein et al . Did craniotomies to allow in vivo imaging of dendrites in auditory cortex of mice approximately 6 months old . In addition, filopodia (protrusions without spine heads or with very small heads) were eliminated from the former study, but not the latter . Clearly further empirical investigation is needed to clarify these critical aspects of synaptic dynamics . At steady state the magnitudes of the daily changes in weight were distributed approximately normally except for an extra peak centered at w = 0 (figure 4(a)). However, data does indicate that a minor percentage of spines are stable for months or years [24, 25]. These data suggest that a subpopulation of spines with very small daily weight changes might exist, but not yet be resolved due to empirical sensitivity limits . The current model does not represent the biochemical processes that might underlie long - term stability of such a subpopulation . However, recent studies support a relevant hypothesis that ongoing spontaneous neuronal activity is critical for long - term maintenance of synaptic strength . Models have suggested that such activity can preferentially maintain synapses that are already strong possibly by preferentially reactivating stored patterns of strengthened synapses . Empirically, a temporary induced knockdown of nmda receptor function can irreversibly eliminate remote memories, plausibly by preventing spontaneous activity from potentiating and thereby maintaining synapses . Ongoing ltp increments that are necessary to maintain strong synapses, whether single or clustered (as in the current model), may correspond to frequent spontaneous or environmentally induced activity, which may induce repeated cycles of nmda receptor - dependent ltp . Simulations (figures 5(a)-5(b)) illustrate that the model can store a specific memory trace, for ~1 yr, corresponding to persistence of a pattern of strong synapses . However, in humans, some memories persist for many years . In accordance with the hypothesis of govindarajan et al ., such memories might be encoded at the cluster level rather than the single - synapse level, as a set of specific, stable clusters of active synapses . In simulations, they maintained a range of strong synapse numbers (~47) similar to the range suggested by data demonstrating clustering on neocortical pyramidal dendrites . Because each cluster was stable indefinitely, if a pattern of such clusters was established, that pattern would persist . In simulations, stable clusters were found when the total number of synapses in a cluster was 10 (figure 3(c)), or 1520 . However, for five synapses per cluster, anomalous dynamics resulted . A bimodal synaptic weight distribution, not resembling empirical data, we do not take this result to be a prediction of a minimum empirical cluster size . Instead, we believe that the model should be improved in future work to avoid or reduce this dramatic change in dynamics . The model makes additional predictions . When comparing spines of similar sizes in different clusters, the average volume change between imaging sessions is predicted to be less positive (or more negative) if other spines in a cluster are large . In addition, because synaptic weights and spine volumes are not considered bistable, different induction protocols for late, protein - synthesis dependent ltp are predicted to induce clearly different amplitudes of synaptic weight increase or of average spine volume increase . Without bistability, repeated applications of stimulus protocols should, at least in some cases, further enhance l - ltp.
Viruses and cells: the 766 bvdv isolates were kindly provided from 14 livestock hygiene service centers in hokkaido prefecture, japan, from 2006 to 2014 . These viruses were isolated from serum, buffy coat, nasal discharge, pleural effusion, fecal specimen or emulsion of an organ (lung, liver, kidney, spleen, heart or brain) of cattle or aborted fetuses infected with bvdvs . Seventeen of the 766 isolates were cp bvdvs, and the other 749 isolates were ncp bvdvs . For example, bvdv / nakashibetsu/881/10 strain was isolated in 2010 at nakashibetsu, hokkaido, japan . Bvdvs isolated from 2001 to 2006 in hokkaido were described in our previous report and also analyzed genetically and antigenically in the present study . Nose strain (bvdv-1a), is27cp/01 strain (bvdv-1b) and kz-91-ncp strain (bvdv-2a) were selected as reference strains . Hokudai - lab/09 strain (bvdv-2b) was isolated from a commercial fetal bovine serum batch derived from north america . Gbk_e strain (bvdv-2a) was kindly provided from takashi kozasa (national veterinary assay laboratory, kokubunji, japan). The bovine kidney cell line mdbk - hs was propagated in eagle s minimum essential medium (nissui pharmaceutical, tokyo, japan) supplemented with 0.295% tryptose phosphate broth (becton dickinson, san jose, ca, u.s.a . ), 10 mm n, n - bis (2-hydroxyethyl)-2-aminoethanesulfonic acid (sigma - aldrich, st . Louis, mo, u.s.a . ), 0.3 mg / ml l - glutamine (mem - bes) and 10% horse serum (life technologies, carlsbad, ca, u.s.a . ). Bovine fetal muscle (bfm) cell cultures within 20 passages were propagated in mem - bes with 5% horse serum and 5% fetal bovine serum which is free from both bvdv antigens and antibodies (japan bio serum, hiroshima, japan). Mdbk - hs cells were used for virus preparation, and bfm cells were used for cross - neutralization tests . Virus genome sequencing and phylogenetic analysis: viral rna was extracted by trizol ls reagent (life technologies) from the supernatants of mdbk - hs cells inoculated with viruses . The part of 5-utr genome was amplified by reverse transcription (rt) and pcr using the superscript iii one - step rt - pcr system with platinum taq high fidelity (life technologies) and the primer set, 324 and 326 . For amplification of the entire e2 gene, extracted rna was reverse - transcribed with the random primer (n)9 (takara bio, otsu, japan) using the m - mlv reverse transcriptase (life technologies). The entire e2 gene of bvdvs was amplified using primers in supplementary table 1 and ex - taq dna polymerase (takara bio). Nucleotide sequences of pcr fragments were determined using the bigdye terminator v3.1 cycle sequencing kit (life technologies) and the 3500 genetic analyzer (life technologies) according to the manufacturer s protocol . Sequencing data were analyzed using the genetyx network version 12.0.1 software (genetyx, tokyo, japan). The entire e2 sequences of field isolates used for antigenic analysis were deposited in the ddbj / embl / genbank databases under accession numbers described in supplementary table 2 . For phylogenetic analysis, phylogenetic trees based on nucleotide sequences of the 5-utr and the e2 gene were constructed by the maximum - likelihood method and bootstrap analysis (n=1,000) using the mega 6.0 software with default parameters . The sequence data of reference strains were obtained from the ddbj / embl / genbank databases . Statistical analysis: pearson s chi - square test was performed in order to estimate association between viral genotypes and incidences of clinical signs in cattle infected with bvdvs . Fisher s exact test was performed in order to identify the categories responsible for a significant chi - square statistic . Antisera: antisera against is27cp/01, bvdv / nakashibetsu/881/10, bvdv / nakasatsunai/719/09-cp, bvdv / setana/1103/13, bvdv / hamanaka/646/08, gbk_e, hokudai - lab/09 and bvdv / hamanaka/843/10 strains were prepared using slc: jw / csk rabbits (japan slc, hamamatsu, japan). These viruses were injected four times intravenously and intramuscularly with each virus suspension containing approximately 10 tcid50 at 3, 5 and 7 weeks after the first injection . Eight weeks later, sera were obtained and inactivated for 30 min at 56c to be used for cross - neutralization tests . Rabbit antisera against the nose strain (bvdv-1a) and the kz-91-ncp strain (bvdv-2a) were also produced by four times injection and kindly provided from dr . Cross - neutralization tests: cross - neutralization tests were performed in bfm cell cultures grown in 96-well microplates as described previously . Briefly, serial twofold dilutions of sera were prepared in a volume of 25 l in a microplate with cell culture media, mixed with an equal volume of virus suspension containing 200 tcid50 and incubated at 37c for 1 . Then, 100 l of bfm cell suspension (approximately 2 10 cells) were added into all the wells of the microplate and incubated at 37c under 5% co2 for 5 days . The fixed cells were stained using an immunoperoxidase method with anti - ns3 mabs . Each assay was performed in quadruplicate, and neutralization titers were expressed as the reciprocal of the highest dilution that inhibited 50% viral growth . Antigenic similarity (r) values were calculated according to the following formula of archetti and horsfall . Genotyping of the isolates based on the 5-utr nucleotide sequences: the 766 bvdvs were isolated from 2006 to 2014 from pi cattle in hokkaido, japan . Phylogenetic analysis of the 5-utr nucleotide sequences revealed that these isolates were classified as bvdv-1 (544 isolates) and bvdv-2 (222). Bvdv-1 were further divided into bvdv-1a (93 isolates), 1b (371) and 1c (80), and all bvdv-2 isolates were grouped into bvdv-2a (222) (table 1table 1.genotyping of bvdvs isolated in hokkaido from 2006 to 2014year of isolationno . Of isolategenotypebvdv-1bvdv-21a1b1c2a2006662431922007123148212152008851740424200978744101720108311351522201113310501162201210217424392013611319227201435216413total7669337180222a) from april to december . Proportion of subgenotypes 1a, 1b, 1c and 2a was 12.1%, 48.4%, 10.5% and 29.0%, respectively . The sequence identity of the 5-utr was 7275% between bvdv-1 and bvdv-2 isolates, and almost equal to those of the previous report . The sequence identities among bvdv-1 and bvdv-2 isolates were 87100% and 93100%, respectively . B) from january to july . Association between viral subgenotypes and their pathogenicity in cattle: to investigate association between viral subgenotypes and their pathogenicity in cattle, the present isolates were classified according to viral subgenotypes and clinical signs of cattle . Between 43.065.0% of cattle infected with each subgenotype virus showed no clinical signs, and the others showed typical clinical signs of bvd except for no information (fig . (a) the pie charts show percentage incidence of clinical signs in cattle infected with each subgenotype virus . Statistical analysis using pearson s chi - square test and fisher s exact test showed that cattle infected with bvdv-1b viruses showed significantly less clinical signs compared with other subgenotypes (p<0.01). (b) clinical signs frequently observed in cattle infected with bvdvs of each subgenotype . Complications of clinical signs in the same cattle were dually counted for each sign . ). In statistical analyses, pearson s chi - squared test was performed in order to estimate association between viral genotypes and incidences of clinical signs in cattle infected with bvdvs . Difference of viral genotypes significantly relates to incidence of clinical signs in cattle (p<0.01). The percentages of clinical sings of bvdv-1b vs. other subgenotypes were compared with fisher s exact test . This analysis revealed that cattle infected with bvdv-1b viruses significantly showed less clinical signs compared with other subgenotypes (p<0.01). Clinical signs frequently observed in cattle were poor development, diarrhea, respiratory symptoms, reproductive failure, fever, mucosal disease and death (fig . (a) the pie charts show percentage incidence of clinical signs in cattle infected with each subgenotype virus . Statistical analysis using pearson s chi - square test and fisher s exact test showed that cattle infected with bvdv-1b viruses showed significantly less clinical signs compared with other subgenotypes (p<0.01). (b) clinical signs frequently observed in cattle infected with bvdvs of each subgenotype . Complications of clinical signs in the same cattle were dually counted for each sign . Phylogenetic analysis on the basis of nucleotide sequences of the viral glycoprotein e2 gene: the entire e2 genes of bvdv-1a, 1b and 2a isolates were analyzed for more comparative genetic investigation . Thirty - eight isolates of bvdv-1a, 70 isolates of bvdv-1b and 24 isolates of bvdv-2a from 2001 to 2014 in hokkaido were randomly selected for phylogenetic analysis on the basis of the entire e2 array, avoiding biases by year and geographical localization of viral isolation . The bvdv-1a, 1b and 2a isolates in hokkaido were blanched into 5, 5 and 2 clusters by phylogenetic analysis supported with bootstrap values more than 50, respectively (figs . 2.phylogenetic tree of bvdv-1a field isolates based on nucleotide sequences of the entire e2 gene . Nucleotides 1,122 bp of the entire e2 gene were used for phylogenic analysis . The phylogenetic tree of bvdv-1a field isolates was constructed using the maximum - likelihood method and bootstrap analysis (n=1,000) by the mega 6.0 software with 31 sequences obtained from the ddbj / embl / genbank databases and through personal communication . The 38 field isolates in hokkaido were classified as 5 clusters (i v) followed by bootstrap values of phylogenetic analysis . 3.phylogenetic tree of bvdv-1b field isolates based on nucleotide sequences of the entire e2 gene: nucleotides 1,122 bp of the entire e2 gene were used for phylogenic analysis . The phylogenetic tree of bvdv-1b field isolates was constructed using the maximum - likelihood method and bootstrap analysis (n=1,000) by the mega 6.0 software with 33 sequences obtained from the ddbj / embl / genbank databases and through personal communication . The 70 field isolates in hokkaido were classified as 5 clusters (i v) followed by bootstrap values of phylogenetic analysis . 4.phylogenetic tree of bvdv-2a field isolates based on nucleotide sequences of the entire e2 gene: nucleotides 1,116 bp of the entire e2 gene were used for phylogenic analysis . The phylogenetic tree of bvdv-2a field isolates was constructed using the maximum - likelihood method and bootstrap analysis (n=1,000) by the mega 6.0 software with 38 sequences obtained from the ddbj / embl / genbank databases and through personal communication . The 24 field isolates in hokkaido were classified as 2 clusters (i ii) followed by bootstrap values of the phylogenetic analysis . On phylogenetic analysis of the e2 gene, all isolates were classified as the same subgenotypes based on the 5-utr . The classification of each e2 cluster of bvdv-1a and 1b was not biased by year and geographical localization of viral isolation . Only isolates of 2009 and 2010 years were classified as bvdv-2a cluster ii . Phylogenetic tree of bvdv-1a field isolates based on nucleotide sequences of the entire e2 gene . The phylogenetic tree of bvdv-1a field isolates was constructed using the maximum - likelihood method and bootstrap analysis (n=1,000) by the mega 6.0 software with 31 sequences obtained from the ddbj / embl / genbank databases and through personal communication . The 38 field isolates in hokkaido were classified as 5 clusters (i v) followed by bootstrap values of phylogenetic analysis . Phylogenetic tree of bvdv-1b field isolates based on nucleotide sequences of the entire e2 gene: nucleotides 1,122 bp of the entire e2 gene were used for phylogenic analysis . The phylogenetic tree of bvdv-1b field isolates was constructed using the maximum - likelihood method and bootstrap analysis (n=1,000) by the mega 6.0 software with 33 sequences obtained from the ddbj / embl / genbank databases and through personal communication . The 70 field isolates in hokkaido were classified as 5 clusters (i v) followed by bootstrap values of phylogenetic analysis . Phylogenetic tree of bvdv-2a field isolates based on nucleotide sequences of the entire e2 gene: nucleotides 1,116 bp of the entire e2 gene were used for phylogenic analysis . The phylogenetic tree of bvdv-2a field isolates was constructed using the maximum - likelihood method and bootstrap analysis (n=1,000) by the mega 6.0 software with 38 sequences obtained from the ddbj / embl / genbank databases and through personal communication . The 24 field isolates in hokkaido were classified as 2 clusters (i ii) followed by bootstrap values of the phylogenetic analysis . Antigenic analysis of bvdv-1a and 1b field isolates by cross - neutralization tests: to compare the phylogenetic e2 classification and the antigenicity, 8 isolates of bvdv-1a and 10 isolates of bvdv-1b were randomly selected from each e2 cluster for cross - neutralization tests, avoiding biases by year and geographical localization of viral isolation . Nose (bvdv-1a) and is27cp/01 (bvdv-1b) strains were also analyzed as representative strains of each subgenotype . Rabbit antisera against bvdv-1b field isolates, bvdv / nakashibetsu/881/10, bvdv / nakasatsunai/719/09-cp, bvdv / setana/1103/13 and bvdv / hamanaka/646/08 strains were prepared to analyze antigenic property of each bvdv-1b e2 cluster . The cross - neutralization tests showed 4 to 64-fold antigenic differences between bvdv-1a and 1b isolates in japan (table 2table 2.cross-neutralization titers of antisera raised against different strains of bvdv-1a and 1bsubgenotypecluster of e2 genevirusantisera against bvdvs1a1bnosecluster icluster iicluster iiicluster ivcluster vis27cp/01nakashibetsu /881/10nakasatsunai /719/09-cpsetana/1103/12hamanaka /646/081acluster inose2,04864643212864betsukai/503/072,04864643212832monbetsu/205/041,0246432326432cluster iimonbetsu/03/01-cp1,0246464163232betsukai/669/081,0246432326464cluster iiioketo/277/042,04864643212864kamiyuubetsu/08/022,04864323212864cluster ivakkeshi/710/091,0246432163232cluster vhamatonbetsu/1191/131,02412816161281281bcluster iis27cp/01256512256256128128yuubetsu/10/01256512256256512256okoppe/89/01256256256256256128betsukai/884/10128512256128512256cluster iisaroma/23/022562561,024256512256nakashibetsu/856/102565121,024512256256nakashibetsu/881/101285121,0241,024256128cluster iiinakasatsunai/583/07256128256512256256nakasatsunai/719/09-cp256128128512256128cluster ivsetana/1103/1225612825625651264cluster vhamanaka/646/08641286464128512a) neutralization titers are expressed as the reciprocal of the highest dilution that inhibits 50% viral growth, and homologous titers are described in bold . B) bvdv/ is omitted from the name of field isolates . ). Antigenic similarity (r) values of bvdv-1a and 1b strains were 6.3 to 17.7, which suggested significant antigenic differences between bvdv-1a and 1b subgenotypes . The cross - neutralization tests of bvdv-1a field isolates showed 1 to 2-fold antigenic differences against bvdv-1a nose strain, and this result indicated that antigenicity of bvdv-1a isolates was similar regardless of further classification by e2 array . Bvdv-1b field isolates of clusters i, ii, iii and iv showed 8-fold or less antigenic differences, and r values were 25.0 to 50.0 . These results indicated that antigenicity of these bvdv-1b isolates was almost similar among e2 clusters . The bvdv / hamanaka/646/08 strain of bvdv-1b cluster v showed lowest neutralization titers compared with other bvdv-1b isolates, and r values compared with other e2 clusters were 12.5 to 25.0 . These results indicated that the antigenicity of this isolate was slightly different from other bvdv-1b isolates . A) neutralization titers are expressed as the reciprocal of the highest dilution that inhibits 50% viral growth, and homologous titers are described in bold . Antigenic analysis of bvdv-2a field isolates by cross - neutralization tests: the 6 isolates of bvdv-2a were also selected for antigenic analysis by cross - neutralization tests based on the same criteria . Kz-91-ncp (bvdv-2a), gbk_e (bvdv-2a) and hokudai - lab/09 (bvdv-2b) strains were also analyzed as representative strains of each subgenotype . Rabbit antisera against the bvdv / hamanaka/843/10 strain were prepared to analyze antigenic property of bvdv-2a cluster ii . The cross - neutralization tests showed 2 to 16-fold antigenic differences, comparing with bvdv-2a and 2b (table 3table 3.cross-neutralization titers of antisera raised against different strains of bvdv-2subgenotypecluster of e2 genevirusantisera against bvdvs2a2bkz-91-ncphamanaka /843/10gbk_ehokudai - lab/092acluster ikz-91-ncp512641632yuubetsu/71/015121286464okoppe/458/052561283264honbetsu/597/07256641664akkeshi/1170/13256641632cluster iihamanaka/843/101281281616shikaoi/909/10128128816gbk_e12812812882bhokudai - lab/092566432128a) neutralization titers are expressed as the reciprocal of the highest dilution that inhibits 50% viral growth, and homologous titers are described in bold . B) bvdv/ is omitted from the name of field isolates . ). The r values among subgenotypes were 12.5 to 35.4, and significant antigenic differences were not observed among bvdv-2 subgenotypes . The cross - neutralization tests of bvdv-2a field isolates showed 1 to 4-fold antigenic differences, and antigenicity of bvdv-2a field isolates was almost similar among e2 clusters . A) neutralization titers are expressed as the reciprocal of the highest dilution that inhibits 50% viral growth, and homologous titers are described in bold . Bvdvs have been detected since 1969 in japan, and bvd has not been eradicated as yet . Approximately 60% of dairy cattle and 20% of beef cattle in a total of japan are raised in the hokkaido prefecture, and thus, it is important to control bvd in this area . The 766 bvdvs were isolated from cattle or aborted fetuses by the 14 livestock hygiene service centers of hokkaido prefecture from 2006 to 2014, and now, we have a total of 1,155 field isolates since 2001 . To confirm a diagnosis of persistent infection with bvdvs, cattle should be retested after an interval of at least 3 weeks . In japan, most of cattle were not retested, because of economic losses by detention of viral pollutant in herds . These infected cattle were sporadically identified in herds, not in a group, and thus, almost of these cattle can be considered as pi cattle . To investigate recent epidemics in hokkaido for the control of bvd phylogenetic analysis on the basis of the 5-utr revealed that field isolates were divided into bvdv-1a, 1b, 1c and 2a . These subgenotype viruses have been circulating at least since 2001 in hokkaido, japan, but hobi - like viruses (bvdv-3) were not detected from field isolates by the present phylogenetic analysis . On classification of bvdv-2 subgenotypes, some criteria were reported in the previous studies [19, 34, 41]. In the present study, the classification of bvdv-2 isolates was followed using that of peterhans et al ., and all japanese bvdv-2 strains were classified as bvdv-2a . In japan, no epidemic has been reported, that was caused by highly pathogenic bvdv-2 viruses, such as the 890 strain isolated in north america or the nrw 19 - 13 - 8 strain recently isolated in germany . Taken together, bvdv-1b viruses are still predominant, and bvdv-2a has increased since 2011 in hokkaido, japan . Interestingly, statistical analysis showed that bvdv-1b isolates in hokkaido tended to result in less clinical signs in cattle . This result may indicate that the predominance of bvdv-1b is due to difficulty of diagnosis by clinical signs . Inactivated vaccines containing bvdv-1a and 2a antigens and live - attenuated vaccines containing bvdv-1a antigen had been used widely in japan until 2014, whereas bvdv-1b and 2a viruses were predominant recently in hokkaido . Therefore, we analyzed nucleotide sequences of the e2 of bvdv-1a, 1b and 2a field isolates from 2001 to 2014, since the e2 is a main target of immune responses in hosts and important for viral antigenicity [12, 13]. These field isolates were further classified, supported with bootstrap values in the phylogenetic trees . Regardless of the classification of e2 clusters, all bvdv-1a and 2a field isolates were antigenically similar . Antigenicity of bvdv-1b isolates was almost similar among e2 clusters, while only one isolate of bvdv-1b cluster v, bvdv / hamanaka/646/08 strain, showed antigenic difference . The bvdv / hamanaka/646/08 strain was blanched into the most distant cluster from other bvdv-1b clusters and showed the lowest identity of the e2 gene (8488%) with other bvdv-1b isolates . These results indicate that genetic differences on the e2 gene correlate with differences in viral antigenicity, and thus, phylogenetic analysis on the e2 array improves understanding of viral antigenicity in detail . Additionally, the isolates of bvdv-1b clusters iv and v were blanched into the same cluster with osloss strain, which was classified as bvdv-1b2, and it is the first report of isolation of bvdv-1b1 viruses in japan . Bvdv / setana/1103/13 strain of bvdv-1b cluster iv was antigenically similar with bvdv-1b2 viruses, and antigenicity could not be clearly distinguished between bvdv-1b1 and 1b2 viruses . Taken together, it has been confirmed that the bvdv-1a, 1b and 2a isolates are likely to be antigenically conserved among each subgenotype during the last 14 years in hokkaido, japan . Antigenic diversity among subgenotypes of bvdv-1 has been well demonstrated [1, 3, 28, 31, 36]. Japanese bvdv-1a and 1b viruses showed significant antigenic differences in the previous studies [28, 31], and the present study also showed antigenic differences between bvdv-1a and 1b isolates in hokkaido, supported by r values (6.3 to 17.7) lower than 25.0 . In contrast, bvdv-1a and 1b isolates in other countries, such as switzerland, u.s.a . And argentina, showed higher r values (24.2 to 50.0) [1, 3, 36]. In such countries, the several reports also showed that bvdv-1a vaccines can induce only lower antibody titers against bvdv-1b viruses [14, 32, 36], and some authors discussed that this antigenic difference may lead to predominance of bvdv-1b viruses over the other subgenotypes [14, 36]. In japan, there are no complete data of the frequency of vaccination in cattle, and thus, it is still unclear whether the predominant situation of bvdv-1b viruses was due to bvdv-1a vaccine pressure or not . Recently, a commercial inactivated vaccine containing bvdv-1b and 2a strains and a live attenuated vaccine containing bvdv-1a and 2a strains have become available in japan, and further studies are needed to consider the epidemiological impact of these vaccines on the predominant bvdvs . In summary, we revealed that bvdv-1b and 2a viruses were recently predominant in hokkaido, japan . Bvdv-1a, 1b and 2a isolates show genetic diversity on the e2 gene with antigenic conservation among each subgenotype during the last 14 years . Based on the present study, it is required to use effective vaccine against predominant field isolates for the control of bvd in japan . Vaccination as a stand - alone control measure is not adequate in preventing viral circulation [18, 23], and thus, it is important to both stamp out pi cattle and to use effective vaccines for reduction of pi cattle to control bvd.
Insufficiency fractures occur in weakened bones unable to withstand even the stresses of normal daily activities . Spine, pelvis and long bones of lower extremities are common sites of insufficiency fracture . Cases of sternal insufficiency fracture have been rarely reported in an elderly patient with osteoporosis or chronic obstructive pulmonary disease (copd) taking corticosteroid osteoporosis often leads to thoracic kyphosis secondary to thoracic compression fracture . Thoracic kyphosis may cause a bending stress on the sternum, which may result in sternal insufficiency fracture . To make the diagnosis of sternal insufficiency fracture, spontaneous fracture of sternum secondary to secondary neoplasm, lymphomatous infiltration and myelomatosis must be excluded . It has been emphasized that sternal insufficiency fracture should be considered in the differential diagnosis of acute chest pain in the elderly . Bone scintigraph contributes to the early diagnosis and chest computed tomography can confirm the diagnosis and rule out the possibilities of metastatic spread . Therapy for underlying causes, as well as pain control, must be included for the treatment of sternal insufficiency fracture . We describe here a case of sternal insufficiency fracture in a patient with long - standing copd who had osteoporosis and thoracic kyphosis . A 72-year - old woman, a smoker with a 15 years history of copd, was admitted to our hospital because of anterior chest pain for 20 days . Auscultation of the chest showed coarse breathing sound without rale and heart sound was normal . Her initial laboratory findings were as follows: hematocrit 42.1%, leukocyte count 11,600 10/mm (neutrophil 71.8%, lymphocyte 20%, monocyte 7.4%, eosinophil 0.3%), platelet count 235,000 10/mm . The values for glucose, liver function, renal function, muscle enzyme and electrolytes were normal . Arterial blood gas on room air revealed ph 7.443, po2 of 64.7 mmhg, pco2 of 38.9 mmhg, bicarbonate 26 mmol / l and o2 saturation of 93.7% . Lateral radiograph of the sternum showed buckling fracture of the upper body of the sternum (fig . 1), but her previous lateral radiograph of the sternum obtained 3 months ago revealed normal appearance . Lateral chest radiograph demonstrated compression fracture of the 5th and 8th thoracic spine and osteoporosis through the spine (fig . Bone scintigraph showed increased uptake at the upper body of the sternum, costovertebral junction of both 2nd and 4th ribs, and compression fracture with hot uptake at 2nd, 3rd lumbar vertebrae (fig . Chest ct revealed cortical breakage at the posterior aspect of the sternum with soft tissue swelling (fig . Lumbar spine bone density measured by dual energy x - ray absorptiometry was reduced to 0.735 g / cm (t score;3.21) at the level of l2 . Stress fractures are classified as fatigue and insufficiency fracture depending on the amount of stress applied to bone and on the elastic properties of the bone . Insufficiency fracture occurs when the elastic resistance of bone is inadequate to withstand the stresses of normal activity . The sternum is an integral part of the thoracic cage, and slight movement at the manubirosternal joints aids expansion of the chest during inspiration . The stresses of sudden forward angulation of the thoracic spine in violent flexion are transmitted to the sternum by the ribs and clavicles . Bone loss with age and loss of elasticity associated with ossification of the costal cartilage are major predisposing factors for sternal insufficiency fracture . Bones weakened by osteopenia have insufficient elastic resistance to withstand even the minimal stress of normal daily activity . Sternal insufficiency fracture, which has been attributed to chronically applied flexion compression stress to the sternum caused by accentuated thoracic kyphosis, results from acute flexion - compression stress applied to the weakened sternum, particularly during forward bending . But chen et al . Reported that sternal insufficiency fracture may occur with or without thoracic kyphosis . They classified sternal insufficiency fracture into two types- nonbuckling or buckling- and reported that all buckling fractures were associated with thoracic kyphosis, whereas nonbuckling fracture may be presented with or without thoracic kyphosis . Reported spontaneous sternal fractures in four patients with chronic obstructive pulmonary disease taking corticosteroid and suggested that corticosteroids treatment and limited mobility secondary to their lung disease caused accelerated trabecular bone loss, which, in turn, lead to progressive thoracic kyphosis and deforming stress to the sternum . Our patient has suffered from copd and has been taking corticosteroid for 15 years . In most cases, sternal insufficiency fractures occur at the junction between the superior third and the two inferior thirds of the sternal body . If sternal fractures were accompanied by osteolysis and adjacent soft - tissue swelling, pathologic fracture must be considered . Spontaneous sternal fractures have been also reported in patients with myeloma, metastatic cancer, lymphomatous infiltration, during labour or athletic activities . In our patient, pathologic fractures could be excluded on the basis of clinical findings and absence of osteolysis . The chest pain may be similar to that of myocardial infarction, acute pericarditis, pulmonary embolism and reflux esophagitis . Cardiopulmonary disorders as underlying causes of chest pain could be ruled out by the electrocardiograph, laboratory findings and clinical course in our patient . Dyspnea in copd patients with sternal insufficiency fracture can be aggravated by paradoxical movement of the upper fractured fragment . If sternal insufficiency fracture is clinically unsuspected, radiological investigation and accurate diagnosis might be delayed . Sternal insufficiency fracture can be confirmed by lateral chest radiographs which provide information about the location of the fracture, the stage in the process of callus formation, additional thoracic vertebral fractures and thoracic kyphosis . Bone scintigraphy is a very useful diagnostic tool in the diagnosis of insufficiency fracture in various sites, such as the sternum . Bone scintigraphy, which shows an intense horizontal or oblique uptake, contributes to an early diagnosis . In most cases, increased uptake on bone scan is observed within 72 hours at the fracture sites, but the bone scan may detect insufficiency fracture as early as 1 day after occurrence . It is also useful in monitoring the healing process through gradual decrease in uptake intensity . The minimum time for return to normal is 5 months and, in 90% of patients, the abnormal uptake disappears within 2 years . Computed tomography provides information on the location, extent and stage of repair and helps exclude the possibility of infection and malignancy . Bone biopsy must be considered only in cases which are suspicious of malignancy and infection . Abundant granulation tissue with reactive bone and hyaline cartilage are the main histological features in bone biopsy specimens from the insufficiency fracture . Calcitonin therapy seems to be effective through both its analgesic and anti - osteoclastic effects . In addition, the underlying causes for osteoporosis should be recognized and specifically treated . In summary, sternal insufficiency fracture should be included in the differential diagnosis of acute chest pain or aggravating dyspnea in copd patients, and radiologic studies, such as lateral chest radiography, bone scintigraph or ct, must be considered.
Forward head posture is anterior positioning of the cervical spine, which is regarded as a bad head posture and is commonly found in patients who experience problems with the head and neck1 . Particularly, forward head posture is frequently found in people sitting in front of a computer for prolonged periods . Load increases in the muscles and joints of the cervical spine as a result of forward head posture are considered a major cause of musculoskeletal disorders2 . Sustained computer work affects the range of cervical flexion, especially in the upper cervical part3, and forward head posture is related to reduced proprioception4 . Respiration is a complex function that involves cooperation between the musculoskeletal and nervous systems, by which air can move in and out of the lungs according to changes in the volume of the rib cage5 . The loss of respiratory functions is related to functional disorders associated with trunk posture and weakening of the respiratory muscles6 . Forward head posture reduces muscle power in the neck, which is followed by a reduction in muscle power of the respiratory muscles . Thus, damage in the respiratory muscles is associated with damage of the motor control in the cervical spine . In addition, forward head posture has a negative effect on the expansion of the thorax and alveolar ventilation, thereby reducing the lung volume and vital capacity as well as weakening respirator functions7 . Joint mobilization is a method that applies traction and gliding techniques passively to the articular surface in order to maintain or recover mobility back to the normal state . These movements are applied by a physical therapist, and this is a passive technique that is performed at slow speed, allowing the patients to stop the movement by themselves . Mulligan first proposed the use of sustained natural apophyseal glide (snag) mobilization, which can be applied for spinal pain treatment8 . The concept of snag is to increase the treatment effects by having patients perform active movements while removing pain in the lesions by means of manipulative therapy . This is a new concept in the manipulative therapy field, and differs from traditional manipulative therapy by combining the active movements of the patients with additional passive movements performed with the aid of therapists9 . It should be noted that while applying snag mobilization, the therapist needs to apply the exercise to be horizontal or perpendicular to the joint, and the movements of the patient should be performed within a range in which the patient does not feel any pain . At the end of the joint movement silveria et al.10 revealed that respiratory functions can change as a result of forward head posture and that inappropriate posture may worsen respiratory functions, particularly in patients with respiratory diseases11 . Furthermore, forward head posture can induce inappropriate posture, thereby causing compensation mechanisms to increase the respiratory functions, and kim et al.12 moreover reported that forward head posture induced weakening of the respiratory functions . Thus, the purpose of this study was to determine the effects of the cervical snag mobilization proposed by mulligan on forward head posture and various respiratory functions . The study subjects included individuals whose craniovertebral angle was 4913 in order to determine the effects of cervical snag manipulative therapy on forward head posture and respiratory function, and the subjects were randomly classified into an experimental group receiving cervical snag and a control group not receiving the intervention . The changes after the exercise were measured and compared against the baseline and between the two groups . This study conducted experiments with male and female adults in their 20s who had forward head posture . Thirty subjects who understood the purpose of this study and participated voluntarily were randomly classified into the experimental (15 subjects) and control groups (15 subjects). The exclusion criteria were as follows: subjects who had undergone operations in the spinal bones or chest, had traumatic neck injury, had acute or chronic neuromuscular pain not related to other body parts, had severe obesity (body mass index [bmi]>40 kg / m), had clinical abnormalities in the rib cage or spine, had severe comorbid diseases, had diabetes or malignant tumors, and who were smokers . Subjects in the experimental group underwent cervical snag manipulative therapy as an intervention to treat forward head posture for flexion and extension, eight times per set, three times a week for four weeks . During the therapy, the subjects were seated on chairs with back support while a therapist was positioned behind the subject . The therapist applied a force to the spinous process in the upper side of the fixed joint with the thumb of the right hand and applied a passive gliding exercise continuously, while the left thumb was placed with the right thumb . The gliding exercise of the cervical snag for cervical flexion was performed by the subjects actively repeating flexion of their necks and returning back to the neutral position . In addition, cervical snag for extension was conducted by the subjects repeatedly performing extension of their necks and returning back to the neutral position . Here, the application of the passive gliding exercise maintained its direction in the anterosuperior direction along the line of the articular surface of the facet joint while flexing the neck and returning back to the neutral position, as well as when extending the neck and returning back to the neutral position repeatedly8 . To determine whether the subjects had forward head posture or not, the craniovertebral angle was measure while respiratory function was measured using a spirometer . The craniovertebral angle is measured to determine the presence of forward head posture, which is assessed by the head position when observed laterally at the seventh cervical (c7) vertebra . This angle is formed by a horizontal line drawn through the spinous process of the c7 vertebra and a line joining the spinous process of the c7 vertebra with the tragus of the ear . For the measurement, the subjects maintained the upright posture while relaxing both their arms next to their trunk and gazed at a predetermined point according to their eye height . To measure the accurate position while taking a picture, positions of the tragus of the ear and the spinous process of the c7 vertebra were marked . Once a photo was shot laterally using a digital camera (ixus951s; canon, china), the craniovertebral angle was calculated using imagej software (rasband, usa)15 . According to the study by nemmers et al.13, forward head posture is defined by a craniovertebral angle in the range of 4959. thus, this study set the criterion of forward head posture as 49 in terms of the craniovertebral angle . The respiratory functions of each subject were measured using a spirometer (sp-260 pneumotacho sensor; schiller ag, switzerland). Three measurements were taken and the mean was chosen as the test result if they showed reproducibility . The measurements were performed while the subjects were in the upright position, and included forced vital capacity (fvc),% predicted value of forced vital capacity (fvc% pred . ), forced expiratory volume in one second (fev1), and% predicted value of the forced expiratory volume in one second (fev1%pred . ). Differences in the forward head posture and respiratory functions between the two groups before and after the experiment were analyzed using the mann - whitney u test, whereas the differences in forward head posture and respiratory functions before and after the treatment period within a group were analyzed using the wilcoxon signed - rank test . This study was approved by the bioethics committee of the catholic university of pusan (cupirb-2013 - 015). The average age, height, weight, bmi, craniovertebral angle, fvc, fvc% pred ., fev1, and fev1%pred ., were 22.07 years, 167.93 cm, 65.20 kg, 22.94 kg / m, 45.74, 3.54 l, 84.07%, 3.27 l, and 90.20%, respectively, in the experimental group . In the control group, the corresponding values were 21.47 years, 170.13 cm, 62.33 kg, 21.54 kg / m, 46.26, 3.91 l, 88.47%, 3.68 l, and 97.07%, respectively . There were no significant differences in the general characteristics and variables between the two groups before the experiment . The analysis results of the respiratory functions showed that the subjects in both groups had normal fvc and fev1/fvc . The craniovertebral angle of the subjects in the experimental group increased significantly after four weeks of intervention (p<0.05). In the control group, there was no significant difference in the craniovertebral angle before and after the four - week experiment (p>0.05) (table 1table 1.comparison of the cva and respiratory functions between the experimental (n=15) and control groups (n=15)grouppre testpost test(mean sd)(mean sd)cva ()experimental45.743.1652.322.68*control46.262.2347.412.53fvc (l)experimental3.540.753.750.65*control3.910.623.940.83fvc% pred.experimental84.079.1589.679.38*control88.477.8689.5310.68fev1 (l)experimental3.270.753.490.64*control3.680.723.830.79fev1%pred.experimental90.2010.9296.609.36*control97.076.83100.6710.08cva: craniovertebral angle, sd: standard deviation, fvc: forced vital capacity, fev1: forced expiratory volume at one second,% pred . Cva: craniovertebral angle, sd: standard deviation, fvc: forced vital capacity, fev1: forced expiratory volume at one second,% pred . : percent predicted value, * p <0.05 moreover, the respiratory functions in the experimental group before and after the intervention were compared, and the result showed that the fvc, fvc% pred ., fev1 and fev1%pred . However, there were no significant differences in the control group (p>0.05) (table 1). Movements of the thorax can be controlled by coordinated movements among the spine, ribs, and surrounding joints . Forward head posture can increase kyphosis, and excessive kyphosis of the thoracic spine due to forward head posture can reduce the mobility of the thorax, thereby having a negative effect on the respiration capabilities15, 16 . In addition, changes in the posture have been known to affect the length of the respiratory muscles during the breathing rest17 . Kim et al.12 measured the craniovertebral angle of healthy adults in their 20s and studied 15 subjects with forward head posture (experimental group) and 15 healthy adults (control group) by measuring and comparing their respiratory functions . Of the subjects in the experimental group was 81.95%, while that of the control group was 93.54% . Moreover, the mean fev1%pred . Of the subjects in the experimental group was 90.20%, while that of the control group was 99.62%, indicating that the respiration functions in the experimental group were significantly lower than those of the control group . In a study by oh18, the subjects were divided into a joint mobilization group, for which cervical snag mobilization was applied; a neuro - feedback group; and a control group, and changes in the neck postures after the treatments were compared . The results showed that joint mobilization had the most significant effect on postural improvements in the neck . In the present study, there was no significant difference in the craniovertebral angle between the two groups before the intervention, whereas the experimental group showed significant improvements after four weeks of intervention . On the other hand, no significant changes were observed in the control group after the four - week period . Hence, these results suggest that cervical snag mobilization is effective in improving forward head posture . Kim19 divided subjects with forward head posture into an experimental group, for which the mckenzie intervention was applied, and a control group . No significant differences in respiration functions were observed between the groups before the intervention, whereas significant improvements were noted in the subjects in the experimental group after four weeks of intervention . Furthermore, another previous study aimed to determine the effect of thoracic spine posture correction using chiropractic manipulations, and divided the subjects into a thoracic spine correction group using manual therapy and a thoracic spine correction group using an impulse gun, after which the differences in vital capacity were compared before and after the interventions . The results revealed that the subjects in both groups showed significantly increased vital capacity after the interventions20 . In our study, the experimental group demonstrated significantly improved respiration functions after the intervention, whereas no significant differences were observed in the control group compared to at baseline . Accordingly, after the four - week intervention, statistically significant differences in the respiration functions were found between the experimental and control groups . Hwangbo21 conducted experiments with 45 chronic neck pain patients who had thoracic kyphosis and divided the subjects into thoracic joint mobilization, self - stretching exercise, and thoracic joint mobilization plus self - stretching exercise groups . All three groups showed significantly improved joint range of motion and respiratory functions after the interventions . The above study results are consistent with those of the present study, in which postural correction through manipulative therapy was found to be an effective method for recovering and improving respiratory functions . In conclusion, cervical snag mobilization, which has been previously shown to reduce neck pain and increase the joint range of motion, can also help recover the posture of persons with forward head posture and improve their respiratory functions . As a limitation of this study, the experiments were conducted only on young adults in their 20s, and the effects of this treatment on people of various ages were not examined . Furthermore, our study also did not verify how long the effects are maintained after the intervention . Therefore, it will be necessary to conduct a study on the effects of cervical snag mobilization on forward head posture and respiratory functions in subjects of various ages and to determine how long the effects continue after the intervention in the future.
In the previous issue of critical care, nakos and colleagues presented interesting experimental research in sheep, reporting beneficial effects of the prone position on the damage of mechanical ventilation (mv) on lung tissue and apoptosis in several vital organs . These observations are an interesting addition to a number of experimental and clinical studies showing that mv can initiate as well as exacerbate lung injury, and can worsen other vital organ function . Ventilator - induced injury (vili) can thereby contribute to an unfavourable outcome . At least two different basic mechanisms are involved in vili and peripheral organ dysfunction: direct mechanical lung damage and enhancement of inflammatory changes in pulmonary tissue . As a result, subsequent pathophysiological pathways contribute to clinical symptoms and morbidity, including translocation of inflammatory mediators, endotoxins and bacteria from the lung to the systemic circulation . The clinical relevance of vili in the intensive care unit is confirmed by the beneficial effects on outcome of protective ventilatory techniques, including the use of lower tidal volumes and plateau pressures, as well as higher levels of positive end - expiratory pressure . The study of nakos and colleagues expands the findings of two recent publications on potentially beneficial effects of the prone position on vili and its systemic complications . In an experimental work on normal rats, valenza and colleagues observed a more homogeneous distribution of lung strain during mv in the prone position, assessed by computed tomography . These data suggest that a better distribution of alveolar ventilation in the prone position could be the cause of the delayed occurrence of vili compared with the supine position . In the other recent investigation, mentzelopoulos and colleagues examined the overall parenchymal lung stress and strain, estimated from the transpulmonary plateau pressure and the tidal volume to end - expiratory lung volume ratio, in 10 patients with severe ards . Both of these indexes were reduced in the prone position compared with the semirecumbant position . This suggests that lung tissue damage by vili can be reduced by the prone position . In the aforementioned study of vili in normal sheep, nakos and colleagues it is noteworthy that the type of mv used (tidal volume of 15 ml / kg body weight and positive end - expiratory pressure of 3 cmh2o) for a duration of only 90 minutes did produce marked alterations in the lung and certain distal organs . The prone position made a significant difference only for the lung, the liver and the diaphragm . In contrast, apoptotic changes in the kidney, the brain and the intestine were no different between the supine and prone positions . How could these findings be explained? First, the modifications of lung histology observed are in line with some earlier studies [7,9 - 12] and could be explained by differences in the distribution of ventilation, in tissular stress and strain as well as in changes of interactions between the weight of the heart and underlying lung tissue in the supine and prone positions . More novel approaches may be needed to explain the different intensities of apoptosis observed in different organs . Although such observations have been reported previously, little is known about the causes of programmed cell death in this situation . One of the suggested mechanisms could be the increased systemic plasma levels of inflammatory mediators and proaptotic soluble factors such as fas ligand, but this does not explain the profound differences between some organs . Other factors such as different sensibility for these circulating proteins and/or differences in organ perfusion between the supine and prone positions may explain the more protective effect of the prone position for the liver and the diaphragm than for the kidney and the intestine epithelial cells . These changes in cell biology induced by mv and the protective role of the body position seem an exciting area for further research . The optimal position in an intensive care unit patient in regard to vili remains to be defined, and it could be different from the sheep model studied by nakos and colleagues.
Pollens are important allergens which trigger symptoms in patients with allergic diseases such as allergic rhinitis (ar) and asthma . Pollens during pollination period generally trigger asthma . At the time of seasonal peaks, large number of pollen grains are liberated from the trees and remain suspended in the air . In various studies, it was observed that number of patients attending hospital increases with higher pollen count in that period . Therefore, knowledge about pollen season of the area may prove an important tool for a doctor treating asthmatic patients . Pollen count varies at different places and is affected by the topographical factors, local vegetation of the area, and meteorological factors . Pollen calendar is a useful tool in the diagnosis and management of allergic disorders . During pollination season, sensitive subjects develop symptoms of the disease, therefore, chances of getting new patients increases . However, we could not find significant indian data relating pollen counts with clinical symptoms except a jaipur study carried out in 19571958 . Therefore, we conducted this study to characterize main types of pollens in jaipur and to find a correlation with the hospital visit of new patients of asthma and ar . The study was carried out at asthma bhawan, located in the western part of jaipur . New patients of ar and asthma who were residents of jaipur were included in the study . Skin prick tests (spts) were performed using allergen extracts, saline as negative control and histamine as positive control . It was considered positive when wheal diameter was more than 3 mm of size, or it was with pseudopodia formation . Pollen sampling was carried out from january 1, 2011, to december 31, 2012 . The aerobiological samples of pollens were collected through burkard 24 h spore trap system, which is a type of suction sampler . Although sampling collected at multiple places is desirable yet pollen sampling carried at one place is also shown be representative of 30 km radius area . The method of pollen collection, preparation of slide and analysis of sample had been described . The counts represent number of pollens per cubic meter of air in 24 h. traditionally different species of poaceae and cheno - amaranthaceae family are not described separately . However, we were able to differentiate some of the species from the poaceae family . These include cynodon, hordeum vulgare, pennisetum glaucum, saccharum munja, sorghum vulgare, triticum aestivum, and zea mays . Similarly, the identifiable pollens of cheno - amaranthaceae family were amaranthus spinosus, spinacia oleracea, and chenopodium album . Most of the pollens of chenopodiaceae and amaranthaceae family which could not be differentiated were grouped under the heading of cheno - amaranthaceae . The total number of new patients attending the hospital during 12 months was averaged for 2 years . Pollen counts of various species were also used in making the pollen calendar of the jaipur . An average monthly pollen count of trees, weeds, and grasses were correlated with an average number of new patients during that month . Correlation of the spt with the pollen counts of both years was also done using pearson correlation coefficient . An average monthly pollen count of trees, weeds, and grasses were correlated with an average number of new patients during that month . Correlation of the spt with the pollen counts of both years was also done using pearson correlation coefficient . During 2011 and 2012, the average number of new patients of asthma and ar per year attending asthma bhawan outpatient department was 1692.5 . During these years the numbers of pollen trapped were 13,738 and 15,183 respectively with yearly average of 14,460.5 pollens [table 1]. Analysis of pollen data of 2 years showed 37 types of pollen species or families . Since many of these pollens were identified only after this study therefore during this period, spt tests were carried out for only 17 pollens as identified in the earlier study . Average pollen counts and number of new outpatient department patients during 12 months and their correlation two seasonal peaks of pollen count were observed . The first peak was mainly due to trees pollens while the second peak was due to weeds and grasses pollens . Major part of the first peak was in march, and it had holoptelea (65%) as the major contributor . While major part of the second peak was contributed by grasses family . In the second season, september had the highest number, and the grasses (38%) contributed the most . The main contributors of the total pollen counts for 2 years were poaceace family (42%) and cheno - amaranthaceae family (30%). During january and cheno - amaranthaceae, poaceace, and holoptelea integrifolia are the highest pollen generating plant family / species [table 2]. Top ten pollen generating plant families / species during 2 years in this study, 37 types of pollen species / families were identified in the 2 years duration . Out of these 25 species / families were having a limited period of pollination in the year and 12 species / families had their pollens in the aerobiology of jaipur throughout the year . Pollen calendar was prepared based on the presence of different pollens in specific part of the year [figure 1]. Pollen calendar of the pollens in jaipur when average monthly pollen counts were correlated with the number of new patients during that period, a positive correlation was found with grass pollens . The correlation of the individual pollen with the spt of patients gave the correlation in only one of the species that is c. album, a weed . Pollen count peaks were observed during march to april and august to october in both years . Many studies have demonstrated that peak pollen counts were associated with higher number of hospital visits by new asthmatic or ar patients . In our study also a significant positive correlation was demonstrated between number of monthly new asthmatic and ar patients and grass pollen count . However, correlation was not significant with weeds and trees . Although in the study done in kuwait, the number of new patients of ar were significantly correlated with weeds but not to grass and trees . In yet another study, episodes of asthma exacerbations in children were significantly correlated with pollen counts . The cause and effect relationship was further established in a study wherein a cohort of asthmatic patients exacerbations were monitored at monthly interval, and these were significantly correlated with the pollen counts in the environment . Similarly, an earlier study done in jaipur in 19571958 showed that the number of respiratory allergy patients in allergy clinic were proportional to the fluctuation in the pollen count . All these evidence suggest strong association between the presence of respiratory symptoms and presence of pollens in the environment . It emphasizes the need of proper knowledge of pulmonologists about the environmental pollens and vegetations of the area . A proper pollen calendar may prove a useful tool for clinicians involved in the treatment of patients with respiratory allergy . We could not compare data of absolute number of pollen counts of our study with that of earlier study because of variation in the methodology . However, the proportion of various types of vegetation can be compared which showed interesting differences . Have published that in jaipur tree pollens were 50% while grass pollens were only 14% . In the present study, tree pollens constituted only 17% while proportion of grass is much higher (42%) [figure 2]. Probably urbanization has replaced trees by concrete jungles thereby causing reduced pollen counts . In our study, grass pollens were present throughout the year and peak was present during postmonsoon period . In earlier jaipur study grass pollens were limited only during postmonsoon period . Probably with urbanization in jaipur during last seven decades density of trees proportion of pollens of trees, weeds and grasses during 19571958 and 20112012 in jaipur a similar study was conducted in delhi from september 1990 to august 1997 . During the 7-year period, this was attributed to the large clearance of vegetation from the city . In their study studies done in different parts of india showed that there is wide variation in number of pollens and most frequent pollen . In gwalior, pollen grains mainly belonged to families of poaceae and amaranth - chenopodiacae similar to our study, while in lucknow, grasses and holoptelea were main pollens . In the majority of places, two peaks of pollen seasons were observed but in north kashmir peak pollen counts were observed during march september period . Number of new patients of asthma and ar attending hospital were significantly correlated with grass pollen counts . Knowledge of pollen calendar may prove useful in the evaluation of patients with seasonal exacerbation of symptoms of respiratory allergy.
Drug addiction is a multifactorial disorder caused by the interaction of individual and environmental factors . Among the underlying factors that contribute to an enhanced predisposition to drug addiction are the existence of a vulnerable personality or phenotype [15], early exposure to drugs of abuse [68], and the presence of adverse environmental conditions such as exposure to stress [912]. In fact, evidence suggests that individual differences in susceptibility to addiction involve integrated neurocircuits underlying stress, reward, and behavioural inhibitory processes . One of the most recognised factors facilitating the transition from voluntary, recreational drug use to dependence and addiction is exposure to drugs of abuse early on in life . Adolescence is a critical developmental period characterized by immaturity of inhibitory control brain systems related with planning, evaluation of consequences, decision - making, and control of behaviour, such as the prefrontal cortex (pfc) [14, 15]. Moreover, the adolescent brain exhibits more plasticity and adolescents are more sensitive than adults to the rewarding effects of drugs and less sensitive to their aversive properties, all of which facilitate drug consumption at this age [1417]. In fact, the characteristic behaviour of adolescents (impulsivity, emotional liability, increased risk - taking, enhanced novelty - seeking, etc .) That can favour drug use is due to this lack of prefrontal cortical maturation and hyperactivity of limbic structures involved in the processing of rewarding, emotional, and stressful stimuli, such as the nucleus accumbens (nacc) and amygdala [14, 15]. Consumption of cannabis, the most used illegal drug, usually begins during adolescence, and an increase in the problematic use of this drug among adolescents has been reported in recent years [1820]. Regular heavy use has more negative consequences at this early age than during adulthood, including enhanced vulnerability to develop dependence, suggesting that the adolescent brain is particularly vulnerable to the effects of cannabis exposure [2224]. Furthermore, adolescent cannabis abuse seems to enhance vulnerability to later consumption of other drugs [25, 26]. Early onset of cannabis consumption has been shown to be a proximal trigger of later cocaine use [2729] and increases the severity of cocaine withdrawal symptoms and relapse to cocaine dependence . Similarly, in animal models, exposure to cannabinoid agonists (thc and cp 55940) during adolescence induces an upregulation of dat in the caudate - putamen, increased self - administration of opioids, cocaine, and nicotine [3237], and enhanced locomotor responses to cocaine . In line with this, previous studies in our laboratory have demonstrated that preexposure to the cannabinoid agonist win 55212 - 2 increases the cpp induced by morphine and the acquisition, persistence, and reinstatement of mdma - induced cpp . However, no previous studies have evaluated whether preexposure to cannabinoids during adolescence modifies the subsequent acquisition and reinstatement of the cpp induced by cannabinoids or cocaine . Regarding the individual factors that contribute to drug addiction, differences in response to novelty and impulsivity that exist before the first experience of the drug have been related to differences in sensitivity to drug reward and vulnerability to addiction [1, 3, 4, 9]. In previous studies by our group we have observed that the novelty - seeking trait predicts greater sensitivity to the conditioned rewarding effects of cocaine [41, 42]. In particular, the hole - board test is a highly effective paradigm of novelty - seeking and predicts said sensitivity in adolescent male mice, since only high novelty seeker (hns) adolescent mice have been shown to acquire the cpp induced by a low dose of cocaine, which is ineffective in inducing cpp in low novelty seeker (lns) mice . Moreover, we have observed a higher sensitivity of hns to the conditioned rewarding effects of low doses of cocaine and mdma in mice exposed to cocaine, ethanol, or mdma . However, the influence of the novelty - seeking phenotype on sensitivity to the rewarding effects of cannabinoids has not been studied to date . Thus, the first aim of the present study was to evaluate the influence of the novelty - seeking phenotype on the sensitivity of adolescent mice to the rewarding effects of low doses of the cb1 agonist win 55212 - 2 in the cpp paradigm . We hypothesised that only hns mice would acquire cpp after conditioning with a low dose of win 55212 - 2, as occurs with other drugs of abuse . The second aim was to study whether the stimulation or blockade of cb1 receptors during adolescence modifies the conditioned rewarding effects of win 55212 - 2 or cocaine and if such effects are modulated by the novelty - seeking phenotype . We expected preexposure to a cannabinoid agonist during adolescence to increase the cpp induced by low doses of win 55212 - 2 and cocaine and for this effect to be more pronounced in hns mice . A total of 250 male mice of the of1 strain were acquired commercially from charles river (barcelona, spain) at 21 days of age . They were housed in groups of four in plastic cages (25 25 14.5 cm) for 5 days before experiments were initiated, under the following conditions: constant temperature (21c), a reversed light schedule (white lights on 19.3007.30 h), and food and water available ad libitum, except during behavioural tests . Animals were handled on each of the 3 days immediately prior to the preconditioning (pre - c) phase in order to reduce their stress levels in response to experimental manipulations . Procedures involving mice and their care were conducted in conformity with national, regional, and local laws and regulations, which are in compliance with the european directive 2010/63/eu . The hole - board test was carried out in a square box (28 28 20.5 cm) with transparent plexiglas walls and 16 equidistant holes of 3 cm in diameter in the floor . Photocells below the surface of the holes detected the number of times mice performed a head dip . Frequency of head dips was recorded automatically by the apparatus (cibertec, sa, spain). For place conditioning, we employed twelve identical plexiglas boxes with two equal sized compartments (length 30.7 cm, width 31.5 cm, and height 34.5 cm) separated by a grey central area (length 13.8 cm, width 31.5 cm, and height 34.5 cm). The compartments of these boxes had different coloured walls (black versus white) and distinct floor textures (fine grid in the black compartment and wide grid in the white one). Four infrared light beams in each compartment of the box and six in the central area allowed the position of the animal and its crossings from one compartment to the other to be recorded . The equipment was controlled using three pcs and monpre 2z software (cibertec, sa, spain). (laboratorio alcaliber sa, madrid, spain), win 55212 - 2 (tocris, biogen cientfica, s.l ., madrid, spain), or rimonabant (sr 141716a, sanofi recherche, montpellier, france) in a volume of 0.01 ml / g . Control groups were injected with the physiological saline used to dissolve cocaine (nacl 0.9%) or with tween-80 (sigma - aldrich, madrid, spain), which was used to dissolve win 55212 - 2 and rimonabant (0.01%, 0.01 ml of tween dissolved in 100 ml of saline). The doses of cocaine we administered were selected on the basis of previous studies showing that 1 mg / kg is a subthreshold dose for inducing cpp in nave mice, while 6 mg / kg is effective in inducing cpp acquisition but not in producing reinstatement after extinction of cpp [41, 46]. Similarly, the doses of cannabinoid drugs administered were selected on the basis of previous studies on the effects of win 55212 - 2 in the cpp paradigm [39, 47] and on the effects of cannabinoid pretreatment on the cpp induced by other drugs of abuse . Pretreatment of mice with 0.1 mg / kg of win 55212 - 2 is effective in increasing the cpp induced by mdma, while 1 mg / kg of rimonabant specifically blocks cb1 receptors and does not act as an inverse agonist . At the beginning of the test, mice were placed in the same corner of the box and were allowed to freely explore the apparatus for 10 min . The illumination in the experimental room consisted of four neon tubes fixed to the ceiling (light intensity of 110 lux at 50 cm above floor level). In all experiments, animals were first tested in the hole board on pnd 26 (prior to any treatment) and defined as high novelty seekers (hns) or low novelty seekers (lns) according to whether the number of head dips they performed was higher or lower than the median of the group . We have previously used this median - split analysis to study the effects of novelty - seeking on the behavioural effects of different drugs of abuse [4245]. In experiment 1, mice initiated the place conditioning procedure six days after the hole - board test (on pnd 32). In the other experiments, given that mice received a pretreatment after being classified as hns or lns, the place conditioning procedure began two days after (on pnd 34). Thus, the window of adolescence taken into account for the experiments included from pnd 26 to pnd 45 (see a timeline of the experiments in figure 1). Place conditioning, consisting of three phases, took place during the dark cycle . During the first phase, or preconditioning (pre - c), mice were allowed access to both compartments of the apparatus for 15 min (900 s) per day for 3 days . On day 3, the time spent by the animal in each compartment during 900 s period was recorded . Animals showing strong unconditioned aversion for any compartment (less than 33% of the session time) were excluded from the rest of the procedure so that the cpp procedure was unbiased in terms of initial spontaneous preference [46, 47]. One compartment was paired with the drug and the other with the vehicle using a counterbalanced design such that half the animals in each group received the treatment in one compartment and the other half in the other compartment . After assigning compartments, no significant differences were observed between the time spent in the drug - paired and vehicle - paired compartments during the preconditioning phase . This is an important step in the experimental procedure that avoids any preference bias before conditioning . In the second phase (conditioning), animals were conditioned with win 55212 - 2 or cocaine, as described in previous studies [46, 47]. In brief, in the case of win 55212 - 2, mice were treated with win 55212 - 2 immediately before confinement for 30 min to the drug - paired compartment (days 4, 6, 8, and 10) and with vehicle before confinement to the vehicle - paired compartment (days 5, 7, 9, and 11). In the case of cocaine, mice underwent two pairings per day on days 4, 5, 6, and 7, receiving an injection of physiological saline immediately before being confined for 30 min to the vehicle - paired compartment and receiving an injection of cocaine after an interval of 4 h, immediately before confinement to the drug - paired compartment . During the third phase (postconditioning, post - c), which took place on day 8 (in the case of cocaine) or day 12 (in the case of win 55212 - 2), the guillotine door separating the two compartments was removed and the time spent by the untreated mice in each compartment was recorded during a 900 s observation period . The difference in seconds between the times spent in the drug - paired compartment in the post - c versus pre - c test is a measure of the degree of conditioning induced by the drug . If this difference is positive, then the drug is considered to have induced a preference for the drug - paired compartment . Groups showing cpp in post - c underwent an extinction session every three days (on mondays, wednesday, and friday) during which they were placed in the apparatus (without the guillotine doors separating the compartments) for 15 min until the time spent by each group in the drug - paired compartment was similar to that of pre - c and differed from that of post - c (student's t - test). After extinction had been confirmed in an additional session, a reinstatement test was performed 15 min after administration of a priming dose (half of that used during conditioning) of the respective drug (0.0375 mg / kg of win 55212 - 2, 0.5 or 3 mg / kg of cocaine). In study 1, two experiments were performed in order to study the influence of the novelty - seeking phenotype on the effects of cannabinoid exposure on the acquisition of the cpp induced by win 55212 - 2 . In the first experiment, 60 male mice performed the hole - board test in order to be classified as hns or lns and were randomly assigned a drug treatment (0.075 or 0.05 mg / kg of win 55212 - 2). Thus, four groups of mice were formed according to novelty - seeking profile and the dose of win 55212 - 2 received during cpp conditioning (hns+win 0.075, hns+win 0.05, lns+win 0.075, and lns+win 0.05). The cpp procedure began on pnd 32 and conditioning took place from pnd 35 to pnd 42 . After the post - c test, groups showing cpp underwent extinction and reinstatement tests . In the second experiment, 80 male mice performed the hole - board test in order to be classified as hns or lns and were randomly assigned a drug treatment (vehicle, 0.1 mg / kg of win 55212 - 2 or 1 mg / kg of rimonabant). Mice received one daily injection of their respective treatment for 5 days (pnd 2630) and, after an interval of 3 days without any treatment, underwent the cpp procedure following conditioning with the same dose of win 55212 - 2 (0.05 mg / kg). Thus, six groups of mice were formed according to novelty - seeking profile and the pretreatment received before conditioning with win 55212 - 2 (hns - veh - win, hns - win - win, hns+sr - win, lns - veh - win, lns - win - win, and lns - sr - win). The place conditioning procedure began on pnd 34, and conditioning took place from pnd 37 to pnd 44 . Study 2 was performed in order to study the influence of the novelty - seeking phenotype on the effects of cannabinoid exposure on the acquisition of the cpp induced by cocaine . Eighty male mice performed the hole - board test and were defined as hns or lns and randomly assigned a drug treatment (vehicle, 0.1 mg / kg of win 55212 - 2 or 1 mg / kg of rimonabant). The animals received a daily injection of their respective treatment for 5 days (pnd 2630) and, after an interval of 3 days without any treatment, underwent the cpp procedure having been conditioned with the same dose of cocaine (1 mg / kg). Thus, six groups of mice were formed according to novelty - seeking profile and the pretreatment received before conditioning with cocaine (hns - veh - coc, hns - win - coc, hns+sr - coc, lns - veh - coc, lns - win - coc, and lns - sr - coc). Following the post - c test, groups showing cpp underwent extinction and reinstatement tests . With the objective of corroborating the results obtained in the groups receiving pretreatment with win 55212 - 2 and conditioned with 1 mg / kg of cocaine, two additional groups were included in the procedure . Thirty mice performed the hole - board test in order to be classified as hns or lns and were then treated with 0.1 mg / kg of win 55212 - 2 for 5 days . After an interval of 3 days without any treatment, the mice underwent the cpp procedure having been conditioned with 6 mg / kg of cocaine (hns - win - coc6 and lns - win - coc6). In this study all the groups began the cpp procedure on pnd 34, and conditioning took place from pnd 37 to pnd 40 . Differences between the number of dips performed by hns and lns groups were analysed with student's t - tests . To evaluate the influence of the novelty - seeking trait on the cpp induced by win 55212 - 2 (study 1, experiment 1), data of the time spent by the animals in the drug - paired compartment were analysed by means of a mixed anova with two between - subjects variables: novelty - seeking, with two levels (hns and lns), and treatment, with two levels (win 0.05 and win 0.075), and one within - subjects variable: days, with two levels (pre - c and post - c). To evaluate the effect of pretreatment with cannabinoid drugs on the subsequent cpp induced by win 55212 - 2 or cocaine in hns and lns mice (study 1, experiment 2; and study 2), data of the time spent in the drug - paired compartment were analysed with a mixed anova with two between - subjects variables: novelty - seeking, with two levels (hns and lns), and pre - treatment, with three levels (veh, win, and sr), and one within - subjects variable: days, with two levels (pre - c and post - c). In the abovementioned experiments, extinction and reinstatement values in the groups showing cpp to evaluate the effect of pretreatment of hns and lns mice with win 55212 - 2 on the subsequent cpp induced by 6 mg / kg of cocaine (additional groups of study 2), data of the time spent in the drug - paired compartment were analysed with a mixed anova with one between - subjects variable: novelty - seeking, with two levels (hns and lns), and one within - subjects variable: days, with four levels (pre - c, post - c, extinction, and reinstatement). The time required for preference to be extinguished in each animal was analysed by means of the kaplan - meier test, with breslow (generalized wilcoxon) comparisons when appropriate . In all the anovas, linear and logistic regression analysis was employed to determine the association between the level of novelty - seeking and the development of preference . The novelty scores for each mouse, identified by group, are represented in figure 2 . Although the distribution is not completely bimodal (some mice had a similar novelty - seeking score in lns and hns groups), they are clearly different with respect to the median scores . In all experiments, student's t - tests showed significant differences between the number of dips performed by hns and lns groups (ps <0.01). Study 1 explains the influence of the novelty - seeking phenotype on the effects of cannabinoid exposure on acquisition of the cpp induced by win 55212 - 2 . Experiment 1 is about the influence of the novelty - seeking phenotype on the sensitivity of mice to the rewarding effects of win 55212 - 2 . The anova of the data obtained with the mice conditioned with 0.05 and 0.075 mg / kg of win 55212 - 2 revealed that the interaction days treatment novelty - seeking [f(1,45) = 4.175; p <0.05] was significant . Post hoc comparisons showed that only the group of hns mice conditioned with the high dose of win 55212 - 2 spent more time in the drug - paired compartment in post - c than during pre - c (p <0.05). This cpp disappeared after two extinction sessions and was not reinstated by priming with 0.0375 mg / kg of win 55212 - 2 . Thus, the hns trait would seem to increase the sensitivity of mice to the rewarding effects of win 55212 - 2 (see figure 3). Linear and logistic regression analysis did not show any significant correlation between the novelty - seeking trait and development of the cpp induced by 0.075 mg / kg of win 55212 - 2 . Experiment 2 is about the effects of exposure of hns and lns mice to agonist and antagonist cannabinoids on acquisition of the cpp induced by a subthreshold dose of win 55212 - 2 . The anova did not show any significant effect, thus indicating that pretreatment with a cannabinoid agonist or antagonist did not increase the sensitivity of mice to the conditioned rewarding effects of win 55212 - 2 (see figure 4). Study 2 explains the influence of the novelty - seeking phenotype on the effects of agonist and antagonist cannabinoid on acquisition of the cpp induced by cocaine . The anova of the data obtained with the mice conditioned with 1 mg / kg of cocaine revealed a significant effect of the interaction post hoc comparisons showed a significant increase in the time spent by hns and lns mice pretreated with win 55212 - 2 in the drug - paired compartment in post - c with respect to pre - c (ps <0.01). After extinction of cpp (7 sessions), a priming dose of 0.5 mg / kg of cocaine induced reinstatement of cpp only in hns mice (p <0.01). Thus, pretreatment with win 55212 - 2 increased the rewarding effects of cocaine irrespective of the novelty - seeking profile of the mice, but only hns animals were more sensitive to reinstatement after cocaine priming (see figure 5). The anova of the data obtained with the mice pretreated with win 55212 - 2 and conditioned with 6 mg / kg of cocaine revealed a significant effect of the variable days [f(3,72) = 17.772; p <0.01], with mice spending more time in the drug - paired compartment in post - c than during pre - c (p <0.01) and in the reinstatement test than during the previous extinction test (p <0.05). Post hoc comparisons showed a significant increase in the time spent by hns and lns mice in the drug - paired compartment in post - c with respect to pre - c (ps <0.01) and revealed a reinstatement of cpp (ps <0.05) after a priming dose of 3 mg / kg of cocaine (see figure 6). The kaplan - meier test showed that the time required for extinction was longer in hns than in lns mice (14 versus 7 days, x = 3.995, p <0.05) (see figure 7). Linear and logistic regression analysis did not show any significant correlation between the novelty - seeking trait and development of the cpp induced by 1 or 6 mg / kg of cocaine, in accordance with a previous study carried out in our laboratory . Animal models are a vital tool for increasing our understanding of the behavioural traits (e.g., novelty - seeking) and environmental events (e.g., early drug exposure) associated with the individual vulnerability of subjects to repeated drug consumption and how these factors interact to facilitate the development of drug addiction . The results of the present study demonstrate for the first time that adolescent hns mice are more vulnerable to the rewarding effects of cannabinoids . Even more importantly, given the high risk of adverse effects associated with cocaine, there was some indication that adolescent mice with this phenotype are more vulnerable to the reinstating effects of a low dose of cocaine if they have been previously exposed to a cannabinoid agonist . The first contribution of this study is the demonstration that the hns phenotype increases the sensitivity of mice to the conditioned rewarding effects of the cannabinoid agonist win 55212 - 2 . We have observed that hns mice acquire cpp after conditioning with 0.075 mg / kg, a dose that is ineffective in lns . Although no previous studies have evaluated the influence of the novelty - seeking trait on the rewarding effects of cannabinoids, our results are in accordance with those observed with other drugs of abuse, such as cocaine or mdma, which have demonstrated that hns mice are more sensitive to the conditioned rewarding effects of these drugs [4143]. It is not clear if the ability of hns mice to develop cpp after administration of the cannabinoid agonist is related with an increase in the reinforcing / rewarding value of this drug for these animals or whether they acquire incentive learning in a more efficient way than lns mice . Either way, increased levels of incentive salience attributed to drugs and/or drug - associated cues can enhance the intensity and duration of incentive motivation for drugs of abuse (higher unconscious wanting and conscious craving), thus facilitating the transition to drug addiction, as suggested by robinson and berridge . It has been reported that hns animals have a characteristic striatal da profile (higher endogenous levels, stronger responses to reward cues, and lower availability of d2/d3/d4 receptors), which may contribute to the tendency of these animals to exhibit approach reactions towards novel stimuli and may explain the increased cpp observed in the present study . The second important result of the present study is that even though exposure to the cannabinoid agonist win 55212 - 2 during adolescence did not enhance the acquisition of cpp induced by win 55212 - 2 itself at the doses tested, it did enhance the acquisition of cpp induced by a low dose of cocaine . Mice pretreated with win 55212 - 2 exhibited cpp after conditioning with a low dose of cocaine that was ineffective in inducing cpp in animals pretreated with vehicle . Moreover, mice pretreated with win 55212 - 2 showed priming - induced reinstatement of the cpp induced by 6 mg / kg of cocaine, an effect that has not been observed in nave mice . Although clinical and epidemiologic studies show that cannabis consumption usually precedes the initiation of cocaine use [2729], only two studies have evaluated the effect of stimulation of the endocannabinoid system (ecs) during adolescence on the subsequent effects of cocaine . In line with the results of the present study, adolescent rats pretreated with cannabinoid agonists showed increased locomotor responses to cocaine challenge and a higher rate of cocaine self - administration . Thc preexposure also increases the rewarding effects of nicotine, morphine, and mdma [40, 47, 51]. Conversely, other studies with adult animals have shown that cannabinoid agonists reduce cocaine reward [52, 53]. Usually, genetic ablation or antagonism of cb1 receptors decreases the self - administration [5456], cpp [5760], and sensitization [55, 61] induced by cocaine, although some studies have found no effects [55, 62, 63]. Thus, the ecs plays a complex role in the behavioural effects of different drugs of abuse . The present study extends these results by demonstrating that exposure to a cb1 agonist during adolescence increases the conditioned rewarding effects of cocaine, thus suggesting sensitization of the brain reward system . Ecs plays an important role in adolescent brain development, and the strong stimulation of this system by cannabinoids might induce long - lasting neurobiological consequences, such as alterations in emotional and cognitive performance, increased risk of developing schizophrenia, and enhanced vulnerability to the use of drugs of abuse . In particular, changes in the da reward system induced by exposure to cannabinoids could underlie the behavioural effects observed . Cannabinoid adolescent exposure induces an upregulation of dat in the caudate - putamen, an increase in d1rs content in the nacc shell, and a reduction in the expression of d2rs in ca1 . These changes can contribute to an increase in the reinforcing / rewarding value of the drug, leading to a greater risk of developing compulsive drug seeking . Moreover, neuroadaptations in the ecs may be part of the neuroplasticity associated with the development of cocaine addiction . On the other hand, neither exposure to the cannabinoid agonist win 55212 - 2 during adolescence nor pretreatment with rimonabant modified the subsequent effect of win 55212 - 2 in the cpp paradigm, in contrast with that observed with cocaine in this study or in previous studies with morphine or mdma [39, 40]. There is not a clear reason for the absence of an increase in vulnerability to the cpp induced by win 55212 - 2 after adolescent preexposure to this drug . It is possible that the particular profile of win 55212 - 2 in the cpp paradigm underlies the results observed . This drug only induces cpp with specific doses, with higher or lower doses being ineffective . Given that our main objective was to detect differences in the influence of adolescent cannabinoid exposure between hns and lns, we used a very low dose of win 55212 - 2 (0.05 mg / kg), as we expected that cannabinoid pretreatment would cause a shift to the right of the dose - response curve . For example, in a previous study we observed that older adolescent mice (pnd 52) developed cpp after conditioning with 0.05 mg / kg of win 55212 - 2, suggesting that adolescent maturation is a factor that increases sensitivity to this drug . In any case, it is possible that if higher doses were used during conditioning, we would observe a potentiation of the rewarding effects of win 55212 - 2 in mice pretreated with this cannabinoid during adolescence . In fact, the effects of novelty - seeking phenotype (experiment 1) were only apparent when the dose of win 55212 - 2 was higher (0.075 mg / kg) than the dose used in this experiment . This warrants a tentative conclusion concerning the effects of adolescent exposure to win 55212 - 2 on a subsequent win 55212 - 2 cpp . Future studies using higher doses of win 55212 - 2 during conditioning or different procedures of preexposure to this drug are necessary to determine whether or not adolescent exposure to cannabinoids alters the effects of win 55212 - 2 in the cpp paradigm . The main result of the present work is that the novelty - seeking phenotype determines the influence of adolescent cannabinoid exposure on the subsequent rewarding effects of cocaine in the cpp paradigm . Not all mice are equally vulnerable to the sensitization of the brain reward system induced by stimulation of the cannabinoid system during adolescence . Hns mice are particularly affected by pretreatment with win 55212 - 2, showing a priming - induced reinstatement of the cpp induced by 1 mg / kg of cocaine and an enhanced duration of the cpp induced by 6 mg / kg of this drug (effects that are not observed in lns mice exposed to win 55212 - 2). Our results support the idea that exposure to cannabis during adolescence, though it can increase the rewarding effects of subthreshold doses of cocaine six days after pretreatment, is not enough to promote long - lasting brain changes that increase the likelihood of the development of cocaine addiction (which can be evaluated by the maintenance of cpp or its reinstatement after extinction). Genetic and behavioural predispositions for example, a novelty - seeking phenotype may underlie increased adolescent drug experimentation, enhanced reward when the subject is exposed to the drug, and the development of neuroadaptations that lead to later adult addiction . Animal models allow us to answer questions that cannot be explored in human subjects due to ethical constraints and can be useful for analysing possible neurobiological substrates underlying interactions between environmental and biological factors that contribute to individual vulnerability to drug abuse and addiction . The phenotypic causation gateway hypothesis proposes a sequential progression of drug use in which early initiation of cannabis use is a risk factor for the future consumption of other drugs of abuse, such as cocaine . In support of this hypothesis, we have observed that mice exposed to the cannabinoid agonist during adolescence show an increased acquisition and reinstatement of cocaine cpp . The alternative common liability hypothesis proposes that cannabis and use of other illicit drugs are influenced by correlated genetic and environmental factors . Our research has shown that the novelty - seeking trait is associated with an enhanced acquisition of win 55212 - 2 cpp, as we have observed previously with cocaine, and also with an increase in the effects of adolescent cannabinoid exposure on reinstatement and maintenance of cocaine cpp . Thus, the results of the present study support the formulation of a vulnerability model that integrates the gateway and common liability hypotheses in order to explain the increased likelihood of transition from regular cannabis use to that of other substances (such as cocaine or heroin). There is a subpopulation of adolescents which engages in extremely risky cannabis and drug use early in life and which seems to run a greater risk of abuse and addiction later in life . The results of the present study suggest that there is not a direct causal mechanism between adolescent drug exposure and the subsequent development of addiction . Instead, there are individual brain and behavioural differences that are present prior to the onset of drug use, such as a higher propensity for sensation - seeking, which influence both the tendency to experiment with drugs of abuse early in life and the later development of addiction . These subjects appear to be more vulnerable to the appearance of permanent neurobiological changes following drug exposure that may lead to the transition from voluntary to compulsive drug use . Thus, specific preventive programs aimed at these more vulnerable subjects could reduce drug consumption and later addiction.
The pol3/cdc2 gene of saccharomyces cerevisiae encodes the catalytic subunit of the dna polymerase . The coding sequence includes a catalytic domain, a nucleotide binding domain, and an exonuclease proofreading site . Pol has a primase activity and is involved in initiation of both the leading and lagging strands . Both pol and pol can extend the primers formed by pol [3, 4] and are proposed to be involved in nucleotide excision repair and base excision repair [6, 7]. In addition, the dna polymerase exonuclease is involved in postreplication repair [8, 9]. Yeast strains lacking the proofreading exonuclease activity of the polymerase have a strong mutator phenotype . The pol3-t mutation is located near the catalytic domain outside the exonuclease domain in a region probably involved in nucleotide binding . The pol3-t mutant allele, initially isolated as tex1 mutant because it increased the rate of excision of a bacterial transposon within the yeast lys2 gene, also enhances intrachromosomal deletion recombination between short repeats of several base pairs separated by long inverted repeats . The molecular analysis of the transposon excision events indicates that dna replication slippage is most likely responsible for these excision events [11, 12]. Furthermore, the frequency of deletions between distant short repeats within lys2 or the can1 gene is also increased many fold . Finally, it has been shown that the same mutator phenotype as observed in the pol3-t mutation exists after repression of the pol3 gene, indicating that the mutator phenotype may be due to low levels of pol3 rather than to faulty effects of the pol3 mutant proteins . Rad50 is involved in dna double strand break repair by nonhomologous end joining and homologous recombination such as sister chromatid recombination and double strand break (dsb) processing . Rad50 together with xrs2 and mre11 is part of the mrx complex which localizes to dsbs [18, 19]. Whereas wild type cells are much more radiation - sensitive in g1 (1.5% survival at 150 gy) compared to g2 (70% survival), mre11 mutant cells show about the same survival rate in both phases (0.6% versus 1%), indicating preferential mrx - mediated repair when sister chromatids are present in g2 . In addition the gene products 46/47 of the bacteriophage t4, homologs of mre11/rad50, are required for recombination - induced replication [2325]. Recombination - induced replication also may be involved in dsb repair during g2 by synthesis dependent strand annealing, possibly explaining the mrx - mediated preferential repair in g2 cells . Several mutants with elevated spontaneous intrachromosomal recombination frequencies have been isolated in saccharomyces cerevisiae [27, 28]. Among them, a mutant allele of cdc2/pol3, which encodes the catalytic subunit of the dna polymerase, increases deletion events . Intrachromosomal deletion events between duplicated sequences may occur by several mechanisms such as intrachromatid exchange, single - strand annealing, one - sided invasion, unequal sister chromatid exchange or, sister chromatid conversion [13, 2931]. This hyperrecombination phenotype is partially dependent of rad1 and rad52 because the pol3-t mutation still enhances intrachromosomal recombination in the rad1rad52 double mutant . This suggests that the hyperrecombination phenotype may depend on dna genes other than rad52 or rad1 . Here, we report a further characterization of the pol3-t mutant . We investigated the effect of the rad50 gene involved in dsb repair, on the pol3-t phenotype by measuring methyl methanesulfonate (mms) sensitivity, the spontaneous as well as mms-, uv-, and -ray - induced intrachromosomal recombination and, finally, the effect on homologous integration . Complete media (ypad), synthetic complete (sc), and drop - out (sd) media were prepared according to standard procedures . Magic column (promega, madison, wi) was used for preparation of small - scale dna . The names and the genotypes of the strains used are listed in table 1 . Because pol3-t confers a temperature sensitive phenotype, strains agy34, agy38, agy39, and agy40 were constructed by introducing the pol3-t mutation into strains yr50 - 1, rsy12, yr50 - 12, and ymg1, respectively . This was done by transformation of the cells with plasmid p171 (a gift from michael resnick, national institute of environmental health sciences, research triangle park, nc), which contains a 2.2-kb ecorv - hindiii fragment containing the pol3-t allele . Temperature - sensitive ura colonies that contained the full - length pol3-t allele and a truncated pol3 allele flanking the ura3 gene were isolated . Ura temperature - sensitive strains carrying the pol3-t allele were selected after selection on medium containing 5-foa . Single colonies of strain rsy6 and its derivatives mag1, rad50, pol3 t, mag1pol3 t and rad50 pol3 t were inoculated into ypad at 25 for 24 hours . Thereafter, cells were washed, resuspended in 5 ml of fresh yapd at the concentration of 3 10 cells / ml and exposed to mms for 4 hours at 30. then cells were washed twice, counted, and plated in ypad at the concentration of 200 cells per plate . This substrate consists of two his3 alleles, one with a deletion at the 3 end and the other with a deletion at the 5 end, which share 400 bp of homology . These two alleles are separated by the leu2 marker and by the plasmid dna sequence . An intrachromosomal recombination event between the two his3 alleles leads to his3 reversion and loss of leu2 . To determine the frequency of spontaneous intrachromosomal recombination, single colonies were inoculated into 5 ml of sc - leu, so that recombinants cannot grow, and incubated at 25 or 30 for 24 hours . Thereafter, cultures were washed twice and counted and appropriate numbers were plated onto sc and sc - his plates to determine the surviving fraction and the frequency of intrachromosomal recombination events, respectively . Intrachromosomal recombination was measured following uv, -ray, and mms exposure . For uv exposure thereafter, cells were washed, resuspended in fresh sc - leu for 4 hours at 30c . 10 ml aliquots containing 3 10 cells / ml were irradiated in distilled water using a uv source at the dose rate of 3.5 ergs / m / sec . The same number of cells were exposed to -rays using a co -ray source at 9.1 cgy per second [30, 34]. Following irradiation, thereafter, cells were washed, resuspended in 5 ml of fresh sc - leu at the concentration of 3 10 cells / ml and exposed to mms for 4 hours at 30. then cells were washed, counted and plated as described . At the highest mms dose only the wild type strain grew for one generation; at low doses all strains grew an average of 2 - 3 generations . The gene targeting events were determined in the rsy12 strain and its derivatives y50 - 12, agy38, and agy39 which carry the complete deletion of the ura3 gene . The ecori - hindiii fragment from plasmid pjz102 carrying the lys2 gene disrupted by ura3 insertion was transformed in all the rsy12 derivative strains as previously described . Transformants were selected on sc - ura plates and, then, replicated in sc - lys medium . The frequency of homologous gene replacement was calculated as number of total ura3lys2 colonies 10 transformed cells per g dna . The number of transformed cells per g dna was determined using the episomal plasmid yeplac195 as previously described results were statistically analysed using the student's t - test . Probabilities are shown as * p <.05, * * p <.01, * * * p <.001 . The rate of dna damage - induced recombination was extraplotated as follows: for each strain, we measured the number of recombination events induced for a range of increasing dosages in single experiment . From one experiment, we fitted the best - fit line to the data and took the slope of this line as the rate of induction . We used a student's t test to compare between individually extrapolated rate of induction values between strains (for the same dna damaging agent). The main lesion mms produced in dna is methylation, primarily producing 3-methyladenine (3mea). 3mea is mainly repaired by base excision repair (ber), but some lesions can be converted to dsbs which are repaired by nonhomologous end joining or homologous recombination [3538]. It has previously been shown that pol3 mutant cells are sensitive to mms which is taken as evidence for involvement of dna polymerase in the base excision repair pathway . The 3mea dna glycosylase, encoded by the mag1 gene, has been shown to be very important for 3mea removal from dna [39, 40]. The pol3-t mutant is sensitive to the alkylating agent mms as reported for other pol3 mutants [6, 14]. The deletion of the rad50 gene also confers high sensitivity to mms . In the present study, we determined the epistasis of the mms sensitivity of the pol3-t mutant with the base excision repair mutation mag1 and the double strand break repair gene rad50 . Previously, it has been shown that the mag1 and the rad50 mutations show a synergistic interaction with respect to mms sensitivity implying that mag1 and rad50 act in distinct repair pathways . Here the pol3-t mutant was more sensitive to mms than wild type (figure 1), and the double mutant mag1pol3-t was more sensitive to mms than each single mutant indicating that mag1 and pol3 belong to different repair pathways (figure 1(a)). Moreover, the double mutant rad50pol3-t showed the same sensitivity to mms as the rad50 single mutant . This suggests that rad50 and pol3 may belong to the same pathway for repairing mms - induced lesions . We previously have shown that the pol3-t mutation causes a hyperrecombination phenotype in yeast that is partially dependent on rad52 and rad1 . This suggests that replication slippage or a single - strand annealing pathway that is rad52 and rad1 independent could be responsible for the hyperrecombination phenotype . The rad50 gene product is involved in dna replication slippage between distant repeats [11, 42]. Moreover, the deletion of the rad50 gene in the pol3-t background decreases the frequency of excision of tn5 . To investigate the effect of rad50 on pol3-t - mediated recombination, we constructed the haploid strain agy34 which contains an intrachromosomal recombination substrate (see materials and methods). The pol3-t mutation confers a temperature - sensitive phenotype and growth arrest at 37c; therefore we measured the effect of the rad50 deletion mutation after growth at 25c and 30c . Single colonies of rsy6, agy30, yr50 - 1, and agy34 were inoculated into sc - leu medium for 24 hours at 25c and 30c . During this period rsy6 (wild type) and yr50 - 1 (rad50) underwent 4 to 5 cell divisions at both temperatures . Agy30 (pol3-t) and agy34 (rad50pol3-t) underwent 3 cell divisions at 25c and 2 cell divisions at 30c . In the pol3-t strain, intrachromosomal recombination increased 14-fold at 25c and 32-fold at 30c confirming that pol3-t confers a hyperrecombination phenotype (table 2,). In the rad50 background strain, the pol3-t mutation did not increase intrachromosomal recombination at either 25c or 30c (table 2) demonstrating that the rad50 deletion completely abolished the pol3-t - mediated hyperrecombination phenotype . Integration of linear dna fragment by homologous recombination into a chromosomal gene is thought to occur by two independent strand invasion events leading to the replacement of the chromosomal target with the dna fragment [43, 44]. The homologous integration is reduced in the rad1, rad51, rad52, and rad57 deletion mutant while it is unaffected in the rad50 . We, therefore, measured the homologous integration in the pol3-t and in the rad50pol3-t mutant . The rsy12, agy38, agy39, and y50 - 12 strains were transformed with the ura3 fragment flanked by lys2 sequence . As an homologous integration event leads to the replacement of chromosomal lys2 gene with the ura3 fragment, the frequency of homologous integration was determined as number of ura3lys2 colonies 10 transformed cells per g dna . In the pol3-t mutant, the frequency of homologous integration increased 11-fold as compared to the wild type (table 3). In the double mutant rad50pol3-t, the frequency has increased 10.5-fold as compared to the wild type indicating that the elevated level of integration is not rad50 dependent (table 3). As previously reported, the rad50 mutation did not affect the frequency of homologous integration as compared to the wild type (table 3). Mms, uv, and -rays induced intrachromosomal recombination in the pol3-t mutant (tables 4, 5, and 6). To further characterize the pol3-t phenotype, we looked at whether the rad50 deletion could also suppress mutagen - induced intrachromosomal recombination events in the pol3-t mutant . Single colonies of both yr50 - 1 (rad50) and agy34 (rad50pol3-t) strains were grown at 25c for 17 hours and then incubated at 30c for 4 hours before mms, uv, and -ray exposure after which survival and intrachromosomal events were scored for a range of doses of each mutagen . The rate of intrachromosomal recombination induction with dose for each experiment was found by linear regression; comparison of the induction rate between strains was made using student's t - test . To see if pol3-t strains are defective in dna damage - induced intrachromosomal recombination, we compared the rate of recombination induction among strains . Then, we measured the number of recombination events induced for a range of increasing dosages in single experiment . From one experiment, we fitted the best - fit line to the data and took the slope of this line as the rate of induction . Each experiment was done in at least triplicate, and thus, for each mutagen and each strain there are at least three separate measures of the rate of induction with dose . Survival and intrachromosomal recombination events were measured in wild type and pol3-t strains to 0, 10, 100, 200, and 500 g / ml mms and in rad50 and rad50pol3-t strains to 0, 1, 10, 50, 100, and 200 g / ml . 10 g / ml mms induced a significant increase of intrachromosomal recombination in the wild type but none in each of the mutants (table 4). Yet 100 g / ml mms was the lowest dose used that significantly increased intrachromosomal recombination in each of the strains . The rate of intrachromosomal recombination induction was 19.3 1.9 (10 per g / ml mms) in the wild type and 20.1 1.3 (10 per g / ml mms) in the pol3-t . The rad50 mutation resulted in a significantly lower induction rates of 1.3 0.3 (10 per g / ml mms) (p <.005) and was partially restored to the wild type level in the double mutant rad50pol3-t with 5.0 1.1 (10 per g / ml mms) (p <.005 when compared to rad50). This suggests that rad50 is required for mms - induced intrachromosomal recombination more so in the wild type than in the pol3-t mutant background . A fluence of 100 j / m induced a significant increase in each of the strains except the rad50 mutant for which a significant increase was not observed below 500 j / m (table 5). The intrachromosomal recombination induction rate was 42.1 5.5 (10 per j / m uv) in the wild type and 17.3 3.9 (10 per j / m uv) in the pol3-t strain . This rate was significantly lower in both the rad50 and rad50pol3-t strains which exhibited induction rates of 2.1 0.4 and 3.8 1.0 (10 per j / m uv), respectively (p this suggests that rad50 had a reducing effect in the pol3 as well as in the pol3-t mutant to uv - induced intrachromosomal recombination events (table 5). The rad50 and the rad50pol3-t strains are much more sensitive to -rays than the wild type and the pol3-t single mutant strains, respectively, yet little difference in -ray sensitivity was found among the rad50 and rad50pol3-t strains (table 6). The rad50 phenotypic sensitivity to ionizing radiation is severe; the dose corresponding to 5%10% survival, 50 gy, is approximately 20x less than an equitoxic dose in the wild type and pol3-t strains . Because rad50 and rad50pol3-t strains exhibit extremely low survival to -rays at doses> 50 gy, the rate of intrachromosomal recombination from 0 and 50 gy was compared between each of the four strains, a dose range at which recombination was found to sharply increase with dose . Within this dose range, the rate of intrachromosomal recombination in each of the strains was as follows: 79.3 35.5 (10 per gy) in wild type, 101.6 46.9 (10 per gy) in pol3-t 69.5 20.1 (10per gy) in rad50, and 77.8 22.6 (10 per gy) in the rad50pol3-t double mutant . Thus between the range 050 gy, all strains exhibited a similar rate of intrachromosomal recombination . The pol3-t toxicity to ionizing radiation is similar to wild - type, and thus the rate of -ray - induced recombination was compared between these strains between 50 and 1000 gy, a range at which recombination is induced at a lower rate (table 6). Here, the pol3-t strain showed a trend of a lower induction rate than that of wild type: 19.8 4.3 versus 35.6 13.2 (10 per gy) (p = .06). We found that pol3-t was synergistic with mag1 for mms toxicity but epistatic with rad50 . This suggests that pol3 may participate in the rad50 pathway for repair of mms damage . The mechanism by which the mms - induced lesions are converted to dsbs is not completely understood except that dsb repair - deficient mutants are also sensitive to mms . In theory, it is possible that mms damaged sites are converted into dsbs, and pol3 is involved in their repair even though there is no published evidence for that . However, in our experiments the pol3-t mutant was not more sensitive to ionizing radiation that causes dsbs arguing against pol3 involvement in dsb repair . Recently, it has been shown that mms does not induce dsbs in both yeast and mammalian cells . The number of alkylated sites converted to single - strand breaks and dsbs, however, could be too few to be detected by their assay, but enough to require the involvement of the dsb repair pathway . The authors also suggested that the alkylation damage may stall the replication fork leading to the formation of a chicken foot structure which resembles a holliday junction . This may explain the reason why the dsb repair mutants that are also deficient in recombination are sensitive to mms . This would imply some involvement of rad50 in resolution of stalled replication forks, which may involve recombination [21, 22]. In fact, the gene products 46/47, the bacteriophage t4 homologs of mre11/rad50, are required for recombination - induced replication [2325]. Both pol3 as well as rad50 may be involved in replication on the mms - damaged template explaining their epistasis for mms sensitivity . We also found that the elevated level of intrachromosomal deletion recombination events in the pol3-t mutant is dependent on the rad50 gene . The rad50 protein is part of a complex that plays a major role in processing of dna dsb ends; therefore dna dsb processing may be necessary for conferring the hyperrecombination phenotype of pol3-t . On the other hand, as discussed above for mms toxicity, rad50 may be involved in recombinational resolution of replication forks stalled by dna damage . In the presence of the pol3-t mutation, when replication is stalled at the restrictive temperature, such recombinational resolution may become important . If the second copy of the his3 repeat is accidentally used as template for such resolution rather than the copy at which replication has stalled, the pol3-t - caused hyperrecombination phenotype may be mediated by rad50 . In a similar way for the involvement of rad50 in the pol3-t - mediated replication slippage at direct repeats within lys2 a possible replication function of rad50 has been proposed, rather than dsbs being involved in the slippage events . We, indeed, found that the elevated frequency of homologous integration conferred by the pol3-t mutation was not affected by rad50 . This may indicate that the slow replication rate of the pol3-t mutant may favor homologous recombination events between the chromosomal dna and an exogenous dna fragment . Moreover, rad50 that is primarly involved in dsb processing did not affect this phenotype . We found that the rad50 mutant is almost completely deficient in mms, and uv - induced recombination but no difference was observed in -rays - induced recombination . It has also previously been found that rad50 is involved in mms but not uv - induced recombination between homologs in a diploid . We have previously shown that intrachromosomal recombination between repeats is induced by site specific dsbs in g1, g2, and dividing cells . A site - specific single strand break, however, induced recombination only in dividing but not in g1 or g2 arrested cells . In a similar fashion, mms, ems, 4-nqo, and most but not all ionizing radiation - induced dna damage were dependent on dna replication for induction of intrachromosomal recombination this indicates that either replication turns the various dna damages into dsbs, which then induces intrachromosomal recombination by single - strand annealing, or that recombination is induced by resolution of dna - damaged replication forks as mentioned above . The latter explanation would be in agreement with rad50 being involved in dna damage - induced resolution of stalled replication forks since most of the damage - induced recombination was rad50-dependent similar to pol3-t induced recombination . At greater levels of dna damage some dsbs may be formed accounting for the low level of recombination induction in the rad50 mutant . Interestingly, no difference was observed in -ray - induced recombination events . In the wild type the rate of -ray - induced recombination was observed to be biphasic with the number of events increasing sharply between 0 and 50 gy, and at doses beyond 50 gy the rate of recombination was substantially lower . Because the rad50 mutation is extra sensitive to ionizing radiation, the rate of recombination events was not scored at doses above 50 gy . Between 0 and 50 gy neither rad50 nor pol3-t mutations had an effect on the rate of -ray - induced recombination . It is possible that rad50 is involved in a second phase of -ray induced recombination at doses above 50 gy or that the types of damage primarily produced by ionizing radiation are not repaired though the rad50 pathway . Either of such would explain why no difference in rate of intrachromosomal recombination was observed between 0 and 50 gy . In summary, furthermore, the epistasis for mms sensitivity and the deficiency in dna damage induced as well as complete block in pol3-t induced intrachromosomal recombination by rad50 is in agreement with involvement of rad50 in repair by recombination resolution of stalled replication forks.
Familial juvenile hyperuricemic nephropathy (fjhn1; mim 162000) is an autosomal dominant condition characterized by defective urinary concentrating ability, gouty arthritis, interstitial nephritis, and chronic renal failure . It is a genetically heterogeneous condition, caused due to mutation in three genes: uromodulin (umod) (40%), renin (2.5%), and hepatocyte nuclear factor-1 beta (2.5%). Biochemical hallmarks of the disease are hyperuricemia out of proportion to the degree of renal failure and reduced fractional uric acid excretion . Here, we describe an indian family with multiple members affected with fjhn1 due to a novel heterozygous missense mutation in exon 5 of umod gene . A 17-year - old male presented with pain and swelling in small joints of hands, feet, knees, ankles, elbows, and wrists for 2 years along with the presence of nodules on the right little finger and the left ear lobe . On examination, swellings were present on second and third metacarpophalangeal joints and third proximal interphalangeal joints . There were tophi of size 23 cm with whitish discharge on the right little finger and of 0.5 cm on the left ear lobule [figure 1]. The serum uric acid level was 13.9 mg / dl, and serum creatinine 1.4 mg / dl (normal uric acid level in> 18 years old: 6.2 0.8 mg / dl). There were multiple family members affected with the same disorder; some had only gouty arthropathy and others had both gouty arthropathy and renal disease [tables 1 and 2]. His father had died at the age of 42 years due to chronic kidney disease and had gouty arthritis . One of his elder brothers and one paternal uncle's son has gout along with kidney disease, and one brother has only gouty arthritis [figure 2]. Proband showing a nodule on left ear lobe and another on right little finger with whitish discharge clinical features of proband and his family members investigations of the proband and his brother family pedigree showing multiple affected members informed consent was obtained from the three affected individuals for deoxyribonucleic acid analysis, collection of clinical data, and publication of photographs . The 10 coding exons of umod gene were amplified by polymerase chain reaction and cycle sequenced by capillary electrophoresis using an abi 310 sequencer (applied biosystems foster city, ca, usa). A heterozygous missense variant (c. 949 t> g) in exon 5 [figure 3] was identified in the proband and two affected brothers causing substitution of cysteine by glycine at codon position 317 (p.c317 g). It is a novel variant, not reported in 1000 genomes, clinvar, human genome mutation database, and human genome variation . The affected residue locates within the cysteine - rich 2 domain and is immediately preceded by a highly conserved cysteine residue . Various bioinformatics tools such as mutation taster, polyphen and sorting intolerant from tolerant also predicted it to be pathogenic . Based on the above evidence, we concluded that this novel variant is very likely the causal pathogenic mutation . G in exon 5 of uromodulin gene causing substitution of cysteine by glycine at position 317 umod also called as tamm - horsfall protein is a polymeric protein located on the tubular cells lining the thick ascending limb of the loop of henle and early distal convoluted tubules . From the apical membrane, it is secreted into the tubular lumen where it polymerizes into a water impermeable gel - like structure that modulates salt transport, urine concentration, and urate metabolism . Common genetic variants in umod gene have been found to be associated with hypertension, reduced renal function, and increased risk of chronic renal failure . Other disorders caused by mutation in umod are medullary cystic kidney disease type 2 (mim 603860) and glomerulocystic kidney disease (mim 609886). Until date, more than 70 mutations have been described in umod and most of them are clustered in exon 4 (83.8%), 5 (8%), and 8 (8%) of umod gene . Two - thirds of these mutations cause substitution of cysteine residues or highly conserved polar amino acids . In the present family, the mutation c. 949 t> substitution of cysteine residue can alter the disulfide bond formation that interferes with correct folding of the umod protein . The misfolded protein accumulates in the endoplasmic reticulum of tubular cells that elicits an adaptive response called as unfolded protein response causing cell death . Have shown that substitution of cysteine by tyrosine (cys317tyr) at the same position leads to delay in export of umod to plasma membrane due to longer retention time in endoplasmic reticulum . There is marked interfamilial and intrafamilial variability that was also seen in the present family . Hyperuricemia is present in 83.3% of the cases and gout in 45% of mutation positive cases . Median age of onset of end - stage renal disease (esrd) was earlier in cases with mutation in epidermal growth factor (egf)-2 and egf3 domains and later in cases with mutation in domain of 8 cysteine (d8c) and cysteine rich regions 1 and 2 . However, there is no correlation between the presence of hyperuricemia or gout and development of esrd . Use of uricosuric drugs such as allopurinol has a definite role in decreasing hyperuricemia and features related to gout . However, the efficacy of these medications in slowing the progression of renal disease is still not clear.
Escherichia fergusonii was described as a new species of the genus escherichia, family enterobacteriaceae in 1985 . It is closely related to e. coli, with whom it shares many of its biochemical properties and resembles the genus salmonella in the lack of lactose breakdown activity . When first identified, the clinical significance of this organism was unclear . First isolate suggesting that this organism was a pathogen was from a human patient with pancreatic carcinoma and cholangiosepsis, in switzerland . The organism was detected in the blood, gallbladder fluid, feces, and a superficial abdominal wound . In the veterinary literature, e. fergusonii has been associated with a clinical case of acute enteritis, septicemia, and death of an adult horse from germany . E. fergusonii was also isolated from intestine, lung, liver, and kidney from a goat with a history of chronic diarrhea and emaciation, in canada . In cattle, birds seem to be also susceptible to e. fergusonii infections; this bacterium was isolated in pure growth from lesions in ostriches with severe hemorrhagic diarrhea and fibrinonecrotic typhlitis . Common pulmonary bacterial pathogens in cattle include mannheimia haemolytica, pasteurella multocida, histophilus somni, mycoplasma bovis, and trueperella (arcanobacterium) pyogenes . Young animals are more prone to develop pneumonias caused by one or more of these agents; however, adult animals are also susceptible, particularly when immunocompromised . In this report, escherichia fergusonii was isolated in pure culture from otherwise pneumonic lesions, where one or more of the common bacterial pathogens for cattle were expected to be found . A 4-year - old angus cow, pregnant, nursing her 6-month - old heifer, was found down, alert, tachypneic, and with hyperthermia (41.7c). The herd had been moved to a new irrigated pasture the day before the animal was presented for clinical evaluation . The referring veterinarian treated the cow with iv fluids, flunixin meglumine, and ceftiofur . Despite treatments, the animal was found dead the next day and submitted for postmortem examination together with a blood sample drawn the previous day . The case was described as acute, lasting only 36 hours; other herdmates were not affected . On necropsy, the animal was in fair postmortem state, good nutritional status, mildly dehydrated, and icteric . A 25 cm . The cecum had a dark brown runny content, and the spiral colon had dry brown feces . The packed cell volume was determined in the submitted blood sample and found to be 26% . Sections of lung, liver, spleen, kidney, heart, rumen, abomasum, small, intestine, spiral colon, mammary gland, and brain were fixed in 10% buffered formalin, routinely processed for histology and examined . It consisted of a fibrinonecrotic bronchopneumonia with large, irregular, necrotic alveolar areas, filled with fibrin and surrounded by densely packed neutrophilic infiltrates, including oat cells, suggestive of mannheimia spp . Or pasteurella spp . Infection (figure 1). Within the necrotic areas, the liver displayed centrilobular hepatocellular degeneration, with incipient hepatocyte necrosis (suggestive of hypoxic changes), mild histiocytic infiltration in sinusoids, and increased bile in canaliculi . The mammary gland had a chronic - active suppurative mastitis with increased interlobular fibrosis, multifocal acinar necrosis, neutrophilic exudates into the acinar and ductal lumina, and moderate numbers of intralesional gram - negative coccobacilli . Rare intraerythrocytic parasites consistent with anaplasma sp . Were detected with wolbach - giemsa staining in the liver and lungs and in a smear from the fresh blood sample stained with diff - quick (in> 1% of rbc, estimated). Lungs and liver were cultured on blood - agar and macconkey - agar plates, incubated for 48 hours, 37c in aerobic, co2 enriched conditions (7% co2). Culture identification was performed with standard biochemical procedures and confirmed with commercial enteric identification system (api 20 e test by biomerieux). The single bacterial isolate in pure culture and in large numbers from two lungs and one liver samples was acid / acid (a / a), gas producer, and h2s negative on triple sugar iron media (tsi), motile, indole, and ornithine decarboxylation positive on motility - indole - ornithine media (mio), orthonitrophenyl--galactoside (onpg) positive, urea hydrolysis positive and negative for citrate utilization . Based on these findings isolate was identified as escherichia fergusonii . Given the unusual bacteriological results and lung histology suggestive of another, rather than escherichia spp . E. fergusonii was isolated again from lung, in pure culture and large numbers . On kirby - bauer disk diffusion test, using interpretation criteria as with e. coli, the isolate was resistant to ceftiofur, erythromycin, penicillin, and ampicillin, and it was sensitive to neomycin, streptomycin, tetracycline, and florfenicol . Anaplasma infection was confirmed by pcr, test performed on splenic tissue at the washington animal disease diagnostic laboratory as previously described . Leptospira was ruled out by fluorescence antibody test (fat) on kidney smears (leptospira fluorescent antibody conjugate, national veterinary services laboratory). Range 0.250.5 ppm), copper, zinc, and iron were within normal limits and mercury, and arsenic, cadmium, and lead were not detected . E. fergusonii pathogenic capability has been demonstrated as reported in multiple species including humans, several mammalians, and birds [26]. Here, e. fergusonii appears to be responsible for a severe, acute pneumonia and death in an adult cow . It is possible that stressors such as an anaplasma infection with mild anemia, low selenium levels, and advanced pregnancy while nursing a 6-month - old calf may have contributed to an immunocompromised animal susceptible to this bacterium . While the lesions were histologically suggestive of mannheimia / pasteurella pneumonia (oat cells formation) and assuming e. fergusonii would produce escherichia coli - like lesions (suppurative rather than fibrinonecrotic), recovering e. fergusonii in large numbers and pure culture from 3 lung sampling sites (2 on necropsy and 1 reculture) would suggest that this pneumonia was due to the bacterium . It is possible that mannheimia / pasteurella started the pneumonic process, induced the lesions associated with these bacteria, and then were controlled with antimicrobial treatment . Under this condition, if e. fergusonii was present it was then able to multiply and appear as the agent responsible for the proceeding severe, acute pneumonia leading to death . It is highly unusual for a single dose of an antimicrobial product to clear a pathogen such as mannheimia / pasteurella when death occurs soon (less than 24 hours) after the initiation of treatment . If this scenario happened, e. fergusonii should still be considered an opportunistic but potentially a severe pulmonary pathogen for cattle . Postmortem contamination was considered but if e. fergusonii was a relatively common contaminant, it would be frequently detected in animals submitted for necropsy with some autolysis and often in mixed cultures . E. fergusonii is rarely isolated from necropsy samples in our bacteriology laboratory, never in large numbers and pure culture . Isolation from liver is suggestive of a potential bacteremic spread when disease was advanced or terminal . We believe that e. fergusonii is an organism that under certain circumstances might act as a lung pathogen in cattle . To our knowledge, this is the first case where e. fergusonii is reported as a pulmonary pathogen in cattle.
One hundred sixty - four maine clinics were contacted in february 2003 and invited to join the study; 69 of these agreed to participate . Clinics were instructed to record results of all idexx 3dx lyme disease tests that were conducted as part of a routine health screen, to record town of residence, and to record if a lyme disease vaccine had ever been administered . Lyme disease vaccines can be highly effective (2); however, since vaccination rates are unevenly distributed, inclusion of vaccinated dogs would bias estimates of disease risk . Canine seroprevalence rates were calculated for minor civil divisions, including towns and unorganized townships . The relationships between the canine prevalence rates and human lyme disease reports to the bureau of health (217 division - matched reports) and tick submissions to the vector - borne disease laboratory (12,482 division - matched submissions) for the 2 years before this study, 20012002, were tested with spearman rank correlation . Canine c6 antibodies persisted in experimentally infected, untreated dogs for 65 weeks, with no endpoint described (9); exposure status of the dogs in the present study could not be determined . Using data from 2 years allowed us to include sufficient numbers of human reports for meaningful statistic testing without sacrificing the ability to look at a " snapshot in time " of the lyme disease spread . Two maps were created . The first map (figure 1) showed prevalence rates of minor civil divisions with 10 tests . The second map (figure 2) showed pooled data from all divisions, including those with small sample sizes . For this map, an overlay of the state with 15-minute quadrangles was used . Each division from which data were collected seroprevalence rates for quadrangles were calculated by combining test results from all divisions within a quadrangle to find the average rate . Quadrangles having a pooled total of <10 tests were not included in this map . Canine lyme disease seroprevalence rates based on the idexx 3dx test for minor civil divisions with 10 tests, maine, 2003 . Regional canine lyme disease seroprevalence rates calculated from minor civil division pools created within 15-minute quadrangles, maine, 2003 . Test results from 9,511 dogs that had not been vaccinated for lyme disease were submitted from 343 minor civil divisions . One hundred and eighty - three divisions met the criterion of a minimum sample size of 10 for calculating prevalence rates . At the division level, seroprevalence rates significantly correlated with the number of ticks submitted to the maine medical center research institute's vector - borne disease laboratory from 2001 to 2002 (r = 0.41, p<0.001), and human lyme disease reports to the bureau of health (r = 0.15, p<0.05) from 2001 to 2002 . Rates were highest along southern coastal maine (47%), with regional rates of 11% as far east as columbia and along the mid - new hampshire border as far north as upton . Forty - four divisions with 10 tests had prevalence rates of 0%; 12 of these had 30 tests and 3 had 60 . This study demonstrates how canine serosurveys using the idexx 3dx test can serve as an active surveillance system for potential human lyme disease risk . This method overcomes the limitations of human lyme disease reporting systems by relying on routine screening of populations of healthy dogs to calculate true seroprevalence rates . In this study, a large volume of data from across the state was generated for the most extensive and detailed measure of regional lyme disease risk in maine to date . In contrast, passive human lyme disease surveillance during the previous 2 years yields cases from <90 towns, approximately two thirds of which had only 1 or 2 cases . Canine seroprevalence rates were congruent with i. scapularis submissions and human lyme disease reports during a 2-year period when dogs could have been infected, reinforcing the effectiveness of this method for predicting geographic human risk . One previous study has calculated canine seroprevalence rates in maine (6), but a different assay technique was used (4), which limited our ability to compare those rates to those of the current study . In spite of substantial agreement between canine seroprevalence and rates of tick submissions, mapping of canine seroprevalence data shows high - risk foci in inland areas that were not previously identified by 14 years of tick submissions to the vector - borne disease laboratory or from human lyme disease reporting to the bureau of health; this suggests that canine serosurveys may identify new areas of disease transmission . These are areas of low human population density, and repeat surveys may demonstrate the value of canine serosurveillance in detecting disease spread where human populations are low . Mapping of pooled data on a regional scale allows geographic patterns of disease to be viewed . Most notably, our data show a concentration of infected dogs in southern and coastal areas . Patterns of infection are suggested in inland areas as well . The significance of these patterns with respect to environmental variables favoring disease transmission is unknown but could be clarified by comparing prevalence rates with patterns of land use, deer herd density, habitat, and other ecologic attributes . The widespread acceptance of the idexx 3dx test facilitates the use of canine serosurveys for public health . In many maine veterinary offices, virtually every dog tested for heartworm in the spring is tested for b. burgdorferi antibody; however, well below 100% of canine patients are vaccinated against lyme disease . Previous serosurveys have involved much more intensive effort because of the need for veterinarians to collect extra blood samples . The ease of data collection based on this manner of testing enhances real - time as well as long - term monitoring of disease . Furthermore, the large volumes of test results generated from routine b. burgdorferi screening, and the ability to collect information on dog residence, make large - scale studies of disease geography possible . That we did not exclude in our analyses dogs that have traveled suggests that caution should be used when considering the importance of low prevalence rates or prevalence rates calculated from low sample sizes . However, our finding of dozens of towns with 0% prevalence suggests that the effect of dogs that have traveled on calculated seroprevalence rates is small.
A 29-year - old female patient reported to the department of periodontics with a complaint of progressive spacing between maxillary right central and lateral incisors . The patient reported a history of composite restoration 2 years back in relation to tooth #7 in a private dental clinic . Following 6 months of restoration intraoral soft tissue examination revealed that oral hygiene status (score 0.9; ohi - s, green and vermilion) was compromised in relation to tooth #7 due to overhanging composite restoration showing marginal and papillary inflammation, and sinus scar on the attached gingiva, associated with purulent discharge from the sulcus . Probing pocket depth measuring> 10 mm mesial to tooth #6 and distal to #7 was associated with pathological mesiolabial migration and grade - ii mobility . Periapical radiograph revealed overhanging restoration with cup - shaped alveolar bone loss as shown in figure 1b . (b) preoperative radiograph showing arc - shaped radiolucency associated with maxillary right lateral incisor . (d) eighteen months follow - up radiograph showing substantial decrease in size of the radiolucency considering the clinical and radiographic findings, the case was diagnosed as localized chronic periodontal abscess in relation to tooth #7 . Initial treatment included phase i periodontal therapy with systemic medication (amoxicillin 500 mg tid, metronidazole 400 mg bid, diclofenac potassium 50 mg bid for 5 days), chlorhexidine mouth wash, and oral hygiene instructions . Thorough root planing was performed to eliminate the palatal groove and supragingival groove was smoothened using diamond burs to prevent the local accumulation of plaque . Later, ldd with chlorhexidine (chx) chip (periocol - cg, eucare pharmaceuticals, chennai, india) was carried out at 3-, 6-, and 9-month intervals in order to control the periodontal disease activity, as shown in figure 1c . After 18 months of follow - up, significant amount of reductions with respect to mobility, bleeding on probing, pocket depth (5 mm), and gain in attachment (3 mm) was observed from baseline . Significant regeneration or bone fill was also observed in radiograph as shown in figure 1d . A 25-year - old male reported to the department of periodontology with a chief complaint of bleeding gums during brushing, for a period of 6 months . The periodontal examination showed that there was bleeding on probing with increased probing depth in upper left central incisor (#9), measuring about 8 mm on the mesiolabial side, 5 mm on the midlabial, distolabial, and distopalatal side, and 9 mm on the mesiopalatal and midpalatal aspect with grade - i mobility . Upon probing, it was found that a palatoradicular groove originated from the cingulum and extended apically to the mesial aspect of the root surface [figure 2a]. On radiographic examination, an arc - shaped radioluceny was seen in the middle and apical one - third of the root surface, with loss of lamina dura . (a) photograph showing raised full - thickness periosteal flap revealing deep intrabony defect and the palatal groove . (b) the groove is planed and collagen membrane is placed over the bone graft . (c) four months postoperative radiograph revealing new bone filling the defect based on the clinical and radiographic findings, a diagnosis was made as the patient received a session of oral prophylaxis, including scaling and root planning, and proper oral hygiene instructions . The papilla preservation flap was selected to gain access to the bony defect, and bone graft combined with resorbable barrier membranes were used to induce periodontal regeneration . Under local anesthesia, sulcular incisions were made around #8, 9, and 10, and a semilunar incision was given on the palatal aspect at the base of the interdental papilla between #8 and #9 . A complete mucoperiosteal flap was elevated on both the labial and palatal sides, exposing the entire bony defect . A palatoradicular groove was clearly visible in the middle one - third of the root surface after removal of granulation tissue . The palatal groove was eliminated (radiculoplasty) by means of a surgical length high - speed diamond periodontal bur under constant water spray . Later, the root was planed with manual instruments (gracey curettes, hu - friedy, n.rockwell, chicago). Then, root conditioning was done using tetracycline hcl (100 mg / ml) for 3 min . A demineralized, freeze - dried bone graft [osseograft, advanced biotech products (p) ltd ., usa] with saline was grafted into the bony defect, after which a resorbable type i collagen membrane (healiguide, advanced biotech products ltd .) Was placed over the graft to cover 23 mm beyond the bony defect as shown in figure 2b . Diclofenac potassium 50 mg bid for 5 days, and 0.12% chx mouthwash 2 times a day for 4 weeks were prescribed . A 29-year - old female patient reported to the department of periodontics with a complaint of progressive spacing between maxillary right central and lateral incisors . The patient reported a history of composite restoration 2 years back in relation to tooth #7 in a private dental clinic . Following 6 months of restoration intraoral soft tissue examination revealed that oral hygiene status (score 0.9; ohi - s, green and vermilion) was compromised in relation to tooth #7 due to overhanging composite restoration showing marginal and papillary inflammation, and sinus scar on the attached gingiva, associated with purulent discharge from the sulcus . Probing pocket depth measuring> 10 mm mesial to tooth #6 and distal to #7 was associated with pathological mesiolabial migration and grade - ii mobility . Periapical radiograph revealed overhanging restoration with cup - shaped alveolar bone loss as shown in figure 1b . (b) preoperative radiograph showing arc - shaped radiolucency associated with maxillary right lateral incisor . (d) eighteen months follow - up radiograph showing substantial decrease in size of the radiolucency considering the clinical and radiographic findings, the case was diagnosed as localized chronic periodontal abscess in relation to tooth #7 . Initial treatment included phase i periodontal therapy with systemic medication (amoxicillin 500 mg tid, metronidazole 400 mg bid, diclofenac potassium 50 mg bid for 5 days), chlorhexidine mouth wash, and oral hygiene instructions . Thorough root planing was performed to eliminate the palatal groove and supragingival groove was smoothened using diamond burs to prevent the local accumulation of plaque . Later, ldd with chlorhexidine (chx) chip (periocol - cg, eucare pharmaceuticals, chennai, india) was carried out at 3-, 6-, and 9-month intervals in order to control the periodontal disease activity, as shown in figure 1c . After 18 months of follow - up, significant amount of reductions with respect to mobility, bleeding on probing, pocket depth (5 mm), and gain in attachment (3 mm) was observed from baseline . Significant regeneration or bone fill was also observed in radiograph as shown in figure 1d . A 25-year - old male reported to the department of periodontology with a chief complaint of bleeding gums during brushing, for a period of 6 months . The periodontal examination showed that there was bleeding on probing with increased probing depth in upper left central incisor (#9), measuring about 8 mm on the mesiolabial side, 5 mm on the midlabial, distolabial, and distopalatal side, and 9 mm on the mesiopalatal and midpalatal aspect with grade - i mobility . Upon probing, it was found that a palatoradicular groove originated from the cingulum and extended apically to the mesial aspect of the root surface [figure 2a]. On radiographic examination, an arc - shaped radioluceny was seen in the middle and apical one - third of the root surface, with loss of lamina dura . (a) photograph showing raised full - thickness periosteal flap revealing deep intrabony defect and the palatal groove . (b) the groove is planed and collagen membrane is placed over the bone graft . (c) four months postoperative radiograph revealing new bone filling the defect based on the clinical and radiographic findings, a diagnosis was made as the patient received a session of oral prophylaxis, including scaling and root planning, and proper oral hygiene instructions . The papilla preservation flap was selected to gain access to the bony defect, and bone graft combined with resorbable barrier membranes were used to induce periodontal regeneration . Under local anesthesia, sulcular incisions were made around #8, 9, and 10, and a semilunar incision was given on the palatal aspect at the base of the interdental papilla between #8 and #9 . A complete mucoperiosteal flap was elevated on both the labial and palatal sides, exposing the entire bony defect . A palatoradicular groove was clearly visible in the middle one - third of the root surface after removal of granulation tissue . The palatal groove was eliminated (radiculoplasty) by means of a surgical length high - speed diamond periodontal bur under constant water spray . Later, the root was planed with manual instruments (gracey curettes, hu - friedy, n.rockwell, chicago). Then, root conditioning was done using tetracycline hcl (100 mg / ml) for 3 min . A demineralized, freeze - dried bone graft [osseograft, advanced biotech products (p) ltd ., usa] with saline was grafted into the bony defect, after which a resorbable type i collagen membrane (healiguide, advanced biotech products ltd .) Was placed over the graft to cover 23 mm beyond the bony defect as shown in figure 2b . Postoperatively, amoxicillin 500 mg tid for 7 days, diclofenac potassium 50 mg bid for 5 days, and 0.12% chx mouthwash 2 times a day for 4 weeks were prescribed . Although different treatment modalities like scaling and root planing, odontoplasty, amalgam restoration, and tooth extraction have been proposed to treat palatogingival groove and associated periodontal bone defects, they do not frequently lead to the regeneration of the lost periodontal tissues . Hence, the treatment approaches should be aimed to 1) eliminate or at least flatten the radicular portion of the groove, 2) regenerate the periodontal attachment and bone loss and consequently improve the clinical conditions, and 3) prevent bacterial recolonization of the defect - associated area . In case 1, to control the disease progression and promote regeneration, chx is a chlorophenyl biguanide and a symmetrical molecule consisting of four chlorophenyl rings and two biguanide groups connected by a central hexamethylene bridge, with the two positive charges on either side of the hexamethylene ring . It has broad - spectrum antibacterial action against a wide range of vegetative gram - positive, gram - negative bacteria, yeast, fungi, facultative anaerobes and aerobes, and certain viruses like hiv . At low concentrations, the agent is bacteriostatic, and at higher concentrations, it is rapidly bactericidal . Chx chip (periocol - cg) is a small, orange - brown rectangular chip, rounded at one end for insertion into periodontal pockets . It is a biodegradable film of fish collagen matrix into which 2.5 mg of chx gluconate has been incorporated and cross linked with glutaraldehyde, glycerin, and water . Each chip weighs approximately 7.4 mg and resembles a baby's finger nail measuring approximately 45 mm and 0.35 mm thickness . The chx chip releases and maintains chx concentration in the gingival crevicular fluid to greater than 100 g / ml for at least 7 days, which is well above the tolerance of most of the oral bacteria . Thus, by limiting most of the periodontal pathogens, it prevents the disease activity and may aid in healing of the periodontium by regeneration . Have shown that controlled - release chx chip can reduce the probing depth and improve the attachment level . Similarly, in the present case, there was significant reduction in probing pocket depth, bleeding on probing, attachment gain, and bone fill during 18 months of evaluation . In case 2, the principles of regeneration have been studied since the 1970s, when melcher suggested that the periodontal ligament cells have the ability to promote new cementum, periodontal ligament, and bone formation (periodontal regeneration). Confirmed that the periodontal ligament cells have the ability to reestablish connective tissue attachment, once the contact between the gingival connective tissue (and epithelium) and the root surface is prevented by the use of a barrier . Anderegg and metzler reported 10 cases of palatoradicular groove treated using gtr with significant reduction in probing depth (5.00.8 mm) and gain in attachment level (5.30.9 mm). Reported a case in which tooth #7 was successfully treated by radiculoplasty, bone graft with demineralized freeze - dried bone allograft, and placement of a non - absorbable membrane . Postoperatively, substantial resolution of the osseous defect and about 7 mm of probing attachment gain was recorded . One of the main goals of periodontal regenerative surgical therapy is to obtain and maintain primary soft tissue closure above the bony defect during the healing period, and thus ensure protection to the blood clot for the healing process . In this case report, primary soft tissue coverage above bony defect was accomplished by means of papilla preservation flap . In the present case, the defect was deep and wide where there was less possibility of containing the blood coagulum during the healing period . Hence, demineralized, freeze - dried bone graft and a resorbable type i collagen membrane was used as the periodontal regenerative materials . A resorbable collagen membrane has demonstrated to have the ability to prevent the apical migration of epithelium along the root surface during periodontal wound healing without requiring a second surgery for membrane removal . A bone graft was combined with gtr since in addition to reducing the dead space for tissue ingrowths, it also prevents the overlying membrane from possible collapse . The use of bone graft and gtr to treat this bony defect resulted in a significant improvement in the clinical parameters, with bone filling the defect after 4 months [figure 2c]. Effective recognition of the palatoradicular groove is critical due to the diagnostic complexity and the periodontal problem that may arise if they are not properly interpreted and treated . Although several studies have reported the clinical evidence of arresting the disease progression by chx, to our knowledge for the first time, presenting radiographic evidence of periodontal regeneration in osseous defects with palatoradicular groove using chx as local drug therapy . Further controlled studies to confirm the advantages of this technique over conventional treatment modalities are required.
Culturally sensitive dialog tools promoting patient - provider communication and healthy behaviors improve patient outcomes . However, few studies explicate methods of achieving cultural sensitivity in interventions like diabetes education, including how and if members of the target population were involved . (e.g. Matching of materials and messages to the preferred by the target population) and deep structure (incorporating cultural, social, historical, environmental, and psychological factors that influence health behaviors of the target population). This report describes the development of dialog tools targeting dietary education among pakistani immigrants in denmark with type 2 diabetes, a population with increased prevalence of both type 2 diabetes and multiple chronic conditions, a lower educational level, and less diabetes knowledge, compared to the majority population . Design - based research covers methodologies in education that are designed to bridge the gap between research and practice . Design methods include ethnographic and observational techniques, visualization, prototyping, sketching, storytelling, brainstorming, and others . The processes in design - based approach are a continuous process of definition and redefinition of problems and design opportunities, as well as design and redesign of prototypes [table 1]. Rather than designing an entire intervention only to discover at the end that it may not work, iterative design argues for quickly building prototypes, testing them, and re - designing while gradually evolving the intervention over time . In this study, we applied the methodology of design thinking, which is a humanistic approach developed by brown and wyatt . Design thinking particularly focuses on the needs of the people who consume a product or service and the infrastructure that enables it . Overview of activities in the design thinking process the consumers of dietary education are health care professionals and patients, so both groups were highly involved in the development phase . The process of design thinking can be divided into three major phases: inspiration, ideation, and implementation [table 1]. Researchers with public health, behavioral and educational science backgrounds were drivers of all processes . In addition, four dieticians, an industrial designer, a nutritional scientist with managerial responsibility, and 18 patients with pakistani background and type 2 diabetes were involved in the process . Patients were recruited within a specialist diabetes clinic in the copenhagen area, using snowball sampling . The iterative development process characterized as research through mistake required a great deal of dialog between researchers and dieticians . Dieticians had a strong focus on the outcome, namely effective education, as opposed to the researchers strong focus on the process leading to effective education through designing, testing, and redesigning tools . The number of tools and their content such as the amount of text and pictures were modified throughout the entire process, based on data from observations and interviews with patients, dieticians, and health care professionals with the goal of increasing the surface and deep structure dimensions of cultural sensitivity . A consistent developmental pattern was a movement toward less text and more pictures in the dialog tools . Some dialog tools were rooted in existing education materials and converted into interactive and engaging tools . Others emerged as ideas from patients or as a combination of patients and dieticians ideas . For example, patients preferred that the dietary education addressed low blood sugar in relation to diet, whereas dieticians expressed a need to address high blood sugar . Consequently, researchers merged the two ideas into a dialog tool addressing the symptoms of high and low blood sugar, as well as possible solutions to address high or low blood sugar as described by patients and dieticians . For instance, patients considered a food pyramid with familiar and commonly consumed food items irrelevant and difficult to interpret; it was consequently omitted early in the process . In practice, how effective the tools were at activating and involved patients was highly dependent on the setting and the dieticians skills in social learning, a person - centered approach, and cultural competence . Dieticians considered it is challenging to choose the right tools at the right time . Knowledge and learning tools were chosen and tested more frequently by dieticians than were reflection tools . Barriers to applying reflection tools were that dieticians were less confident at using them and viewed them as time - consuming . In addition, dieticians were more familiar with applying knowledge - based materials in their usual patient counseling . Researchers perceived that dieticians application of the tools was not always consistent with the intended person - centered approach, which encompassed a strong focus on patient experiences and patient - identified problems and challenges . Furthermore, researchers and dieticians did not always reach consensus about the educational philosophy with regards to pedagogy and process of learning . For example, one learning and knowledge tool contained pictures of food items patients reported eating if they experienced low blood sugar . One dietician was concerned that the images depicted inappropriate food items and could cause confusion for patients . These differences were explored and sought solved through dialog between researchers and dieticians during workshops . We observed differences in how the tools were received by patients in individual and group settings . One reflection tool intended to create awareness of the patient's role in the family regarding food (e.g. Planning, grocery shopping, and social practices) was well - received when tested in family interviews but not in a group setting . Interviews with patients revealed that the tool was considered inappropriate in group settings due to cultural expectations about a family's role in practices around food . If the family pattern diverged from the expectations, it was considered inappropriate to share this information in a group setting . In this way, cultural sensitivity was also embedded in the application of dialog tools . A design thinking approach appears to be a promising method to develop dialog tools for patient education that are culturally sensitive, thereby increasing their acceptability among the target population . The process also emphasizes the importance of adequate training and competencies in the application of dialog tools and of alignment between researchers and health care professionals with regards to the educational philosophy underlying their use.
Preterm birth is the leading cause of neonatal death worldwide with one million deaths directly resulting from premature birth . More children under the age of 5 years die due to preterm birth than to aids, malaria, or tuberculosis recently, the importance of epigenetics as a regulator of gene expression has become apparent and, potentially, epigenetic differences are driving gene expression leading to preterm birth . Epigenetics is the process by which interactions between genes and environment lead to stable changes in phenotype . Epigenetic changes (e.g., dna methylation, covalent histone modifications, etc .) Are by definition heritable, meaning that effects brought about by the environment at critical periods of development (such as gestation) can have long - term detrimental consequences . Indeed, certain epigenetic changes are passed between generations which might explain some of the familial and intergenerational effects observed for preterm birth . Epigenetic information is conveyed via a synergistic interaction between mitotically heritable patterns of dna methylation and histone - mediated modifications to the chromatin structure . In mammals, dna methylation primarily involves the addition of methyl groups to cytosine residues present in a cpg dinucleotide . Hypermethylation of promoter regions of genes is typically associated with transcriptional repression whereas hypomethylation is usually permissive for gene activity . Histone modifications consist of a plethora of enzymatic modifications including acetylation, methylation, ubiquitination, and phosphorylation of different amino acids in the n terminal tails of histone proteins, the combination of which is thought to determine the local conformational state of the chromatin . Currently, over 60 different histone modifications have been identified although actual numbers are likely to be significantly higher . Recent work has clearly demonstrated that epigenetic marks determine time- (temporal) and tissue - specific (spatial) aspects of gene expression throughout development . In contrast, others might carry an epigenetic signature that is less sensitive to the normal stimuli of labour, therefore, leading to dysfunctional labour or postdates delivery . The environment presumably plays a crucial role in bringing about these epigenetic changes that are critical for the safe passage of gestation and later outcomes . An increasing number of diverse factors are now known to epigenetically regulate genes, including age, inflammation, gender, genotype, stress, nutrition, metabolism, drugs, and infection, thus heightening the relevance of the study of the epigenetics of preterm birth . Both classes of epigenetic modification (e.g., dna methylation and covalent histone modifications) can be reversed through treatment with a chemical inhibitor: 2-deoxy-5-azacytidine (aza) that inhibits dna methylation leading to global hypomethylation of dna, while treatment with an inhibitor of histone deacetylation such as trichostatin a (tsa) leads to increased levels of histone acetylation . In both cases we demonstrated in an earlier study that the combination treatment of human choriodecidual explants with aza and tsa leads to a massive increase in il-1 production in response to lps . In the present study lipopolysaccharide (lps), 5-aza-2-deoxycytidine (aza), and trichostatin a (tsa) were purchased from sigma chemical (st . Louis, mo). Culture media and fetal calf serum (fbs) were from life technologies (carlsbad, ca, usa). Human il1, tnf, il10, and il1ra elisa kits were purchased from bd bio sciences . Placental tissues were collected from women undergoing elective caesarean section at term, with the approval of the northernx regional ethics committee . Three individual placentae from singleton pregnancies of healthy nonsmoking mothers were used in the study . In triplicate, villous and amnion tissues explants were cultured in 12-well plates (three pieces of tissue to a well) in dmem / f12 media supplemented with glutamax, 10% fbs, and 1% antibiotic - antimycotic and incubated at 37c in humid 5% co2/95% air for 24 h (modified from [18, 19]). Explant treatments included the use of 5-aza-2-deoxycytidine (aza), which inhibits dna methylation, and/or trichostatin a (tsa) which inhibits histone deacetylation . Doses and times were chosen to be consistent with published literature [18, 20]. 24 hours following placental dissection, the media were replaced with serum - free media (dmem / f12 with glutamax and 0.1% bovine gamma globulin and 1% antibiotic - antimycotic medium). Explants were treated with either 200 nm aza alone, tsa (300 nm) alone, 5 m aza with tsa (300 nm), or the dmso carrier and cultured for 48 h, with media refreshed once during this time . This represented a 48 h preincubation aza (the action of aza is passive and requires cell division for action). The treatment period commenced 72 h postdissection and consisted of the addition of 300 nm tsa or dmso carrier in fresh media, in the presence or absence of lps (5 g / ml), to the explants for a duration of 24 h. the media were collected following the treatment and the wet weight of the tissue in each well determined so that cytokine production rates could be normalized . Measurements of pro- (il1, tnf) and anti - inflammatory (il10, il1ra) cytokines were conducted on cultured media using elisas according to manufacturers' specifications . Production rates of cytokines were calculated as picograms per gram wet tissue weight per 24 h and are presented as% basal control values (means se, n = 3). Statistical significance was determined by anova, and p <0.05 was considered to be significant . Lps treatment significantly (p <0.05) increased the production of il-1 (~1034-fold), tnf (~23>100-fold) and il10 (~610-fold) after 24 h of treatment in villous explants, as expected . Aza treatment did not have any significant effect on any cytokines' production tested either alone or in combination with lps . Interestingly, however, the stimulatory effects of lps on tnf production were partially mitigated (p <0.05) by tsa treatment in villous explants . Neither lps nor the tsa or aza had any significant effect on the cytokine production in amnion explants after 24 h of treatment . Conceivably, epigenetic modifications (e.g., dna methylation and covalent histone modifications) might render individuals more or less susceptible to either term or preterm birth by modulating the expression of genes that are effectors of the parturition pathway, for example, the contraction - associated proteins, cox-2, oxytocin, and prostaglandin receptors in myometrium . Thus, some individuals may have a sensitive epigenetic phenotype that leads to an increased susceptibility to preterm labour . Global dna methylation is increased in preterm preeclamptic placentae . In this study, in conjunction with our previous work we have shown that epigenetic regulation of cytokine production is tissue specific in gestational tissues . Aza / tsa treatment resulted in a massive increase in il-1 production in response to lps whereas in amnion and villous placenta this did not occur although a small positive trend in mean production was noted (figures 1 and 2). This raises the question of tsa - like moieties being developed to attenuate inflammatory process in the human placenta . The disadvantage of such an approach is, of course, the enhancement of il-1 production in choriodecidua by such an agent . The tissue - specific nature of these regulatory mechanisms means that we must be cautious in our approach to such matters . Amnion clearly does not respond to the inflammatory challenge of lps although it remains a significant source of cytokine production and once activated can respond vigorously to modifications of the cytokine environment [2225]. Villous placenta seems crudely to be more active in proinflammatory cytokine biosynthesis than anti - inflammatory cytokine biosynthesis . This is clearly dangerous for the fetus and may play a role in the fetal inflammatory syndrome, although clearly direct evidence must be obtained before conclusions are drawn . Furthermore, treatment with a histone deacetylation inhibitor can partially abrogate lps - stimulated tnf production in villous placenta but not amnion.
Inherited retinal diseases include some of the commonest causes of blindness in the developed world [1, 2]. Prominent examples included age - related macular degeneration (amd), diabetic retinopathy, and the numerous monogenic conditions such as retinitis pigmentosa (rp), stargardt's disease, and x - linked retinoschisis . As well as causative / predisposing genetic abnormalities, in some cases (such as amd), environmental factors such as smoking and diet have been highlighted [4, 5]. These aetiological factors have been associated with diverse abnormal biochemical pathways in the degenerating retina, for instance, oxidative stress; lipofuscin accumulation in the retinal pigment epithelium; abnormalities of the extracellular matrix; mitochondrial abnormalities; ischaemia with neovascularisation; programmed cell death . In particular in amd and rp, inflammation has recently become a prominent member of this list of abnormal pathological pathways triggered by genetic retinal disease [12, 13]. Early studies showed that autoantibodies can be detected in blood of amd patients [14, 15] and that macrophages also accumulate in the choroid which suggested that immune - mediated processes were involved in the pathogenesis of amd . Renewed interest in inflammation in genetic retinal disease was, however, more recently triggered by the discovery of elements of the immune system and multiple proteins of the complement pathway within the drusen seen in amd . Although the exact pathophysiology of amd remains largely unknown, accumulation of drusen is acknowledged as an early and major pathological hallmark of the disease, preempting damage in the retinal pigment epithelium, photoreceptors, and choroid leading to atrophic or neovascular complications . Immunohistochemical studies of human retina highlighted that amongst other components, amd drusen contained inflammatory mediators such as vitronectin, immunoglobulin light chains, factor x, and complement proteins (c5 and c5b-9 complex). Importantly, it was also demonstrated that drusen displays intense hla - dr immunoreactivity [17, 18]. This later finding complements other independent work suggesting and association between amd and hla - genotype . It is, however, now recognised that the composition of drusen deposits is extremely heterogeneous amongst different patients and that many other components are also found in addition to inflammatory mediators . For instance, other studies have highlighted the appearance of oxidative protein modifications within amd drusen including cross - linked species of tissue metalloproteinase inhibitor 3, vitronectin, and carboxyethyl pyrrole protein adducts suggesting oxidative stress as an etiological factor in amd drusen formation . The feasibility of linking immunity to amd pathophysiology has also been suggested by the central role the retinal pigment epithelium (rpe) plays in both amd pathogenesis and ocular immune modulation . Both in vivo and in vitro experiments have demonstrated that the rpe expresses both innate and adaptive immune receptors [22, 23]. In addition, rpe cells are known to secrete numerous cytokines, chemokines, and adhesive molecules including interleukin-6, interleukin-8, and immunosuppressive factors including tissue - necrosis factor-, interleukin-11, and interferon- . Evidence suggesting a role for inflammation in amd has, however, been strongly supported by molecular genetic studies . In particular, genes strong associations have been demonstrated for alleles of genes encoding complement factor h (cfh) [2426] which is a regulator of the alternate complement pathway, complement component c2/complement factor b (c2/cfb), and cfh - related genes cfhr1 and cfhr3 . Weaker associations have been linked to complement factor 1; complement c3 and complement component 1 inhibitor (serping1), a regulator of the classic complement pathway; chemokine c - x3-c receptor 1 (cx3cr1); and toll - like receptor genes tlr3 and tlr4 (with a role in the innate immune system) [29, 30]. It should be noted, however, that strong genetic associations between loci and amd also exist, for example, to the plekha1/arms2/htra1 region of chromosome 10q26 . Most recently, however, there has been remarkable work linking nucleotide - binding domain and leucine - rich - repeat - protein 3 (nlrp3) and the inflammasome with the aetiology of armd [3133]. The inflammasome is a term used to identify a collection of proteins that work together within cells with a common purpose, more specifically, a caspase-1 dependant multiprotein complex that has a key role in innate immunity . The inflammasome can be triggered by a number of stimuli including microbial pathogen - associated molecular patterns, bacterial toxins and most relevant to genetic retinal disease this results in the upregulation of proinflammatory cytokines interleukin-1 and interleukin-18 [34, 35]. The inflammasome can be activated by three classes of immune sensors including the toll - like receptors, rig - i - like helicases, and nlr proteins . Currently, four inflammasomes based on nlrp3 have been characterised: nlrp1/nlrp1b; nlrc4/ipaf; nlrp3/nalp3; aim2 . Activation of the nlrp3 inflammasome has recently been reported in dry amd drusen, by complement component c1q or by carboxyethylpyrrole (during oxidative stress). In wet armd, activation of the nlrp3 inflammasome has been seen triggered by alu rna molecules (short chains rna). Intriguingly, reflecting the diversity of immune responses, the most recent in vivo and in vitro studies have suggested that the nlrp3 inflammasomes may have a beneficial role in wet armd but a harmful effect leading to rpe cell death in dry amd [31, 32]. Linking inflammatory mediators to the choroidal neovascularization seen in complicated amd is also firmly established . In both preclinical and clinical studies, cellular components of immunity including macrophages, lymphocytes and neutrophils have been found to be significant components of choroidal neovascular complexes [16, 41, 42]. Additionally, inflammatory cytokines such as interleukin-6 and interleukin-8 have also been identified in the aqueous humor of amd patients suffering from choroidal neovascularization . While the term retinitis pigmentosa as coined by donders in 1857 is generally considered a misnomer, a role for inflammation and immunity in the pathogenesis of the disease has significant merit . The earliest studies to suggest this showed elevated igm in six out of ten rp patients . Other early studies also suggested that retinal (probably photoreceptor) autoantibodies could be found in the systemic circulation of rp patients [4548]. Immune reactivity in rp was also established by exposing lymphoctyes and leuckocytes from blood samples of rp patients to human and bovine retinal antigens . However, results have been complicated by the fact that immune reactivity appears to vary amongst rp patients possibly reflecting the genetic heterogeneity of the disease . Studies suggested that circulating immune complexes could be detected in less than 50% of rp patients . This was, however, reported as significant since it correlated with statistically significant reductions of circulating complement factors c3 and c4 and a significant reduction in time taken for rp patient sera to achieve 50% hemolysis of sheep red blood cells . A link with hla status has also been reported in rp patients, and vitreous samples from rp patients have been shown to contain many immune system cells such as various types of lymphocytes . More recent studies have highlighted the activation of microglia in rp retina preceding photoreceptor cell death . Activation of microglia results in many biochemical events including the release of cytokines and chemokines . In rd mice (a homozygous nonsense phosphodiesterase - beta subunit gene mutant), it has been shown that prior to peak photoreceptor cell death, there is an upregulation of mrna of proinflammatory factors: monocyte chemoattractant proteins 1 and 3; macrophage inflammatory proteins 1alpha and 1beta; regulated on activation normal t - cell expressed and secreted (rantes); tumor necrosis factor - alpha . Microglia activation and upregulation of proinflammatory markers has also been demonstrated to precede peak photoreceptor cell death in rd10 mice (homozygous missense phosphodiesterase beta subunit mutant). Although direct biochemical assessment of retina from human rp patients is difficult, more detailed recent studies have searched for signs of inflammatory cells and humoral inflammatory factors in aqueous and vitreous humor from rp patients . Slit lamp examination revealed that cells could be visualised in the anterior chamber 37% (190) and the vitreous of 61% (313) of 509 rp eyes (up to 30 cells identified in a 1 9 mm vertical slit - lamp field). It was not explained however how it was concluded that these were inflammatory cells (and not for instance, pigmentary cells). The study did, however, also report multiplex elisa data suggesting significantly increased protein levels of cytokines (interleukin 6) and chemokines (interleukin-8, monocyte chemoattractant protein 1, and thymus activation - regulated chemokine) in the aqueous . Much more notably, in the vitreous of these rp patients, significantly elevated levels of cytokines (interleukin 1, 1, 2, 4, 6, and 10, interferon- and tissue necrosis factor-) along with chemokines (such as interleukin-8, monocyte chemoattractant proteins 1 and 2, interferon- inducible protein-10, and thymus activation - regulated chemokine) were found . These include cell - based therapies; gene therapy; electronic retinal replacements; molecular - based approaches such as neuroprotection and antiangiogenesis . With an established role for inflammatory mediators in the pathogenesis of both amd and rp, it would therefore be rational to investigate anti - inflammatory approaches . However, despite numerous animal models for rp, no universally recognised animal model for amd yet exists, and only approximations modeling aspects of the disease are available . In addition, it is as yet unclear what role relative to other pathogenic mechanisms inflammation plays in disease pathogenesis . Anti - inflammatory approaches, for example, might have little impact on disease if inflammation is a secondary effect or a minor contributor to pathogenesis . To some extent, therefore, the importance of inflammation in amd and rp can be validated through quantification of the effect of anti - inflammatory therapeutics . There are currently 846 listed clinical trials (http://www.clinicaltrials.gov/) focused on amd of which 51 are specifically targeting inflammation . There are also 78 clinical trials listed for rp, although none are focused on anti - inflammatory therapeutics . Studies targeting inflammation in amd and rp may be subdivided into broad approaches targeting multiple components of inflammation or more specific targeting of complement activation, for instance . Corticosteroids have been used in retinal disease for many years because of their general anti - inflammatory effect, generally up - regulating the expression of anti - inflammatory proteins and suppressing the expression of proinflammatory factors [63, 64]. Although their use in uveitis and retinitis is well established, corticosteroids are now being considered in amd . Many studies have looked at the use of intravitreal dexamethasone in the treatment of neovascular complications of amd, mostly as an adjuvant therapy in combination with photodynamic therapy, intravitreal anti - vegf therapy, or in multitherapy approaches [65, 66]. A sustained release dexamethasone (such as ozurdex, allergan, inc ., irvine, ca) would seem to be the logical option in such an adjuvant approach . One single - masked, randomized control study in 243 eyes reported work comparing intravitreal ranibizumab plus sustained release dexamethasone with ranibizumab plus sham . Results suggested a reduction in the need for multiple ranibizumab injections and an increasing interval between injections although combination therapy was associated with raised intraocular pressure requiring treatment in 16% [67, 68]. A number of other clinical trials are now assessing dexamethasone as an adjunct in the treatment of wet amd, and full reports are awaited (http://www.clinicaltrials.gov/, nct01162746; nct00793923; nct00390208). Other approaches include iluvien, an intravitreal implant containing fluocinolone acetonide packed in a nonbiodegradable polyamide tube . An ongoing phase 2 clinical trial is currently recruiting patients to look at the efficacy of this intravitreal implant in inhibiting geographic atrophy progression in amd (http://www.clinicaltrials.gov/, nct00695318). Rapamycin, a drug originally designed as an antifungal agent, has recently been shown to be a potent immunosuppressive, anti - inflammatory, and antiangiogenesis agent by inhibiting the mammalian target of rapamycin (mtor), a serine / threonine protein kinase . Recent work in the senescence - accelerated oxys rat has shown some inhibition of the spontaneous retinopathy phenotype seen which models age - related macular degeneration in some respects . A phase 2 study has been launched by national eye institute to determine whether repeated intravitreal rapamycin can slow progression of geographic atrophy (http://www.clinicaltrials.gov/, nct01445548). Glatiramer acetate is another broad immunomodulatory agent that upregulates specific suppressor t - cells and suppresses inflammatory cytokines . Intravenous glatiramer acetate in dry amd patients has been shown to reduce drusen load on optical coherence tomography imaging . In the wet form of amd, anti - inflammatory agents have been found to be moderately successful in controlling choroidal neovascularization . For example, intravitreal triamcinolone acetonide and infliximab, an antibody of tumor necrosis factor (tnf-), have shown positive effects in treating cnv in patients and animal models [72, 73]. The area in which inflammatory mediators in genetic retinal disease is being most intensively investigated, however, is in inhibiting activation of the complement system in amd patients . Fcfd4514s is a recombinant, humanized monoclonal antibody fab fragment antibody targeted to block the complement factor d, an early rate - limiting enzyme in the activation of the alternative complement pathway . Current phase 2 clinical trials are assessing its use in geographic atrophy (http://www.clinicaltrials.gov/, nct01602120). Eculizumab (soliris) is a humanized complement factor 5 monoclonal antibody that binds to complement factor 5 to block subsequent downstream anaphylatoxin activation and the formation of membrane attack complexes . It is considered by some to be the most likely approach since it preserves production of c3a anaphylatoxin and c3b production required for opsonisation and clearing of harmful immune complexes . An example of studies focusing on nonantibody approaches to modify complement activation is pot-4, the first complement inhibitor to be assessed in amd . This molecule is a cyclic peptide that reversibly binds to c3 preventing its activation to c3a and c3b, thus blocking the classic pathway and the lecithin pathway as well as the alternative complement pathway . Intravitreal depot injections are being assessed in patients with wet and dry amd (http://www.clinicaltrials.gov/, nct00473928). Other nonantibody approaches include small molecule peptidomimetic c5a receptor antagonists currently being considered for amd . An alternative approach that may avoid the general consequences of inhibiting complement activation is studies focusing on replacing abnormal complement factor h alleles . Tt30 is a recombinant fusion protein being used to replace defective complement factor h and is being considered for use in amd trials . Modification of complement activation may also be of benefit in wet amd . In a laser - induced mouse model of choroidal neovascularization, intravenous administration of cr2-fh, a recombinant form of complement factor h linked to complement receptor 2, inhibited neovascular growth . Corticosteroids have been routinely used to treat the macular edema seen in late rp with mixed success . Most recently, however, a sustained - release dexamethasone implant (ozurdex) has been used in a small cohort of rp patients with macular oedema, suggesting some structural and functional benefits . Also recently, n - acetylcysteine, an orally bioavailable antioxidant, has been used in rd10 mice . It was shown by tunel staining that a reduction in photoreceptor cell death was associated with a strong suppression of expression of cytokines interleukin 1 and tissue necrosis factor- and chemokines monocyte chemoattractant proteins 1 and thymus activation - regulated chemokine . In another study, fluocinolone acetonide has been conjugated with dendrimer particles (a hydroxyl - terminated polyamidoamine dendrimer - drug conjugate nanodevice) to target outer retina activated microglia . They showed that after intravitreal administration in the royal college of surgeons rat model of rp (homozygous mertk mutant), four weeks later, there had been significant preservation of outer nuclear layer thickness (indicative of photoreceptor survival) and in electroretinogram b - wave response . In addition, it was shown that this was associated with a reduction of activated microglia in the retina . Considerable evidence now exists linking inflammatory mediators to genetic retinal diseases such as amd and rp . It is, however, still unclear whether this is a central or pivotal role . Preclinical and clinical trials suggest that inhibiting inflammatory mediators can have some therapeutic benefit, but further ongoing trials are needed to demonstrate the true impact of this approach . The benefits of inhibiting inflammation in genetic retinal disease might, for instance not be so clear - cut . In recent clinical trials, ciliary - derived neurotrophic factor (cntf, a neuroprotective growth factor) has been shown to provide some inhibition of degeneration in both dry amd and rp . Studies in mouse retina, however, have suggested that cntf induces expression of proinflammatory genes in retinal mller cells . A role for anti - inflammatory agents, as stand - alone monotherapies or as adjuvants (for instance, in combination with neuroprotective strategies or anti - vegf therapies), is certain to be prominent feature of future research into the treatment of retinal disease.
Hypertension is a major cardiovascular risk factor, and cardiovascular disease is a leading cause of premature morbidity and mortality in china . The joint national committee 7 (jnc 7) report describes prehypertension as an independent category of blood pressure . With the exception of people who take antihypertensive drugs, people with systolic blood pressure (sbp) between 120 and 139 mmhg or diastolic blood pressure (dbp) between 80 and 89 mmhg are deemed to have prehypertension . Compared to people with normal blood pressure, these people require lifestyle modifications to decrease the risk of progression to hypertension and to prevent cardiovascular disease . In the clinical setting, elevation of serum factors such as low - density lipoprotein cholesterol (ldl) were believed to be predictive factors for atherosclerotic cardiovascular disease and mortality . Besides these traditional risk factors, high - sensitivity c - reactive protein (hs - crp), a marker of low - grade inflammation, has been used as a predictor of cardiovascular mortality and morbidity in healthy people . Elevation of hs - crp may suggest acute involvement of inflammation in the development of hypertension and always occurs before blood pressure elevation . At the same time, it was demonstrated that elevated serum sialic acid (sa) is associated with increased cardiovascular mortality [911] and could be associated with prehypertension in indians . The purpose of this study was to investigate the correlations of sa and hs - crp in chinese prehypertensive patients . We detected and analyzed potential cardiovascular risk factors such as dyslipidemia, elevated hs - crp, and sa to explore the possible relationship between these 2 factors in volunteers with hypertension, prehypertension, and normal blood pressure . The study protocol received ethics approval from the china - japan friendship hospital regional ethics committee . Written informed consent was obtained from each participant in accordance with the declaration of helsinki . We enrolled 181 volunteers deemed healthy based on physical examination at the china - japan friendship hospital in july 2011 . We excluded volunteers with the following conditions: secondary hypertension, coronary heart disease, myocardial infarction, heart failure, cerebrovascular disease, diabetes, gout, incomplete liver and kidney function, recent infection, pregnancy, habitual drinking, habitual smoking, blood system diseases, and other endocrine diseases . Based on the 2010 china hypertension prevention and control guidelines, the volunteers were divided into 3 groups: 50 in the normal blood pressure group (control; sbp <120 mmhg, dbp <80 mmhg), 61 in the prehypertension group (sbp 120~139 mmhg and/or dbp 80~89 mmhg), and 70 in the hypertension group (sbp 140 mmhg and/or dbp 90 mmhg). Blood pressure was determined using a standard mercury sphygmomanometer; it was measured thrice and the average value was recorded as the volunteer s blood pressure . The body mass index (bmi) volunteers were required to eat lightly for 3 days before measurements were obtained, with a compulsory water - only fast 12 h before measurement; 5 ml venous blood was collected from the volunteers in resting conditions . The plasma was used for estimating the lipid profile, apolipoprotein b, serum hs - crp, and sa . Shanghai shen suoyou fu medical diagnostic products provided the reagents for testing serum total cholesterol (tc), triglyceride (tg), high - density lipoprotein cholesterol (hdl), ldl, and fasting glucose (fbg). The landau british company provided the reagents for hs - crp and the serum sa detection kit was from wenzhou east ou jin ma biotechnology . Variance analysis was used for comparison among groups and t - test was used for comparison between groups . The relationship between serum sa and hs - crp with prehypertension figure 1 depicts the general characteristics and clinical profiles of the hypertensive, prehypertensive, and control volunteers . There was no significant difference in sex and age among these 3 groups . There was a significant gradient increase in sbp, dbp, bmi, sa, and hs - crp levels in all 3 groups . The levels of sa, hs - crp, and bmi in prehypertensive patients were higher than in healthy controls (p=0.015,0.006, and 0.004, respectively; figure 1a, 1b, 1e) and lower than in hypertensive groups (p=0.02, 0.008, 0.005, respectively; figure 1a, 1b, 1e). The level of hdl in prehypertensive patients was lower than in healthy controls and higher than in hypertensive groups (p=0.007 and 0.004, respectively; figure 1d).compared with the controls, tc, ldl, and fbg levels were significantly increased in hypertensive volunteers (p=0.003, 0.008, 0.002; respectively, figure 1c, 1d, 1f). There were no significant differences in tc, ldl, and fbg between healthy controls and prehypertensive patients or between prehypertensive and hypertensive patient groups . We used multiple linear stepwise regression to evaluate the relationship between serum sa and hs - crp with blood pressure in the 3 groups . Using sbp and dbp as dependent variables and tc, hdl, ldl, tg, fbg, bmi, sa, and hs - crp as independent variables, we found that fbg, bmi, sa, and hs - crp were independently associated with sbp (p=0.02, 0.001, 0.01, 0.002, respectively; table 1), and ldl, bmi, sa, and hs - crp were independently associated with dbp (p=0.03, 0.03, 0.04, 0.001, respectively; table 2). There is a positive correlation between hypertension and cardiovascular disease, and hypertension is becoming a serious threat to human health . The jnc 7 report describes prehypertension as an independent category of blood pressure . . Demonstrated that prehypertension precedes the development of hypertension in 90% of people and that it can increase the risk of cardiovascular disease [1317]. Identifying the risk factors for early hypertension would be of great significance in preventing cardiovascular disease . Crp, which is synthesized by the liver, can respond to factors released by macrophages and fat cells . As an acute - phase protein active in the response to inflammation, crp also can predict cardiovascular mortality and morbidity in healthy people . In this study, there was a positive correlation between serum hs - crp level and sbp and dbp . The following facts may be associated with the relationship between serum crp and blood pressure: (1) crp can damage vascular endothelial cells, reduce the release of nitric oxide and prostaglandin, and weaken the vasodilatation function; (2) elevation of blood pressure can damage vascular endothelial cells and activate the inflammation response, followed by elevated crp; and (3) elevated crp can increase endothelin release, contract blood vessels, and promote vascular smooth - muscle cell proliferation and migration, and the development of atherosclerosis . Overall, crp is an important inflammatory factor, being significantly correlated with blood pressure in prehypertensive and hypertensive volunteers . Several studies have demonstrated an association between serum sa and cardiovascular mortality in the general population . As a potential risk factor, sa can be an acute - phase response marker in cardiovascular disease . In this study, there was a significant gradient increase in the sa levels of prehypertensive and hypertensive volunteers compared with that of the controls (p<0.05). This suggests that the blood sa levels in these volunteers increased before they developed high blood pressure . In other words, three mechanisms may be involved in the influence of blood sa levels on blood pressure . Firstly, sa can promote atherosclerosis development by the inflammatory response, interfere with iron metabolism, and promote platelet thrombus formation mechanisms . Sa is the main source of vascular endothelial cell surface negative charge; it can influence the vascular endothelial cell function for promoting the development of hypertension . Thirdly, sa can also affect ldl metabolism, inducing vascular smooth muscle damage, and the damaged muscle can promote the development of hypertension . Similar to crp, sa is associated with and is a predictor of cardiovascular disease and type 2 diabetes . Compared with crp, sa may be a more stable inflammatory marker because it can reflect the overall level of acute - phase reaction, whereas crp only represents the acute - phase reaction when it is released from the liver . There were significant differences in tc, ldl, and fbg levels between the prehypertension and control groups . The increased tc and ldl levels suggested that the prehypertensive volunteers also had blood lipid and blood glucose disorders . Blood lipids, blood glucose, and blood pressure can be involved in synergistic mutual promotion . In conclusion, acute - phase markers such as sa and hs - crp were significantly increased in prehypertensive and hypertensive volunteers . The increased serum sa and hs - crp levels were independently associated with sbp and dbp, respectively . Higher levels of these 2 factors may suggest a greater risk for future high blood pressure . Clinically, comprehensive hypertension risk can be evaluated by detecting blood, salivary, and serum crp in prehypertensive patients, and pharmacological tools can be developed to ameliorate the development of hypertension in this highly susceptible section of the population.
The isolation and initial characterization of tm171 - 03 have been described elsewhere (2). For genomic sequencing, rna was extracted from infected vero cell culture supernatant (second vero cell passage from the original brain material, designated v2) using the qiaamp kit (qiagen inc ., valencia, ca), reverse transcribed with amv reverse transcriptase (rt) (roche, indianapolis, in) and amplified by polymerase chain reaction (pcr) as nine overlapping fragments by using taq polymerase (roche). The pcr products were purified from 1.5% tae / agarose gels by using the qiaquick kit (qiagen) and directly sequenced on an abi prism model 3100 dna sequencer (applied biosystems, foster city, ca) at the university of texas medical branch's protein chemistry core facility by using the amplifying primers and additional internal primers . The primers used for rt - pcr and sequencing were similar to those used by lanciotti et al . (3) and beasley et al . (4) (complete details are available on request). Sequence data were assembled into the complete genome sequence and analyzed as described elsewhere (2,4). In addition, bayesian analyses were performed by using mrbayes v3.0 (5) and 100,000 generations . A general time - reversible model was used with empirically estimated base frequencies and either a codon position - specific or a distribution of substitution rates . The genomic sequence for tm171 - 03 (genbank accession number ay660002) differed from the ny99 prototype sequence (genbank af196835) at 46 nucleotides (nt) (0.42%). As reported previously, sequencing the prm - e genes of tm171 - 03 (v1 passage) identified nonsynonymous mutations encoding substitutions at prm-141 ilethr and e156 serpro (2). The e-156 mutation results in the loss of the e-154 - 156 " nys " glycosylation motif . Complete genome sequencing identified only two other encoded amino acid changes from the ny99 sequence at ns4b-245 (ileval) and ns5 - 898 (thrile). However, during the sequencing of the v2 passage material, a reversion from pro to ser encoded at e-156 was observed . Analysis of the sequence chromatograms from v1 and v2 passages, and for a pcr product obtained from the original brain material, indicated that this reversion was likely to be the result of a mixed virus population, with overlapping " t " and " c " peaks visible at residue 1432 in the sense or antisense sequences for each product . To confirm this finding, pcr products containing the e-156 region from each passage level of tm171 - 03 were cloned into pgem - t(easy) (promega, madison, wi), and five clones were sequenced for each . For the original brain tissue, four clones encoded pro at e-156 and one clone encoded ser . For products derived from either v1 or v2 passages, two or three clones encoded a pro at e-156, and the remainder encoded a ser . In addition, several variants of tm171 - 03 were purified through two rounds of plaque selection in vero cells, and nucleotide sequencing of these variants also confirmed a mixed population . Sequences from approximately half of the plaques encoded a pro at e-156, while the remainder encoded ser . Western blotting of infected vero cell lysate antigens for these variants with wnv e protein - specific monoclonal antibody 7h2 (6) showed differences in the electrophoretic mobility of the proteins consistent with the presence or absence of glycosylation (figure 1). Western blot showing differing mobility of e proteins from nine plaque - purified variants of west nile virus (wnv) strain tm-171 mex03 . Nucleotide sequencing of strains in lanes 5 to 9 indicated the presence of an " nys " glycosylation motif at residues 154 to 156 of e, while strains in lanes 1 to 4 encoded " nyp . " Antigens were separated in a nonreducing 5%/10% discontinuous sodium dodecyl sulfate polyacrylamide gel, transferred to 0.2 m nitrocellulose and detected with wnv - specific monoclonal antibody 7h2 (6). Comparison of the tm171 - 03 nucleotide sequence with other genomic sequences of wnv strains showed that it was most closely related to strain ny00-grouse3282 (genbank af404755; figure 2). The ny00-grouse3282 sequence differed from ny99 at only 13 nt (0.11%), and its relationship to tm171 - 03 was apparently based on 10 nonstructural protein region nucleotide differences from ny99 that were shared with tm171 - 03 (table 1). None of these mutations encoded amino acid differences, and tm171 - 03 differed from ny00-grouse3282 at 39 other nucleotides . Isolates collected during 2000 and subsequent years are needed to attempt to establish a definitive relationship for tm171 - 03 with a particular north american isolate . Neighbor - joining phylogenetic tree based on complete genome sequences of west nile virus strains . Bayesian analysis also confirmed the close relationship between tm171 - 03 and ny00-grouse3282 sequences (data not shown). Genbank accession numbers for sequences used to construct the tree are indicated on the branches . Bold text indicates residues at which ny00-grouse 3282 and tm171 - 03 both differed from ny99 . Consensus sequence of early passage material had " c " at nucleotide 1432 . To assess the effects of the e-156 serpro mutation on the virulence of tm171 - 03, serial 10-fold doses from 1,000 to 0.1 pfu of tm171 - 03 and four plaque - purified (pp) substrains (tm171 - 03-pp1 and -pp2 encoding pro at e-156; tm171 - 03-pp5 and -pp6 encoding ser) were inoculated intraperitoneally (i.p .) And intracranially (i.c .) Into groups of 3- to 4-week - old female nih swiss mice to determine mouse neuroinvasiveness and neurovirulence, as described elsewhere (7) and in accordance with guidelines of the university of texas medical branch institutional animal care and use committee . Inoculation, as were the plaque - purified variants, tm171 - 03-pp5 and -pp6, which encoded the e154 - 156 nys glycosylation motif (i.p . And 50% lethal dose [ld50] values for each <2.0 pfu; table 2). The lethality of these strains was comparable to that of other north american isolates that have been evaluated by using the nih swiss mouse model (4,7). In contrast, the nonglycosylated variants tm171 - 03-pp1 and -pp2 were both attenuated, having i.p . Nih, national institutes of health; ast, average survival time; i.p ., intraperitoneal; i.c ., intracranial; ld50, 50% lethal dose; sd, standard deviation; na, not applicable . Average survival time sd was calculated for to confirm that the mouse virulence differences between the plaque - purified variants could be primarily attributed to the mutation at e-156, regions that encoded the additional consensus amino acid mutations at prm-141, ns4b-245, and ns5 - 898 were sequenced . All four plaque - purified variants encoded the three amino acid mutations that were present in the consensus sequence . No additional mutations encoding amino acid changes were identified in the regions that were sequenced for these strains (equivalent to 3,000 nt in total for each). Although the entire genome of each plaque - purified variant was not sequenced, we believe that it is highly unlikely that the mouse virulence differences observed between the variants would be attributable to other amino acid mutations in the unsequenced regions that were present in the two e-156 pro variants but not the e-156 ser variants or the parental tm171 - 03 strain . These results are somewhat contrary to previously reported data that described attenuated variants with glycosylated e proteins that were derived from a virulent, nonglycosylated israeli lineage 1 wnv strain (8). However, subsequent studies identified e glycosylated variants of the same strain that retained a virulent phenotype, which suggests that multiple determinants, most probably including mutations in the nonstructural protein genes, were responsible for the observed variations in virulence (9). Other comparisons of wild - type wnv strains suggested that absence of e protein glycosylation might be associated with attenuation of mouse neuroinvasiveness (7). Recently, some of us have shown that mutating the e protein gene of a wnv infectious clone derived from the ny99 prototype strain to prevent glycosylation resulted in a 200-fold attenuation of neuroinvasiveness, but not neurovirulence, in the nih swiss mouse model (d.w.c . Data). Given the greater degree of attenuation of neuroinvasiveness and neurovirulence observed for the nonglycosylated tm171 - 03-pp1 and -pp2 variants described here, we hypothesize that one or more of the other mutations (at prm-141, ns4b-245, or ns5 - 898) also contributed to the phenotype, but this hypothesis remains to be determined experimentally . All of these mutations in the absence of the e-156 serpro mutation (as occurred in the tm171 - 03-pp4 and -pp5 variants) did not appear to significantly affect the mouse virulence phenotype . E protein glycosylation appears to play an important role in flavivirus assembly in mammalian cell culture (10); the mechanism by which this particular mutation would emerge in a wild - type wnv population, as is the case with the tm171 - 03 isolate, is not clear . However, the posttranslational processing of glycoproteins differs between mosquito and mammalian cells (11), and adaptation of dengue virus to mosquito cells resulted in loss of the equivalent glycosylation motif (12), which suggests that the presence of carbohydrate on the e protein may be of lesser importance during virus replication in mosquito cells . Recent data from the mexican department of health indicate that no human cases of encephalitis attributable to local transmission of wnv have occurred during 2004 and, although many wnv - seropositive horses have been identified, few cases of overt clinical disease have been reported (http://www.cenave.gob.mx/von; accessed 26 aug, 2004). The epidemiology of wnv disease in mexico is likely to be complicated by preexisting immunity to other flaviviruses, but the emergence of an attenuated wnv strain would be important . Border suggest that they are closely related to recent isolates from texas that do not encode mutations at the e glycosylation motif (13; j. estrada - franco, et al . Data).we are unaware of any other wnv isolates from tabasco or other southern regions of mexico . Obtaining additional isolates from southern mexico is important to determine if a nonglycosylated wnv population is emerging and to ascertain what impact this may have on the prevalence of severe wnv disease in mexico.
Acute kidney injury (aki) is a common complication that occurs in some of the hospitalized patients especially in intensive care units . Renal ischemia reperfusion (ir) is one of the most important causative mechanisms of aki . Renal ir injury may also lead to the failure of other systems like lung, brain, and liver [1, 2]. Humoral or cellular factors are thought to be the causes of remote organ failure, but their exact pathophysiological mechanisms are not completely understood [3, 4]. Previous studies have shown that aki causes an increase in leukocyte infiltration in remote organs such as the liver . It has also been demonstrated that renal ir induces oxidative stress in the liver resulting in hepatic dysfunction . Renal ir caused an increase in hepatic tumor necrosis factor levels, myeloperoxidase activities, and thiobarbituric acid reactive substance (tbars) concentrations [5, 6]. During renal ir, liver functional indices such as blood ast and alt were elevated and spermine - spermidine acetyl transferase, an enzyme upregulated in early phases of hepatic injury, was increased . Superoxide dismutase (sod) and catalase are among the most important enzymatic antioxidant systems in the body . Sod, as the first and most important line of defense against reactive oxygen metabolites, transforms superoxide ion to h2o2 that is a less reactive molecule . Reactive oxygen species degrade polyunsaturated fatty acids, forming mda, a cytotoxic reactive aldehyde which can be used as a biomarker to measure the level of oxidative stress in an organism . In recent years, ischemic conditioning (i.e., brief intermittent episodes of ischemia) has been considered to protect against prolonged lethal ischemia . More recently, postconditioning (poc, intermittent interruptions of blood flow at the beginning of reperfusion) has been discussed as a more practical approach than ischemic preconditioning (ipc). Similar to preconditioning, poc triggers signaling pathways and activates effectors implicated in other cardioprotective maneuvers . It was suggested that poc reduces the cardial reperfusion - induced injury, blunts oxidant mediated damages, and attenuates the local inflammatory response to reperfusion . This study was designed to investigate the protective effects of renal ischemic poc on liver damage after renal ir injury . The possible role of poc in reduction of ir - induced oxidative stress in the liver was also investigated . After right nephrectomy, twenty - four male sprague - dawley rats (250 to 300 g) were randomly divided into three groups, eight in each: sham, ir, and poc groups . Rats were anaesthetized by intraperitoneal injection of sodium pentobarbital (60 mg / kg sigma - aldrich, steinheim, germany). Systolic blood pressure was measured by the tail - cuff method connected to a pressure transducer (mlt 0380, adinstruments, castle hill, australia). In the ir group, 45 min of left renal artery occlusion was induced followed by 24 hours of reperfusion . In the sham group, all of the above surgical procedures were applied without induction of ir . In poc group, after induction of 45 min ischemia, 4 cycles of 10 seconds of ischemia and 10 seconds of reperfusion were applied to the kidney just at the beginning of 24 hours of reperfusion to the kidney . After 24 hours, serum and liver tissue samples were collected for measuring of hepatic functional indices and assessment of hepatic oxidative stress status . Blood samples were centrifuged at 4000 g for 10 min at 4c, and serum was collected for biochemical analysis . Liver tissues were washed in cold phosphate - buffered saline and snap - frozen in liquid nitrogen . Serum aspartate aminotransferase (ast) and alanine aminotransferase (alt) were used as hepatic functional indices and were measured by commercially available kits . The tissue mda level was determined by the method of esterbauer and cheeseman based on its reaction with thiobarbituric acid at 90100 c and measurement of the absorbance at 532 nm . Mda reacts with thiobarbituric acid (tba) and produces a pink pigment which has a maximum absorption at 532 nm . The value of each sample was obtained from the standard curve and was expressed as mol / g tissue . Sod activity was measured according to the paoletti and mocali method . In this assay, superoxide anion is generated from molecular oxygen in the presence of edta, manganese (ii) chloride, and mercaptoethanol . Nicotinamide adenine dinucleotide phosphate oxidation is linked to the availability of superoxide anions in the medium . Statistical analysis . Serum levels of alt and ast, hepatic functional parameters, were significantly increased in ir group compared to the sham group (114.5 13.73 versus 70.62 7.75 mg / dl and 428.4 31.39 versus 253.28 18.13 mg / dl, p <0.05, figure 1). These indices were significantly lower in poc group compared to the ir group (73.71 8.94 versus 114.5 13.73 mg / dl and 274.4 31.33 versus 428.4 31.39 mg / dl, p <0.05, figure 1). Hepatic mda levels were increased and sod activity was decreased in ir group compared to the sham group (6.31 1.16 versus 1.24 0.42 mol/100 mg tissue and 0.46 0.1 versus 1.48 0.08 u/100 mg tissue, p <0.05, figure 2). Induction of renal poc prevented the ir - induced reduction in hepatic sod activity and ir - induced increase in hepatic mda level (2.48 0.15 versus 6.31 1.16 mol/100 mg tissue and 1.55 0.08 versus 0.46 0.1 u/100 mg tissue, p <0.05, figure 2). The present study demonstrated that renal ir leads to the damage to the liver as a remote organ . Our findings suggest that renal poc attenuates ir - induced liver functional injury and mda levels and increases sod activity in liver tissues compared to the ir group . Several mechanisms are suggested to be involved in remote organ failure, but their exact pathophysiological roles are not completely understood [3, 4]. Chemokines and mitochondrial products activate neutrophils to amplify remote lung injury during mouse acute liver failure . Renal ir and bilateral nephrectomy result in uncontrolled expression of interleukin-17a in the small intestines . Il-17a is a proinflammatory cytokine that causes recruiting neutrophils, activates t cells, and induces expression of other cytokines and chemokines such as tnf- and il-6 in liver tissue . Increased oxidative stress and production of reactive oxygen species in the liver that were shown in the present study are also thought to play a key role in triggering and maintaining the inflammatory response . Malondialdehyde, an index of lipid peroxidation, was found to be increased in the liver after both renal ischemia reperfusion and bilateral nephrectomy . In addition, hepatic glutathione, an important endogenous free radical scavenger with protective effects on the liver, was decreased . Administration of glutathione before renal ir decreased histological evidence of liver injury and malondialdehyde concentrations and reduced transaminitis . In addition, renal ir leads to decreased concentrations of antioxidant enzymes including myeloperoxidase, superoxide dismutase, and catalase . In the present study, changes in ast and alt in serum following renal ir are indicators of remote organ failure in liver . Induction of oxidative stress and the increased production of reactive oxygen species, as a result of renal reperfusion injury, are thought to play key roles in triggering the damage locally or to the remote organs . The increasing mortality rate in patients with aki necessitates the design of strategies to better understand and assess the impact of kidney injury on distant organs . There is abundant evidence that the sudden restoration of blood flow to ischemic tissue may paradoxically exaggerate injury that is not present at the end of ischemia and could be modified by interventions given only at reperfusion . Reperfusion elicits a wide range of injuries depending on the timing of restoration of blood flow and involves a number of triggers, mediators, and end effectors that are responsible for vascular endothelial dysfunction, upregulation of adhesion molecules on the endothelium, transendothelial emigration of inflammatory cells, tissue edema, infarction, and apoptosis . Therefore, it is valuable to explore clinically applicable and effective therapeutic strategies to reduce postischemic injury . Poc, intermittent interruptions of blood flow at the beginning of reperfusion, has been discussed as a practical approach that can trigger signaling pathways and activate effectors . One promising finding of the present study was that induction of remote poc resulted in the protection of liver tissue, demonstrated by reduction in alt and ast . Data from this study also showed that poc protected the liver from renal ir injury by a modification in the hepatic sod activity and mda level . Thus, it can be concluded that the changes in hepatic oxidative stress markers and liver functional indices are in harmony . In other words, in those groups of rats where the oxidative stress is higher, the liver is less functional . Penna et al . Suggested that poc reduces the cardiac reperfusion - induced injury, blunts oxidant mediated damages, and attenuates the local inflammatory response to reperfusion . In a study by liu et al ., poc protection is evidenced by increase in nitric oxide release and no synthase expression . In another study, it was found that poc with a consecutive sequence of 3, 6, and 12 min of reperfusion separated by 5 min of reocclusion reduced creatinine and bun levels . Protection was associated with preservation of mitochondrial function after 24 and 48 hours of reperfusion . Furthermore, attenuation of reperfusion injury with poc in the kidney has also been associated with phosphorylation of akt and erk1/2 and preservation of antioxidant enzymes such as superoxide dismutase, catalase, and glutathione peroxides . Suggested that attenuation of renal ischemia reperfusion injury by poc involves adenosine receptors and pkc activation . In the present study, poc protected the liver, as a remote organ, from renal ir injury by reductions in the oxidative stress markers and preservation of the antioxidative enzymes . The present study is compatible with the past reports in which it has been demonstrated that poc was able to decrease the systemic damage intensity after a small intestinal ischemic - reperfusion episode . In conclusion, this study suggests that aki initiates distant organ dysfunction and poc protects the liver as a remote organ from the renal ischemia reperfusion injury . These beneficial effects of poc may be due to the reduction of oxidative stress parameters.
The incidence of type 2 diabetes (t2d) has increased significantly over the last several decades (24, 42), and management of the disease presents a significant health challenge . T2d is characterized by elevated fasting blood glucose and insulin insensitivity, and can lead to many health complications, including the development of cardiovascular disease (8). Exercise is recommended as a therapy for the prevention and management of t2d (26). The american college of sports medicine (acsm) recommends 150 minutes / week of moderate intensity aerobic exercise conducted over 5 days / wk or more, along with moderate to vigorous - intensity resistance training at least 23 days / wk (8). Acutely and chronically, resistance and aerobic exercise have been shown to improve glucose uptake and insulin action (2, 13, 17, 18, 20, 23, 27, 3133). In spite of the known health benefits of exercise, most americans do not meet the recommended amounts of exercise, in part due to a lack of time (5). Recent studies have examined the effects of high intensity interval training in an attempt to reduce the necessary time commitment while simultaneously improving health (3, 7, 21). For example, sprint interval training (sit) in young volunteers results in significant improvements in muscle oxidative capacity (6, 7), exercise performance, fat oxidation (28, 30), endothelial function (29), and glucose tolerance (i.e., ability to maintain normal blood glucose) (3). Although use of sit induces significant physiological and functional improvements from only 23 minutes of exercise per workout, the total workout time commitment remains close to 30 minutes due to the prolonged rest period between each work interval . Thus, in terms of time commitment, sit is no more effective than traditional aerobic training . Perhaps more important, sit employing the wingate protocol is conducted at supramaximal intensity and is potentially unsafe for sedentary middle - aged and older adults, especially if they have not undergone proper medical evaluation for determination of exercise safety (1). Consequently, other hit protocols have been developed that utilize a lower intensity than sit and also requires less time . (21) utilized a protocol consisting of ten 1-minute exercise intervals at a workload ~ 90100% vo2max interspersed with 60 recovery periods with a total workout time (excluding warm - up and cool - down) of ~ 20 minutes . Use of this training strategy has been shown to significantly increase skeletal muscle glut-4 protein content (21) and lower 24-hour glucose in type 2 diabetics (21). Moreover, because of the 1-minute recovery periods, the metabolic cost, heart rate response, and rating of perceived exertion are similar to continuous steady state running at 70% vo2max (11). In spite of these recent findings, hit may not be feasible for many individuals due to various reasons including, but not limited to, the costs associated with exercise testing, prescription, and supervision . Kettlebell training has existed for several years and is known to result in significant improvements in muscular strength (e.g. Back squat) and power output (e.g. Vertical jump) (25). It can differ considerably from traditional resistance training in that exercises may be performed at a significantly lower percentage of 1 repetition maximum, and with less recovery time between exercises . In many respects, kettlebell training is similar to circuit training and represents a hybrid of traditional endurance and resistance training . Most kettlebell exercise routines require the use of only one or two kettlebells and can be performed in the home . It is considered a more cost - effective means of exercise, as it does not require expensive equipment or monthly fitness membership . In spite of the significant functional improvements associated with kettlebell training, the effects of kettlebell exercise on selected health markers such as glucose tolerance have yet to be investigated . The purpose of this preliminary study was to examine whether or not a single session of kettlebell exercise impacts glucose tolerance in healthy, but sedentary individuals . A secondary objective was to evaluate the average oxygen cost of the kettlebell workout employed in this study . We hypothesized that immediately following a bout of kettlebell exercise, glucose tolerance would be significantly improved compared to control . We also hypothesized that a bout of kettlebell exercise would be as effective at improving glucose tolerance compared with a bout of hit similar in duration . Inclusion criteria included healthy individuals who were sedentary (exercised 2 day / week), had a body mass index <30, and had a normal blood glucose response during a two - hour oral glucose tolerance test (ogtt) (i.e., did not display impaired glucose tolerance or type 2 diabetes). Exclusion criteria included individuals who were active (exercised> 2 times / week), had a bmi 30, took glucose or lipid lowering medication, smoked, or had any medical condition where exercise was contraindicated . Six healthy sedentary males with a mean age of 23.8 (1.8) years and a mean bmi of 26.5 (0.5) kgm completed the study . All subjects provided informed consent prior to participation in the study . To test our hypothesis, a repeated measures design was used . Following a screening ogtt and determination of maximal oxygen consumption (vo2max), subjects underwent three different experimental conditions . Each visit was separated by a minimum of 5 and maximum of 7 days . All procedures except the graded treadmill test were performed between 06000900 hours following an overnight fast (> 8 hours). Subjects were asked to refrain from any vigorous physical activity and to maintain their normal diet throughout the study . The independent variable was the experimental condition whereas the major dependent variables included blood glucose and insulin concentrations . Blood was obtained from an ear stick before (0 minutes), 30, 60, 90, and 120 minutes after rapidly consuming 75 gm of glucose (100 ml volume, glucose orange drink 075, azer scientific, morgantown, pa). Blood glucose was measured using a commercially available glucose meter (accu - chek glucose meter, aviva, roche diagnostics, indianapolis, in) that meets the international organization for standardization requirements (35). Any subject with a fasting blood glucose> 100 mgdl or with a two - hr ogtt blood glucose concentration> 140 mgdl was excluded from the study . After completing the ogtt, subjects were familiarized with the equipment and procedures to be used throughout the study . On the second visit, body composition was assessed using volume plethysmography (bodpod, cosmed, chicago, il). Subjects then underwent a graded exercise test on a treadmill for determination of vo2max . During the treadmill test, subjects ran at an initial self - selected speed between 8.0 12.9 kmh at 0% grade . The grade remained constant throughout the test, but the speed was increased 0.8 kmh every two minutes . Subjects were given a three - minute warm - up period (4.8 kmh at 0% grade) prior to the test and a three - minute cool - down period (3.2 kmh at 0% grade) following the test . The exercise test was terminated when the subject could no longer continue (volitional exhaustion). Prior to the test, an ear stick was performed to obtain baseline blood lactate (lactate plus, nova biomedical, waltham, ma) levels . Oxygen consumption was measured breath by breath throughout the test (viasys vmax, carefusion, san diego, ca). Heart rate was measured at each stage using a polar heart rate monitor (polar usa, lake success, ny) via a chest strap, whereas perceived exertion was measured using the standard 620 borg scale . Heart rhythm was also monitored using an electrocardiograph (mac 550, ge healthcare, united kingdom). Was separated by ~ one week (57 days), and the order of conditions was randomized for each subject . Condition 1 was a control visit (quiet sitting for 2 hours during the ogtt) where no prior exercise was performed . Subjects used either a 9 or 11.3-kg kettlebell for the workout depending on their ability . Kettlebell ability was based on whether a subject could complete an exercise with an 11.3 kg kettlebell . If the subject deemed the kettlebell too heavy and was unable to complete the 15 repetitions, a 9-kg kettlebell was provided for that exercise . The workout consisted of seven exercises (squat and press, chest press, one - arm kettlebell swing, bent over row, front squat, sit - up press - up, and kettlebell swing) in sequence targeting the muscles of the legs, arms and core . Fifteen repetitions per exercise were performed with 30 seconds of standing recovery between each set . After completion of the seven exercises, subjects were given one - minute standing recovery followed by a second circuit of the aforementioned exercises . The workout was preceded by a warm - up consisting of five sets of 20 kettlebell swings . Heart rate was measured at the end of each exercise whereas rating of perceived exertion (rpe) was measured following each circuit . Condition 3 consisted of high - intensity interval running (hit) on a motor driven treadmill with a 1:1 work - to - rest ratio . Following a three - minute warm - up period at 4.8 kmh, subjects performed 10 one - minute intervals at a running speed corresponding to 90% vo2max . Each exercise interval was interspersed with a one - minute active rest period (5.6 kmh). . Heart rate and rpe were recorded throughout the condition . To determine the effect of the hit and kettlebell workouts on blood glucose and lactate, blood was obtained via ear stick before and immediately following the exercise protocols . Approximately five minutes following each condition, 7ml of blood was withdrawn from the antecubital vein into edta lined vaccutainer tubes (16x100 lavendar, bd, franklin lakes, nj). Blood glucose was also measured at each draw using the portable glucose meter as previously described . Plasma insulin was measured in duplicate using an enzyme - linked immunosorbent assay (elisa) kit (ab100578, abcam, cambridge, england) per the manufacturer s instructions . The elisa kit was read at 450 nm wavelength using a microplate reader (imark, biorad, hercules, ca). During a separate visit after completion of the three experimental conditions, a subset of five subjects came into the lab for measurement of the oxygen cost of the kettlebell workout . Subjects performed the same kettlebell workout previously described while oxygen consumption and respiratory exchange ratio (rer) was continuously monitored (trueone, parvo medics, sandy, ut). Glucose and insulin data were analyzed using a two - way (group * time) repeated measures anova (sigma stat). The holm - sidak method was used for post - hoc multiple pair - wise comparisons . All data were normally distributed, and values are expressed as mean se (n = 6). Inclusion criteria included healthy individuals who were sedentary (exercised 2 day / week), had a body mass index <30, and had a normal blood glucose response during a two - hour oral glucose tolerance test (ogtt) (i.e., did not display impaired glucose tolerance or type 2 diabetes). Exclusion criteria included individuals who were active (exercised> 2 times / week), had a bmi 30, took glucose or lipid lowering medication, smoked, or had any medical condition where exercise was contraindicated . Six healthy sedentary males with a mean age of 23.8 (1.8) years and a mean bmi of 26.5 (0.5) kgm completed the study . To test our hypothesis, a repeated measures design was used . Following a screening ogtt and determination of maximal oxygen consumption (vo2max), subjects underwent three different experimental conditions . Each visit was separated by a minimum of 5 and maximum of 7 days . All procedures except the graded treadmill test subjects were asked to refrain from any vigorous physical activity and to maintain their normal diet throughout the study . The independent variable was the experimental condition whereas the major dependent variables included blood glucose and insulin concentrations . Blood was obtained from an ear stick before (0 minutes), 30, 60, 90, and 120 minutes after rapidly consuming 75 gm of glucose (100 ml volume, glucose orange drink 075, azer scientific, morgantown, pa). Blood glucose was measured using a commercially available glucose meter (accu - chek glucose meter, aviva, roche diagnostics, indianapolis, in) that meets the international organization for standardization requirements (35). Any subject with a fasting blood glucose> 100 mgdl or with a two - hr ogtt blood glucose concentration> 140 mgdl was excluded from the study . After completing the ogtt, subjects were familiarized with the equipment and procedures to be used throughout the study . On the second visit, body composition was assessed using volume plethysmography (bodpod, cosmed, chicago, il). Subjects then underwent a graded exercise test on a treadmill for determination of vo2max . During the treadmill test, subjects ran at an initial self - selected speed between 8.0 12.9 kmh at 0% grade . The grade remained constant throughout the test, but the speed was increased 0.8 kmh every two minutes . Subjects were given a three - minute warm - up period (4.8 kmh at 0% grade) prior to the test and a three - minute cool - down period (3.2 kmh at 0% grade) following the test . The exercise test was terminated when the subject could no longer continue (volitional exhaustion). Prior to the test, an ear stick was performed to obtain baseline blood lactate (lactate plus, nova biomedical, waltham, ma) levels . Oxygen consumption was measured breath by breath throughout the test (viasys vmax, carefusion, san diego, ca). Heart rate was measured at each stage using a polar heart rate monitor (polar usa, lake success, ny) via a chest strap, whereas perceived exertion was measured using the standard 620 borg scale . Heart rhythm was also monitored using an electrocardiograph (mac 550, ge healthcare, united kingdom). Was separated by ~ one week (57 days), and the order of conditions was randomized for each subject . Condition 1 was a control visit (quiet sitting for 2 hours during the ogtt) where no prior exercise was performed . Subjects used either a 9 or 11.3-kg kettlebell for the workout depending on their ability . Kettlebell ability was based on whether a subject could complete an exercise with an 11.3 kg kettlebell . If the subject deemed the kettlebell too heavy and was unable to complete the 15 repetitions, a 9-kg kettlebell was provided for that exercise . The workout consisted of seven exercises (squat and press, chest press, one - arm kettlebell swing, bent over row, front squat, sit - up press - up, and kettlebell swing) in sequence targeting the muscles of the legs, arms and core . Fifteen repetitions per exercise were performed with 30 seconds of standing recovery between each set . After completion of the seven exercises, subjects were given one - minute standing recovery followed by a second circuit of the aforementioned exercises . The workout was preceded by a warm - up consisting of five sets of 20 kettlebell swings . Heart rate was measured at the end of each exercise whereas rating of perceived exertion (rpe) was measured following each circuit . Condition 3 consisted of high - intensity interval running (hit) on a motor driven treadmill with a 1:1 work - to - rest ratio . Following a three - minute warm - up period at 4.8 kmh, subjects performed 10 one - minute intervals at a running speed corresponding to 90% vo2max . Each exercise interval was interspersed with a one - minute active rest period (5.6 kmh). Heart rate and rpe were recorded throughout the condition . To determine the effect of the hit and kettlebell workouts on blood glucose and lactate, approximately five minutes following each condition, 7ml of blood was withdrawn from the antecubital vein into edta lined vaccutainer tubes (16x100 lavendar, bd, franklin lakes, nj). Blood glucose was also measured at each draw using the portable glucose meter as previously described . Plasma insulin was measured in duplicate using an enzyme - linked immunosorbent assay (elisa) kit (ab100578, abcam, cambridge, england) per the manufacturer s instructions . The elisa kit was read at 450 nm wavelength using a microplate reader (imark, biorad, hercules, ca). During a separate visit after completion of the three experimental conditions, a subset of five subjects came into the lab for measurement of the oxygen cost of the kettlebell workout . Subjects performed the same kettlebell workout previously described while oxygen consumption and respiratory exchange ratio (rer) was continuously monitored (trueone, parvo medics, sandy, ut). Glucose and insulin data were analyzed using a two - way (group * time) repeated measures anova (sigma stat). The holm - sidak method was used for post - hoc multiple pair - wise comparisons . All data were normally distributed, and values are expressed as mean se (n = 6). One subject withdrew from the study because they did not wish to have any further venipuncture . A second subject was eliminated from the study because of nausea following ingestion of the glucose drink . Another subject was eliminated due to a display of reactive hypoglycemia following the hit workout . Values obtained for blood lactate (> 8.0 mmoll) or rer (1.15) at the end of the test indicated that all subjects achieved vo2max . Glucose values obtained during a two - hour ogtt after the three experimental conditions appear in figure 2 . There was a significant effect for time (p <0.001) and interaction (p = .028). There were no significant differences in blood glucose levels at 0 or 120 minutes between all three conditions . However, 60 minutes after glucose ingestion, blood glucose was significantly lower following hit (p <0.001) and kettlebell (p = 0.003) exercise when compared to control . Figure 4a illustrates the mean heart rate response following each interval throughout the entire hit workout . Heart rate gradually increased with each successive interval throughout the workout . At the end of the 10 interval, figure 4b illustrates the mean heart rate response after each exercise throughout the entire kettlebell workout . The lowest heart rate was observed following the chest press exercise (2 and 9), whereas the highest heart rate was observed after the one - arm kettlebell swing exercise (3 and 10). Heart rate averaged ~ 81% and ~ 84% of hrmax after the 1 and 2 circuit, respectively . During the hit workout, rpe gradually increased during the workout and averaged 15.7 (0.9) after the last interval . During the kettlebell workout, rpe averaged 12.7 (1.4) and 14.7 (1.7) after the first and second circuits, respectively . Blood glucose values were obtained immediately before and after the kettlebell and hit workouts (figure 5a). Pre- and post - exercise glucose values were not significantly different from one another for either condition . Moreover, there was no difference between the two exercise conditions . Blood lactate was also measured before and immediately following the kettlebell and hit workouts (figure 5b). There was no difference in resting blood lactate levels before the hit and kettlebell workouts . However, after exercise, blood lactate was significantly higher after the kettlebell workout (9.2 0.9 mmoll) compared with hit (5.7 0.3 mmoll) (figure 5b). The blood lactate values were ~ 86% (kettlebell) and ~ 53% of that reached during the vo2max test . The oxygen cost of the kettlebell workout was measured in a subset of five subjects . Vo2 averaged 20.4 (2.2) mlkgmin (46.5% vo2max) during the first circuit, and 21.1 (2.0) mlkgmin (48.1% vo2max) during the second circuit . Rer averaged 1.2 (0.04) and 1.1 (0.04) during the first and second circuit, respectively . In the present preliminary study, we investigated the effect of a single bout of kettlebell exercise on glucose tolerance in sedentary, but healthy male subjects . The kettlebell and hit workouts (including warm - up and cool down) were similar in duration and averaged ~25 and 26 minutes, respectively . We found that immediately following a single session of kettlebell or hit exercise, glucose tolerance during an ogtt was significantly improved at 60 minutes with no concomitant change in insulin concentration . In addition, there was no difference between the two modes of exercise . These findings indicate that kettlebell exercise may serve as an alternative training strategy to hit for improving glucose tolerance . The mechanisms for improved glucose clearance post - exercise are complex and have not been completely elucidated . Immediately post exercise, increased glucose clearance can be due to both insulin - dependent and insulin - independent pathways . In a rat study by hamada et al . (12), insulin - independent glucose uptake was increased when measured 40 minutes after a single 60-minute session of treadmill exercise and was associated with increased ampk threonine phosphorylation . However, by 85-minutes post exercise, this ampk effect had dissipated and the increased glucose uptake that persisted was likely due to insulin - dependent mechanisms . In human skeletal muscle post - exercise, akt phosphorylation has been shown to increase (37) or not change (36, 39) during a euglycemic clamp with physiological insulin levels . In several other acute exercise studies, no changes were observed in insulin receptor binding or phosphorylation, sub - maximal insulin stimulation of the tyrosine phosphorylation of irs-1 or sub - maximal insulin - stimulation of p13k (4, 14, 3941). Regardless of the mechanism for the improved glucose uptake, glut-4 protein is known to increase after aerobic (9, 16, 32, 34), resistance (15, 19), and high - intensity interval (22) exercise . Results from these previous studies suggest that glut-4 is also increased after kettlebell exercise, though definitive data are currently lacking . Although the two exercise conditions were qualitatively different from one another, the heart rate response was similar . In addition, the end - workout perceived exertion was also similar, with rpe averaging ~16 and 15 for the hit and kettlebell workout, respectively . In spite of these similarities, however, the blood lactate concentration was significantly higher following the kettlebell workout (9.2 mmoll) when compared to the hit workout (5.7 mmoll). We hypothesize that the increased blood lactate concentration after the kettlebell workout is due to a higher reliance on glycolysis . Exercise order was constructed to alternate between different muscle groups during the workout, with each exercise lasting approximately 30 seconds followed by 30 seconds rest . In contrast, during the hit workout, the same musculature was recruited during each interval, and the work interval was 60-sec in duration . We did not measure the oxygen cost of the hit workout in the present study . However, our previous work indicates that oxygen consumption for the workout employed reaches approximately 70% of vo2max (11). During the kettlebell workout in the current study, vo2 averaged ~ 21.1 (4.9) mlkgmin, or 48% of vo2max . Farrar et al . (10) reported that the oxygen cost of kettlebell exercise was ~ 34.3 (5.7) mlkgmin . In this latter study, subjects employed a significantly heavier kettlebell and were required to complete as many two - handed swings as possible in 12 minutes (10). The contrasting findings are therefore likely due to the different weight and workout characteristics employed in the two studies . Utilizing a 10-exercise, 3 circuit design (30 seconds exercise, 15-sec recovery), wilmore et al . Reported that the oxygen cost of circuit weight training in men was approximately 41% of vo2max (38). Although blood lactate following the kettlebell workout approached that recorded at the end of the graded maximal exercise test and was significantly higher than that observed after hit exercise, all subjects were able to complete this workout . Moreover, the subject s perception of effort at the end of kettlebell exercise was similar (~ 15, hard) to the hit workout . The workout may require modification for older, higher risk individuals who do not tolerate such a high perception of effort . For example, the work - to - rest ratio during interval exercise is known to affect heart rate, lactate, and rpe responses (11). Thus, when prescribing kettlebell exercise to higher risk individuals, it may be desirable to lower the weight and/or increase the recovery period between exercises to attenuate these variables . High intensity interval training has been studied extensively the last several years, and has been proposed as a time - efficient alternative to traditional aerobic training for the improvement of metabolic and cardiovascular health . In spite of the established health benefits, incorporation of a safe and effective hit program into the daily routine of lay individuals will require laboratory testing and professional consultation . The cost associated with implementation of such a program, as well as other factors (e.g., availability of facilities, time and cost of driving, weather, etc .) May deter many individuals from commencing a hit exercise program . In contrast, the cost associated with kettlebell exercise is quite low, the exercises can easily be learned from web - based videos, and the workouts can be performed in the home or office . Limitations to the current study include the small sample size (n = 6), the use of sedentary but healthy volunteers, exclusion of female subjects, age of the volunteers, as well as the use of only one exercise workout . Regardless, this preliminary study suggests that kettlebell exercise acutely improves glucose tolerance in young sedentary subjects, and that the changes are similar to that observed following a bout of high - intensity interval running . Thus, kettlebell exercise might serve as a suitable alternative to hit or traditional aerobic training . However, future studies are required to determine the acute and long - term effectiveness of kettlebell training at improving metabolic health in pre - diabetic and diabetic individuals . Moreover, because individuals often cite lack of time as an excuse for not exercising regularly, further work is required to determine the minimal kettlebell exercise dose to improve glucose tolerance.
A biotage 5 ml microwave vial containing a stirring bar was charged with [rh(acac)(co2)] (2 mol%, 4.3 mg, 0.0166 mmol), (r, r)-ph - bpe (3 mol%, 12.6 mg, 0.0249 mmol) and paraformaldehyde (6 equiv, 150 mg). The vial was sealed with a crimp cap, purged with three vacuum / argon cycles and left under an argon atmosphere . Alkene (150 mg, 0.832 mmol), toluene (3 ml) and an internal standard (1 drop of cyclooctane) were added to a schlenk flask under an inert atmosphere . The resulting solution was mixed, and a small sample was taken for a t0 nmr analysis . The solution was then added to the microwave vial and heated to 120 c using microwave radiation . After 45 min, the vial was cooled, and the positive pressure inside the vial was released by piercing the cap with a needle . A small sample was taken and analysed by h nmr spectroscopy to calculate the conversion to the resulting aldehyde . The aldehyde was reduced using nabh4 to the corresponding alcohol (see the supporting information) and isolated using flash chromatography on silica gel (n - hexane / etoac 4:1) to give 2,3-diphenylpropan-1-ol as a white solid (126 mg, 0.60 mmol). The enantiomeric excess of the alcohol was determined by chiral hplc on a chiralcel od - h, 2504.6 mm, n - hexane/2-propanol 90:10, 0.5 ml min, 254 nm, tr[()-(r), major]=18.3 min, tr[(+)-(s), minor]=20.5 min; []d 85.5 (c 1.0, chcl3, ee 95%; lit: []d 80.7 (c 1.13, chcl3), ee 93%) see the supporting information for nmr data . Caution!!! This procedure gives enhanced convenience and requires far less complicated safety measures than conventional ahf, because the syngas is added to the reactor in solid form . Using the amounts above, the highest pressure detected during an athf using 6 equiv of [ch2o]n was 7 bar at reaction temperature (4 bar at rt). The highest pressure detected at 120 c when no athf was taking place, but decarbonylation did was 13 bar . In the 50 ml glass or steel pressure vessels, the highest pressure detected was 3 bar . Similar to the majority of chemical reactions with volatile components, scale - up of these procedures needs careful consideration of the pressures possible and the maximum operating pressure of the vessel used . As a service to our authors and readers, this journal provides supporting information supplied by the authors . Such materials are peer reviewed and may be re - organized for online delivery, but are not copy - edited or typeset . Technical support issues arising from supporting information (other than missing files) should be addressed to the authors
To report an unusual case of suicide attempt secondary complicated of pulmonary and systemic embolisms . A 49-year - old - woman, with a factor v leiden mutation and a notion of chronic depression, admitted to our intensive care unit for a suicide attempt by ingestion ofmepronizine and lormetazepam . We report the rare evolution of this patient with a persistent alteration of consciousness associating a respiratory degradation . Despite the drug intoxication and possibility of aspiration, we performed a computed tomography (ct) angiography which confirmed the presence of a bilateral, proximal, pulmonary embolism suspected on transthoracic echocardiography . Association of stroke and pulmonary embolism led us to suspect a patent foramen ovale (pfo). Neurological and respiratory degradation following voluntary drug intoxication led to the discovery of both a pulmonary and cerebral embolism secondary to a pfo entrapped thrombus . An entrapped thrombus in a pfo is a rare and dangerous situation, associated with many complications . Association of systemic and pulmonary embolisms should lead to pfo detection to guide therapeutic interventions . A 49-year - old - woman was found at home presenting neurological distress with a glasgow score of 11 caused by mepronizine and lormetazepam (supposed ingested doses: 12 g and 32 mg, respectively) poisonings and was brought to our intensive care unit . She already tried to kill herself by voluntary drug intoxication (chronic depression) and her initial physical examination at admission showed tachycardia (143 bpm) and tachypnea (respiratory rate 30 cycles / min) with an oxygen saturation of 75% in room air . Due to those respiratory and neurological failures, the patient was intubated, but her respiratory parameters did not improve . The transthoracic echocardiography revealed enlarged right cardiac chambers and an elevated pulmonary artery pressure (spap 50mmhg). Considering the severity of respiratory failure and normality of chest x - ray, a spiral computed tomography (ct) was performed revealing a massive bilateral proximal pulmonary embolism . Increased neurological distress association of stroke and pulmonary embolism led us to suspect a pfo responsible for a cerebral paradoxical embolism . This diagnosis was confirmed by transesophageal echocardiography with an entrapped thrombus (supplementary video) and positive agitated saline contrast injection . Both pulmonary embolism and brain infarction were treated by unfractioned heparin due to the probable embolic origin of the stroke . The further care took place in a neurosurgery unit, but she unfortunately died 2 days after admission . Despite the confirmation of etiological diagnosis, we were unable to reconstruct the natural history of events: did the suicide attempt lead to a coma with prolonged immobility favoring thromboembolic complications? Was an embolic complication (stroke) or pulmonary embolism the first event, leading to feeling unwell which triggered the suicide attempt? Pfo is present in more than 25% of adults and is the cause of about 95% of the right - to - left shunts . Several previous reports described a straddling thrombus within a pfo with pulmonary and coronary or cerebral embolism . Cryptogenic strokes represent about 40% of strokes and paradoxical embolism via a pfo seems to be responsible of 50% of them leading to 40,000 - 160,000 such cerebral accidents per year in the united states . The principal cause of elevated right cardiac chambers pressure is pulmonary embolism and presence of a pfo in patients with clinically apparent pulmonary embolism increases systemic embolism from 2% to 28% (p <0.02). Venous thrombosis, oral contraceptives, or recent surgery can increase the risk of paradoxical embolism through pfo as factor v leiden mutation (known in our case) and prothrombin g20210a mutation that seems to play a critical role increased about fivefold the risk of stroke in these patients . Those findings show that estimation of paradoxical embolism risk level should simultaneously take into account both the presence of pfo and risk factors for right cardiac chambers pressure elevation . Despite therapeutic interventions, mortality vary from 14% to 33% during the hospital stay, impending paradoxical embolism being associated with a 30-day mortality rate is 18.4% . High level evidence for impending paradoxical embolism treatment need has to be investigated and treatment has to be adapted to the characteristics of the patients and care center resources and expertise . The first pfo treatment was cardiac surgery, but it is no longer indicated as an isolated procedure . No prospective randomized long - term study has ever proved a benefit from closing the pfo . Pfo can be treated by percutaneous therapy with low morbidity and mortality rates and recurrent neurological or peripheral embolic event in 0%-3.8% per year . Nonetheless, the interest of a pfo closure after a stroke remains debatable as a recent study did not show a significant benefit, using a composite end - point mixing mortality and stroke recurrence in a 2 years follow - up period . Nonetheless, per - protocol and as - treated analysis showed significant improvement in the risk of recurrent stroke . Pooling these data local radiofrequency application and percutaneous intracardiac suture are still being evaluated clinically . At last, medical strategy by lifelong anticoagulants such as warfarin pfo is present in more than 25% of adults and is the cause of about 95% of the right - to - left shunts . Several previous reports described a straddling thrombus within a pfo with pulmonary and coronary or cerebral embolism . Cryptogenic strokes represent about 40% of strokes and paradoxical embolism via a pfo seems to be responsible of 50% of them leading to 40,000 - 160,000 such cerebral accidents per year in the united states . The principal cause of elevated right cardiac chambers pressure is pulmonary embolism and presence of a pfo in patients with clinically apparent pulmonary embolism increases systemic embolism from 2% to 28% (p <0.02). On the contrary, venous thrombosis, oral contraceptives, or recent surgery can increase the risk of paradoxical embolism through pfo as factor v leiden mutation (known in our case) and prothrombin g20210a mutation that seems to play a critical role increased about fivefold the risk of stroke in these patients . Those findings show that estimation of paradoxical embolism risk level should simultaneously take into account both the presence of pfo and risk factors for right cardiac chambers pressure elevation . Despite therapeutic interventions, mortality vary from 14% to 33% during the hospital stay, impending paradoxical embolism being associated with a 30-day mortality rate is 18.4% . There is no modification of mortality between thromboembolectomy, anticoagulation, or thrombolysis . High level evidence for impending paradoxical embolism treatment need has to be investigated and treatment has to be adapted to the characteristics of the patients and care center resources and expertise . The first pfo treatment was cardiac surgery, but it is no longer indicated as an isolated procedure . No prospective randomized long - term study has ever proved a benefit from closing the pfo . Pfo can be treated by percutaneous therapy with low morbidity and mortality rates and recurrent neurological or peripheral embolic event in 0%-3.8% per year . Nonetheless, the interest of a pfo closure after a stroke remains debatable as a recent study did not show a significant benefit, using a composite end - point mixing mortality and stroke recurrence in a 2 years follow - up period . Nonetheless, per - protocol and as - treated analysis showed significant improvement in the risk of recurrent stroke . Pooling these data local radiofrequency application and percutaneous intracardiac suture are still being evaluated clinically . At last, medical strategy by lifelong anticoagulants such as warfarin pfo is a frequent condition, but an entrapped thrombus is a rare and life - threatening situation that should be sought for in a suspicious clinical situation such as the one described here (pulmonary and systemic embolism and a coagulation factor mutation).
Image bioinformatics as a field is characterized by an odd mixture of tremendous advances in its computational statistics aspects while suffering from a persistent resistance to their use by biomedical domain experts . The image analysis platform with the deepest domain penetration in the research community is probably national institutes of health (nih's) imagej in large part because of its free open source and pluggable implementation . Over the years, an extensive community of image analysis developers and researchers has developed a comprehensive environment for image analysis software development using java . The development cycle can be roughly described as follows: when a promising new algorithm is identified, it might be first prototyped in a specialized environment such as mathwork's matlab, but to reach a broader non - programming audience, it is then laboriously ported as an imagej plugin . Illustrating the domain penetration challenge, a regular stream of new and updated plugins feeds a comprehensive repository that now has several hundred entries (http://rsbweb.nih.gov/ij/plugins/). However, a visit to the laboratory will show that those who could benefit from an add - on are typically not aware of them . Even more striking is the situation that the few researchers using image analysis, who know how to find and install plugins, often also need image analysis applications that are slight modifications or combinations of existing functionalities . Paradoxically, the computational statisticians with the quantitative expertise to develop those modifications often do not have the substantial software development skills needed to deliver the novel application as a stand - alone application or as a plugin module . A common solution to for example, the quantitative image analysis of estrogen receptor, progesterone receptor, and more generically, the ki-67 immunohistochemistry staining results in breast cancer tissue sections can be conveniently performed by submitting the image to a public web service . Users benefit from improvements in the code automatically and no application needs to installed, therefore overcoming concerns with compromising privacy or degrading the performance of existing applications in the client machine . Submitting to a remote service exposes the image to a third party outside the reach of institutional it; updates in the web service may cause results not to be reproducible and the server side application is typically not exposed to public scrutiny, limiting the opportunities for other quantitative researchers to advance or even fully understand the underlying algorithms; bioinformatics web services are also notorious for relatively short lifetimes, reflecting a sustainability model that can only be met in the long term by institutional commitment or by commercial products . A third solution might be to develop web services that deliver the software rather than process the data, the software - as - a - service (saas) model . The imagejs webapp ecosystem described in this report advances along those exact lines without crossing the lines set by requirements of privacy, scalability, reproducibility, and sustainable deployment associated with the biomedical environment . It also pays particular attention to the need for producing and delivering reproducible research, a topic that is taking center stage as bioinformatics increasingly seeks to deliver data - intensive solutions with translational usage . Specifically, if an image analysis result can be retrieved directly from the published image, with both the data and the analytical environment that generated the result, then one could indeed claim to be reporting reproducible research . Accordingly, imagejs seeks to deliver image analysis results meeting the gold standard in that report's description of the spectrum of reproducibility [figure 1]. Imagejs migrates through script tag loading to the browser (by pointing a script.src to http://imagejs.github.com/imagejs.js), where it creates an object with a method, imagejs . Loadmodule, that will import and register additional components onto imagejs.modules, while keeping data meant to be shared between modules in imagejs.data . The corresponding uml representation is appended to the lower left side of the browser box . The solid lines represent programmatic exchanges and dashed line represents an exchange that requires user intervention, such as the loading or saving an image / analysis the possibility of approaching software development as an open organic process, which is explored by the imagejs webapp environment described here, has been proposed before as a requirement for medicine 2.0 . As discussed in that report, such an approach would blur the separation between software development and software deployment, turning coding into a conduit for workflow assembly that is more akin to social networking mechanisms . This is a departure from conventional bioinformatics infrastructure that can also be construed as a response to the mounting knowledge re - engineering bottleneck . It would provide a beyond the data deluge solution to image analysis where the computation is pushed to where the data is, rather than the customary approach of shuffling the data among a myriad of analytical services . Imagejs was entirely developed in javascript (ecmascript 5th ed . ), the assembler language of the web . To illustrate the distributed and collaborative nature of the proposed webapp ecosystem, its component modules were developed in multiple versioned code hosting services, github (http://github.com) and google code (http://googlecode.com). It can also be started directly from http://imagejs.github.com/, which serves code hosted at https://github.com/imagejs/imagejs.github.com . The segmentation, feature extraction, and filtering modules were developed, and are hosted at http://imagejs.googlecode.com/. The list of modules can be accessed directly through http://module.imagejs.googlecode.com/git/, and the development history can be inspected at http://code.google.com/p/imagejs/source/list?repo=module . In some examples, a web read - write resource is used to provide persistent image storage as a web service . A number of alternatives exist; in this report, we used webrw http - rest api, which is supported by two independent implementations, both open source: one is written in nodejs (https://github.com/jonasalmeida/webrw) and another in php (https://github.com/ebadedude/webrw). Important note: although the core components and most modules will work in different web browsers, this study makes use of recent html5 features such as the file api (http://www.w3.org/tr/fileapi/) that are still being adopted . To avoid problems with the syntax or support of recent developments in html5, the reader is advised to use the latest version of google chrome (version 18 at the time of this reporting). The imagejs browser based computational ecosystem is loaded by pointing it (preferably using google chrome, see availability in materials and methods) to http://imagejs.github.com . This action will cause imagejs's document object, imagejs, to migrate to the web browser . A quick inspection of this object will reveal that it includes only a handful of methods, including the one that will load external code, loadmodule . A closer inspection of this method will show that a) it imports external code by pointing a browser's document object model (dom) script tag to the url of the external code (module) and b) it registers the imported module in imagejs.module(url). As is the rest of this section, this inspection is also provided as a webcast video, publicly available at http://www.youtube.com/watch?v=qbkbgb4eche . The features of the imagejs environment as a vehicle to deliver computation were studied by developing and deploying an image analysis workflow that included standard modules for feature segmentation, analysis, and filtering . Each of these modules was configured not only to deliver a desirable image analysis functionality and in the process test if the browser is a suitable platform to do so but also to test different models of dependency between modules . The goal of testing different models of articulation between analytical modules is to explore the balance between flexibility and robustness of browser - based computational ecosystems as platforms for collaborative software development . Each module represents an independent development exercise, hosted and versioned in its own externally hosted service . As stated in the materials and methods section, to reinforce the perception of independent development, the multiple modules and imagejs core code are scattered between distinct versioned hosting services, namely, github and google code . Examples of interface triggers for loading of modules illustrated in this section: menu driven, dependency driven, and programmatically associated with action by another module . The analytical workflow can therefore be assembled by loading modules in response to actions by the user or it can be initiated by a particular result of the analysis the image analysis procedure developed starts with the selection by the user of a chromomarker . A chromomarker, rgbmarker, is defined as the three - element vector with the intensities in the red, green, and blue channels that one uses to retrieve image features with similar chromometric characteristics . To this purpose, the user selects a pixel in the image, i, of size n m as a marker, with [r, g, b] intensities, and sets a weighted threshold, t, for a dissimilarity metric, dist, that will be resolved for all pixels in the image, each with its own intensity values [r, g, b]: the first module, chromomarkers, will segment all pixels in the image that are at a distance smaller than t. segmentetpixelcoordinates = [i, j]|dist([r, g, b](i, j)) <t (2) both operations, distance calculation (equation 1) and segmentation (equation 2), represent a first test of the browser as an efficient environment for image processing . The javascript engine of modern web browsers includes support for map and reduce operations, which we recently found to offer an efficient solution to the parallelization / vectorization of code execution in the context of sequence analysis . For example, the n m distance matrix, d, defined by equation 1, can be resolved efficiently by nesting two map operations on the image rgb intensities, i: d = i.map(function(x, i){return x.map(function(y, j){returni[r, g, b](i, j)})}) (3) the efficiency of this implementation in imagejs relies on the javascript compiler mapping the explicit parallelization of the code to local opportunities for distribution . For example, by possibly using the machine's graphics processing units (gpus). As can be verified by operating imagejs (or by viewing the accompanying webcast at http://www.youtube.com/watch?v=qbkbgb4eche), chromomarkers will display the edges of segmented image superimposed on the original image . The edge detection is performed by another mapping operation which is worth inspecting in the native javascript syntax to recognize the nested mapping pattern used in equation 3, and is highlighted below in the code for equation 4 . This time, the nested mapping is being used to inspect the neighborhood of each pixel to find out if it corresponds to a segmented pixel with a non - segmented non - pixel, in which case it is classified as an edge: as can be verified by using imagejs or by viewing the accompanying webcast, the image segmentation operations are executed in real time (under 1 or 2 sec), on par with other image analysis environments . Feature extraction represents a tougher challenge . Here, the goal is to identify which sets of segmented pixels define a contiguous feature . This module's interface now separates (they are triggered by distinct events) feature analysis operations that can be performed in real time, such as the determination of segmentation density or the ratio between rgb intensities between segmented and non - segmented regions, from those that actually require the extraction of features, such as counting them . The description of this feature extraction procedure provides the opportunity to demonstrate how code can be invoked in a publication without concern that subsequent updates or renaming will cause this information not to be available . For example, at the time of this writing, the code for feature extraction can be found in line #171 of version 4ec7931d17ccc17d27e724d51ae0 of jmat.js, which can be following that link will not only return the code used, but also expose comments made by co - developers . It is again worth noting that although the imagejs core is hosted and versioned at imagejs.github.com, this procedure happens to be hosted and versioned by a distinct environment, this time at google . Both hosting services, which is to say, the hosting services resolved by the links, are likely to last longer (forever) than the interest or even the memory of its authors . The ability to simultaneously host versioned development and serve executable javascript code by exactly the same mechanism is a unique feature of the web environment . In the previous section, the feature extraction procedure was described by reference to the specific version and line of code deployment at the time of this writing . The ability to reference specific versions of the code therefore extends to the ability to execute them as well . This feature is enhanced by imagejs by allowing the submission of modules by passing them as arguments to the url call . For example, http://imagejs.github.com/?https://raw.github.com/imagejs/imagejs.github.com/27b596ed08d41e79c6c96e86f0318694ca98cc9e/mainmenu.js and http://module.imagejs.googlecode.com/git-history/ef105347cc13dcb24cdfae621522b5891ff11ab7/mathbiol.chromomarkers.js and http://module.imagejs.googlecode.com/git-history/ef105347cc13dcb24cdfae621522b5891ff11ab7/mathbiol.countshapes.js specifies a very particular combination of versions of the multiple modules involved in the assembly of imagejs . This is of course not a convenient url to exchange, so a shorter reference could be generated, for example, http://bit.ly/h3hvbz . It is worth repeating the note that none of the resources used to enable the assembly of a specific version of the imagejs tool depends on the commitment of the authors of this report to maintain those resources . The imagejs computational environment will natively allow for three mechanisms to incorporate code generated by others . The easiest to distribute is to simply add the address of the modules to the url of imagejs core application, as illustrated above . A more interactive possibility is to use an input box as exemplified by the main menu / load option . The filtering of segmented images offers an illustration of the usefulness of this mechanism in facilitating the interaction with researchers focused on the computational statistics aspects of the analysis . This module, mathbiol.filtershapes, is strictly dedicated to specifying a number of matrix manipulation procedures erode and round at the time of this writing . The association of these procedures with the user interface buttons that trigger them is dealt by the feature extraction module . Adding a new filtering procedure to this object we found this style of module development to be particularly appealing to the biostatistics minded researcher because it does not require web programming skills beyond a basic understanding of javascript syntax, which is reminiscent of the c language . In summary, the primary goal of the modules described in this report is to illustrate how the image analysis can be orchestrated to involve multiple contributions, with different dependencies, using different styles, different modes of interaction with the user, hosted in multiple locations, while delivering reproducible results available in the pervasive web browser platform . Figure 2 summarizes the orchestration of modules described here, highlighting the salient features and dependencies they were designed to illustrate . The conventional approach of manually loading images from the local file system, by file select or by drag and drop, is supported . Manually saving the image and its analysis results back to the files system is also supported and consists of saving the contents of imagejs.data [figure 1] as a json structure . This behavior relies on a relatively new development in web computing standards, the file api (http://www.w3.org/tr/fileapi). Another possibility that is particularly useful in collaborative and distributed environments is to rely on the read - write capabilities anticipated for web 3.0 apps . In a nutshell, this is a cloud computing option that treats web services as both remote storage and remote devices, allowing for exchange of data simply by reference . One of the modules, countshapes, illustrates this functionality by using the webrw service described in the materials and methods section . This was adopted as a generic solution of reading and writing back to the web such that we would not have to choose among a slew of excellent commercial resources such as dropbox.com, amazon's s3, or google's fusion tables, which would have required user authentication . Regardless of the web read - write cloud service chosen, the attraction of this option is that programmatically, the web is closer to the web browser that to the browser's machine own file system [figure 1]. Accordingly, the same module loading mechanism described in the previous sections will now be used to deal with and saving and loading of data . As an example, see either https://bitly.com/withdata or point a qr reader to the qr code in figure 3 http://bit.ly/withdata.qrcode; both link to the same data with analysis, as depicted in figures 3 and 4 . Quick response (qr) code, generated automatically by http://bit.ly/withdata.qrcode for the link http://bit.ly/withdata, which in turn points to http://imagejs.github.com/?http://module . Js and http://165.225.128.64/?doc=uid5716226333752275 and http:// module.imagejs.googlecode.com/git/mathbiol.showdata.js, which corresponds to a particular image analysis result that is assembled, re - analyzed, reproducing the display depicted in figure 4 image analysis corresponding to http://bit.ly/withdata . See figure 3 for equivalent qr code for optical reading by tablet devices the proposition that image js0 is particularly adequate to the development of very specific image analysis applications was assessed by developing a new module to assist with the determination of cellular proliferation index from ki67-labeled transmission microscopy images . As proposed, this was pursued by building not only on top of the imagejs abstraction [figure 1] but also integrated with one of the generic modules described earlier, chromomarkers . As a consequence, this exercise was conveniently reduced to the writing of a few image analysis filters that rely on the chromomarkers segmentation utilities to select segmentation thresholds . The ki67 index, a cellular proliferation index, is the ratio of nuclei undergoing division, often estimated from transmission microscopy images of tissue treated with a generic nuclear stain, such as hematoxylin, and an antibody that targets ki67, a protein present only in the active stages of the cell cycle . To address the vagaries of manual estimation of proliferation from such images, the ki67 imagejs module was designed to assist with the calculation and, more importantly, to report the final value with the graphic display of the corresponding segmentations . A snapshot of this application is presented in figure 5, and can be invoked by a short link such as http://bit.ly/ki67js or http://uab.mathbiol.org/ki67 in a modern web browser, preferably google chrome . Snapshot of the result of using imagejs's ki67 module to determine proliferation index in a labeled glioblastoma sample imaged by transmission microscopy . A webcast illustrating its usage is available at http://www.youtube.com/watch?v=ncpngrxwwdq and is also provided with the help option of this imagejs application the image analysis procedure developed starts with the selection by the user of a chromomarker . A chromomarker, rgbmarker, is defined as the three - element vector with the intensities in the red, green, and blue channels that one uses to retrieve image features with similar chromometric characteristics . To this purpose, the user selects a pixel in the image, i, of size n m as a marker, with [r, g, b] intensities, and sets a weighted threshold, t, for a dissimilarity metric, dist, that will be resolved for all pixels in the image, each with its own intensity values [r, g, b]: the first module, chromomarkers, will segment all pixels in the image that are at a distance smaller than t. segmentetpixelcoordinates = [i, j]|dist([r, g, b](i, j)) <t (2) both operations, distance calculation (equation 1) and segmentation (equation 2), represent a first test of the browser as an efficient environment for image processing . The javascript engine of modern web browsers includes support for map and reduce operations, which we recently found to offer an efficient solution to the parallelization / vectorization of code execution in the context of sequence analysis . For example, the n m distance matrix, d, defined by equation 1, can be resolved efficiently by nesting two map operations on the image rgb intensities, i: d = i.map(function(x, i){return x.map(function(y, j){returni[r, g, b](i, j)})}) (3) the efficiency of this implementation in imagejs relies on the javascript compiler mapping the explicit parallelization of the code to local opportunities for distribution . For example, by possibly using the machine's graphics processing units (gpus). As can be verified by operating imagejs (or by viewing the accompanying webcast at http://www.youtube.com/watch?v=qbkbgb4eche), chromomarkers will display the edges of segmented image superimposed on the original image . The edge detection is performed by another mapping operation which is worth inspecting in the native javascript syntax to recognize the nested mapping pattern used in equation 3, and is highlighted below in the code for equation 4 . This time, the nested mapping is being used to inspect the neighborhood of each pixel to find out if it corresponds to a segmented pixel with a non - segmented non - pixel, in which case it is classified as an edge: as can be verified by using imagejs or by viewing the accompanying webcast, the image segmentation operations are executed in real time (under 1 or 2 sec), on par with other image analysis environments . Feature extraction represents a tougher challenge . Here, the goal is to identify which sets of segmented pixels define a contiguous feature . This module's interface now separates (they are triggered by distinct events) feature analysis operations that can be performed in real time, such as the determination of segmentation density or the ratio between rgb intensities between segmented and non - segmented regions, from those that actually require the extraction of features, such as counting them . The description of this feature extraction procedure provides the opportunity to demonstrate how code can be invoked in a publication without concern that subsequent updates or renaming will cause this information not to be available . For example, at the time of this writing, the code for feature extraction can be found in line #171 of version 4ec7931d17ccc17d27e724d51ae0 of jmat.js, which can be forever available at http://code.google.com/p/jmat/source/browse/jmat.js?r=4ec7931d17ccc17d27e724d51ae0342b871bc98a#171 . Following that link will not only return the code used, but also expose comments made by co - developers . It is again worth noting that although the imagejs core is hosted and versioned at imagejs.github.com, this procedure happens to be hosted and versioned by a distinct environment, this time at google . Both hosting services, which is to say, the hosting services resolved by the links, are likely to last longer (forever) than the interest or even the memory of its authors the ability to simultaneously host versioned development and serve executable javascript code by exactly the same mechanism is a unique feature of the web environment . In the previous section, the feature extraction procedure was described by reference to the specific version and line of code deployment at the time of this writing . The ability to reference specific versions of the code therefore extends to the ability to execute them as well . This feature is enhanced by imagejs by allowing the submission of modules by passing them as arguments to the url call . For example, http://imagejs.github.com/?https://raw.github.com/imagejs/imagejs.github.com/27b596ed08d41e79c6c96e86f0318694ca98cc9e/mainmenu.js and http://module.imagejs.googlecode.com/git-history/ef105347cc13dcb24cdfae621522b5891ff11ab7/mathbiol.chromomarkers.js and http://module.imagejs.googlecode.com/git-history/ef105347cc13dcb24cdfae621522b5891ff11ab7/mathbiol.countshapes.js specifies a very particular combination of versions of the multiple modules involved in the assembly of imagejs . This is of course not a convenient url to exchange, so a shorter reference could be generated, for example, http://bit.ly/h3hvbz . It is worth repeating the note that none of the resources used to enable the assembly of a specific version of the imagejs tool depends on the commitment of the authors of this report to maintain those resources . The imagejs computational environment will natively allow for three mechanisms to incorporate code generated by others . The easiest to distribute is to simply add the address of the modules to the url of imagejs core application, as illustrated above . A more interactive possibility is to use an input box as exemplified by the main menu / load option . The filtering of segmented images offers an illustration of the usefulness of this mechanism in facilitating the interaction with researchers focused on the computational statistics aspects of the analysis . This module, mathbiol.filtershapes, is strictly dedicated to specifying a number of matrix manipulation procedures erode and round at the time of this writing . The association of these procedures with the user interface buttons that trigger them is dealt by the feature extraction module . Adding a new filtering procedure to this object we found this style of module development to be particularly appealing to the biostatistics minded researcher because it does not require web programming skills beyond a basic understanding of javascript syntax, which is reminiscent of the c language . In summary, the primary goal of the modules described in this report is to illustrate how the image analysis can be orchestrated to involve multiple contributions, with different dependencies, using different styles, different modes of interaction with the user, hosted in multiple locations, while delivering reproducible results available in the pervasive web browser platform . Figure 2 summarizes the orchestration of modules described here, highlighting the salient features and dependencies they were designed to illustrate . The conventional approach of manually loading images from the local file system, by file select or by drag and drop, is supported . Manually saving the image and its analysis results back to the files system is also supported and consists of saving the contents of imagejs.data [figure 1] as a json structure . This behavior relies on a relatively new development in web computing standards, the file api (http://www.w3.org/tr/fileapi). Another possibility that is particularly useful in collaborative and distributed environments is to rely on the read - write capabilities anticipated for web 3.0 apps . In a nutshell, this is a cloud computing option that treats web services as both remote storage and remote devices, allowing for exchange of data simply by reference . One of the modules, countshapes, illustrates this functionality by using the webrw service described in the materials and methods section . This was adopted as a generic solution of reading and writing back to the web such that we would not have to choose among a slew of excellent commercial resources such as dropbox.com, amazon's s3, or google's fusion tables, which would have required user authentication . Regardless of the web read - write cloud service chosen, the attraction of this option is that programmatically, the web is closer to the web browser that to the browser's machine own file system [figure 1]. Accordingly, the same module loading mechanism described in the previous sections will now be used to deal with and saving and loading of data . As an example, see either https://bitly.com/withdata or point a qr reader to the qr code in figure 3 http://bit.ly/withdata.qrcode; both link to the same data with analysis, as depicted in figures 3 and 4 . Quick response (qr) code, generated automatically by http://bit.ly/withdata.qrcode for the link http://bit.ly/withdata, which in turn points to http://imagejs.github.com/?http://module . Js and http://165.225.128.64/?doc=uid5716226333752275 and http:// module.imagejs.googlecode.com/git/mathbiol.showdata.js, which corresponds to a particular image analysis result that is assembled, re - analyzed, reproducing the display depicted in figure 4 image analysis corresponding to http://bit.ly/withdata . See figure 3 for equivalent qr code for optical reading by tablet devices the proposition that image js0 is particularly adequate to the development of very specific image analysis applications was assessed by developing a new module to assist with the determination of cellular proliferation index from ki67-labeled transmission microscopy images . As proposed, this was pursued by building not only on top of the imagejs abstraction [figure 1] but also integrated with one of the generic modules described earlier, chromomarkers . As a consequence, this exercise was conveniently reduced to the writing of a few image analysis filters that rely on the chromomarkers segmentation utilities to select segmentation thresholds . The ki67 index, a cellular proliferation index, is the ratio of nuclei undergoing division, often estimated from transmission microscopy images of tissue treated with a generic nuclear stain, such as hematoxylin, and an antibody that targets ki67, a protein present only in the active stages of the cell cycle . To address the vagaries of manual estimation of proliferation from such images, the ki67 imagejs module was designed to assist with the calculation and, more importantly, to report the final value with the graphic display of the corresponding segmentations . A snapshot of this application is presented in figure 5, and can be invoked by a short link such as http://bit.ly/ki67js or http://uab.mathbiol.org/ki67 in a modern web browser, preferably google chrome . Snapshot of the result of using imagejs's ki67 module to determine proliferation index in a labeled glioblastoma sample imaged by transmission microscopy . A webcast illustrating its usage is available at http://www.youtube.com/watch?v=ncpngrxwwdq and is also provided with the help option of this imagejs application because of the increasing volume and heterogeneity of data, the organic development of software that delivers computational solutions to translational environments is not only a challenge of increasing proportions, but also one with increasing rewards . Accordingly, advances in biomolecular methodology, coupled with the benefits of an integrated environment in which data science in a biomedical context may be applied, are increasingly seen as a key new frontier for pathology . The opportunity to develop encompassing integrative infrastructure for image analysis has not been missed by the research community, with very comprehensive initiatives such as omero advancing open source software that pathologists with access to informatics research resources and partnerships can use . The advantages of these partnerships are also increasingly compelling as the amount of annotated image data in the public domain increases . Furthermore, these are also increasingly object of large - scale modeling exercises such as the recent morphological analysis of the cancer genome atlas (tcga) slide images to identify classifiers of tumor subtypes . These advances make the prospect of pushing image analysis to the lab medicine or to the point of care all the more enticing and the inability to do so all the more frustrating . In principle, applications such as nih imagej provide a good solution to the last mile problem of delivering computational solutions to the environments and machines that have access to the image data that need to be analyzed . The use of the java language (the j in imagej) to deliver such a solution is in line with its 1990s motto of write once, run anywhere . It was then widely anticipated that this would be the language of the web and that not only would applications be delivered to the browser as applets (http://java.sun.com/applets/) but also eventually the browser would mature to such a high level of integration with the java language (it would have a native jvm) that even individual procedures would be delivered into a communal computational pool where an ecosystem of workflows might emerge in reaction to the data and user interaction context . In a nutshell, the web browser was, correctly, anticipated to become the ultimate saas platform endowed with efficient processors and with a protective sandbox such that the machine's own file system would not be exposed to the foreign code injection . This should allow for the promise of personalizing the analysis of an image in that private file system to benefit from the wealth of reference data being annotated elsewhere . In fact, this promise has since been delivered, not by object - oriented java which still requires a virtual machine to be first loaded by the browser before being interpreted, but by its little functional helper, javascript, which went on to provide the basis for the second generation of web technologies a decade later . Another key variation on the original prediction was the emergence of cloud computing infrastructure as a logical extension of the machine's file system . This is the modern scenario that the imagejs prototype, described in the results section, explores: we now have all the features needed for pervasive image analysis that we can port all the way to the point of care . Specifically, a) we have an efficient computational environment and b) we can deliver saas in a manner that is both safe and reproducible . The main argument for delivering image analysis using the browser's native interpreter is that it is the route best aligned with the sandboxed browser, and is therefore least likely to face objections by no download and installation policies in care delivery environments . Initially, it was not clear that this environment is sufficiently performant for image analysis . The world wide web consortium (w3c) has recognized the need for metrics for different computational operations, but has only recently standardized their acquisition . We have also recently found out when functionally decomposing sequence analysis into mapreduce operations that these improvements may actually justify rather than deter the use of the browser to deploy advanced computational statistics procedures . As described in the results section and documented in the accompanying webcast, the ability to perform image segmentation using weighted euclidean distance, edge detection, and then overlaying the edges on top of the original image, all in real time, suggest that a similar argument may be valid for image analysis . This argument will be on even more solid ground if efficiency refers to power consumption, since that is the very argument why web browsers in mobile devices are increasingly not supporting graphics rendering using adobe's flash, microsoft's silverlight, and oracle - sun's jvm . The argument that the browser offers a safer delivery of applications is the same that leads it departments to disable the installation of applications by researchers and clinicians in biomedical facilities . There certainly are opportunities to make webapps unsafe, but the fact that they are executed within the browser's sandbox raises effective barriers to accessing the file system or devices attached to the machine where the webapp is being executed . The argument for a more reproducible delivery of image analysis solutions is also not an absolute claim . The first is that the script tag loading mechanism enables the use of hosted code versioning services for versioned application hosting, as illustrated in the results given in the section the second reason for this claim is that scientific publication also relies on the web browser as the primary dissemination mechanism, which signifies that an image analysis result represented as a figure in a published manuscript can include a link to the data and its versioned analysis code such that the result is automatically reproduced by the machine of the reader . As illustrated in figure 4, the reproduction in the client machine can even include the assembly of the analytical environment where alternative analysis can be attempted . The main argument for delivering image analysis using the browser's native interpreter is that it is the route best aligned with the sandboxed browser, and is therefore least likely to face objections by no download and installation policies in care delivery environments . Initially, it was not clear that this environment is sufficiently performant for image analysis . The world wide web consortium (w3c) has recognized the need for metrics for different computational operations, but has only recently standardized their acquisition . We have also recently found out when functionally decomposing sequence analysis into mapreduce operations that these improvements may actually justify rather than deter the use of the browser to deploy advanced computational statistics procedures . As described in the results section and documented in the accompanying webcast, the ability to perform image segmentation using weighted euclidean distance, edge detection, and then overlaying the edges on top of the original image, all in real time, suggest that a similar argument may be valid for image analysis . This argument will be on even more solid ground if efficiency refers to power consumption, since that is the very argument why web browsers in mobile devices are increasingly not supporting graphics rendering using adobe's flash, microsoft's silverlight, and oracle - sun's jvm . The argument that the browser offers a safer delivery of applications is the same that leads it departments to disable the installation of applications by researchers and clinicians in biomedical facilities . There certainly are opportunities to make webapps unsafe, but the fact that they are executed within the browser's sandbox raises effective barriers to accessing the file system or devices attached to the machine where the webapp is being executed . The argument for a more reproducible delivery of image analysis solutions is also not an absolute claim . The first is that the script tag loading mechanism enables the use of hosted code versioning services for versioned application hosting, as illustrated in the results given in the section the second reason for this claim is that scientific publication also relies on the web browser as the primary dissemination mechanism, which signifies that an image analysis result represented as a figure in a published manuscript can include a link to the data and its versioned analysis code such that the result is automatically reproduced by the machine of the reader . As illustrated in figure 4, the reproduction in the client machine can even include the assembly of the analytical environment where alternative analysis can be attempted . Imagejs provides a pervasive mechanism to deliver image analysis workflows and interactive interfaces to where the data are . It includes a core object model equipped with data - specific attributes and methods, such as a module loader that registers the source urls of the components loaded . The ability to define workflows by chaining the addresses of the modules with imagejs's own the use of versioned code hosting as a mechanism for deployment is also a stark departure from conventional bioinformatics infrastructure, where the ensuing code injection is normally avoided rather than promoted . However compelling this mechanism for distributed development and deployment may be, and no matter how convenient and scalable the delivery of computation to image repositories may be, imagejs webapp ecosystem is primarily an experiment in informatics . The ability to gather data about the population of this computational webapp ecosystem by others and about collaborative data processing to inform further development of distributed image analysis infrastructure may well be its most valuable purpose.
According to the latest classification of the world health organization classification of tumors published 2008th in lyon, molecular, biological and clinical studies have recognized within non hodgkin lymphoma - diffuse large b cell lymphoma (dlbc) morphological, molecular and immunohistochemical subgroups and entities (1). Despite great progress in treatment of dlbcl in last 20 years of immunochemotherapy era, failure free survival (ffs) remains around 50% with a particularly poor prognosis for those who have not been treated with immunochemotherapy and autologous transplantation . In current practice immunochemotherapy (r - chop) is considered the standard first - line treatment of nhl built of cd20 + b cells, and thus dlbcl . Although the r - chop is the best existing first - line therapy for dlbcl, it is curative in about half of patients, while in others it does not achieve a permanent and/or complete remission . Approximately 30 - 40% of patients responds very well to treatment and live long, while 60 - 70% die from the disease . Patients with high and intermediate ipi (> 2) have a high rate of relapsing . In these patients advances in treatment can potentially be achieved using autologous peripheral blood stem cell transplantation (apbsct), but it is accompanied by an increased rate of mortality and delayed improvement of survival (2). Therefore, first - line therapy requires further training, which includes understanding the pathophysiological mechanisms of the disease, distinguishing patients with favorable between those with unfavorable characteristics, in which the standard therapeutic approach is not sufficient . It should provide proper patient selection and choice of adequate treatment, which is important in achieving a better and longer therapeutic response, reducing morbidity and treatment costs, avoiding disability and other late effects of treatment, including secondary malignancies . If we go back to the fact that the nhl is composed of more varieties of one disease, since progress can only be achieved from a critical analysis and understanding of a wide range of characteristics of the disease, which include: clinical, immunohistochemical, cytogenetic and molecular characteristics . It is appropriate to assume that a good choice of therapy, with the definition of prognostic indicators, may improve treatment results . Prognosis and predictions of nhl is represented by clinical factors expressed by international prognostic index (ipi). However, it is evident that clinically and pathologically standard parameters themselves are not sufficient . Biological properties of the tumor largely determine its clinical behavior, indicate prognosis and treatment outcome . It can identify new targets that will target the so - called biological therapy . List of biomarkers with potential prognostic and predictive significance of diffuse large b cell lymphoma (dlbcl) is huge (3). Based on differentiation cell type determined by immunohistochemical technique and fluorescence in situ hybridization (fisc) by two groups of dlbcl are determined: germinal center b cell type like (gcb) dlbcl with identification of two cell type: bcl-6 + / cd10 + / mum1-/cd138- and bcl-6 + // cd10-/-mum1 / cd138 -, which has a favorable prognosis, and activated b cell type (abc) dlbcl immunophenotype bcl-6 + /-cd10-/ mum1 + / cd138- ., which has a poor prognosis with a small third untested group with a poor prognosis, which is considered unique with abc (4). The 2008 who classification of tumors of hematopoietic and lymphoid tissues along with data from a study by rosenwald, coloma, hans, hummel, and al (5 - 8) point out that the cases with the expression of cd10 cells are considered gcb type, as well as cases that were cd10-, bcl6 +, mum1- . Hans s algorithm uses three antibodies: cd10, mum1 and bcl6 on which form non gbc and gbc subgroups . Today, the determination of cell type differentiation is an important part of the diagnostic work - up of dlbcl with the recent studies testing and the importance of molecular markers involving foxp1 and gcet1, whose significance is tested in many studies (9, 10). In addition, noteworthy is the importance of the other biological characteristics of the b cell nhl as well as understanding of programmed cell death - apoptosis . Understanding the complexity of carcinogenesis has a positive impact on finding the right option in choosing the right therapy for the treatment and improving the lives of patients . Recognition of apoptotic deregulation as a fundamental element in the development of cancer today is the most important guide in the study of cancer and finding targeted therapeutic options . Patients were followed in relation to the clinical characteristics and the data of histopathologic diagnosis until the completion of the study . In this study we analyzed 60 patients who had been diagnosed de - novo diffuse large b cell lymph (dlbcl) and who were treated and followed up at the hematology clinic, university clinical center of sarajevo . Median follow - up was 47 months (3 - 91 months). At the end of the study 44 (73.35%) patients were divided into two groups: the origin of germinal center - gcb and non germinal center - non gcb . According to the latest who classification in relation to subtypes and entities, the study included patients who belonged: dlbcl nos with subtype t - rich and entities: mediastinal large b cell lymphoma 3 patients and alk positive dlbcl 1 patient . It was a homogeneous group of patients in comparison to the first line of treatment . In the first - line treatment patients received immunochemotherapy per protocol r - chop (rituximab 375mg / m2 iv day 1 + chop / day 1 cyclophosphamide 750 mg / m2 iv, 50mg / m2iv doxorubicin, oncovin max . Post - treatment restaging consisted of a repetition of earlier pathological tests and / or biopsy . Response was assessed according to conventional criteria (normalization of metabolic tests and the absence of previously existing tumor mass). Biopsy material was first analyzed in several different centers to diagnose dlbcl using the following markers: cd20, bcl-2, bcl-6, cyclin d1, very rare cd10, according to the indications: cd5, bcl-1, cd3, cd30, s- 100, ck - hmw, ck / ae1/ae3, ck, cd79alfa, cd15, alk, ema, lca / cd45, cd43, ttf-1, vimentin, tdt, cd99, cd23, cap, lambda, synoptophysin, ck7, nse, hmb45, desmin, asma additional immunohistochemical staining were performed at the institute of pathology and cytology of clinical center of university of sarajevo on the same histopathological material . Biopsy samples were further analyzed by immunohistochemistry for the markers: bcl6, cd10, irf / mum1, cd138 at the institute of pathology, clinical center university of sarajevo . The sections were incubated with primary antibody, including: anti - cd20 (1:150, clone l26, dakocytomation, glostrup, denmark), anti - cd10 (1:150, clone 56c6, novocastra laboratories, newcastle, tyne, uk),anti - bcl-6 (1:40, clone pg.b6p, dakocytomation, glostrup, denmark),cd138 (1:10 dilution, clone am 411 - 10 m, biogenex, ca usa, irf / mum1 (1:40 dilution, clone sc 6059, santa cruz biotechnology, inc, ca, usa), anti - cd10 (1:150, clone 56c6, novocastra laboratories, newcastle, tyne, uk), anti - bcl-6 (1:40, clone pg.b6p, dakocytomation, glostrup, denmark), cd138 (1:10 dilution, clone am 411 - 10 m, biogenex, ca usa, irf / mum1 (1:40 dilution, clone sc 6059, santa cruz biotechnology, inc, ca, usa), the project provides visualization which was performed with envision method (dakocytomation, glostrup, denmark) with the manufacturer s instructions . Bcl-6 and cd10 was quantified using the h score (histo - score) system, according to the method described by mccarty et al . Positive expression of the mum1 and cd138 was considered when more than 25% neoplastic cells . Microscopy preparation had next appearance: statistical analysis: when it comes to statistical analysis we used univariate methods for evaluation of significant difference (x test, binary logistic regression analysis). We assessed the overall survival with kaplan - meier methods and unstratified long - rank test . We used a multivariate backward wald model to assess the significance for the efficacy variables and to establish th odds ratio (or) and 95% ci for each subgroup . This study included 60 patients diagnosed with de novo diffuse large b cell lymphoma (dlbcl). The age of the respondents was 18 - 72 years and the average age prevalence was 45 years old . Responses of total period of monitoring during the period of examination, with 60 patients who were treated by immunochemotherapy and who had dlbca, complete remission 47 (78,3%), pr - partial remission 8 (13,3%), pb - progressive disease 5 (8,3) was achieved . Statistically significant difference was confirmed compared to the ipi> 2 (low: high) 39 (65%) vs 21 (35%) x p= 0.014, clinical stage i / ii vs iii / iv x 26 (43.3%) vs 36 (56.7%) p<0.0005, ecog> 27 (11.7%) vs 53 (88.3%) p=0.008 and level ldh normal vs. increased 38(63,3%)vs 22 (36,7%) p=0.003 compared to achieve first complete remission . Difference in survival length of the examinees with mum1>25% is statistically significant (mantel - cox)=19.2 p<0.0005 . Examinees with mum1>25% live shorter (23 months; 95%(16 - 29 months) comparing to examinees with mum<25% who live 37 months in average; 95% (34 - 40 months). Analysis risk factor to three years survival using binary logistic regressive analysis it is confirmed: significant differences are not confirmed ages p=0.903 or 0.956 (0.465 - 1.966), gender p=0.322 or 0.593 (0.211 - 1.667) but there is significant differences ecog> 2 p=0.002 or 6.390 (2.022 - 20.194) and level ldh p=0.005 or 4.66 (1.586 - 13.698) to three year survival . Using binary logistic regressive univariate analysis significant differences is confirmed in the expression of mum1 p=0.003 or 0.082 (0.16 - 0.430) to three year survival in gbc vs. non gbc group in dlbcl . Statistically significant difference is confirmed in the expression of cd10 at the level of borderline impact of p<0.069 or 2.331 (0.9365.808) to three - year survival . Significant differences is not confirmed in the expression of bcl6 p=0.916 or 0.005 (0.000 - 1.817) and expression of cd138 p=0.444 or 0.453 (0.059 - 3.446) to three year survival . Influence of independent clinical and immunophenotype factors on three - year survival was examined using multivariate cox s regression method backward wald . Independent factors showed statistically significant influence of ecog>2 p=0.002, ldh p=0.005, mum1 p=0.003 and ipi>2 p<0.0005 . Using multivariate cox s regression method on three - year survival, mum1 has the strongest influence p<0.0005 or=0,083 (0.23 - 0.303), then ldh p=0.002 or=5.8 (19.3 - 17.5) (table 2). Clinical features dlbcl according to immunohistochemical profile univariate and multivariate analysis risk factor three - year overall survival in comparison to three - year survival, immunohistochemical features in relation to expression bcl6, cd10, cd138 i mum1, only expression mum1 had a significant independent influence . Expressions bcl6 and cd138 did not have significant influence to three - year survival dlbcl in the immunochemotherapy era . In the presented study the relationship between clinical status and immunohistochemical profiles has been analyzed in the expression: bcl-6/cd10 group gcb which has similar subtypes with b cell origin of germinative center was correlated with group non - gcb, which has subtypes of non germinative center . Immunohistochemical groups were comparable with data from the last sub - classification nomenclature of lymphoma (1). At the molecular level there are two large groups of patients with dlbcl: germinal center b cell type like (gcb) dlbcl, which has a favorable prognosis, and activated b cell type (abc) dlbcl, which has a poor prognosis, with a third small untested group with poor prognosis, which is considered unique with abc . In previous studies because of its expensive technology molecular analysis is more rarely used than immunohistochemical analysis related to cd10, bcl-6, mum1 cd138.11 in some studies (12 - 14). Whether is this rate of gcb defined immunohistochemical phenotype is variable from study to study (18% in the study boroveki to 49% in the study paepe et al) (15). In our study, the group a (gcb) was 39 (65%) patients in group b (non - gcb) 21 (35%) patients . Study was preceded by a pilot study, prognostic and predictive significance of cd10 expression in diffuse large b cell lymphoma (2007), which confirmed the significant impact of cd10 expression in relation to the achievement of cr1 . Abstract of the study is published in the journal leukemia research - clinical and laboratory studies (16). Analysis of clinical response median follow - up was 47 months (3 - 91 month), which is satisfactory considering the fact that relapse usually occurs within the first two years after our initial treatment . We analyzed 60 patients with dlbcl (median age was 45 with most patients in the age group 46 - 65 years, significantly impacts of age on the results of this study was not confirmed . Good response to first - line therapy is confirmed with the achievement of cr1 in 78.3% of investigated, which is comparable with the results of reference centers . A study by the 2007th published coiffier (17). The difference in achieving cr1 can be explained by the fact that the study included a small group of subjects in which more patients belonging to group a (gcb) 39 (65%). Statistically significant difference was confirmed compared to the ipi> 2 (low: high) 39(65%) vs 21 (35%) p= 0.014, clinical stage i / ii vs iii / iv 26 (43.3%) vs 36 (56.7%) p<0.012 and ecog>27 (11.7%) vs. 53 (88.3%) p=0.008 compared to achieve first complete remission . Statistically significant difference confirmed ipi> 2 (low: high) =15,345 p<0.0005 in achieving three - year survival . With univariate binary logistic regression analysis it is confirmed statistically significant influence of ipi>2 p<0.0005 or= 4.5 95% ci (1.98 - 10.3) to three year survival (table 2). Using univariate binary logistic regression analysis it is confirmed that the age and sex of the examinees do not have impact to three - year survival: ages p=0.903 or 0.956 (0.465 - 1.966), gender p=0.322 or 0.593 (0.211 - 1.667), with patients with dlbcl, while ecog>2 has statistically significant influence to three - year survival p=0.002 or=6.390 (2.022 - 20.194) as well as the level ldh p=0.005 or=4.6) in the expression of mum1 p=0.003 or 0.082 95%ci (0.16 - 0.430 1.5 - 13.6) (table 2). Using backward wald multiple regression analysis on clinical and immunophenotypic features in 60 dlbcl patients in relation to three - year overall survival, the significant impact of mum1 expression is confirmed p<0.0005 or=0.083(0.23 - 0.303), then ldh p=0.002 or=5.8 (1.93 - 17.5) and ipi p=0.002 or=4.47 95%ci (1.8 - 12.7) (figure 1a). Kaplan - meier curve in the group gbc / mum the survival average 37.5 months 95%ci (34 - 40) months vs. nongbc / mum1 + 23,1 months 95% ci (16.3 - 29.8) months . Difference in the average of survival between these two groups is statistically significant p<0,0005 . In the group gcb survival is longer (figure 1b). During the period of follow - up the total three - year survival in the group gcb was longer at the level of significance of p<0.0005 . In our study, data obtained in relation to the first complete remission and three - year overall survival suggest better sensitivity to immunochemotherapy in the first line treatment of dlbcl in gcb group . Kaplan - meier curves for three year overall survival kaplan - meier curves for overall survival (3 year): . Expression mum1 results of immunohistochemical analysis in this study we found the expression of bcl-6, cd10 and mum1, with two separate immunophenotypic groups: gcb and non - gcb, comparable with those given in the new who classification of tumors of hematopoietic and lymphoid tissues 2008 (1) and data by rosenwald, coloma and hans (5 - 7), who point out that the cases with the expression of cd10 cells are considered gcb type, as well as cases that were cd10-, bcl6 +, mum1 . Expression of cd138 was 25% in 6 patients and statistically significant impact of expression cd138 was not proved in this study p=0.444 or 0.453 (0.059 - 3.446). In this study, the expression of bcl-6 (weak vs. moderate + high) was not confirmed with significant difference in the groups gbc vs. non - gbc p=0.588 x = 0.003 and consequently not found significant effect of bcl-6 in response to the application of immunochemotherapy . Effect of bcl-6 expression as a predictor of longer os in dlbcl with ipi was confirmed in the era before immunotherapy, as confirmed in their study by berglund m (18). With application of immunochemotherapy predictive role of blc6 expression some studies have confirmed the loss of the positive prognostic impact of bcl-6 in the group of patients treated with anti - cd20 antibody in comparison with the patients treated only with chemotherapy . Explanation may perhaps be found in the mechanism of increased chemo - sensitivity of lymphoma in the use of immunotherapy with chemotherapy as anti cd20-blocks anti - apoptotic effect of some of the mediator, such as bcl-2 and bcl-6, or nfkb system (19 - 23). High expression of cd10 is confirmed in group gcb x = 21.538 p <0.0005 where it reached a better response to therapy compared to cr . In relation to three - year survival the expression of cd10 was confirmed with impact on borderline impact x p=0.069 or 2.331 (0.936 - 5.808). Expression of mum1 was> 25% in group non - gcb, and <25% in group gcb, as well as in the study of alizadah (4). Difference in the survival length examinees with expression mum1> 25% vs. <25% is statistically significant (mantel - cox)=19,2 p<0,0005 . The examinees with> 25% mum1 live shorter (23 months; 95% (16 - 29 months), compared with examinees with <25% mum1 who live in average 37; 95% (34 - 40 months) (figure 1b). High expression of mum1 is confirmed in group non - gcb, which has reduced sensitivity, poorer response to treatment, in relation to the achievement of cr1 and os in the application of immunochemotherapy with dlbcl . Our results in relation to impact expression mum1 on three - year survival are comparable with the study of author berglund m (18). He states that the expression of bcl-6 and cd10 are better predictors of response and that expression of mum1 is not associated with a good prognosis . Results of this study are comparable with the results of the above authors in relation to expression of mum1 and partially cd10, while not comparable to the results related to the expression of bcl-6 . The data obtained in our study confirmed that immunohistochemical profile affects the achievement of three - year survival with significant influence of expression mum1 and borderline impact expression of cd10 and in applying immunohemotherapy in treating dlbcl . Good predictors of response are confirmed in the application of immunochemotherapy: expression of mum1-, which is comparable with the results obtained by muris jj (24) which in his study concludes that the strongest predictors are cd10 expression, mum1, bcl-2 and ipi . The results of multiple regression analysis using multivariate cox s regression backward wald, impact of independent clinical and immunophenotype factors on three - year survival was examined . Independent factors showed statistically significant influence univariately ecog>2 p=0,002, ldh p=0,005, mum1 p=0,003 . Using multiple regression analysis of clinical and immunophenotypic features dlbcl in relation to three - year overall survival, the significant impact of mum1 expression is confirmed p<0,0005 or=0,083 (0,23 - 0,303), then ldh p=0,002 or=5,8 (1,93 - 17,5) (table 2). Pre - treatment prognostic and predictive value of immunohistochemically defined gcb and non gcb group within dlbcl was confirmed significant independent by univariate analysis and by multivariate analysis effect of the expression of mum1 . The results of multiple regression analysis, the independent influence of mum1 expression confirm significant impact of the planned three - year survival rate, where the impact associated with immunohistochemical markers of gcb and non gcb was analyzed and in which the analysis confirmed significant difference in the achievement of cr1 and os . Immunohistochemical profile in the expression: bcl-6/cd10/ mum1/ has a significant impact on therapeutic response dlbcl in relation to three year overall survival when applied immunochemotherapy . The significant impact of mum1>25% expression is confirmed and particular influence the expression of cd10 to three - year survival . In this study significant impact to three - year survival of expression bcl6 in the era of immunochemotherapy in dlbcl was not confirmed.
Convenience of administration and patient compliance are gaining significant importance in the design of dosage forms . Recently more stress is laid down on the development of organoleptically elegant and patient friendly drug delivery systems . Although various novel and advanced drug delivery systems have been introduced for therapeutic use, the popularity of oral dosage forms has not been eclipsed . The oral route remains the preferred route of drug administration due to its convenience, good patient compliance, and low medicine production costs . To meet these medical needs, formulators have devoted considerable efforts to develop an innovative dosage form known as orally disintegrating tablet (odt). A major claim of the some odts is increased bioavailability compared to traditional tablets . One of the major challenges to drug development today is poor solubility; as estimated most of the developed drugs are poorly soluble or insoluble in water . According to a study by sastry et al ., dysphagia is common in about 35% of the general population . Elderly and pediatric patients and traveling patients who may not have ready access to water generally need easy swallowing dosage forms . Further, drugs exhibiting satisfactory absorption from the oral mucosa or intended for immediate pharmacological action can be advantageously formulated in these dosage forms . Therefore, research on developing orally disintegrating systems has been aimed at investigating different excipients as well as techniques to meet these challenges . Taste masking of active ingredients becomes essential in these systems because the drug is completely released in the mouth . It is important that freeze - dried and effervescent disintegrating systems rapidly disintegrate in contact with fluids; they do not generally exhibit the required mechanical strength . In the same way, the candy process cannot be used for thermolabile drugs . It is also accountable that these techniques differ in their methodologies and the odts formed vary in various properties such as mechanical strength of tablets, taste and mouth feel, and swallowability, drug dissolution in saliva, bioavailability, and stability . Lamotrigine, an antiepileptic drug (aed) of the phenyltriazine class, is chemically unrelated to existing antiepileptic drugs . For epilepsy it is used to treat partial seizures, primary and secondary tonic - clonic seizures, and seizures associated with lennox - gastaut syndrome . Lamotrigine has relatively few side - effects and does not require blood monitoring in monotherapy . Lamotrigine is thought to exert its anticonvulsant effect by stabilizing presynaptic neuronal membranes; it inhibits sodium currents by selectively binding to the inactivated state of the sodium channel and subsequently suppresses the release of the excitatory amino acid, glutamate . Lamotrigine was selected for the present work because it is bcs class ii drug and has solubility problems . Bcs class ii (i.e., less water soluble) drugs require innovative approaches to reach a sufficiently high bioavailability when administered by oral route . Poorly water soluble drugs can exhibit a number of negative clinical effects including potentially serious issues of interpatient variability and subsequent erratic absorption . Lamotrigine is very slightly soluble in water (0.17 mg / ml at 25c) and slightly soluble in 0.1 m hcl (4.1 mg / ml at 25c), having plasma half - life of 24 to 35 hours . Secondly it has bitter taste, which decreases patient compliance when taken orally; both these problems were eliminated by preparing its solid dispersion with -cd . -cd make inclusion complex with drug and bitter taste of the drug can be masked . By taking into account all these aspects it was planned to formulate orally disintegrating tablets containing solid dispersion of lamotrigine because orally disintegrating systems become more popular than other oral drug delivery systems due to the highest component of compliance they offered to the patients, especially to the geriatrics and pediatrics . In addition, patients suffering from dysphagia, motion sickness, repeated emesis, and mental disorders prefer these medications because they cannot swallow large quantity of water . Lamotrigine was obtained as a gift from ipca laboratories ltd, kandivali, mumbai . And sodium starch glycolate, mannitol, sodium saccharin, and crospovidone were received as gift samples from signet chemicals, mumbai, india . Magnesium stearate, hydrochloric acid, polyvinyl pyrrolidone k30 (pvp k30), avicel ph102, and all other chemicals used were of analytical grade . Odt tablets were prepared by using 3 full factorial design using design expert trial 8.0.7.0 by direct compression . One - way analysis of variance (anova) was adopted to find out the significance of in vitro drug release data at 5% level of significance (p <0.05). For the enhancement of solubility and dissolution of lamotrigine, solid dispersion and inclusion complexes were prepared using pvpk30 and -cyclodextrin, respectively . Table 1 depicts the composition for preparing solid dispersion of lamotrigine with polyvinyl pyrrolidone k30 and -cd in various ratios . The physical mixtures were wetted with water - methanol (1: 9) mixture and kneaded thoroughly for 30 min in a glass mortar . The paste formed was dried under vacuum for 24 h. dried powder was passed through sieve no . The respective powders were weighed according to full factorial design and (drug: -cd solid dispersion (1: 1) (weight per weight), ssg, crospovidone, mannitol, avicel ph-102, sodium saccharin (as sweetening agent), magnesium stearate, and other excipients listed in table 3) were blended thoroughly with a mortar and pestle . Then the mixture was weighed and fed manually into the die of an instrumented single - punch tablet machine (cadmach, ahmedabad) to produce tablets using flat - faced punches . The hardness of the tablets was kept constant and was measured with a hardness tester . The various pre- and postcompression parameters of blend and tablets, respectively, are shown in tables 4 and 5 . A 3 randomized full factorial design was adopted to optimize the variables . In this design the amounts of superdisintegrants, x1 (crospovidone) and x2 (sodium starch glycolate), were selected as independent variables . The disintegration time (dt) and percent friability (% f) and wetting time (wt) were selected as dependent variables . Low (1), medium (0), and high (+ 1) are the values of x1 (crospovidone) and x2 (sodium starch glycolate), respectively . After inserting the values of dependent variables in the design expert software the goals were set as shown in table 6 . The concentration of ssg and crospovidone was kept within range, disintegration time (dt) was targeted 15 s, wetting time (wt) was kept in range of 1132 s, and friability was minimized . The solution was suggested for this goal by the software according to which optimized batch was prepared which had close relation with the values of dependent variables as suggested by the software . Drug content was calculated by dissolving physical mixtures and solid dispersion equivalent to 10 mg lamo in 10 ml of methanol, filtered using whatman filter paper (number 41), suitably diluted with 0.1 n hcl, and analyzed by using uv spectrophotometer against 0.1 n hcl as blank . Pure lamotrigine and solid dispersion equivalent to 10 mg of lamotrigine were added to 10 ml of 0.1 n hcl in a 10 ml volumetric flask . The volumetric flasks were capped properly and shaken at 37c in a temperature controlled water bath (shaking water bath) for 48 h. resultant samples containing undissolved solid dispersion suspended in the volumetric flask were filtered through whatman filter paper (number 41), suitably diluted with 0.1 n hcl, and analyzed by uv spectrophotometer at 267.5 nm . Accurately weighed solid dispersion equivalent to 10 mg of lamotrigine was added to 900 ml of dissolution medium, that is, 0.1 n hcl in usp ii paddle type apparatus, and stirred at a speed of 50 rpm at 37 0.50c . 10 ml aliquots were withdrawn at 2, 4, 6, 8, 10, 15, 20, 25, and 30 minutes and replaced by 10 ml of fresh dissolution media . The collected samples were analyzed after filtration and dilution at 267.5 nm using uv - visible spectrophotometer against the blank . The release profile data was analyzed for cumulative percent drug released at different time intervals and for dissolution efficiency at 6 and 10 minutes . Bulk density is defined as the mass of powder divided by the bulk volume and is expressed as g / cm . Apparent bulk density (b) was determined by pouring the blend into a graduated cylinder . The bulk volume (vb) and weight of powder (m) the bulk density was calculated using the the following formula:(1)b = mvb . Tapped density (t) can be defined as mass of blend in the measuring cylinder divided by its tapped volume . The measuring cylinder containing a known mass of blend was tapped 100 times using tapped density apparatus . The minimum volume (vt) occupied in the cylinder and the weight (m) of the blend the parameter is used to evaluate flowability of a powder by comparing the bulk density and tapped density of a powder using the following formula, known as carr's compressibility index (%): (3)carr's index = tapped densitybulk densitytapped density100 . It is calculated by the following formula:(4)hr=tb, where t is tapped density and b is bulk density . A hausner ratio of less than 1.25 (equivalent to 20% carr) indicates good flow, while that of greater than 1.5 (equivalent to 33% carr) indicates poor flow . A hausner ratio between 1.25 and 1.5 glidants can be added to improve flow . The blend was poured through a funnel that can be elevated vertically until a specified cone height (h) was obtained . Radius of the heap (r) was measured and angle of repose () was calculated using the following formula:(5)tan=hr;therefore; =tan1hr . Tablet thickness is an important characteristic in reproducing appearance and also in counting by suing filling equipment . Ten tablets were taken and their thickness was recorded using micrometer (mitutoyo, japan). As per ip, twenty tablets were taken and weighed individually and collectively using digital balance . It can be defined as the force required per unit area to break the tablet . The resistance of the tablet to chipping, abrasion, or breakage under conditions of storage transformation and handling before usage depends on its hardness . This device subjects the tablets to the combined effect of abrasions and shock in a plastic chamber revolving at 25 rpm and dropping the tablets at a height of 6 inches in each revolution . Preweighed sample of tablets was placed in the friabilator and subjected to 25 rpm for 4 minutes (100 revolutions). The friability (% f) is determined by the following formula: (6)%f=1w0w100,where w0 is initial weight of the tablets before the test and w is the weight of the tablets after test . Disintegration of orally dissolving tablets is achieved in the mouth owing to the action of saliva; however amount of saliva in the mouth is limited and no tablet disintegration test for mouth dissolving tablets was found in usp and ip to simulate in vivo conditions . A modified method was used to determine disintegration time of the tablets . A cylindrical vessel was used in which 10 meshscreen was placed in such way that only 2 ml of disintegrating or dissolution medium would be placed below the sieve . To determine disintegration time, 6 ml of phosphate buffer (ph 6.8) was placed inside the vessel in such way that 2 ml of the media was above the sieve and 4 ml of the media was below the sieve . Tablet was placed on the sieve and the whole assembly was then placed on a shaker . The time, at which all the particles pass through the sieve, was taken as a disintegration time of the tablet . The method was followed to measure tablet wetting time . A piece of tissue paper (12 cm 10.75 cm) folded twice was placed in a small petri dish (internal diameter = 65 cm) containing 10 ml of 0.1 n hcl . A tablet was put on the paper, and the time for the complete wetting was measured . In vitro dispersion time was measured by dropping a tablet in a glass cylinder containing 6 ml of 0.1 n hcl . Three tablets from each formulation were randomly selected and in vitro dispersion time was performed . Solid dispersion (sd) of lamotrigine with betacyclodextrin and pvp - k30 (1: 1 to 1: 3) was prepared by kneading technique; the prepared solid dispersion was evaluated for percent drug content, solubility studies, and in vitro drug release as shown in figure 1 . The drug content of solid dispersion (lp1lb3) was found to be from 97.8 to 99.9, which is found to be within the range of 5% of the theoretical claim (table 2), which showed the uniformity and reproducibility of the obtained method . The saturation solubility of pure drug and solid dispersion was found to be 0.16 mg / ml and 0.83 mg / ml as shown in table 2 . It was observed that the saturation solubility of drug was increased by 4 - 5-folds by converting the drug into solid dispersion, due to change in physical state of lamotrigine from crystalline to amorphous state . For tablets prepared using superdisintegrants, the bulk density of blends varied between 0.598 and 0.678 g / cc . The tapped density was found in the range of 0.7820.672 g / cc . By using these two density data, blends having value of compressibility index less than 16% were considered as free flowing ones . The values for compressibility index were found between 11.362 and 12.395% . The powder blends of all formulation had hausner's ratio of less than 1.25 indicating good flow characteristics . The angle of repose below 30 range indicated good to excellent flow properties of powder . The mixed blends were then compressed using single - punch tablet machine . After compression of powder, the tablets obtained were evaluated for their organoleptic (color and odor), physical (size, shape, and texture), and quality control parameters (diameter, thickness, hardness, friability, disintegration time, and wetting time). All the formulations were white in color and flat in shape with smooth surface not having any defects . The average weight of the prepared tablets was found between 151.8 and 146.5 mg . The hardness of tablets varied from 2.7 to 3.1 kg / cm (table 5). Superdisintegrants were incorporated in the formulations to facilitate quicker disintegration of the tablet as soon as it contacts the saliva in the mouth . These disintegrants act by drawing water into the tablet owing to the wicking or capillary action leading to swelling and breakup of the tablet . In the formulation of odts, two superdisintegrants (sodium starch glycolate and crospovidone) the disintegration process of the tablet was fully dependable on nature and concentration of superdisintegrant used . A 3 randomized full factorial design was used in the present study to study the effect of concentration of 2 superdisintegrants as factors on the disintegration property, wetting time, and percent friability . In this design, 3 factors were evaluated, each at 3 levels, and experimental trials were performed at all 9 possible combinations . The amounts of ssg (sodium starch glycolate) (x1) and the amount of crospovidone (x2) were selected as independent variables . A statistical model incorporating interactive and polynomial terms was used to evaluate the responses:(7)y = b0+b1x1+b2x2+b12x1x2+b11x12+b22x22,where y is the dependent variable, b0 is the arithmetic mean response of the 9 runs, and bi is the estimated coefficient for the factor xi . The main effects (x1 and x2) represent the average result of changing 1 factor at a time from its low to high value . The interaction terms (x1x2) show how the response changes when 2 factors were simultaneously changed . The disintegration time, wetting time, and percentage friability for the ssg and crospovidone combination (batches odt1 to odt9) showed a wide variation (i.e., 1132 s, 2140 s, and 0.520.69, resp . ). The data clearly indicated that the disintegration time, wetting time, and percentage friability are strongly dependent on the selected independent variables . The fitted equation relating the responses disintegration time, percentage friability, and wetting time to the transformed factor is shown in table 6 . The polynomial equations (see (8)) can be used to draw conclusions after considering the magnitude of coefficient and the mathematical sign it carries (i.e., positive or negative). Table 7 showed the results of the analysis of variance (anova), which was used to generate mathematical models:(8)dt=17.443.17x17.00x2 + 2.00x1x20.17x1x1 + 2.33x2x2,wt=25.782.83x16.67x2 + 1.75x1x20.83x1x1 + 2.33x2x2,%f=0.560.017x10.060x2 + 0.020x1x2 + 1.00x1x10.030x2x2.the high values of correlation coefficient for disintegration time,% friability, and wetting time indicate a good fit, that is, good agreement between the dependent and independent variables . The equations may be used to obtain estimates of the response as a small error of variance was noticed in the replicates . The f value in the anova table was the ratio of model mean square (ms) to the appropriate error (i.e., residual) mean square . The larger the ratio is, the larger the f value is and the more likely that the variance contributed by the model was significantly larger than random error . If the f ratio, the ratio of variances, lies near the tail of the f distribution, then the probability of a larger f is small and the variance ratio was judged to be significant . Usually, a probability less than 0.05 is considered significant . Values of p less than 0.0500 indicate that model terms are significant . In this case the models generated for disintegration time, percent friability, and wetting time were found significant . As there were no insignificant terms, model reduction is not required . The f distribution is dependent on the degrees of freedom df for the variance in the numerator and the df of the variance in the denominator of the f ratio . The model f value of 128.63 for disintegration time, 133.28 for wetting time, and 48.36 for friability and high r values suggested that these models are significant . The results of multiple linear regression analysis revealed that, on increasing the concentration of both the sodium starch glycolate and the crospovidone, a decrease in disintegration time was observed; both coefficients b1 and b2 bear a negative sign . Decrease in disintegration time is more significant in case of crospovidone than sodium starch glycolate . By increasing the concentration of crospovidone it is obvious that, in the presence of higher percentage of superdisintegrant crospovidone, wicking is facilitated . In case of percent friability, conclusions can be drawn considering the magnitude of the coefficient and the mathematical sign (positive or negative) it carries . Also crospovidone produces mechanically stronger tablets than that of sodium starch glycolate, so with the increase in concentration of crospovidone friability decreases . The optimization of the odt was decided to target disintegration time 15 s and percent friability is minimized and wetting time is within range . The optimized concentration was obtained by software as clear in the surface response prediction curves . A checkpoint batch was prepared at x1 = 0.36 level and x2 = 0.56 level . From the full model, it was expected that the friability value of the checkpoint batch should be 0.52, the value of disintegration time should be 15.00 s, and the value of wetting time should be 23.58 s. the obtained results were found as expected . From all of the solid dispersion prepared it was clear that solubility of drug increases with increase in the amount of both carriers but pvp - k30 showed more increase in solubility than -cd and trial batches of odts were prepared with selected solid dispersion of both carriers, that is, pvp k30 and -cd; the tablets made with lp3 showed high values of disintegration time because in higher concentrations it acts as binder and therefore increases the disintegration time so pvp k30 solid dispersion was not used for the preparation of odt, thus -cd was used for the preparation of solid dispersion as it showed more release in first 5 min . Than other solid dispersion by incorporating lesser carrier than others which also helps in keeping the weight of the final dosage form within range . Secondly -cd makes inclusion complex with the drug which masks the bitter taste of the drug simultaneously . From the evaluation of the parameters of the various batches of the odts it was clear that both superdisintegrants decrease the disintegration time but crospovidone showed more stronger affect than ssg; secondly it produced mechanically harder tablets than ssg . As crospovidone facilitates wicking effect, it also reduces the wetting time more effectively than ssg . So it was concluded that optimization helps in selecting the appropriate amount of dependent variables to achieve the required goal.
For a long time, child protection in general has been perceived as a matter for the professionals specializing in social service, health, mental health, and justice systems . However, this problem remains a duty to all, and more so a concern for other social scientists such as anthropologists, economists, historians, planners, political scientists, sociologists, and humanists (e.g., ethicists, legal scholars, political theorists, and theologians) who contribute to the understanding of the concepts of and strategies in child protection and the responsibility for adults and institutions with roles in ensuring the safety and the humane care of children under their care . Child abuse, therefore, is when harm or threat of harm is made to a child by someone acting in the role of caretaker . Child abuse can be in the form of physical abuse, when the child suffers bodily harm as a result of a deliberate attempt to hurt the child, or severe discipline or physical punishment inappropriate to the child's age . It can be sexual abuse arising from subjecting the child to inappropriate exposure to sexual acts or materials or passive use of the child as sexual stimuli and/or actual sexual contacts . Child abuse can also be in the form of emotional abuse involving coercive, constant belittling, shaming, humiliating a child, making negative comparisons to others, frequent yelling, threatening, or bullying of the child, rejecting and ignoring the child as punishment, having limited physical contact with the child (e.g., no hugs, kisses, or other signs of affection), exposing the child to violence or abuse of others or any other demeaning acts . All these factors can lead to interference with the child's normal social or psychological development leaving the child with lifelong psychological scars . Lastly, child abuse can be in the form of child neglect, when an able caregiver fails to provide basic needs, adequate food, clothing, hygiene, supervision shelter, supervision, medical care, or support to the child . It is usually difficult to detect child abuse, unless one creates an atmosphere that would encourage disclosure by the child being abused . Signs and symptoms of child abuse commonly include subnormal growth of the child, unexplained head and dental injuries, soft - tissue injuries like bruises and bite marks, burns and bony injuries like broken ribs, in the absence of a history pointing to the cause or causes of the trauma . The present case report describes a child who was abuse by a very close relative, and who caused physical and psychological trauma to the young lad . Peter, a 12-year - old boy, accompanied by his maternal aunt, presented at the local university dental hospital (pediatric dental clinic) in kenya in october 2012, with a complaint of a large, painful left facial swelling related to the left upper incisors . He had been referred from a local rural hospital where he had been taken by the same aunt, for treatment of the swelling . The swelling had occurred only 2 days prior to visiting the local hospital, and 4 days before presenting himself at the university dental hospital . Family history indicated that the young boy was a first - born among three siblings (9-year - old girl, 5-year - old boy), and that their single parent (mother) had been deceased for 6 years due to hiv - related complications . The three children had moved to live with their maternal grandparents and their seven sons . The patient had no adverse past medical history and had never consulted a dentist previous to the present problem . The boy was in grade seven in a local primary school and had the aspiration of becoming a medical doctor in future . It was not possible to establish from the aunt or the boy the situation of the patient's other siblings . An extra - oral examination showed a young boy with a normal gait, sickly, unkempt, rather withdrawn, and small for his age . He had asymmetrical face due to the swelling involving his left submandibular region and spreading upwards to the inferior orbital margin, febrile (39.1c), a marked submandibular lymphadenopathy on the left side, the skin overlying the swelling was warm, shiny and fluctuant, and the lips were dry and incompetent (2 cm) and as shown in [figures 1a c]. However, the temporomandibular joint movements were normal . The patient was also found to have a big, healing scar on the dorsal surface of the left foot, the cause of which was also unclear [figure 1]. (a) frontal and (b) lateral (c) profiles of the patient showing the facial asymmetry with the left submandibular to infra - orbital and the healing scar on the foot intra - oral examination revealed a young boy in the permanent dentition with un - erupted third permanent molars, poor oral hygiene with heavy plaque deposits on the tongue and a generalized but moderate inflammation of the gingiva . There was a grade three mobility in relation to 11, 12, 21, 22 and a grade two mobility in relation to 23, 24, 25 (miller mobility index). There was intramucosal swelling in relation to 21 - 24 extending labially / buccally (measuring 4 cm 3 cm) and palatally (measuring 3 cm 2 cm). On elevation of the upper lip, active discharge of pus mixed with blood and some black granules there were no alveolar / bone fractures elicited, but carious lesions were present on 46 (occlusal), 47 and 37 (buccal). Orthodontic evaluation showed angles class i molar relation on the left and edge to edge tending to class ii on the right side . There was an anterior over - jet of 3 mm (11/21), an overbite of 20%, coincidental dental / facial midline and crowding on the upper right arch with 15 palatally displaced as can be seen in figure 2a c . (a) intra - oral photographs of the patient showing the labial and (b) palatial swelling in relation to displaced 21 and 22 (c), generalized marginal gingival inflammation, palatally displaced 15, moderate dental plaque deposits and a moderate anterior dental crowding in the lower dental arch for investigations, orthopantogram, intra - oral periapical 11, 12, upper and lower standard occlusal and bite wing radiographs were taken and examined . In addition, clinical photographs, study models, and vitality tests for the traumatized teeth were undertaken . A diet and nutrition assessment, full blood count, stool microscopic analysis for ova and cyst and bacterial culture and sensitivity were also undertaken . The results of the radiographs showed un - erupted with potential impaction of 48 and 38, an upper midline radioluscence, widened periodontal space in relation to 11, 21 (with a mesial tilt), 22, occlusal caries on 46 and buccal caries on 47 and 37 . There was the presence of root fractures involving the apical one - third of 21, 22 . Vitality tests conducted on the traumatized incisors showed false positive (may be due to the presence of infection). The blood analysis showed the presence of neutrophilia (suggestive of bacterial infection), mild iron deficiency, but he was sero - negative . From the diet chart, the boy was generally on a noncariogenic diet that lacked the intake of fruits and animal proteins . Nutritional assessment revealed a boy with a height of 144 cm, a weight of 28 kg, and a body mass index (bmi) of 13.5 kg / m (below 5 percentile (given the ideal bmi should be 17.8 kg / m in the 50 percentile). From the history adduced and the results of the investigations, a diagnosis of child abuse and neglect was reached, with the boy having suffered traumatic injuries resulting in facial cellulitis, ellis class vi fracture involving 21, 22 associated dentoalveolar abscess and subluxation of 11, 12 . In addition, there were dental carious lesions on 46 (occlusally), 47 and 37 (buccally) and a relatively severe malnutrition . The patient had also moderate plaque induced gingivitis, mild anemia (microcytic and iron deficiency), mild dental fluorosis, potentially impacted 48 and 38 and crowding in the upper right and lower anterior arches . The objective of treating the boy was to eliminate the pain, infection, improve the general and oral health, restore carious teeth, improve esthetic and report the child abuse and neglect to the relevant authorities . In the initial phase of treatment, the patient was admitted for 4 days and placed on dexamethasone 8 mg stat, cefuroxime 750 mg 3 times a day, metronidazole 500 mg 3 times a day, diclofenac 50 mg tablets alternating 4 hourly with oral paracetamol 1000 mg 3 times a day, to run for 5 days . Patient was also placed on chlorhexidine mouthwash 10 ml twice daily for 7 days and ranferon (hematinics) 10 ml to be used twice a day for 1 month . The second phase of treatment included incision and drainage of the abscess, followed by the splinting of the mobile teeth in the upper dental arch using semi - rigid splint of 0.6 mm stainless steel round wire for 4 weeks while . A referral of the patient was made the child support center in the main referral hospital, plus the patient was placed on future recalls to determine whether the patient would have overcome the problem and the oral health was maintained in good condition . The third phase of treatment involved interceptive orthodontics with the extraction of 15 to relieve the crowding in the area . Oral hygiene instructions were availed to the patient and the guardian, placement of fissure sealants was done for the premolars and molars to help reduce plaque retention on these teeth, preventive resin restorations were placed on 37, 46, and 47 . The root fractures involving the apical one - third of 21 and 22 meant that the two teeth were to be initially dressed using non setting calcium hydroxide, and after healing, root canals are filled in the usual manner [figure 3]. Postobturation intraoral periapial radiograph showing the restoration on 12, 11, 21, and 22 nutrition evaluation had initially been done and when the patient was re - evaluated after 1 month, he had gained bodyweight up to 1 kg . The child support center continued to carry out psychotherapy, and during one of the sessions, the patient confessed to having undergone physical abuse and threatened not to divulge any information by one of the uncles . The center considered placing the boy into a children's home, probably together with his siblings . Radiographic examinations evaluation after 3 months indicated some external apical root resorption taking place on 21 and 22 . After 10 months, the oral health and general heath of the patient had remarkably improved as shown in figure 4 . Posttreatment photographs taken after 10 months showing improved oral health of the patient and the glimmer of confidence in the patient as shown in a - d respectively the objective of treating the boy was to eliminate the pain, infection, improve the general and oral health, restore carious teeth, improve esthetic and report the child abuse and neglect to the relevant authorities . In the initial phase of treatment, the patient was admitted for 4 days and placed on dexamethasone 8 mg stat, cefuroxime 750 mg 3 times a day, metronidazole 500 mg 3 times a day, diclofenac 50 mg tablets alternating 4 hourly with oral paracetamol 1000 mg 3 times a day, to run for 5 days . Patient was also placed on chlorhexidine mouthwash 10 ml twice daily for 7 days and ranferon (hematinics) 10 ml to be used twice a day for 1 month . The second phase of treatment included incision and drainage of the abscess, followed by the splinting of the mobile teeth in the upper dental arch using semi - rigid splint of 0.6 mm stainless steel round wire for 4 weeks while . A referral of the patient was made the child support center in the main referral hospital, plus the patient was placed on future recalls to determine whether the patient would have overcome the problem and the oral health was maintained in good condition . The third phase of treatment involved interceptive orthodontics with the extraction of 15 to relieve the crowding in the area . Oral hygiene instructions were availed to the patient and the guardian, placement of fissure sealants was done for the premolars and molars to help reduce plaque retention on these teeth, preventive resin restorations were placed on 37, 46, and 47 . The root fractures involving the apical one - third of 21 and 22 meant that the two teeth were to be initially dressed using non setting calcium hydroxide, and after healing, root canals are filled in the usual manner [figure 3]. Postobturation intraoral periapial radiograph showing the restoration on 12, 11, 21, and 22 nutrition evaluation had initially been done and when the patient was re - evaluated after 1 month, he had gained bodyweight up to 1 kg . The child support center continued to carry out psychotherapy, and during one of the sessions, the patient confessed to having undergone physical abuse and threatened not to divulge any information by one of the uncles . The center considered placing the boy into a children's home, probably together with his siblings . Radiographic examinations evaluation after 3 months indicated some external apical root resorption taking place on 21 and 22 . After 10 months, the oral health and general heath of the patient had remarkably improved as shown in figure 4 . Posttreatment photographs taken after 10 months showing improved oral health of the patient and the glimmer of confidence in the patient as shown in a - d respectively all types of child abuse and neglect leave the affected child with long - lasting scars that may be physical or psychological, but they are the emotional scars that leave the child with life - long effects, damage to the child's sense of self, the ability to build healthy relationships and function at home, work or school . This situation can in turn result in the child turning to alcohol or drugs to numb the painful feelings . On the other hand, the exposure by the child to violence during childhood can increase vulnerability of that child to mental and physical health problems like anxiety disorder, depression, etc ., and make victims more likely to become perpetrators of violence later in life . The oral cavity can be a central focus for physical abuse due to its significance in communication and nutrition . A neglected and abused child like the one described here, can become helpless and passive, displaying less affect to anything whether positive or negative in his or her encounters . The patient described was vulnerable to abuse as he already lacked the parental protection in his early life, and was living in a poor, but large family where competition for available resources must have been stiff . The abuser, therefore, his own uncle, probably did not like their presence gave him the assumption that the children would grow up to take away what he probably thought would be his dues from the family . In kenya and even in many other countries, data on the prevalence of child abuse is still scarce . A kenyan study undertaken in 2013 showed that violence against children was very high, with 31.9% and 17.5% female and male, respectively reporting having been exposed to sexual violence, 65.8% and 72.9% female and male respectively to physical violence . In the same study, 18.2% and 24.5% female and male, respectively had been abused prior to attaining 18 years of age, and only 23.8% female and 20.6% male reported not having experienced any form of violence during childhood . Child abuse in kenya, therefore, appears to be a rampant problem within the society . In all cases of abuse reported in the literature the motive of child abuse has not always clear, just as it was the case with the patient described here . The patient under study here hailed from a family with low socio - economic background where providing for extra needs in the family could have been a problem . Even during treatment of the patient the family found the cost of treatment to be very high and unaffordable to them, and a waiver of the cost had to be sought and obtained from the university dental hospital . Further, the child having been orphaned with the death of their single parent (mother) left these children unprotected and vulnerable to such abuse from uncles who may have been competing for same needs in an already crowded family . It is possible that factors as poverty, social isolation, and familial disruption could have contributed to the abuse meted by this boy . The fact that the problem was established at this stage, it probably provided the patient and his siblings with the opportunity to get early support and avert serious health problems for them . The referral to the local child protection authority was done to attain this goal and also to have the children monitored consistently for their safety from further child abuse . The child protection agency was indeed considering placing them in the custody of a children's home, though sadly, according to a report by the kenyan government, the utilization of these support services had not been very high, for reasons unknown . The treatment of the patient was carried out in a humane manner, and assistance provided whenever possible to have the full treatment completed . The problem of nutrition was still a difficult one for this large family with a poor background . Nonetheless, the guardian was still briefed on the issue, and informed about the importance of a balanced diet for optimal growth and immunity boosting for such young child, and suggestions for alternative cost - effective foods for the child . It was hoped that the support services of giving the patient and probably his siblings a new home would help the young child to grow and develop normally without fear of abuse . The management of child abuse can be complicated, and often require a multidisciplinary approach, encompass professionals who will identifying the cause of the abuse or neglect, treatment of the immediate problems and referral of the child to the relevant child protection authority for action . Counseling services for the child and the caregivers should form part of the management regime . In the present case, the objectives were met and the patient got full benefits of this approach.
Antimicrobial cationic peptides are host defense molecules produced by the innate immune system of organisms all across the evolutionary spectrum . Indolicidin, encoded by a member of cathelicidin gene family, a cationic antimicrobial tridecapeptide amide (h - ile - leu - pro - trp - lys - trp - pro - trp - trp - pro - trp - arg - arg - nh2), was isolated from cytoplasmic granules of bovine neutrophils . It is one of the shortest known natural - occurring antimicrobial peptide, toxic to both prokaryotes and eukaryotes [3, 4]. Unlike several other antimicrobial peptides, the structure of indolicidin upon membrane interaction is not a well - defined helix or a -turn and does not display their characteristic amphipathic nature [47]. It has been reported that indolicidin expresses its antimicrobial activity by creating pores through cell membranes . Other studies showed that indolicidin treatment resulted total disintegration of membrane structures or that it did not cause cell lysis even at high concentration . Compared to -helical antibiotic peptides, indolicidin is less able to dissipate the bacterial inner membrane potential and forms smaller pores, yet it kills bacteria rapidly . It was reported that an interfacial membrane location was preferred by indolicidin [6, 11]. These results point to a mechanism of action that is different from well - defined channel formation . Lipid bilayer on polyelectrolyte films can be used as a useful experimental approach to study basic problems of biological membrane structures [1214]. Bacteriorhodopsin is a light - driven proton pump in the plasma membrane of halobacterium salinarum . This integral membrane protein is tightly packed in two - dimensional crystalline from termed purple membrane with high (75% w / w) bacteriorhodopsin content, with no other protein . Microscopic (afm) experiments could provide detailed information about these systems . Here, we present an afm study on the interaction of indolicidin with an artificial and a natural membrane . Freshly cleaved mica (spi - chem mica sheets, structure probe, inc ., west chester, pa, usa) surface was covered with poly(l - lysine)-poly(l - glutamic acid)-dipalmitoyl phosphatidylcholine (pll - pga - dppc) layers [14, 17], or with purified purple membrane of halobacterium salinarum [1820] on the following ways: experiments were performed in tris(hydroxymethyl)aminomethane (tris - hcl, 10 mm), and sodium chloride (nacl, 0.15 m) buffer at ph = 7.4 . The polyelectrolytes pll (mr = 32600 g / mol) and pga (mr = 17000 g / mol) have been both dissolved in the above mentioned buffer, at a concentration of 1 mg / ml . Dppc was dissolved in chloroform: methanol (2: 1) at final concentration of 20 mg / ml . Afterward the solvent was evaporated by n2 flow . Buffer was added to the dried dppc (250 g / ml), and liposomes were formed by sonication . No special care was taken to have unilamellar liposomes . To form polyelectrolyte layers, pll was adsorbed first to the freshly cleaved mica, then it was washed with buffer, and pga was adsorbed on pll layer, and it was washed again . These steps have been followed by covering the treated mica with dppc layer; it was heated for 1 hour at 46c, and let to cool slowly . Purple membrane of halobacterium salinarum was prepared according to the method of oesterhelt and stoeckenius, and it was adsorbed from a buffer containing 10 mm tris and 150 mm nacl at ph = 8.0 to the freshly cleaved mica surface treated with the same buffer containing 10 mm cacl2 . Indolicidin was added just before the measurements to the same buffer in which the membrane surfaces were prepared at 0.52, 2.6, 5.2, 7.9, and 15.7 m concentrations (1, 5, 10, 15, and 30 g / ml, resp .) [10, 22]. All chemicals were purchased from sigma - aldrich (st . Louis, mo, usa). Afm measurements were carried out with an asylum mfp-3d head and controller (asylum research, santa barbara, ca, usa) in tapping / noncontact (ac) mode . The driver program mfp-3d xop was written in igor pro software (version 5.05a, wavemetrics, lake oswego, or, usa). Silicon nitride (biolever mini bl - ac40ts) cantilevers (olympus optical co., ltd ., tokyo, japan) were used for the experiments (resonance frequency was 25 khz in water with 0.09 n / m spring constant). Typically 512 512 points were taken at 1 line / s scan rate in ac mode under buffer solution . In order to clarify which model may be the more likely explanation of indolicidin's antimicrobial activity (i.e., pore formation that disturbs the metabolism / homeostasis / ion balance of a cell, or the cell membrane destruction), we developed a modified supported membrane model: a polyelectrolyte film composed of pll and pga attached to flat mica surface and covered with a lipid bilayer of dppc . The reason why we chose this membrane model is that it contains a layer between the hard surface (mica) and the lipid bilayer through which small peptides are able to penetrate . In other words, if indolicidin creates a pore through a membrane, this structure may ensure space for indolicidin on the other side of the membrane, and it can access the membrane from the side that is close to mica, too . In models used previously for studying the action mechanism of indolicidin [8, 23, 24], lipid bilayers were directly attached to mica, leaving no space between the membrane and the hard surface, which may be important for full pore formation . To test the effect of indolicidin on our membrane model, various concentrations of peptide solutions were used (in a range of 0.52 to 15.7 m) [10, 21]. On one hand, when we used 0.52 m of indolicidin, no membrane alterations could be detected with afm (figure 1(a)). If the concentration was increased above 2.6 m, instead of creating pores, indolicidin induced the appearance of aggregates, but the membranes were still intact (figures 1(b) (2.6 m), 1(c) (5.2 m)). We hypothesize that these aggregates are formed from excess amount of indolicidin that is present in the system . However, the aggregation process was too fast, and it did not allow us to follow the formation of these aggregates during afm imaging (taking one image required approximately 10 minutes of scanning). When we further increased the concentration of the antimicrobial peptide (7.9 m (data not shown) or 15.7 m), after about 2 hours, the membrane bilayer structure was destroyed; this phenomenon was not observed at lower concentrations (figure 1(d)). In summary, in our model membrane, we could not find a concentration where pore formation occurred . This suggests that the mechanism through which indolicidin expresses its antimicrobial activity is more likely via disintegrating membranes . To make sure that smaller concentrations have a different effect relative to higher concentrations, and for better understanding of the membrane destruction process, the time dependence of indolicidin treatment was also measured (figure 2). 15.7 m of indolicidin started to induce detectable changes in the membrane structure after the first 4050 min (figures 2(b) and 2(d)). The collapse of the membrane required 140 min at room temperature (figures 2(e) and 2(f)). Based upon the above observations, that is, (1) indolicidin needs a minimal concentration to affect the bilayer structure (below which there is no detectable impact, and above which there is a major / significant impact). These results have a good agreement with the proposed mechanism reported by melo et al . . Indolicidin may behave as a surfactant - like material in a sense that it breaks down the continuity of membranes . The purple membrane disks of halobacterium salinarum have been checked also to test the importance of pll / pga layer . These membrane disks were deposited directly on the ca covered mica surface, without any polyelectrolyte film . In this case, the interaction was slower and more specific . As it can be seen, indolicidin binds to the membrane, but the edges were preferred (figures 3(b) (7.9 m), 3(d) (15.7 m)), since the lipids were more accessible in those regions . Also the roughness of the membrane increased, probably caused by the aggregation of the indolicidin on the surface . Even at higher concentration (15.7 m), indolicidin attached to the membrane surface and especially on the border of membrane disk only but did not break the membrane integrity . This transient layer has about half height (3 - 4 nm) of the purple membrane, in agreement with the results of shaw et al . And mecke et al . Based on the height of the layer, it is probably a monolayer of lipids stabilized with indolicidin . The subject of our present publication is an in situ atomic force microscopy study of interaction of indolicidin with supported planar bilayer membranes of dppc, and purple membrane of halobacterium salinarum . The effect of the peptide on membranes was concentration dependent for dppc and it resulted in the destruction of intact membranes . Among the samples examined, the purple membrane was less sensitive to indolicidin treatment, most likely due to the high membrane protein content . For these membranes, indolicidin tended to bind to the border of membrane disks, where the lipids are easier to interact with . In this paper, we demonstrated that the association of indolicidin with supported planar bilayers causes membrane thinning similar to the work of shaw et al . [23, 24] and mecke et al . Or solubilization of supported membrane on polyelectrolyte film rather than initiating pore formation . These results are in good correlation with molecular dynamics simulations [27, 28].
A 63-year - old man underwent open left nephrectomy for a nonfunctional kidney secondary to stricture urethra . He also had bilateral inguinal hernia for which he underwent bilateral inguinal hernia repair with mesh reconstruction . An abscess developed over the site of previous epidural puncture, which ruptured and drained pus that same day . Following the rupture of the abscess, he became afebrile . The patient reported to the local hospital 2 days later for persisting drainage and was treated with dry dressings and analgesics . However, the draining sinus in his back persisted for 1.5 months and patient was then referred to our spine unit . Examination of the patient showed erythema around the sinus with tenderness over the l1 spinous process . His laboratory parameters showed erythrocyte sedimentation rate (esr) of 55 mm / h and serum c - reactive protein (crp) level of 79 mg / l . A computed tomography (ct) scan showed a sinus tract reaching up to the spinous process of l1 vertebra (fig . He underwent sinus tract excision along with removal of the posterior half of the l1 spinous process . Culture of the tissue from the sinus tract grew methicillin - resistant staphylococcus aureus (mrsa) sensitive to linezolid . He was treated with intravenous linezolid for 6 weeks and the surgical wound healed . At 1-year follow - up, he remained symptom - free . Computed tomography scan showing sinus tract from skin to interspinous ligament and l1 spinous process (arrow). Photomicrograph showing dense sheets of polymorphs with granulation tissue formation and necrotic bone (black arrow), suggestive of acute on chronic osteomyelitis . There has been an increasing trend toward epidural anesthesia and analgesia and the placement of catheters in the epidural space for the management of chronic and postoperative pain.1 back pain developing after epidural anesthesia is common and its incidence varies from 2 to 31%.2 the common causes of back pain after regional anesthesia are thought to be due to ligamentous trauma, reflex paraspinous muscle spasm, and ligamentous strain during patient positioning secondary to skeletal muscle relaxation . Symptoms related to back pain are usually mild and respond well to conservative management.3 infections following epidural catheter insertion are uncommon; epidural abscess is a well - recognized complication . Vertebral osteomyelitis and discitis after epidural catheterization are extremely rare.4 5 6 7 8 to the best of our knowledge, mrsa vertebral osteomyelitis secondary to epidural catheter use has not been reported earlier in the english orthopedic literature . A literature search of published articles in english found only 10 cases of vertebral osteomyelitis as a complication of epidural catheter use . This report analyzes the clinical presentation, laboratory results, therapeutic interventions, and outcome of these patients including the present reported patient (table 1). There were six women and five men who ranged in age from 34 to 79 . The duration of epidural catheter analgesia ranged from 7 hours to 6 days with all patients having back pain (100%). Eight patients had some degree of immune compromise (73%) such as chronic steroid use, ulcerative colitis, chronic alcohol abuse with pancreatitis, diabetes mellitus, and malignancy . The most common organism isolated was pseudomonas aeruginosa (64%; table 2).3 4 5 6 7 9 10 one patient had pneumonia caused by p. aeruginosa and subsequently developed a spinal infection with the same organism following epidural use.3 two healthy patients were infected with propionibacterium acnes, which is a normal anaerobic and weakly pathogenic saprophyte in the skin, sebaceous glands, and hair follicles.11 12 nonoperative management was successful in seven patients (64%) and surgical management in four patients (36%). Bp, back pain; iv, intravenous; ns, not specified; uc, ulcerative colitis; dm, diabetes mellitus; tkr, total knee replacement; thr, total hip replacement; pr, present report; uti, urinary tract infection; ra, rheumatoid arthritis . Vertebral osteomyelitis and discitis following epidural catheter use could be due to hematogenous spread of organisms from infective foci elsewhere in the body13 or direct invasion either by skin bacteria through the needle track,14 contaminated syringes,15 or contaminated local anesthetics.16 the diagnosis of vertebral osteomyelitis requires a high index of suspicion . The clinical features include severe back pain, fever, and painful restriction of movements with or without neurological involvement . Epidural and psoas abscess formation may complicate pyogenic spondylodiscitis.3 17 plain radiographs are normal in the early period of infection . Mri is the study of choice, and it is the most sensitive and specific imaging technique for the diagnosis of a spinal infection.18 however, tissue sampling is often required for characterization of the infecting organism by ct - guided aspiration or by open biopsy.12 in the present patient, vertebral osteomyelitis most likely developed through the epidural track itself for several reasons . A nephrectomy was performed for renal dysfunction due to chronic obstructive noninfective pathology . The perusal of anesthesia notes revealed repeated attempts to insert epidural catheter due to bloody tap . At the initial stages of the wound infection, no antibiotics were given by the treating physician and the mri did not show evidence of epidural abscess . From the analysis of the published literature, it is evident that immunocompromised patients (8/11) are at a higher risk of developing infective complications following epidural catheter use, and these patients should be closely monitored . Daily inspection and prompt removal of epidural catheter should be done on any suspicion of infection,19 as even healthy patients can develop infection.11 12 therefore, strict aseptic technique of epidural catheter insertion should be practiced, and the anesthesiologist as well as the treating surgeon should be aware of the rare possibility of infection even after uneventful epidural analgesia.
Posterior cervical fixation by lateral mass screw insertion and rod fixationhas been frequently used to manage instability caused by trauma, extensive laminectomy state, and destruction by tumors . This technique was first described by roy - camille et al.21), and several modified techniques of lateral mass screw insertion had been introduced to avoid the related complications . Among them, the most common techniques for lateral mass screw insertion were the roy - camille and magerl's techniques8,14,19). Based on these techniques, new insertion angle techniques for deep screw insertion were modified, and their clinical and radiological safety data had been reported previously . But, yoon's method, one of the modified magerl's technique, was not precisely studied in long - term follow - up yet, although it was reported safe method27). For this reason, this study assessed the radiological efficacy of the cervical lateral mass screw insertion and rod fixation by yoon's method with minimum 2 years follow - up . This retrospective analysis study reviewed total 50 consecutive patients who were treated by lateral mass screw insertion and rod fixation between january 2005 and december 2007 . The cases presented cover multiple pathologies including 14 cases of fracture / dislocation, 3 cases of spondylosis, 5 cases of ossification of posterior longitudinal ligament (opll), 16 cases of cord contusion, and 12 cases of tumors . These all patients were operated on by a surgeon (yoon sh), and total 323 screws of all patients were treated with the modified magerl's method according to the modified trajectory described by yoon et al27). Cervical lateral mass screw insertion and rod fixation was done as usual method of posterior cervical fusion . All patients were taken a prone position with the head hold sligh- tly flexed using three - pin skull fixation . Standard- midline incision was performed and all cervical lateral masses of interest were exposed to facilitate fusion and allow for accurate screw trajectory . The lateral masses were drilled and tapered using the technique of lateral screw insertion trajectories described by a modified magerl's technique (yoon's method). The entry point wasinitiated at a point 1 mm medial and 1 mm superior to the mid - portion of the lateral mass, and preceded along a course 20 - 30 cephalic and about 20 laterals from c3 to c7 . There were 12 cases of transpedicle screw insertion on the thoracic spine due to a c6 - 7 level injury, but thoracic screws were not included in this study . Arthrodesis was completed by burring the exposed bone surfaces and placing allobone graft into and around the lateral mass . After surgery, philadelphia collar was routinely applied to all patients for neck protection and motion limitation to promote the cervical fusion until 6 to 8 weeks after the operation . Postoperative assessment of lateral mass screw insertion and rod fixation was performed according to the previous study17). At 1, 6, 12 and 24 months after surgery, routine anterior - posterior and flexion - extension lateral radiographs were obtained for each visit to our clinic, andwe checked the sagittal angle of lateral mass screws on both sides and the presence of screw loosening or breakage . A thin section ct scan focused on the lateral mass fixated area during immediate and last follow - up periods, and the lateral angle of the lateral mass screws on both sides and the position of the screw tip in relation to the vertebral foramen were recorded . The screws with the tip penetrated into the vertebral foramen (foraminal invasion) or into the spinal canal (cord invasion) were defined as mal - position of screw . Cervical lordosis or the instrument level angle were checked by the sagittal cobb's angle between c2 and c7 (fig . 1a) or the upper and lower endplate of lateral mass fixated cercvical levels (fig . 1b) in the neutral cervical lateral radiographies . Cervical or segmental kyphosis of instrument level were defined as more than 10 degrees of the sagittal cobb's angle between c2 and c7 or 10 degrees up increment in sagittal cobb's angle between the upper and lower level of lateral mass fixated levels . In this study, the criterion for fusion is the presence of bony trabecular continuity between the vertebral bodies, and non - union was defined as a visible gap, graft collapse, and motion of greater than 5 with dynamic radiographies . The age of patients at the time of operation ran ged from 16 to 80 years (mean 52 years). Mean follow - up period was 32 months (range 24 months to 52 months). There were no statistically difference between the surgical levels, composition of cervical disease, and sizes of cervical lateral masses of lesions by the age or sex of patients . All patients were stabilized with screws and rods, and total screw cases were 323 screws implanted in 50 patients . Cervical lordosis by cobb angle between c7 and c7 was 18.8110.72 in immediate post - operated status, and it significantly increased to 14.768.47 in 24 months follow - up (p<0.001). The instrument level cobb angle was not significantly change in immediate post - operated and 24 months follow - up status (7.014.38, 6.992.80, respectively). Flexibilities checked by proximal and distal kyphosis were markedly increased from immediate operated status to follow - up . Proximal kyphosis was increased from 4.002.29 to 5.913.17 (p<0.001), and distal kyphosos was increased from 3.172.89 to 4.452.84 (p<0.001). Junctional kyphosis between immediate postoperative and last follow- up lateral x - ray was observed in 4.0%(2 of 50 cases) including one case with non - fusion . Unsuccessful bone fusion occurred in 4.0%(2 of 50 cases), but did not need further operation . Among the 323 screws, screw pull - out was observed in 2 patients (4.0%) with 0.9% of case by screw rate (3 of 323 screws) (fig . 2), foramen invasion without definite vertebral artery injury was exhibited in 1.2%(4 of 323 screws) (fig . 3). The radiographs revealed facet injury occurred in 2 patients (0.6%) (fig . 4). One patient experienced screw pull - out, foraminal stenosis, and aggra- vation of adjacent disc protrusion simultaneously . Other complications suchas pseudoarthrosis and vertebral artery injury were not observed during this follow - up . Since roy - camille first introduced cervical lateral mass screw fixation in 197921), many modified techniques for screw insertion, including magerl, anderson, an, and yoon have been published in an effort to reduce the risk of neurovascular and facet injury3,4,6,7,9,10,11,14,24,27). Previously introduced lateral mass screwingmethods have reported some neurovascular complications related to the trajectory of screw . Heller et al . Reported that biomechanical limitations of lateral mass screwing came from the small amount of bonypurchase availability such as screw loosening or avulsion12,13). Currently, many researchers have introduced a modifiedtrajectory of the lateral mass screw to supplement the limitation of this method . Heller et al . Reported the result of 654 screws inserted in 78 patients12). Complication rates as a function of the number of inserted screws which included nerve root injury, facet violations, vertebral artery injury, broken screw, screw avulsion, and screw looseningwere below 1.1% . The authors had introduced a modified lateral mass screwing method, a reduced sagittal (43.94.5), and a lateral angle of screw(19.63.5) performed with a concept based on magerl's method which resulted in a deeper depth of the screw(13.52.1mm)27). The principle of this technique involved deeper insertion of screws safely while avoiding cord or root violation . This modified from magerl's technique ascertained evidence that our consecutive lateral mass screwing method was safe and efficient . In 50 patients, there were kyphotic changes in 4.0%(2 of 50 cases) and among 323 screws, screw pull - out (4% of 50 cases or 0.9% of total screws), foraminal invasion (1.2% of total screws), and facet injury (0.6% of total screws) occurred . There was no vertebral artery injury on postoperative ct scan or screw loosening on dynamic x - ray follow up . This study showed that lateralmass fixation is a safe and reliable method of posterior stabilization with a modified trajectory of the lateral mass screw . Junctional kyphosis related to the thoracolumbar spinal fusion has been considered a major drawback and has been reported in several studies5,16,25). However, even though there is a long level fusion, posterior lateral mass screw fixation of the cervical spine has a lower rate of junctional problem than that of th elumbar spine . Heller et al . Reported that the adjacent segment degeneration after cervical lateral mass screw fixation was 3.8%13), and lali described the occurrence of adjacent segment degeneration as one in 143 patients (0.6%)22). In the current series, we found that junctional problems in cervical lateral mass fixation occurred at a rate of 4.0% . The main cause of this may be lower motion of the upper - lower lateral mass screw on the cervical spine than that on the lumbar spine or lower weight of loading on the cervical spine than on the lumbar spine . Actually, the modern posterior cervical stabilizing techniques was divided into pedicle screw fixation and lateral mass screw fixation . Pedicle screw fixation of the cervical spine has been considered as an effective procedure for stabilizing unstable spine injury1). Most researchers report a high success rate of stabilization of the cervical spine after pedicle screw fixation however, it also has the potential to injurethe nerve root or vertebral artery and there is a high mal - position rate of screw and therefore, the safety of this technique is still in doubt20,26). For example, the pedicle perforation rate was 6.2%(45 out of 667 screws) and neurovascular complications occurred in two screws . Yoshimoto et al ., yukawa et al ., and kasts et al . Reported the pedicle perforation rates were 11.1%(15 out of 134 screws),14.3%(59 out of 417 screws), and 30%(28 out of 94 screws), respectively, including eight screws with critical breaching2,15,28,29). Lateral mass screw fixation of cervical spine also provides an effective bone fusion for stabilizing unstable spinal injury compared to pedicle screw fixation . They concluded that bone fusion be- tween c1 lateral mass and c2 pedicle screws were achieved in all 319 cases (100%). Liu et al . Reported that 38 consecutive patients with symptomatic anterior cervical pseudarthrosis were managed successfully with posterior lateral mass screw fixation and fusion (100%)18). In our study, kyphosis and/or unsuccessful bone fusion occurred in 6.0% (3 of 50 cases), but did not need further operation . Further, the rate of screw pull - outs was 4.0%(2 of 50 cases, 3 of the 323 screws). Lateral mass screws may be considered a safe and efficient method for stabilization because this method shows a relatively lower complication rate than pedicle screw fixation and there is not much difference between the two with respect to the rate of bone fusion or screw failure (biomechanical stability). We believe that this study has not provided a newer technique for lateral mass screwing as compared to previous method . Therefore, it should include follow - up on both clinical and anatomical bases using cadavers for comparison in future studies . The lateral mass screw insertion and rod fixation by the modified magerl's method (yoon's method) is a safe and reliable technique with low rate of complication related to instruments in minimum 2 years follow - up.
Alcoholic liver - disease patients frequently display evidence of iron overload [15]. Alcohol - induced iron overload enhances the production of free radicals and proinflammatory cytokines [6, 7]. However, the underlying mechanisms of iron accumulation observed in alcoholic liver disease are unclear . We and others have recently shown a role for hepcidin in alcohol - induced increases in iron transport [813]. Hepcidin is a circulatory antimicrobial peptide synthesized by the liver [14, 15]. It plays a pivotal role in iron homeostasis by inhibiting iron uptake in the duodenum and iron export in reticuloendothelial macrophages [16, 17]. Alcohol downregulates hepcidin expression in the liver, which leads to an increase in duodenal iron transporter expression . Bone morphogenetic proteins (bmps) belong to the transforming growth factor beta (tgf-), superfamily of growth factors . Bmp2, bmp4, bmp6 and bmp9 have all been reported to regulate hepcidin transcription [1922]. However, transgenic mouse studies have recently suggested that bmp6, is involved in the regulation of hepcidin expression in vivo [23, 24]. Moreover, iron has been shown to induce bmp6 mrna expression and smad5 phosphorylation [2527]. Similar to tgf- receptor, the binding of bmp ligands to type i and type ii bmp receptor serine / threonine kinases leads to the phosphorylation and activation of type i bmp receptor (bmpr - i). Activated bmpr - i in turn phosphorylates the receptor - regulated smad (r - smad) family of transcription factors: smad1, smad5, and smad8 . On the other hand,, these r - smads form a complex with the common mediator of smad signaling, smad4 . The smad complexes subsequently translocate into the nucleus where they participate in the regulation of gene transcription [30, 31]. Of note, liver - specific disruption of smad4 leads to a decrease in hepcidin expression and accumulation of iron in liver, kidney, and pancreas . The involvement of the profibrogenic cytokine, tgf- in alcohol - induced liver injury has been well - established [33, 34]. However, the role of bmps and bmp receptor - mediated signaling in alcoholic liver disease is largely unknown . In this study, we examine the effect of alcohol on bmp expression and bmp receptor - mediated regulation of hepcidin transcription in the liver in vivo . Alcohol and iron play a synergistic role in the pathogenesis of alcoholic liver disease . These studies will help us to further understand the mechanisms of liver injury induced by iron and alcohol . Animal experiments were approved by the animal ethics committee at the university of nebraska medical center . C57bl/6 ncr male mice (nih) were housed individually and pair - fed with either regular or ethanol - containing lieber de carli liquid diets (dyets, inc ., cat no: 710027, 710260, resp . ), as described previously . The ethanol content of the diet was gradually increased over a 9-day period to 5% (no ethanol for 3 days, 1% for 2 days, 2% for 2 days, and 3% for 2 days). Mice were fed initially with a custom prepared egg - white - based solid rodent diet containing 0.02% carbonyl iron (f614, bio - serv, inc .) For one week to achieve a basal hepcidin expression level . Subsequently, they were fed with 0.2% or 2% carbonyl iron diets for 3 weeks to achieve normal and iron overload states, respectively, as published previously . Rna isolation, cdna synthesis, and quantitative pcr were performed, as published previously . The sequences of taqman fluorescent probe (5 6-[fam]; 3 [tamra - q]) and primers are shown in table 1 . Total liver cell lysates were prepared by homogenizing mouse livers in lysis buffer [10 mm tris / hcl (ph 7.4), 100 mm nacl, 5 mm edta, 10% glycerol, 1 mm pmsf, complete protease inhibitor cocktail (roche diagnostics corp . ), phosphatase inhibitor cocktail a (santa cruz, sc-45044), and 1% triton - x-100]. The lysates were subsequently incubated on ice for 20 min . And centrifuged (3000x g) for 5 min . Western blots were performed, as described previously [12, 36]. Anti - phospho - smad2, anti - phosho - smad1/5, anti - smad2, and anti - smad5 antibodies were obtained commercially (cell signaling). For immunoprecipitations, 500 g of liver lysate protein was incubated with bmpr - i antibody or normal rabbit igg (santa cruz) and protein a / g plus - agarose preblocked with bsa (santa cruz). Immunocomplexes eluted by nonreducing sds buffer were resolved on 10% polyacrylamide gels and immunoblotted with anti - phosphoserine (millipore) or bmpr - i antibodies (santa cruz). Alkaline phosphatase - conjugated anti - mouse (millipore) or anti - rabbit (southernbiotech) light chain - specific immunoglobulins were used as secondary antibodies . Immunostaining of paraffin embedded liver sections with tgf- (abcam) or bmp2 (santo cruz) antibodies were performed by vectastain abc kit (vector labs), according to manufacturer's instructions . Briefly, the consensus and mutant smad4 oligonucleotides (santa cruz) were labeled by t4 polynucleotide kinase and p--atp (perkin elmer, 3.000 ci / mol, 10 mci / ml). 7 g of nuclear extract protein and 100.000 cpm of p - labeled smad probes were used for each binding reaction . Protein and dna complexes were resolved on 7% nondenaturing polyacrylamide gels and radiolabeled bands were visualized by autoradiography . For competition assays, unlabeled consensus smad oligonucleotide in 30-fold excess was incubated with nuclear lysates on ice prior to the addition of the p - labeled consensus smad probe . Chromatin isolated from formalin - fixed mouse liver was sheared by sonication and immunoprecipitated by using control igg (cell signaling) or anti - smad4 antibody (cell signaling) and protein a / g beads (santa cruz). An aliquot of precleared chromatin was saved as total input dna prior to the immunoprecipitation . Coimmunoprecipitated dna and total input dna were analyzed by pcr using primers (forward 5-gccatactgaaggcactga3; reverse 5-gtgtggtggctgtctagg-3) specific for mouse hepcidin promoter . Statistical analysis of differences in treatment groups was performed by using the nonparametric mann - whitney test and student's t - test . In order to study the effect of chronic alcohol consumption on the expression of different bone morphogenetic proteins (bmps) and signaling in the liver, we employed wild - type mice pair - fed with regular (control) or ethanol - containing lieber de carli diets, as described in materials and methods . Mice fed with alcohol for 4 weeks displayed significant lipid accumulation in the liver, compared to control mice fed with regular l. de carli diet, as shown by hematoxylin and eosin staining (figures 1(a) and 1(b)). Similarly, chronic alcohol consumption resulted in increased transforming growth factor beta (tgf-) expression in the liver, as shown by immunostaining and western blotting (figure 2). Tgf- is known to induce the phosphorylation and activation of the transcription factor, smad2 . Accordingly, western blot analysis indicated a significant twofold increase in the level of phospho - smad2 protein expression in the livers of alcohol - fed mice compared to control mice (figures 3(a) and 3(c)). The level of total smad2 protein expression in the liver was not altered by alcohol (figure 3(b)). Bmps also belong to the tgf- superfamily of growth factors and activate the smad signaling pathway . However, the effect of alcohol on bmp expression is unknown . Compared to control mice, mice with chronic alcohol exposure displayed an increase in bmp2, bmp4, and bmp6 mrna expression in the liver (figure 4(a)). However, the median response differences in bmp4 and bmp6 expression between alcohol - fed and control mice were not statistically significant (p> 0.05) (figure 4(a)). In contrast, the alcohol - induced increase in bmp2 mrna expression in the liver was statistically significant (p <0.05) (figure 4(a)). The livers of alcohol - treated mice also exhibited an increase in bmp2 protein expression compared to control mice (figures 4(b) and 4(c)). Mice with chronic alcohol exposure displayed a significant (p <0.05) decrease in hepcidin mrna expression in the liver (figure 5). Bone morphogenetic proteins induce intracellular signaling via the phosphorylation of the transcription factors, smad1, smad5, and smad8 . We performed western blots by using an antibody which recognizes both smad1 and smad5 phosphorylated on serine residues, as described in materials and methods . Unlike smad 2 (see above), our western blot analysis did not detect a significant change in the phosphorylation of smad1 and smad5 proteins in the livers of alcohol - treated mice, compared to the controls (figures 6(a) and 6(c)). Since iron has been reported to induce bmp signaling and smad5 phosphorylation [25, 27], the livers of mice fed with iron diets (see materials and methods) were employed as internal controls . Accordingly, our western blot analysis detected a significant increase in smad1 and smad5 phosphorylation in the livers of mice with iron overload, compared to control mice with a normal iron state (figures 6(a) and 6(c)). The level of total smad5 protein expression in the liver was not altered by alcohol or iron treatments (figure 6(b)). Bone morphogenetic proteins bind to and signal through type i and type ii serine / threonine kinase receptors, bmpr - i and bmpr - ii . Upon ligand binding, bmpr - i is phosphorylated . To determine the activation of bmpr - i, we performed immunoprecipitation experiments followed by western blotting, as described in materials and methods . Bmpr - i immunocomplexes from mouse livers were blotted with an anti - phosphoserine antibody . The level of bmpr - i phosphorylation on serine residues in alcohol - fed mice was not significantly different than that in control mice (figures 7(a) and 7(c)). However, bmpr - i phosphorylation was induced in the livers of mice fed with high iron diets, which were used as internal controls (figures 7(a) and 7(c)). We also confirmed by western blotting that equal levels of bmpr - i protein were immunoprecipitated from the livers of alcohol or iron - treated and control mice (figure 7(b)). Furthermore, control samples, which were immunoprecipitated with normal rabbit igg also showed no significant bmpr - i phosphorylation (figure 7(a)). In order to determine the effect of alcohol on smad4 dna - binding activity in the liver, we performed electromobility shift assays, as described in materials and methods . The dna - binding activity of smad4 in liver nuclear lysates from mice with chronic alcohol exposure was not significantly different than that of control mice (figure 8). However, iron, used as internal control, induced smad dna - binding activity (figure 8). The specificity of dna - binding activity was also confirmed with both competition tests, using unlabeled (cold) smad consensus oligonucleotides, and by employing p - labeled mutant smad oligonucleotide as a probe in gelshift assays, as described in materials and methods (figure 8). In order to determine the effect of chronic alcohol exposure on smad4-mediated transcription of hepcidin, we performed chromatin immunoprecipitation experiments, as described in materials and methods . The binding of smad4 to hepcidin promoter was significantly attenuated in the livers of mice treated with alcohol compared to control mice (figures 9(a) and 9(d)). We have also confirmed that the level of total input dna (see materials and methods) was similar in all samples (figure 9(b)). Furthermore, no significant amplification of hepcidin promoter was observed in chromatin samples, which were immunoprecipitated with the control igg (figure 9(c)). Hepcidin, mainly synthesized in the liver, is the key regulator of iron homeostasis and its expression is also regulated by iron . Alcohol has been shown to suppress hepcidin transcription in the liver leading to elevated iron absorption in the duodenum [911, 13]. However, how alcohol attenuates liver hepcidin transcription and function is not completely understood . Various signaling mechanisms including bmp - mediated smad signaling are involved in the regulation of hepcidin transcription in the liver [2325, 27]. The deletion of smad4 in the liver also attenuates hepcidin expression and causes pronounced hepatic iron accumulation in mice . Tgf- is one of the main profibrogenic cytokines, which is involved in the progression of alcoholic liver disease [33, 34, 38]., we show that alcohol significantly induces the expression of bmp2 in the liver in vivo . Although alcohol is known to alter iron homeostasis [3, 5, 39], unlike iron [25, 27], chronic alcohol exposure did not significantly upregulate the expression of bmp6 in the liver . Ligand binding induces the phosphorylation of type i bmp receptor (bmpr - i). Upon phosphorylation, bmpr - i stimulates bmp signaling by phosphorylating smad1, smad5, and smad8 . Interestingly, despite an alcohol - induced increase in bmp expression, the phosphorylation of smad1 and smad5 was not elevated in the livers of mice with chronic alcohol exposure . It is feasible that alcohol - mediated inhibition of bmp - mediated smad signaling may occur in proximity to the cell surface . Our immunoprecipitation studies clearly demonstrate a lack of bmpr - i phosphorylation in the livers of mice with chronic alcohol exposure . The specificity of immune complexes was confirmed by employing control antibodies and igg light - chain - specific secondary antibodies for western blotting (see figure 7). Furthermore, we have also confirmed that iron, as an internal control, upregulates the phosphorylation of both bmpr - i, and smad1 and smad5 proteins . Of note, we have previously reported that alcohol renders hepcidin insensitive to body iron levels and abolishes its protective role in iron overload . However, whether or not alcohol interferes with iron - mediated activation of hepcidin transcription via bmp / smad signaling in the liver warrants further investigation . The inhibition of bmp receptor activation and signaling by alcohol may involve various mechanisms . Alcohol metabolism is well known to increase the nadh: nad ratio and induce hypoxia in the liver . Accordingly, hypoxia has recently been suggested to inhibit hepcidin expression by attenuating smad signaling in human huh7 hepatoma cells . Furthermore, hypoxia - induced changes in the nadh: nad ratio have been reported to attenuate bmp receptor activation in lung cells . However, it should be noted that alcohol - induced hypoxia is limited to the centrilobular region of the liver . It is therefore possible that other mechanisms besides hypoxia may be involved in alcohol - induced inhibition of bmp - mediated smad signaling in the liver . For example, changes in inhibitory smads or a competition between r - smads activated by tgf- (smad2, smad3) and bmps (smad1, smad5, and smad8). Of note, tgf- receptor has been reported to interact with bmpr - i and inhibit bmp - mediated smad signaling . Accordingly, we have observed the activation of smad2, but not of smad1 or smad5, in the livers of mice with chronic alcohol exposure . Nevertheless, our findings showing alcohol - induced inhibition of smad dna - binding activity and the binding of smad4 to hepcidin promoter strongly suggest that alcohol can directly interfere with nuclear smad dna complexes . The regulation of smad signaling complexes by alcohol may therefore be one of the mechanisms by which alcohol suppresses hepcidin transcription in the liver in vivo . Alcohol metabolism in the liver produces toxic metabolites, such as acetaldehyde and lipid peroxidation products [45, 46]. They, in turn, activate tgf- production and lead to the secretion of extracellular matrix proteins . Bmps have been reported to interact with and antagonize tgf- blocking its profibrogenic activity [47, 48]. By blocking tgf-, bmps can also modulate cell adhesion and migration [49, 50]. It is therefore possible that the induction of bmp expression in the liver in response to chronic alcohol exposure is associated with antifibrogenic response mechanisms . Furthermore, the inverse effect of alcohol on tgf- and bmp - mediated smad signaling may be one of the mechanisms involved in the progression of liver fibrosis in alcoholic liver disease . The alcohol - induced inhibition of smad4 binding to hepcidin promoter and suppression of hepcidin transcription in the liver is expected to gradually elevate intestinal iron uptake and iron storage in kupffer cells . Accordingly, we have previously reported the elevation of hepatic iron levels in rats with chronic alcohol exposure . Iron and alcohol are known to act synergistically to induce liver injury [5153]. Interestingly, the inhibition of bmp signaling has also been reported in hfe knockout mice, an animal model for the commonest iron overload disorder, genetic hemochromatosis [54, 55]. This study therefore indicates a role for smad signaling in the regulation of iron metabolism by alcohol, which may have implications for alcoholic liver disease and also genetic hemochromatosis in conjunction with alcohol . Bone morphogenetic protein signaling has recently been shown to induce hepcidin transcription in the liver . Bmp and tgf- both belong to the same family of growth factors and stimulate the smad signaling pathway . Alcohol is known to induce tgf- expression, which plays a role in liver fibrinogenesis, whereas the effect of alcohol on bmp signaling is unknown . Here, we show that similar to tgf-, bmp protein expression was also upregulated in the liver . However, alcohol exerted different effects on tgf--mediated smad2 activation and bmp - mediated smad1 and smad5 activation . The inhibitory effect of alcohol on bmp - mediated smad signaling may occur in proximity to the cell surface by interfering with the activation of bmp receptor type i. this subsequently resulted in the inhibition of smad4 binding to hepcidin promoter in the livers of mice with chronic alcohol exposure . Collectively, these findings strongly suggest that the simultaneous inhibition of bmp - mediated smad activation and stimulation of tgf--mediated smad activation by alcohol may be involved in the suppression of liver hepcidin transcription and deregulation of iron metabolism by alcohol in vivo . Further understanding of the role of alcohol in smad signaling and hepcidin transcription will help to elucidate the mechanisms of liver injury observed in patients with alcoholic liver disease or with genetic hemochromatosis and alcohol abuse.
The goals of total knee arthroplasty (tka) are to relieve pain, maintain knee function and kinematics, and restore stability and range of motion (rom) to facilitate daily activities . Of these, restoration of rom has been considered important especially in eastern countries where high flexion is required for religious and social activities . Factors that can be associated with rom include the cause of disease, preoperative joint deformity and rom, age, gender, surgical technique, implant fixation strength, postoperative rehabilitation, and implant design1). Since first introduced in tka for optimal component positioning and lower limb alignment, navigation systems have been improved with rapid development of computer technology to allow for soft tissue balancing and flexion - extension gap balancing, and accordingly have contributed to the accuracy of tka2). In this study, we analyzed the results of high flexion tka using one of the most recently developed navigation systems, the electromagnetic navigation system, to compare the influence of two different implant designs (mobile - bearing and fixed bearing designs) on rom including maximal flexion angle and clinical and radiographic results . The mobile - bearing implant used was nexgen lps - flex mobile knee (nexgen, legacy posterior - stabilized flexion mobile, zimmer, warsaw, in, usa) whereas the fixed - bearing implant was nexgen lps - flex fixed knee (nexgen, legacy posterior - stabilized flexion fixed, zimmer). Of the patients that had undergone tka by the same surgeon between january 2010 and june 2010 at our institution, 67 patients with a minimum follow - up of one year were randomly selected for this study . The implants used were the lps - flex mobile knee in 32 patients and lps - flex fixed knee in 34 patients . In six of the patients with bilateral tka, the mobile - bearing prosthesis was used on one side and the fixed - bearing on the other side . In all patients, an electromagnetic navigation system (zimmer computer assisted solutions electromagnetic quad - sparing) was used . The mean follow - up period was 14.5 months (range, 12 to 18 months) and the mean age of the patients was 67.5 years (range, 60 to 78 years) in the mobile - bearing group and 68.5 years (range, 61 to 77 years) in the fixed - bearing group . The mean preoperative rom was 118 in both groups and no notable intergroup difference could be found regarding flexion contracture (table 1). Considering that the preoperative rom could affect the postoperative rom3,4), we excluded patients who had 90 of rom preoperatively . There were no particular instructions for knee flexion exercises and the same rehabilitation protocol was prescribed in both groups . The clinical results were graded according to the knee society knee score (ksks) and knee society functional score (ksfs). Patient satisfaction and preference were assessed according to the western ontario and mcmaster universities arthritis index (womac) score5), a questionnaire for measuring pain, stiffness, and function . Postoperative pain was evaluated using the visual analog scale (vas). A patient's ability to kneel and sit cross - legged was assessed through interview or observation during follow - up . Physical examination and goniometric measurement however, we used a radiographic measurement method devised by edwards et al.6) to reduce measurement errors and increase reproducibility . We measured the angle formed by lines drawn down the mid - shafts of the tibia and femur on the lateral radiographs taken with the knee in full extension and full flexion preoperatively, as well as at the final follow - up (fig . Radiographic assessment was done by the same surgeon three times per patient and the mean value was used for analysis . The mechanical axis deviation was measured as the difference in the angle between the femoral mechanical axis and the tibial mechanical axis on the weight bearing long leg anteroposterior radiographs taken preoperatively and postoperatively . The femoral and tibial component positions in the sagittal and coronal planes were assessed using the method of seon and song7). The coronal inclination of the femoral component was measured as the medial angle between the mechanical axis and the bottom of the component on the anteroposterior radiographs and the sagittal inclination as the angle with the femoral shaft on the lateral views . The desired sagittal inclination was defined as 90. the coronal and sagittal tibial component positions were assessed in a similar manner . The bisecting line of the tibial shaft was used as a reference for sagittal tibial component positioning . The desired tibial component inclination was defined as 90 in the coronal plane and 86o in the sagittal plane (fig . All the operations were performed by the same surgeon using a medial parapatella approach . To increase articulation curvature during flexion, an additional 2 mm posterior femoral bone cut was performed . The anterior portion of the tibial component was removed to avoid interference with the patella and the posterior cam mechanism was modified to facilitate high flexion . The preoperative and postoperative mechanical axes and extent of bone resection could be evaluated using an electromagnetic navigation system in all cases . In particular, varus / valgus femoral resection, degree of flexion / extension, varus / valgus tibial resection, and posterior tilt could be assessed in real time during bone resection of the distal femur and the proximal tibia by placing a paddle on the resection surface (fig . 3). After bone resection, lower limb alignment was assessed using the navigation system with a temporary implant or an inserted spacer . After implant fixation, the alignment was evaluated and corrected intraoperatively if needed . For the lps - flex mobile bearing knee, any osteophytes that could cause soft tissue tension were thoroughly removed and subperiosteal release of the medial and lateral collateral ligaments at their insertion sites was performed . Flexion / extension gaps were measured intraoperatively using a gapper in several trial tests to confirm mediolateral stability prior to soft tissue balancing . For the lps - flex mobile bearing knee, tibial resection preceded femoral resection, whereas it was vice versa for the lps - flex fixed bearing knee ., active joint movement exercises were performed in tandem with passive exercises using cpm devices to facilitate rapid rom recovery . Ksks, ksfs, womac score, vas for pain, and rom and maximal flexion angle before surgery and at the last follow - up were analyzed using an independent sample t - test . Patient ability to kneel and sit cross - legged was assessed using the chi - square test . Of the patients that had undergone tka by the same surgeon between january 2010 and june 2010 at our institution, 67 patients with a minimum follow - up of one year were randomly selected for this study . The implants used were the lps - flex mobile knee in 32 patients and lps - flex fixed knee in 34 patients . In six of the patients with bilateral tka, the mobile - bearing prosthesis was used on one side and the fixed - bearing on the other side . In all patients, an electromagnetic navigation system (zimmer computer assisted solutions electromagnetic quad - sparing) was used . The mean follow - up period was 14.5 months (range, 12 to 18 months) and the mean age of the patients was 67.5 years (range, 60 to 78 years) in the mobile - bearing group and 68.5 years (range, 61 to 77 years) in the fixed - bearing group . The mean preoperative rom was 118 in both groups and no notable intergroup difference could be found regarding flexion contracture (table 1). Considering that the preoperative rom could affect the postoperative rom3,4), we excluded patients who had 90 of rom preoperatively . There were no particular instructions for knee flexion exercises and the same rehabilitation protocol was prescribed in both groups . The clinical results were graded according to the knee society knee score (ksks) and knee society functional score (ksfs). Patient satisfaction and preference were assessed according to the western ontario and mcmaster universities arthritis index (womac) score5), a questionnaire for measuring pain, stiffness, and function . A patient's ability to kneel and sit cross - legged was assessed through interview or observation during follow - up . Physical examination and goniometric measurement however, we used a radiographic measurement method devised by edwards et al.6) to reduce measurement errors and increase reproducibility . We measured the angle formed by lines drawn down the mid - shafts of the tibia and femur on the lateral radiographs taken with the knee in full extension and full flexion preoperatively, as well as at the final follow - up (fig . Radiographic assessment was done by the same surgeon three times per patient and the mean value was used for analysis . The mechanical axis deviation was measured as the difference in the angle between the femoral mechanical axis and the tibial mechanical axis on the weight bearing long leg anteroposterior radiographs taken preoperatively and postoperatively . The femoral and tibial component positions in the sagittal and coronal planes were assessed using the method of seon and song7). The coronal inclination of the femoral component was measured as the medial angle between the mechanical axis and the bottom of the component on the anteroposterior radiographs and the sagittal inclination as the angle with the femoral shaft on the lateral views . The desired sagittal inclination was defined as 90. the coronal and sagittal tibial component positions were assessed in a similar manner . The bisecting line of the tibial shaft was used as a reference for sagittal tibial component positioning . The desired tibial component inclination was defined as 90 in the coronal plane and 86o in the sagittal plane (fig . All the operations were performed by the same surgeon using a medial parapatella approach . To increase articulation curvature during flexion the anterior portion of the tibial component was removed to avoid interference with the patella and the posterior cam mechanism was modified to facilitate high flexion . The preoperative and postoperative mechanical axes and extent of bone resection could be evaluated using an electromagnetic navigation system in all cases . In particular, varus / valgus femoral resection, degree of flexion / extension, varus / valgus tibial resection, and posterior tilt could be assessed in real time during bone resection of the distal femur and the proximal tibia by placing a paddle on the resection surface (fig . Lower limb alignment was assessed using the navigation system with a temporary implant or an inserted spacer . After implant fixation, the alignment was evaluated and corrected intraoperatively if needed . For the lps - flex mobile bearing knee, any osteophytes that could cause soft tissue tension were thoroughly removed and subperiosteal release of the medial and lateral collateral ligaments at their insertion sites was performed . Flexion / extension gaps were measured intraoperatively using a gapper in several trial tests to confirm mediolateral stability prior to soft tissue balancing . For the lps - flex mobile bearing knee, tibial resection preceded femoral resection, whereas it was vice versa for the lps - flex fixed bearing knee ., active joint movement exercises were performed in tandem with passive exercises using cpm devices to facilitate rapid rom recovery . Ksks, ksfs, womac score, vas for pain, and rom and maximal flexion angle before surgery and at the last follow - up were analyzed using an independent sample t - test . Patient ability to kneel and sit cross - legged was assessed using the chi - square test . There were no statistically significant intergroup differences in the ksks and ksfs (p>0.05). In the mobile - bearing group, the mean ksks and ksfs increased from 48.2 (48.26.4) preoperatively to 94.5 (94.53.2) at the last follow - up and from 45.3 (45.35.8) preoperatively to 93.8 (93.82.8) at the last follow - up, respectively . In the fixed - bearing group, the mean ksks and ksfs increased from 49.5 (49.55.6) preoperatively to 95.1 (95.12.8) at the last follow - up and from 46.9 (46.95.9) preoperatively to 94.2 (94.23.0) at the last follow - up (p>0.05). The mean womac score decreased in both groups, from 81.0 (81.05.5) preoperatively to 14.5 (14.51.6) at the last follow - up in the mobile - bearing group and from 82.5 (82.56.0) preoperatively to 15.2 (15.21.8) at the last follow - up in the fixed - bearing group (p>0.05). There were no notable intergroup differences in the mean vas pain score (p>0.05) (table 2). The mean vas pain score improved from 7.8 (7.81.6) preoperatively to 1.5 (1.50.6) at the last follow - up in the mobile - bearing group and from 7.6 (7.61.5) preoperatively to 1.4 (1.40.5) at the last follow - up in the fixed - bearing group . Significant intergroup differences were not identified in the ability to kneel and sit cross - legged through observation or interview during the follow - up (p>0.05) (table 3). Kneeling and cross - legged sitting was possible in 22 and 28 cases, respectively, in the mobile bearing group (n=32) and in 24 and 29 cases, respectively, in the fixed - bearing group (n=34). No remarkable intergroup differences were noted in patients with 130 maximal flexion angle (high flexion) (p>0.05) (table 4). The number of patients with 130 maximal flexion angle was 18 in the mobile - bearing group and 19 in the fixed - bearing group . Kneeling and cross - legged sitting was possible in 15 and 18 cases, respectively, in patients with high flexion in the mobile - bearing group and in 16 and 18 cases, respectively, in patients with high flexion in the fixed - bearing group . On the lower limb alignment, the mechanical axis deviation was more varus in the fixed - bearing group (0.91.1) than in the mobile - bearing group (0.71.0), but there was no significant difference between the groups . The coronal inclination of femoral component coronal and tibial component was 89.32.8 and 89.81.0, respectively, in the fixed - bearing group and 89.63.2 and 89.31.2, respectively, in the mobile - bearing group . The sagittal inclination of femoral component and tibial component was 88.51.5 and 86.61.4 in the fixed - bearing group and 88.51.8 and 86.22.0 in the mobile - bearing group . Thus, the coronal and sagittal implant positioning was satisfactory in both groups, which showed no significant intergroup differences (tables 5, 6). There were no statistically significant intergroup differences in rom and maximal flexion angle (p>0.05). The mean rom increased from 118.5 (118.55.8) preoperatively to 130.0 (130.03.8) at the last follow - up in the mobile - bearing group and from 118.0 (118.05.2) preoperatively to 129.5 (129.54.0) at the last follow - up in the fixed - bearing group . The mean maximal flexion angle increased from 122.0 (122.05.2) preoperatively to 131.1 (131.13.6) at the last follow - up in the mobile - bearing group and from 121.8 (121.85.0) preoperatively to 130.8 (130.83.3) at the last follow - up in the fixed - bearing group (p>0.05) (table 7) (figs . 4, 5). Polyethylene component wear, posterior instability, component loosening, or infection was not observed in any of the patients during the 1 year follow - up period . Complications requiring revision surgery were not noted during the short - term follow - up period . There were no statistically significant intergroup differences in the ksks and ksfs (p>0.05). In the mobile - bearing group, the mean ksks and ksfs increased from 48.2 (48.26.4) preoperatively to 94.5 (94.53.2) at the last follow - up and from 45.3 (45.35.8) preoperatively to 93.8 (93.82.8) at the last follow - up, respectively . In the fixed - bearing group, the mean ksks and ksfs increased from 49.5 (49.55.6) preoperatively to 95.1 (95.12.8) at the last follow - up and from 46.9 (46.95.9) preoperatively to 94.2 (94.23.0) at the last follow - up (p>0.05). The mean womac score decreased in both groups, from 81.0 (81.05.5) preoperatively to 14.5 (14.51.6) at the last follow - up in the mobile - bearing group and from 82.5 (82.56.0) preoperatively to 15.2 (15.21.8) at the last follow - up in the fixed - bearing group (p>0.05). There were no notable intergroup differences in the mean vas pain score (p>0.05) (table 2). The mean vas pain score improved from 7.8 (7.81.6) preoperatively to 1.5 (1.50.6) at the last follow - up in the mobile - bearing group and from 7.6 (7.61.5) preoperatively to 1.4 (1.40.5) at the last follow - up in the fixed - bearing group . Significant intergroup differences were not identified in the ability to kneel and sit cross - legged through observation or interview during the follow - up (p>0.05) (table 3). Kneeling and cross - legged sitting was possible in 22 and 28 cases, respectively, in the mobile bearing group (n=32) and in 24 and 29 cases, respectively, in the fixed - bearing group (n=34). No remarkable intergroup differences were noted in patients with 130 maximal flexion angle (high flexion) (p>0.05) (table 4). The number of patients with 130 maximal flexion angle was 18 in the mobile - bearing group and 19 in the fixed - bearing group . Kneeling and cross - legged sitting was possible in 15 and 18 cases, respectively, in patients with high flexion in the mobile - bearing group and in 16 and 18 cases, respectively, in patients with high flexion in the fixed - bearing group . On the lower limb alignment, the mechanical axis deviation was more varus in the fixed - bearing group (0.91.1) than in the mobile - bearing group (0.71.0), but there was no significant difference between the groups . The coronal inclination of femoral component coronal and tibial component was 89.32.8 and 89.81.0, respectively, in the fixed - bearing group and 89.63.2 and 89.31.2, respectively, in the mobile - bearing group . The sagittal inclination of femoral component and tibial component was 88.51.5 and 86.61.4 in the fixed - bearing group and 88.51.8 and 86.22.0 in the mobile - bearing group . Thus, the coronal and sagittal implant positioning was satisfactory in both groups, which showed no significant intergroup differences (tables 5, 6). There were no statistically significant intergroup differences in rom and maximal flexion angle (p>0.05). The mean rom increased from 118.5 (118.55.8) preoperatively to 130.0 (130.03.8) at the last follow - up in the mobile - bearing group and from 118.0 (118.05.2) preoperatively to 129.5 (129.54.0) at the last follow - up in the fixed - bearing group . The mean maximal flexion angle increased from 122.0 (122.05.2) preoperatively to 131.1 (131.13.6) at the last follow - up in the mobile - bearing group and from 121.8 (121.85.0) preoperatively to 130.8 (130.83.3) at the last follow - up in the fixed - bearing group (p>0.05) (table 7) (figs . 4, 5). Polyethylene component wear, posterior instability, component loosening, or infection was not observed in any of the patients during the 1 year follow - up period . Complications requiring revision surgery were not noted during the short - term follow - up period . The primary goal of tka is to alleviate pain but it is more favorable to restore normal knee function8). Postoperative rom is especially important for asian patients who frequently squat or sit in a cross - legged position9). Goodfellow and o'connor10) introduced a mobile - bearing knee system in 1976 to address component loosening and wear, the two most common issues of tka . The mechanism that hinders knee flexion remains unclear, but the ability to restore posterior femoral translation has been considered crucial for improving range of flexion after tka11,12). A decrease in posterior femoral translation causes impingement of the posterior edge of the tibial component on the femoral shaft, thus constraining flexion motion11 - 13). High flexion knee system was designed to increase posterior femoral translation for high flexion12,13). We used the high - flexion lps - flex total knee system in this study . An additional 2 mm posterior femoral bone resection was performed to extend the posterior condyle of the femoral component by 2 mm and increase the articular contact area and thus posterior femoral translation for high flexion . In addition, the stress on the polyethylene implant was reduced, which contributed to the low incidence of component wearing . The lps - flex mobile system is a mobile bearing implant designed to allow for a total of 50 of axial rotation (internal rotation, 25 and external rotation, 25) of the polyethylene insert in the tibial component during knee flexion . Therefore, we used a technique similar to the' gap technique' for soft tissue balancing in the mobile - bearing group: after tibial resection, internal / external stability was confirmed by measuring the flexion / extension gaps in several trial tests . In contrast,' measured resection technique' where femoral resection precedes tibial resection, was used in the fixed - bearing group . In our opinion, comparisons of the postoperative lower limb alignment and coronal / sagittal implant positions between the groups should be performed in further studies . Therefore, a range of errors could be identified at every step of the surgery and the surgeon could give real time feedback based on surgical experience and intraoperative data to achieve ideal values14). There are many studies showing that navigation - assisted tka produces more satisfactory results than the established tka in terms of implant positioning and lower limb alignment that are associated with long - term longevity15 - 18). Mobile - bearing knee prostheses are more effective in reducing fatigue wear because the enlarged contact surface causes less stresses compared to fixed - bearing ones19) and in lowering stresses on the bone - implant interface and risk of loosening, which potentially increases implant longevity10,20). Another advantage is that the motion between the tibial component and the polyethylene insert can be adjusted to minimize backside wear21). Clinical results of tka using mobile - bearing and fixed - bearing implants have been addressed in various studies . Woolson et al.22) reported that there were no significant differences between the mobile - bearing implant group (57 cases) and fixed - bearing implant group (45 cases) in terms of the ksks, ksfs, pain score, and postoperative flexion angle . Ranawat et al.23) used mobile - bearing and fixed - bearing implants during tka in 26 patients and found no notable differences between the two implants in terms of the ksks and ksfs, postoperative rom and maximal flexion angle, knee pain, and patient satisfaction . Lampe et al.24) used navigation in 52 cases of mobile - bearing knee replacement and 48 cases of fixed - bearing knee replacement . At 2 years postoperatively, no significant differences were noted in the ksks and ksfs, oxford knee score, and rom . Kim et al.25) performed 116 cases of bilateral tkas using a mobile - bearing implant and a fixed - bearing implant on each side and found no significant differences between the two types of implants in terms of the rom, ksks, pain score, patient satisfaction, and polyethylene wear . In contrast, price et al.26) reported that the ksks and pain score at 1 year after surgery were higher, albeit slightly, in the mobile - bearing group although the rom was similar between the groups with 105.3. luring et al.27) reported that the mediolateral stability was higher in the mobile - bearing group after pcl retaining tka . Sohn et al.28) followed 32 patients that underwent bilateral tka using a mobile - bearing implant and a fixed - bearing implant on each side and noted that the postoperative subjective satisfaction and preference evaluated using the womac score was higher in the mobile - bearing group although the two implants did not result in differences in the ksks, ksfs, and postoperative rom . In this study, significant intergroup differences were not observed in the ksks and ksfs, womac score, rom and maximal flexion angle, and possibility of kneeling and sitting cross - legged (p>0.05). The radiographic results showed that there were no notable intergroup differences in the postoperative mechanical axis deviation and the femoral and tibial component positions in the sagittal and coronal planes (p>0.05). However, we think these results should be confirmed by further studies with longer follow - up periods . The clinical results of high - flexion tka were satisfactory in both the mobile - bearing and fixed - bearing group . There were no significant intergroup differences regarding the clinical results (kss, ksfs, and womac score), radiological results (rom and maximal flexion angle), and possibility of kneeling and sitting cross - legged . However, these results should be verified in long - term follow - up studies that address the longevity of the implants.
In this paper i summarize our recent investigations (park and kim, phys chem c 111:14903, 2007; solid state ionics 179:1329, 2008) on the origin of the grain - boundary resistance in a doped lagao3, a perovskite - structured solid electrolyte . The partial electronic and ionic resistances of the bulk and the grain boundaries, as well as the total resistance, in 1 mol% sr - doped lagao3 were measured separately by means of a dc - polarization method and ac - impedance spectroscopy . Both of the partial resistances at the grain boundaries were greater than the bulk counterparts, indicating that the grain boundaries impede the ionic as well as the electronic transport in this material . The transference number of the partial electronic conductivity at the grain boundary was however greater than that in the bulk . This fact strongly suggests that both electronic and ionic charge carriers deplete at the grain boundaries to form the space - charge zones and that the grain - boundary cores in this material are positively charged . In light of the fact that the effective charge of the oxygen vacancy (+ 2) is greater than that of the electron hole (+ 1), the oxygen vacancies deplete more sharply in the space - charge zones compared to the electron holes such that the grain boundaries become more mixed conducting relative to the bulk . These observations verify that the electrical conduction across the grain - boundaries in 1 mol% sr - doped lagao3 is governed by the space charge . The physical behavior of grain boundaries (i.e., interfaces between crystallites, namely grains, in polycrystalline ceramics) differs from that of the bulk due to their structural deviation from the crystal interior . In the past decade, the electrical nature of grain boundaries relative to the bulk has attracted considerable attention as size effects on the conductivity have become one of the main foci of research interest, particularly in the field of solid state ionics . Reducing the size of the grains enhances the geometric contribution of the grain boundaries to the total volume of the polycrystalline ceramic such that the overall electrical properties may be governed by the property associated with the grain boundaries when the grain size is sufficiently small (typically less than few tens of nanometers). The overall conductivity of a material with a higher density of grain boundaries can then be enhanced if the grain boundaries serve as highly conducting paths . Solid electrolytes (ses) are virtually pure ionic conductors that serve as a key component in electrochemical devices such as solid oxide fuel cells (sofcs) [3, 4]. Among them, doped zirconia and ceria, fast oxygen - ionic conductors with a fluorite structure, have almost exclusively been employed as ses for sofc applications owing to their relatively high ionic conductivity at elevated temperatures [24]. However, these ses present sufficiently high ionic conductivity only at very high temperatures, leading to the high operating temperature (> 800 c) of the sofcs . It is desirable to lower the operating temperature down to the intermediate temperature (it) range (500700 c or even less) to ameliorate the problems associated with high - temperature operation, such as long - term durability of the cells and cost . Lower - temperature operation, on the other hand, requires enhanced conductance in the ses . Nanocrystalline ses have been the center of attention for over a decade owing to their potential for use in the it - sofcs . However, it was found that the grain boundaries in fluorite - structured ses inherently rather impede oxygen - ionic transport in the materials, and this issue worsens at lower temperatures . Hence, the electrical nature of the grain boundaries in those ses has been intensively explored during the past decade and the intrinsic origins of the grain boundary resistance are now relatively well understood [59]: at the grain boundaries, the oxygen vacancies (vo) deplete to form space - charge zones [10, 11] in the vicinity of the grain - boundary core, leading to high resistance to oxygen - ionic transport across them . The excess positive charge formed in the grain - boundary core is responsible for the depletion of vo in the space - charge zones . Doped lagao3 is a perovskite - structured oxygen - ionic conductor that presents a conductivity higher than the conductivities of the fluorite - structured ses at lower temperatures, and is thus considered a se for it - sofc applications . However, the electrical nature of the grain boundaries in this se resembles that in fluorite - structured ses in that the grain boundaries block the oxygen - ionic transport . In view of the relatively recent discovery of this se, research on it has focused almost exclusively on its bulk properties, while little attention has been paid to the grain boundaries to date . The chief question about the blocking nature of the grain boundaries in this perovskite - structured se is whether the intrinsic cause of the grain - boundary resistance is the space charge, as seen in the fluorite - structured ses . In this contribution i summarize our recent investigations [13, 14] on the influence of the space - charge effects on the grain - boundary conduction in 1 mol% sr - doped lagao3 (lsgo), which we selected as a model system . As will be presented below, the results obtained from dc - polarization and ac - impedance measurements clearly demonstrate that both vo and the electron holes (h) (i.e., the majority charge carriers in lsgo at the oxygen partial pressure, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$p_{{{\text{o}}_{2}}} $$\end{document}, of concern) deplete at the grain boundaries to form space - charge zones, leading to grain boundaries with high resistance to both ionic and the electronic transport across them . Figure 1 shows a high - resolution transmission electron microscope (hr - tem) image of dense (> 95%) lsgo used for electrical measurements . The grain boundaries appear to be free of pores as well as insulating amorphous phases which are often responsible for the high resistance to the ionic current at the grain boundaries observed in impure ses . The ca and si contents (typical sources of the amorphous phases) in the sample, measured using an inductively coupled plasma (icp) technique, were below the detection limit (100 ppm), consistent with the tem results.fig . 1a representative hr - tem image of a dense (> 95%) lsgo ceramic prepared for electrical measurements . The grain size is ~5 m . The scale bar indicates 5 nm a representative hr - tem image of a dense (> 95%) lsgo ceramic prepared for electrical measurements . The grain size is ~5 m . The scale bar indicates 5 nm the resistances under different \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$p_{{{\text{o}}_{2}}} $$\end{document} in lsgo were measured using both ac - impedance spectroscopy and a dc - measurement technique . The advantage of the ac over the dc measurements is that the ac technique allows one to measure the local resistance (e.g., in the bulk and the grain boundary) separately . Figure 2 shows an ac - impedance spectrum (i.e., a nyquist plot) measured from lsgo in o2 at 400 c (see red symbols), which consists of a relatively tiny (see also the inset in fig . 2) arc that appears at higher frequencies and a large semicircular arc that subsequently appears at lower frequencies of concern (namely arc 1 and arc 2, respectively). The best fits for arcs 1 and 2 using an equivalent circuit consisting of two parallel rq elements in series [i.e., (r1q1)(r2q2) where r and q denote resistance and a constant - phase element, respectively] are indicated as solid lines in fig . 2 . The dielectric constant of ~30 at 400 c estimated from c1 (= (r11nq1)) agrees well with that of pure lagao3 (~25), suggesting that arcs 1 and 2 represent the bulk and the grain boundaries, respectively, as usual . (figure 2 also shows an indication of a third arc, corresponding to the electrode resistance, which appears at at even lower frequency range than the frequency range of concern in this study; however, a discussion of the electrode resistance is beyond the scope of this paper .) Note that the grain boundaries are almost exclusively responsible for the overall resistance in lsgo at 400 c . 2nyquist plots measured from lsco under o2 (red symbols) and n2 (blue symbols) at 400 c . The solid lines indicate the best fits obtained using an equivalent circuit consisting of two parallel rq elements nyquist plots measured from lsco under o2 (red symbols) and n2 (blue symbols) at 400 c . The solid lines indicate the best fits obtained using an equivalent circuit consisting of two parallel rq elements it is interesting to note that arc 2 varies with varying ambient \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$p_{{{\text{o}}_{2}}} $$\end{document}, while arc 1 remains unchanged . As mentioned above, the majority ionic and electronic charge carriers in lsgo under oxidizing conditions (e.g., under o2) are vo and h, respectively . If electric conduction in lsgo is predominantly controlled by vo, the resistance should be independent of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$p_{{{\text{o}}_{2}}} $$\end{document} since the number of vo in the material is determined by the amont of dopant . Hence, the fact that only the grain - boundary resistance depends on the ambient \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$p_{{{\text{o}}_{2}}} $$\end{document} implies that the electronic contribution to grain - boundary conduction is greater than that the electronic contribution to the bulk conduction . In other words, the electronic transference number (tj = j/kk) at the grain boundaries (tel, gb) is greater than that in the bulk (tel,). According to eq . 1, at equilibrium, the local concentration of defect j in the vicinity of the grain - boundary core is determined by the electrical potential of the grain - boundary core:1\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\left ({\frac{{c_{j} (x)}}{{c_{j\infty}}}} \right)^{{1/z_{j}}} = \exp \left ({- \frac{e}{{k_{b} t}}\updelta \phi (x)} \right) $$\end{document}where (x) is the electrical potential relative to the bulk (subscript; i.e., (x) = (x) ()). The symbols z, e, kb and t denote the charge number, elementary charge, boltzmann s constant and temperature, respectively . Both vo and h thus deplete in the vicinity of the grain - boundary core to form space - charge zones if (0)> 0 . Furthermore, vo should deplete more sharply than h (see eq . 1), as illustrated qualitatively in fig . 3, since the effective charge of vo (+ 2) is greater than that of h (+ 1), leading to a greater tel, gb than tel,. Therefore, fig . 2 strongly suggests that the grain - boundary conduction in lsgo is controlled by the space charge . In order to verify this speculation, one should measure the partial ionic and electronic conductivities at the grain boundaries and in the bulk separately to check whether tel, gb is in fact greater than tel,.fig . 3concentration profiles (qualitative) of the dopant (sr), oxygen vacancies (vo) and electron holes (h) at grain boundaries in lsgo as expected from a space - charge model when (0)> 0 . Note that t el, gb is greater than t el, concentration profiles (qualitative) of the dopant (sr), oxygen vacancies (vo) and electron holes (h) at grain boundaries in lsgo as expected from a space - charge model when (0)> 0 . Note that t el, gb is greater than t el, figure 4 presents the current (i)voltage (u) characteristics measured from an ion - blocking dc - polarization cell (see the inset in fig . Dc - polarization methods [16, 17] are considered to be one of the most effective means to measure the partial conductivities separately . Prior to measuring the i u characteristics, the ion - blocking cell was polarized at a constant applied voltage of 5 mv . During polarization, the initial current (~155 na) rapidly dropped to reach an equilibrium value of 30 na within 1000 s. this fact ensures that the ionic current is effectively blocked at the ion - blocking electrode . Figure 4 shows that the current linearly increases with increasing applied voltage up to ~25 mv and then starts to deviate from linear behavior to show the characteristic nonlinear i u relation for a blocking cell as the voltage further increases . In light of the fact that the concentration of electrons in lsgo in the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$p_{{{\text{o}}_{2}}} $$\end{document} range of concern is negligibly small compared to that of h (i.e., h is almost exclusively responsible for the electronic current in lsgo, if not entirely), one can estimate the partial electronic conductivity (el = 1/rel(d / a), where d and a are the distance between the electrodes and the area of the electrode, and r denotes resistance) by directly measuring rel in the ohmic region (<25 mv).fig . 4the current (i)voltage (u) characteristics measured from an ion - blocking dc - polarization cell . The inset in the upper - left corner shows a schematic diagram of the cell . The reversible electrode was exposed to air the current (i)voltage (u) characteristics measured from an ion - blocking dc - polarization cell . The inset in the upper - left corner shows a schematic diagram of the cell . The reversible electrode was exposed to air it is also necessary for one to selectively measure the local el in the bulk and at the grain boundaries to eventually estimate both tel.gb and tel,. This is actually possible owing to the fact that the activation energy of rgb (~0.7 ev) estimated from the arrhenius plots (not shown here) was found to be significantly higher than that of r (~1.4 ev) in lsgo [13, 14]. At relatively high temperatures (> 750 c), the resistance in lsgo is predominantly determined by r (i.e., rdc = r + rgb r since r rgb), while rgb is responsible for the resistance (i.e., rdc = r + rgb rgb since r rgb) at lower temperatures (<500 c). Note that the electrodes of the sample were modified in such a way that the resistance at the electrodes is negligibly small at all temperatures of concern (also see experimental for details). By measuring rel in different temperature regions, one can thus measure rel, and rel, gb selectively and thus tel, and tel, gb . Figure 5 shows tel, gb and tel, estimated at different temperatures . The tel, gb / tel, measured at lower / higher temperatures was extrapolated to higher / lower temperatures for direct comparison . As is clear from fig . 5, tel, gb is greater than tel, as expected from fig . 2 at all temperatures of concern . Therefore, fig . 5 verifies that the high grain - boundary resistance to oxygen - ionic transport observed in lsgo is due to the depletion of vo to form space charge zones at the grain boundaries . Space - charge - controlled grain - boundary conduction in perovskites has been previously reported for dielectric oxides (e.g., acceptor - doped srtio3), and intensively studied by waser, maier and their coworkers [1823 and references cited therein]. At the grain boundaries in these materials, both vo and h were found to be depleted, forming space - charge zones similar to those we observed in lsgo.fig . 5the transference numbers for electron holes in the bulk (blue symbols) and at the grain boundaries (red symbols) measured at different temperatures . The solid lines indicate extrapolations of the measured data the transference numbers for electron holes in the bulk (blue symbols) and at the grain boundaries (red symbols) measured at different temperatures . The solid lines indicate extrapolations of the measured data a more quantitative and comprehensive analysis of the influence of space - charge effects on the oxygen - ionic transport in lsgo is given in . Attention should also be paid to the origin of the grain - boundary resistance in highly doped lagao3, materials that are more relevant to practical applications . In highly doped samples, the influence of space - charge effects on grain - boundary conduction may be less, since the width of the space - charge zone (related to the debye length) decreases with increasing dopant concentration in the bulk . One mol% sr - doped lagao3 (la0.99sr0.01gao3x: lsgo) was synthesized employing a pechini - type method using la(no3)3 6h2o (99.9%, sigma louis, mo, usa), ga(no3)3 8h2o (> 99.9%, sigma the synthesized lsgo was pressed into pellets at 300 mpa by cold isostatic pressing . The as - pressed pellets were sintered at 1600 c for 10 h in air . The relative density of the sintered pellets, estimated using an archimedean method, was above 95% . The chemical composition as well as the concentrations of background impurities (including ca and si) in the pellets were determined using inductively coupled plasma emission spectroscopy (icp). The structure and phase homogeneity of the lsgo pellets was characterized using an x - ray diffractometer (xrd) with cu - k radiation (xds 2000, scintag, santa clara, ca, usa). The microstructure of the pellets was examined using a high - resolution transmission electron microscope (hr - tem, jem-2500se, jeol, tokyo, japan). The electrical resistance of the pellet was measured as a function of temperature (t = 250~600 c) under different oxygen partial pressures using both two - probe ac impedance spectroscopy and a dc - measurement technique . Prior to the measurements, pt electrodes were fabricated by painting pt paste (5349, heraeus, hanau, germany) on both surfaces of the pellet, followed by annealing at 1000 c/1 h in air . Impedance spectra were obtained in the frequency range from 50 mhz to 10 mhz using an impedance analyzer (novocontrol, novocontrol technology, hundsangen, germany). The total dc currents were measured using a source - measure unit (236, keithley, cleveland, oh, usa) in the high - temperature (750 c) and the low - temperature (500 c) regions . To minimize the electrode resistance of the pellet, which may be present at low temperatures, the surfaces of the pellets were coated with a porous composite layer . The composite material was prepared by mechanically mixing lsg and lsm (la0.8sr0.2mno3-, fcm, usa) powders (1:1 wt%) with the organic solvent . The slurry was screen - printed on the surface of the pellet and then heated at 1000 c for 2 h in air . The partial electronic current in the sample was measured using a dc - polarization method . A dc source meter (230, keithley) was used to apply constant voltage (u) from 0 v to 1.0 v, and an electrometer (617, keithley) was used to measure the current (i). This article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.
As the most common form of dementia, alzheimer disease is characterized by progressive loss of memory and deterioration of cognitive functions . It is predicted that about 75.63 million people would suffer from dementia by 2030 . Accordingly, in the present study, the intended remedy was selected and an appropriate pharmacognostical and pharmaceutical evaluations were performed . By searching through the traditional pharmaceutical manuscripts such as qarabadeen - e - salehi, qarabadeen - e - azam, qarabadeen - e - ghaderi and canon of medicine, a simple but proven compound remedy (frankincense and black pepper) was selected . Related pharmaceutical assessments such as weight variation, hardness, friability, and disintegration tests as well as pharmacognostical evaluations such as microscopic characterization, tlc, gc / ms, ft / ir fingerprints, and radical scavenging activity assessment (dpph) were performed . The resulting formulation, as a floating tablet, included 60% of frankincense gum and 15% of black pepper along with appropriate pharmaceutical ingredients (weight variation: 0.2190.004 g, hardness: 6.500.67, friability: 0.45%, disintegration time> 30 min). Microscopic characterization demonstrated stone cells, calcium oxalate crystals, sclereids of endocarp and pitted cells of mesocarp of pepper fruits as well as oil drops of frankincense gum . Gc / ms analysis revealed acetyl acetate and trans - caryophyllene as the main constituent . Moderate radical scavenging activity (ic50> 100 g / ml) was calculated for the methanol extract of tablets . Carrying out and validating a gc method for standardization of the formulated tablet, and having the structure for the effectiveness of these medicinal herbs in alzheimer may be the horizon for a new alzheimer - targeted medicine.
Asian americans comprise the fastest growing immigrant population in the united states (usa) and currently number about 18 million or 6% of the total usa population . Vietnamese americans represent the fourth largest subgroup of asian americans with 1.6 million individuals . A significant proportion of vietnamese americans experience serious socioeconomic difficulties, and those residing in the eastern region of the usa report higher levels of poverty and lower levels of educational achievement as compared with other asian subgroups nationwide or the usa population [3, 4]. Studies have shown that vietnamese americans also have higher rates of certain types of cancers . In comparison to other racial and ethnic groups in the usa, vietnamese women experience the highest incidence rate of invasive cervical cancer [5, 6]. Due to potential underreporting, the cancer incidence rates among vietnamese women may be higher . Over the past few decades, significant advances in cervical cancer early detection and prevention have benefitted a large subset of the usa female population by reducing the incidence, prevalence, and mortality rates of this disease; however, these rates have remained elevated in certain population subgroups . These disparities in cervical cancer incidence rates have been attributed, in part, to differences in screening uptake . For example, cervical cancer screening rates are dramatically lower among vietnamese american women compared to women in other ethnic and racial subgroups, with a prior study reporting that 1 in 3 vietnamese women had never had a papanicolaou (pap) test . Considering the high rates of cervical cancer among vietnamese american women [5, 6], however, there is a lack of knowledge on how to approach this health issue effectively in this population . Previous studies have indicated that there are substantial barriers that prevent vietnamese american women from obtaining pap tests . In addition to the perceived invasive nature of the pap test itself, vietnamese women share with other members of their communities common, often insurmountable barriers, including cultural (modesty), linguistic (limited or no english proficiency), and socioeconomic (poverty) barriers and a pervasive unfamiliarity with the usa healthcare system [1114]. Although each of these barriers has been found to be associated with screening rates in other populations, the impact of these barriers is more profound on this hard - to - reach ethnic group [9, 15, 16]. Evidence of the profound impact of these barriers is indicated by the fact that a substantial majority of vietnamese (75%) residing in the eastern usa are either medically underserved or uninsured and are not participating in mainstream screening and prevention programs . Even though prior studies of cancer screening behaviors have been conducted among vietnamese americans residing in the western or southern usa, studies suggest that there are significant geographic variations in cancer screening behaviors and incidence rates [17, 18]. Hence, there is a need for a better understanding of how these various factors may be associated with cervical cancer screening behaviors of vietnamese american women residing in the eastern usa, which will inform the development of appropriate strategies that would facilitate the participation of these communities in life - saving intervention and early detection programs in order to reduce such disparities and improve accessibility and quality of health care for this population . We have been conducting one of the largest randomized community cervical cancer intervention trials, aimed to increase cervical cancer screening and reduce health system access barriers among medically underserved and low - income vietnamese women . This randomized controlled trial (rct) is a five - year study conducted at 30 vietnamese community organizations in the eastern region of the usa (pa, nj). The intervention trial, guided by a conceptual framework derived from the health belief model (hbm) and social cognitive theory (sct), addresses both individual choices and healthcare system barriers . An overview of the intervention trial and primary results will be reported in a separate publication . The purpose of this paper is to analyze the baseline data in order to: (a) determine whether demographic, health access, and kab (knowledge, attitudes, and beliefs) factors are associated with prior history of cervical cancer screening among vietnamese american women and (b) to identify important factors that inform the development of culturally appropriate intervention strategies that would lead to reducing cervical cancer screening disparity among vietnamese women . The center for asian health (center) has an enduring collaborative relationship with over 250 asian american organizations represented by the asian community health coalition (achc), a nonprofit 501(c)(3) umbrella organization, established concurrently with the center in 2000 . The vietnamese community - based organizations (vcos) included in this study as part of the coalition serve important social functions, and they represent the ideal milieu for obtaining information on accessibility to needed health services . Their unique status in these communities underscores their importance as an ideal avenue for recruiting community - based participants for the study and intervention delivery . In the present study, the cbos varied in size, with the number of female vietnamese members in each of these 30 organizations ranging from between 80 to 2500 women . The average age of study participants was 52 years (range: 20 to 70 years). Specifically, they were directly involved in the planning, development, and implementation of the project . Vietnamese women (n = 1949) were recruited from participating community - based vietnamese community organizations (n = 30) and assessed for study eligibility . Of the total recruited and assessed, 1518 met the inclusion criteria of self - identified vietnamese identity, ages 18 to 70, had not had a pap - test over the past 12 months, and had not been diagnosed with cervical cancer . Of the total eligible women, 1450 consented, completed the baseline survey, and are included in the data analysis for this paper . Prior to project implementation, community leaders and volunteers participated in training sessions focused on the revisitation of project aims and significance to vietnamese women, recruitment strategies, and guidelines for administration of the research instrument as well as data collection, accuracy, and confidentiality . All measures in english were translated, back - translated, and pretested in vietnamese to ensure the scientific and cultural appropriateness of the instrument for community vietnamese participants . The 2030-minute baseline survey was provided in vietnamese and english versions, and bilingual assistance was available at all sites . The measures collected at baseline assessment include (1) demographics and acculturation; (2) health care access; (3) health behavior and pap test history; (4) perceptions related to health belief model constructs; (5) knowledge, attitudes, and beliefs of vietnamese women about cervical cancer; (6) human papillomavirus (hpv-) related questions . Our research team investigators hypothesized that these factors mentioned above would affect cervical cancer screening behaviors by serving as either barriers or facilitators to health - seeking behavior change . This paper primarily examines the association of demographic and acculturation characteristics (measured using 8 items), healthcare access barriers (6 items), and knowledge, attitudes, and beliefs about cervical cancer screening (13 items) and hpv - specific knowledge (10 items) with ever having had a pap test . These measures were validated in a number of our previous studies [10, 13, 1921]. The findings of hbm constructs and other variables' association with cervical cancer screening behaviors are being reported in a separate publication . Univariate logistic regression was used to examine the association between the probability of ever having had a pap smear test and each variable in the domains of demographic variables, access barriers, knowledge, attitude, and beliefs about cervical cancer . The strength of association was expressed as odds ratio and its 95% confidence interval . Both unadjusted odds ratio and odds ratio adjusted for demographic variables were reported . To examine whether variables in a domain contributed independently to pap test behavior all demographic variables significant in the univariate logistic regression model were included in the multivariate model . At baseline, 53.03% (769/1450) reported ever having had a pap test . Among demographic variables (table 1), vietnamese women in the 1840 age group, who did not speak english at all, were unemployed, never married or divorced / separated, had below high school education, and lived in the usa 10 years or less, were less likely to have had a pap smear test (p <0.01) as compared to their peers . Women who were born in the usa, lived in the usa for more than 20 years and had some english reading ability, had a greater likelihood of having ever received a pap smear test (p <0.01). In multivariate analyses, younger age, low education, unemployment, being married, english speaking ability, and country of birth remained significantly associated with prior pap test behavior . With regard to access barriers (table 2), vietnamese women who did not have insurance, did not visit a physician regularly or could not get time off for a doctor's appointment were less likely to have ever had a pap test (p <0.001), while women, who had received a doctor recommendation for a pap test, who visited doctors speaking english or both english and vietnamese or who did not have a preference regarding the gender of their doctors, were likely to have had a pap test in the past (p <0.001). Specifically, receiving a doctor's recommendation for a pap test was the strongest predictor of obtaining a pap test (adjusted or = 9.00, 95% ci = 5.6014.44, p <0.001), with 87.6% of those who received a recommendation reporting that they had had a pap test compared to 46.4% of those who had not received a doctor's recommendation for testing . Insurance was the second strongest factor (adjusted or = 3.41, 95% ci = 2.644.39, p <0.001), nearly doubling the pap test rate (67.5% versus 35.2%). All 11 items in the knowledge, attitude, and beliefs domain were significantly associated with pap test behavior (p <0.001) (table 3). In particular, it should be noted that the majority of women (65.8%) held the belief that you only see doctors when you're sick, whereas relatively few women believed that women older than 21 should be regularly screened (38.2%) and that screening was necessary for women not engaging in sexual activities (26.1%). Further, knowledge of cervical cancer symptoms was low in this group, and only 22.7% had ever heard of hpv . In univariate analyses, women with a belief that cancer can be cured if detected early, belief that a pap test can detect cancer early and prolong time, belief that women over age 21 should have a pap test regularly, or belief that cancer incidence increases with age, were about twice as likely to have had a pap test compared to women who did not hold these beliefs . With respect to hpv - specific knowledge (table 4), women who knew that hpv causes cervical cancer and is sexually transmitted were more likely to have had a pap test compared to women who did not know this information . Similarly, women who were familiar with hpv risk factors (such as having multiple sexual partners) were more likely to have obtained screening compared with women who did not know the risk factors . Finally, women who believed that hpv infection is rare were less likely to have been previously screened . Given that there was a considerable number of women who did not respond to any of the hpv knowledge items (table 4), we did not include those items in the multivariate analyses . In multivariate analyses, receiving a doctor's recommendation for the pap test, having insurance, and having time - off to see doctors remained strongly associated with having had a prior pap test (p <0.001), suggesting that they are independently associated with pap test behavior even after adjusting for the other access barriers and for demographic variables . In addition, six variables from the knowledge, attitudes, and beliefs domain remained highly significant (p <0.001, table 5) in the multivariate logistic model, indicating their independent contributions to pap test behavior . One of the most critical issues in cervical cancer prevention among vietnamese american women over the past two decades is the persistently low pap screening rate despite significantly high incidence rate of cervical cancer . Specific challenges and barriers to obtaining screening need to be examined and addressed in this underserved population . Although previous studies in the western region of the usa laid the groundwork for interventions [2326], they rarely addressed both individual and system barriers that are associated with cervical cancer screening behaviors among vietnamese women in a single study with a large sample size (n = 1450). In addition, geographic differences may be important to consider, as geographic variations may exist regarding access to healthcare providers and/or healthcare staff who can provide bilingual services . (2009) have demonstrated that the considerable language obstacles that exist within some immigrant populations can serve as critical barriers to healthcare and uptake of screening tests . Findings from this population suggest that younger vietnamese women are less likely to have ever had a pap smear compared to their older (> 60 years) counterparts . This finding is in contrast to a number of studies [16, 2830], which have been summarized in several recent reviews [31, 32]. But a recent study of young asian american women also reported that younger age was associated with lower likelihood of obtaining screening . With increasing age, there was an increase in odds of ever having had a pap smear test . Our finding that younger vietnamese women were less likely to have ever had a pap test may be due, in part, to cultural norms that promote more conservative views about sexual relations among unmarried individuals . Specifically, focus groups among young asian americans revealed that premarital sexual behavior was generally not widely acceptable, nor was seeking gynecological examinations prior to marriage, as that might adversely reflect sexual promiscuity . As a result, younger unmarried women may be less likely to seek cervical cancer screening due to the perceived community stigma associated with sexual promiscuity . This would also be consistent with prior findings reporting the common belief that pap testing is only for women who are married or who have had children . Indeed, in the present study, we found that women who were not married or who were divorced / separated were less likely to have ever had a pap smear test . Therefore, these findings highlight the need to focus on younger vietnamese american women or those who are not married who may not engage in screening behaviors due to cultural barriers and beliefs . Our findings that higher levels of education, english proficiency, employment, access to a physician, physician recommendation, and having health insurance are associated with significantly higher rates of pap screening and are corroborated by other studies [31, 34, 35]. For example, higher educational attainment was associated with greater likelihood of screening, whereas being unemployed was associated with lower likelihood of screening . These associations may be attributed, in part, to differences in knowledge and access to care . Women with higher educational levels may have greater knowledge and understanding regarding the need for cancer screening tests [36, 37]. In addition, as education level is frequently associated with income, women with higher education or who have employment may have greater financial resources with which to obtain preventive care . Women who could not speak english and who were foreign - born were less likely to have ever had a pap smear test . This is consistent with prior studies that have reported difficulties with english as a significant obstacle to screening for this population [38, 39]. Unfortunately, language issues continue to serve as a barrier to screening as multilingual screening services are extremely limited or unavailable for most vietnamese american women . Vietnamese women who do not have a regular healthcare provider were less likely to report ever having had a pap test, which is consistent with numerous prior studies [16, 28, 31]. Having a physician that one sees for routine healthcare over time is likely to lead to better quality of care and offers more opportunities for discussing prevention and screening options than if one only visits a healthcare provider when one is ill . Further, receiving a physician recommendation for screening was the strongest factor associated with screening, similar to prior published findings [30, 31, 35]. These findings highlight the importance of having access to a regular healthcare provider who can recommend the appropriate screening tests and remind women to participate in preventive care . Although programs are available that provide low - cost or free cancer screening services for women without health insurance or a healthcare provider, vietnamese american women are often unaware of these services, not eligible for these programs, or face considerable barriers to accessing such programs . As a result, intervention programs to reduce cervical cancer disparities need to identify and target the subgroups of women who are not able to access or receive these cancer screening programs . Our study identified 11 factors in the knowledge, attitudes, and beliefs domain that were associated with vietnamese women's cervical cancer screening behavior . Specifically, a lack of knowledge was associated with poor participation in cervical cancer screening . Other studies have reported that vietnamese american women may hold various misconceptions about cervical cancer and cervical cancer screening [29, 35]; as a result, these beliefs may prevent women from obtaining the necessary screening . However, women who correctly reported that a pap smear test can detect cervical cancer early were twice as likely to have had a pap test compared to women who did not hold this belief . Similarly, women who had heard about human papillomavirus (hpv) were more likely to have had a pap test . It should be noted that hpv - specific knowledge was relatively low in this population . Indeed, nearly half of the study participants did not know that hpv can cause cervical cancer or that it was sexually transmitted . In addition, many women could not identify risk factors for hpv infection and over half of the women thought that hpv infection is rare . Further, these findings likely overestimate hpv - related knowledge given that between 9%18% of respondents left these items blank . However, women who did have knowledge about hpv and its risk factors were more likely to have undergone screening . Potential limitations of the study include the cross - sectional study design and using self - report to categorize prior screening behavior . In addition, our findings may not be generalizable to vietnamese residents who are not closely engaged with their communities, and nonparticipants may have different patterns of cancer screening behaviors from the study respondents . However, the findings from the present study offer one of the largest assessments of cervical cancer screening among vietnamese american women residing in the eastern usa and provide insights regarding identified significant factors for promoting cervical cancer screening in this population . In summary, this study adds to the literature on cancer health disparities among vietnamese american women and sheds light on the special health needs of this relatively recent immigrant population . Vietnamese women have the highest incidence rates of cervical cancer in the usa, and numerous factors serve as barriers to their participation in pap test screening programs . These data help us identify the subgroup of vietnamese american women who may be underutilizing screening services, as well as significant factors that we can address to enhance screening rates . Intervention programs need to address lack of knowledge and misconceptions regarding preventive care, language difficulties and access issues . Culturally tailored and linguistically appropriate educational materials and navigation assistance to overcome access barriers have been found to be effective in increasing screening rates in other studies . Indeed, although interventions that target women's health beliefs can increase knowledge, the effectiveness of such interventions is likely to be attenuated if access barriers are not adequately addressed . Access barriers, including the cost of screening, lack of insurance, and language difficulties, pose formidable challenges to this population . Community partnerships may be helpful for reducing some access barriers by providing essential infrastructure and resources to facilitate the broad implementation of health promotion programs . In addition, overcoming access barriers may necessitate setting aside additional resources to help underserved communities obtain the recommended healthcare services and/or require changing current healthcare program guidelines, such as expanding the eligibility criteria for state- and/or federally funded programs that provide low - cost cancer screening and prevention services for underserved women.
Over the last two decades, morphological cardiac changes induced by athletic conditioning have been of great interest.1 several studies have been orchestrated to delineate features of the athlete s heart such as left ventricular (lv) and left atrial remodelling.2 accordingly, relevant studies are still being performed using electrocardiography (ecg) and/or echocardiography to further shed light on these issues . Among these, some researchers have targeted their studies at comparing ecg and/or echocardiographic findings between dynamic (endurance) and static (strength) athletes.36 however, some contrasting results exist in the literature in this regard.7 furthermore, exercise is believed to alter a sympathovagal balance of the sinus node contributing in part to the heart rate changes in athletes.8 nonetheless, it remains controversial whether these alterations in the autonomic function at rest, which is usually presented as bradycardia, are caused by attenuation of sympathetic tone and/or by enhanced vagal activity.9 therefore, related investigations use heart rate variability (hrv) as a noninvasive method of providing information about vagal and sympathetic effects on the heart.10 to the best of the authors knowledge, no single study has been hitherto performed to evaluate ecg, echocardiography, and hrv findings among athletes . Therefore, the aim of this study was to assess the ecg, echocardiography, and hrv in a group of iranian dynamic and static type athletes and compare the related findings with those of healthy controls . Between april 2010 and april 2011, 50 professional iranian athletes introduced by the physical education organization (tehran, iran) and 50 healthy nonathletes (as the control group) were recruited . The study was approved by the local medical ethical committee of tabriz university of medical sciences (tabriz, iran). The inclusion criteria were being a professional athlete; lack of any history of structural cardiac, cerebrovascular, chronic renal or hepatic diseases, malignancy, and pregnancy; and willingness to participate in the study . Standard 12-lead ecg was performed on all athletes and the control group in the supine position after a few minutes of rest during quiet respiration and recorded at 25 mm / second . Thereafter, in the ecg analysis particular attention was paid to heart rate (beats / minute), pr interval (milliseconds), qrs duration (milliseconds), qt interval corrected for the heart rate (milliseconds), qt dispersion (difference between maximum and minimum qt interval) (seconds), p - wave morphologic abnormality (p - wave duration> 120 milliseconds as measured in the lead with the widest p - wave, amplitude> 0.25 mv, and terminal negative deflection in the right precordial leads> 0.1 mv in depth), presence of q - waves (2 mm in depth in at least two leads), r amplitude in precordial leads (v1 and v5) (mm), sokolow lyon voltage criterion for lv hypertrophy (sv1 + rv5> 3.5 mv), and t - wave inversion (2 mm in depth in at least two contiguous leads, with the exclusion of leads iii and augmented vector right). In addition, all athletes and the control group underwent transthoracic echocardiography and related features including lv ejection fraction (lvef), lv end - diastolic diameter (lvedd), lv end - systolic diameter (lvesd), lv mass, left atrial volume index (lavi), early mitral filling velocity / early diastolic mitral annular velocity ratio, and pulmonary arterial pressure (pap) were recorded and evaluated.11,12 moreover, both the athletes and the control group underwent ecg holter monitoring for 15 minutes, and several parameters related to hrv including standard deviation of the normal - to - normal intervals and the square root of the mean squared difference of successive normal - to - normal intervals were recorded . Regarding the frequency domain, low frequency, high frequency, very low frequency, and ultra - low frequency ecg holter monitoring was performed in the morning after 30 minutes of supine rest and the studied individuals had abstained from exercise for 12 hours (the night before testing). The sampling rate of the holter monitors was 500 hz . The holter images were scanned and analyzed with ab-180r holter monitoring system (advanced biosensor inc, columbia, sc) after being manually edited to eliminate ectopic beats and noise signals by an experienced electrophysiologist (bk). The results of short - term recordings have been shown to correlate well with 24-hour recordings and are suitable for measuring changes over time.13 furthermore, the prognostic value of short - term holter recordings has been demonstrated for traditional hrv parameters.14,15 data are presented as mean standard deviation or as a percentage . All statistical analyses were performed with ibm spss for windows version 17 (spss inc, chicago, il). To analyze the measured quantitative variables between the studied groups, one - way analysis of variance was applied followed by an additional post hoc test in cases of significance . To study the frequency changes of the qualitative variables, chi - squared test or fisher s exact test were used . In this study, 100 people with a mean age of 27.8 10.6 years (range: 2035 years) were recruited: 50 healthy nonathletes (control group) and 50 professional athletes . The professional athletes group consisted of 20 professional athletes in the field of static exercise (eg, weightlifting and body building) and 30 professional athletes in the field of dynamic exercise (eg, swimming, soccer, track and field, badminton). There was no difference in gender and age between the control and athletes group (p> 0.05; table 1). Classical underlying risk factors for cardiac diseases and cardiac symptoms of the studied participants are presented in table 1 . No significant difference was observed in the abnormal cases of ecg between the athletes and the control group; abnormal findings were present in 17 cases (34%) of the athletes group and 14 cases (20%) of the control group . The ecg qualitative and quantitative findings obtained from both groups are presented in table 2 . Among the ecg quantitative variables, there was a statistically significant difference regarding r - wave amplitude between static, dynamic, and control groups; the static athletes showed the highest r - wave amplitude (p <0.001). Lvedd of the dynamic athletes was significantly greater than that of the control and static groups (p <0.001). In addition, lvesd of the static group was significantly lower than that of the control and dynamic groups (p <0.001). Furthermore, lv mass of the dynamic and static athletes was significantly greater than that of the controls (p <0.001). On the other hand, lavi in the dynamic athletes was significantly higher than that in the control and static groups (p <0.001 and p = 0.001, respectively). There were no differences in other echocardiographic variables including lvef, early mitral filling velocity / early diastolic mitral annular velocity ratio, and pap between the groups (table 3; p> 0.05). Among the findings obtained from the ecg holter monitoring, heart rate and systolic blood pressure at rest were significantly different between the studied groups . The dynamic athletes had lower systolic blood pressure than the controls (p = 0.01; table 4). Moreover, the heart rate was lowest in the control group compared with that in the dynamic and static athletes (p <0.001; table 4). There were no differences in hrv parameters, both time and frequency domain, between the groups (table 4; p> 0.05). In recent years, numerous medical reports have been describing diverse changes in ecg of professional athletes, most of which are due to a physiological adaptation of the athlete s heart to the conditions associated with physical activities.16,17 abnormal ecg is more frequent among athletes compared with nonathletes, with a wide range of changes varying from 10%50%.16 in a study carried out by sharma et al studying the ecg changes between athletes and nonathletes, sinus bradycardia and sinus arrhythmia were reported in 80% and 52% of the athletes, respectively.18 magalski et al highlighted that the most important ecg abnormalities accompanied with a high risk in athletes are deep q - wave and inverted t - wave, which were, however, rare (<5%).19 deep inverted t - waves are one of the most important alarming indicators of cardiomyopathy in athletes.20 in the current study, deep q - wave and inverted t - wave was present in 2% of the athletes, each accounting for a very low percentage of the abnormal ecg findings in athletes . This finding is similar to that of previous studies.19,21 consistent with previous studies, the most common ecg finding in the current study was sinus bradycardia.18,20,22 there is a consensus on the most common ecg changes in athletes: sinus bradycardia, first degree heart block, and incomplete right bundle branch block.23 similarly, sinus bradycardia and incomplete right bundle branch block were the most common ecg abnormalities in the athletes group of the current study . Furthermore, tall r - wave was only detected in the static athletes, which is consistent with the findings of bialy et al s study.24 this finding is suggestive of cardiac adaptation of the static athletes for their particular type of exercise, ie, strength training exercises . Previous studies have confirmed that adaptive changes of the heart muscle, such as symmetrical hypertrophy and cardiac volume changes, are based on the exercise activity of the athletes, and hemodynamic changes and requirements are the major factors contributing to the changes in the heart muscle and structure of the heart in athletes.25 in an echocardiographic study of athletes performed by bialy et al lv mass of the dynamic athletes increased compared with the nonathletes.24 in the current study, lv mass of dynamic and static athletes was significantly greater than that in nonathletes . This finding was previously reported by abinader et al26 and dandrea et al.3 although the current study did not result in a difference between static and dynamic athletes with regard to lv mass, venckunas et al indicated that lv mass was lower in static athletes compared with dynamic athletes.7 during dynamic exercise, the lv withstands repetitive stress, which leads to an increase in lv mass . In addition, the current study revealed that lvesd was lower in static athletes and lvedd was greater in dynamic athletes considering their increased hemodynamic requirements . Abinader et al26 and dandrea et al5,6,27 reported similar findings in this regard . Moreover, in the current study, lavi was significantly greater in the dynamic athletes compared with the static athletes and nonathletes . This finding is similar to that of previous studies by dandrea et al.2729 in addition, the current results indicate similar lvef values in the nonathletes, static athletes, and dynamic athletes . Likewise, dandrea et al found no difference between the static and dynamic groups with regard to lvef.5,6,2729 furthermore, the current study failed to detect any difference in pap between the studied groups . In contrast, recent investigations by dandrea et al indicate a higher pap in dynamic athletes.4,6 one of the long - term effects of exercise is a positive increase in parasympathetic activities in the autonomic nervous system, which can be traced using parameters such as standard deviation of the normal - to - normal intervals (hrv) and square root of the mean squared difference of successive normal - to - normal intervals.25 during dynamic exercise, the heart rate increases which is due to parasympathetic blockade and increase in sympathetic activity; however, the dominance of the parasympathetic system is significant in athletes.30 the current study revealed that the heart rate and systolic blood pressure at rest were lower in the athletes compared with the control group . These findings are similar to those of previous studies.24,31,32 with regard to the hrv parameters, previous studies indicated a significant increase in hrv in professional athletes.3133 in other studies on the autonomic nervous system using hrv analysis, a shift in the cardiac autonomic balance towards the dominance of the sympathetic system was noted.3436 on the other hand, in a study carried out by raczak et al, no increase in adrenergic activity was reported despite an increase in activity.25 lower sample sizes in previous studies may have contributed to the observed differences in results . In the current study, no significant difference was observed between the athletes and nonathletes regarding hrv . The sampling rate of holter monitoring was 500 hz in the current study, a rate sufficient for measuring very low frequency, low frequency, and high frequency domains of hrv during short - term recording.37 however, the measurement of ultra low frequency requires more recording time . The present investigation found that the most common ecg abnormalities among adolescent iranian athletes were sinus bradycardia and incomplete right bundle branch block . In addition, according to their increased hemodynamic requirements, static exercise seemed to reduce lvesd . On the other hand additionally, iranian athletes showed no differences in hrv parameters, excluding heart rate and systolic blood pressure, compared with the nonathletes.
Autophagy, or the process of degradation of intracellular components in lysosomes, has been traditionally linked to cellular energy balance and to the cellular nutritional status [1, 2]. In fact, although during the recent revival of the autophagic process, most of the emphasis has been placed on its role in other cellular functions such as cellular quality control, remodeling, or cell defense, the first descriptions of the autophagic process in the early 1960s already stated that conditions such as starvation lead to its activation [35]. These early studies proposed that autophagic activation during starvation was necessary to maintain the cellular energetic balance . Later studies in yeast, in fact confirmed that activation of autophagy was essential to preserve cellular viability during nutritional starvation (nitrogen depletion in yeast), and that mutants defective in autophagy were lethal [6, 7]. In most of these studies emphasis was placed on the ability of autophagy to supply through degradation of protein products the amino acids required to maintain protein synthesis under the extreme nutritional conditions . However, the contribution of autophagy to the cellular energetic balance may not be solely dependent on this capacity to provide free amino acids, which in fact, are a relatively inefficient source of energy when oxidized to urea and carbon dioxide . Recent studies support that autophagy can also provide energetically more efficient essential components, such as free fatty acids (ffas) and sugars . In this paper, we focus on the contribution of autophagy to lipid catabolism and the consequences of this novel autophagic function in the cellular energetic balance as well as in specific lipid - mediated regulatory functions . Lastly, we also discuss the possible implications of alterations in the autophagic breakdown of lipids in human health and disease, with emphasis on common metabolic disorders . Cells store fat in the form of lipid droplets (lds)intracellular deposits of lipid esters surrounded by a monolayer of phospholipids and separated from the hydrophilic cytosolic environment by a coat of structural proteins, known generically as perilipins (figure 1) [8, 9]. Despite their misleading appearance of inert stores, studies during recent years have revealed that ld are sites of high activity and that their functions are not limited to passive store of lipids . In fact, their dynamic nature, multifunctionality, and defined identity have now conferred upon them the category of intracellular organelles [8, 9]. Furthermore, as many other organelles, lds have been shown to interact in a regulated manner with other intracellular compartments (likely, to provide them with specific lipids for their membranes) and to adapt to changes in the cellular environment [10, 11]. A growing theme in the field of ld research is now the identification of functions for the ld beyond those related to lipid metabolism or supply of membrane lipids . Pioneering among those has been the finding that the hydrophobic matrix of the ld can become a sequestering surface for misfolded proteins that if left free in the cytosol could organize into oligomeric and aggregated products highly toxic for cells [12, 13]. Ld sequestration of proteins does not only apply to pathogenic proteins destined for degradation, but also may have a regulatory role in the availability of some fully functional proteins . For example, certain histones elude nuclear translocation through dynamic and reversible interactions with ld . Interestingly, pathogens such as some types of viruses, have found in the ld ideal platforms for assembly [15, 16]. Although lipid droplets are particularly prominent in the adipose tissue where they organize as a single large droplet (up to 100 m diameter) that occupies almost the totality of the cytoplasm all cells contain lipid droplets to variable extents that range from 0.1 to 10 m . In addition to size differences, the adipose tissue ld has a core predominantly formed by triglycerides (tgs) whereas in most cells cholesterol and tg share the nuclear core of the ld [8, 9]. Ld originate from the er and maintain a close connection with this organelle, which facilitates exchange of lipids and proteins between both compartments to accommodate to the metabolic requirements of the cell the interaction of lipases present at the surface of the ld with the structural proteins that surround ld and with inhibitory proteins in the cytosol contributes to modulate the rate of lipolysis . Cells activate lipolysis not only when they need energy but also in response to a large affluence of lipids to prevent stores from becoming compromisingly enlarged for the cell . Although, traditionally, mobilization of ld by lipolysis has been solely attributed to the ld - associated lipases, recent studies have revealed a role for autophagy in ld breakdown (figure 1). The presence of lipases in the lysosomal lumen, along with a large variety of hydrolases such as proteases, glycases and nucleases, has been acknowledged since the early days of the discovery of this organelle . However, lysosomal lipases, also known as acid lipases because of their optimal acidic pka, were thought to serve mainly in the degradation of lipids contributed by the diet through endocytosis or those present in the membranes of the organelles digested during the autophagic process . The elevation of ld to the category of cytosolic organelles was in part a motivation to address their turnover by autophagy . This catabolic process is capable of sequestering whole cytosolic organelles inside double - membrane vesicles known as autophagosomes, which deliver this cargo to lysosomes upon heterotypic fusion with their membrane [18, 19]. Each of the events of the autophagic process is coordinated by a complex network of more than 32 genes and their protein products (autophagy - related genes (atgs) and proteins (atgs)). Atgs participate at the level of: (1) activation, (2) nucleation of the autophagosome membrane that forms de novo through conjugation of proteins and lipids from different cellular compartments, (3) elongation of the membrane and sealing to form the autophagosome, (4) trafficking toward the lysosomes, and (5) fusion of the two membranes . The first hint that ld could become substrates of the autophagic process originated from studies in cultured hepatocytes knocked down for atg5, one of the genes essential for the formation of autophagosomes . Hepatocytes respond to an acute oleic challenge by increasing lipolysis, which would prevent massive enlargement of the ld compartment . Oleic challenge resulted in a marked increase in the number and size of ld in cells with compromised macroautophagy . The same was true in vivo, when knockout in liver of another essential autophagy gene (atg7) led to an accelerated development of liver steatosis (fatty liver) in the autophagy compromised animals, when compared to control animals . Detailed biochemical and functional analyses helped in establishing that the observed lipid accumulation did not result from increased formation of ld or reduced lipid secretion from hepatocytes, but that, instead, it could be explained almost exclusively on the basis of reduced lipolysis . It is possible that, through mechanisms yet to be identified, changes in autophagic activity may modulate the ld - associated lipases and contribute to the observed changes in lipolysis . However, independent of this possibility, there is now evidence that the autophagic system contributes directly to the mobilization of lipids from ld to lysosomes, wherein luminal lipases mediate their lipolysis . In fact, neutralization of the lysosomal ph, that would have a marked effect on the lysosome - resident lipases but does not modify the activity of the cytosolic lipases, was enough to almost completely block the lipolysis activated in response to a lipid challenge . Sequestration of cytosolic components inside the forming autophagosome was considered for a long time a nonselective in - bulk process by which cytosolic material was randomly delivered for lysosomal degradation . However, recent years have revealed the existence of a growing number of proteins dedicated to the tagging and recognition of cytosolic components for autophagic degradation . In the case of intracellular protein aggregates, the presence of polyubiquitinated chains formed through specific types of linkage (the best characterized uses the lysine 63 in ubiquitin to link one ubiquitin moiety to another in the polyubiquitin chains) is the tag identified by the cargo - recognition machinery . Similarly, ubiquitination of proteins on the surface of peroxisomes and of different pathogens contribute to their segregation towards the autophagic system [23, 24]. However, ubiquitin is not the only signal identified as marker for autophagic degradation . Selection of mitochondria for mitophagy (selective degradation of mitochondria by autophagy) has been shown to occur through different mechanisms, which likely coexist in most cells . In most cases, changes in structural components of the mitochondrial membrane are identified by partner cytosolic proteins (such as parkin or nix), that once bound at the surface of this organelle, tag it for degradation . All cargo recognition molecules or autophagy receptors share their ability to bind to the tagging molecule in the organelle to be degraded as well as to specific components of the autophagic machinery (in almost all cases the light chain protein 3 or lc3) [21, 26]. This recruitment of autophagic components toward the cytosolic material to be degraded is proposed to initiate the in situ formation of the autophagosome around this material and to mediate selectivity . Some levels of lipophagy may always occur even during the random sequestration of cytosolic material by in - bulk autophagy . In fact, analysis of the components inside autophagosomes in cells maintained in basal conditions revealed the presence of lipid material and ld structural proteins inside these vesicles, along with other cytosolic material . However, as described in the previous section, when lipophagy is activated in response to a lipid challenge or prolonged starvation, there seems to be a switch toward the preferential sequestration of ld, supporting some level of selectivity in this process . An intriguing observation in the studies of hepatic lipophagy was the fact that ld do not always seem to be sequestered as a whole by the autophagosomes, but, on the contrary, in many instances, only fractions of the ld underwent autophagy (figure 1). Thus, membranous structures enriched in lc3, in support of their autophagic origin, appear to grow from the surface of the droplet towards the inner core . Often these membranes curve to finally seal, giving rise to double - membrane vesicles of a slightly smaller size than a conventional autophagosome (50100 nm) and contain only components of the ld in their lumen . Interestingly, formation of the membranes seems to be polarized in only one site on the surface of the ld . Other components of the autophagic machinery, such as atg5 and atg7, also localize to these areas of the ld in further support that formation of the limiting membrane occurs at the surface of the ld (figure 1). In the process of de novo formation of the autophagic membrane, atg7 acts as the enzyme regulating conjugation of atg12 to atg5 (to serve as scaffold for assembling other components of the forming membrane), as well as the conjugation of lc3 to a lipid (phosphatidylethanolamine, pe) to generate lc3-ii that is one of the interestingly, atg7 is not required for the recruitment of lc3 to the ld, since this protein, although in its nonconjugated form, is still found associated to ld in cells defective in atg7 . Pe, the only lipid known to conjugate to lc3, is among the phospholipids that contribute to form the delimiting phospholipid monolayer of ld . The specific mechanism by which the limiting autophagosome membrane grows from the ld surface is still poorly characterized, but the presence of membrane - like structures in the ld core has been previously described . In addition, although the core is predominantly composed of lipids, some proteins can also be detected in this region . Early studies have suggested that these proteins may form complexes with phospholipids to form structures compatible with the hydrophobic environment inside the ld . In this respect, conjugation of lc3 to pe on the surface of the ld may provide the right conformation for the forming membrane to advance towards the inside of the ld . Polyubiquitination has been detected in polarized areas of ld in part resulting from the accumulation of clusters of polyubiquitinated apolipoprotein b (apob) on their surface . The fate of apob in this location seems to be to undergo lysosomal degradation . Whether or not the lysosomal degradation of apob occurs as a result of the activation of lipophagy and how the accumulation of this protein contributes to the initiation of the process requires future investigation . Recent studies have shown now the integration into the ld surface of the ancient ubiquitous protein 1 (aup1), which bears a c - terminus able to bind enzymes involved in ubiquitination . Whether or not the presence of aup1 in ld is necessary or precedes the arrival of the autophagic machinery requires future investigation . Of particular interest is the fact that lds have been shown to dynamically interact with two of the organelles that have been proposed as sites of formation of the limiting membrane of the autophagosomes the er and the mitochondria (figure 1) [11, 31]. Interactions with the er may be related to ld biogenesis, as this is the compartment from where these organelles originate, but may also favor the distribution of lipids from the ld towards other organelles through the endosecretory pathway . In the case of mitochondria, the close interaction between ld and the outer - membrane of this organelle could facilitate delivery of the ffa released by lipolysis for mitochondrial -oxidation . However, considering the described association of the autophagic initiation complex to punctual areas in the membrane of the er and the mitochondria, and the formation of cup - like precursors of the limiting membrane of the autophagosomes from these regions [32, 33], it is tantalizing to at least propose that the previously described interactions of ld with these organelles, could also contribute to the initiation of their autophagic degradation . As described in previous sections, mobilization of ld by autophagy was first observed both in cultured hepatocytes in response to fatty acid exposure, and in liver of mice maintained on a diet enriched in fat for prolonged periods of time (4 months). The liver responds to the massive influx of lipids from the blood by upregulating ld biogenesis, as a mechanism of defense against the toxicity of fa, which upon esterification get converted into tg and stored into ld . However, in order to prevent uncontrolled expansion of ld, activation of lipolysis also occurs under these conditions and contributes to maintain ld size . Failure to regulate lipid accumulation in hepatocytes may be the basis of pathogenic conditions such as liver steatosis and steatohepatitis . Autophagy has now been added to the mechanisms that control the growth of the hepatic ld under these conditions (figure 2). Besides lipid challenges, other stimuli such as starvation also engage the lipolytic contribution of the autophagic system . Classic measurement of protein catabolism in liver during starvation, revealed that most of the protein degradation in this organ occurs during the 46 h that follow starvation, and that protein breakdown, even of autophagic origin, decreases markedly once the 810 h of starvation are reached . However, this decrease in autophagic degradation of proteins by autophagy is not equivalent to a decrease in overall autophagic activity . Formation and clearance of autophagosomes seems to be maintained throughout the starvation period, but there is a consistent change in the type of cytosolic components sequestered in these vesicles . Whereas cytosolic proteins and some organelles are the main cargo of the autophagic process during the early hours of starvation, as lack of nutrients persists, there is a gradual change towards preferential sequestration of lipid droplets inside autophagosomes (figure 2). This selective autophagy of lipid stores, known now as lipophagy, accounts for a high percentage of the lipolysis occurring during prolonged starvation in liver . Interestingly, although lipophagy is markedly upregulated in response to lipid challenges and during prolonged starvation, it is possible that a certain percentage of degradation of lipid stores in lysosomes occurs continuously in many cell types . Thus, blockage of autophagy through knockdown of any of the essential atg in hepatocytes in culture, leads to a significant increase in the number of lipid droplets in these cells even when maintained under normal nutritional conditions and in the absence of any additional challenge . Similar basal lipophagy has also been observed in cell types not typically known to store fat such as fibroblasts, macrophages, t cells, dendritic cells, lymphoblasts, glia, striatal cell lines, and even primary neurons [20, 3436], although the relative contribution of autophagy to basal lipolysis may vary depending on the cell type . Further studies are necessary to determine the reasons behind the coexistence of the two different mechanisms for lipolysis the one mediated by the cytosolic lipases and the one occurring through the autophagic system . It is possible that activation of one or the other may mainly lead to quantitative differences (i.e., lipophagy may be able to provide large amounts of ffa in shorter time). However, because the lysosomal lipases have been poorly characterized, it is also possible that the quality and type of the resulting lipolytic products differs between cytosolic and lysosomal lipases . Lastly, in light of the growing evidence in support of the heterogeneity of the cellular ld, it is also plausible that the two lipolytic systems target different subpopulations of ld . As detailed earlier, lipophagy appears to contribute significantly to the mobilization of cellular lipids for provision of energy . However, the identification of lipophagy in cell types other than those involved in lipid storage, such as in immune or neuronal cells, suggests that autophagic turnover of lipids is perhaps a generic mechanism for the utilization of cellular fat stores in diverse cell types . In fact, recent reports have now included two additional cell types; hypothalamic neurons and macrophage foam cells, to the increasing list of cells where lipophagy has been shown to be present and functionally important . The neurons within the mediobasal hypothalamus (mbh) form part of a focal neural network that integrates nutritional and hormonal information from two main cellular kinases, the mammalian target of rapamycin (mtor) and the phosphoinositol-3-kinase (pi3k) to control food intake and energy balance . Hypothalamic fatty acid metabolism, amongst other neuronal mechanisms, has been linked to the regulation of appetite [41, 42]. Although recent work suggests that neuronal ffa availability and oxidation provide the energetic requirements for activation and firing of orexigenic agouti - related peptide (agrp) neurons, the lipolytic mechanisms that generate neuron - intrinsic ffa have remained poorly elucidated . Since autophagy is activated by starvation in most cells, it was plausible that autophagic mobilization of lipids in the hypothalamus could contribute to the generation of neuronal ffa during starvation that, in turn, trigger mechanisms driving food intake . In fact, a recent study in mice knockout for atg7 in agrp neurons shows that the hypothalamus, indeed, needs autophagy to upregulate expression of agrp in response to nutritional depletion . This indicates the distinctive characteristic of hypothalamic neurons in their ability to activate autophagy, quite unlike other regions of the brain in which autophagy does not seem to be under this type of nutritional regulation . The activation of autophagy occurred in parallel to starvation - induced increases in hypothalamic ffa uptake (figure 3), suggesting that, as in the case of the liver, acute ffa stimulus might be a mechanism for activation of hypothalamic autophagy during starvation . Indeed, the exposure of hypothalamic cells to ffa or ffa - rich serum from starved rodents increased autophagy (figure 3). The activation of autophagy in hypothalamic neurons upon acute lipid stimulus associated with increases in the levels of phosphorylated ampk and ulk1, a kinase involved in the regulation of the autophagic process and recently described to be an ampk substrate . These findings indicate that hypothalamic ampk and ulk1 may contribute to a ffa sensing mechanism that modulates autophagy in response to changes in nutrient signals . However, the mechanisms connecting ffa release and agrp expression remain unknown for the most part . Although it is possible that ffa modulate some of the signaling cascades involved in agrp regulation, a direct effect of the autophagic process on secretion of agrp - containing vesicles cannot be ruled out . The immediate fate of the ffa taken up by hypothalamic cells is esterification into neuronal ld, which underscored the requirement of a lipolytic mechanism to liberate neuronal ffa during starvation . Indeed, the activation of hypothalamic autophagy observed under these conditions, leads to increased mobilization of neuronal lipids to lysosomes . The physiological consequence of these interactions is the generation of neuronal ffa, since inhibiting lysosomal hydrolysis or interfering with the autophagic process significantly decreases hypothalamic ffa levels . Lipophagy - generated hypothalamic ffa directly regulate the increase in orexigenic agrp expression that occurs in agrp hypothalamic neurons in response to starvation or to exposure to extracellular ffa . In fact, selective blockage of autophagy in agrp neurons has been shown to reduce fasting - induced increases in hypothalamic agrp levels, food intake, and body weights . Interestingly, mice deficient in autophagy in agrp neurons also displayed higher levels of the anorexigenic peptide -melanocyte stimulating hormone (msh), which is produced within the adjacent proopiomelanocortin (pomc) neuronal population, which could contribute to the reduced adiposity in these mice . In this respect, it is interesting to note that the effect of autophagy in lipid mobilization and the downstream consequences of neuronal lipophagy may be very neuronal type - specific . For example, a recent study using acute intrahypothalamic injection of sirna against atg7 revealed increased adiposity and glucose intolerance in the injected mice, in contrast to the lean phenotype observed when only agrp autophagy is compromised . It is possible that adiposity in this model occurred from concurrent reduction of atg7 in both agrp and pomc neuronal populations, or from autophagic deficiency in additional cell types, for instance hypothalamic glial cells, also shown to regulate glucose homeostasis . However, as the actual impact of the sirna injection in the autophagic flux in this model is not known, is not possible to discard that differences in efficiency of the autophagic compromise between pomc and agrp neurons are the real reason behind the different phenotype, or even that autophagy was not affected in the agrp neurons and the phenotype only resulted from reduced pomc autophagy . Although future investigation is required to clarify the cell type differences and to identify additional stimuli that may also modulate hypothalamic autophagy, the current findings highlight an exciting new role for lipophagy in control of food intake and whole body energy balance by modulating the controlled production of neuronal ffa that regulate agrp levels (figure 3). In this way, the contribution of autophagy to the cellular and organismal energetic balance is no longer merely limited to its role in active breakdown of macromolecules or cellular stores to obtain energetic products, but has been raised to a more global regulatory function that includes the modulation of food intake . Forthcoming studies should help in addressing the possible implications of these findings for metabolic diseases such as obesity and the impact that these metabolic changes could have on hypothalamic autophagy . The presence of lipophagy in diverse cell types raises the question whether lipophagy might also serve to mobilize lipids within the principal fat storing organ in the body, the adipose tissue . Surprisingly, recent reports by two independent groups demonstrate a completely new and unexpected function of autophagy in regulating adipose physiology [48, 49], which is quite distinct from the role of autophagy in mobilizing lipids observed in other cell types [20, 3436]. In fact, adipose - selective knockout of essential autophagy genes in mouse significantly reduced adipocyte lipid droplet content and fat tissue mass [48, 49]. Likewise, blocking autophagy in cultured preadipocytes decreased cellular triglyceride content and levels of key adipogenic transcription factors cebp- (ccaat / enhancer - binding protein alpha), cebp- (ccaat / enhancer - binding protein beta) and ppar- . Conceivably, reduced expression of adipocyte - specific genes led to the formation of an adipose tissue that predominantly consisted of immature fat - deficient preadipocytes judging by their reduced levels of terminal differentiation markers (fatty acid synthase, fatty acid - binding protein-4 (fabp-4/ap-2), glucose transporter 4 (glut4), or stearoyl coa desaturase 1). Intriguingly, selective inhibition of autophagy in white adipose tissue (wat) in vivo not only impaired wat differentiation but also introduced brown adipose tissue- (bat-) like features in autophagy - deficient wat . The autophagy - deficient white adipocytes exhibited a cellular morphology that resembled closely that of brown adipocytes . For instance, atg7-deficient white adipocytes displayed increased number of smaller multiloculated lipid droplets and mitochondria, rounded nuclei, and larger cytoplasmic size [48, 49]. The molecular characteristics of the adipose tissue in the autophagy - deficient mice also mimicked those of bat as reflected by increased levels of brown adipogenic factors, ppar- transcriptional coactivator (pgc-1), and uncoupling protein-1 (ucp-1). Acquisition of bat - like properties resulted in higher adipose tissue -oxidation rates in knock - out animals than in controls [48, 49]. The physiological consequences of this shift in wat phenotype were a decrease in body weight, reduced adiposity and resistance against high fat diet - induced alterations in glucose homeostasis [48, 49]. Although, the mechanism by which autophagy controls adipocyte differentiation or modulates the phenotypic switch from wat to bat - like is unclear, a likely possibility is that autophagy modulates levels of key regulatory proteins to control adipocyte cell fate, differentiation and fat storage . However, it is still plausible that specific autophagy - related components may be directly involved in the process of adipogenesis and that this function is not only limited to the adipose tissue . This concept is supported by studies performed at ages before adulthood in the same mouse model null for autophagy in liver used in the discovery of hepatic lipophagy . In contrast to the massive accumulation of lipids observed in the adult animals, very young animals, at least when unchallenged, had consistently lower hepatocyte content of ld . The previously described association of lc3-ii to ld, also confirmed in this latter work, was proposed to be required for ld formation . Since expression of the enzyme used to flox out the autophagic gene does not start in this mouse model until 3 - 4 months after birth, it is possible that if autophagy is involved in both formation and mobilization of ld, the partial blockage of autophagy was initially sufficient to cope with the lipophagic requirements of the young animals and prevent the accumulation of ld . However, as the animals reached adulthood, the complete and persistent blockage of the autophagic system tilted the balance between lipogenesis and lipolysis toward the former one, leading to ld accumulation . This dual involvement of autophagy in lipogenesis (ld formation) and lipolysis proposed in the liver now raises the question of whether a similar dual role could also occur in the adipose tissue . In fact, recent studies with a mouse model deficient in caveolin 1 have shown lipoatrophy of the adipose tissue mediated by massive upregulation of autophagy in this tissue . Future studies with inducible autophagy knockouts in the adipose tissue of adult mice are needed to determine if autophagy does contribute to lipid mobilization also from fully formed adipose tissue . After the first observations demonstrating the existence of lipophagy and the upregulation of this process in response to a lipid challenge, numerous studies have confirmed the stimulatory effect of dietary lipids on the autophagic process . Upregulation of autophagy in response to increased ffa has been demonstrated in neurons, muscle, pancreas, mammary epithelial cells, liver - derived cells, and even in colon cancer cells [5256]. Although the mechanisms that modulate the activation of the autophagic process under these conditions are still poorly elucidated, at least in the case of the pancreatic beta cell, autophagic activation has been proposed to occur through activation of the c - jun n - terminal kinase 1 pathway in a manner independent of er or oxidative stress . In contrast to this stimulatory effect of a lipid challenge on the autophagic system, an equal number of studies have started to report inhibition of autophagy in response to exposure to high concentrations or particular type of lipids (figure 4). For example unsaturated ffa such as oleic acid has a marked stimulatory effect on autophagy in many cells, at least up to some concentrations [20, 57, 58]. In contrast, saturated ffa such as palmitic acid maybe due in part to its lower incorporation into ld remains in the cytosol at higher concentrations and suppresses autophagy . Likewise, in animals exposed to a high - fat diet for prolonged periods of time it is possible to detect an increase in autophagic activity during the first weeks of treatment, which is progressively followed by a gradual decrease in autophagy . This decrease further contributes to the expansion of the ld compartment, eventually leading to hepatotoxicity and steatosis [20, 57, 58]. Interestingly, the switch from activation to inhibition of autophagy in response to lipogenic stimuli can also be cell type dependent . Thus, same amounts of oxidized low - density lipoprotein that stimulate autophagic activity in schwannoma cells have been shown to be toxic for neuroblastoma cells . Although many mechanisms could contribute to the inhibitory effect of ffa on autophagy, a systematic analysis of the different steps of the autophagic process has revealed a primary defect in the fusion between autophagosomes and lysosomes in cells exposed to high concentrations of ffa or in animals subjected to prolonged high - fat diet . Interestingly, this failure to deliver autophagosome cargo directly to lysosomes is initially compensated for by increasing fusion of autophagic compartments with late endosomes (to generate what is known as an amphisome). However, as the high levels of intracellular lipids persist, defective intracellular turnover becomes evident, either because of further compromise of the pathway or maybe because of an additional failure in the endocytic system as autophagic cargo builds up in these compartments . Analysis of autophagic vacuoles from animals exposed to a high - fat diet revealed that changes in the lipid composition of the membrane of these vesicles are behind their compromised fusogenicity . This - dual effect of dietary lipids on autophagy and lipophagy should be taken into consideration when contemplating manipulations of the autophagic system as a therapeutic strategy for metabolic disorders . The fast development of steatosis and fatty liver observed in mice defective for autophagy in this organ strongly supported the contribution of altered autophagy to the pathogenesis of this common disease . In fact, a compromise in hepatic autophagy has been proposed to underline also the basis for the accumulation of ld upon exposure to toxic concentrations of ethanol . Furthermore, recent studies have demonstrated that pharmacological upregulation of autophagy reduces hepatotoxicity and steatosis in an alcohol - induced model of fatty liver . However, future studies are needed before autophagy activation can be used as a generalized treatment against this disease, because, for example, upregulation of the autophagic process in hepatic stellate cells has been shown to favor their activation and consequently initiate liver fibrosis . The liver responds to some stressors through global activation of autophagy, including degradation of lipids, proteins, and organelles . However, in other instances upregulation of autophagy as a protective mechanism against liver injury can be specific for lipophagy . For example, the autophagy upregulated as a first line of defense against alcohol - induced toxicity in liver, selectively targets mitochondria, and lipid droplets, while excluding soluble cytosolic proteins and other organelles . Future efforts should focus in understanding how selective forms of autophagy can be individually modulated for therapeutic purposes . The recently discovered capability of the autophagic system to mobilize hepatic lipids is also utilized by viruses to favor their replication . Earlier studies have shown that although autophagy is usually an efficient mechanism in the defense against most viral infections, upregulation of autophagy could also favor replication of some viruses such as the dengue virus . Recent studies have demonstrated that dengue virus - dependent induction of autophagy mediates ld breakdown and release of ffa necessary to maintain the high levels of intracellular atp required for dengue viral replication . Future studies are needed to determine which subset of hepatotropic virus makes use of lipophagy for their own replication and whether blockage of the autophagic system can be performed in this organ in a selective way to preferentially affect virogenesis but not normal liver metabolism . The finding that autophagy is required for adipogenesis has elicited a considerable interest in the interplay between autophagy and metabolic disorders such as obesity . Studies performed in human subjects with different types and degrees of obesity have revealed a direct correlation between autophagic activity and the sizes of various fat depots . Interestingly, autophagy was found to be inappropriately active in omental fat tissues extracted from obese individuals, and, in fact, autophagic activity was remarkably raised in insulin - resistant obese subjects . This indicates that although functional autophagy may be a requirement for adipose differentiation during development, autophagy might also be involved in the maintenance of adipose tissue size and lipid storage in adults . The fact that autophagic upregulation occurs before obesity - associated morbidity becomes manifested, still leaves open the possibility that this system could be activated as a defensive mechanism against the increase in intracellular lipids . However, the final outcome and autophagy effect may be very different depending on the metabolic status . For example, in adipocytes from type 2 diabetes patients characterized by unresponsiveness to insulin, maintained attenuation of mtor has been recently described and proposed as the main mechanism responsible for the upregulation of autophagy in these cells . The concomitant increase in ld formation under these conditions along with their enhanced autophagy favors cellular toxicity due to the excessive release of ffa from ld . It is anticipated that blockage of autophagy, or at least downregulation to a normal level, may be better under these conditions . Lipophagy has been recently proposed as a possible defensive mechanism against atherosclerosis, or the thickening of the artery walls due to abnormal accumulation of lipid deposits in macrophage foam cells . The recent finding that autophagy contributes to lipolytic mobilization of ld in macrophages also, provides now a new possible mechanism for the pathogenesis of atherosclerosis . This study has revealed that macrophage lipophagy is upregulated both in vitro and in vivo in response to lipid loading and that failure to upregulate the autophagic system, in mice defective for this pathway, results in inefficient clearance of cholesterol in macrophages . In light of the inhibitory effect that high concentrations of intracellular lipids can have on autophagy, it is reasonable to propose that chronic exposure to high levels of circulating lipids may compromise the autophagic system of the artery wall macrophages and lead to their transformation into foam cells as lipids accumulate in their cytoplasm . This massive accumulation of lipids is the seeding for the subsequent formation of the atherosclerotic plaque . Current therapeutic strategies in this disease are aimed at promoting cholesterol efflux from these macrophages to reduce the size of the lipid - enriched plaque that they form beneath the endothelial cells . Consequently, manipulations aimed at enhancing macrophage autophagy and thus favoring cholesterol efflux from these cells, may have therapeutic potential in the atherosclerotic artery walls . Interestingly, the contribution of changes in autophagy to atherosclerotic plaque development may go beyond macrophages and involve also the smooth muscle cells of the arterial wall . Recent studies have shown compromised autophagy in these cells as a consequence of the inflammatory response associated to the plaques . The fact that a decline in autophagic activity, and in particular in lipophagy, would contribute to intracellular accumulation of ld and that, as described in previous sections, these abnormally expanded lipid stores would further reduce autophagic activity, makes this an attractive feedback loop for the perpetuation of the metabolic syndrome of aging (characterized by hypercholesterolemia, accumulation of lipid deposits in organs, and insulin resistance) (figure 4). Interestingly, and in some way contra intuitively, treatment with antilipolytic agents has been shown to improve the age - related hypercholesterolemic phenotype and overall health - span in old mouse models . However, recent studies support that most of the beneficial effect observed with these agents is dependent on their ability to induce autophagy, likely as a response to the increase in intracellular lipid stores . Genetic connections among autophagy, lipid metabolism, and longevity have also been recently highlighted in studies in c. elegans . Functional autophagy is necessary in this model to maintain the activation of a cellular lipase (lipl-4) and conversely, this lipase is required for induction of autophagy . Interestingly, both the activity of this lipase and autophagy are required to attain the extension in life span observed upon germline removal in worms . Although the specific lipid targets of this lipase and the way in which it participates in autophagy remain unknown, it is tempting to propose that part of the effect in life - span could be due to better intracellular lipid handling by lipophagy . The recent discovery of lipophagy has contributed to link two major intracellular catabolic pathways autophagy and lipolysis . This new function of autophagy in lipid metabolism expands the physiological relevance of the autophagic process by making its contribution to the energetic balance more relevant (when considering the higher energetic value of lipids versus proteins), but also including now under the list of autophagic functions the control of many of the regulatory activities that lipids exert inside cells . Does lipophagy regulation occur through similar signaling pathways to those described for other types of autophagy? Are there differences between the types of lipid byproducts generated by lipophagy when compared to cytosolic lipolysis? What determines the threshold for the switch from a stimulatory to an inhibitory effect of ffa on lipophagy? And also, in a more general context, what are the possible effects of lipophagy on the combinations of metabolic defects that often coexist in our population such as obesity, diabetes, and hyperlipidemia? Does defective hypothalamic lipophagy with age contribute to the reduced food intake observed in advanced aging? Although these are still early days for lipophagy, there is now ample evidence that organ - specific targeting of this process may have implications for development of novel therapeutic interventions against common human metabolic disorders such as obesity and insulin resistance.
Acute lung injury (ali) and acute respiratory distress syndrome (ards) are life - threatening syndromes that cause high morbidity and mortality . Epidemiologic data have revealed that the incidence of ali / ards varies widely by geographic location . The incidence ranges from 64.2 to 78.9 cases/100.000 person - years in the usa, and in northern europe, it is of 17 cases/100.000 person - years . The subsequent neutrophil activation leads to tissue damage via the release of proteases, oxidants, and cationic peptides . Through the recent use of molecular and cellular assays and knockout animals, considerable progress has been made towards the understanding of the genetic, tissue - specific, and immunological factors that contribute to the development of ali pathophysiology . However, no specific therapies are available, and the disease outcome has yet to be improved by pharmacologic treatments . Ventilation with lower tidal volumes is the only method that has shown a level of benefit . Thus, the identification of new molecules that can modulate ali - associated inflammation is highly desirable and is a significant goal of pharmaceutical companies . Recent evidence has suggested that certain compounds are effective in inhibiting neutrophil function and infiltration, and such inhibition is desirable for the treatment of patients with ali and sepsis . Natural products and their derivatives (secondary metabolites) are the most common sources of these drugs . Many plant - derived secondary metabolites are capable of directly modulating inflammation by altering the production and activity of second messengers, the expression of transcription factors, and the expression of key proinflammatory molecules [68]. In addition, they can provide relief from symptoms that is comparable to that obtained from allopathic medicines . Ellagic acid, a polyphenol, is present in several fruits, such as grapes, strawberries, pomegranates, and walnuts, as well as several medicinal plants [911]. Ellagic acid has exhibited antioxidant, anticancer, antiallergic, and anti - inflammatory [11, 15] activities, among others . Interestingly, ellagic acid, as well as extracts that are rich in ellagic acid, has demonstrated significant effects on the airways . In this context, hilaire (lythraceae) extracts and ellagic acid reduced most of the phenotypes of experimental ovalbumin - induced allergic airway inflammation, and punica granatum (lythraceae) fruit extract reduced the airway inflammation during lps - induced ali in mice . Here, we used the nonlethal acid - initiated experimental model of ali to determine whether preventive or therapeutic administration of ellagic acid could interfere with the development and establishment of ali - associated inflammation . In this study, ellagic acid demonstrated potent anti - inflammatory effects, accelerated the resolution of inflammation, and decreased the exacerbation of the inflammation process caused by selective cox-2 inhibition . Taken together, these results suggest the potential of ellagic acid as a candidate for the treatment of ali - associated inflammation . All animal care and procedures used in this study were in compliance with the guidelines on the use of animals of the uftm ethics committee (protocol no . 162), which follow the nih principles of laboratory animal care publication no . 8523 . The experiments were conducted using female balb / c mice (57 weeks old and weighing 2025 g) that were kept in controlled temperature (22 2c) and humidity (45%55%) under a 12:12 h light - dark cycle (lights on 07:00 h). The mice were anesthetised with ketamine (50 mg / kg) and xylazine (8 mg / kg), and hydrochloric acid (0.1 n hcl, ph 1.5, 50 l) was intratracheally instilled into the left lung via a 24-gauge angiocatheter . At 12, 48, and/or 72 h following acid - initiated acute lung injury bronchoalveolar lavage fluid (balf) and lung tissue were harvested . One group of animals was instilled with saline into the left lung (the control group). The treatment of animals with ellagic acid was carried out as described by rogerio et al . . Once ellagic acid demonstrates poor solubility in water, the treatment in each animal was carried out with a suspension of ellagic in water at dose 10 mg / kg . The suspension was homogenized with the syringe used in the oral administration before each animal treatment . To study the preventive anti - inflammatory effects, ellagic acid (10 mg / kg) or a vehicle control (water) was given daily by oral gavage (30 minutes prior and 24, 47, and/or 71 h following the intratracheal acid instillation). In a second cohort, the mice were therapeutically treated with ellagic acid or the vehicle by oral gavage (2, 24, 47, and/or 71 h following the acid - initiated injury). In a third cohort, the ellagic acid or the vehicle was administered during the resolution phase after the peak of inflammation (12 h) at 24, 47, and/or 71 h following acid - initiated acute lung injury . In a fourth cohort, the animals were pretreated with a selective inhibitor of cyclooxygenase-2 (cox-2) (celebra, 10 mg / kg; intraperitoneal route) 30 min prior to the intratracheal acid instillation [18, 19] and then treated with the ellagic acid or the vehicle (2, 24, and 47 h after the acid - initiated injury). As a positive control, the mice were treated with dexamethasone as described earlier (1 mg / kg, s.c . Injection). At 12, 48, and/or 72 h following the acid - initiated acute lung injury, the mice were euthanised by sodium pentobarbital overdose (70 mg / kg, intraperitoneal), and the balf and lung were collected . Balf was performed with 1 ml of phosphate - buffered saline (pbs) plus 0.6 mm ethylenediamine tetraacetic acid (edta) and placed on ice . The total cell and differential leukocyte counts were made according to rogerio et al . . Following centrifugation (400 g, 5 min, 4c), the supernatants of the balf were collected and stored at 80c for subsequent cytokine determination . The animals were injected with evans blue dye (30 mg / kg) via the left retro - orbital plexus 2 h prior to euthanasia . The balf was collected at 12 h following the acid - initiated acute lung injury, and the extravasation of the dye was quantified by spectrophotometry (absorbance at 650 nm) [20, 21]. Il-6, kc, il-1, and il-10 levels were assayed by elisa according to the manufacturer's instructions (r&d systems, minneapolis, mn, usa). When significant differences were identified, the individual comparisons were subsequently made with tukey's test . Ellagic acid (sigma - aldrich, mo, usa), dexamethasone (decadron, laboratrio teuto brasileiro, go, bra), celecoxib (celebra, pfizer pharmaceuticals llc, sp, bra), evans blue (vetec qumica fina ltda, rj, bra), hcl (vetec qumica fina ltda, rj, bra), xylazine (hertape calier saude animal s / a, mg, bra), and ketamine (cristlia - produtos qumicos farmacuticos ltda, sp, bra) were purchased . We first evaluated the preventive effect of ellagic acid (10 mg / kg, p.o .) On the acid - initiated acute lung inflammation . The total cells, neutrophils, macrophages, and lymphocytes were quantified from the balf . In nearly all of the time points analysed, the numbers of balf total cells, neutrophils, macrophages, and lymphocytes from the vehicle - treated group were significantly increased compared to the saline control group (figure 1(a)). The neutrophil numbers significantly increased after lung injury with maximal numbers at 12 h. ellagic acid or dexamethasone treatment significantly reduced the total number of cells and neutrophils in the balf compared to the vehicle - treated mice at 12, 48, and 72 h after injury (figures 1(a) and 1(b)). The balf neutrophil numbers of mice treated with ellagic acid were reduced by approximately 60%, 67%, and 73%, while the dexamethasone treatment reduced them by 78%, 50%, and 57% at 12, 48, and 72 h, respectively . Moreover, the ellagic acid significantly reduced the macrophages (45%) and the lymphocytes (87%) numbers at 48 h, while the dexamethasone only reduced the macrophages (38%) and the lymphocytes (60%) numbers at 72 h (figure 1(d)). The lungs of the vehicle - treated mice demonstrated increased edema, thickening of the alveolar septum and interstitium, and leukocyte infiltration compared to the control group . Ellagic acid and dexamethasone treatment reduced all of the aforementioned inflammatory parameters compared to the vehicle - treated mice (figure 1(e)). To investigate the therapeutic anti - inflammatory effect of ellagic acid on acid - induced ali, the mice were treated with ellagic acid or the vehicle control at 2, 24, 47, or 71 h after lung injury . The numbers of total cells, neutrophils, lymphocytes, and macrophages in the vehicle - treated mice significantly increased compared to the saline control group in nearly all of the time points (figure 2). The ellagic acid significantly reduced the numbers of total cells and neutrophils in the balf compared to the vehicle - treated mice at all of the time points (12, 48, and 72 h) (figures 2(a) and 2(b)). The dexamethasone treatment reduced the total cell numbers at 12 and 72 h and reduced the neutrophil numbers at 12 h (figures 2(a) and 2(b)). The number of neutrophils in the balf of animals that were treated with ellagic acid was reduced by approximately 52%, 71%, and 70% at 12, 48, and 72 h, respectively, while the dexamethasone treatment reduced the neutrophils by 87% at 12 h. the number of macrophages in the balf was reduced by both ellagic acid (33%) and dexamethasone (51%) at 72 h (figure 2(c)). No significant alteration was observed in the lymphocytes numbers by both ellagic acid and dexamethasone at all of the time points analyzed (figure 2(d)). Additionally, ellagic acid and dexamethasone treatment reduced edema, thickening of the alveolar septum and interstitium, and leukocyte infiltration compared to the vehicle - treated mice (figure 2(e)). We next evaluated the therapeutic effect of ellagic acid on the balf cytokine levels at 12 h after intratracheal administration of acid . The concentrations of il-6, kc, and il-1 were increased in the vehicle - treated mice compared to the saline control mice (figures 3(a)3(c)). Ellagic acid and dexamethasone treatment significantly reduced the il-6 levels in the balf (figure 3(a)). Il-6 levels were reduced from 34.4 7.4 pg / ml (vehicle control) to 11.369 3.6 pg / ml (ellagic acid) and 13.3 15.3 pg / ml (dexamethasone) (mean sem). Treatment with dexamethasone, but not ellagic acid, reduced the balf il-1 concentration compared to the vehicle - treated mice (figure 3(b)). In addition, neither ellagic acid nor dexamethasone reduced the kc levels compared to the vehicle control (figure 3(c)). No significant alteration in il-10 levels was observed in the vehicle - treated mice when compared to the saline control group (figure 3(d)). Ellagic acid and dexamethasone treatment increased the levels of il-10 by approximately eight- and elevenfold, respectively, compared to the saline control group (figure 3(d)). The vascular permeability changes were increased in vehicle - treated mice compared to the saline control group . Ellagic acid and dexamethasone treatment also reduced the vascular permeability changes associated with ali compared to the vehicle - treated mice (figure 3(e)). We used immunohistochemistry to assess the effects of therapeutic ellagic acid treatment on p - selectin expression and on the phosphorylation state of ap-1 and nf-b at the peak of lung inflammation (12 h). P65 nf-b staining was observed in the nucleus of the lung cells from the saline control mice . A discrete activation of c - p65 nf-b and c - jun activation was observed in the bronchial epithelium of the vehicle - treated mice (figures 4 and 5) compared to the control group . Treatment with dexamethasone, but not ellagic acid, decreased the activation of p65 nf-b and c - jun compared with the vehicle - treated mice (figures 4 and 5). P - selectin staining was observed in all groups; however, no significant alteration in staining was observed among the groups (data not shown). We next assessed the therapeutic effect of ellagic acid on the exacerbated inflammatory response of mice exposed to experimental acid - induced ali and treated with the selective cox-2 inhibitor (celecoxib, 10 mg / kg; i.p .) At 48 h. compared to the saline control group, the vehicle- or the celecoxib - treated mice displayed increased numbers of total cells, neutrophils, macrophages, and lymphocytes in the balf (figure 6). In addition, celecoxib - treated mice had increased total cells, neutrophils, and lymphocytes in the balf when compared to the vehicle - treated mice (figure 6). Ellagic acid (10 mg / kg) and dexamethasone (1 mg / kg) reduced the exacerbation of ali inflammation induced by cox-2 inhibition . Both treatments reduced the recruitment of total cells, neutrophils, macrophages, and lymphocytes into the balf . Ellagic acid and dexamethasone treatment reduced the number of total cells from 178.3 3.2 (selective inhibitor of cox-2) (mean 10 cells / ml sem) by approximately 69% and 77%, respectively, to 55.0 3.2 (mean 10 cells / ml sem) and 40.0 1.8 (mean 10 cells / ml sem) (figure 6(a)). Similarly, ellagic acid and dexamethasone treatment reduced the number of neutrophils from 73.7 6.4 (selective inhibitor of cox-2) (mean 10 cells / ml sem) by approximately 82% and 83%, respectively, to 12.7 1.6 (mean 10 cells / ml sem) and 12.3 1.0 (mean 10 cells / ml sem) (figure 6(b)). The number of macrophages was reduced from 82.0 6.5 (selective inhibitor of cox-2) by approximately 53% and 72% to 37.9 3.3 (ellagic acid) (mean 10 cells / ml sem) and 22.5 2.8 (dexamethasone) (mean 10 cells / ml sem), respectively (figure 6(c)). The number of lymphocytes was reduced from 21.6 4.0 (selective inhibitor of cox-2) by approximately 75% and 82% to 5.5 13.6 (ellagic acid) (mean 10 cells / ml sem) and 3.8 2.8 (dexamethasone) (mean 10 cells / ml sem), respectively (figure 6(d)). As our results suggested a protective effect of ellagic acid on the airway, we next determined the influence of ellagic acid on the resolution of established airway inflammation . T50 correspond to the time point to reduce 50% of neutrophils, and resolution interval (ri) is defined as the time required for the cell numbers to decrease to 50% of the peak of inflammation (the interval between peak of inflammation, at 12 h, and t50) [22, 23] (figure 7(a)). In the vehicle - exposed mice, the t50 was 43 h, and the endogenous resolution interval for the balf neutrophils was 31 h. the treatment with ellagic acid, vehicle, and dexamethasone was carried out 12 h (in the resolution phase) after the peak of inflammation (12 h). The t50 and ri for the balf neutrophils were markedly decreased with the ellagic acid treatment to 33 h and 21 h (67% of the vehicle resolution interval), respectively (figure 7(b)), indicative of more rapid resolution of acute inflammation . The dexamethasone treatment also decreased the t50 and ri to 31 h and 19 h (61% of the vehicle resolution interval) (figure 7(b)), respectively . In the present study, the ellagic acid displayed anti - inflammatory properties by decreasing the severity of hcl acid - initiated ali, accelerating the resolution of inflammation and decreasing the cox-2 inhibitor - induced exacerbation of inflammation . Ellagic acid reduced several inflammatory parameters, including the vascular permeability alterations and the neutrophil recruitment to the balf and the lung . In addition, ellagic acid reduced the proinflammatory cytokine il-6 and increased the anti - inflammatory cytokine il-10 in the balf without downregulating the nf-b and ap-1 signaling pathways (different from dexamethasone). Together, these findings demonstrated that ellagic acid has potential anti - inflammatory effects for the resolution of ali inflammation . Although inflammation is essential for the maintenance of tissue homeostasis and protection against infection, uncontrolled and persistent inflammation may contribute to tissue damage, a characteristic phenomenon of several inflammatory disorders, including ali . In airway inflammation of ali, the neutrophils are the first cells to be recruited and are the predominant cause of tissue damage . A persisting neutrophilia is associated with a poor outcome of ali . In addition, another hallmark of ali is edema, which is a consequence of the increased permeability of the alveolar - capillary barrier, as well as epithelial damage, which results in the impairment of arterial oxygenation [24, 26]. Over the past several years, no therapeutic agents have demonstrated a clear benefit during ali treatment [4, 27]. In the continued search for bioactive plant - derived products, several groups, including our own, have successfully employed experimental models to screen the pharmacologic activities of plant extracts, as well as isolated compounds, such as ellagic acid . Utilising secondary metabolites from medicinal plants that can control leukocyte recruitment, such as neutrophils, could be a strategy to reduce the lung damage during ali . Phytochemical and pharmacological studies have identified many potential anti - inflammatory substances, particularly those derived from plants used in folk medicine . Lafoensia pacari (lythraceae) has been used in traditional medicine to treat gastric ulcers and inflammation in the state of mato grosso (brazil). In a bioassay - guided fractionation of the lafoensia pacari extract, rogerio et al . Identified ellagic acid as the compound responsible for the reduction of neutrophil recruitment into the peritoneal cavity of mice induced to injury by histoplasma capsulatum - derived -glucan . This reduction in the recruitment of neutrophils and eosinophils to the balf by ellagic acid has also been observed in an ovalbumin - induced experimental allergic airway inflammation model . In addition, lafoensia pacari extract and ellagic acid demonstrated antiedematous activity in a mouse paw edema model [11, 28]. Ellagitannins present in the pomegranate (punica granatum) fruit, which has been used for centuries for medical purposes . Studies with pomegranate extract have demonstrated its anti - inflammatory effects in murine models of collagen - induced arthritis and experimental colitis [30, 31]. In an experimental model of ali (lps - initiated), the pomegranate extract also reduced the myeloperoxidase (a heme enzyme present in the primary granules of neutrophils) in the lungs of mice . The free ellagic acid is absorbed in the gut, but its bioavailability is low . It binds in the intestinal epithelial cells, and its uptake might occur through monolayer of these cells . In addition, ellagic acid could be conjugated (sulphate ester, glucuronide, and glutathione conjugates) [33, 35] or metabolized by bacteria in the gut to produce urolithins (a and b). These microbial metabolites are more bioavailable than ellagic acid, and in the human plasma, they were detected after consuming pomegranate extract capsule (21.6 mg of free ellagic acid) at 8 and 24 h . So, these metabolites could be also responsible for the biological activity of ellagic acid such as anti - inflammatory activity [29, 37]. Interesting, while these metabolites do not accumulate in organ tissues, the free ellagic acid irreversibly binds to macromolecules (proteins and dna) and consequently might accumulate in the epithelial cells and others cells . Ellagic acid was detected in the lung of mouse after oral administration (at dose 2.0 mmol ~6 mg / kg). In addition, these authors demonstrated that ellagic acid localized preferentially in lung (10-fold higher) when compared to liver . So, if beneficial effects of ellagic acid such as the anti - inflammatory activity observed by us in the acute lung injury are associated with urolithin production is not possible to answer . So, as ellagic acid, urolithins, or both could be responsible by this activity, however, only ellagic acid is detected in the lung, and because of this, probably the ellagic acid is major responsible for reducing the airways inflammation . The key result from our study was that the ellagic acid demonstrated both preventive and therapeutic effects in reducing edema and leukocyte recruitment to the balf, similar to dexamethasone, during ali . In addition, ellagic acid, similar to dexamethasone, accelerated the resolution of inflammation by promoting the recovery from lung injury and reduced the exacerbation of inflammation induced by cox-2 inhibition . These results suggest that ellagic acid has potent anti - inflammatory activity and is able to reduce the airway inflammation, as well as its exacerbation, during ali . Selectins, a family of transmembrane molecules that are expressed on the surface of leukocytes and activated endothelial cells, are critically involved in leukocyte recruitment . We evaluated the expression of p - selectin in the lungs, as this molecule is considered to be an important target for modulating neutrophil influx into the inflamed tissue [40, 41]. Our findings revealed no significant alterations in the expression of p - selectin in the bronchial epithelium among the groups (data not shown). Demonstrated that nf-b expression and nuclear translocation increased in airway epithelial cells in an ali model (acid - initiated). Unlike dexamethasone treatment, ellagic acid did not reduce nf-b activation during the peak of inflammation (12 h) in acid - initiated ali . These findings suggest that the effect of ellagic acid on acid - induced ali was nf-b and ap-1 independent . In ali, a complex network of cytokines and chemokines, such as il-6, il-1, and kc, among others, several studies have demonstrated that ellagic acid can inhibit cytokines and chemokines in vivo and in vitro [14, 44]. Of particular interest, ellagic acid, similar to dexamethasone, reduced the levels of il-6 in the balf of mice with acid - initiated ali . In mice with lps - initiated ali, il-6 was correlated with a proinflammatory phenotype, and high levels of il-6 in the plasma and balf of humans were associated with an increased risk of developing ali . Il-10 is an anti - inflammatory cytokine with a significant role in preventing inflammatory diseases . Il-10 demonstrated a protective role in lps - induced ali . In the acid - initiated ali, ellagic acid, similar to dexamethasone, increased the il-10 concentration in the balf . Therefore, these results suggest that ellagic acid could improve the outcome, as well as the prognosis, of ali in patients by modulating the cytokines involved in ali physiopathology . However, further studies are needed before this possibility can be examined in humans . In conclusion, ali is a disease with high morbidity and mortality, and currently, the disease outcome has yet to be improved by pharmacologic treatment . Ellagic acid has demonstrated antioxidant and anti - inflammatory activity in several in vivo and in vitro experimental inflammation models . In hcl acid - initiated ali, ellagic acid demonstrated potent anti - inflammatory effects, accelerated the resolution of inflammation, and decreased the exacerbation of the inflammation process caused by selective cox-2 inhibition . These effects were due to the modulation of cytokines (decrease of il-6 and increase of il-10 in the balf). The inability of ellagic acid to modulate the nf-b and ap-1 signaling pathways suggests that this molecule may control inflammation without inducing an immunosuppressive response, as is observed during dexamethasone treatment . L of ellagic acid, did not produce toxic effects in humans over a 3-year period . Moreover, the l. pacari extract (which contains ellagic acid) did not show cytotoxicity in vitro or in vivo . In conclusion, ellagic acid might be a future alternative treatment for the reduction of inflammation during ali and other inflammatory diseases with fewer adverse effects than corticosteroids.
We present a case of a papillary urothelial bladder carcinoma in a direct inguinal hernia . A 79-year - old man presented to our department with a swelling in the left groin evolving over 10 years without any symptoms . The patient was operated using the transurethral resection of bladder tumor (tur - bt) technique 3 months before due to papillary urothelial carcinoma of the prostatic part of the urethra . The ultrasound examination was inconclusive showing only a left inguinal hernia while the intravenous pyelography revealed an abnormal position of the urinary bladder . 1) showed a left groin hernia with an irregular mass content which grows from the urinary bladder (probably tumor of the bladder wall). The patient underwent open surgery via an inguinal approach; the tumor was palpated in the herniated portion of the bladder (fig . A partial cystectomy was done and the inguinal hernia was repaired without the use of mesh . Pathologic examination of the specimen reported a tumor of 8 cm 5 cm 5 cm (fig . 4) revealed a high - grade carcinoma with necrosis and characteristics of a papillary urothelial carcinoma with invasion of 1/3 of the muscularis propria (t2a). One year after the operation the patient presented no recurrence of the tumor or hernia . Some researchers have estimated the prevalence may be closer to 10% in men . According to the relationship with the peritoneum, the hernias are classified as follows: (a) paraperitoneal, which are common (60%) in which the peritoneum covers the external aspect of the herniated bladder, can be direct or indirect, as it was in our case; (b) extraperitoneal, in which the tumors do not cover the peritoneum and are usually small; and intraperitoneal, in which the peritoneum covers the entire portion of herniated bladder . The most common etiologies of bladder hernias are: obesity, weakness of the pelvic wall, bladder outlet obstruction, and decreased tone of the bladder . In our case the patient had a history of hernia repair 53 years ago, however, whether a history of herniorrhaphy affects the occurrence of bladder hernia is uncertain . Bladder hernias are usually asymptomatic but are often associated with intermittent swelling in the groin and significant lower urinary tract symptoms . In cases of large hernias the patients typically present with two - stage micturition, involving spontaneous bladder emptying with a second stage manual compression of the hernia . The differential diagnosis includes: bladder diverticulum, hernia of a mesenteric cyst, hydrocele and spermatic cord cyst . The radiological diagnosis can be established by cystography, ultrasonography, and intravenous pyelography or computed tomography . The numbers of cases of hernia which contain a tumor of the urinary bladder being published are low (table 1). The purpose of treatment is to remove the tumor, repair the hernia and correct the obstructive condition of any lower urinary tract . The patient survival is low due to the delay and difficulty in obtaining an accurate diagnosis . Despite the overall poor prognosis inguinal bladder hernias are relatively uncommon, with few (22) reports of tumor in the herniated bladder have been published in the international literature (medline / pubmed). The surgical management consists of removing the herniated bladder tissue containing the tumor with a marginal of safety, and repairing the hernia, with careful urological follow up . Written informed consent was obtained from the patient of the publication of this case report and accompanying images . A copy of the written consent is available for review by the editor - in - chief of this journal of request . Anastasios katsourakis participated in the design of the study and drafted the manuscript; george noussios participated in the coordination and helped to draft the manuscript; christos svoronos performed the literature review; michael alatsakis helped to draft the manuscript; efthimios chatzitheoklitos participated in the coordination.
Cognitive impairment caused by various diseases associated with the aging of the population has become a recent concern1 . Although many studies have been done on patients with cognitive disorders, a clinical screening tool for specific cognitive characteristics has not been developed3 . Stroke patients show cognitive disorders during the neurological recovery process, making early intervention through screening necessary4 . The mini - mental state evaluation (mmse), which is commonly used for screening cognitive impairment, has been studied in patients with dementia5 . Simple methods of screening for stroke patients with cognitive characteristics and objective inspection tools are needed . The clock drawing test (cdt) developed by applying rasch analysis can screen patients with cognitive impairment in a short time . The appropriate items and rating scales for the cdt were selected according to the characteristics of cognitive problems in a previous study6 . On the other hand, therefore, the aim of this study was to confirm the clinical usefulness of the cdt by applying rasch analysis to predict cognitive impairment . The study participants were enrolled from patients at 10 rehabilitation hospitals in south korea . All subjects provided written informed consent to participate in this study in accordance with the ethical standards of the declaration of helsinki . Participants without visual problems or a history of other neurological diseases other than stroke were included . The mmse is the most widely used assessment tool for the screening of cognitive abilities7 . In this study, 187 patients were evaluated by the cdt developed through rasch analysis along with the mmse . The data were analyzed according to the general characteristics of the subjects to increase the clinical utility of the cdt . In addition, the cutoff point was classified to identify cognitive impairment in the cdt, and the sensitivity and specificity were analyzed . The cdt composed of 16 items in 6 areas could objectively evaluate the cognitive characteristics based on the task to be carried out6 . Analysis of variance was performed to examine the significance of the mmse and cdt according to the general characteristics of the subjects . Receiver operating characteristic (roc) analysis was performed to produce a cutoff point for cognitive impairment and calculate the sensitivity and specificity values . Roc analysis was used to determine the optimal cutoff values and the cognitive dysfunction of bias in this study . A comparison of the mmse and cdt in accordance with the general characteristics of the subjects showed significant differences according to gender, age and education for both tools (table 1table 1.difference between the mmse and cdt according to general characteristics of the participants (n=182)characteristicsnmmsepost hoccdtpost hoc(m sd)(m sd)gendermale11723.2 5.9(a> b)10.6 3.8(a> b)female6521.5 5.38.7 4.0age 49 or less2325.0 5.5(a, b, d> e)12.1 2.9(a, b> e)(years)50594424.6 3.911.3 3.2(a> d)60695321.5 6.79.5 4.370794522.6 5.19.1 3.780 or more1717.6 5.46.8 3.8educationno education1521.9 4.1(d, e> b)6.4 3.7(d, e> a, b)(school)elementary5520.3 6.28.7 3.9middle1823.0 3.99.2 3.5high4723.8 5.511.0 3.6university or more4724.1 5.911.5 3.4after stroke3 or less5621.8 5.59.1 4.3(months)462522.3 6.09.6 4.27122523.0 5.210.4 3.813243725.1 3.410.9 3.225 or more3921.3 7.410.0 3.9dominant handright17322.6 5.79.8 3.9left421.5 8.39.5 5.5both524.4 6.012.2 3.6affected side(brain)right9323.1 5.410.1 3.9(a, b> c)left8022.3 6.110.0 3.9both, etc.920.2 7.36.7 3.8type of damageinfarction13422.7 5.79.9 4.0hemorrhage4722.6 6.19.9 3.9other116.0 0.08.0 0.0item number in areas (a=1, b=2, c=3, d=4, e=5)). In both tools, males showed higher cognitive skills than women . In the case of age, those 7080 years of ages showed significant differences compared with younger patients . In the case of education, patients with no education or an elementary school education showed significant differences compared with those with a high school or college education . Analysis of the duration after stroke revealed a significant difference between the tools, but there were no significant differences according to time period . Item number in areas (a=1, b=2, c=3, d=4, e=5) a total cdt score of 10.5, which was selected as the cutoff point to identify cognitive impairment, showed sensitivity, specificity, and youden index values of 86.4%, 91.5%, and 0.8 . In addition, the cdt showed positive and negative predictive values of 95% and 88.2%, respectively, compaired with the mmse (table 2table 2.prediction of cognitive impairment in accordance with the cdt (n=182)cdt (total score)mmse (total score)predictive value (%) cognitive impairment (<24)normal (24)10764ppv=95.0>111290npv=88.2youden index (%) sensitivity=86.4, specificity=95.7ppv: positive predictive value; npv: negative predictive value). This study was performed to enhance the clinical usefulness of the cdt by applying rasch analysis for predicting of cognitive impairment . The cdt can enable the assessment and early intervention in patients with cognitive impairment8 . The usefulness of cdt for the screening of cognitive impairment has been reported . In particular, the cdt applying rasch analysis is an objective and reliable assessment tool, and it enables the ability of individuals can be evaluated mathematically9, 10 . Examination of the validiry of the cdt by comparison with the mmse showed similar significant differences according to gender, age, and education . The cdt and mmse reflect different cognitive characteristics, which may have affected the results . These results showed that the cdt could be a useful tool for the screening of cognitive impairment5, 11 . Rasch analysis was applied to the cdt for tool development because it enables the ability of individuals be measured accurately by based on the item response theory . The clinical advantage of the cdt in screening for cognitive disorders was confirmed through roc analysis12 . The standard cdt determines that a patient may have a cognitive impairment when the patient scores have less than 10 points . The positive predicted value was 95.0%, which represents the probability of cognitive dysfunction for positive test results, and the negative predictive value was 88.2%, which represents the probability of cognitive function being normal for negative test results; these values were based on a cutoff of 10 points . The cdt is believed to be useful in assessments and interventions based on its excellent ability to identify cognitive impairment6, 13,14,15 . In addition, it must not be sensitive to different environments, and the sensitivity and specificity must be high16 . Therefore, the cdt applying rasch analysis is a useful tool for screening high - risk patients with cognitive impairment . Nevertheless, a follow - up study of the cdt for patients with a variety of diseases will be needed.
Gestational trophoblastic disease (gtd) encompasses a spectrum of pregnancy - related disorders that includes benign, pre - malignant disorders (complete and partial hydatidiform mole), and persistent, malignant disorders (invasive mole, choriocarcinoma, placental site trophoblastic tumor and epithelial trophoblastic tumor). Gestational trophoblastic neoplasia (gtn) is a term used for the persistent / malignant disorders . All these pathologies derive from trophoblast and differ in their propensity in invasion (local or general) or spontaneous resolution . Most women with molar pregnancy can be cured by removal of the products of conception and fertility is preserved ., the growth continues, and gestational trophoblastic tumor (gtt) or gestational trophoblastic neoplasia (gtn) occurs . Patients with gestational trophoblastic neoplasia are categorized into low and high risk according to the international federation of gynaecologists and obstetricians (figo). The prognosis depends largely on early diagnosis and the start of chemotherapy adapted to the 2000 figo score . Single - agent chemotherapy is achieved by the combination of methotrexate and folinic acid or using dactinomycin . The first - line treatment of high - risk gtn is multi - agent chemotherapy using ema - co (etpososide methotrexate - actinomycine d- cyclophosphamide - oncovin). Treatment failure reasons are often known as a delay in diagnosis, care and drug resistance . In africa, particularly in senegal, patients are often seen late . Therefore, the aim of this study was to analyze the deaths after gestational trophoblastic neoplasia to determine treatment failure factors . This is a retrospective study of patients with gestational trophoblastic neoplasia diagnosed and supported at the obstetric and gynecologic clinic at dakar teaching hospital between 1 january 2006 and 31 december 2014 . We took into account socio - epidemiological characteristics of patients, initial diagnosis, time between uterine evacuation and admission, time to onset of gtn, treatment (deadlines, protocols), difficulties encountered in the implementation of therapy and survival . All patients were initially supported in other health centers for uterine evacuation and referred to our center for monitoring . Figo staging and scoring system are detailed in tables 1 and 2 . For patients admitted before that date, we tried to assess risk based on information available in the files . International federation of gynaecologists and obstetricians (figo) anatomical staging modified who prognostic scoring system as adapted by international federation of gynaecologists and obstetricians (figo) score-6: low - risk group score-7: high - risk group from that date, chemotherapy with methotrexate every 14 days was prescribed for patients at low risk . For patients with a score greater than or equal to 7, multi - agent chemotherapy (ema - co) was proposed . Otherwise, a chemotherapy combining various drugs was proposed and administered: etoposide - cisplatin, etoposide endoxan - methotrexate, methotrexate -5fu - etoposide . Data were entered and analyzed using spss (statistical package for social science) 19.0 . In total, 1044 patients were admitted during the study period, 164 cases (15.7%) of gestational trophoblastic neoplasia (gtn) were diagnosed and 21 deaths occurred leading to a specific lethality of 12.8% (21/164). The average age was 30 years with a low of 16 and high of 54 years and the average parity, 3 (range 0 to 10). Almost all patients (n = 18; 85.7%) had low income or any income . The average time between the initial evacuation of hydatidiform mole and the first contact was 3.6 months . Eight of 21 patients (38.1%) were seen in our department beyond 2 months after uterine evacuation . The mean time to onset of gestational trophoblastic neoplasia was 22.1 weeks (5.5 months). In 71.7% of patients, histology was not carried out after initial uterine evacuation, the diagnosis of hydatidiform mole was made on clinical and ultrasound features and that of gestational trophoblastic neoplasia on history, evolution of human chorionic gonadotrophin (hcg) and ultrasound findings . Characteristics of patients none of the patients had regular chemotherapy . Instead of a cycle of methotrexate every 14 days, the average time between cycles was 4 weeks . Some patients took a break after two cycles and came back after collecting the amount needed to buy drugs and continue treatment . The single - agent chemotherapy cycle with methotrexate is financially estimated between cfa 35,000 and cfa 42,000 ($50 and $60) (folinic acid excluded). For multi - agent chemotherapy using emaco (etoposide, methotrexate, dactimomycine, cyclophosphamide and vincristine), cfa 250,000 ($355) were needed per cycle . This protocol was hardly implemented . Patient s diagnostic and therapeutic characteristics are summarized in table 4 diagnostic and therapeutic characteristics of deceased patients lr: low risk, hr: high risk, mtx: methotrexate, 5fu: 5 fluoro - uracile, vp16: etoposide, emaco: etoposide, methotrexate, dactinomycine, cyclophosphamide, oncovin, htr: hysterectomy, revised classification (using 2000 figo scoring system) seven out of 21 patients who were deceased within 3 months after diagnosis had metastatic tumors . Patients who were at low risk with relatively long survival (n=3) had begun their treatment and stopped it . An exploration of the achievement of the disease was not carried out for financial reasons . Moreover, they could not benefit from chemotherapy because of their overall condition . In all, 10 of the 12 women at high risk according to figo did not receive multi - agent chemotherapy (ema - co) for exclusively financial reasons . The average survival time was 9.9 months ([95% ci] 5.369 - 14.429) and the median was 2.87 months ([95% ci] 0.000 - 14.982) as shown in figure 1 . In total, 1044 patients were admitted during the study period, 164 cases (15.7%) of gestational trophoblastic neoplasia (gtn) were diagnosed and 21 deaths occurred leading to a specific lethality of 12.8% (21/164). The average age was 30 years with a low of 16 and high of 54 years and the average parity, 3 (range 0 to 10). Almost all patients (n = 18; 85.7%) had low income or any income . The average time between the initial evacuation of hydatidiform mole and the first contact was 3.6 months . Eight of 21 patients (38.1%) were seen in our department beyond 2 months after uterine evacuation . The mean time to onset of gestational trophoblastic neoplasia was 22.1 weeks (5.5 months). In 71.7% of patients, histology was not carried out after initial uterine evacuation, the diagnosis of hydatidiform mole was made on clinical and ultrasound features and that of gestational trophoblastic neoplasia on history, evolution of human chorionic gonadotrophin (hcg) and ultrasound findings . Characteristics of patients none of the patients had regular chemotherapy . Instead of a cycle of methotrexate every 14 days, the average time between cycles was 4 weeks . Some patients took a break after two cycles and came back after collecting the amount needed to buy drugs and continue treatment . The single - agent chemotherapy cycle with methotrexate is financially estimated between cfa 35,000 and cfa 42,000 ($50 and $60) (folinic acid excluded). For multi - agent chemotherapy using emaco (etoposide, methotrexate, dactimomycine, cyclophosphamide and vincristine), cfa 250,000 ($355) were needed per cycle . Patient s diagnostic and therapeutic characteristics are summarized in table 4 diagnostic and therapeutic characteristics of deceased patients lr: low risk, hr: high risk, mtx: methotrexate, 5fu: 5 fluoro - uracile, vp16: etoposide, emaco: etoposide, methotrexate, dactinomycine, cyclophosphamide, oncovin, htr: hysterectomy, revised classification (using 2000 figo scoring system) seven out of 21 patients who were deceased within 3 months after diagnosis had metastatic tumors . Patients who were at low risk with relatively long survival (n=3) had begun their treatment and stopped it . An exploration of the achievement of the disease was not carried out for financial reasons . Moreover, they could not benefit from chemotherapy because of their overall condition . In all, 10 of the 12 women at high risk according to figo did not receive multi - agent chemotherapy (ema - co) for exclusively financial reasons . The average survival time was 9.9 months ([95% ci] 5.369 - 14.429) and the median was 2.87 months ([95% ci] 0.000 - 14.982) as shown in figure 1 . The figo oncology committee at its meeting during the xxvi figo world congress of gynecology and obstetrics in washington dc in september 2000 revised the staging system of gestational trophoblastic neoplasia (gtn). The following criteria were retained: gtn may be diagnosed when the plateau of human chorionic gonadotropin (hcg) lasts for four measurements over a period of 3 weeks or longer; that is, days 1, 7, 14, 21.gtn may be diagnosed when there is a rise of hcg of three weekly consecutive measurements or longer, over at least a period of 2 weeks or more; days 1, 7, 14.gtn is diagnosed when the hcg level remains elevated for 6 months or more.gtn is diagnosed if there is a histologic diagnosis of choriocarcinoma . Gtn may be diagnosed when the plateau of human chorionic gonadotropin (hcg) lasts for four measurements over a period of 3 weeks or longer; that is, days 1, 7, 14, 21 . Gtn may be diagnosed when there is a rise of hcg of three weekly consecutive measurements or longer, over at least a period of 2 weeks or more; days 1, 7, 14 . Two points are capital: the diagnosis of gtn must be early because it has prognostic influence; the treatment must be appropriate, treating the real early gestational trophoblastic neoplasia by validated chemotherapy protocols . Chemotherapy with methotrexate leads to 90.2% remission in stage i and 68.2% for stage ii and iii . Sekharan et al . Found a complete response rate of 93% on a series of 321 patients . Gestational trophoblastic tumors at high risk should be treated immediately by multi - agent chemotherapy . The emaco protocol results in complete remission up to 100% in high - risk stage ii and between 76 and 97.3% in higher stages and metastatic conditions . The second line treatment is ep - ema (etoposide - cisplatin / etoposide methotrexate, dactinomycin), which provides 70 - 76% remission after failure of first - line chemotherapy with ema - co . Criteria for the diagnosis of trophoblastic neoplasia are used in our department since 2011; chemotherapy protocols are also recommended by level of risk . The particularity of our health system is the lack of health insurance . Although some tests are supported, chemotherapy drugs are in charge of patients and their families . This situation leads to lack of normal monitoring of hcg which delays the diagnosis of gestational trophoblastic neoplasia and worsens the prognosis of these patients . Chemotherapy adapted to low - risk figo score is estimated between cfa 35,000 ($50) and cfa 42,000 ($60) per cycle . Patients and their families we rarely prescribe folinic acid in rescue; a bottle of folinic acid costing more than the methotrexate cycle a cycle of em - aco protocol (d1, d2 and d8) is financially valued at cfa 250,000 ($355). This represents more than the average wage of a senegalese worker . We cannot hope for cancer convincing results if drugs are in charge of patients . This inequity in care is our daily challenge both in the treatment of gestational trophoblastic neoplasia and in other cancers such as breast cancer . Indeed, a social worker in our department regularly approaches some persons who accept willingly to sponsor some patients . But the treatment is long and expensive; this approach has also shown the limits of its efficiency . Patients with short survival had already gestational trophoblastic neoplasia when admitted in our department, several months after uterine evacuation . The upstream monitoring was not properly insured . On admission, they had visceral metastases . Unable to achieve the chemotherapy drugs appropriate to the risk, there have been prescribed a protocol adapted to their means or no protocol at all . This sad situation is a daily occurrence and requires a deep reorganization of our health system and a high awareness of practitioners to refer to time or declare all suspected cases of hydatidiform mole or gestational trophoblastic neoplasia . We cannot hope for cancer convincing results if drugs are in charge of patients . Chemotherapy adapted to low - risk figo score costs between cfa 35,000 ($50) and cfa 42,000 ($60) per cycle . For majority of our patients and their families this amount is unaffordable.a cycle of em - aco protocol (d1, d2 and d8) is financially valued at cfa 250,000 ($355). Chemotherapy adapted to low - risk figo score costs between cfa 35,000 ($50) and cfa 42,000 ($60) per cycle . A cycle of em - aco protocol (d1, d2 and d8) is financially valued at cfa 250,000 ($355).
Intussusception is not a rare disease in children, however in adults it accounts for only 1% of bowel obstructions, and 5% of all intussusceptions . We herein report a preoperatively diagnosed case of adult intussusception caused by a small bowel lipoma . A 33-year - old man was admitted to our hospital with three weeks history of colicky epigastric pain . Before admission the patient had been hospitalized at another hospital, but the cause of the repeated colicky epigastric pain had not been identified . The patient had no significant past medical history of illnesses nor any hospitalization otherwise . On physical examination, the abdomen was flat and no tumor was palpable . 1). Colonoscopy revealed ileocolic intussusception, but no obvious cause was identified (fig . Barium enema for reduction of the ileocolic intussusception showed a small bowel tumor in the ileum 15 cm proximal to the ileocecal valve (fig . Reduction of the intussusception under barium enema was succeesful, and the patient underwent laparotomy the next day . However, recurrent ileocolic intussusception was found, for which a manual reduction and a partial resection of the ileum encompassing the small bowel tumor in the ileum 15 cm proximal to the ileocecal valve was performed . The resected specimen showed a soft and yellowish - white submucosal tumor with a diameter of 40 25 mm . Histological findings revealed fat cells proliferating in the submucosal layer and confirmed the diagnosis of lipoma of the small bowel . Adult intussusception is rare and usually caused by a tumor acting as the apex of the intussusception . Therefore, such a condition should indicate the possibility of the presence of malignancy in the bowel . However, it has been reported that 52 - 80% of cases of adult small bowel intussusception are caused by benign entities, such as lipoma, hamartomatous polyp, inflammatory polyp, hyperplastic polyp, meckel's diverticulum or surgery - related lesions . Because benign tumors of the small bowel are commonly polypoid - shaped, the intussusception usually develops before the tumor has grown to a size sufficient to obstruct the passage of the small intestinal contents . Small intestinal tumors are rare, accounting for 1 - 2% of all gastrointestinal tract tumors . Moreover, preoperative diagnosis is often difficult because of the lack of specific clinical symptoms and difficulty with the examination of the small intestine . Computed tomography and ultrasonography of the abdomen . However, further examinations such as barium enema or endoscopic ultrasonography are useful in cases of difficult diagnosis . It is accepted that gentle preoperative or operative reduction can be attempted safely to avoid unnecessary operation . Laparoscopic surgery for intussusception is increasing, and successful reduction of intussusception recently has been reported . Although more technically difficult than laparotomy, with an increased risk of perforation and dissemination and metastasis in cases of malignancies or with intestinal dilatation, laparoscopic surgery seems to become a procedure of choice for intussusception caused by benign intestinal tumors in the future.
Ropivacaine is a local anaesthetic (la) effective for both intraoperative anaesthesia and post - operative analgesia . For peripheral nerve blockade, however, the lower lipid solubility of ropivacaine causes greater sensory and motor differential blockade . Though this is an advantage when analgesia with minimal motor block is required, it may be a drawback in orthopedic procedures where reduction of fracture is dependent on good muscle relaxation . Dexemedetomidine, an 2 adrenoreceptor agonist, has evinced a lot of interest of late as a useful additive to local anesthetics in peripheral nerve blocks . The combination of dexmedetomidine and ropivacaine has been associated with significant prolongation of the duration of sensory blockade and post - operative pain relief . However, its effect on the time of onset and the quality of motor block with ropivacaine has been equivocal . Drugs added as adjuvants to las may be systemically absorbed and interact with general anaesthetics . Though intravenous (iv) dexmedetomidine may decrease the requirement of anaesthetic agents during ga, the interaction of perineural dexmedetomidine with ga has not been evaluated . In this study, we investigated whether the combination of dexmedetomidine and 0.5% ropivacaine improved the quality, time to onset and duration of the supraclavicular brachial plexus block . After obtaining the informed written consent from patients and institutional ethics committee clearance (no . Ec / nims/1445/2013), 36 patients of american society of anaesthesiologists [asa] physical status i - ii scheduled for surgery of fractures of shaft of humerus, elbow and forearm under supraclavicular block and ga were enrolled for prospective, double blind randomised controlled trial . Patients receiving beta blockers, with difficult airway, ischemic heart disease, head injury and pregnant women were excluded . Patients were randomly allocated using a computer generated randomisation sequence to receive either 35 ml of ropivacaine 0.5% with 0.5 ml of isotonic sodium chloride solution (group r, n - 18), or 35 ml of ropivacaine 0.5% with 0.5 ml (50 g) of dexmedetomidine (group rd, n - 18). The person who prepared the drug solutions was different from the person who administered the block and the person who monitored the quality and duration of block and the haemodynamics post - operatively . The anaesthetic plan was administration of supraclavicular brachial plexus block followed by induction of ga 45 min later . The combination of ga and block was planned to study the interaction of perineural dexmedetomidine with general anaesthetics as earlier studies reported sedation with its use . Also, surgeries on shaft of humerus and elbow are performed in the lateral position, hence, supplemental ga was preferred to just supraclavicular block alone . In the operating room, an iv cannula was inserted in the contralateral upper limb and standard asa monitoring was applied . Heart rate (hr), systolic arterial pressure (sap) and diastolic arterial pressure (dap), oxygen saturation (spo2) and sedation score according to ramsay sedation scale (rss) [appendix] were recorded before the block was performed . Under strict aseptic precautions and after infiltration of 2 ml lidocaine 2% locally, supraclavicular brachial plexus was located with a peripheral nerve stimulator (stimuplex, braun, germany) connected to a 21-gauge, 10-mm - long needle (vygon, france) by the classical kulenkampff method . The localisation of the plexus was considered optimal when an output current <0.5 ma caused contraction of the muscles of the hand or forearm . Sensory block in the territories of median, ulnar, radial and musculocutaneous nerves was assessed by pinprick test using a 3-point scale: 0 - normal sensation, 1 - loss of sensation of pinprick (analgesia), 2 - loss of sensation of touch (anaesthesia). Motor block was evaluated by thumb abduction (radial nerve), thumb adduction (ulnar nerve), thumb opposition (median nerve) and flexion at the elbow (musculocutaneous nerve) on a 3-point scale for motor function: 0 - normal motor function, 1 - reduced motor strength but able to move fingers, 2 - complete motor block . The onset time of the sensory and motor blocks were recorded by assessment of the block every 3 min for 45 min after injection of the la . The hr, sap, and dap were documented at every 5 min for 45 min . Sedation was assessed by rss every 5 min for 45 min after giving the block . A successful block was defined as a grade 2 sensory block in 3 or more nerve territories . The time of onset of sensory block was defined as the time between the administration of the la and complete sensory block . Duration of sensory block was defined as the time taken from the administration of la to complete recovery of anaesthesia on all nerves . The duration of analgesia was defined as the time to attain a visual analogue score (vas) of> 4 after the la administration . Motor block was designated incomplete when there is grade 1 motor block in the presence of complete sensory block . When both sensory and motor blocks were incomplete, this was termed as failure of block, and the patients were excluded from the study . Onset time of motor block was defined as the time interval between the completion of the la administration and complete motor block . In the case of an incomplete motor block at the induction of ga, which progressed to complete motor block at extubation, duration of motor block was defined as the time to the recovery of complete motor function of the hand and forearm after the administration of la . The patient was pre - medicated with 1 g / kg fentanyl and 0.2 mg glycopyrrolate iv . Electroencephalogram (eeg) entropy was measured with a special electrode applied to the forehead and connected to the entropy module (m - entropy plug in module, s/5: datex - ohmeda, finland). After 5 min, the patient was induced with 30 mg boluses of thiopentone sodium (tps) given iv every 30 s, while monitoring the verbal response and both state entropy (se) and response entropy (re). The dose of tps required to induce loss of verbal response (tps - lovr) and for the re to decrease to below 60 (tps - entropy) were noted . The patient was ventilated with face mask at a respiratory rate of 14/min with 50% o2 and 50% n2 o and the trachea was intubated 2 min after giving 0.6 mg / kg rocuronium by a single experienced anaesthesiologist . The hr, sap and dap were recorded after induction, during laryngoscopy and endotracheal intubation, 1, 2, 3, 4, 5, 15, 30, 45, 60, 90 and 120 min after intubation and 5 min after extubation . The end tidal concentration of isoflurane was noted as iso - et at every 10 min interval, and the average was taken at the end of surgery . Additional doses of 0.5 g / kg fentanyl were administered if the difference in re and se> 10 . The muscle relaxation was maintained with boluses of 10 mg of inj . Rocuronium iv if there was clinical sign of recovery from muscle relaxation (evidenced as spontaneous breathing on capnography). Adverse perioperative events comprising of hypoxemia (spo2 <90%), a decrease in sap> 20% from the baseline value), bradycardia (hr <50 beats / min), or nausea and vomiting were noted from the time of institution of block to conclusion of the study . Post - operatively hr, sap, dap and sedation score (ramsay score 1 - 6) were recorded every 30 min for 2 h. the sensory and motor block were assessed every 30 min after surgery until they resolved . Pain was assessed using the vas every 30 min, and when the vas was> 4, the patient received inj tramadol 2 mg / kg as rescue analgesic and the study was discontinued . Sample size calculation was performed using pass from the data of a recently published study, which reported a significantly earlier onset of motor blockade (21 min in rd group and 47 min in r group). Twelve patients were needed in each group to achieve 75% power with significance of 0.05 using two sided t - test to detect a difference of 26 min . Statistical analysis was performed with statistical package for social sciences 17.0 developed by ibm corporation for windows . Eighteen patients in each group were enrolled for the study . Due to inability to localise the brachial plexus, one patient in each group was excluded . Two patients in r group and one patient in rd group were excluded due to failure of block . Thirty - one patients (15 in the r and 16 in the rd group) were included in the final analysis of the results . The demographic data and surgical characteristics were comparable in both groups [table 1]. The demographic data and surgical characteristics of both groups the onset of sensory blockade was faster in the rd group . The duration of sensory blockade and analgesia was significantly prolonged in group rd (p <0.05) [table 2]. Onset of sensory and motor blockade; duration of sensory, motor block and analgesia the proportion of patients who achieved complete motor blockade was more in the rd group . Five out of 15 (33%) patients in r group and 2 out of 16 (12%) in rd group had incomplete motor blockade and complete sensory block before induction of ga . In these 7 patients, 2 patients in the r group and 1 in the rd group had complete motor blockade at extubation . In these 3 patients, the time for the onset of motor blockade was taken as 45 min . In the remaining patients (three patients in r and 1 patient in rd group), the time to the highest grade of block achieved was noted as the onset time . The onset of motor block was significantly faster in group rd [table 2]. In the patients who did not have complete motor blockade, time to recover from the highest degree of block achieved was recorded as the duration of motor blockade . The duration of motor block was prolonged in group rd (p <0.05) [table 2]. The hr was significantly lower at 30, 35, 40, 45 min after administration of block, at induction, intubation, 1, 2, 3, 4, 5, 15, min after intubation and at 5 min after extubation in rd group (p <0.05) [figure 1]. However, the incidence of bradycardia (hr <50/min) was similar in both rd and r group . The sap was significantly lower in the rd group at 30, 35, 45 min after the institution of block and at 4 and 5 min after intubation . The dap was significantly lower in the patients in rd group at 5 min after intubation (p <0.05) [figure 2]. Transient hypotension (> 20% fall in baseline systolic blood pressure) was seen in 3 of the 16 patients in the rd group and none in the r group after addition of isoflurane for maintenance of anaesthesia which responded to iv fluids and 6 mg bolus of iv mephentermine . R ropivacaine; rd ropivacaine dexmedetomidine comparison of blood pressure changes in the r and rd group . R ropivacaine; rd ropivacaine dexmedetomidine; sap systolic aortic pressure, dap diastolic aortic pressure pre - induction, the patients in rd group had significantly higher scores on rss (p - 0.00) [figure 3]. The onset of the sedation was noticed about 10 min after the injection of the drug, and the rss continued to be higher in these patients up to the time of induction of ga . The dose of thiopentone for lovr was significantly lower in the rd group in comparison to r group (p - 0.00). However, there was no difference in the requirement of thiopentone in either group when the end point of induction was taken as entropy <60 . Also, the requirement of isoflurane to maintain entropy between 40 and 60 was not different in either group . None of the patients in either group needed additional doses of fentanyl and rocuronium [table 3]. R ropivacaine, rd ropivacaine dexmedetomidine (p <0.05) requirements of anaesthetic agents there was no significant difference in the incidence of nausea and vomiting in either group . There was no incidence of persistent paraesthesias or residual weakness of the operated upper limb in any patient before discharge from the hospital . Brachial plexus block is commonly used as a sole anaesthetic technique or may be supplemented with ga for surgeries on the upper limb . Many adjuvants are added to las to hasten the onset and prolong the duration of the block . Dexmedetomidine, an alpha 2 agonist, has been used with las in regional blocks and iv regional anaesthesia and has been found to significantly reduce the onset time and prolong the duration of sensory block and analgesia . The action of dexmedetomidine in peripheral nerve blockade seems to be due to increase in hyperpolarization activated cation current that prevents the nerve from returning to resting membrane potential . It has been used in combination with various las like levobupivacaine 0.5%, bupivacaine 0.25% and ropivacaine 0.75% and 0.5% and in various plexus and nerve blocks like axillary, posterior tibial, supraclavicular and ulnar nerve . Though lignocaine causes profound muscle relaxation, it may be associated with significant local nerve toxicity . Bupivacaine not only causes motor sparing but also has serious cardiac complications if accidental intravascular injection occurs . However, ropivacaine causes a greater sensory and motor differential blockade than bupivacaine which is dose dependent, with higher concentrations (1%) causing greater degree of motor blockade than lower concentration (0.5% and 0.75%). Combination of dexmedetomidine and ropivacaine increases the duration of sensory blockade and analgesia, but its efficacy in improving the onset time, duration and the quality of motor blockade has been equivocal . Evaluated the effect of 1 g / kg dexmedetomidine added to 0.5% ropivacaine in posterior tibial nerve block . In their study, although the duration of sensory block was significantly prolonged (by 5.3 h), the motor blockade was incomplete with ropivacaine and dexmedetomidine did not affect the quality of motor block . In another recent study by marhofer et al . They compared three drug regimes with ropivacaine 0.75% (r), interaction of ropivacaine 0.75% with systemic dexmedetomidine or peineural dexmedetomidine on ulnar nerve block . Onset of motor block was faster, and the duration of motor block was significantly prolonged by the perineural administration of dexmedetomidine . This study was undertaken to elucidate the influence of dexmedetomidine added to 0.5% ropivacaine for supraclavicular brachial plexus block on the characteristics of sensory and motor block with particular emphasis on the quality of motor blockade . Addition of dexmedetomidine to ropivacaine 0.5% shortened the onset time of motor block and significantly extended the duration of sensory and motor blocks and the duration of analgesia . Though the difference in the onset time between the groups was statistically significant, the sample size was not sufficiently powered to exclude an alpha error . The discrepancy in the onset time in the earlier study could have been as a result of this . The study had a power of 87% to detect this difference with an alpha error of 0.00001 . We conclude that dexemedetomidine causes faster onset, extends the duration and improves the quality of motor blockade . Intravenous dexmedetomidine acts on locus coeruleus and causes sedation that mimics non - rapid eye movement sleep . Significant sedation with the use of perineural dexmedetomidine was observed in our study and was thought to be due to systemic absorption of dexmedetomidine . Ramsay sedation score was at least one point higher in the rd group when compared to r group . But unlike rancourt et al . Who observed the effect between 60 and 120 min after the injection, the onset of sedation was seen as early as 10 min and patients in rd group continued to have a higher rss until induction of ga . This variation could be explained by the fact that the site of peripheral nerve block in both the studies was different and systemic absorption is faster with supraclavicular than posterior tibial nerve block . Due to the sedation, however, when objective measure of depth of anaesthesia like entropy was used neither the dose of thiopentone for induction nor the mac of isoflurane for maintainence of anaesthesia was decreased in the rd group . From this, we hypothesize that though perineural dexmedetomidine reaches the systemic circulation in concentrations to cause sedation, the blood levels are not sufficiently high to influence the eeg entropy . Esmaoglu et al . In their study reported that the addition of 100 g of dexmedetomidine to levobupivacaine for axillary block caused a high incidence of bradycardia . But when lower doses (1 g / kg, an average of 5060 g total) were used, the incidence of bradycardia was not significant . Three patients in rd group had transient hypotension, the incidence of which is similar to that reported in earlier studies . Hypotension occurred between 15 and 60 min after ga was induced and was treated with iv fluids and mephenteramine . Therefore, we conclude that the interaction of perineural dexmedetomidine with ga does not seem to increase the incidence of bradycardia and hypotension . Firstly, the fixed dose of 50 g of dexmedetomidine was chosen empirically as earlier studies of higher doses of the drug showed significant bradycardia . We wanted to ascertain whether the lower dose of the drug was effective in improving the quality of block without causing significant side effects . Secondly, a total of 7 patients in the study (5 in rd and 2 in r group) did not achieve complete blockade at the time of induction . Among the 7, in 3 patients complete motor block was observed at extubation . In these patients, the addition of 50 g of dexmedetomidine to 0.5% ropivacaine for supraclavicular brachial plexus block extended the duration of the sensory and motor blockade and post - operative analgesia . Though perineural dexemedetomidine causes sedation, it does not reduce the requirement of anaesthetic agents when used in conjunction with ga . Further research is needed to study the pharmacokinetics of perineural dexmedetomidine and the effects of its systemic absorption.
3-hydroxy-3-methylgutaryl coenzyme a (hmg - coa) reductase inhibitors (statins) are cholesterol - lowering drugs which work by blocking the rate - limiting step in the cholesterol synthesis pathway (fig . 1). Stains are the most frequently and widely used medication in the treatment of cardiovascular disease, diabetes, and cancer to reduce cholesterol levels (e.g., ldl - cholesterol) by inhibiting the formation of mevalonate (a precursor to cholesterol), ubiquinone (coenzyme q), and other compounds . Although statins have a number of beneficial effects including a lipid - lowering effect, improved endothelial function, anti - inflammation, and insulin sensitivity, statins, particularly lipophilic statins (e.g., simvastatin, atorvastatin, cerivastatin, and lovastatin), also cause adverse side effects in skeletal muscle ranging from mild to moderate muscle fatigue, weakness, and pain to fatal rhabdomyolysis [46]. In fact, considering that the occurrence of less adverse side effects is not reported, the incidence of statin - induced myopathy may be 510%, and concerns about the safety of statins on skeletal muscle are expected to increase . However, the underlying mechanisms by which statins induce skeletal muscle side effects have not been clearly determined . Therefore, this review primarily focuses on statin - induced myopathy and the potential mechanisms of statin - associated myopathy . In addition, this review provides an overview of the role of exercise in stain - induced myopathy . Statins, widely prescribed cholesterol - lowering drugs for the treatment of dyslipidemia and cardiovascular disease, are associated with skeletal muscle - related complaints or myopathies . Apoptosis is programmed cell death that is highly regulated and executed via the activation of caspase dependent or independent signaling . In general, apoptosis plays an important role in governing development, growth, and repair in cells . However, excessive apoptosis may be associated with dysfunction, disease, and myopathy in skeletal muscle . It has been reported that statin treatment can induce apoptosis in skeletal muscle in both human [912] and rodent [1316] models . For example, simvastatin treatment (5 m) during 48 hours increased protein levels of proapoptotic protein bax and apoptosis marker tunel - positive nuclei in primary human skeletal muscle cells . Furthermore, kobayashi et al . Showed that cerivastatin treatment (100 m) during 2472 hours elevated apoptosis in rhabdomyosarcoma cells from human subjects . Mitochondria play a central role in regulating homeostasis as well as inducing apoptosis in skeletal muscle . Therefore, mitochondrial dysfunction is associated with the increase in the susceptibility to apoptosis and oxidative stress in skeletal muscle . Previous studies showed that statins might impair mitochondrial function in the skeletal muscles of humans [1723] and animals, leading to myopathy . For example, patients with hypercholesterolemia taking simvastatin (80 mg / day) for 8 weeks displayed a decrease in mitochondrial respiratory chain enzyme and citrate synthase activities . Stains also inhibit the synthesis of ubiquinone (coenzyme q10), a major electron carrier in the mitochondrial respiratory chain . However, statin treatment does not appear to consistently affect mitochondrial function in the whole body . . Showed that fat oxidation and respiratory exchange ratio (rer) did not change in patients with hypercholesterolemia taking atorvastatin (40 mg / day) for 8 weeks . Although numerous studies on statin - associated myopathy have been reported in animals and humans, the molecular mechanisms of statin - induced myopathy have not been completely elucidated . A variety of hypotheses regarding potential mechanisms of statin - induced myopathy have been proposed to gain insight into myopathy in skeletal muscle, including (a) deficiency of ubiquinone, (b) reactive oxygen species (ros) production, and (c) induction of apoptosis . Ubiquinone is located in the mitochondrial respiratory chain, where it plays an essential role in transferring electrons from complex i and ii to complex iii associated with oxidative phosphorylation and energy production . In addition, ubiquinone acts as a potent antioxidant in the inner mitochondrial membrane by scavenging free radicals . However, it has been shown that statins reduced levels of ubiquinone in muscle and blood (fig . The rationale of statin - induced decrease in ubiquinone is the fact that statins can inhibit the biosynthesis of ubiquinone as well as cholesterol in the cholesterol synthesis pathway as shown in fig . 1 . For example, blood and muscle concentrations of ubiquinone were decreased after short- and long - term treatment with statins, which suggests that deficiency of ubiquinone in mitochondria may impair cellular respiration resulting in skeletal myopathy and that supplementation with ubiquinone may be an appropriate therapy to counteract adverse side effects of statin treatment . In particular, superoxide (o2) free radicals are generated from complex i (mainly) and complex iii in the electron transport system and changed to hydrogen peroxide (h2o2). It has been recently reported that statin treatment increased oxidative stress in human skeletal muscle cells and fibers (fig ., we recently found that simvastatin treatment induced mitochondrial oxidative stress as indicated by increases in o2 and h2o2 production as well as impaired oxygen consumption supported by complex i substrates (glutamate + malate). In addition, it has been suggested that statin - induced myopathy is associated with apoptosis in skeletal muscle . As mentioned above, statins induce apoptosis in skeletal muscle, which may be an essential factor causing myopathy experienced by patients taking stains . In general, apoptosis is induced through three major apoptotic signaling pathways: the (a) mitochondrial - driven pathway, (b) cytokines / fas - driven pathway, and (c) endoplasmic reticulum (er)/ca - driven pathway . However, statin - induced apoptosis in skeletal muscle may be mitochondrial - mediated as indicated by an increase in bax, release of cytochrome c, active caspase-9, and caspase-3 by statin treatment . In particular, the increase in ros (e.g., o2 and h2o2) generation with statin treatment may play an important role in opening the mitochondrial permeability transition pore (mptp), which results in caspase dependent (e.g., cytochrome c and caspase-9) or independent (e.g., apoptosis inducing factor [aif] and endog) apoptosis in skeletal muscle (fig . 3), suggesting that statin - induced oxidative stress triggers mitochondrial - mediated apoptosis . For example, kwak et al . Demonstrated that simvastatin treatment induced apoptosis as well as oxidative stress in differentiated skeletal muscle cells . Exercise is regarded as one of the most cost effective ways to prevent metabolic and cardiovascular diseases and is recommended to patients as a lifestyle intervention to supplement drug therapy . However, the benefit / risk of exercise with statin therapy has not been thoroughly investigated . To date, the effects of exercise frequency, intensity, time or type on the risk of statin - induced myopathy have not been well studied . Most studies of the interactions of exercise and statin therapy include an acute / single exercise and indirect measures of muscle damage (i.e., blood creatine kinase [ck] levels). In contrast to statin - induced myopathy, chronic exercise training has the potential to counteract statin - induced side effects in skeletal muscle . For example, endurance exercise training increases mitochondrial biogenesis and mitochondrial respiration, and decreases oxidative stress and apoptosis in skeletal muscle . However, previous studies have shown inconsistent findings regarding the effects of exercise on statin - induced myopathy . While some studies reported that exercise seemed to increase the risk of statin - induced myopathy [3337], others suggested that exercise did not affect statin - induced myopathy [33,3842]. For example, 12 weeks of aerobic exercise training in combination with simvastatin (40 mg / day) decreased cardiorespiratory fitness and muscle citrate synthase activity in obese subjects . In addition, 2 weeks of treadmill exercise increased muscle damage in rats taking cerivastatin (0.51.0 mg / kg / day) for 2 weeks . In contrast, 10 weeks of endurance and resistance exercise training did not affect serum ck in hypercholesterolemic patients taking rosuvastatin (10 mg / day) for 20 weeks . Furthermore, meador and huey showed that 4 weeks of wheel running exercise with cerivastatin treatment (1 mg / kg / day) for 2 weeks prevented statin - associated force loss and increased fatigability in mice, suggesting that exercise prior to statin treatment can protect against statin - induced muscle dysfunction . Table 2 shows a summary of studies examining the effects of exercise on statin - induced myopathy in human and animal models . Although the mechanisms of statin - induced skeletal myopathy have not been determined, the mechanisms may be associated with ubiquinone deficiency, oxidative stress, and apoptosis . However, the underlying molecular and cellular mechanism by which statins affect mitochondrial function and apoptosis in skeletal muscle remains unknown . Furthermore, it is not clear whether exercise exacerbates statin - associated myopathy in skeletal muscle . Therefore, further studies of patients taking statins with different kinds of exercise are warranted to develop new strategies for statin - associated mitochondrial dysfunction and apoptosis leading to skeletal myopathy.
We included all children up to the age of 18 years, who sustained ocular injuries with firecrackers and presented to us during the festive season of diwali from 2009 to 2013 on 3 consecutive days - the day of diwali, 1 day before, and 1 day after diwali . The study was conducted in a tertiary care eye center in tamil nadu, southern india . We did a retrospective analysis of the medical records of children who presented to the ed of our hospital during the diwali season for 5 consecutive years . The study was conducted after obtaining the approval of the study site institutional review and ethics board . A complete slit lamp biomicroscopic examination and fundus examination were done in all patients at the time of presentation and on follow - up . All patients who sustained open globe injuries underwent preoperative imaging of the eye and orbit to rule out retained foreign bodies . The spectrum of ocular involvement was noted . Surgical intervention, when indicated, was done within 24 h of presentation to the ed . Demographic data of all the patients, the nature and site of injury, the initial and final va, and the intervention done were noted . Poor visual outcome was defined as vision <6/60 and unilateral blindness as <3/60 in the injured eye . Frequency and percentage were calculated for categorical variables, and mean standard deviation for continuous variables . Data were collated and analyzed using spss version 20 (ibm spss statistics for windows, version 20.0 . Eighty - four children presented with ocular injuries due to fireworks over 3 consecutive days during the diwali season between 2009 and 2013 . The age and gender distribution are given in fig . The mean age of boys was 9.8 4.2 years and that of girls 8.4 3.2 years . The youngest child was a 1-year - old boy who had sustained an injury while watching the celebrations with his mother . Twenty - six children (31%) sustained injury while watching, and 26 (31%) sustained an injury while igniting firecrackers themselves . History regarding the type of firecracker was not documented in 32 children (38.1%). Age and gender distribution the spectrum of eye involvement in the children in our study is summarized in table 1 . The most common site of injury was the cornea, which was affected in 51 (60.7%) children . Twenty - four (28.6%) children had lid and adnexal injury, 56 (66.7%) had anterior segment, and 17 (20.2%) had posterior segment involvement . Spectrum of ocular involvement in children with firecracker injury among the 84 children who presented to us, 37 (44%) required hospitalization . Parents of six children requested for discharge against medical advice . Among the remaining 31 inpatients, five had penetrating trauma to the globe, and three had intraocular foreign bodies (two in the posterior segment and one in the lens). All open globe injuries were managed surgically . All children with closed globe injuries who were treated as inpatients were managed conservatively, except for one child who underwent a superficial corneal foreign body removal under general anesthesia . One child with closed globe injury had an intraorbital foreign body; this child was lost to follow - up once poor visual prognosis due to retinitis sclopetaria and choroidal rupture were explained . Six of them underwent lens matter aspiration with intraocular lens implantation . Among the remaining four, one child had angle recession and anterior subluxation of the lens with corneal edema he underwent lens matter aspiration and partial anterior vitrectomy but was left aphakic due to corneal edema and macular scar . One child had cataract surgery with lens implantation but had poor vision due to choroidal rupture . After either surgical or medical intervention, 77.5% (93 eyes) had the good visual outcome (6/18 or better). Of the five open globe injuries, four had a poor visual outcome . Only one child with open globe injury with a foreign body within the lens had a good visual outcome . The prevalence of unilateral blindness in our study was 8% (95% confidence interval - 213%), with 10 children having final va worse than 3/60 . Visual outcome following ocular firecracker injury in children causes of unilateral blindness following firecracker injury in children on follow - up, many children were noted to have long - term complications, which could potentially compromise vision . Five children had angle recession and three who developed secondary glaucoma are on regular follow - up . Two children developed a traumatic macular hole, and epiretinal membrane was seen in one child . One child with severe facial burns developed lower lid cicatricial ectropion which was managed surgically . Many studies have reported on ocular injuries caused by firecrackers . However, to the best of our knowledge, there have not been any study focusing on ocular firework injuries in the pediatric age group . Kuhn et al . Found that up to 61% of firecracker injuries were sustained by children . Boys in the age group of 610 years constituted the majority (56.5%) of cases in our study . Marilyn et al . Reported one - third of permanent blindness among children who sustained ocular injury due to fireworks . In contrast, in our study, only three children (5.1%) with ocular injuries did not have even pl while 10 (11.9%) children had vision worse than 3/60 in the injured eye . Our study demonstrates the magnitude of severe ocular morbidity and loss of vision in children due to firecracker injuries . According to the literature, only 5% of injuries required hospitalization, while 44% in our study needed inpatient care . Among the 84 children who presented to us, one - third was only observing the event, and one - third acquired bilateral ocular injury . Vision loss in children causes a huge burden to the family as well as society . Factors such as hospital stay, psychological impact, loss of school days, and treatment expenses are also important considerations . Awareness needs to be created among children by parents and teachers, regarding the possible danger of injury from firecrackers and about the careful handling of these devices . This can be accomplished through school education programs and media campaigns via television, radio, and newspapers . Social workers and organizations also have a key role to play in creating public awareness and curbing blindness due to firecracker injury . The importance of strict parental supervision during these celebrations also needs to be emphasized . In india, the ministry of environment and forests has banned the manufacture, sale, and use of firecrackers generating noise levels exceeding 125 db or 145 db . The supreme court has also banned setting off firecrackers between 10 pm and 6 am during festival seasons . However, effective legislation regarding displays and celebrations involving firecrackers is generally lax in india . The central pollution control board estimates that 95% of firecrackers violate noise and pollution norms . Moreover, legislation regulating bursting of firecrackers by individual members of the public is virtually nonexistent . It is high time that stringent legislative measures are implemented to govern the use of fireworks both for public displays as well as by private individuals . Many countries have used legislative measures to regulate the use of fireworks . In the uk, it is an offense to throw or set off fireworks on any street, highway, or public place . According to the uk fireworks act 2003, it is an offense to possess fireworks in public places, and setting off fireworks during the night (between 11 pm and 7 am) is a punishable offense . The fireworks act in canada prohibits selling and setting off fireworks in the country, except between october 24 and november 1 in any year . It also specifies that fireworks may not be sold to a minor without the written permission of the parent or guardian of the minor . Implementation of similar legislative measures would go a long way in reducing firework - related injuries in india . Apart from these regulations, legislation should stipulate all safety measures including the age limit for independently handling these devices, as well as the minimum distance that has to be maintained while lighting firecrackers and watching fireworks . Regulations for the safe handling of these devices should be introduced and implemented to prevent further such injuries in the future . One of the limitations of this study is that we included only children who sustained firecracker injury during 3 consecutive days around diwali . This may have resulted in underestimation of the problem . As this was a retrospective study, we could not gather accurate information on preinjury vision, parental supervision, or the type of firecracker that caused maximal ocular damage . Ocular firework injuries that occur in children can result in considerable ocular morbidity and lead to permanent blindness . Assuming all eyes had a good vision before trauma, 1 out of 12 children injured by firecrackers in our study became blind unilaterally . It is imperative that adequate measures are taken through public education and legislation to ensure that celebrations involving fireworks are conducted in a safe manner to prevent ocular injuries and visual loss, especially in children.
It has a profound impact on every aspect of quality of life and is thus the dominant cause of total suffering for cancer patients even though pain relief is achievable in more than 90% of the cases . Inadequate pain relief in practice is well documented and can involve up to 40% of patients . Nurses have a key role in effective pain management; therefore, nurses knowledge is of critical importance in the care of patients with cancer pain. [46] the nurse's accurate assessment, prompt intervention, and adequate evaluation of pain relief measures are necessary for better clinical outcomes . However, nurses may not be prepared to assume a critical role because their lack of knowledge and individual attitudes on pain can interfere with their ability to effectively manage pain . The most common explanation is that nurses receive too little pain management education in their nursing curricula . The majority of studies determined that nurses answered less than 70% of questions correctly, indicating that many nurses continue to lack sufficient knowledge regarding appropriate pain management . One of the most important deficiencies of nurses about cancer pain assessment is that their assessment often focuses on patients behaviors rather than pain intensity and other descriptive characteristics of pain . As a result, most nurses have overestimated the percentage of patients who over - report their pain . It has been reported that opioid knowledge of nurses who cared for patients with cancer was generally weak . Nurses also were unaware that a common side effect of opioid analgesics, constipation, does not decrease over time . In addition, many nurses do not know that the incidence of psychologic dependence in patients with cancer is less than 1 in 1000 patients . Many studies have also demonstrated that negative nursing attitudes create barriers to effective cancer pain management . Howell et al ., found that nurses believed that their patients should experience pain first before being given pain medication . In their study affirmed that nurses have poor knowledge and negative attitudes toward the approach and treatment of patients in pain . The health belief model (hbm) is a psychological model that attempts to explain and predict health behaviors . The hbm was spelled out in terms of four constructs representing the perceived threat and net benefits: perceived susceptibility, perceived severity, perceived benefits, and perceived barriers . The purpose of this study was to identify the level of knowledge, attitude, and hbm constructs among aalzahra hospital nurses regarding the management of cancer pain . The health belief model (hbm) is a psychological model that attempts to explain and predict health behaviors . The hbm was spelled out in terms of four constructs representing the perceived threat and net benefits: perceived susceptibility, perceived severity, perceived benefits, and perceived barriers . The purpose of this study was to identify the level of knowledge, attitude, and hbm constructs among aalzahra hospital nurses regarding the management of cancer pain . In this cross - sectional study, 98 randomly selected nurses, who were employed in alzahra educational hospital in isfahan, iran, were enrolled in the study . All nurses agreed to participate in the study and therefore they did sign the consent form . Content and construct validity of the questionnaire was revised by a group of specialists in the field of health education, anesthesiology, and oncology . Reliability analysis was conducted for testing the reliability of knowledge and hbm constructs . Internal consistency of these sections of the questionnaire was calculated using cronbach's alpha technique (0.82 for knowledge, 0.79 for attitude, 0.75 for perceive benefits, 0.68 for perceived barriers, 0.72 for perceived threat, 0.74 for self - efficacy, and 0.85 for cues to action). The questionnaire contained two sections: (a) socio - demographic characteristics of nurses (such as sex, education, marital status) and (b) knowledge and hbm constructs . To assess the knowledge of nurses regarding cancer pain management each correct answer was given a score of 1 and each wrong answer a score of 0 . Hbm constructs section consisted of attitude (10 items), perceived benefits (5 items), perceived barriers (5 items), perceived threat (5 items), self - efficacy (5 items), and cues to action (5 items). For scoring this section of questionnaire, 5-point likert scale (0=strongly disagree, 1=disagree, 2=no opinion, 3=agree, and 4=strongly agree) was used . For negative questions, after completion of the questionnaire by the nurses, the obtained data were analyzed by spss (version 11.5, chicago, il, usa) using statistical tests (descriptive, pearson correlation, independent t - test) at the significance level of =0.05 . The demographic characteristics of the 98 nurses who responded to the questionnaire are presented in table 1 . As shown in the table, of the 98 nurses participating in the study, 81.6% were females, 67.3% were married, 80.6% had bachelors degree, and 68.4% had moderate income . The majority of nurses had insufficient knowledge and attitude regarding cancer pain management . Among the hbm constructs, perceived barriers and perceived threat were in low range . The nurses also reported high self - efficacy in cancer pain management [table 2]. Pearson correlation test showed that the knowledge of the nurses had a direct relationship with their attitude, perceived benefits, self - efficacy, and cues to action . But knowledge had reverse relationship with perceived barriers and perceived threat . The same test (pearson correlation) also indicated that nurses attitude regarding cancer pain management had a direct relationship with perceived benefits, self - efficacy, and cues to action, but had reverse relationship with perceived barriers and perceived threat [table 3]. Independent t - test showed that the mean scores of model variables in the two sexes had no significant difference (p>0.05). In other words, no relationship was observed between the two sexes and the mean score of hbm variables . Pearson correlation indicated that there was no significant relationship of age and work experience with the score of model variables (p>0.05). Demographic characteristics of the nurses participating in the study mean (sd) of the knowledge, attitude, and hbm constructs of nurses regarding cancer pain management pearson correlation coefficient between knowledge, attitude and hbm constructs this study provides important information about the level of nurses pain knowledge and attitude in isfahan, iran . The findings showed that on average, the nurses included in this study showed low scores on knowledge and attitudes regarding cancer pain management . In other words, these results demonstrated that the nurses knowledge and attitude about cancer pain management is far from optimal . Regarding knowledge section, inadequacy of health care professionals knowledge and education has been proposed as one of the major factors contributing to inadequate pain relief in cancer patients worldwide . It is also well documented that there is a lack of professional health care education about pain management, which has resulted in less than optimal pain management for cancer patients . An earlier survey has shown that an addiction to opioid is observed in less than 1% of cancer patients . In this study, only 12.4% of nurses correctly identified that less than 1% of patients who receive opioids for pain relief will develop addiction and 87.6% erroneously believed that addiction will occur in patients . Compared with the nurses in western countries, more nurses in this study our study's results revealed that among the hbm constructs, the highest mean score was related to self - efficacy . In other words, the participating nurses believed that they had enough ability to manage cancer pain issues such as emotional relationship with patients, to use the needed dose of opioid, and to give relevant information to the patient and his / her caregivers . 's study which had reported low self - efficacy among nurses regarding cancer pain management . We considered that, this difference may arise from work experience of our study subjects who have long - term clinical experiences . Regarding cues to action, results of this study indicate that 78.5% of nurses agreed with the important role of seminars and workshops to increase their knowledge toward cancer pain management . In mamishi's study, the most important source of information from nurses viewpoint was university curriculum . In our study, there was direct correlation between knowledge and other hbm constructs except for perceived barriers and perceived threat . It means with increasing knowledge of nurses, their perceived barriers and perceived threat regarding cancer pain management have been decreased . There was also a reverse correlation between nurse's self - efficacy and their perceived barriers and perceived threat . This finding is in accordance with earlier findings in this regard. [2931] the present study provides important information about nurse's knowledge and attitude deficits in pain management of cancer patients . When major medical and nursing textbooks published worldwide are examined, it is seen that pain makes up a small part of the content . In a study by ferrell et al . In 2000, it was observed that pain - related issues and pain management were addressed in only 284 of 45,683 pages in nurses textbooks . Additionally, it is reported that baccalaureate nursing programs allocate little time to pain management . First, the sample size was relatively small and may not represent all nurses in isfahan . Additionally, the study sample was taken from a university hospital, so it cannot necessarily be generalized to other staff populations . First, the sample size was relatively small and may not represent all nurses in isfahan . Additionally, the study sample was taken from a university hospital, so it cannot necessarily be generalized to other staff populations . The deficits in knowledge and attitude identified in this survey are a significant barrier to the effective management of pain in cancer patients . We believe that pain management issues in master nursing programs in iran are insufficient as well . National and local course programs about pain management are also insufficient, although remedial interventions such as rearing palliative care nurses to improve the standard of clinical practice are currently being implemented and the impact on knowledge and outcomes of these interventions will be the subject of future studies in a countrywide continual quality improvement project.
Reticulate acropigmentation of kitamura (rak) and dowling - degos disease (ddd) are part of a spectrum of rare autosomal dominant genodermatosis, characterized by progressive, symmetric and asymptomatic reticulated pigmented macules affecting the dorsa of the hands, in the former, and the flexures, in the latter . Hyperpigmented lesions in rak may also involve the flexor aspects of the wrists, neck, eyelids and periorbital areas . Other features include palmoplantar pits, breaks in the epidermal ridge pattern and occasionally, plantar keratoderma and alopecia . Rak's onset is usually in childhood unlike ddd, where the reticulate pigmentation has a late onset, in early adult life . In addition, ddd also present comedo - like lesions and pitted acneiform scars in the face, without palmoplantar pitting . It is very often associated with epidermoid cysts, keratoacanthoma, squamous cells carcinoma, abscess, suppurative hidrosadenitis, seborrheic keratosis and pilonidalis cysts . The histopathology of the hyperpigmented lesions is similar and characteristic in rak and ddd, with the presence of digitated and filiform elongated rete ridges, with clumps of heavy melanin pigmentation at their tips, thinning of the epidermis and pseudo - cysts . This resembles the appearance of a solar lentigo, but with epidermal atrophy, melanin incontinence and perivascular lymphocytic infiltrate . Accordingly to the similarity in clinical and histological features, many authors consider rak and ddd different phenotypes of a single disorder . In literature the authors found only few cases of overlap rak - ddd (about a dozen), including family cases described until four generations . An otherwise healthy 45-year - old female presented since early childhood, with a progressive and asymptomatic reticulated acropigmentation with brown pigmented macules on the dorsa of the hands, forearms and feet (figures 1, 2). Hyperpigmented macules, ephelide - like, on both axillae, buttocks and perioral area, also appeared in adulthood (figure 3). The physical examination revealed as well palmar pits (figure 4) but no facial pitted scars, breaks in dermatoglyphics, comedo - like papules or alterations in mucous membranes, hair, teeth and nails . Hyperpigmented macules on the dorse of the feet . Figure 3hyperpigmented, ephelide - like macules around the mouth . The patient reported similar lesions (mainly the reticulated acropigmentation) on two relatives (mother and aunt) apparently in an autosomal dominant pattern . The skin biopsy of a pigmented macule of the back of the hand revealed elongated rete ridges, with increased pigmentation of the basal layer and an increment in the number of melanocytes, characteristic of rak (figure 5). Histopathology of an hyperpigmented lesion of the dorso of the hand . Based on the history, clinical and pathologic findings, the authors believe that this case is one more example of the rare event of overlap rak - ddd, among the few non - asian cases described in literature . Rebora and crovato first suggested in 1983 that the two entities, rak and ddd were different phenotypic expressions of the same genodermatosis . In similarity to the other rak - ddd overlap cases described in the literature, our patient had typical characteristics of both variants . Concerning rak, it was possible to perceive the reticulated hyperpigmentation with acral distribution and palmar pits and; in addition, the hyperpigmented lesions on the flexures were typical of ddd . The true knowledge of the relationship between rak and ddd will be possibly achieved, through the clarification of the genetic background of both diseases.
The metabolic syndrome (ms) consists of multiple and interrelated risk factors of metabolic origin that appear to directly promote the development of atherosclerotic cardiovascular disease . The ms strongly associates with type 2 diabetes mellitus, or the risk for this condition . Although the exact etiology of the ms still remains unclear, it is known to involve complex interactions between genetic, metabolic, and environmental factors, where diet is of central importance [13]. There has been a substantial increase in fructose consumption, in the last decades, which has been associated with some adverse metabolic changes similar to those observed in the ms [47]. On the other hand, minerals like potassium, calcium, and magnesium, proposed as protective against the ms, are generally deficient in ms - inducing diets [3, 810]. Natural mineral waters are waters of underground origin, protected from contamination and microbiologically wholesome . They are characterized by their purity at source, content in minerals, trace elements, and other constituents as well as by favorable effects on human health . Additionally, bioavailability of minerals from natural mineral waters is high [1214]. The fructose - fed rat is an interesting and well - validated animal model of diet - induced ms (predominantly acquired ms model) that is commonly used in ms research . Different rat strains with distinct fructose ingestion protocols are reported in the literature and, in all cases, fructose has been observed to induce ms features such as moderate hypertension, glucose intolerance, hyperinsulinemia, insulin resistance, dyslipidemia (hypertriglyceridemia, hypercholesterolemia), altered cytokine and adipokine status (altered tumor necrosis factor - alpha (tnf-) and leptin levels, e.g. ), decreased melatonin production, and/or increased body fat and/or body weight [1520]. Both in humans and rats, a strong association has been found between ms and oxidative stress and fructose - feeding associates with modification of the hepatic redox status [16, 2224]. Beneficial effects of acute or chronic natural mineral - rich waters ingestion on blood pressure (bp) [2527], metabolic profile (plasma insulin sensitivity, fasting serum glucose concentration, and fasting serum lipid profile [25, 29]), and plasma oxidative stress markers (reactive oxygen species, lipid and protein oxidation product levels, total antioxidant capacity, and total thiol levels) have been published, but, to our knowledge, not in ms individuals or animal models . The natural mineral waters tested are rich, albeit in different proportions, in bicarbonate, calcium, magnesium, potassium, and/or sodium . We aimed to investigate the possible beneficial effect of natural mineral - rich water on ms induction by fructose - feeding . In the present work, sprague - dawley rats (sdr) were fed with 10% fructose in natural mineral - rich water (pedras salgadas) for 8 weeks and compared to animals fed 10% fructose in tap water . The natural mineral - rich water tested has high total mineralization content (2855 mg / l), being mainly rich in sodium and bicarbonate and with higher potassium, calcium, and magnesium content than tap water . The study was carried out in 21 adult male cd sdr (388483 g), from charles river laboratories (chatillon / chalaronne, france). Telemetry transmitters (ta11pa - c40, data sciences international (dsi), st . Paul, mn, usa) were implanted in the abdominal cavity, with the catheter in the abdominal aorta, by charles river . Rats were individually housed, in an enriched environment, and maintained on a daily photoperiod of 12 h lighting schedule (2022c) with free access to standard laboratory pellet food (2014 teklad global 14% protein rodent maintenance diet from harlan interfauna iberica sa, barcelona, spain) and tap water . Acclimatization took place for 10 days before starting the experimental protocol, which was authorized by the veterinary national department of the ministry of agriculture, rural development and fisheries . During acclimatization, the handling and care of the animals were conducted in conformity with the european community council guidelines for the use of experimental animals (86/609/eec) and act 129/92 . Animals were randomly divided into 3 groups (7 animals each) with free access to different drinking solutions: (a) tap water (cont), (b) 10% fructose in tap water (fruct), or (c) 10% fructose in natural mineral - rich water (fructmin). All experimental groups were fed ad libitum with the standard laboratory chow diet mentioned above (20% of energy derived from protein, 13% from fat, and 67% from carbohydrate). A 3-week pretreatment period with the natural mineral - rich water was performed to the fructmin group (while the other rats were drinking tap water) to allow adjustment to water flavor and sparkles . This period of time induced no change in the pattern of food intake or increase of animals body weight (data not shown; all animals weighed 475597 g at the beginning of the dietary manipulation with fructose). Body weight and food and fluid ingestion values were registered weekly, from week 0 to week 7 or 8 (as shown in figures 1(a)1(c), resp . ). On week 0 these parameters were evaluated on the same day, which occurred 24 to 48 h after starting the dietary manipulation, and then on every one week after the first measurement . Each week, from week 0 to 7, all animals spent 24 h inside metabolic cages for evaluation of food and fluid consumption as well as for urine collection (the latter at 0, 2, 4, and 6 weeks). At each occasion, the three groups of rats were represented, with an equal number of animals per group . Total energy ingestion was calculated by multiplying food and fluid ingestion values by the corresponding reference energy values and then adding these two results . The chemical characteristics of tap and natural mineral - rich waters are given in table 1 . The latter is classified as a hypersaline sodium - rich naturally sparkling mineral water, in conformity with the european community council guidelines for natural mineral waters (2009/54/eec), and was kindly provided by unicer bebidas, sa (lea do balio, matosinhos, portugal). Dataquest art 4.1 silver telemetry system (dsi) with rcp-1 receivers (and apr-1 for ambient pressure reference) was used for telemetric measurement of bp (mm hg) and heart rate (hr; beats / min) in the animal cage . Dataquest art acquisition software (dsi) was used to monitor all rats, for 8 weeks . Sampling was performed every min and setting segment duration at 20 s; 3 different animals (one from each experimental group) were evaluated per day from 4:00 p.m. to 8:00 a.m., seven days per week . Bp values were not included / considered if pulse pressure (the difference between systolic and diastolic bp) was below 20 mm hg and hr values were not used if pulse pressure values were lower than 10 mm hg . Data were exported from dataquest art 4.0 analysis program (dsi) to microsoft excel 2010 (redmond, wa, usa) and then subjected to statistical analysis . All chemical substances used in all the experiments were of analytical grade . At the end of the dietary intervention kg of body weight) and blood was collected from the left ventricle into heparinized syringes . After perfusion, liver, heart, kidneys, and epididymal adipose tissue were rapidly removed from the thoracic and abdominal cavities, washed in cold saline solution, placed in qualitative filter paper for excess liquid removal, and weighed . The liver was cut into several fragments that were immersed in liquid nitrogen and stored at 80c, until further processing . Plasma concentrations of glucose, triacylglycerols, total cholesterol, hdl - cholesterol, ldl - cholesterol, c - reactive protein (crp), glutamic - oxaloacetic transaminase (got), glutamic - pyruvic transaminase (gpt), total bilirubin, uric acid, urea, creatinine, total proteins, albumin, ferritin, sodium, potassium, chloride, magnesium, calcium, and phosphorus were determined . All these quantifications were made at the clinical pathology unit of so joo hospital centre, epe, porto, portugal, using standardized methods for human sample routine hospital measurements . Plasma levels of insulin (mercodia ab, 10 - 1137 - 01 (uppsala, sweden)), adiponectin (invitrogen corporation, krp0041 (camarillo, ca, usa)), aldosterone (uscn life science inc ., e0911ra (wuhan, china)), substance p (r&d systems inc ., kge007/skge007/pkge007 (minneapolis, mn, usa)), interleukin-6 (il-6; cusabio biotech co. ltd ., csb - e04640r (wuhan, china)), and tnf- (cusabio, csb - e11987r) were evaluated according to the manufacturers' instructions from the specific elisa kits . (rsh69 k), nuclear factor kappa - b ligand (rankl; rbn-31 k-1rankl), leptin, and osteoprotegerin (opg; rbn1 - 31 k) were measured with a luminex 200 analyzer (luminex corporation, austin, tx, usa) according to protocols (milliplex map kits) of millipore corporation (billerica, ma, usa). Raw data (mean fluorescence intensity) were analyzed using istm 2.3 software (luminex corporation). Oxidative damage to lipids, proteins, and dna was evaluated by measuring thiobarbituric acid - reactive substances (viz ., malondialdehyde (mda)), carbonyls, and 8-hydroxy-2-deoxyguanosine (8-ohdg) levels, respectively . Catalase, total superoxide dismutase (sod), glutathione - s - transferase (gst), glutathione - peroxidase (gpx), and glutathione - reductase (gr) activities were quantified ., except for the use of bradford method for protein quantification and the use of a kit for 8-ohdg quantification (the dna extraction kit (v - gene) was purchased from bioron international (ludwigshafen, germany) and the 8-ohdg kit from japan institute for the control of aging (haruoka, fukuroi, shizuoka, japan)). Liver tissue samples (300450 mg) were homogenized with a teflon - glass homogenizer in an equal volume of protein extraction buffer (50 mm tris - base, 150 mm nacl, ph 7.4, 1% triton x-100, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate (sds), 1 mm edta, tablets of protease inhibitors, and phosphatase inhibitors (100 mm sodium fluoride and 10 mm sodium orthovanadate)), with subsequent agitation for 30 min at 4c . Then, each sample was centrifuged, at 13 000 g for 20 min at 4c, and the protein solution under the lipid layer was collected and kept at 80c, until further analysis . Proteins were quantified by using the bicinchoninic acid protein assay kit (pierce, rockford, il, usa). Proteins were dissolved (1: 1) in loading buffer (50 mm tris - hcl, ph 6.8, 100 mm dithiothreitol, 2% sds, 0.01% bromophenol blue and 10% glycerol) and denatured, for 5 min at 95c . Then, 40 g of each sample was loaded per well, separated by electrophoresis in a 12% sds polyacrylamide gel, and transferred to a nitrocellulose membrane (hybond c - extra, amersham, ge healthcare, buckinghamshire, uk). The membrane was blocked in tris - base - buffered saline with 0.1% tween 20 (v / v) (tbst) containing 5% bovine serum albumin (w / v) and incubated overnight with the primary antibody against sirtuin 3 (sirt3; cell signaling technology inc ., danvers, ma, usa) diluted 1: 1500 in tbst, with gentle agitation, at 4c . Then, the membrane was washed in tbst and incubated with donkey anti - rabbit polyclonal antibody conjugated to horseradish peroxidase (santa cruz biotechnology inc ., heidelberg, germany), diluted 1: 5000 in tbst, for 1 h at room temperature . Detection was performed with an enhanced chemiluminescence reagent (amersham, ge healthcare, buckinghamshire, uk). Band intensity was determined using image lab software (version 4.0.1; bio - rad laboratories, hercules, ca, usa) and normalized for -actin expression (1: 1000 and 1: 2000 for primary and secondary antibodies (santa cruz biotechnology inc ., heidelberg, germany), respectively, diluted in 5% (w / v) of nonfat dry powdered milk sveltesse (nestl portugal sa, linda - a - velha, portugal) in tbst). Liver magnesium and calcium content were measured by inductively coupled plasma optical emission spectrometry (icp - oes; activam, jobinyvon, horiba scientific, edison, nj, usa), at 285.213 nm and 422.673 nm, respectively, according to iso 11885 (water quality determination of selected elements by icp - oes (https://www.astandis.at/shopv5/preview.action;jsessionid=cf7234fbac2bcfdd35a4593a11bd4700?preview=&dokkey=347061&selectedlocale=en)), after microwave oven (mars 5, cem corporation, matthews, nc, usa) assisted acid digestion of liver fragments according to epa 3052 (microwave assisted acid digestion of siliceous and organically based matrices (http://www.epa.gov/osw/hazard/testmethods/sw846/pdfs/3052.pdf)). The significance of differences of each week, cross - sectional statistical analysis, among groups regarding systolic and diastolic bp, hr, body weight, food and fluid ingestions, urine volume, urinary sodium and creatinine excretions, total energy ingestion, and percentage energy supplied by fluid / total energy ingestion was evaluated using anova followed by bonferroni's multiple comparison test or by kruskal - wallis followed by dunn's multiple comparison test, according to their distribution . These statistical methods were also used for evaluation of significance of differences among groups regarding organ weight / body weight, hepatic oxidative stress markers, and mineral content as well as plasma biochemical, metabolic, hormonal, and inflammatory data, at the end of the dietary intervention . The association between the outcomes (systolic and diastolic bp, hr, body weight, food and fluid ingestions, urine volume, urinary sodium and creatinine excretions, total energy ingestion, and percentage energy supplied by fluid / total energy ingestion) and the interaction of dietary intervention with time evolution (evaluated in weeks), longitudinal statistical analysis, was measured with the interaction terms (), which were estimated by mixed effects model with random effect in the intercept . The area under the curve (auc) was calculated through linear interpolation using the composite trapezoid rule . Statistical analysis was performed using r: a language and environment for statistical computing, graphpad prism software (version 6.00; la jolla, ca, usa), or ibm spss statistics software (version 20.0; armonk, ny, usa). Values were presented as mean standard error of the mean and differences considered significant for p <0.05 . In general, on each separate week (week by week), body weight (figure 1(a)) and food ingestion (figure 1(b)) revealed similar values for the 3 animal groups . With time (over the dietary intervention period), a significantly higher and similar increase of body weight for both fructose groups versus cont group was observed (see supplementary table 1 available online at http://dx.doi.org/10.1155/2014/384583 and inset in figure 1(a)). With time fructmin rats decreased food ingestion significantly more than cont rats and showed a trend towards a higher decrease with time than fruct rats (supplementary table 1). Week by week, fluid ingestion showed significantly higher values for both fructose - fed groups versus cont group, without any significant difference between fruct and fructmin (figure 1(c)), which was in accordance with auc values (supplementary table 2). Fluid ingestion increased significantly for fructmin versus cont and fruct with time (supplementary table 1). Week by week, no differences were observed for fructose ingestion (either from fluid ingestion or from both food and fluid ingestions (data not shown)) neither for percentage energy supplied by fluid / total energy ingestion between the two intervention groups (the latter being in accordance with auc values; figure 2(a) and supplementary table 2), in which there was a substantial proportion of energy ingested from fluid (4872% of total energy ingestion; figure 2(a)). Total energy ingestion was significantly higher every week of the protocol for both fructose - fed groups versus cont group, without any significant difference between fruct and fructmin (figure 2(b)), which was in accordance with auc (supplementary table 2) and body weight (figure 1(a)) results . Total energy ingestion decreased similarly with time for all groups (supplementary table 3; data not shown for controls). With time, urine volume was significantly higher in fructmin versus cont and fruct (supplementary table 4). Week by week, urinary sodium excretion values were expected when taking into consideration the sodium content of tap and natural mineral - rich waters: fructmin group had significantly higher values than the other two animal groups, without any significant difference between fruct and cont (figure 3(b)), which also agreed with auc values (supplementary table 2). Between weeks 1 and 5, fruct rats had a significantly higher hr than cont rats (figure 4(b)). Interestingly, both systolic and diastolic bp and hr evolution over time seemed to be protected from fructose effects by the natural mineral - rich water until approximately half of the dietary intervention period (figures 4(a)-4(b), resp . ). A significant increase of systolic bp with time for both fructose groups versus cont group was observed (supplementary table 5). Diastolic bp in fructmin group showed a tendency to increase with time versus cont group (supplementary table 5). A significant increase of hr with time for fructmin versus cont was observed (supplementary table 5). Liver and both kidneys weight to body weight ratios were significantly higher in fruct versus cont (figures 5(a), 5(c), and 5(d), resp . ). Additionally, the liver showed a strong trend to an increase in fructmin versus cont (p = 0.053) and a significant increase in fruct versus fructmin (figure 5(a)). Natural mineral - rich water ingestion prevented fructose effects on liver and both kidneys weight to body weight ratios . Epididymal adipose tissue to body weight ratio was slightly and similarly higher in both fructose - fed animal groups versus cont group (figure 5(b)). No differences were found among groups regarding heart weight / body weight (data not shown). Triacylglycerol levels significantly increased in fruct versus cont and a tendency to an increase in fructmin versus cont (p = 0.080) was observed (figure 6(b)). Insulin significantly increased (figure 6(c)) and leptin variation followed the same pattern in fruct versus cont (p = 0.057) (figure 6(d)). Insulin sensitivity index was also calculated and a strong tendency to a decrease was observed in fruct versus cont (p and global p = 0.055; 0.247 10 0.032 10, 0.137 10 0.009 10, and 0.211 10 0.030 10 for cont, fruct, and fructmin, resp . ). Glucose (figure 6(a)) and aldosterone (figure 6(e)) seemed to increase and melatonin (figure 6(f)) seemed to decrease in fruct versus cont . Natural mineral - rich water ingestion appeared to counteract these fructose - induced metabolic and hormonal effects . Urea (table 2) and magnesium (table 3) levels significantly decreased in the two fructose - fed groups versus the cont group . Total proteins and albumin levels significantly increased in both groups of fructose - fed animals versus cont group (except for total proteins in fructmin versus cont where a strong tendency was observed) (table 2). Tnf- and il-6 levels seemed to increase and opg to rankl ratio seemed to decrease in fruct versus cont (table 2), with the natural mineral - rich water improving these parameters . Crp and substance p levels slightly increased in fructmin versus the other two animal groups (table 2). The replacement of food by fructose solution as an energy source could explain the similar decreases in plasma urea, magnesium, got, gpt, ferritin, and uric acid levels in both fructose - fed sdr groups versus cont group (although significantly only for some parameters). Catalase and sod activities and gsh to gssg ratio increased (figures 7(a), 7(b), and 7(e), resp .) And gpx activity, gssg level and sirt3 protein expression decreased (figures 7(c), 7(d), and 7(f), resp .) In fruct versus cont (significantly for catalase, gpx, and gssg and a strong tendency for gsh / gssg (p = 0.062, global p = 0.045)). Regarding catalase and gssg, there was a strong trend to, respectively, a decrease and an increase in fructmin versus fruct (p = 0.065 and p = 0.055, resp . ). No significant modifications were observed for 8-ohdg levels (data not shown) neither for other redox parameters (table 4). A slight decrease was observed in fruct versus cont for both liver magnesium and calcium content that was prevented by natural mineral - rich water ingestion (figures 8(a) and 8(b), resp . ), most particularly for magnesium . The fructose - fed sdr model mimics a predominantly environmentally acquired ms model that is commonly used in ms research . Similarly, in the present study, many of the alterations observed in different protocols of fructose - induced ms were recapitulated . Increased systolic bp, adiposity index and liver and kidney weight to body weight ratios as well as modulation of the hepatic redox status and similar changes in the plasma levels of hormones, except for aldosterone, and/or energy substrates evaluated in this work have been reported in different protocols of fructose - induced ms in sdr [1518, 20, 2224, 3638]. As previously reported, fructose intervention increases sdr body weight, but besides fructose metabolic effects, two details of our experimental protocol could have contributed to body weight increase: rats were housed individually, which may have reduced their physical activity, and were already adult rats at the beginning of the dietary manipulation (their age was reflected in the high body weight values 475597 g), which may have amplified fructose metabolic effects . Additionally to the variations observed in food and fluid ingestions seen in the cont group with aging (over the 8 weeks of dietary intervention), fructose - fed rats adjusted fluid and food ingestions, aiming to maintain the level of energy consumption, as previously described . Fructose - fed animals increased their body weight similarly between them and more than control rats (associated with a small increase of epididymal body - fat), reflecting the absence of any major natural mineral - rich water consumption effect on both food and fructose ingestions . Accordingly, effects shown below against ms induction in fructmin rats related exclusively to natural mineral - rich water ingestion and, interestingly, natural mineral - rich water ingestion reduced / prevented the majority of the fructose effects and, consequently, protected against ms induction, which, to our knowledge, is described here for the first time . Ms represents a risk for cardiovascular disease (whose prevalence is increasing worldwide), which, together with the recent report of luo et al . On the consumption of low - mineral bottled water that increases the significant increase in plasma insulin levels in the fruct versus cont group could have contributed to the significant effects in systolic bp and hr described before (the effect of natural mineral - rich water with time on hr and diastolic bp decreased after body weight adjustment). Hyperinsulinemia may increase bp and hr by increasing the sympathetic nervous system activity, through alteration in the neuronal vascular control and/or by enhancement of kidney sodium reabsorption [6, 41, 42]. Increased sympathetic modulation of vessels and heart precedes metabolic dysfunction in mice drinking 10% fructose in tap water for up to 2 months . Hr, a marker of autonomic dysfunction, associates with ms, particularly with insulin resistance, and interestingly, in japan, the prevalence of ms increases linearly with the increase in hr [1, 44]. Bp correlates with plasma aldosterone levels and an association between plasma aldosterone levels and hyperinsulinemia has been described in obesity . Although both fructose - fed groups in the present study had significantly increased body weight versus controls, the insulin value in the fructmin group (that after body weight adjustment presented a strong tendency to decrease versus fruct (data not shown)), along with the later bp increase, was in accordance with the unaltered aldosterone levels in the fructmin group . In fructose - fed sdr, the absence of a significant increase in body weight associates with no increase of aldosterone levels, in spite of hyperinsulinemia . Leptin resistance may be an early feature of metabolic dysfunction induced by fructose - feeding, since it may precede increased adiposity, elevated circulating leptin levels, and changes in glucose metabolism in rats . Despite higher leptin levels (with the comparison versus cont significant after adjustment for body weight (data not shown)), which would anticipate a reduction in food intake and body fat in healthy conditions, fruct rats had a lower decrease of food ingestion with time than fructmin rats (significant after adjustment for body weight (data not shown)) as well as a similar weight gain and amount of epididymal fat . These results could reflect a phenomenon of selective leptin resistance that, together with the activation of the sympathetic nerves by hyperleptinemia, could have contributed to the earlier development of hypertension in fruct rats [5, 4749]. Melatonin has anti - inflammatory, antihyperlipidemic, and antihypertensive properties and it is known to influence insulin secretion and to enhance its action (it increases insulin sensitivity and enhances insulin effects on leptin expression) [19, 5052]. The apparent deregulation of leptin, melatonin, insulin, and aldosterone observed in the fruct group, owing to modifications in the hormone levels, was less evident in the fructmin group . Fructose is highly lipogenic as its hepatic metabolism provides great amounts of triose phosphate precursors for fatty acid synthesis [5, 6]. The difference in triacylglycerol levels in the two fructose - fed groups could be explained by the improvement of leptin, insulin, and aldosterone levels in fructmin induced by the natural mineral - rich water ingestion (the magnitude of triacylglycerols increase versus cont was reduced after body weight adjustment (data not shown)). The increase in plasma albumin and total protein levels has been described in fructose - fed rats, which could reflect a combination of undernutrition (also because of the decrease in food ingestion), some degree of liver disorder (resulting from ms induction), and/or dehydration (owing to loose stools resulting from incomplete fructose absorption) [56, 57]. Nevertheless, the pattern of urine volume mirrored the pattern of fluid ingestion and we did not observe loose stools, which makes dehydration unlikely in the fructose - fed rats . Although we found a significant increase in both kidneys weight to body weight ratios in the fruct group, we believe that there was no renal functional alteration in this sdr group taking into consideration the plasma and/or urinary profiles of creatinine, urea, albumin, total proteins, magnesium, sodium, potassium, calcium, chloride, and phosphorous . Despite an increase in the kidney weight to body weight ratio, rizkalla et al . Reported no glomerular basement membrane thickening in sdr after 10 weeks of 57% fructose - feeding . Fructose - feeding accelerates osteoporosis and, accordingly, the opg to rankl ratio (reflecting the ratio of osteoblast versus osteoclast activities [58, 59]) seemed to decrease in the fruct group . Interestingly, and in accordance with fruct group results, tnf- and il-6 are important mediators in the process of osteoclast differentiation and activation and, thus, the changes observed in their levels might have contributed to the lower opg to rankl ratio . High levels of leptin and aldosterone have been linked to proinflammatory and prooxidant actions [45, 47]. In the fructmin group, the improvement of the leptin, aldosterone, tnf-, and il-6 values could have contributed to the improvement of the opg to rankl ratio . Taking into consideration all the results obtained for both fructose - fed sdr groups, the slightly increased levels of substance p and crp in fructmin rats were unexpected . Plasma substance p levels increase under magnesium deficiency and contribute to increase inflammation and protein and lipid oxidation . In fact, plasma magnesium levels of both fructose groups were significantly decreased, but the fructmin group displayed better plasma tnf- and il-6 levels as well as lower hepatic protein oxidation content (after adjustment for body weight this latter parameter showed a tendency to a decrease in fructmin versus the other two groups, most particularly versus fruct (data not shown)). The absence of oxidative lesions in lipids, proteins, and dna (the same as for proteins happened for dna oxidative lesions (data not shown)) could be explained by the significantly increased catalase activity and apparently increased sod activity . Describe similar results for lipid oxidative lesions and catalase and sod activities by 10% fructose ingestion in tap water . The significant decrease in gpx activity in fruct rats could be partially compensated by the significant increase in catalase activity, since both enzymes can eliminate hydrogen peroxide (converting it to water). Catalase is responsible for the elimination of high concentrations of hydrogen peroxide, while gpx does it when concentrations of hydrogen peroxide are low . The higher levels of hydrogen peroxide could have resulted from the fructose - feeding [7, 63] and the small decrease of sirt3 protein expression could have intensified reactive oxygen species production in fruct rats . The significant decrease in hepatic gpx activity could have contributed to the strong tendency for an increase in the gsh / gssg ratio in fruct versus cont, by oxidizing less gsh to gssg . Increased gssg efflux from hepatocytes and/or increased hepatic gsh synthesis induced by fructose could also apply . However, we did not observe an increase in gsh level as it might have been expected from a lower gsh oxidation and/or increased gsh synthesis . Although cellular atp depletion induced by fructose prevents atp - dependent gssg efflux in freshly isolated rat hepatocytes, this phenomenon should not have a strong impact here since an increase in uric acid formation was not observed . The variations observed for gpx, sod, and catalase activities in the two fructose - fed groups are in accordance with the antioxidant actions of melatonin (probably its primary function) and sirt3 . Melatonin possesses free radical - scavenging activity, stimulates antioxidant enzymes (e.g., gpx), and inhibits reactive oxygen / nitrogen species producing enzymes [66, 67]. Sirt3 has beneficial effects on mitochondrial electron transport chain (contributing to a reduction in the production of reactive oxygen species) and mitochondrial antioxidant enzymes (probably also on gpx, like melatonin). Reduction of sirt3 associates with an accelerated development of metabolic abnormalities similar to the ms, which is in agreement with our overall results . Our results also showed that the natural mineral - rich water could contribute to the preservation of the hepatic intracellular ions, namely the magnesium content . It is well documented that plasma ion levels might not reflect their tissue levels, and here this was evident regarding plasma and hepatic concentrations of magnesium and calcium . For quite some time, it was thought that it could be the cause of insulin resistance, but very recently it was described that type 2 diabetes mellitus and a lower degree of metabolic control are essential in accounting for the lower levels of serum magnesium that occur in obese individuals . Figure 9 summarizes the significant effects of fructose - feeding obtained in this research that were reduced / prevented by the natural mineral - rich water (taking into consideration that when fructose was coingested with the natural mineral - rich water no significant effects were observed versus the control). Still, although for some of the parameters evaluated in our study the extension of differences among groups did not achieve statistical significance, the variations observed were consistent with the pattern expected, which reinforces their biological relevance and justifies their presentation and discussion . The results here described suggest that this natural mineral - rich water seems to have potential to prevent ms induction . We hypothesize that its regular intake in the context of modern diets, which have a general acidic character interfering with mineral homeostasis and are poor in micronutrients, namely potassium, calcium, and magnesium, could add surplus value and attenuate imbalances, thus contributing to metabolic and redox health and, consequently, decreasing the risk for atherosclerotic cardiovascular disease.
The evolution of the nervous system in the animal kingdom is currently under major debate in evolutionary developmental biology and comparative embryology 1 . In this context, the evolutionary path that leads to the morphological complexity of the nervous system passes through the invertebrate / vertebrate transition . At the beginning of the xx century, the cephalochordate amphioxus occupied the most prominent role in illuminating, at the morphological level, such a transition (see 2 for an historical perspective). During the last decade, increasing information on the molecular aspects of amphioxus development has revealed a number of previously hidden features . One prominent example is the molecular regionalisation of the amphioxus nervous system, which is greatly hindered by its anatomical simplicity . The central nervous system of an adult amphioxus is a mere tubular nerve cord lying dorsally over the notochord . The nerve cord and the notochord cover together the entire length of the animal, except in the anterior region, where only the notochord reaches the rostral tip of the body (fig . 1). This exclusive rostral expansion of the notochord is a hallmark of the taxon cephalochordata (corda for corda dorsalis, original name of the notochord - in the head). The only externally visible landmarks of the amphioxus nerve cord are discrete enlargements at both the anterior and posterior ends, regarded as the anterior vesicle and the caudal ampulla, respectively . Transiently during embryonic development, in young larvae, the anterior swelling is commonly known as cerebral vesicle and is much more pronounced than in adults . Apart from the serially repeated exit points of the dorsal nerves, the nerve cord of amphioxus is devoid of rhombomeres or other external morphological indications of segmentation . The outgoing dorsal nerves, unsupplied with ganglia, contribute to the peripheral nervous system by innervating most of the organs of the body, shaping an irregular nerve net, where a number of peripheral neurons are also accommodated 3 in contrast with the anatomically non - regionalised central nervous system and the apparently disorganised peripheral nervous system, the discrete expression patterns of distinct genes and the specific distribution of certain proteins outline a completely different chronicle for the nervous system of amphioxus . Most of the neural genes characterised to date reveal gapped expression domains within the developing central nervous system, and restricted expression to certain cell subpopulations within the embryonic epidermis . Retinoic acid treatments greatly affect these gene expression domains 4, suggesting a well - controlled pre - patterning that defines distinct territories, not only within the neural ectoderm but also within the epidermis of amphioxus embryos . After two centuries of heated debate, amphioxus is still an epicentre for the controversial evolutionary origins of vertebrates . Whatever its actual position, as the sister group of vertebrates, as the earliest chordate, or as (less likely) the earliest deuterostome 5, its privileged phylogenetic position sets amphioxus in the appropriate place to cast light on some of the main transitions that occurred during animal evolution: the origin of deuterostomes, the origin of chordates, or the origin of vertebrates, all of them correlated with novel evolutionary features, and some of them linked to the elaboration of the most complex nervous systems . The relative phylogenetic position of cephalochordates and urochordates has very recently received a lot of attention 6 . Both cephalochordates and urochordates are invertebrate chordates that share with vertebrates certain anatomical features: a notochord, pharyngeal slits and a dorsal hollow nerve cord . However, these pre - vertebrate characteristics are lost in tunicates after metamorphosis, while they are maintained for life in cephalochordates . Furthermore, cephalochordates but not urochordates possess additional vertebrate - like characters, such as a post - anal tail and segmentally arranged muscles (myomeres) (fig . 1). Both clades include the only invertebrates able to form a dorsal nerve cord through neurulation . However, unlike in urochordates, in amphioxus the nervous system seems to be developmentally active beyond metamorphosis . This is supported by modern anatomy 3, which shows that cytoarchytectural reorganisations should occur within the nerve cord of amphioxus until reaching a definitive internal structure in the adult . The present communion between modern morphology and the use of molecular biology tools is revealing an unexpected variety of cell types, territories and boundaries along the antero - posterior axis of the nerve cord and on the epidermis of amphioxus . Here i attempt to summarize distinct patterns of gene expression, giving an overall view of the formation of the central and peripheral nervous systems of amphioxus and suggesting the possible origin of two characteristic neural features in vertebrates: the placodes and the neural crest . In amphioxus, the embryonic anterior - posterior axis is determined early (by the time of gastrulation), as a consequence of the animal - vegetal polarity of the oocyte, induced by the sperm entry point during fertilisation . At the onset of gastrulation, the vegetal pole of the blastula invaginates, leaving a wide - open blastopore, which subsequently closes . As soon as invagination begins, amphiwnt1 turns on around the blastoporal opening in conjunction with ambra, followed by the expression of amphiwnt8 and a down - regulation of -catenin in the invaginating mesendoderm 7,8 . This territorial area homing the expression of these genes is soon segregated into the blastoporal lips, which remain on the posterior side of the embryo and will contribute to the tail bud later in development 9 . Other amphioxus wnt genes are also expressed around the blastopore in an overlapping pattern to that of amphinotch and ambra 7, 10, 11 . This indicates that both the wnt and notch pathways may act as a posterior signalling centre involved in the specification and maintenance of the posterior identity . Whether the notch and wnt signalling systems are involved in the specification of the dorso - ventral axis however, it has been suggested that wnt signals may be involved in restricting expression of genes such as amphisox1/2/3, amphidral and amphidll to the ectoderm 7 . Amphisox1/2/3 and amphineurogenin are the earliest known markers for the presumptive neuroectoderm in amphioxus 12 . The expression of both largely overlaps at the early gastrula, on the outer dorsal epiblast (ectoderm), thus indicating the existence of a dorso - ventral axis already at this stage . Opposite amphisox1/2/3 and amphineurogenin, amphidral is expressed in the non - neural ectoderm, suggesting that the neural / non - neural boundary might become delimited early in development 13 . Throughout gastrulation, some of the genes involved in neural patterning are expressed in the dorsal blastoporal lip, which has been regarded as the homolog of the amphibian spemann's organiser 14, crucially involved in neural induction . In vertebrates, the early nodal expression is involved in the establishment of the spemann's organiser and induces the expression of organiser - specific genes such as goosecoid . In amphioxus, amphinodal's strongest expression is in the inner hypoblast (mesendoderm) of the dorsal blastoporal lip 15 . Therefore, amphinodal might well induce the expression of goosecoid in the dorsal blastoporal lip, where it overlaps with other organiser - related genes such as amhnf3, ambra and amphifoxd, but not amphiotx 11, 16 - 19 . This incomplete overlapping expression occurs for a short period of time and, in comparison with vertebrates, it is slightly delayed in development . Thus, it is unclear to what extent the dorsal blastoporal lip functions, if it does, as a dorsal - ventral organiser, though it may have some properties related to the spemann's organiser, such as influencing the formation of the neural plate and the underlying chordamesoderm . As gastrulation proceeds, some genes begin to be restrictively expressed in certain regions of the neuroectoderm, which may be an anticipation of the cryptic regionalisation of the neural tube and the epidermis observed in succeeding stages . Islet and amphipax6 are first solely expressed in the anterior neuroectoderm, whereas amphievxa is expressed just in the posterior neuroectoderm and amphimsx in the middle part 20 - 23 . The homogeneous expression of amphisox1/2/3 and amphineurogenin in the dorsal epiblast is gradually restricted only to the neural ectoderm 12 . Amphizic and amphivent, which were earlier widely expressed dorsally, become restricted to the lateral regions of the nascent neural plate 14, 24 . Conversely, other genes are expanded to the neuroectoderm, as shown by amphibrn1/2/4, amphipax3/7 and the various amphihairy genes . As the gastrula elongates to reach the earliest neurula stage, the expression of amphibrn1/2/4, initially located in the dorsal epiblast, gradually spans from the posterior to the anterior neural plate 25 . The initial expression of amphipax3/7 in the dorsal presumptive axial and paraxial mesoderm is additionally extended to the dorsal ectoderm, where it also appears at the lateral edges of the presumptive neural plate 26 . Likewise, the amphihairy genes also label the forming neural plate, in this case accompanied by a complementary striped expression in the presumptive somitic mesoderm 27 . This raises the recurrent question on the effect that mesoderm segmentation might exert on the molecular regionalisation of the neural tube in amphioxus . Although not segmental, the mesodermal expression of i d and amphidmbx could be tentatively related to this issue, since in vertebrates they have a well - defined location within the developing central nervous system 28, 29 . Furthermore, the apposed ectodermal - mesodermal expression also observed for the amphioxus snail gene, which is detected in the dorsal presumptive somitic mesoderm and the overlying edges of the forming neural plate, and several other genes (e.g. Amphizic, amphivent) also suggest a collaborative role between the two germ layers 30 . At the end of gastrulation, as the neural plate starts to form, the amphioxus embryo becomes more vertebrate - like . However, in contrast with vertebrates, neural folds do not form during amphioxus neurulation . Instead, the non - neural ectoderm detaches from the edges of the open neural plate, overgrowing laterally over the neural plate and fusing in the dorsal midline . As the non - neural ectoderm covers the neural plate, the lateral edges of the latter curl up dorsally and fuse in the dorsal midline, underneath the non - neural ectoderm, to form the neural tube . Once the neural tube is formed, it stills remains anteriorly open through the neuropore . Subsequently, as the neurula elongates, the posterior neural tube and the adjacent notochord and somites stem from the tail bud, which probably still maintains some of the organiser properties mentioned above . Throughout neurulation, the various gene expression patterns are highly dynamic within the central nervous system (table 1) and reveal discrete molecular boundaries, most of them hidden at a morphological level . The central nervous system of amphioxus neurulae, in its advanced stages, consists of a dorsal neural cord lacking constrictions along its rostrocaudal axis . The only regional difference lies at the anterior end, only regional difference lies at the anterior end only regional difference lies at the anterior end where the neural canal is slightly dilated into a cerebral vesicle, anterior to the level of somite 1 and up to the anterior part of somite 2 . Most of the cerebral vesicle is dominated by the expression of amphiotx, yet with a gap of expression halfway along its anterior - posterior axis . This organ is the source of the reissner's fiber, which fills the central neural canal, and is probably the homologue of the subcommisural organ of the vertebrate diencephalon 16 . In this region similarly, amphidll - positive cells are also embedded in the rostral domain of amphiotx, but located more anteriorly than amphibf-1, in the preneuroporal region 32 . Amphid1 is also expressed in the cerebral vesicle at the level of the presumptive infundibular organ, while amphith is expressed at the level of the presumptive lamellar organ, which in turn is covered by the caudal expression of amphiotx 33,34 . These sharp expressions probably reflect a complex internal morphology within the cerebral vesicle; this is also observed for amphipax6, which is expressed in a few cells of the developing frontal eye 20 . The posterior expression of amphiotx overlaps with that of amphidll, amphipax6, amphisim and the anteriormost expression of amphifoxb . The delimited expression of amphisim in this area is especially interesting, since it is a marker of the posterior diencephalon and midbrain in vertebrates . However, amphioxus orthologues of other vertebrate midbrain and mhb (midbrain - hindbrain boundary) markers, such as amphievx, amphien, amphipax2/5/8 and amphiwnt1, have failed to provide evidence for a true midbrain and mhb homolog in amphioxus 29,35 . Both amphibf-1 and amphidll are orthologue genes to those marking the vertebrate telencephalon and, in the case of amphidll, other parts of the vertebrate diencephalon as well . Together with the expression of amphiotx, the orthologues of which are markers of the vertebrate telencephalon, diencephalon and midbrain, and the territorial domain occupied by amphisim, combined gene expression suggests that the amphioxus cerebral vesicle is largely homologous to the vertebrate forebrain (telencephalon plus diencephalon), although certain homology with the midbrain cannot be completely ruled out . In the hypothetical absence of a midbrain homolog in amphioxus, the territory posterior to the cerebral vesicle, caudal to amphiotx expression at the level of somite 2, has been widely seen as a homolog of the craniate hindbrain . Following the expression of amphiotx, amphioxus hindbrain is subjugated to the expression of different hox genes, partially overlapped along the anterior - posterior axis . Spatially, the first hox gene expressed in the anterior hindbrain is amphihox1 (somites 2 - 4), followed by amphihox3 (somites 4 - 8) and amphihox4 (somites 6 - 8) 36 . Amphifoxb is expressed segmentally as well, concomitantly with hox genes, though it shows a prominent gap of expression at the level of somite 5, where the pigment spot will form and, intriguingly, where the expression of other segmental genes is also disrupted (e.g. Mnx, islet) 35 . Other genes broadly expressed within the neural tube of amphioxus are: amphisox1/2/3, amphinetrin, amphif - spondin, the different hairy genes and amphibrn1/2/4 . All of them label certain fractions of the hindbrain and some of them include some spots of expression within the cerebral vesicle . While amphisox1/2/3 is excluded along the midline and the anterior part of the neural tube, amphinetrin shows a fairly complementary pattern, being expressed just along the midline 12,37 . Notwithstanding, amphinetrin expression in the floor plate lasts longer than amphisox1/2/3 expression does and always overlies its own expression in the dorsal notochord, even below the cerebral vesicle (from which it is excluded), until the larval stages, when amphinetrin is lost at both anterior and posterior ends of the notochord . The long - lasting expression of amphinetrin in the floor plate suggests a role of the amphioxus floor plate in the control of axon path finding, possibly guiding newborn neurons within the nerve cord 37 . Amphif - spondin expression by the end of neurulation largely overlaps the expression of amphinetrin, though covering broader areas within the neural tube, including the cerebral vesicle, where it shows a gap of expression just on the ventral side 38 . Similar to amphisox1/2/3, amphibrn1/2/4 is excluded from the midline, but is additionally expressed in the cerebral vesicle with the same gap of expression as the one observed for the amphif - spondin gene 25 . Throughout the neural tube, amphioxus hairy genes are expressed in complementary patterns . Amphihairyb is expressed in the anterior neural tube, spatially followed by amphihairyc and amphihairyd, being amphihairya the most restricted one to the posterior neural tube . Independently, all of them show gapped expression and overlap at certain levels, just in some cases filling the gaps of one another . As mentioned previously, in general the expression of the different amphihairy genes in the neural tube is accompanied by a striped expression in the somitic mesoderm, but in the case of amphihairyc and amphihairyd, it is further escorted by their expression in the notochord 27 . The apposed expression of the notochord and the neural plate is also observable for amphinetrin, amhnf3 and amphihh, at neurula stages 17,37,39 . Though the expression of these three genes is undetectable in the ventral cerebral vesicle, it is clearly seen throughout the rest of the neural tube and along the whole length of the notochord, including the portion underlying the cerebral vesicle . In vertebrates, the notochord is a transient embryonic structure that acts as an organiser inducing the floor plate and cooperating in the establishment of the dorso - ventral axis of the neural tube and somites . Although in amphioxus this structure is permanent, based on comparable gene expression patterns, it may well have properties similar to those of the vertebrate notochord, yet with a longer period of action that could extend beyond metamorphosis . In this regard, however, the role of the anterior notochord is obscured by the fact that genes such as amphinetrin, amhnf3 or amphihh seem to be unable to induce floor plate fates in the ventral cerebral vesicle, which suggests that the cells lying ventrally in the cerebral vesicle may not be competent to respond to their signals 37 . The cryptic internal segmentation of the amphioxus neural tube has been visualized by iterative gene expression patterns . As illustrative examples, amphikrox, shox, islet and amphimnx share a one somite - wide periodicity of expression throughout the neural tube . All of them are expressed in the hox - delineated hindbrain regions, though not all their patterns are in the same phase, indicating that different sets of cells take part in the iteration . Both shox and islet transcripts are located at the level of somite boundaries, while amphikrox transcripts are centralised at the level of somites and amphimnx ones are close to the posterior border of the somites 39 - 41 . The repetitive pattern appears more synchronised adjacent to the first four somites and is altered at the level of somite number 5, as occurs with the segmental expression of amphifoxb . Similarly, amphicoe and amphielav are also iteratively expressed along the nerve cord during neurulation 42 - 44 . The amphicoe - expressing cells within the nerve cord show a periodicity matching the adjacent somites, in a pattern similar to those of amphifoxb and amphineurogenin, at the same developmental stages 12,35 . Unlike amphikrox, shox and amphimnx expression, the amphicoe transcripts are not solely confined to the ventral part of the nerve cord, since they are also present in dorsal cells lying in comparable positions to those expressing islet . Interestingly, the dorsal expression of both islet and amphicoe only occurs beyond the level of somite 5, where the dorsal cells expressing them are displaced anteriorly to the accompanying expressing cells in the ventrolateral floor of the nerve cord 41 . However, though serially arranged, amphielav - expressing cells do not clearly match somite boundaries and are located on both the dorsal and ventral sides of the nerve cord, at all levels posterior to the cerebral vesicle 44 . In most cases, the iterative expression of these genes is maintained up to the larval stages, being down - regulated, but not completely missing, at about three days post - fertilisation . Similar expression patterns have been described for other genes, such as amphink2 - 1, amphink2 - 2, amphifringe or amphimsx, although their transcripts are not detected in the neural tube that far in development 21, 45 - 47 . The four genes are segmentally expressed in the neural tube at mid - neurula stages, just after mesoderm segmentation has commenced, but fade away from these locations by the end of neurulation . Again, this transient expression may correlate mesoderm segmentation with the development of internal metameric neural structures . However, other genes, such as amphidach and amphierr, show an iterative pattern of expression, most obviously at larval stages 48,49 . In both cases, the series of positive cells have a caudal limit of expression at the level of somites 5 - 6 . It would seem that the only genes iteratively expressed beyond the level of somite 5 up to the latest stages of development analysed are amphicoe, amphielav and amphineurogenin, but always excluding the most posterior part of the neural tube 12,43,44 . Since these genes are early markers for neuronal fates, this might suggest that posterior neuronal fates are delayed in development until later larval stages, at which their expression has not yet been analysed . The combinatorial iterative expression of all these genes, at different times and in distinct subsets of cells, suggests that the amphioxus nerve cord is internally organised in a variety of neurons, segmentally arranged in a dorso - ventral and an antero - posterior order, which might affect their relative connectivity and consequently their particular functions . Although it is difficult to correlate the internal morphology of the embryonic and adult nerve cord, the differentiation events associated with the expression of the above - mentioned genes might only reflect the preliminary organisation of the anterior part of the adult nerve cord, which according to wicht and lacalli spans up to the level of myomere number 11 3 . Given that the intermediate and posterior parts of the adult nerve cord show a slightly distinct internal organisation, these regions could be morphogenetically delineated later in development . Similar early genetic programs could be acting at advanced larval stages and even beyond metamorphosis, when the embryo is still posteriorly elongating and dramatic morphological changes occur along the body, including the formation of certain structures that will be subsequently innervated by the descending branches of the dorsal nerves . However, this possibility is still to be explored, since the metamorphic and post - metamorphic larvae of amphioxus have rarely been used for gene expression studies . In recent years, the epidermis of amphioxus has received particular attention 50, as a number of genes are specifically expressed by distinct epidermal cell populations during amphioxus embryogenesis, which indicates that distinct genetic programmes are switched on in particular cells and territories of epidermal tissue, previously thought to be uniform . Some of these genes, such as amphicoe, amphielav and amphitrk, spread spottily over the epidermal surface of the embryo 43,44,51 . While amphicoe and amphielav are also expressed in the central nervous system, by the time they do in epidermal cells, amphitrk expression is solely confined to the non - neural ectoderm during neurulation, yet is restrictively expressed in the central nervous system in adult amphioxus . Within the neuroectoderm, all three of these genes are expressed in developing neuronal precursors, or putative mature neurons in the case of amphitrk . Noticeably, the respective orthologue genes in vertebrates are widely expressed in neuronal precursors during embryogenesis . All amphicoe, amphielav and amphitrk genes are expressed by scattered individual epidermal cells distributed over the ventrolateral flanks of neurulae . These cells show a distinctive elongated morphology that clearly sets them apart from surrounding epidermal cells . The number of cells expressing amphielav is apparently higher than the number of cells expressing amphicoe or amphitrk, which suggests that the embryonic epidermis might contain sub - populations of neuronal cells, which might depend on the combinatorial or differential expression of certain genes, such as amphicoe or amphitrk, to abandon their epidermal condition . Thus, the scattered epidermal expression of genes involved in neural specification or differentiation suggests a neurogenic potential for the embryonic epidermis of amphioxus, which would be able to generate neuronal cells from ordinary ectodermal cells, giving rise, among other cells perhaps, to the primary sensory neurons observed by scanning electron microscopy (sem) in the epidermis of late neurulae 43 . Conversely, other genes show a far more limited axial expression in the epidermis than those mentioned above . In particular, the anterior epidermis appears to concentrate much of the epidermal gene expression studied to date: amphineurogenin, amphipax6, islet, amphitrk, amphimsx, amphiotx, amphibmp2/4, amphiwnt11, amphifoxq2 and amphitob are all expressed in this region, though in a partially overlapping manner 12,16,20,21,41,51,52 - 55 . This could correlate with the concurrence of a variety of specialised sensory cell types morphologically characterised in the anterior part of late larval and adult amphioxus specimens 3 . In this respect, the rostral expression of amphimsx and amphitrk at early larval stages has been related to the development of the corpuscles of de quatrefages, a multi - cellular organ composed of supporting cells and peripheral neurons that remain enclosed within a subepidermal capsule of connective tissue in the rostrum 21,51 . At least some of the peripheral neurons of the corpuscles of de quatrefages are primary neurons that send axonal processes to the central nervous system via the rostral nerves, but they are morphologically different from those primary neurons observed by sem at late neurula stages . The latter probably represent the early steps of differentiation of the type - i receptors described in late larval and adult amphioxus . The most common receptor cell types are called type i and type ii receptors . While type i receptors are primary sensory neurons, type ii receptors are secondary sensory neurons devoid of axons . Both types of sensory neurons are widely distributed over the entire epidermis but appear densely grouped in the rostrum, buccal cirri and tail 3 . The oral region of late larvae is also rich in other neuronal cell types exclusively located in this area, such as the oral spines and those of the synaptic complex of the oral nerve 56 . Although the origins of all these peripheral neurons are not clear, there is no evidence indicating anything other than a local origin . Therefore, the assorted neural - related gene expression in these areas could be associated with distinct steps of neural commitment and differentiation of concrete ectodermal cells . The overlapping expression area of both amphineurogenin and amphipax6 in the ectoderm has been homologised with the vertebrate olfactory epithelia, which expresses the respective orthologous genes 12,20 . The vertebrate pax-6 gene is the most specific maker of the olfactory epithelia, but is also expressed by the lens placode . Conversely, sox2, sox3, neurogenin1 and neurogenin2, delta-1 and myt-1 (neurod) are expressed in most of the vertebrate placodes 57 . Few specific placodal genes have been studied to date in amphioxus . Among these, except for amphisox1/2/3, both amphipax6 and amphineurogenin are broadly expressed in the rostral ectoderm of early larvae, where amphimsx is also expressed, yet covering a narrower area on each side of the larvae . Since amphioxus is devoid of placodes, it is very tempting to correlate these gene expression data with the presence of a putative rudimentary placode - like region, which could be defined as a relatively broad ectodermal area of the rostrum able to give rise to distinct sensorial organs and neuronal subpopulations, and located only in the anterior part of the embryonic ectoderm . Apart from the scattered expression of certain neural genes (amphitrk, amphicoe and amphielav), the embryonic epidermis of amphioxus expresses a few other genes almost ubiquitously . This is the case of amphievxb, amphidral, amphidll and ap-2, which are widely expressed in the non - neural ectoderm throughout neurulation 13,32,58,59 . These unexpected expression patterns make interpretation of the function of these genes in amphioxus embryogenesis very difficult . Furthermore, amphievxb is a highly derived gene, fruit of a specific cephalochordate duplication and a general, cephalochordate - specific role, in epidermal functions has been suggested for this gene 58 . However, the overall epidermal expression of the genes characterised to date in amphioxus might lead to an alternative hypothesis . If the embryonic epidermis of amphioxus is endowed with the neurogenic potential of generating assorted neuronal cell types, amphidll and ap-2 could participate in the epidermal versus non - epidermal sorting of the different cells in the embryonic skin of amphioxus . Given that both genes are homogeneously expressed in this tissue, the decision between epidermal and neural would not rely on the expression of these genes, but on their expression together with other genes such as amphielav or other uncharacterised proneural genes . The neural crest is a vertebrate - specific embryonic cell population defined by its origins at the neural plate border, migratory capacity, pluripotency and characteristic gene expression profile . Although the genetic machinery of neural crest appears to be at least partially conserved in both urochordates and cephalochordates 60, there is no compelling evidence, to date, for any invertebrate embryonic cell population that has all the properties of the vertebrate neural crest . Even so, some migratory populations have been described in both urochordate and cephalochordate embryos . In both cases, while these cells express hnk-1 and zic gene markers in the ascidian ectainascidia turbinata, no gene expression profile could be determined for the migratory cells in amphioxus 51,61 . Nevertheless, as noted in the previous section, amphioxus gene expression data demonstrate that particular epidermal cells have a distinctive gene expression profile, which would match the distinctive behaviour of these cells that migrate in a ventro - dorsal direction during neurulation . Although this is only data correlation, the genetic program of these individually migrating cells is likely to be different from the surrounding epidermal cells lacking these properties . Recent studies on brdu incorporation throughout amphioxus development demonstrate that the embryonic epidermis of the neurulae is devoid of cell proliferation 62 . These results, together with the absence of apoptosis at the same stages and in tissue 63, indicate that the migrated epidermal cells in late neurulae did not relocate by movements caused by the elimination or addition of nearby cells . The absence of epidermal mitosis is consistent with the ciliation of most cells in the embryonic skin of amphioxus neurula . As mitosis and ciliation seem to be mutually excluding in most eukaryotic cells, proliferation and differentiation this is consistent with some epidermal cells being able to differentiate during neurulation, when mitosis arrests occur . As in vertebrates, amphidral may be involved in the cell division shutdown, since its downregulation in the epidermis only happens when proliferation is resumed in this tissue, at advanced larval stages 13,61 . Under these circumstances, some cells might be able to activate certain differentiation genetic programs that would lead into the early differentiation of the primary neurons observed at late neurula stages 43 . However, such a spatio - temporal genetic program is currently unknown, though it is possible to establish certain associations between gene expression and epidermal subpopulations . At present, it seems clear that distinct genetic programs are operating in the embryonic skin, distinguishing individual and possibly migrating cells from the rest of the epidermis . As previously mentioned, the most prominent epidermal subpopulations are those labelled by amphicoe, amphielav and amphitrk expression . These are followed by the much smaller subpopulations expressing islet and amphierr, which, unlike those expressing amphicoe, amphielav and amphitrk, appear only in the trunk region 4, 49 . As a common denominator, all these genes are involved in the specification of neuronal precursors or in neuronal differentiation, thereby strengthening the local neurogenic potential of the amphioxus embryonic epidermis . In tandem with this, one of the most striking features of amphitrk and amphielav expression is the dorsalisation of the signal as neurulation proceeds, which follows the same direction at the same stages of development of those migrating individual cells observed by dii tracing 51 . Furthermore, the detailed position of amphitrk- and amphielav - positive cells locates them within the epidermis or just beneath it, suggesting that if these cells are migrating they might be doing it either through the epidermis or through the subepidermal plexus . On taking this independent evidence together with the expression of the vertebrate trk and hu / elav orthologue genes in the neural crest and/or its derivatives, it is very tempting to establish parallelism between these cells and the vertebrate neural crest . Therefore, if these cells (amphitrk- and amphielav - positive cells) individually detached from the epidermal layer and entered the sub - epidermal plexus, until reaching the definitive (and unknown) location at which they would finally differentiate into particular neuronal types, they would conform some of the properties of vertebrate neural crest cells . The particular migration of vertebrate neural crest cells is also characterised by the precise definition of their individual routes, which are crucially dependent on an antero - posterior hox code interestingly, nested hox expression in scattered epidermal cells has been observed in the embryonic epidermis of amphioxus 4 by the time that migration begins and the earliest neural gene expression is already occurring . Furthermore, under retinoic acid treatment the location of those individual epidermal cells that express hox genes is altered, as is that of the amphicoe, islet and amphierr - positive cells and, importantly, that of the primary neurons observed at late neurula stages 4 . These results suggest that the embryonic skin of amphioxus is probably pre - patterned following an antero - posterior hox code, which in conjunction with other genes would divide the epidermis into distinct territories with particular gene expression profiles . Under this hypothesis, individual cells would migrate vertically through defined routes, which would molecularly, but not morphologically, be delimited into epidermal meridians (fig ., amphioxus skin possesses a moderate diversity of peripheral sensory neurons, probably born locally from normal epidermal cells through different expression profiles 50 . Collation of all the data set out here suggests that the individually migrating cells in amphioxus epidermis may well match cells with a particular gene expression profile that are responsible for the final differentiation into distinct types of peripheral sensory neurons, though these have much less pluripotency than in vertebrates . In summary, based on: i) the presence of distinct genetic programs in individual embryonic epidermal cells; ii) the ability to migrate as individual cells; iii) the ability to detach, presumably before migration; iv) correlation with the antero - posterior boundaries of hox expression domains; and v) the partial pluripotency of these cells, i suggest that amphioxus possesses an embryonic cell population that exhibits most of the properties of vertebrate neural crest cells . Thus, it is tempting to speculate that they might represent an intermediate evolutionary step that ended up in the deployment of vertebrate neural crest cells . The main caveats of this thesis are that these cells do not originate from the edges of the neural tube and that migration has the opposite orientation (ventro - dorsal). However these two caveats can be reconciled if, in an evolutionary sense, the amphioxus nerve neural system represents an intermediate state, from a diffuse neural epidermal net all around the body, like that of hemichordates 64, to full concentration on the dorsal side of the body, where the nerve tube cohabits in vertebrates with the embryonic germ of the neural crest and placodes . Accumulating data on gene expression during amphioxus embryogenesis challenges the classic morphological simplicity of the amphioxus nervous system . Spottily-expressed genes, neural and non - neural ectodermal specificity, cell migration in the ectoderm and cryptic complexity are all providing us with new insights into the neural genetic programs of this, our old beast, half - way along the path of construction of complex vertebrate nervous systems . In the near post - genomic future, more and more data will be arriving and, hopefully, experimental embryology (by means of genetic manipulation of living embryos) will help clarify the numerous question marks on the evolution of the nervous system, for which the friendly little amphioxus may have some answers . Lateral view showing the internal anatomy and part of the overlying segmented muscle blocks (myomeres). Hypothetical model for neural crest - like cell migration in amphioxus . The expression of characteristic neural genes in scattered individual cells in the epidermis indicates that neuronal precursors are generated from the normal epidermal cells following a particular genetic program switched on during neurulation . These unknown genetic programs should endow these particular cells with additional distinctive properties, which might include the acquisition of individual migratory behaviour . The migration and terminal differentiation of those neuronal precursors, in particular locations, could depend on the pre - patterning of the neurula epidermis . This model summarises and gives an oversimplified view of the epidermal expression of different genes that seem to participate in the epidermal patterning of the amphioxus neurula . As in the neural tube, hox genes are expressed in a nested manner and, together with the expression of amphipax6, amphien and amphicdx, divide the entire epidermis into meridians of differential expression . All these genes are expressed in a scattered manner, but are delimited along the anteroposterior axis as indicated by colour code . In the case of the hox genes, the meridians were established by the combinatorial expression of amphihox 1, 3, 4 and 6 . Under this hypothetical model, those individual cells (red dots) mentioned above, would migrate vertically (arrows) through defined routes, as delimited by each meridian of combinatorial expression.
In the analysis of the overall evolution of life on the planet the tree of life (tol) hypothesis has dominated for almost two centuries, though networks, ladders and other kinds of structures have been employed both before and since the tol hypothesis became established . Naturally, because the tol hypothesis predated the discovery of mobile genetic elements (mges) or even the discovery of genes, the initial formulation of the tol hypothesis specifically dealt with, and was synthesized using the observed phenotypes of cellular life . The discoveries of conjugation, transduction, transformation, plasmids, bacteriophage, gene transfer agents and nanotubes have presented the tol hypothesis with its greatest challenges because these processes and associated mobile genetic elements have the potential to disrupt the vertical inheritance pattern that is expected from the tol hypothesis they facilitate horizontal gene transfer (hgt). The past decade has seen a significant amount of debate concerning whether or not hgt is important, irrelevant, or inbetween . One particularly interesting fact that has emerged from the sequencing of genomes came from the analysis of 10 million protein - coding genes and gene tags in sequenced eubacterial, archaebacterial and eukaryotic genomes as well as metagenomes . It was observed from this analysis that genes encoding transposases are the most abundant kinds of genes in nature . These genes are responsible for facilitating the horizontal transfer of genetic material and testify to the importance, or at the very least, the success of such processes . The upshot of our genome - level analyses is that hgt can easily be shown to be almost ubiquitous, frequent in some kinds of genes, less frequent in others, performed between cellular life forms and mobile genetic elements . In fact, it now seems that one of the major restraints on hgt has nothing to do with phylogeny, rather it is the degree of a protein in its protein - protein interaction network . In other words, proteins have a strong tendency to be involved in hgt, with this process being mitigated or moderated simply by the degree to which a protein interacts with other proteins . If it is positioned centrally in the network (as judged by its degree), then it is less likely to be involved in successful hgt . Therefore, the tol hypothesis has now been well and truly tested and shown to be an inadequate model for all life on the planet . The largest statistical trend has been suggested to be approximately 1.5% of the data, though leigh and coworkers, have shown that even within the set of trees displaying this trend, there is significant incongruence . One of the most obvious shortcomings of the tol hypothesis is that it does not deal with all the evolving entities on the planet . Mobile elements have normally been frozen out of discussions of the grand schemes of evolution of life . They simply did not feature in the tree of life hypothesis and with notable exceptions (e.g., refs . 19, 23 and 24) they have not been included in tree of life diagrams or in discussions of the evolutionary relationships between cellular organisms and mges . This might seem to be permissible if mges played a very small role in the evolutionary history of life on the planet, but when the data are examined, we can see that mges have played an enormous role . Phage, which are important agents of hgt, for instance, are the most abundant life forms on earth, with ~10 tailed phage particles on the planet and are responsible for 10 infections per second . We can see that cells (and in particular, prokaryotic cells) are hugely influenced by mges and we also see mges themselves are greatly influenced by cells . Therefore, there surely must be a better means of thinking about the evolving entities on the planet than simply focusing on the tol hypothesis and only considering small portions of the genomes of a fraction of the evolving entities . The evolutionary history of life on the planet is full of vertical and horizontal connections between all kinds of evolving entities . In figure 1 we demonstrate an ever more frequently seen kind of network diagram that is displaying a very common motif in evolutionary biology . This diagram depicts the connections between genes that are found in enteric bacteria and some mobile genetic elements, in this case, plasmids . Every node in the network is a gene and every edge is a statement that the two connected nodes manifest greater than 95% sequence similarity . The interesting thing is that we can see all possible kinds of connections chromosomal genes connected to chromosomal genes, mge genes to mge genes and chromosomal genes connected to mge genes . This figure is clearly not depicting constantly diverging cellular organisms; it is a network showing the sharing of genes between all kinds of evolving entities . This is a network where the nodes represent genes and the edges represent links between genes where the sequence similarity is greater than 95% at the nucleotide level . The blue nodes are genes that are found on plasmids, while the brown nodes are genes that are found in cellular chromosomes . The blue edges link mge genes with other mge genes, the green edges link chromosomal genes with chromosomal genes and the red genes link mge genes with chromosomal genes . A useful way to construct hypotheses is to start at uncontroversial starting points axioms that we can all agree on . With a goal to describe life in its most fundamental way, we might consider that the first axiom might be that all evolving entities are included in any hypothesis that dealt with the most fundamental description of evolution . Next if we refer to the hundreds of thousands of experiments and observations that have concerned the inheritance of genetic information, we have made the observation that genes can be acquired by both vertical and horizontal transmission . So, this is the second axiom the theory must encompass horizontal and vertical acquisition of genetic material . Starting with these two axioms, we can easily see that tol models have handicaps that are difficult to overcome . Many tol models do not even accommodate these two most basic of axioms . In its place, we have proposed that that the best way to describe evolution is to consider evolving entities such as nucleotides or genes or operons or even genomes as genetic goods in the same sense as goods are often viewed in the discipline of economics . It encompasses all the patterns and processes we see in nature and at no time does it try to ignore patterns or evolving entities . The public goods hypothesis gets away from the vocabulary of tree - thinking and its associated history and does not require ad hoc amendments or qualifications in order to incorporate the observed data . Current incarnations of the tol require footnotes relating to horizontal gene transfer, hand - waving in relation to mobile genetic elements and dismissal or avoidance of fusions of cellular and/or genetic elements . In the field of economics, goods may be exchanged, moved, modified and amalgamated into larger goods, transported or even destroyed . Furthermore, goods can be classified according to the properties of excludability or rivalry (also known as subtractability). An excludable good is one where it is relatively easy to prevent others from accessing that good and a rivalrous good is one whose use by one individual effectively prevents its use by another . Naturally, the objects in evolutionary biology have their own properties and how we view them is likely to differ from how economists view goods, nonetheless, goods - thinking provides a useful perspective on evolutionary biology . For the most part, it is difficult to see that genetic goods might be excludable . The nucleotides that are used by all evolving entities are the same and the genetic code always consists of triplets of codons, genes have promoters, start codons and stop codons and recombination (breaking and joining of nucleic acids) is cosmopolitan . The machinery of dna replication and of translation of protein - coding genes is pretty universal the exceptions for translation are the alternative genetic codes . However, for the most part, genetic material is not excludable and this is irrespective of whether the genetic material is found in a cell, on a plasmid or in a virus . There are three kinds of evolving entities on this network, represented by the nodes and the edges represent identifiably homologous regions that are shared . As can be seen, we have sharing between cellular life forms, between mobile genetic elements and between cellular and mobile elements . We know of no formulation of the tol hypothesis that encompasses this kind of situation, however a goods - thinking approach is more than adequate to encompass the observed data and in this particular case, the genetic goods do not appear to be excludable . It remains to be seen whether effective excludability is possible for some genetic goods and this line of thinking automatically suggests a program of research . This property refers to whether a good is available to be used by one individual simultaneous with its use by another individual . How we view rivalry might depend on whether we wish to view a gene as all copies of its orthologs or whether we wish to focus on a single copy of the gene itself . If we view a gene as all copies of the gene, then that gene is non - rivalrous, whereas the latter might indicate that it is rivalrous . Clearly, because the mechanism of replicating genes is found in all cellular life forms, then any kind of gene can be potentially replicated and therefore, it is difficult to make any kind of gene rivalrous . As a consequence of the difficulty in making genes excludable or rivalrous, we view genes to be public goods for the most part . They are free to be inherited vertically from parent to offspring and they are free to be acquired horizontally . This does not mean that there are no constraints on gene movement, but this does not affect the definition of genes as public goods . Just because we might view genes as public goods in a fundamental way we have mentioned the alternative genetic codes, but we might also consider toxin - antitoxin genes as being somewhat dependent on one another and therefore, they can effectively exclude other genes or genomes from having one without the other . Likewise, with plasmid incompatibility systems, we find that plasmids are rivalrous for the cells in which they replicate, meaning that a particular cell might become a club for only one kind of plasmid with a particular incompatibility system . It is outside the scope of this manuscript to detail other situations where genetic goods might be privatized or brought into clubs or coalitions, but it is likely that such situations exist . In a brief aside, we might consider the public availability of genes and proteins to be something that is a general feature of both genetic and proteic material . It would be wrong to consider proteins that are largely contained within a bacterial cell to be private goods for that bacterium . A suite of proteins capable of breaking down phenylacetate, for instance, might all be contained within the cell that produced the proteins, however, removal of phenylacetate from the environment might benefit other organisms directly . Therefore, we might consider that even though these phenylacetate - degrading proteins appear to be private goods, the consequence of their existence is a public good and because the genes can be acquired by other organisms through appropriate vectors or transformation, the genes can also be considered public goods . In 2004, the discovery of a 1.2 megabase virus led to speculation on whether this might represent a fourth domain of life (sensu woese). A technical comment in response to this publication showed a phylogeny with one mimivirus gene occupying a phylogenetic position within the eukaryotes and not as a separate group outside the three domains . The response to this comment was that [] the tradition is to deny viruses the status of bona fide living organisms and to a priori doubt the capacity of phylogenetic analyses to investigate their deepest origin . However, since then it has been shown that mimivirus genes occupy many different phylogenetic positions and the positioning of mimivirus as a fourth domain of life is probably not sensible . This exchange encapsulates the two sides of the argument on one side it is held that cellular organisms are real life, whereas viruses are not and on the other side, viruses have all the traits necessary to be included in any discussions about life on the planet . Standard definitions of viruses usually cite their size or an inability to replicate autonomously as being the feature that separates them from cellular organisms . But with giant viruses like mimivirus, megavirus and mamavirus that are larger than many bacteria and with many intracellular bacteria being unable to replicate or live autonomously, then the distinctions are no longer so clear, yet the tol treats them as entirely separate . Both kinds of evolving entity (cellular and viral) can contain genes for transcription, translation, replication, metabolisms of all kinds and so forth . An analysis of escherichia coli, has identified almost 16,000 different gene families that are to be found in the various genomes of this species, with only approximately 6% of these gene families being found in all sequenced genomes of e. coli . However, just like mimivirus, many of these genes have phylogenetic affinities that are incompatible with one another and many of the genes have only been found in one strain of e. coli . In many respects, mimivirus and e. coli have similar features . The only way in which they differ is that e. coli catalyzes its own replication . Therefore, it seems unusual from this perspective to completely exclude viruses from hypotheses governing life on the planet ., we view genes as goods that can be acquired vertically or horizontally and this includes all kinds of mobile genetic elements . The public goods hypothesis has the particular feature that ecology is allowed to play a much greater role in evolution than is generally acknowledged under a tree model . Under a tree model, we might expect an evolving entity to adapt to a particular environment in a gradual piecemeal fashion and even it might be expected that different parts of the phylogenetic tree would be adapted to different environments . What we see instead are high levels of diversity of organisms with mosaic genomes . In the public goods view of evolution, the environment would play a very big role and effectively a suite of genes that are adapted to a particular environment would operate in that environment, irrespective of the phylogenetic assignment of the cell that was replicating, transcribing and translating those genes . In other words, the environment, combined with population processes would select the collection of goods that existed in that environment, irrespective of which organisms were replication, transcribing and translating those goods and irrespective of whether the goods were on the chromosomes of cellular organisms, on plasmids or on viruses . While the tol hypothesis did not imply any particularly strong role for the environment, apart from the selection of fitter genetic variants, the public goods hypothesis implies that the environment is intimately involved in the rapid evolution of mosaic genotypes in order to procure the phenotypes that are best adapted . In ascribing a more important role to mges, we would be at pains to point out that the evolutionary history of life on the planet has seen contributions from both vertical and horizontal gene transfer . Often it has been said that if we count the actual number of vertical vs. horizontal transfers of genes and we include the numbers of genes involved (usually thousands of genes are inherited via cell division at every cell division and only a small number are acquired via horizontal acquisition and only infrequently), then vertical transmission of genes has occurred much more often than horizontal transfer . However, this line of thinking can be very unhelpful if we wish to discover long - term consequences of genome change . Counting numbers of genes and prioritizing vertical gene transfer has led to an unwillingness to see how it is often the horizontal transfer of genes that has led to rapid response to environmental change in a lineage . A very important example has been the spread of plasmid - borne antibiotic resistance in the past 50 y as a consequence of large - scale production of antibiotics . In the absence of mges, however, acquisition of these goods has led to the proliferation of the organisms with these goods . Darwin s paradigm has broadened and now includes descent with modification due to error - prone polymerases, genomic modification by horizontal gene transfer, natural selection on new variants and in the case of some cellular entities, such as animals, speciation as envisioned by people like ernst mayr.
A medline search revealed a report of olanzapine - induced hyponatremia, and three such cases have been reported at a dutch pharmacovigilance centre . Hyponatremia has also been reported with other typical and atypical antipsychotics . A systemic review by meulendijks et al . Included four studies and 91 publications containing case reports and case series of antipsychotic - induced hyponatremia . They found that the number of case reports of hyponatremia involving typical and atypical antipsychotics was 58 and 10 respectively, from 1974 to 2003 . They also concluded that antipsychotic - induced hyponatremia did not seem to be associated with age or gender and was not dose dependent . A 63-year - old hindu male, smoker and a known case of prostate enlargement was diagnosed with recurrent depressive disorder, for which he was on escitalopram 5 mg / day for last two years . Around two months back, he complained of unsatisfactory night sleep, feeling low, and experiencing referential ideas with elementary auditory hallucinations . The current exacerbation was categorized as severe depression with psychotic symptoms as per icd-10 (dcr). The dose of escitalopram was increased to 10 mg / day and olanzapine 5 mg / day was added . After two weeks, his sleep pattern was restored, symptoms abated and patient was better for about a month . He then developed symptoms of mild anorexia, nausea, mild weakness, and occasional muscle cramps . After 10 days, abrupt exacerbation of excessive weakness, lethargy, muscle cramps, unsteady gait, fleeting disorientation, and urinary retention developed, and the patient was admitted . His physical examination revealed mild pallor, tachycardia, normal blood pressure, moderate dehydration, and disorientation of time and place . His respiratory system and abdominal examination was unremarkable and his glasgow coma scale was 11 . His blood investigations revealed serum sodium was 118 mmol / l, serum potassium was 3.5 mmol / l, and total leucocyte count was 12,100/cmm with 78% neutrophils . Thyroid - stimulating hormone, hemoglobin, albumin, and bicarbonate levels; liver and renal function; and lipid profile were normal . He was treated with oral fluid restriction, stopping olanzapine and starting antibiotics . In view of lack of signs and symptoms of fluid overload, it was considered as probable case of normovolemic hyponatremia and 3% nacl was used initially as the correcting fluid . Mmol / l / day . After 4 hours, the patient became alert and regained his sensorium . Later, correction was done using free water restriction, normal saline, and oral salt supplement, and by serially measuring blood na regularly every 6 hours . His symptoms and general condition improved over the next two days and serum sodium level reached 138 mmol / l . Patient was discharged on third day and he was told to continue escitalopram 10 mg . Olanzapine or any other antipsychotic was not restarted as his mental status examination did not revealing any psychotic psychopathology at that point of time . The patient and guardians were educated about the risk of hyponatremia, importance of diet and fluid intake habits, and early warning signs, and about quitting smoking . On subsequent three follow ups, he was maintaining well, and his serum electrolyte estimation was within normal range . A possible causal relation between the drug and adverse event was established by the who - umc scale (who) and naranjo algorithm . Written informed consent has been obtained from the patient for publication of this case report . The exact estimate about incidence of hyponatremia induced by antipsychotics is currently not available but many antipsychotics like chlorpromazine, fluphenazine, haloperidol, flupenthixol, trifluoperazine, thioridazine, amisulpride, and risperidone have been implicated . It has been suggested that the inhibitory effect of dopamine on release of anti - diuretic hormone (adh) is blocked by d2 receptor antagonism . This may be the possible mechanism for the causation of hyponatremia by all d2 receptor antagonists including olanzapine . The exception is clozapine, which has been found to have a beneficial effect on polydipsic behavior and development of hyponatremia, which may be attributed to its lower binding affinity to d2 receptors . Other contributory factors like old age, diet, salt intake, smoking, original psychopathology like psychogenic polydipsia, diabetes, other comorbid conditions, and side effects of antipsychotics or concurrent medications such as dryness of mouth may also play a role . In this case, the temporal relationship suggests olanzapine as the causative molecule, but it is difficult to pinpoint the offending medication . All serotonin reuptake inhibitors including escitalopram are also known for causing hyponatremia, and the patient was on escitalopram for two years without any problems . With the worsening of the disease, the dose of escitalopram was increased and at the same time, olanzapine was also initiated . Hence, the causality may be attributed to the combined effect to both of these drugs . However, escitalopram was restarted with no further episodes of hyponatremia suggesting a stronger possibility of causal relation with olanzapine . There may be involvement of other possible non - pharmacological factors like water and salt intake pattern and some infection as evidenced by leucocytosis . Olanzapine may be responsible for hyponatremia in vulnerable people, which may be the product of a combination of factors . Emphasis should also be laid on the education of patients and their family members regarding early identification of hyponatremia.
The online version of this article (doi:10.1007/s40119 - 015 - 0050 - 2) contains supplementary material, which is available to authorized users . Current guidelines call for lifelong aspirin (acetylsalicylic acid; asa) with consideration of up to 6 months of clopidogrel following transcatheter aortic valve replacement (tavr). Recently, small studies have questioned the necessity of dual antiplatelet therapy (dapt) following the procedure . Furthermore, many patients receiving tavr have a pre - existing indication for oral anticoagulation (oac), most commonly atrial fibrillation (af). To date, there have been little data formally addressing the optimal combination of antiplatelet and anticoagulant medications after tavr, particularly in patients with an indication for oac . A 2012 expert consensus document supported by the american college of cardiology (acc) and society of thoracic surgeons (sts) suggests treating these patients with asa and an anticoagulant, omitting clopidogrel . The 2014 acc / american heart association (aha) valvular disease guidelines give a iib recommendation for 6 months of treatment with asa and clopidogrel after tavr, but do not comment on patients with an indication for anticoagulation . Current european society of cardiology (esc) guidelines state that in tavr patients with af, a single antiplatelet combined with an anticoagulant is generally used but treatment decisions should be made based on the perceived bleeding risk of an individual patient . Actual treatment patterns in clinical practice are unknown and are likely to vary by physician and institution . Therefore, we assessed the current practice of antithrombotic treatment following tavr at a single, large academic center . We performed manual chart review of all patients undergoing tavr from april 2009 through march 2014 at brigham and women s hospital in boston, ma, usa . Pre - tavr antithrombotic regimens were obtained from admission medication reconciliations or prior clinic notes when possible . Post - procedural medications were obtained from the hospital s electronic medication administration log and patient discharge summaries . All procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation (institutional and national) and with the helsinki declaration of 1964, as revised in 2013 . Of 255 total patients (mean age 81 years, 48% female), 169 (66%) had transfemoral, 44 (17%) had transapical, and 42 (16%) had an alternative access site tavr (table 1). One hundred and thirty - one (51%) patients had an indication for oac pre - tavr, of which 122 (48%) had af and chads2 (congestive heart failure, hypertension, age, diabetes, stroke) score> 1, 6 (2%) had a history of deep vein thrombosis / pulmonary embolism, and 3 (1%) had other indications . Of patients with an indication for oac, 92 (70%) were on oac prior to the procedure, the majority (88%) of whom were treated with warfarin . Twenty - nine (11%) of the total cohort were on dapt prior to the procedure (most for recent coronary stenting) and 5 (2%) were receiving triple therapy with two antiplatelet agents and an anticoagulant . Complete baseline and discharge antithrombotic use is shown in table 2.table 1baseline characteristicscharacteristicvalueage, years80.6 9.77bmi, km / m 27.3 6.66white94.9male51.8hypertension90.2diabetes39.6atrial fibrillation or flutter48.2 permanent38.2 paroxysmal45.5 n / a16.3chads2 score3.29 1.05nyha class iii / iv93egfr, ml / min/1.73 m 57.8 29.5dialysis3.1mi21.6pci29.0cabg36.1peripheral arterial disease22.0cerebrovascular disease13.3chronic lung disease40.8dvt / pe9.0gi bleeding14.9hemoglobin, g / dl11.1 1.78platelets, k/l201.7 82.6lvef,% 53.8 14.68aortic valve area, cm 0.66 0.17aortic valve peak velocity, m / sec4.29 0.63moderate - severe mr39.3transfemoral66.3transapical17.3other valve access site16.4values are mean standard deviation or percentage bmi body mass index, cabg coronary artery bypass grafting, chads 2 congestive heart failure, hypertension, age, diabetes, stroke, dvt / pe deep vein thrombosis / pulmonary embolism, egfr estimated glomerular filtration rate, gi gastrointestinal, lvef left ventricular ejection fraction, mi myocardial infarction, mr mitral regurgitation, n / a not available, nyha new york heart association, pci percutaneous coronary interventiontable 2admission and discharge antithrombotic regimens in patients undergoing transcatheter aortic valve replacementadmission antithrombotic regimendischarge antithrombotic regimensapt dapt oacsapt + oactriple diedtotalnone416041530sapt77801603104dapt121041229oac012217233sapt + oac050433354triple0101305total121222891515255 asa aspirin (acetylsalicylic acid), dapt dual antiplatelet therapy, oac oral anticoagulation, sapt single antiplatelet therapy sapt = asa or p2y12 antagonist dapt = asa + p2y12 antagonist triple = asa + p2y12 antagonist + oac baseline characteristics values are mean standard deviation or percentage bmi body mass index, cabg coronary artery bypass grafting, chads 2 congestive heart failure, hypertension, age, diabetes, stroke, dvt / pe deep vein thrombosis / pulmonary embolism, egfr estimated glomerular filtration rate, gi gastrointestinal, lvef left ventricular ejection fraction, mi myocardial infarction, mr mitral regurgitation, n / a not available, nyha new york heart association, pci percutaneous coronary intervention admission and discharge antithrombotic regimens in patients undergoing transcatheter aortic valve replacement asa aspirin (acetylsalicylic acid), dapt dual antiplatelet therapy, oac oral anticoagulation, sapt single antiplatelet therapy sapt = asa or p2y12 antagonist dapt = asa + p2y12 antagonist triple = asa + p2y12 antagonist + oac all patients had oac held prior to the procedure and only 12 (13%) patients on baseline oac were bridged with a parental anticoagulant prior to tavr . There were 155 patients (65%) who had an indication for oac post - tavr (including 19 with new onset af), and of these 77 (50%) were bridged with parental anticoagulation after the procedure . Of the 145 patients with an indication for oac who survived the initial hospitalization, 106 (73%) were discharged on an antithrombotic regimen that included an anticoagulant . Of the 16 surviving patients with new onset af, 11 (69%) were newly started on oac after tavr . In the total cohort there were 15 deaths, 13 strokes (10 ischemic, 2 hemorrhagic, and 1 unspecified) and 29 major bleeding events prior to discharge . Seven out of 13 patients with in - hospital stroke (5 ischemic) had longstanding af . Of the 5 patients with ischemic stroke, three were not on baseline oac and two had oac held without bridging prior to the procedure . Of 106 patients discharged on oac, 89 (84%) were treated with asa + oac . The most common discharge regimen for the 95 surviving patients without an indication for anticoagulation was dapt (93%) with only 7 (7%) receiving asa or clopidogrel alone . In addition, the small number of events and lack of long - term follow - up precluded our ability to relate treatment medications with outcomes . In addition, the small number of events and lack of long - term follow - up precluded our ability to relate treatment medications with outcomes . In conclusion, at our institution, post - procedural antithrombotic regimens in patients receiving tavr are highly variable . Nearly two - thirds of patients had an indication for oac post - tavr . For patients with an indication for anticoagulation, treating physicians tended (84%) to follow consensus guidelines that suggest a regimen of asa + oac following the procedure . Overall, dapt remains the most frequent antithrombotic regimen at discharge, although 7% of patients were treated with a single antiplatelet agent alone . An analysis of the german aortic valve registry (gary) found similar results with 66% of patients discharged on dapt and 27% discharged on an anticoagulant . This study showed a higher rate of triple therapy with 16% of total patients discharged on dapt plus an anticoagulant . Whether these regimens truly represent the optimal balance between bleeding and thrombosis following tavr, particularly in patients at high risk for adverse events like those with af, this article is distributed under the terms of the creative commons attribution - noncommercial 4.0 international license (http://creativecommons.org/licenses/by-nc/4.0/), which permits any noncommercial use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the creative commons license, and indicate if changes were made . All procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation (institutional and national) and with the helsinki declaration of 1964, as revised in 2013.
Carbon nanotubes (cnts) belong to the nanomaterials family . Due to their unique specific properties (e.g., size, strength, and electrical conductivity), their use is planned in many industrial areas, including electronics, the medical and pharmaceutical industries, and aeronautics . Cnts make up a complex family, comprising single - walled and multiwalled carbon nanotubes (swcnts and mwcnts) composed of single or multiple graphene sheets rolled into cylinders . Cnts can also be functionalized for industrial purposes through modification of the nanotube surface with specific chemical groups . The biodurability and high length - to - width aspect ratio of cnts have raised questions related to their toxicity and effects on human health . Their fibrous nature has led to particular concern surrounding the cnts, and parallels have been made with asbestos fibres and their effects on humans [2, 3]. To date, occupational exposure to cnts remains poorly understood, but exposure can occur during their manufacture as well as during their industrial use, for example, in the machining or sanding of carbon parts . During the last decade, many toxicological studies have been published on the potential health effects of cnts, but the results have been sometimes conflicting . The discrepancy is mainly a result of differences in the type of cnt used (shape, diameter, and being single - walled or multiwalled), the concentrations used, or the dispersion methods employed . Moreover, few studies have analysed sw- and mwcnts in the same experimental model [511]. To illustrate this complexity, cnts have been shown to induce in vivo an inflammatory response after intratracheal instillation [1217] or intraperitoneal injection with fibrosis and granuloma [2, 13], but the effects were less clear after inhalation [14, 18]. In vitro, genotoxic events have also been observed in vitro with the micronucleus assay [9, 2224] and the comet assay [22, 24, 25]. In contrast, asakura et al . Observed no induction of micronuclei or hgprt mutations in chl / iu lung cells, which raises concerns about the relevance of the choice of the cellular type according to nanomaterial and toxicological endpoints . The oxidative stress, induced after treatment with fibers and particles, can explain in part the biological effects observed . For carbon nanotubes, several works have shown that they were able to induce and increase ros production [2730]. The main objective of the present study was to determine the toxicological effects of cnts according to their physicochemical characteristics . However, as the majority of previous studies were conducted on immortalized cell lines and as syrian hamster embryo cells (she) are normal and easily implemented, we also compare the toxicological effects of cnts on she cells and on immortalized chinese hamster lung fibroblast v79 cells . This comparison will enable us to determine whether a normal cell model is more suitable than an immortalized cell line for evaluating the toxic effects of cnts . For this purpose, five commercially available cnts (one swcnt, two dwcnts, and two mwcnts), which can potentially be found in the workplace, were tested in v79 and she cells for their in vitro genotoxicity (comet and micronucleus assays), cytotoxicity, and oxidative stress induction (dcfh - da fluorescent probe). Three other laboratory - synthesized cnts (one dwcnt and two mwcnts) were tested for comparison . The single- and double - walled samples analysed in this study includeda purified single - walled carbon nanotube (swcnt 1100, nanocyl, belgium);a purified double - walled carbon nanotube (dwcnt 2100, nanocyl, belgium);a short, purified double - walled carbon nanotube (dwcnt 2150, nanocyl, belgium) derived from grinding dwcnt 2100;a purified double - walled carbon nanotube (dwef), donated by e. flahaut of cirimat / umr cnrs 5085, toulouse, france . A purified single - walled carbon nanotube (swcnt 1100, nanocyl, belgium); a purified double - walled carbon nanotube (dwcnt 2100, nanocyl, belgium); a short, purified double - walled carbon nanotube (dwcnt 2150, nanocyl, belgium) derived from grinding dwcnt 2100; a purified double - walled carbon nanotube (dwef), donated by e. flahaut of cirimat / umr cnrs 5085, toulouse, france . Two multiwalled carbon nanotubes were also tested:(v)a purified multiwalled carbon nanotube (mwcnt 3100, nanocyl, belgium);(vi)a short, purified multiwalled carbon nanotube (mwcnt 3150, nanocyl, belgium), derived from grinding of mwcnt 3100; a purified multiwalled carbon nanotube (mwcnt 3100, nanocyl, belgium); a short, purified multiwalled carbon nanotube (mwcnt 3150, nanocyl, belgium), derived from grinding of mwcnt 3100; two other mwcnt samples were provided by dr . D. begin (lmspc - umr 7515-strasbourg), synthesized according to gulino et al . : (vii)a raw multiwalled carbon nanotube (mwcnt sbb);(viii)a purified multiwalled carbon nanotube (mwcnt sbp).several criteria guided our choice of cnt samples . First, five of the samples are commercially available (samples 1100, 2100, 2150, 3100, and 3150) and can therefore be encountered in the workplace . The other three samples (dwef, sbb, and sbp) were synthesized in research laboratories . Second, each of the large cnt families is represented (single-, double-, and multiwalled cnts). Third, both short and long cnts were obtained in order to determine the biological effect of cnt length (2100 versus 2150; 3100 versus 3150). Finally, both raw and purified samples were chosen in order to determine the impact of the presence of chemical products other than carbon on cellular toxicity (2100 versus dwef; sbb versus sbp). A raw multiwalled carbon nanotube (mwcnt sbb); a purified multiwalled carbon nanotube (mwcnt sbp). The chemical contents of cnt samples were analysed by inductively coupled plasma mass spectrometry (icp - ms) (spectro ciros ccd, germany). Nanotube diameters and the number of walls present were measured by transmission electron microscopy (tem) (philips cm20, the netherlands). Specific surface area was determined using the bet technique with a gas sorption analyzer (asap 2020 micromeritics, france). Cnt lengths were determined by the supplier . In order to obtain a homogeneous suspension (estimated visually), the samples were placed in complete medium at the highest concentration used in in vitro assays and sonicated for 2.5 min . With a vibracell (50 w, 20 khz, bioblock scientific, france) at 40% power . Dls (dynamic light scattering) analysis was done to determine the agglomeration status of suspensions using a zetasizer nano zs apparatus (malvern, france), but as mentioned before by tavares et al . And as recently commented on by the oecd, such technique (designed for analysis of spherical particles) did not give correct results (data not shown). The alternative method, electronic microscopy, involves methods of sample preparation which induce changes in agglomeration status and thus is not perfectly adapted either . In the absence of adequate technique, the agglomeration status was unknown . The she and v79 cells were treated with cnts at concentrations ranging from 0.27 to 2.1 g / cm of cell culture dish (free radical generation) or from 0.23 to 3.75 g / cm (other assays). These concentrations are in the same range as those previously used in our laboratory for studies of asbestos fibres . In a preliminary experiment, these concentrations induced no more than 5055% cytotoxicity as measured by the wst assay (see below). V79 cells (lung fibroblast from chinese hamster, atcc, usa, reference ccl-93) were selected for this study as they are one of the cell models recommended in ocde guideline number 487 for use in the in vitro micronucleus assay . Cells were grown in dulbecco's mem (dmem; invitrogen, france), supplemented with 10% fetal calf serum (dutscher, france) and 0.5% penicillin / streptomycin (5000 u-5000 g / ml, invitrogen, france). Cells were incubated at 37c with 10% co2, as recommended by the supplier for optimal culture with our medium . Syrian hamster embryo (she) cell cultures were used as they are normal diploid cells, nongenetically modified, metabolically competent, and p53 effective and there is no known difference with those constituting the organism where they come from . They have been demonstrated to be suitable for genotoxicity assays [37, 38]. Cells were established from individual 13-day gestation foetuses (inbred colony, inrs, france). The culture medium used was dulbecco's mem (dmem; invitrogen, france), supplemented with 17% fetal calf serum (dutscher, france) and 0.5% penicillin / streptomycin (5000 u-5000 g / ml, invitrogen, france). Cells were incubated at 37c and 10% co2 . 1 10 cells / ml (v79) or 1.5 10 cells / ml (she) were seeded in 48 wells on a 96-well plate for 24 h. the cell cultures were then treated for 24 h with culture medium (control) or with sample suspensions in final concentrations between 0.23 and 3.75 g / cm of cell culture surface . The remaining 48 wells on the well plate received the same suspensions (medium or cnt samples) to ensure the absence of interference between cnts and wst-1 reagent . After treatment, 1/10 (v / v) wst-1 reagent (roche diagnostics, france) was added to each well for 3 h. the plates were then centrifuged at 4500 rpm for 5 min to eliminate the majority of cnts and therefore to avoid interference between the soluble formazan dye formed and the cnts at the time of the reading . The supernatant was transferred to new 96-well plates and optical density (od) was recorded at 450 nm and 690 nm with a microtiter plate reader (synergy ht, biotek, france,). The delta od (od450 nm od 690 nm) was then calculated . Data were expressed as% of control sem for each treatment concentration and compared using an anova - lsd test (fisher's least significant difference) (statgraphics centurion, statpoint technologies, usa). Cell counting for the comet assay was performed with a coulter z1 (beckman coulter, france) (data not shown). 5 10 v79 or she cells were treated with 0.27 to 2.1 g / cm of cnts for 24 h. thirty minutes before the end of treatment, 25 m of 2,7-dichlorodihydrofluorescin diacetate (h2dcf - da, invitrogen, france) was added to the cultures . Cells were trypsinized and then centrifuged and then placed in hbss (hank's buffer saline solution) with 50 g / ml of propidium iodide . A sample of nanometric anatase tio2 was used for the positive control at 9.2 g / cm . Statistical analysis was performed using an anova - lsd test (fisher's least significant difference) (statgraphics centurion, statpoint technologies, usa). Potential interference between cnts and dcf was tested by acellular assays, mixing h2dcf (obtained by naoh treatment of h2dcf - da) or dcf fluorescent probe (sigma - aldrich, france) and cnts at different concentrations (from 1 to 250 g / ml, equivalent to 0.23 to 58 g / cm of cell culture dish). No interference was shown for up to 25 g / ml (5.8 g / cm) of cnts in she cells (data not shown). The fpg enzyme, a glycosylase, recognizes and specifically cuts modified bases such as 8-oxoguanine from dna, producing apurinic sites that are converted into strand breaks by the associated ap - endonuclease activity . Therefore, dna strand breaks detected by the fpg modified comet assay provide a measure of oxidative dna damage ., with minor modifications . In brief, two duplicate comet slides were made for each treatment: one slide was treated with fpg and the other with the fpg buffer only . The she (2 10) or v79 (1 10) cells were treated for 24 hours either with cnts at concentrations ranging from 0.23 to 3.75 g / cm or with positive control methyl methanesulfonate (mms, sigma - aldrich, france) at 0.125 mm or with medium alone . Approximately 20,000 cells were mixed in 600 l of 1% low melting agarose (lma, sigma - aldrich, france) and the mixture was transferred onto a slide precoated with normal melting agarose (nma 1%, sigma - aldrich, france). Slides were then immersed in lysis solution (2.5 m nacl, 100 mm na2edta, and 10 mm tris with 1% triton x-100 and 10% dmso added fresh) and kept in the dark for 1 h at 4c . The slides were drained and incubated in the dark for 30 min at 37c, either in enzyme buffer alone or in fpg (5 u / ml) in enzyme buffer (40 mm hepes, 0.1 m kcl, and 0.5 mm na2edta; ph 8). The slides were immersed in cold alkaline solution (300 mm naoh, 1 mm na2edta; ph 13) for 20 min and electrophoresis was then performed in the same buffer at 0.7 v / cm for 40 min to allow the fragments of damaged dna to migrate towards the anode . The slides were then washed with 0.4 m tris - hcl for 15 min and stained with propidium iodide (2.5 g / ml). Images of 100 randomly selected comets were acquired and analyzed for each sample (comet assay iv, perceptive instruments, uk) in order to evaluate the% tail dna used as a measure of dna damage . Statistical analyses were performed on means using the anova - lsd test (statgraphics centurion, statpoint technologies, usa). The concentration / tail dna relationship was determined by linear regression (mixed model) after logarithmic transformation of tail dna and concentration values (stata 12.1, college station, texas, usa). Approximately 2.5 10 v79 cells and 5 10 she cells were seeded in labtek slides (nunc a / s, denmark) with 1 ml of culture medium . After 24 h, the cells were treated either with cnts at concentrations ranging from 0.23 to 3.75 g / cm or with positive control methyl methanesulfonate (mms, sigma - aldrich, france) at 0.25 mm or with medium alone for 24 h (v79 cell doubling time: 1418 hours; she cell doubling time: 1820 hours). At the end of treatment, cells were washed with pbs (phosphate buffer saline, invitrogen, france) and fixed in methanol for 15 min . Slides were washed in pbs and drained and received one drop of pro long gold antifade reagent with dapi (molecular probe, invitrogen, france). About 1000 cells were analysed at each concentration for the presence of micronuclei (mn). Cell proliferation / division was assessed through analysis of the mitotic index (% of mitotic cells). Statistical analysis of mn induction was performed on the pooled data of the three independent experiments using the chi - square test . The single - walled 1100 cnt sample contained 3.15 wt .% silica and 1.44 wt .% cobalt . The double - walled 2100 and 2150 cnt samples contained 2.69 and 2.48 wt . The multiwalled 3100, 3150, and sbp samples contained few impurities, but the mwcnt sbb contained 7.22 wt .% aluminium and 4.15 wt .% iron . The tem analyses revealed that most of the metal catalysts were located inside the carbon nanotubes . Specific surface areas were higher for single- (1128 m / g) and double - walled cnt (611 to 985 m / g) than for the multiwalled cnt (between 150 and 330 m / g). Due to the association of carbon nanotubes in bundles, it was not possible to accurately measure their lengths . The external diameters of the carbon nanotube samples ranked from small to large as follows: 1100 (1.54 nm) <dwef (1.63.4 nm) <21002150 (37 nm) <31003150 (1119 nm) <sbb - sbp (977 nm). After dispersion in complete medium, optical microscopy observations showed that the mwcnts were better dispersed than both the double - walled and single - walled cnt (1100), even though bundles were present in all samples . The production of reactive oxygen species (ros) is often associated with toxicological effects of particles or fibres . In order to address this issue, we performed ros detection in cells after treatment with cnts, using the cell - permeable dcfh - da fluorogenic probe . As shown in figures 1(a) and 1(b), no increase in fluorescence intensity was induced by exposure of either cell type to the 1100 single - walled carbon nanotubes or by the 2100 double - walled carbon nanotubes . The 2150 and dwef samples induced significant increases in fluorescence with concentration in v79 cells (figure 1(a)) but not in she cells (figure 1(b)). For the mwcnts in v79 cells, only the sbp sample did not induce significant increase in fluorescence . The 3150 induced significant increase at the highest dose, the 3100 at the two highest concentrations (1.05 and 2.1 g / cm), and sbb at 0.53, 1.05, and 2.1 g / cm . In she cells, all mwcnt samples were negative except sample sbb, which induced a significant increase at the highest concentration (2.1 g / cm) (figures 1(c) and 1(d)). Cell viability was assessed after 24 h treatment with the carbon nanotube samples (figure 2). The data are reported as the percentage of control relative to the concentration . 24-hour exposure to the swcnt 1100 sample caused no modification of cell viability in either cell type, regardless of the concentration tested (0.23 to 3.75 g / cm). The 2100 dwcnt induced a significant reduction in cell viability at 3.75 g / cm in she cells but not in v79 cells . All the other sw- and dw - carbon nanotubes induced a concentration - dependent decrease in cell viability, which became significant at 3.75 g / cm in v79 cells and at 1.87 g / cm in she cells for the 2150 sample and at 1.88 and 3.75 g / cm in both cell types for the dwef sample . All the mwcnts induced significant decreases in cell viability at the two (3100 in v79 and she; 3150 in she) or three (3150, sbb, and sbp) highest concentrations . The effect on cell viability of the samples at 3.75 g / cm ranked in the following order: in v79 cells: 11002100 (100102% of control) <2150 (77%) <dwef (74%) <3100-sbb (66%) <3150 (64%) <sbp (59%); in she cells: 1100 (106%) <2100 (87%) <dwef (74%) <31003150 (67%) <2150 (63%) <sbp (50%) <sbb (47%). In v79 cells: 11002100 (100102% of control) <2150 (77%) <dwef (74%) <3100-sbb (66%) <3150 (64%) <sbp (59%); in she cells: 1100 (106%) <2100 (87%) <dwef (74%) <31003150 (67%) <2150 (63%) <sbp (50%) <sbb (47%). In conclusion, the mwcnts were found to be more cytotoxic than both the sw- or dw - nanotubes . Two types of assay were used to evaluate the genotoxicity of carbon nanotubes in v79 and she cells: the comet assay and the micronucleus assay . Results obtained following 24-hour treatment with 1100, 2100, 2150, and dwef samples are presented in figure 3 . The positive control (mms) induced significant dna damage in both v79 and she cells, both with and without the fpg enzyme treatment . For the negative control (medium alone), an increase in the number of dna breaks was observed after treatment of the slides with the fpg enzyme . With the exception of sample 2150, treatment of the cells with the sw- or dwcnt samples induced no effect in either v79 or she cells, with or without fpg treatment . Sample 2150 induced a significant increase in the number of dna breaks at 1.87 and 3.75 g / cm in the absence of fpg in she cells (figure 3(f)). Negative results were also obtained in v79 cells with mwcnts (figure 4), regardless of the concentration tested and both with and without fpg treatment . In she cells, only the sbb and sbp samples showed a significant concentration - damage relationship, with a significant increase in dna breaks observed at the two highest concentrations (figures 4(f) and 4(h)). We also observed a concentration - related increase in damage after fpg treatment, with a significant response at the highest concentration for the sbp sample (figure 4(h)). In v79 cells, sample 1100 induced a significant increase in micronucleated cells at concentrations of 0.94 and 1.87 g / cm but not at 3.75 g / cm . The results obtained from exposure to the double - walled cnts (2100, 2150, and dwef) also showed one (2150: 0.23 g / cm) or two (2100: 0.23, 0.94 g / cm; dwef: 0.47, 0.94 g / cm) significant concentrations . In she cells in contrast, samples 1100, 2100, and 2150 had no effect, and dwef only induced a significant increase in the number of micronucleated cells at 0.23 g / cm . The 3100 mwcnt induced a significant increase in the number of micronucleated cells at concentrations of 0.23, 0.47, and 1.87 g / cm in v79 cells and at 0.47 g / cm in she cells . The 3150 mwcnt exhibited similar genotoxic potential in that three (0.23, 0.94, and 1.87 g / cm) and four (0.23, 0.94, 1.87, and 3.75 g / cm) of the concentrations tested induced significant increases in the number of micronucleated cells in she and v79 cell cultures, respectively . Micronucleus formation was significant in v79 cells at all concentrations for sbb and sbp samples, with a concentration relationship observed for the sbb sample . The sbb and sbp samples were also positive in she cells but only at three concentrations (0.23, 0.47, and 0.94 g / cm) for the sbp sample and four concentrations (0.23, 0.47, 0.94, and 1.87 g / cm) for the sbb sample . The v79 mitotic index shows that all cnts with the exception of the 1100 and dwef samples induce a decrease in the number of cells in mitosis . This effect was more pronounced for the mwcnts than for the single- or double - walled cnts and correlates with cell viability if sample dwef is excluded (figure 2). Cells, only sbb and sbp, and to a lesser extent 2150, induced a decrease in the mitotic index . The specific physicochemical properties of carbon nanotubes, associated with their high aspect ratios, have led many laboratories to initiate and conduct in vitro and in vivo toxicological studies . However, results are sometimes conflicting and despite these efforts it is difficult to draw any overall conclusions . In this work, eight cnts representative of each of the commonly encountered classes (single- (sw-), double- (dw-), and multiwalled (mw) cnts, purified and raw) were tested for their cytotoxicity and genotoxicity in she and v79 cells . V79 cells, which are recommended for the micronucleus assay (oecd guideline number 487), have also been used for comet assays in several studies . She cells were used as they are primary cells and are suitable for analyzing the genotoxic properties of chemicals and in particular the effects of fibres or particles [3638]. We have shown that, in our experimental conditions, mwcnts were more cytotoxic than their single- or double - walled equivalents in both cell types . She cells and v79 cells do not present any great differences in terms of sensitivity . Because the sb samples induced 5055% cytotoxicity at concentrations of 3.75 g / cm, higher concentrations would not have been compatible with the other assays for evaluating the genotoxic potential of cnts . Even though comparison with other studies is complex and risky because of differences between the materials and methods used, we note that our results differ from those obtained after 24-hour treatment in both macrophage nr8383 and human aortic endothelial cells in which the same toxicity was observed for sw- and mwcnts at concentrations of 31.2 g / cm and 1.4 g / cm, respectively . Several hypotheses can be put forward to explain the discrepancy between these results . First, the different methods used for sample dispersion may have caused some discrepancy in biological assays as the cnts may have been dispersed to different extent . Second, some cnts may interfere with the culture medium, leading to cytotoxicity through nutrient depletion [42, 43]. We tested this hypothesis in a preliminary experiment by incubating the culture medium with cnts . After cnt elimination, no she cell cytotoxicity or cytostasis was induced by the medium (data not shown). However, we observed only slight differences between the sbb and sbp samples . Moreover, electronic microscopy showed that the metal particles are located inside the cnts and therefore do appear to be in contact with the surrounding medium . Interestingly, as in our study, chen et al . Observed that the 3150 sample induced cytotoxicity in a549 human lung epithelial cells (34%) and in raw 264.7 murine macrophage cells (27%) but at much higher concentrations (25 g / ml, approximately 15 g / cm) than we observed . Cell number decrease, as measured by the wst viability test, and the decrease in cell mitosis for the majority of samples in both cell types, as measured by the mitotic index, suggest that cnts can act on the cell cycle and block cell division, as was observed in c6 rat glioma cells with mwcnts one possible explanation for this could be that the action of cnts mainly takes place at the level of mitotic spindle as was demonstrated in the studies of sargent et al . [4547]. The action of cnts on the cell cycle should therefore be investigated in a future study, by analysis of the cell cycle, the dna repair system, dna synthesis, and the spindle apparatus . Mwcnts, on the whole, also had greater effects than sw- and dwcnts in the genotoxicity assays . However, unlike in the cytotoxicity assays, some differences were observed in the responses of the two cell types . In the comet assay, none of the cnts induced a significant increase in dna damage in v79 cells, whereas sbb and sbp (mwcnts) and 2150 (dwcnt) induced significant increases in the number of dna breaks at the two highest concentrations in she cells . Treatment with the fpg enzyme increased the level of dna breakage in both cell types (see control assays with and without fpg in figures 3 and 4), indicating that there was a background level of dna base modification in cells . However, no significant difference was observed between control fpg and treated fpg cells in v79, and in she cells, only sbp triggered a significant increase in damage at 3.75 g / cm compared to the fpg treated control . Similar results were obtained with the fpg enzyme by cavallo et al . In their investigation of mwcnt genotoxicity in a549 cells . An increase in the number of dna breaks induced by the fpg enzyme oxidative stress and production of reactive oxygen species are described as cytotoxic and genotoxic effectors which can lead to the production of oxidized bases . This was demonstrated in different cellular types with the cell - permeable dcfh - da fluorogenic probe after treatment with swcnts or mwcnts [30, 49, 50]. In our case, even though we were able to observe significant ros production with the dcfh - da probe for some cnts, no clear relationship could be identified between ros production and dna damage . The effects of cnt - induced ros production should be investigated in more detail by examining the levels of superoxide dismutase and glutathione and by using ros scavengers . Cnt samples were also shown in our study to be capable of inducing micronucleated cells in both cell types, and the effect was seen to be more pronounced with mwcnts . The most genotoxic cnts were the 3150 mwcnt, whose length is described as short by the supplier, the raw and the purified sb samples . The decrease in micronucleated cell frequency at the highest concentrations may be explained by a cell cycle arrest, as was also suggested by the decrease in the mitotic index (see the previous section). Our results from the micronucleus assay corroborate those obtained by others with both sw- and mwcnts [9, 20]. For example, migliore et al ., who demonstrated that sw- and mwcnts induce the formation of micronuclei in raw 264 cells, also showed that these cnts can induce dna damage . Our results show that some cnts, and mainly the mwcnts, can induce cytotoxicity and genotoxicity in she and v79 cells . Furthermore, because the cnts induced more micronucleated cells than dna damage and as cnt exposure provoked a cell cycle arrest as revealed by the evaluation of the mitotic index, we can hypothesize that cnts may act on the apparatus spindle during cell division . When looking at the in vivo studies for a comparison and even if such exercise is limited in terms of conclusions, the mwcnts seem to be more genotoxic than swcnts as we have shown in the present study . But, in vivo, data are limited and results obtained for the swcnts present some discrepancies . Genotoxic effects have been seen in mouse or rat with swcnts by some authors [5254] but not by others [5558]. For mwcnts, results are less confusing with a majority of studies showing genotoxic effects [5961]. One study has compared sw- and mwcnts in the same model with the same methodology but in this work both sw- and mwcnts were unable to induce genotoxic effects [57, 62]. A number of comments can be made regarding the responses of the two cellular types, taking into account that cnts are present in both cellular types as early as 3 h of treatment (electronic microscopy analysis, data not shown): (i) cnt cytotoxicity is at almost the same level in both cell types; (ii) more ros were generated in v79 cells than in she cells exposed to cnts; (iii) more micronucleated cells were observed after cnt treatment in v79 cells, but no dna damage was revealed by the comet assay; the opposite of that was observed in she cells for sbb and sbp . V79 cells are immortalized cells . As they can undergo an infinite number of cell divisions and even though no genotyping or metabolism data were available for this clone, the enzymatic content and gene expression profile for v79 cells are most probably modified at the level of cell cycle checkpoints and dna repair pathways . These differences can explain both the higher level of ros production compared to she cells and the higher background of dna breaks observed in control v79 compared to normal she cells . However, the p53 protein, which mediates the cellular response to dna damage and is involved in cell cycle regulation, apoptosis, and dna repair, does not appear to be able to explain these differences . Indeed, v79 cells have already been described as defective for the functional p53 protein . As shown by chaung et al ., the v79 p53 sequence contains two mutation points that result in a nonfunctional protein . Conversely, she cells are normal diploid cells with no alterations in the cell cycle pathway [65, 66] and she cells also contain a normal p53 protein [67, 68]. However, even if v79 cells do have a mutated p53 gene, we showed in the present study that cnts induced the same cytotoxicity and induced micronucleated cell formation in both cell types ., who found no difference in sensitivity to micronucleus induction and cytotoxicity in p53-wild and p53-null human lymphoblastoid cells . Furthermore, the mitotic index suggests that a cell cycle arrest occurs in both cell types following exposure to cnts . Thus, this blockage does not appear to be influenced by the presence or absence of a mutated p53 gene . To examine this further, as we suggested earlier, additional experiments should be conducted to investigate the cell cycle, spindle apparatus, and effectiveness of the dna repair system . An analysis, at the mrna and protein levels, of p53 and mdm2 (e3 ubiquitin ligase that inactivates p53 by binding directly) in she cells, could be also beneficial to better understanding of the response of these cells . As mentioned before, our results show that, for a given cnt, the ros generation can be different according to the cell type . In acellular assay, we have shown that all cnts were able to induce dcf fluorescence in phosphate buffer up to 25 mg / ml (corresponding to 5.8 g / cm) (data not shown). As the basal level of ros was the same in terms of fluorescence intensity in both cell types and as cnts were able to induce ros in acellular assay, the level of ros cell generation seems to be specific to a combination between cnt and cellular type . These are preliminary results and ros production should be investigated in more detail by examining the levels of enzyme content of each cellular type, the response to ros scavengers, and so on . However, our results nevertheless suggest that no large differences exist between the v79 cell line and the she normal cells after cnt treatment . The two cellular types are thus complementary and a benefit can certainly be gained in using she cells as they are normal cells that are appropriate for the evaluation of nanomaterial cytotoxicity and genotoxicity . Regarding the physicochemical properties and biological effects of cnts, the most pronounced cytotoxic and genotoxic effects were obtained with the multiwalled sbb and sbp samples, and the least toxic cnts in our experiments were the sw- and dwcnts . Our data also demonstrate that, in our experimental conditions, there is no relationship between the toxicological effects of cnts and their metal contaminants . Indeed, sbb, which contains 7.22% aluminium and 4.15% iron, presented near - identical toxicological effects to sbp, which contains only 0.86% iron . Concerning surface area, our results suggest that increased toxicity is not correlated with a higher specific surface area . However, it is important to note that the bet method uses a gas to determine the surface area, and therefore the value obtained does not reflect the real surface area in contact with a liquid or biomolecules . Furthermore, the agglomeration status of the suspension used, which we were unable to determine in this study, could directly influence the biological response . The biological impact of cnt length is also unclear from our experiments . Even though the shorter 2150 sample was found to be more cytotoxic and induced more ros than the longer the long 3100 and short 3150 samples also presented no differences . In vivo, muller et al . Found that ground cnts were less toxic than unground cnts but concluded that the agglomeration state of the cnts rather than their length was likely to be responsible for these differences . The same conclusion was reached by sato et al . In their in vitro and in vivo studies . (2012) observed a more toxic effect from short cnts than from long cnts, concluding that cnt length was indeed responsible for the observed difference in toxicity in c6 rat glioma cells . In our study, the only physical parameters that we were able to partially link to toxic effects were the number of walls and the outer diameters of the cnts . Certainly, the thickest cnt samples (sbb and sbp) produced the most toxic effects (in terms of both cytotoxicity and genotoxicity). The importance of cnt diameter as a parameter to be considered in toxicology assessment has previously been suggested in the work of fenoglio et al . . Using two mwcnts of the same length range but with very different diameters, they showed that the thickest cnt was the least toxic in a murine macrophage cell line (mh - s). In conclusion, this in vitro study demonstrates that exposure to some but not all cnts induces cytotoxic and genotoxic effects, to different extent depending on the cell type used . Our results also suggest that some cnts may act on the cell cycle and on cellular division without having any genotoxic effect . Because of their different physicochemical properties, cnts have different toxicological profiles . This suggests that it is not possible to draw any general conclusions regarding the toxicity of these nanomaterials.
The medial entorhinal cortex is critically involved in spatial navigation and memory . Among other functionally specialized cell types 2008), it contains grid cells (hafting et al ., 2005), spatially modulated neurons which show periodic, hexagonally arranged spatial firing fields . Given the striking regularity and invariance of the grid representation, these cells are thought to be part of the brain s coordinate system supporting spatial navigation (see moser and moser, 2013 for review). Pure grid cells are primarily found in layer 2 (boccara et al ., 2010), which differs from other cortical laminae in its unique cell biology . Here the two types of principal cells, stellate and pyramidal neurons, have been described (alonso and klink, 1993; germroth et al ., 1989). Specifically, stellate and pyramidal neurons differ in conductances and projection patterns (alonso and llins, 1989; lingenhhl and finch, 1991; klink and alonso, 1997; canto and witter, 2012). Recent work indicates that stellate and pyramidal neurons can be reliably differentiated by calbindin immunoreactivity (ray et al ., 2014; kitamura et al ., 2014), and that these cells also differ in their inhibitory inputs (varga et al ., 2010). Calbindin - positive (calbindin) cells, which are clustered and arranged in a hexagonal grid (ray et al ., 2014), have been recently shown to project to the ca1 (kitamura et al ., 2014), while calbindin - negative (calbindin) neurons are homogeneously distributed and project primarily to the dentate gyrus (varga et al ., 2010; ray et al ., few studies have so far explored structure - function relationships in entorhinal circuits (schmidt - hieber and husser, 2013; domnisoru et al ., 2013; zhang et al ., 2013; see rowland and moser, 2014 and burgalossi and brecht, 2014 for reviews). Thus, the functional implications of the remarkable cellular diversity of layer 2 have remained largely unresolved . Resolving how differential spatial firing relates to principal cell types will clarify the cellular mechanisms of grid discharges and spatial input patterns to distinct subfields of the hippocampus . In the present work we aim at resolving layer 2 circuits by taking advantage of improved methodologies for identifying individual neurons recorded in freely moving animals . By cell identification and theta - locking - based classification of unidentified recordings, we provide evidence that grid and border responses are preferentially contributed by pyramidal and stellate cells, respectively . To explore the cellular basis of grid cell activity in medial entorhinal cortex, we juxtacellularly recorded and labeled neurons in layer 2 (which contains the largest percentage of pure grid cells; boccara et al ., 2010) in awake rats trained to explore 2d environments (tang et al ., 2014). The clearest grid - like firing pattern in our sample of 31 identified cells (17 of which met the criteria for spatial analysis; see experimental procedures) was observed in the calbindin cell shown in figure 1a . This neuron had pyramidal morphology, with simple dendritic arborization and a single large apical dendrite targeting a calbindin patch (figure 1b; see also ray et al ., 2014). During exploratory behavior, calbindin neurons fired with strong theta rhythmicity and phase locked near the trough of the local field potential theta rhythm (figure 1c; ray et al ., 2014). Spatial autocorrelation analysis of the firing pattern in the 2d environment revealed a hexagonal periodicity of firing fields (grid score = 1.07; figure 1d), indicative of grid cell activity (hafting et al ., 2005). Because of its relatively low firing rate (0.5 hz) this cell was not included in the grid cell sample (see experimental procedures). Most other identified calbindin neurons had no clear spatial firing patterns . The clearest border discharge in our sample of identified cells was observed in the calbindin cell shown in figure 1e . This cell was a stellate neuron, which did not have a single apical dendrite, but instead extended multiple and widely diverging ascending dendrites; this dendritic tree spanned a vast field, which encompassed multiple calbindin patches (figure 1f; see also ray et al ., 2014). On average, spikes from calbindin neurons were weakly modulated by the local theta rhythm (figure 1 g). In 3 out of 11 calbindin cells from recordings with sufficient spatial coverage, we observed clear border firing patterns as in figure 1h . While we did not observe grid cells, nonspatial firing patterns also dominated in calbindin neurons . While the small size of the data set of identified neurons prevented us from establishing firm structure - function relationships, four preliminary observations can be drawn: (i) grid cells are less abundant in layer 2 than previously assumed (sargolini et al ., 2006; boccara et al ., 2010; but see mizuseki et al ., 2009; gupta et al ., 2012; bjerknes et al ., 2014), and there is no one - to - one relationship between spatial discharge characteristics and cell type, (ii) calbindin neurons probably include grid cells, (iii) the absence of grid cells in the 22 identified calbindin stellate neurons suggests that grid cells are rare in this cell population, and (iv) calbindin neurons include border cells . Currently available evidence points to a correspondence between cytochemical (calbindin versus calbindin) and morphological (pyramidal versus stellate) classification of principal neurons in layer 2 (varga et al ., 2010;, we determined the percentage of calbindin cells in layer 2 and compared these data with related measurements in the literature (figure s1a available online). In agreement with previous studies (peterson et al ., 1996; kumar and buckmaster, 2006; varga et al ., 2010), we found that layer 2 neurons consist of 34% calbindin and 53% calbindin (and reelin) principal cells, and 13% interneurons (figure s1b). (2014) found about 30% of calbindin cells, most of which were shown to have pyramidal morphology (see also varga et al ., 2010; calbindin and calbindin cells showed large quantitative differences in their morphology, but without a clear bimodality in individual morphological parameters (figures s1c and s1d). Calbindin cells had significantly (on average 2.5-fold) smaller dendritic trees (figure s1e). Calbindin cells had a single long (always apical) dendrite, which accounted on average for 63% of the total dendritic length (figure s1e) and which was polarized toward the center of pyramidal cell patches as shown previously (ray et al ., 2014). Calbindin expression matched well, but not perfectly, with pyramidal cell morphology (figures s1c and s1d). Calbindin cells featured similar - length dendrites with the longest dendrite contributing on average for 33% of the total dendritic length (figure s1e). These results are in line with published data and indicate that calbindin and calbindin cells largely correspond to pyramidal and stellate neurons, respectively . However, the lack of clear morphological bimodality in layer 2 (see also canto and witter, 2012) implies that the correspondence between pyramidal / calbindin and stellate / calbindin might not be perfect . Interestingly, the spine density in calbindin cells decreased as a function of distance from the soma, whereas the reverse was true for calbindin cells (figure s1f). These morphological differences, together with clustering of calbindin cells in patches and the polarization of their apical dendrites toward the center of calbindin patches (ray et al ., 2014), likely result in a local and overlapping sampling of inputs in neighboring calbindin cells, whereas neighboring calbindin stellate cells sample large and nonoverlapping input territories . Calbindin stellate and calbindin pyramidal cells differ strongly in their temporal discharge properties (figures 1c and 1 g; ray et al ., 2014). We therefore wondered if temporal discharge properties could be used to classify layer 2 cells as putative pyramidal or stellate neurons . We used a support vector machine to classify neurons based on both the spike phase and strength of phase locking to local field potential theta oscillations, which indeed clearly segregated calbindin and calbindin cells with a large distance to the separating hyperplane (figure 2a; see supplemental information). To further improve the purity of assigned cells, we added a guard zone around the hyperplane separating the gaussian kernels classifying calbindin (light green background) and calbindin (gray background) cells (omitting the guard zone and classifying all cells did not qualitatively affect the results; data not shown). We tested our classifier by a bootstrapping approach (figures s2a and s2b) and found that a large fraction of calbindin and calbindin cells could be correctly assigned (figure s2c). More importantly, the specificity of classification procedure reflected in the purity of the resulting cell samples was excellent, i.e., 89% for putative calbindin cells and 83% for putative calbindin cells (figure s2d), and even higher values for combination of identified and putatively assigned cells (figure s2e). We further evaluated the robustness of the classifier by testing it on a larger data set of identified layer 2 neurons (ray et al ., 2014) recorded under urethane / ketamine anesthesia (klausberger et al ., 2003). We consider this a challenging test of the classifier, as theta phase and strength of locking might differ between the awake and anesthetized state . Similarly to the awake situation, however, the large majority of neurons recorded under anesthesia were also correctly classified (92% of calbindin cells, 65% of calbindin cells, p <0.001, bootstrap; figure 2b, bottom), suggesting that our classification criteria work robustly and can effectively generalize across very different recording conditions (figure 2b). Encouraged by these results, we classified the larger data set of our hitherto unidentified layer 2 juxtacellular and tetrode recordings (classified + identified n = 193 cells). To assess the relationship between cell identity and spatial firing properties, we pooled the nonidentified recordings, assigned to putative calbindin and calbindin cells, with the recordings from histologically identified neurons . The pooled data sets included n = 99 calbindin and n = 94 calbindin cells, respectively . In our first assessment of spatial discharge patterns, we attempted to classify grid and border cells solely using scores (grid score> 0.3, border score> 0.5; solstad et al . According to visual inspection of individual rate maps, however, these criteria were not sufficiently stringent and returned a majority of weakly to nonmodulated neurons, i.e., possibly a majority of false - positive grid and border cells . To resolve this issue (2014), in which spatial discharge properties were only quantified in those cells that carried significant amounts of spatial information (as assessed by a spike - shuffling procedure, see skaggs et al ., 1993; supplemental experimental procedures). This approach identified grid and border responses, which in a majority of cases were convincing according to visual inspection . Boccara et al ., 2010; burgalossi et al ., 2011; domnisoru et al ., 2013), a fraction of layer 2 neurons (33%; n = 63 cells) were significantly spatially modulated . Weak hexagonal symmetry of spatial firing patterns was observed in both the calbindin and calbindin data set, in line with previous observations (burgalossi et al ., 2011; domnisoru et al ., 2013 however, grid scores in the calbindin population were significantly higher than those in the calbindin population (p = 0.000046, mann - whitney u test; figures 2d and 2e), consistent with observations from the identified data set (figure 1). On the other hand, in line with observations from the identified data set (figure 1), calbindin cells had significantly higher border scores than calbindin cells (figure 2 g; p = 0.0012, mann - whitney u test). Border discharges in calbindin cells are shown in figure 2f, which also includes an example where border firing was confirmed by a border test (solstad et al ., 2008; lever et al ., 2009). Thus, according to the grid and border scores shown in figures 2d and 2 g, putative pyramidal and stellate cells have significantly different, but overlapping, spatial properties . Figure 2h gives an overview of the spatial response properties of our pooled calbindin and calbindin data sets, respectively (see also figure s3). Grid patterns were significantly more common in the calbindin population, where 19% (19/99) of the cells passed our grid cell criteria, compared to only 3% (3/94) in the calbindin population (p = 0.00046, fisher s exact test). A higher fraction of calbindin cells passed the border cell criterion (11% calbindin, 10/94 cells; versus 1% calbindin, 1/99 cells), and this difference was statistically significant (p = 0.0042, fisher s exact test). These data confirm and extend the conclusion from our recordings of identified cells and indicate that grid cells are preferentially recruited from the calbindin population, while border responses preferentially occur in calbindin cells . Unlike many studies based on tetrode recordings (sargolini et al ., 2006;, 2010; but see zhang et al ., 2013), a substantial fraction of cells showed head - direction selectivity both in identified and theta - assigned calbindin and calbindin cells (figure s4). Head - direction selectivity was more common in calbindin (19%, 19 out of 99 cells) than in calbindin cells (12%, 11 out of 94 cells), but this difference was not significant (p = 0.17, fisher s exact test), and both classes contained pure as well as conjunctive responses (sargolini et al ., 2006). The grid and border cells recorded here showed systematic differences in spike locking to local field potential theta oscillations (figure 3a). Spikes from most grid cells were strongly entrained by the theta rhythm, with strong phase locking (figure 3b) and a phase preference near the theta trough (figure 3c; p = 0.000000027, rayleigh s test for nonuniformity). The modulation of spiking activity of border cells by the theta rhythm was significantly weaker than in grid cells (figure 3b; p = 0.0013, mann - whitney u test) and showed on average only a weak, nonsignificant phase preference for the theta peak (figure 3c; p = 0.21, rayleigh s test for nonuniformity), which differed significantly from the phase preference of grid cells (figures 3b and 3c; p = 0.0000088, parametric watson - williams multisample test). Thus, in layer 2 grid and border signals mirrored the temporal differences between calbindin pyramidal and calbindin stellate cells reported earlier (ray et al . Relating functionally defined discharge patterns to principal cell diversity is an unresolved issue in cortical physiology . In layer 2 of medial entorhinal cortex, most studies suggested that spatially modulated responses are common, and that grid firing patterns are contributed by both stellate and pyramidal neurons (burgalossi et al ., 2011; schmidt - hieber and husser, 2013; domnisoru et al ., 2013; zhang et al ., 2013). In line with such evidence, we observed a consistent fraction of spatially modulated neurons in layer 2, and weakly hexagonal firing patterns in both stellate and pyramidal neurons . At the same time, however, most grid patterns that met our grid score and spatial information criteria (see supplemental experimental procedures) were classified as putative calbindin pyramidal cells (see figure s3a). Border responses, on the other hand, were predominantly observed in the calbindin stellate population (figure s3b). Our data indicate a strong interdependence between cell type and spatial discharge pattern in layer 2, where a calbindin cell is about six times more likely to be a grid cell and ten times less likely to be a border cell than a calbindin neuron . Our confidence in classification is based on the striking differences between calbindin and calbindin cells in their temporal discharge properties (ray et al ., 2014), the assessment of classification quality by our bootstrapping approach, and the robustness of classification across widely differing recording conditions . It is important, however, to note that our conclusions rest on the validity and accuracy of our classification procedure . A key finding from our work is that layer 2 principal cells can be classified with high accuracy by their distinct temporal discharge properties . Such classification can be extended to a large number of unidentified layer 2 recordings from other laboratories, provided that the required histology and local field potential data have been collected . To this end we provide our classification training data set (table s1) and a custom - written matlab function (supplemental information, note s1). Supplying identity to formerly blind extracellular recordings could be instrumental for understanding principal cell diversity and cortical microcircuitry . Calbindin pyramidal cells might be predetermined for grid cell function as they receive cholinergic inputs, are strongly theta modulated, and are arranged in a hexagonal grid (ray et al ., 2014). We suggested an isomorphic mapping hypothesis, according to which an anatomical grid of pyramidal cells (ray et al ., 2014) generates grid cell activity (brecht et al ., 2014) and is an embodiment of the brain s representation of space in hexagonal grids . Representing grid discharge by a cortical grid might offer similar advantages as isomorphic representations of body parts, as barrel fields (woolsey and van der loos, 1970), or nose stripes (catania et al ., 1993), in somatosensory cortices of tactile specialists . Notably, the local similarity of grid cell discharges is high, as neighboring grid cells share the same grid orientation and scaling and are phase coupled even across distinct environments (hafting et al ., 2005; we speculate that calbindin pyramidal neuron clustering and apical dendrite bundling in patches (ray et al ., 2014) a surprising implication of our data is that the spatial input to the dentate gyrus is provided mainly by stellate border cells, whereas pyramidal grid cells do not feed into this pathway (kitamura et al ., 2014; ray et al ., border responses arise in stellate neurons, with long and widely diverging dendritic trees, i.e., such discharge patterns may result from a relatively global sampling of incoming inputs in medial entorhinal cortex and help generate place cell activity (bjerknes et al . The functional dichotomy of pyramidal and stellate cells in layer 2 will help elucidate how spatial discharge patterns arise in cortical microcircuits . All experimental procedures were performed according to the german guidelines on animal welfare under the supervision of local ethics committees . Juxtacellular recordings and tetrode recordings in freely moving animals were obtained in male wistar and long - evans rats (150250 g), which were habituated to the behavioral arena and trained for 37 days . Experimental procedures were performed as previously described (burgalossi et al ., 2011; herfst et al ., 2012) with the exception that methodological developments allowed us to identify neurons in drug - free animals (tang et al ., 2014; see also supplemental experimental procedures). Some of the data have been published in a previous report (ray et al ., 2014). Recordings in anesthetized animals were performed under urethane / ketamine / xylazine (klausberger et al ., 2003). A hilbert transform was used for assigning instantaneous theta phase of each spike based on theta in the local field potential in the spike - theta phase analysis . Grid scores were calculated as previously described (barry et al ., 2012) by taking a circular sample of the spatial autocorrelogram, centered on, but excluding the central peak . To determine the modulation of a cell firing along a border, we determined border scores as previously described or performed border tests (solstad et al ., 2008; lever et al ., 2009). Head - direction tuning was measured as the eccentricity of the circular distribution of firing rates . Classification based on strength of locking to theta phase (s) and preferred theta phase angle () was done by building a support vector machine, trained on the vectors (cos()s, sin()s) using a gaussian radial basis function kernel . Classification of nonidentified cells into putative calbindin and calbindin cells was performed by applying a conservative classification threshold, where we did not classify cells close to the separating hyperplane.
However, several fractures of glenoid fossa are managed nonoperatively, even if displaced, due to high incidence of associated injuries which may render patient unfit to undergo major orthopaedic surgery . There is a relative paucity of articles reporting on outcome of treatment of glenoid fossa fractures . We present our experience of treating these injuries over past decade with operative and nonoperative methods . 21 patients of glenoid fossa fractures were included in this series with 14 males and 7 females . Patients with displacement of> 5 mm who were fit to undergo surgery within 3 weeks of injury were operated using a posterior judet's approach . Overall 8 patients with displaced fractures were operated (group a) while 9 patients with displaced fractures (group b) and 4 patients with undisplaced fractures (group c) were managed nonoperatively . The mean age and followup period in this series was 29 years and 7.3 years respectively . In group a, average constant score was 87.25 . The least constant score was observed for group b (58.55) while group c had an average constant score of 86 . Operative treatment for displaced glenoid fractures is a viable option at centers equipped to handle critically ill patients and subset of patients with fracture - dislocation as opposed to fracture alone should always be treated operatively due to persistent loss of function . Scapular fractures are rare injuries and most often treated nonoperatively with acceptable results.12345 most scapular fractures are non or minimally displaced and do well with conservative treatment.167 this observation, however, has been based on the treatment of scapular fractures in general and its relevance is, therefore, very limited . A more differentiated approach is necessary as good results are not guaranteed with exclusively conservative treatment in all cases.8 as with any intra - articular fracture, displaced fractures of glenoid fossa may be managed operatively if substantially displaced.89101112131415161718 however, several fractures of glenoid fossa are managed nonoperatively, even if displaced, as high incidence of associated injuries may render the patient unfit to undergo major orthopedic surgery in view of more compelling urgencies.45891011121314 there is a relative paucity of articles reporting on the outcome of treatment of glenoid fossa fractures . On retrospective search of hospital records, we identified patients sustaining glenoid fossa fractures and admitted in our emergency department during the period ranging from 1998 to 2010 . Fractures were classified according to the widely used ideberg classification for glenoid fractures.5 we included only type ii - v fractures in our analysis since these fractures have the distinction of being associated with other high energy injuries and are managed differently as compared to type i fractures which are generally associated with shoulder dislocations . We were able to identify 21 cases with glenoid fossa fracture who were available for assessment after followup periods ranging from 2 to 14 years . There were 6 type ii, 7 type iii, 1 type iv, 6 type v, and 1 type vi fractures [table 1]. All subjects who were available for followup and gave informed consent for their inclusion in the present series were included . Demographic and outcome details of patients included in the series the mean age of patients at the time of trauma was 29 years (range 18 - 59) there were 17 males and 4 females . Road traffic accident was the most common mode of injury accounting for 15 cases, followed by fall from height (4), electrocution (1), and fall of heavy object (1). Associated injuries included brachial plexus injury (2), clavicle fracture (5), coracoids fracture (2), acromion fracture (2), scapular body fracture (3), ipsilateral upper limp fracture(s) (4), rib fracture(s) (9), spine injury (1), pelvic injury (2), lower limb fractures (2), head injury (4), blunt trauma chest (8), and blunt trauma abdomen (1). Overall, 12 patients had significant associated injury (excluding ipsilateral shoulder girdle fractures). After initial resuscitation in the emergency department according to the protocol of advanced life trauma support, patients were assessed for musculoskeletal and associated injuries . Radiographic imaging for scapular fractures included standard scapular trauma series with computed tomography with 3d reconstruction for complex fractures and inability to assess fracture displacement on radiographs (10/21 cases). Further management was based on the amount of fracture displacement and general condition of the patient . There were 17 fractures which were displaced> 5 mm, which was taken as the criterion for operative intervention, but only 8 were operated due to inability of the remaining 9 patients to undergo a major surgical procedure on account of poor general condition . We operated only on patients with displaced fractures who were able to undergo operative intervention within the first 3 weeks of injury [figures 1 and 2]. All fractures were approached from the posterior side using the judet's approach [figure 1] and fixed with either plate (6), screws alone (1), or plate with additional screws outside plate (1), depending on fracture configuration . During this approach, we tried to access only the lateral border of scapula through the intermuscular interval between infraspinatus and teres minor and did not attempt to directly reduce or fix fractures extending to scapular body or vertebral border . In this regard, we agree with bartonek et al . That restoring the lateral border is of paramount importance.19 although we did not use deltopectoral approach in any of the cases in the present series, we have used it in some recent cases where the main fragment was primarily anterior . External fixation was done for clavicle in one gustilo anderson type iiia open displaced fracture of glenoid with ipsilateral clavicle fracture [figure 3]. Remaining 13 patients, including 7 displaced fractures, were managed conservatively with a period of immobilization followed by early mobilization in a hope to achieve better clinical outcome [figure 4]. Patients were thus divided into three groups [a: managed operatively (n = 8); b: displaced but managed nonoperatively (n = 9); and c: undisplaced fractures (n = 4)]. Disappearance of visible fracture lines on x - rays and pain on clinical examination were taken as indicators of union . At the final followup, patients were assessed for pain, function, range of movements, and strength using the constant score20 and the final result was reported as excellent, good, fair, or poor, depending on the difference in scores of abnormal and normal shoulders (<11, excellent; 11 - 20, good; 21 - 30, fair;> 30, poor). (a) radiograph of right shoulder joint showing type v glenoid fracture in a 23 year old male (b) peroperative photograph showing open reduction and internal fixation through posterior approach using two plates (c) followup radiograph at 6 years showing plates in situ and union (d, e, f) clinical photographs showing excellent functional outcome with slight atrophy of infraspinatus muscle possibly due to surgical insult and the final constant score was 93 (a) radiograph of left shoulder joint at followup of 13 years in a case with open reduction shows some degree of degeneration (b, c, d) clinical photographs showing restriction of abduction to 120 and restricted rotations . Final constant score was 76 preoperative (a) and postoperative (b) radiographs of a patient with open glenoid fossa fracture managed with external fixation for clavicle fracture . (c, d) clinical photographs at 6 weeks followup showing the patient had restriction of abduction and external rotation . (e, f) clinical photographs at 6 years followup showing abduction and external rotation . Final constant score for this patient was 95 neutral (a) and abduction (b) anteroposterior radiographs of shoulder showing a type iii displaced fracture which was managed nonoperatively . Patient had good outcome with constant score of 81 and unrestricted movements (c and d) the mean length of hospital stay was 15.2, 32.3, and 3.8 days in groups a, b, and c, respectively . Time for fracture union was the least in group c (5.5 weeks) followed by group a (6.7 weeks) and was the longest in group b (9.4 weeks), but union was achieved in all cases without further intervention, with overall mean time of 7.7 weeks for union in this series . In group a, the average constant score was 87.25 with four excellent, two good, one fair, and one poor result . The least constant score amongst the three groups was observed for group b (58.55) with one excellent, two good, two fair, and four poor results . In group c, the average constant score was 86 with two excellent and two good results [table 1]. Amongst the different parameters of constant score, pain and function were the least affected at the final followup, whereas range of movements followed by strength were the most severely affected . Predictors of inferior outcome included brachial plexus injury [figure 5] and fracture dislocation of glenoid . Four of five cases with poor result in this series had either brachial plexus palsy or fracture dislocation . Only one poor result in group b was not attributable to either of these two factors . Time taken till maximal improvement in shoulder constant score was also compared amongst the three groups and yielded the least value for group a followed by groups c and b. there were two cases of superficial wound infection which resolved with prolonged course of antibiotic therapy for 6 weeks . Radiographs (anteroposterior views) of shoulder at initial presentation (a) and final followup of a patient with type vi fracture with associated brachial plexus injury . Patient had visible atrophy of deltoid muscle (c) and no functional movements at shoulder joint (d). The relative infrequency (prevalence 1%) and benign characteristics of a scapular fracture probably explains the limited attention in the literature . Glenoid fossa fractures represent 10% of scapular fractures with overall prevalence of 0.1%.571011 majority of glenoid fossa fractures are undisplaced and can be managed nonoperatively . This is in contrast to the present series, where majority of fractures were displaced . This may be due to the referral system prevalent in our region whereby we receive higher percentage of patients with high - velocity trauma . Furthermore, inpatient records searched during this study did not include the records of patients with low - velocity trauma who are kept under observation for up to 24 h before being discharged . The glenohumoral joint affords more degree of freedom of movement than any other joint and is therefore able to compensate for severe deformities and loss of movements . Although traditionally advocated treatment for scapular fractures has been nonoperative,2122 recent authors have reported on favorable outcome after operative treatment for displaced glenoid fractures.481112131415161718 kavanagh et al.12 reported on nine patients treated surgically for intra - articular fractures with displacement> 2 mm, and mayo et al.16 reported good to excellent outcomes in 22 of 27 patients . Schandelmaier et al.,13 in a series of 22 operated cases, reported a median constant score of 94% (mean 79%), while adam14 reported excellent or good result in 8 out of 10 operated cases . Anavian et al.,18 in the largest published series of operated glenoid fossa fractures with 33 patients, reported that 27 of 30 patients available at final followup were able to resume previous level of activity and only four had mild pain while rest of the patients were completely pain free . We did not encounter any immediate complication related to the operative procedure, which is similar to the observation made in previously published reports, thus indicating the safety of the approach and feasibility of surgery . Nevertheless, postoperative infection remains a major cause of poor result.1314 the most important predictor of poor outcome in the present series was nonoperative treatment in association with dislocation . Patients with persistent brachial plexus injuries also fared poorly, which has been universally accepted as an indicator of poor outcome in previously published series.1314 excluding these cases with dislocation (gross displacement) and brachial plexus palsy, only one patient of the remaining six in group b had poor result . Thus, a satisfactory result might still be achieved with nonoperative treatment of displaced fractures . Time taken to achieve maximal improvement in shoulder constant score was the least in group a followed by groups c and b. this earlier recovery of shoulder function was perhaps in part due to shorter period of immobilization and earlier institution of physiotherapy in group a. the most common mechanism of these injuries is a violent force applied laterally to the proximal part of the humerus, which is then driven into the glenoid cavity.101419 a transverse fracture of the glenoid fossa occurs and then propagates in one of several directions, depending on the direction of the traumatic force.101419 on account of the amount of force generally required to produce these fractures, the incidence of associated injuries is relatively high.171014 nearly half of these patients have a concomitant injury excluding the shoulder girdle.1021 in the present series, 57% (12/21) cases had associated injuries, with rib fracture and blunt trauma of the chest being the most common injuries . The treatment of these associated injuries invariably assumes priority over scapular fracture on account of their severity and often precludes surgical treatment of displaced fractures during the initial period . Goss was one of the first authors to recommend surgical treatment of glenoid fossa fractures.10 he emphasized on reduction of intra - articular step greater than 5 mm . While some authors have shown acceptable results in fractures displaced less than 5 mm, the advantage of achieving precise reduction in glenoid fossa fractures has not been proven objectively23 although it has been endorsed universally based on the treatment of intra - articular fractures elsewhere in the body.11121314151617 instability of glenohumoral joint or of fracture fragments themselves is a more compelling indication for surgery, which can occur with fracture of more than one - fourth of the glenoid cavity.10111314 in a review of significant published series on operative treatment of scapular fractures, lantry et al.24 found an intra - articular step of 5 mm as the most common indication used for glenoid fossa fractures, although most series, which included glenoid fossa fractures, universally accepted fracture dislocations as an indication of surgery . In view of lack of reports on the results of nonoperative treatment of glenoid fossa fractures, the amount of displacement necessitating operative treatment remains a matter of conjecture.25 nevertheless, it seems reasonable to individualize treatment based on the associated injuries, feasibility of surgery and the risks involved, presence of instability between the fractured fragments or at the joint itself, presence of gross displacement of fragment, or a fracture involving> 25% of glenoid cavity . To conclude, due to rarity of these injuries, most reported series have included a relatively small number of patients treated operatively and even less often treated nonoperatively . Thus, endorsement of favorable results of these series might be an over simplification as the outcome of these fractures might be often dependent on factors other than the anatomy of the fracture alone . We believe that operative treatment for displaced glenoid fractures is a viable option at centers equipped to handle critically ill patients . However, lack of such treatment does not preclude a satisfactory outcome in all displaced fractures . A subset of patients with fracture dislocation as opposed to fracture alone should perhaps always be treated operatively due to persistent loss of function with nonoperative treatment, although the sample size is too small for deriving a meaningful conclusion.
The congenital dermal sinus (cds) is a type of closed spinal dysraphism in which an epithelium - lined sinus tract from the dorsal skin surface extends inwards for a variable distance . It occurs during neurulation when the neural groove closes to form the neural tube on day 26 of gestation and results from a failure of neuroectoderm to separate from the cutaneous ectoderm . Thoracic and cervical regions where the neural folds fuse first are the rare sites for dorsal dermal sinus, whereas lumbosacral and occipital dermal sinuses are relatively frequent . Dermoid and epidermoid tumors and posterior arch defects of the vertebral column can be seen in association of dorsal dermal sinuses . The presence of dorsal dermal sinus in the upper thoracic region in association with spinal intramedullary dermoid cyst is rare . A 2-year - old male child presented with a 3 month history of progressive lower limb weakness and urinary retention . The patient's skin over the upper thoracic region showed a midline dimple with hair [figure 1]. Neurological examination revealed paraparesis (3/5), exaggerated knee and ankle reflex, and sensory level at t6 . Plain x - ray of the thoracic spine was interpreted as normal . Magnetic resonance imaging (mri) revealed a well - circumscribed intramedullary cystic mass extending from lower border of t4 to upper border of t7 and a sinus tract connecting it to the skin dimple [figure 2]. The tumor was hypointense on t1-weighted images and hyperintense on t2-weighted images with enhancement appreciated on gadolinium administration [figure 3b]. Clinical photograph of the patient's skin over the upper thoracic region showing a midline dimple (black circle) magnetic resonance imaging of spine demonstrating a wellcircumscribed intramedullary cystic mass extending from lower border of t4 to upper border of t7 and a sinus tract connecting it to the skin surface . The mass is hypointense on t1-weighted images (a) and hyperintense on t2-weighted images (b) magnetic resonance axial images of spine showing spina bifida of t6 vertebra (a) and contrast enhancement of the intramedullary mass (b) on operation, in prone position, vertical midline skin incision encircling the skin dimple was made, and the sinus tract was followed to the spinous process of t6 with the dissection of the dermal sinus stalk . T6 spinous process was found to be splayed at the midline through which, the sinus tract traversed the lamina of t6 and then pierced the duramater . A well - encapsulated, cystic, intramedullary tumor containing wax - like sebaceous materials and tuft of hair was encountered in communication with the sinus tract . The surgical microscope made it possible to find a plane between the tumor and the spinal cord, and total excision was performed . Microscopic examination revealed a typical dermoid cyst lined by well - differentiated keratinizing squamous epithelium [figure 4]. Photomicrograph of the excised mass revealing a typical dermoid cyst lined by well - differentiated keratinizing squamous epithelium (original magnification, 50) cds results from defective separation of the cutaneous ectoderm from the neuroectoderm during the process of neurulation . Though they can occur at any level along the spinal axis, generally they occur at one end of the neural tube . In order of frequency, it is localized most frequently in the lumbosacral area (41%), followed by the thoracic (10%) and cervical (1%) areas . The rarity of cds in the thoracic region seems to be related to neural tube closure . Fusion of the neural tube begins in the cervical region and then proceeds both cranially and caudally, closing at the cephalad extremity . The areas of later closure of the neural tube have a higher incidence of dermal sinus . Dermoids are rare, benign, slow - growing lesions constituting 1.1% of intraspinal tumors . The majority are in the extramedullary or subdural juxtamedullary in the lumbosacral region, usually in the conus or cauda equina . The complex of upper thoracic cds beginning from the skin, passing through the tissue layers, communicating with the intradural intramedullary dermoid cyst and spina bifida observed in this patient is rare . . This condition may be missed as a result of an asymptomatic clinical presentation . Physical examination and mr imaging are helpful in the diagnosis . The orifice of the sinus may be so small that it escapes detection except on close inspection . The sinus tract begins at the skin dimple and tracks cephalad through the soft tissues to traverse the dorsal dura, as demonstrated in this case . It becomes symptomatic as a result of either infection or associated mass lesions, which can be epidermoid, dermoid, or teratoma . A progressively enlarging inclusion tumor along the sinus tract in the spinal canal will eventually result in compression of adjacent neural structures . Many inclusion tumors associated with cds are asymptomatic because of a slow growth rate, resulting in late presentation . The majority of dermal sinuses clinically manifest within the 1 decade, usually before the age of 5, because of their tendency to become infected . Aseptic meningitis may be observed because of pressure or rupture of a coexisting dermoid cyst and/or epidermoid tumors . In some patients, debris or purulent material although it may be localized and superficial in form, it may also precede the onset of meningitis or intradural abscess . Therefore, the midline skin should be inspected carefully when a child suffers repeated episodes of unexplained meningitis . Morimoto et al ., reported cds in association with intramedullary abscess and dermoid at t12s1 level in a 1-month - old child who presented with a dimple over the lumbosacral junction discharging pus . Physical manifestations include typical skin lesions such as lipoma, hemangioma, hair follicles, dermal sinus mount, dimple, and meningocele . Mri provides rapid and accurate identification of the extent of these lesions, shows the extraspinal portion of the sinus tract and associated inclusion tumor, and defines the degree of the spinal cord compression . The mr characteristics of dermoid cyst are hypointense on t1-weighted imaging, hyperintense on t2-weighted imaging, and peripheral enhancement with gadolinium administration . Once the diagnosis is made, treatment of cds is achieved by complete excision of the sinus tract, including removal of all intraspinal portions with any associated dermoid cysts . Intradural inclusion tumors are completely removed if possible . The tumor may be adherent to the neural element, but it is easily freed from the neural elements . In cases of ruptured or infected tumors, complete excision is nearly impossible owing to dense arachnoid adhesions . In such cases, it is not necessary to attempt removal of the scarred capsular wall entirely . Careful bipolar coagulation is likely to prevent recurrence and reduce the risk of neurological impairment . Therefore, prophylactic surgery is performed as early as possible, when the intervention will be easier and give a better outcome . Such dermal sinuses should be evaluated without delay, in view of the risk of infection and associated morbidity with an expanding inclusion tumor . Early diagnosis and prompt surgical intervention offer the best chance of functional neurological recovery and prevent serious morbidity.
Subjects with chronic hepatitis b virus (hbv) infection are at increased risk of hepatocellular carcinoma, cirrhosis, and chronic hepatitis [24]. Hong kong, as part of china, is a high - prevalence area for hbv infection according to the who definition, and antenatal screening for maternal infection, in the form of screening for hepatitis b surface antigen (hbsag), is a standard procedure . Hong kong is one of the first cities that introduced immunoprophylaxis to the neonates in 1983, with combined immunoglobulin and vaccine given to offspring of mothers with positive screening, and this was followed by universal vaccination to all newborn infants from 1988 [5, 6]. Compliance is ensured by means of a vaccination record issued to all children, which has to be checked by teachers at primary and secondary schools (under the enforced free education system) to ensure that incompletion of any vaccination could be remedied . Furthermore, all nonimmune adult residents of hong kong have opportunities in obtaining vaccination from various institutions such as universities and nongovernment organizations . Good compliance with the vaccination, especially in a nationwide government - initiated public health programme as implemented in taiwan, has resulted in a decline in the hbv carrier rate in children from 10% to <1% and reduction in mortality from fulminant hepatitis and hepatoma in children [7, 8]. Yet in the past four decades, studies on maternal hbv infection in hong kong yielded the prevalence of 6.6% in 1976, 7.4% in 1983, and 10.0% in 1996, and which has remained unabated at around 10% in the most recent studies [11, 12]. Therefore, the persistence of a high and apparently rising prevalence of hbv infection was unexpected . We suspect that one of the explanations of this persistently high prevalence is deficient knowledge on infection with the hbv, especially regarding its prevention in horizontal transmission, in the fertile female population . There are few reported studies on the knowledge of hbv infection among pregnant women, which can be taken as proxy for the fertile females among the general population . To address this issue, we have conducted a survey to examine the knowledge of hbv infection in a nonselected cohort of chinese pregnant women attending our antenatal clinic in 2008 . We found insufficient knowledge on hbv infection in various aspects which were similar to the findings in all other studies in the chinese immigrant populations in some low endemic areas [1420]. It is noteworthy that between 27% and 75% of the studied subjects realized that hbv infection can be a lifelong condition, and 75% and 60% of them knew that hbv infection is associated with cirrhosis and liver cancer, respectively . Vertical transmission of hbv from an infected mother to her infant is a major source of infection in many endemic areas [5, 10, 2327]. In order to control the vertical transmission of hbv, neonatal immunisation programmes involving the use of immunoglobulin and hepatitis b vaccine have been adopted in many countries [28, 29]. In hong kong, this programme was introduced in 1983, following a prospective randomized study that had proved its efficacy [10, 30]. From 1983 to 1988, this programme was selective in that only neonates born to mothers with chronic hbv infection, as reflected in their positive hbsag status, received immunoglobulin and a triple dose vaccination at the time of birth . From november 1988, this programme became universal and covered all neonates born to both hbsag positive and negative mothers as a government - initiated standard public health preventive measure, and a free vaccinations package, including that for hbv, was provided to all newborn infants in the government maternal and child health centres under the department of health [6, 31]. Nowadays, the universal immunization programme is available to the infants of all local residents . The effectiveness of universal immunization has been proven by the demonstration of reduced prevalence of childhood hbv infection and hepatocellular carcinoma in a number of endemic areas [2, 8, 10, 32, 33]. Nevertheless, despite the fact that the hbv vaccine and the immunization prgramme have been introduced since the 1980s, the knowledge on perinatal transmission of hbv was quite variable among different chinese populations, ranging from 40% to 91% . Knowledge was most deficient amongst the chinese immigrants in new york city, where only 40% of the surveyed subjects could give a correct response . The results of these studies suggested that further efforts should be made in educating all chinese women in the reproductive age group irrespective of their place of residence about vertical transmission of hbv infection and its prevention by the neonatal immunization programme . In addition to perinatal transmission, hbv can spread through sexual intercourse and contact with infected blood products through transfusion, sharing of needles and unsafe injecting equipments . Transmission through sexual contact is documented as a major route of spread of hbv in countries with low and intermediate endemicity [24, 34], while blood transfusion and unsafe injection are main sources of hbv transmission in many developing areas [3537]. It has been shown that many chinese people were not aware of the role of horizontal transmission of hbv, especially regarding the transmission of hbv through sexual contact . Only 4065% of surveyed subjects knew that hbv could be sexually transmitted [1322]. This deficiency in knowledge is most likely related to the oversight of not including hbv infection as one form of sexually transmitted diseases in public health promotion and educational materials, a situation that should be rectified in all places irrespective of the local prevalence of hbv infection . However, another important aspect of deficient knowledge in asian and chinese communities worldwide is the risk of horizontal transmission through means others than sexual intercourse, because of the unique culture associated with the chinese and their family settings, especially the sharing of food and eating utensils . Earlier studies have shown the presence of hbsag in several body fluids such as saliva, semen, and urine [3841]. Since then, hbv transmission from saliva had also been described in some studies [4245]. Furthermore, a local case of hbv transmission by human bite had been reported by a research group in recent year and suggested that human bite is another route of hbv transmission . Indeed, hbv infection from saliva contact through bites or other wounds on the skin and open mouth ulcer, and as through prechewing of food from infected persons, has been reported repeatedly [4651]. As premastication of food by the mother or grandparents before the food is fed to the infant and the shared use of chopsticks, communal eating, and sharing of utensils are still common practices in chinese families, transmission by infected saliva could be a serious yet overlooked means of transmission, especially when the exposure by the susceptible subject would be continuous and prolonged . Indeed, even in some recent studies [17, 18, 20], 1143% of the chinese subjects surveyed thought that hbv could not be transmitted by the sharing of eating utensils . Furthermore, hbv can survive for weeks outside the body, and it can be found on contaminated inanimate objects, such as toothbrushes and razor [5255]. In previous studies, 41% to 86% of the subjects knew that sharing razor or toothbrush, tattooing or body piercing (37%), eating food that has been prechewed by an infected person (6982%), sharing of needles (5283%), or exposure to blood or blood products (6590%) could allow hbv to spread from an infected person to susceptible individuals . In our study, 50.2% of the subjects thought that hbv could be transmitted through exposure to body fluids such as saliva and urine . While horizontal transmission through the contact with infected urine was an unlikely or remote cause of infection among the fertile women in our society, contact with saliva, such as from kissing and further studies are warranted to clarify the role of horizontal transmission by infected saliva, but in the meantime, it would be prudent to remind the community not to share eating utensils and to avoid all the aforementioned practices in the family setting for hygiene considerations . On the other hand, in line with other researchers, we have also found erroneous knowledge amongst our subjects . In our study, only 24% of the subjects recognized that hbv is not transmitted by the oral - fecal route, which was consistent with the findings of other studies in the same area [21, 22]. This suggested that there was confusion between hepatitis a and hepatitis b amongst the general public . Only a few studies had examined the knowledge on prevention of hbv transmission, and the majority of the respondents knew that hbv transmission could be prevented by hepatitis b screening and vaccination (6295%). In hong kong, vaccination programmes are provided to all nonimmune adults who requested vaccination by institutions such as universities, and nongovernment organizations such as the family planning association, and by general practitioners [5, 56]. With increased public awareness of hbv infection over the past two decades, the rate of hbv vaccination uptake at their own expense amongst the pregnant women in hong kong increased from 13% in 1996 to 33% in 2008 . Nevertheless, there is much room for improvement and catch - up vaccination or booster doses should be offered to all individuals without confirmed immunity to hbv whenever such individuals are identified . Among the public, less is known about the risk and importance of horizontal transmission; although health education pamphlets, posters, and television advertisements have explained about the risk of hbv in needle - sharing, acupuncture and tattooing, it is not certain to what extent do the general and obstetric population realizes the importance of such information . In hong kong, safe injection practice is performed in the clinical settings without the reuse of syringes and needles in both public and private hospitals, and our pregnant women are at minimal risk of hbv infection via routine antenatal blood taking or drug injection . However, acupuncture and beauty treatments were risk factors in the spread of hbv infection [57, 58], but the safe use of needles in acupuncture and beauty treatments cannot be guaranteed, even though disposable needles are available . In mainland china, the difference in rate of hbv infection between our local women and the immigrants from mainland china could be partly explained on the differences in these practices, but this issue needs to be explored in further studies . At the same time, there remains a substantial portion of our subjects with erroneous knowledge on the prevention of hbv transmission, as only 14% of pregnant respondents knew that neither a balanced diet and vitamin c consumption, nor regular exercise, nor getting enough rest can prevent hbv infection . However, in another recent study amongst the general public, up to 98% of the respondents knew that balanced diet and vitamin c could not prevent hbv infection . Such discrepancy of knowledge found in the same area could be explained by the fact that subjects from the study of chung et al . Were generally better educated, while the pregnant women attending our antenatal clinic were deficient in the knowledge about prevention of hbv infection . In some low endemicity countries such as the united states and canada, immigration from highly endemic areas such as southeast asia has been the major contributor to the horizontal transmission from the carriers to other susceptible individuals, leading to an increasing prevalence of chronic hbv infection . In hong kong, a high influx rate of immigrants and visitors from mainland china in the past decade is thought to be an important contributing factor to the persistence of a high prevalence rate of chronic infection in pregnant women . We had demonstrated an association between status of residency and the hbv carriage rate (5.7% for locally born residents versus 14.2% for immigrants and nonresidents), with the uptake of hepatitis b vaccine (36.0% for local residents versus 22.3% for nonlocal residents), and poor knowledge on hbv transmission and prevention (aor ranged 1.632.01 for new immigrants and 1.651.81 for nonresidents as compared with locally born residents) [12, 13, 56]. In hong kong, the viral hepatitis preventive service has been launched by the department of health in hong kong in july 1998, conducting epidemiological surveillance and distributing information through various channels to the general public . There are also other local sources or channels available for the dissemination of information regarding hbv infection in hong kong, such as healthcare professionals, mass media, the department of health website, and educational pamphlets . In our community, the mass media are the most preferred channels for disseminating educational materials and information to general public at the community level, because of their popularity [60, 61]. Mass media, such as televisions and radios, are available to almost every household in hong kong, and free news channels are available in public transports such as buses and the mass transit system . Furthermore, many newspapers are distributed free of charge and internet services are also easily accessible in the community . We have therefore examined the sources of information on hbv infection and the roles of various channels in the dissemination of information with respect to the level of knowledge, which was not addressed in previous studies . Our aim was to determine whether accessibility and utilization of the various sources of information could have contributed to deficient or incorrect knowledge among our respondents . We found that mass media is the most important source of hepatitis b knowledge among our pregnant women, with the two leading sources of knowledge being television programmes (63.0%) and newspapers (38.8%) (figure 1). Similar to television programmes, radio programmes are also one of the most rapid means of disseminating information in real time to the public and of increasing their awareness and knowledge of hbv infection, but only a minority (17.9%) indicated that radio programmes were useful in learning about hbv infection . Medical and health care services were among the lowest with the poorest source being government medical clinics (9.9%). What was most disappointing was that around 80% of the respondents did not receive any information about hbv infection from the medical and healthcare services or medical professionals, which should have been the optimal channel to disseminate correct medical information . In hong kong, primary medical care is provided at a nominal charge to all local residents, and many charitable organizations provide free medical care to those who cannot afford the outpatient charges . Furthermore, government maternal and child health centers and the family planning association also provide service to all without restriction . The mechanisms of this failure remain to be established, but it was possible that when these women sought help from such services, they were focused only on their complaints or problems at the time . As well, the need for specific health education on the common endemic infections in our territory, such as hbv infection, might not have crossed the minds of the health care professionals at the time due to the assumption that such as information should have been readily available . As we have noted that incorrect or misleading messages have been provided to our subjects, the effects of the various channels of dissemination of the information on hbv infection were assessed by multivariate logistic analysis and the adjusted odds ratios of the source of information for incorrect response on individual item were presented in figure 2 . After adjusting for the significant sociodemographic, medical, and obstetric factors found in univariate analysis, television programmes (aor 0.38 in 1 item), books (aor range 0.350.64 in 5 items), newspapers (aor range 0.44 and 0.58 in 2 items), internet (both aors 0.63 for 2 items), and government antenatal clinics (aor 0.65 for 1 item) were associated with reduced provision of incorrect knowledge about hbv infection for most items . At the same time, however, radio programmes (aor 2.24) were also revealed to be the significant source of provision of incorrect information regarding the transmission of hbv through blood or other blood products . We suspect that some of information acquired from this channel might be erroneous or lacking a scientific or medical basis, and this issue should be examined specifically in future studies . Numerous studies on hbv infection, its sequelae, and the various means of prevention have been published in the past three decades . Yet even the latest studies have found areas of deficient or even erroneous knowledge on hbv infection, and we are especially disappointed to learn from the findings in our pregnant women that there is much room for improvement in the provision of appropriate and correct information on hbv transmission and prevention to the public . We suspect that deficient knowledge and misconceptions, especially regarding the various means of horizontal transmission, have probably contributed to the persistently high prevalence of hbv infection in our obstetric population . Social stigma can result from poor knowledge on hbv infection, as is the case in mainland china . In china, hbv carriers face social discrimination affecting both their life and work as many employers and universities refuse to accept those who were tested positive from the preemployment and preenrolment medical checkup, although according to ministry of health of the people's republic of china, the china government has decided to legislate against the hepatitis b discrimination recently . On the other hand, appropriate public education could reduce the stigma attached to hbv carriers, as shown in the united states that higher levels of knowledge regarding hbv were associated with lower degrees of stigma . Where resources are limited, targeting women in the reproduction age group for health education would be most cost - effective due to their roles as mothers and care providers to the entire household, so that their possession of correct knowledge on hbv transmission and infection would have the greatest overall impact on the population . More studies on the control of hbv infection through enhanced public health education programmes as an adjunct to any ongoing immunization programme in endemic areas are warranted.
High dose rate brachytherapy treatment is accepted as a highly effective and safe mode of treatment of various cancers . The irradiation of the healthy organs is unavoidable during brachytherapy treatments although the maximum dose is delivered to tumor volume . The doses to the healthy organs being considerably high, quantification of the dose is important to assess the risk to the patients for radiation induced cancer . The treatment planning software often predicts the doses only to a few organs near the target (organs at risk) and not to the radio - sensitive organs that are far away from the treatment volume . Monte carlo simulations in the mathematical anthropomorphic phantoms can predict the dose to organs that are beyond the treatment site taking care of in - homogeneity and complex geometry of the human anatomy . Many studies on estimation of organ doses during different brachytherapy treatments using monte carlo simulations with heterogeneous mathematical phantom are already reported in the literature. [47] the organ dose data specific to an indian patient population is required whose average physique is significantly smaller than that of the icrp reference adult . Hence, the mird phantom specifications are further scaled down to average indian standards using appropriate factors . The organ doses to an average indian adult female patient treated for uterus cancer with microselectron ir source and bebig co sources was evaluated by simulating a modified indian reference adult phantom and reported earlier . The computed dose values were validated by comparing with the rando phantom - based measured data available in the literature . The mird - type phantom models are approximations to the human anatomy and these models are sufficiently accurate and valid for estimating the average dose to the organs for the radiation protection purposes . Presently, the same phantom model is extended to evaluate the organ doses specific to the indian patient population undergoing the brachytherapy of the esophagus, breast, and neck cancers with ir and co sources and the results are presented . Brachytherapy treatments of the above locations expose large number radiosensitive organs considerably as most of them are located at the upper part of the trunk . Also, the mean organ dose values of the present simulations during breast treatment using ir sources is compared with the mean organ doses evaluated using a voxel phantom reported by mille and xu . The three - dimensional heterogeneous anthropomorphic phantom representing a standard indian reference adult phantom and the brachytherapy sources are simulated using monte carlo code mcnp version 3.1 in the photon mode . The phantom model is based on the mird specifications scaled down to the average indian reference man of 164 cm height and 53 kg . The brachytherapy sources (microselectron ir source and bebig co) were modeled for each brachytherapy treatment conditions of esophagus, neck, and breast cancers . Exact geometry of the high dose rate microselctron ir source and bebig co sources is modeled in all the cases . The three cases of esophagus treatments, i.e. Upper esophagus, middle esophagus, and lower esophagus, are considered . For this, the whole volume of the esophagus is divided into three equal regions along the length as the upper, middle, and lower esophagus . The location of the brachytherapy source is assumed at the geometrical center of each region of the esophagus of the phantom . For the treatment of breast, the sources are modeled at the center of the breast volume . The source is modeled at the middle of the larynx region for the neck treatment . Although the source may take different dwell positions during the treatment, the assumption of source at the center is expected to provide the mean dose value for all the dwell positions . And that of co is 1.17 and 1.33 mev with a yield of about 100% for each photon per disintegration . In the monte carlo calculations, the mean photon energy fluence spectrum is scored in the selected organs using track length estimate and subsequently converted into tissue - kerma using mass energy absorption coefficient of tissue by using de and df tally cards of mcnp . Tissue - kerma is approximated to absorbed dose assuming charged particle equilibrium exists . The existence of charged particle equilibrium can be assumed as the estimations are the average dose to the organs . The maximum range of the secondary electrons produced are of 45 mm in tissue, and can be considered as absorbed completely within the organ volumes that are in the order of few centimeters . The suitability of using this code is verified by comparing mcnp3.1 calculations with edknrc code of the year 2000 . The beta emission by the sources is ignored in the simulations as they are expected to be stopped by the encapsulation and do not contribute to the doses to the nearby healthy organs . The mean organ dose factors in mgy / min / gbq with ir sources in upper, middle, and lower esophagus, and with co (bebig) source are presented in tables 1 and 2, respectively . The organ doses for the left and right breast treatments are tabulated in table 3 and the results for the neck treatment are in table 4 . The dose to adrenal, lung, ovary, kidney, and testicle is the average of the left and right organ . The relative standard deviation of the doses is less than 4% for all the organs for all esophagus, breast, and neck treatments except for the organ, testicle . The relative standard deviation of the dose to the testicles is about 6% for the left and right breast treatment using ir . The same during upper, middle, and lower esophagus treatment case using ir are about 8%, 6%, and 3%, respectively, and it is about 11% when the ir source is in the neck . The relative standard deviation of the dose to all the organs treated with co sources is lesser than that of treated with ir . The computed organ dose factors in mgy / min / gbq when the ir microselectron source is in the esophagus the computed organ dose factors in mgy / min / gbq when the co source (bebig) is in the esophagus the computed organ dose factors in mgy / min / gbq when the ir and co source are in the breast the computed organ dose factors in mgy / min / gbq when the ir and co source are in the neck the computed mean organ dose values of this study for brachytherapy of left breast with the ir source is compared with the mean organ dose values published by mille and xu . The present study uses a mird - type heterogeneous phantom 164 cm height and 53 kg weight, whereas the study by mille and xu is 163 cm height and 60 kg weight voxel - based phantom simulated using the ct information . As the overall external dimensions of the phantom models being nearly the same, the comparison of results can provide an insight to the influence on the organ dose values computed using mird based phantom model and the sophisticated voxel based phantom model . The organ dose values are expected to vary for both the studies because the models have different parameters such as dimension of the organs, the interspatial distance, and the degree of heterogeneity between the source and target organs . The dose values of the published study are presented in gy for a dose of 34 gy in water at 3.2 cm from the center of the source . Hence, for the purpose of comparison, the organ dose values obtained by this study are also converted to the similar units . For this, the dose in water at 3.2 cm is obtained by simulating a ir point source at the center of a cylindrical water phantom of 30 cm diameter and 15 cm height . The energy fluence spectrum was scored in a ring at 3.2 cm from the source and converted into the dose using appropriate conversion factors . Table 5 presents the comparison of the normalized organ doses for six organs; the organ masses and the distance between the source and the organ used in the present study and published study . The interspatial distance is the distance between the center of the organ and the center of the source for the present study and the mean distance from the organ to balloon center for the published study . It is observed that for the organs, namely brain, uterus, left and right ovaries, the dose values of the present study are less compared to those of the published study and these are located at larger distance in the present model when compared to the voxel model . Similarly for spleen and heart, the dose values of this study are higher than the published values and these organs are at smaller distance in comparison with the voxel model . Comparison of mass of organ and the distance between the source and organ, and the mean organ dose of the present study and the published study of mille and xu the mean organ dose factors in mgy / min / gbq with ir sources in upper, middle, and lower esophagus, and with co (bebig) source are presented in tables 1 and 2, respectively . The organ doses for the left and right breast treatments are tabulated in table 3 and the results for the neck treatment are in table 4 . The dose to adrenal, lung, ovary, kidney, and testicle is the average of the left and right organ . The relative standard deviation of the doses is less than 4% for all the organs for all esophagus, breast, and neck treatments except for the organ, testicle . The relative standard deviation of the dose to the testicles is about 6% for the left and right breast treatment using ir . The same during upper, middle, and lower esophagus treatment case using ir are about 8%, 6%, and 3%, respectively, and it is about 11% when the ir source is in the neck . The relative standard deviation of the dose to all the organs treated with co sources is lesser than that of treated with ir . The computed organ dose factors in mgy / min / gbq when the ir microselectron source is in the esophagus the computed organ dose factors in mgy / min / gbq when the co source (bebig) is in the esophagus the computed organ dose factors in mgy / min / gbq when the ir and co source are in the breast the computed organ dose factors in mgy / min / gbq when the ir and co source are in the neck the computed mean organ dose values of this study for brachytherapy of left breast with the ir source is compared with the mean organ dose values published by mille and xu . The present study uses a mird - type heterogeneous phantom 164 cm height and 53 kg weight, whereas the study by mille and xu is 163 cm height and 60 kg weight voxel - based phantom simulated using the ct information . As the overall external dimensions of the phantom models being nearly the same, the comparison of results can provide an insight to the influence on the organ dose values computed using mird based phantom model and the sophisticated voxel based phantom model . The organ dose values are expected to vary for both the studies because the models have different parameters such as dimension of the organs, the interspatial distance, and the degree of heterogeneity between the source and target organs . The dose values of the published study are presented in gy for a dose of 34 gy in water at 3.2 cm from the center of the source . Hence, for the purpose of comparison, the organ dose values obtained by this study are also converted to the similar units . For this, the dose in water at 3.2 cm is obtained by simulating a ir point source at the center of a cylindrical water phantom of 30 cm diameter and 15 cm height . The energy fluence spectrum was scored in a ring at 3.2 cm from the source and converted into the dose using appropriate conversion factors . Table 5 presents the comparison of the normalized organ doses for six organs; the organ masses and the distance between the source and the organ used in the present study and published study . The interspatial distance is the distance between the center of the organ and the center of the source for the present study and the mean distance from the organ to balloon center for the published study . It is observed that for the organs, namely brain, uterus, left and right ovaries, the dose values of the present study are less compared to those of the published study and these are located at larger distance in the present model when compared to the voxel model . Similarly for spleen and heart, the dose values of this study are higher than the published values and these organs are at smaller distance in comparison with the voxel model . Comparison of mass of organ and the distance between the source and organ, and the mean organ dose of the present study and the published study of mille and xu the normalized organ dose factors are generated during the brachytherapy treatment of esophagus, breast, and neck cancers using ir and co sources to an indian reference patient . The data is useful to assess the representative dose specific to the indian population for radiation protection purposes . The organ dose values of the breast treatment case are compared with a similar monte carlo simulation study and found agreeing.
T1d is characterized by progressive autoimmune / autoinflammatory destruction of pancreatic -cells over a period of years, resulting in absolute insulin deficiency and the need for lifelong dependence on exogenous insulin administration . In addition, t1d increases the high risk of one or more acute and late disease - associated complications, for example, neuropathy, hypoglycemia, cardiovascular disease, and retinopathy [1, 2]. Initial diagnosis has been coupled to a substantial decrease (~90% loss) in -cell mass, subsequently leading to a complete loss of insulin production . Hence, interventions that prevent or halt the predestined decline of -cell function are needed . Several clinical trials are aiming at immune intervention or modulation with the key goal to induce immune tolerance against -cells and thereby prevent autoimmune destruction . These trials have shown varied clinical efficacy but have to some extent provided insight into the role of the immune cell triggered -cell death [5, 6]. Targeting the adaptive immune system to preserve -cell function in new - onset t1d has shown temporary suppression of disease [79]. However, recently suppression of the innate arm of the immune system has been suggested to have even more beneficial effects . In particular, much attention has focused on il-1, which is one of the primary innate proinflammatory cytokines shown to cause tissue damage and organ failure, hence being a key mediator in autoinflammatory conditions [11, 12]. Il-1 has been assigned a key role in t1d and has long been known to cause -cell dysfunction and death . Il-1 is produced and released by several cell types in response to tissue insult, or in the context of diabetes, by -cells under hyperglycemic conditions . Once present in the pancreatic microenvironment it can act locally to inhibit insulin synthesis and secretion and induce -cell apoptosis through activation of proapoptotic jnk, mapk, and nfb signaling pathways . Additionally, il-1 can drive t1d pathogenesis by enhancing the recruitment of immune cells and modify the adaptive immune response towards a more proinflammatory cell repertoire [12, 15]. Thus, there is a strong preclinical rationale for il-1 antagonism to prevent or reverse t1d and t2d onset and il-1 has become a promising target for therapeutic intervention [13, 16]. Ser140 is a 10-amino - acid peptide il-1 receptor antagonist that has previously been shown to inhibit interleukin-1-induced nfb signaling and macrophage secretion of tnf- and hence a potent inhibitor of inflammatory responses . Further, ser140 exceeded the maximal effect of anakinra (a recombinant, nonglycosylated version of human il-1r antagonist) in averting il-1-induced apoptosis in rat pancreatic islets and is currently being evaluated for treatment of t2d . The many shared features between both major diabetes types justify similar efforts of interfering with il-1 signaling in t1d . In this report the nod mouse model seems to reflect several crucial aspects of the human disease including pancreatic inflammation . Further, il-1r deficiency has been shown to reduce progression to diabetes in nod mice making this the ideal model to examine the potential beneficial effects of ser140 in t1d . A total of 40 female nod mice (8 - 9 weeks of age, taconic (usa)) were transferred to the gubra animal unit . The animals were group - housed (5 mice / cage) throughout the habituation and study period in a light - temperature- and humidity - controlled room with free access to food and water . All animal experiments were conducted in accordance with gubra bioethical guidelines, which are fully compliant with internationally accepted principles for the care and use of laboratory animals . The described experiments are covered by personal licenses for jacob jelsing (2013 - 15 - 2934 - 00784) issued by the danish committee for animal research . Nonfasting blood glucose (bg) was monitored biweekly before the experiment start . On day 3, animals were randomized according to bg and then body weight into two groups: a vehicle group (qd) (n = 20) and a ser140 group, 10 mg / kg (qd) (n = 20). Ser140 was provided by phlogo aps, copenhagen, denmark (5 mg / ml in water), and diluted in pbs at the required concentration for injection (10 mg / kg, s.c). Throughout the study, animals had ad libitum access to food and water . Body weight and food and water intake were recorded biweekly from arrival and throughout the study period . Animals were terminated on day 56 and bg was measured using a biosen c - line glucose meter (ekf diagnostics, germany), hba1c using autoanalyzer cobas c-111 with commercial kit (roche diagnostics, germany), and insulin using ultrasensitive insulin elisa (mercodia, sweden) according to the manufacturer's instructions . The pancreas was removed, immersion - fixed in 4% formaldehyde at 4c for 24 hrs, and processed as described previously . Briefly, the pancreas was rolled into a cylinder, infiltrated with paraffin overnight using an automated miles scientific tissue - tek vip tissue processor (sakura), and cut into three to four systematic uniform random tissue slabs with a razor blade fractionator . The blocks were trimmed and three series of 4 m sections were sampled providing twelve to fifteen levels in total for quantitative analyses . One series of sections were subsequently subjected to standard hematoxylin staining for stereological assessment of immune cell infiltrates in combination with a double immunohistochemical staining procedure for stereological assessment of - and non--cells (figure 1). Other series were used for immunohistochemistry on specific immune cell populations and for expression of proinflammatory cytokines by in situ hybridization (ish) (rnascope, advance cell diagnostics, china). All stainings were performed on an autostainer link 48 (dako) and finally digitized under a 20x objective in an aperio scanscope at slide scanner for qualitative image analysis . After deparaffinization in a series of ethanol and xylene and antigen retrieval in citrate buffer (10 mm, ph 6) sections were quenched with 1% h2o2 in kpbs and blocked with sa - biotin kit (x0590, dako) and 5% swine serum in tbs - t + 1% bsa, followed by incubation with the primary non- antibody - cocktail . Sections were then incubated with the secondary biotinylated antibody (fab2) fragment followed by sa - peroxidase (hrp) and visualized with diaminobenzidine and niso4 . For -cells, sections were blocked in 10% rabbit serum (x0902, dako), stained with anti - insulin and hrp - secondary antibody . Finally, the sections were developed in novared (sk4800, vector laboratories), stained in a mayer solution, dehydrated, and mounted in pertex . Deparaffinization was performed as previously followed by antigen retrieval in tris - egta buffer (ph 9) or by proteinase k treatment (f4/80). Endogenous peroxidase activity was quenched in 1% h2o2 and blocked 5% swine serum, 1% bsa, and 0.2% tween 20 . Sections were then incubated with primary antibodies (cd3, cd20, and f4/80) followed by corresponding secondary antibodies . Signal was amplified using vectastain abc amplification system (vector laboratories) (cd20) and envision+ hrp - coupled polymer system (dako) and visualized in a dab solution . The stereological estimation of cell mass was performed by an observer blinded to the experimental groups . The cell mass was estimated by point counting with all points hitting the structure of interest being counted . Sections were scanned in a random systematic way using the newcast system (visiopharm, hrsholm, denmark) to control the stage and collection of data . A single - point grid per frame was used to estimate pancreas mass and a denser grid was used to estimate -cell / non--cell and immune cell mass . Similarly, the grid system was used to correct the presence of nonpancreatic elements in the dissected sample . In principle, the point grid is used to estimate the area fraction of counted cell types . The number of points hitting the structure of interest is then converted into mass by taking the grid ratio into consideration . Ish was performed using the rnascope 2.0 high definition - red assay (advanced cell diagnostics) with il-6 (nm_031168.1), tnf- (nm_013693), and ifn- (nm_008337.3) specific probes according to the manufacturer's instructions . Statistical analyses were performed using a two - way anova with repeated measures and bonferroni post hoc analysis or unpaired student's t - test . Ser140 was able to postpone the development of diabetes in nod mice (figure 2). The first incidence of diabetes (bg> 10 mmol / l) was observed in both treatment groups at experimental week one . However, in week two, a total of three incidences were observed in the vehicle group with no diabetic cases in the ser140 treated group (figure 2(a)). Afterwards, the proportion of normoglycemic ser140 treated mice compared to vehicle became even more evident over time leading to a significantly lower proportion of diabetic mice in the ser140 group at termination (figures 2(a) and 2(b)). The ser140 group displayed significant reduction of mean bg as well as a significant increase in mean plasma insulin at the end of the study (figures 2(c) and 2(d)) with a nonsignificant tendency towards decrease in hba1c (6.05 0.42 versus 5.09 0.41, p = 0.11). No significant difference was observed in overall body weight (figure 3(a)) whereas both food and water intake (measured as average per cage) decreased in the ser140 treated group (figures 3(b) and 3(c)), most likely related to the increased number of diabetic animals in the untreated group . One normoglycemic ser140 treated animal was excluded from the study at experimental day 28 due to general misbehavior unrelated to treatment and was excluded from all measurements . In addition, one vehicle mouse and one ser140 treated mouse died before study end, probably as a consequence of early onset of diabetes, and were not included in the histological analyses due to rapid tissue decay . The effect of ser140 on endocrine and immune cell mass was performed on systematic uniform random samples of the whole pancreas (figures 1(a)1(c)). Total pancreas mass (corrected for fat and lymphoid tissue) was slightly higher in ser140 treated mice compared to vehicle (272 12.5 versus 313 8.83, p = 0.012). The quantitative analyses of immunohistochemically stained islet cell types (figure 1(c)) displayed a tendency towards increased -cell mass with treatment although not significant (figure 4(a)). No treatment related change was observed in non--cell mass (figure 4(b)), whereas the mass of unstained endocrine cells (endocrine cells that have lost the expression of hormones) tended to be reduced following ser140 treatment (figure 4(c), p = 0.065). Immune cell infiltrates, as identified by dense hematoxylin staining, were observed around islets in both groups (figure 1(c)) but being significantly higher in ser140 treated mice (figure 4(d)). The qualitative analysis of specific immune cell subsets revealed that immune cell infiltrates mainly consisted of -cells (cd20), t - cells (cd3), and only few macrophages (f4/80) but with no noticeable changes in immune cell subtypes with treatment (figures 5(a)5(c)). Moreover, consistent with insulitis, proinflammatory cytokines were observed around and within the islets (figures 5(d)5(f)) in both groups . A subgroup analysis of normoglycemic (bg <10 mmol / l) and diabetic (bg> 10 mmol / l) animals revealed a higher -cells mass in normoglycemic mice versus diabetic mice irrespectively of treatment (figure 6(a), table 2). However, further analyses of bg levels as a function of -cells mass revealed that even a minute mass of enduring -cells is able to compensate and maintain normal bg levels (figure 6(b)). Non--cell mass was also significantly lower in the diabetic animals as compared to normoglycemic mice irrespectively of treatment demonstrating a progressive loss of non--cells in the nod model with diabetes onset (figure 6(c)). Subgroup analyses of the nonimmunoreactive endocrine cell masses revealed a significant effect of diabetes status and a significant treatment / diabetes interaction (figure 6(d)). Collectively, the total endocrine cell pool was significantly reduced in diabetic mice (figure 6(e)). Finally, immune cell mass was lower in diabetic mice compared to normoglycemic animals with no significant interaction or treatment effect (figure 6(f)). The nod mouse presents early signs of insulitis, spontaneously develops autoimmune diabetes, and is generally regarded as a suitable animal model of human t1d . Here we report that the novel il-1r antagonist ser140 is able to postpone the onset of diabetes in female nod mice coupled to an overall decrease in bg levels and increased insulin levels upon treatment . Recombinant forms of the naturally occurring il-1 receptor antagonist have already proved to be efficacious in a broad spectrum of inflammatory diseases, including t2d . However, two comprehensive clinical trials of il-1 blockade in t1d have shown divergent results . Anakinra alone appeared to be ineffective in reversal of t1d in hyperglycemic nod mice, whereas another study showed beneficial effects in a carefully selected group of long - standing t1d patients with a type 2 phenotype, suggesting that the compound is more effective in conditions of chronic hyperglycemia . Further, preclinical studies targeting il-1r signaling in gk - rats, as well as in mice fed a high - fat / high - sucrose diet (hfd) [26, 27], resulted in significantly improved glucose control and -cell function . However, despite an ample amount of preclinical and clinical studies a defined mechanism of action for il-1 antagonism in diabetes is still lacking . Il-1 orchestrates several immunological and cellular pathways, hence proposing several mechanistic explanations for prodiabetic effect, due to either a modulatory role in the local immune system or a direct role in pancreatic -cell function and/or survival . In addition, questions remain regarding whether a beneficial effect of il-1 antagonism on bg is a consequence of protection of -cell mass per se or due to an overall improvement of glucose control (-cell function and insulin sensitivity). Indeed, the potential of il-1 antagonism to improve -cell function has been reported in t2d patients, but this could also be explained by the t2d associated deficit in -cell mass . Cytotoxicity sufficient to induce -cell apoptosis will presumably influence the function of surviving -cells making a distinction of the relative contributions of these related processes nearly impossible . In the present study, treatment related changes in serum insulin levels were partly reflected in the preserved -cell mass per se . The assumption that ser140 treatment maintains functional -cell mass is further supported by the decrease in nonimmunoreactive endocrine cell mass . The exact phenotype of the unstained endocrine cells is currently unknown, but it is speculated that they represent -cells that have lost the capacity to produce insulin since an inverse correlation between -cells and unstained endocrine cells was observed (data not shown). Moreover, we found a proportion of normoglycemic mice having very low -cell mass unrelated to treatment, indicating that ser140 does not evidently strengthen residual -cell function . It appears that even small numbers of residual -cells can compensate and maintain normal bg levels as supported by others demonstrating an effective insulin response despite massive loss of -cells . Hence, -cell mass may be an inadequate determinant of overall -cell function in this model . In addition, it is well known that some aging female nod mice never progress to develop diabetes . The compensatory capacity of a minor residual -cell mass combined with the heterogeneity of disease penetrance in the nod mice could be the explanation for the lack of statistical significance in the effect on -cell mass upon ser140 treatment . This finding partly contradicts an anti - inflammatory effect of ser140 in the pancreas but is in line with other studies showing that il-1 antagonism does not alter the adaptive immune response . Somewhat unexpected, the subgroup analyses of diabetic and nondiabetic mice demonstrated a significantly lower immune cell mass in diabetic animals and a conceivably higher immune cell mass in compound treated mice conflicting with an anti - inflammatory effect of ser140 . However, if immune cell recruitment is increasing in the prediabetic stage with a subsequent decrease following diabetes onset (as indicated by the current data), the apparent higher immune cell mass in ser140 treated mice can simply be explained by a ser140 induced postponement of diabetes onset . More studies are, however, needed to accurately depict the endocrine and immune cell dynamics in the female nod mouse model . Alternatively, the apparent higher immune cell mass could be explained by a reduced function of treg cells within inflamed islets after disease onset in nod mice and that ser140 blockade of il-1 signaling might have a preservative function on these cells [33, 34]. The delayed reduction of treg cell function might also explain the significant increase in the plasma levels of the anti - inflammatory cytokine il-10 that has been reported after ser140 treatment . In accordance with previous studies [35, 36] we observed substantial immune cell infiltration into the pancreatic islets being mainly composed of lymphocytes as indicative of insulitis . Consistent with an inflamed pancreas, a substantial proinflammatory cytokine expression was observed around and within the islets . We did, however, not observe any apparent changes in the number of specific immune cell subsets or apparent difference in cytokine expression with treatment . It has previously been shown that even low concentrations of il-1 can exert cytotoxic effect on pancreatic -cells, partly due to their high density of il-1 receptors compared to other cell types . However, based on the data presented here it is not possible to differentiate between the effects of il-1 blockade on the -cells and on the immune system . Hence, based on these limitations we can only cautiously speculate that the -cell sparing effect of ser140 is mediated through direct blocking of the proapoptotic action of il-1 on -cells . We have shown that the il-1r antagonist ser140 at 10 mg / kg subcutaneously is able to prevent the destruction or damaging of the insulin producing -cells and hence reduce the incidence of diabetes in female nod mice . The exact mode of action of these effects is presently not known, but the lack of effect on insulitis suggests direct inhibition of the -cell death pathway under the control of il-1.
Study area - posadas is located on the northeastern border of argentina (2723 s 5553w, 120 m above sea level) and is the most populated city of misiones, with more than 320,000 inhabitants (national institute of statistics and census 2010) (indec.com.ar). The city is located on the shore of the paran river in the paranaense forest eco - region, a subtropical humid forest of the amazonian domain . The mean annual temperature and precipitation in the area are 22.2c and 1,699 mm, respectively (national institute of statistics and census 2009). Longipalpis captures were performed in 2007 and 2009 between january - march (2007: from 1 february-31 march; 2009: from 21 january-11 march). This period displays a high abundance of phlebotominae, which occurs during the warmest temperatures after the rainy season (oliveira et al ., the city was divided into a grid of 400 m x 400 m. in each case, the worst scenario method was used to select at least one household within the area (feliciangeli et al . Worst scenarios are characterised by the presence of vegetation, which provides shadow, moist soil, detritus, access to blood sources and a lack of light interference . A cdc battery - operated mini - light trap was placed in the household peridomicile overnight . Although the sampled areas were the same in 2007 and 2009, not all of the sampled households were the same . All of the sampled households were geopositioned with a gps and located within a map of posadas using arcview gis 3.2a 1999 (environmental systems research institute, arcview spatial analyst 2.0a, new york, a total of 282 and 310 households from the same spatial area were sampled in 2007 and 2009, respectively, and included in the comparative analysis . Each household was sampled for only one night, though exceptions were made when phlebotominae were not captured in any of the traps or when unfavourable weather conditions were recorded (rain, strong winds) that would prevent the presence of sandflies . In such cases, the first night was discarded during the analysis to avoid any biases and to rule out possible negative values for vector abundance . To maintain proper storage of the phlebotominae, they were treated with lacto - phenol, observed with an optical microscope and identified according to galati s key (2003), using generic abbreviations according to marcondes (2007). During the sampling period, the lu . Longipalpis abundance at each household was estimated using the number of specimens captured per trap - night . The observed lu . Longipalpis abundances were compared between the two years using a generalised linear model, with a poisson distribution for errors and a logarithm link function . To account for overdispersion, the standard errors (se) were corrected using a quasi - poisson model (mccullagh & nelder 1989). We also compared the proportion of positive households between the two years using a proportion z - test . Although both of the surveys were conducted during the summer, the daily maximum and minimum temperatures and the daily maximum wind speeds were compared for the sampling periods (t test, alpha with a bonferroni correction of 0.01, meteorological data available from posadas airport, provided by the national weather service). Spatial analysis - longipalpis abundance values obtained in 2009 to compare the spatial dependence of vector abundance between the two years . To estimate the range, the nugget and the sill, we fitted the semivariogram function using a spherical model . To account for anisotropy, four directions were considered: 0, 45, 90 and 135. vector abundance was interpolated using an ordinary kriging procedure to locate patches and gaps of abundance in the city and to compare the changes in the spatial pattern . These analyses were performed using s - plus 6.0 with a spatial extension module (insightful 2001). The interpolated abundance was categorised into three levels: low abundance (less than 30 individuals per trap - night), intermediate abundance (from 30 - 60 individuals per trap - night) and high abundance (more than 60 individuals per trap - night). This classification was based on previous research showing that higher vector abundance is related to a higher transmission risk of vl (costa 2008). We computed the percentages of areas characterised by a null, low, intermediate or high sandfly abundance according to the categories defined, using the interpolated abundance values obtained from the kriging procedure using arcview spatial analyst 2.0a 2000 (environmental systems research institute). Environmental analysis - an environmental analysis was carried out only for the data from 2009 because an analysis of the data from 2007 was previously reported (fernndez et al . A total of 312 sampled households were included in the analysis to examine the association between lu . Longipalpis and the surveyed environmental characteristics (90% of these households were included in the spatial analysis, while the remaining 10% corresponded to households located outside the grid). The results of the data analysis for 2007 were reviewed to determine the environmental variables to be surveyed for 2009 (fernndez et al . 2010); however, the data analysis for 2007 lacked environmental characteristics surveyed at the microhabitat scale . Despite this lack of available data, the present study incorporated environmental characteristics surveyed within the households at the microhabitat scale . Previous literature was referenced to determine and select microhabitat variables related to the biology of the vector (gontijo & melo 2004, costa et al . 2006, mestre & fontes 2007). Additionally, we retained the environmental characteristics that best explained vector abundance in 2007 (fernndez et al . Environmental data were obtained from three different sources: (i) land cover classification and cartographic data, (ii) household field characteristics recorded simultaneously with entomological sampling and (iii) google earth satellite images (table i). For land cover classification, we used data provided by the ente binacional yacyret (eby). Three different classes of land cover were identified based on an ikonos remote - sensing image (from april 2009, 1.2-m resolution): herbaceous vegetation, arboreal or shrub vegetation and non - vegetated areas (e.g., streets, roads, paths and buildings). The percentages of these classes were computed with a buffered circular radius of 50 m, 100 m or 200 m around each sampled household . The distance to the nearest water source (rivers, streams) was computed from a map provided by the eby . The number of unpaved roads in the block was recorded from the google earth satellite images (13 september 2009, 1.62 km altitude). In these images, the land in the study area appears reddish, while unpaved roads appear red and paved roads appear gray to black . Twenty characteristics of the households were surveyed simultaneously with the entomological data, related to the vegetation, general conditions and maintenance of the domicile and peridomicile . Finally, three indices were created based on these characteristics: a vegetation index, in which each surveyed vegetation variable contributed to the index, a dwelling index, based on the housing characteristics and the surrounding area, and an animal index, based on the presence of chickens and/or dogs . Longipalpis abundance and the examined environmental characteristics was analysed through a forward stepwise multiple regression procedure using generalised linear models (mccullagh & nelder 1989). Because the response variable consisted of the number of individuals per trap - night, a poisson distribution was employed for errors and a logarithm link function was applied . To account for overdispersion explanatory variables that were significant at the 5% level were included in the model, establishing parameter estimates / se and degrees of freedom . A two - tailed t test was carried out to determine the significance of the parameter estimates . To avoid multicollinearity between explanatory variables, we discarded those variables that were highly associated with others that had already been included in the model (with p <0.01 for the pearson correlation test). Following a graphical check of the assumptions of the analysis, one outlier was removed . The spatial dependence of the sandfly abundance was analysed including an autocovariation matrix in the generalised lineal model, according to the methodology described by dormann et al . . Then, the autocorrelation of the model residuals was analysed by computing the semivariogram function . All of these analyses were conducted using the r 3.0.0 (r development core team 2013) and s - plus 6.0 with a spatial extension module (insightful 2001). Table ienvironmental characteristics analysed to explain the abundance of lutzomyia longipalpis in the city of posadas, misiones, argentina, in 2009description and unitsneighbourhood (macrohabitat) surface covered by herbaceous vegetation at 50/100/200 m (%) surface covered by trees and bushes at 50/100/200 m (%) surface covered by unvegetated areas at 50/100/200 m (%) number of unpaved streets around the block of the household (0 - 4) water source distance (rivers, streams) (m) household (microhabitat) presence of accumulated unused material presence of garbage (organic and inorganic) presence of sewage presence of latrine presence of water stream presence of impervious surfaces in the peridomicile peridomicile maintenance, categories: good, regular and bad house built in wood house built with brick house built with more than one type of material presence of lemon trees presence of mango trees presence of vines presence of other trees presence of grass presence of bare soil at the peridomicile domestic use of deltamethrin domestic use of phenolic compounds presence of dogs presence of chickens vegetation index, range (0:5). The presence of vines, grass or mango, lemon or other trees add one unit to the index . The presence of garbage, junk, sewage, latrine, bare soil, houses built with more than one type of material and regular peridomicile maintenance adds one unit to the index . Bad maintenance of peridomicile and house built in wood adds two units to the index . Good maintenance of the peridomicile and house built with brick subtracts one unit to the index . The presence of dogs and chickens adds one unit to the index . A: land cover classification, cartographic information or google earth satellite image b: field records carried simultaneously with the trapping session1 c: k - othrina d: acaroina e: index constructed based on the characteristics surveyed . A: land cover classification, cartographic information or google earth satellite image b: field records carried simultaneously with the trapping session1 e: index constructed based on the characteristics surveyed . In 2007 and 2009, 2,380 (male: female sex ratio of 3.5) and 6,916 (male: female sex ratio of 7.5) lu . More than 99% of the total captures (from 282 and 310 of the sampled houses in 2007 and 2009, respectively) represented this species . During both years, the presence of evandromyia cortellezzi (2007: 8 individuals, 2009: 11 individuals) was also recorded and during sampling in 2007, nyssomyia whitmani and nyssomyia neivai were observed, each of which was represented by a single captured specimen . The weather conditions were similar (p> 0.05) during the two survey periods according to an independent t test with the bonferroni correction: daily maximum temperatures, 32.04c (2007) and 32.96c (2009), daily minimum temperatures, 21.96c (2007) and 22.08c (2009), and daily maximum wind speeds, 28.4 km / h (2007) and 30.9 km / h (2009). During both survey periods, the percentage of households in which the vector was observed decreased from 41.5 - 31% from 2007 - 2009, respectively (p = 0.008). In 2009, the average recorded abundance was 22.3 individuals per trap - night [sd 93.2, range (0:1,111)]. This value was almost three times greater than that recorded in 2007 for the same area (8.4 individuals per trap - night, p = 0.02). In 2009, the spatial autocorrelation of lu . Longipalpis abundance was up to 688 m (estimated range of the semivariogram function: sill, 8,074; nugget 1,950). The semivariograms created for the four directions indicated isotropy . For both survey periods, sites of intermediate and high abundance of lu . However, between 2007 - 2009, some changes were observed in the interpolated abundance in relation to the main patches recorded . From 2007 - 2009, three patches increased in size: one showed a change in position, three disappeared and six new patches were recorded (figure). The estimated areas characterised by null or low vector abundance decreased between the two survey years, from 8.4 - 6.3% for null abundance and from 88.6 - 83% for low abundance . In contrast, the estimated areas displaying an intermediate or high vector abundance increased from 1.6 - 4.7% and from 1.4 - 6.1% for 2007 and 2009, respectively . The abundance of lu . Longipalpis in 2009 was greater at sites with a higher degree of tree or bush cover and an accumulation of unused material in households (20.25% of total deviance explained) (table ii). The spatial dependence of the vector abundance was significant in the model (p = 0.03) and the semivariogram created for the residuals of the models showed no spatial dependence . Additionally, the coefficients for the environmental variables did not change substantially by removing the autocovariate term . A: interpolated abundance by kriging in summer 2007 and summer 2009 in the city of posadas, argentina . The main patches are indicated by capital letters (d: patches that disappeared from 2007 - 2009; i: patches that increased in size from 2007 - 2009; m: patches that modified their position in 2009 in relation to their position in 2007; n: new patches that appeared in 2009); b: standard errors (se) of the kriging procedure for both years (2007 se and 2009 se). The year of 2009 showed more variability than 2007 (see reference scale). Note that the colour reference scale of the se was reversed compared to the vector abundance scale (darker colours mean less error) in order to make the figure more readable . Table iimultiple regression model, general linear model [parameter estimates and standard errors (se)] for the abundance of lutzomyia longipalpis as a function of environmental and demographic variables in the city of posadas, misiones, argentina, in 2009variableparameter estimatessephabitat scale interpretationintercept-0.9111.1470.427-presence of accumulated unused material1.6100.320 <0.001microproportion covered by trees and bushes 100 m around the sampling point7.4572.6340.004macroautocovariate0.0080.0040.031-null deviance = 26175.19, degrees of freedom (df) = 310; residual deviance = 20876, df = 307 . Null deviance = 26175.19, degrees of freedom (df) = 310; residual deviance = 20876, df = 307 . Although the pattern of patches was similar between 2007 - 2009, we observed areas of higher abundance and an overall 265% increase in the average abundance . It is difficult to know whether this is the first stage of vector colonisation and if vector abundance will continue to increase in the city or if this pattern of abundance will stabilise over time . Despite the focused anti - vector interventions (pyrethroid treatment) carried out by posadas, the abundance of lu . However, it is not possible to determine the effectiveness of these measures because we cannot predict what the abundance of the vector would have been if these measures had not been taken . In the city of campo grande, located in the central - west region of brazil near the study area, the abundance of lu . Longipalpis increased 60-fold from 1999 - 2000 to 2004 - 2005 (de oliveira et al . 2006a). From 2007 - 2009, spatial analysis showed that the areas with an intermediate or high abundance of sandflies increased, whereas the percentage of households with sandflies decreased during this period . These results suggest that vector abundance is likely increasing, but becoming more concentrated in fewer households . It would be worthwhile to study the dispersion of the vector in the following years to confirm this hypothesis . For both survey years, the se of the interpolated abundance was higher compared to that of the mean values . These authors found that the variance in high or low abundances within patches was due to the abundances recorded in the households . Therefore, the higher se obtained in 2009 in relation to 2007 were likely a result of the higher abundances recorded . Because the vector is not distributed evenly throughout the city, the observed spatial pattern of lu . The patches with a higher abundance should not be considered completely static over time because, as observed in our data, their size and position in space may change over time and new patches may appear, while others disappear . In this regard, it would be worthwhile to study the effects of changes in biotic and abiotic factors, in addition to human practices . Regular monitoring would be required (though not exclusively, i.e., along with examining other epidemiological criteria, such as active transmission) to improve the efficiency of interventions in patches with high vector abundance . Thus, controlling the vector in these patches of high abundance could have a major impact on parasite transmission in the entire city . By applying the 80/20 principle (woolhouse et al . 1997), we were able to postulate that effective interventions in areas with a high vector abundance could decrease the transmission of the disease in the city by approximately 80%, taking into consideration the variations and specific characteristics associated with different transmission scenarios . The similarities between the spatial patterns of the abundance distributions obtained in 2007 and 2009 may reveal characteristics of suitable and unsuitable sites for vector establishment . In this study longipalpis abundance was the amount of surface area covered by trees and bushes around the household, which is defined as a macrohabitat characteristic . Longipalpis abundance for 2007, within a buffer zone of 50 m; however, all of the examined buffer distances (50 m, 100 m and 200 m) were correlated (fernndez et al . 2010). In the 2007 survey, only a few characteristics of the households were recorded and the lack of an explanation for the abundance of lu . Thus, a greater effort was made to describe household characteristics during the 2009 sampling . Although 20 environmental variables were surveyed during household sampling (microhabitat), we did not improve the capacity to explain the distribution of lu . Longipalpis abundance; however, the presence of accumulated unused material within the peridomicile did provide a partial explanation . In the environmental analysis performed in this work, the presence of chickens did not explain the abundance of lu . . However, in the literature, chickens are described as a risk factor when henhouses are close to human bedrooms, due to an increase in the attractiveness and availability of potential breeding sites (alexander et al . An association between chickens and intermediate or high vector abundances has been previously reported (fernndez et al . 2010). In the present study, although we found no evidence of dogs acting as a risk factor for vector abundance, they were present in 60% of the households sampled . In the same study area, santini et al . (2010) found that dogs must remain at a distance of 5 m to prevent the insect from landing in humans, thus demonstrating the importance of keeping dogs away from the humans . 2012), tree and shrub cover would be an environmental characteristic that is related to sandfly abundance . However, further studies will be needed to determine whether sandfly abundance is associated with certain tree species with particular characteristics (e.g., deciduous trees). Within high - abundance patches, the presence of accumulated unused material in the peridomicile may provide suitable conditions (e.g., shelter and shade) for the vector . Longipalpis and the vegetation cover, thus concluding that large trees may offer a better microenvironment where sandflies can find appropriate refuge and breeding sites . Therefore, the authors suggested that sandfly populations are concentrated in small areas where the food supply is satisfactory, coinciding with the presence of large vegetation covering . Defining variables that might be related to vector biology is often a difficult task, especially in an urban context, where the number of possible variables (biological and sociodemographic) is large . The preliminary results presented here provide a framework of variables to be considered and built upon in future studies of leishmania vectors in urban environments . The environmental models created for posadas may be used as a starting point when creating more - robust predictive models of lu . The consistency of some of the environmental indicators in the models constructed for 2007 and 2009 suggests that these variables should be considered in future studies . Other factors that were not considered in this analysis, such as microclimatic variables, could also improve the model . Finally, if the patches of high vector abundance observed in posadas can be used to establish a general pattern for urban environments, it could contribute to explaining the clustering patterns found in the transmission of human and canine vl (waleska et al . (2006) observed that, in general, sites with a high abundance of sandflies correspond to many human and canine cases of vl . Longipalpis abundances and canine vl could be built and used to prevent human cases . A robust environmental model will enable the estimation of vector abundance and the incorporation of this information directly into the construction of risk maps.
Cutaneous complications caused by human immunodeficiency virus (hiv)/acquired immune deficiency syndrome have been reported, including, all kinds of opportunistic infections, psoriasis, seborrheic dermatitis, hairy leucoplakia, and granuloma annulare, among others . Alopecia areata and vitiligo are generally frequent in patients, and their solitary associations with hiv are probably fortuitous in most cases . In the current paper, we report a case of an hiv - infected patient with these conditions . Two years ago, several dispersed hair - loss patches appeared on the patient's scalp without any subjective symptom . He previously visited a dermatologist and was diagnosed with alopecia areata as well as vitiligo . No member of his family had vitiligo or alopecia . Dermatological examination revealed several depigmented macules measuring 2 cm to 5 cm with clear boundaries distributed on the face and neck . Several smooth hair - loss patches measuring 1 - 2 cm were also distributed on the top of the head, and diffuse alopecia was observed around the head [figure 1a, b, and c]. (a) hair loss at his first visit to the clinic; (b) and (c) status of vitiligo at his first visit; (d) hair loss at his second visit a month later enzyme - linked immunosorbent assay and western blot revealed a positive result for serum anti - hiv antibody . Flow cytometry revealed that the patient's cd4 lymphocyte count and cd4/cd8 ratio were 20 cells/l (3.7%) and 0.04, respectively, which are considerably low . The thyrotropic - stimulating hormone and free thyroxine levels were 7.69 iu / ml and 10.06 pmol / l, respectively . Serological test of syphilis showed a positive t. pallidum particle agglutination, but the toluidine red unheated serum test was negative . The patient did not accept any therapy for 1 month until his second visit to the clinic . His alopecia areata worsened, presented ophiasis pattern with 80% hair loss on his head, and even his brows [figure 1d]. The patient's general state of health was still good, and manifestations of opportunistic infection and malignant tumor were not observed . One month after antiretroviral therapy (art), the patient's alopecia areata dramatically improved, but no evident improvement in his vitiligo was found [figure 2]. His cd8 lymphocyte count had a more considerable increase, resulting in a cd4/cd8 ratio of 0.03 . Although, his cd4 lymphocyte count was still very low, no other complaints were reported . The patient received benzathine penicillin injection for 3 times, but his vitiligo was not still improved . (b) status of alopecia areata dramatically improved; (c) and (d) vitiligo did not have obvious improvements alopecia areata is one of the most common autoimmune diseases that can be considered a t - cell - mediated autoimmune disease, whereby the gradual loss of protection provided by the immunity of normal hair follicle plays an important role . Alopecia areata has been shown as a cd8 + t - cell - dependent and organ - specific autoimmune disease in a rat model of alopecia areata, in which depleting cd8 + t - cells could restore hair growth . Vitiligo is a common depigmentation disease characterized by the presence of circumscribed white macules in the skin caused by the destruction of melanocytes in the epidermis . Skin biopsies of vitiligo patients show that inflammatory cells are prominent in the perilesional areas, consisting of cd8 + and cd4 + t - cells, often with an increased cd8+/cd4 + ratio . Although, syphilis infection may also cause alopecia areata or vitiligo like lessions, the laboratory studies in this case only confirmed that the patient had been infected with syphilis . Rawson et al . Suggested an autoimmune mechanism that involves the release of protein fragments from dying cd4 + t - cells that, in turn, promote the formation of auto - reactive cd8 + t - cells in hiv infection . The massive level of death and destruction of lymphocytes in hiv infection breaks the tolerance for self - peptides and leads to the production of auto - reactive cytotoxic t - cells that respond to the cleavage products of apoptotic cells . This mechanism explains the successive occurrence of alopecia areata and vitiligo in the same patient with hiv . Although, the patient's cd4 lymphocyte count was only 20 cells/l, he had no other complaints, except for alopecia areata and vitiligo . After art, his cd4 lymphocyte count increased, simultaneously accompanied by improvement in his alopecia areata without anti - alopecia treatment . Hence, the improvement of alopecia areata and increased cd4 lymphocyte count are positively correlated . The patient represents a very rare case of alopecia areata and vitiligo associated with hiv infection . Self - reactive cd8 + t - cells are generated because the release of protein fragments from dying cd4 + t - cells breaks the tolerance for hidden antigens during progressive immune exhaustion . This mechanism explains the occurrence of some autoimmune diseases, including, alopecia areata and vitiligo, with hiv infection . Written informed consent was obtained from the patient for the publication of this case report and any accompanying images . Alopecia areata and vitiligo associated with hiv infection might be connected with the generation and maintenance of self - reactive cd8 + t - cells.
Follicular lymphoma (fl) cases comprise approximately 35 and 22% of all adult non - hodgkin lymphomas in the usa and worldwide, respectively . Fl has a chronic relapsing - remitting disease course, and there are several treatment options ranging from watchful waiting to chemoimmunotherapy using rituximab in combination with cyclophosphamide, doxorubicin, vincristine, and prednisolone (r - chop). A recent report showed that bendamustine and rituximab (br) therapy was more efficacious and less toxic when compared with r - chop therapy . Although bendamustine has a favorable tolerability, the most frequent hematologic adverse events associated with its use are leukocytopenia, lymphocytopenia, and neutropenia [4, 5, 6, 7, 8, 9]. Common nonhematologic adverse events include nausea, fatigue, and anorexia, and are mainly grade 1 or 2 in severity [4, 5, 6, 7, 8, 9]. Here, we report an informative fl case with severe liver dysfunction and nonallergic bronchitis accompanied by eosinophilia that developed following br therapy . In july 2013, a 66-year - old female was diagnosed with fl (grade 2) using lymph node biopsy of the right supraclavicular lymph node . Based on the follicular lymphoma international prognostic index score criteria, she had stage iiia disease (cervical, axillar, abdominal para - aortic, mesenteric, iliac, and inguinal lymph node involvement) and was at high risk (3 points based on age, stage, and the number of involved nodal sites). The patient refused further r - chop therapy mainly because of finger numbness, hair loss, and general malaise . Therefore, br therapy was administered during the second chemotherapy cycle . The patient received 1 cycle of rituximab (375 mg / m on day 1) in combination with bendamustine (75 mg / m on days 2 and 3). On day 16 of the br therapy, the patient developed liver dysfunction with aspartate aminotransferase (ast) and alanine aminotransferase (alt) levels of 133 and 93 iu / l, respectively . She also developed a severe cough, which resulted in insomnia (grade 3), and was admitted to our hospital for further assessment . As summarized (table 1), her hepatic function had deteriorated further (total bilirubin, 3.1 mg / dl; ast, 800 iu / l; alt, 557 iu / l; alkaline phosphatase, 932 u / l; gamma - glutamyltransferase, 422 u / l; lactate dehydrogenase, 641 u / l). Hepatitis b surface antigen, anti - hepatitis c virus, anti - hepatitis b virus surface antigen, anti - hepatitis b core antigen, and anti - hepatitis a igm antibodies were all negative . A computed tomography (ct) examination did not show any liver abnormalities (data not shown). With regard to the severe coughing exhibited by the patient, a ct examination revealed no significant lung abnormalities, demonstrating that she had not been suffering from bacterial pneumonia (data not shown). The nonspecific ige level was within normal limits and no specific ige was detected against 11 antigens that were tested (cocksfoot, japanese cedar, cat dander, dog dander, egg white, wheat, buckwheat, soy bean, shrimp, candida albicans, and derematophagoides farinae) (table 2). The c - reactive protein level was not elevated throughout the course of the patient's illness (table 1). These data indicated that bacterial, fungal or cytomegalovirus infection, and allergic reactions might not have been the cause of the severe coughing . However, an increase in the eosinophil level was observed around 4 weeks after the beginning of the br therapy, and the eosinophilia was progressive (table 1, fig . 1). Considering these results together, the patient's severe cough was thought to be a result of nonallergic bronchitis due to eosinophilia . The patient was referred to the department of respiratory medicine, and was diagnosed as having bronchitis with eosinophilia . Methylprednisolone sodium succinate (1,000 mg) was administered intravenously for 3 consecutive days . On day 47 of the br therapy, 50 mg of oral prednisolone was administered for 7 days, and the amount of prednisolone was gradually decreased to 0 mg (fig . The severe coughing greatly improved after steroid pulse therapy and diminished very rapidly, and both liver dysfunction and eosinophilia resolved . Bendamustine, consisting of a nitrogen mustard moiety bound to a purine - like ring, is an agent with unique alkylating properties . Bendamustine induces dna damage, apoptosis, and mitotic catastrophe, and shows only a low level or absence of cross - resistance with other alkylating agents [10, 11, 12, 13]. The administration of bendamustine in combination with rituximab in the treatment of fl demonstrated a significantly improved progression - free survival compared with r - chop therapy, but with a distinct toxicity profile . Significantly fewer hematological toxic effects were noted in patients treated with br than in those treated with r - chop . No alopecia was observed in br - treated patients, but a drug - associated erythematous skin reaction was more common than in r - chop - treated patients . Side effects such as liver damage, bronchitis, and eosinophilia were seldom reported in br - treated patients . In this case, the patient was admitted to our hospital for examination because of liver damage and severe coughing . The laboratory data and a ct examination did not indicate that hepatitis viruses or lymphoma cell infiltration into the liver was the cause of the liver damage . Negative laboratory data including a microbiological examination suggested that bacterial and fungal pneumonia, and cytomegalovirus pneumonitis, were also not responsible for the damage (table 2). There was no neutropenia, but lymphocytopenia (up to grade 3) was observed (table 1); therefore, the possibility of viral infectious disease could not be excluded . However, no significant abnormalities were observed in the bilateral lung ct scan examination (data not shown). As eosinophilia was present, therefore, nonspecific ige and specific ige for 11 antigens were examined, but no positive results were observed, suggesting that nonallergic bronchitis with eosinophilia caused the severe coughing (table 2). We speculated that the patient's severe liver damage and nonallergic bronchitis were the results of eosinophilia, and that steroids would be an effective treatment . As expected, the administration of steroid pulse therapy and prednisolone resulted in the complete resolution of the pathology (fig . Br is generally a well - tolerated therapy, and eosinophilia seldom occurs as a side effect of the treatment . Reported a bendamustine - induced skin rash with eosinophil infiltration, but malipatil et al . Reported that no eosinophilia was noted in patients with a skin rash at present, the relationship between br therapy side effects and eosinophilia is not clear . In summary, we reported a case of br - induced severe liver damage and nonallergic bronchitis with eosinophilia . The efficacy of steroid treatment in this patient indicated that eosinophilia resulting from br therapy might have caused severe liver dysfunction and nonallergic bronchitis.
Current guidelines recommend implantable cardioverter defibrillator (icd) implantation for brugada syndrome (brs) patients with a history of ventricular fibrillation (vf). However; patients whose first presentation is vf are at high risk of recurrent vf episodes and/or electrical storm . Here we report a case of brs whose first presentation was electrical storm, for which, primary ablation (i.e. Before icd implantation) resulted in vf - free survival during a 48-month follow up . After resuscitation, he was admitted to a nearby hospital, where brugada - type electrocardiographic readings (ecgs) were recorded . These findings were associated with frequent monomorphic premature ventricular contractions (pvcs) that degenerated to ventricular fibrillation (vf) 3 times during the night (fig . 1). Telemetry revealed that the qrs morphology of the first beat in all vf episodes was identical (left bundle branch block and inferior axis configuration). The patient was then transferred to our hospital, where he was stable, with repetitive pvcs (> 10 pvcs / min) of the same initial morphology . Because these pvcs had led to an electrical storm and continued with similar frequency the next day, emergency catheter ablation (ca) was performed 4 hours after admission . 2) with late potentials (lp), scattered at the free wall of the rv outflow tract (rvot) with only few lp points at its posterior aspect . An optimal pacemap and early activation were observed at the rvot free wall, where ca completely eliminated the pvcs and rendered vf non - inducible . Lp ablation and further energy applications in a broad area around the earliest activation site were performed . Pilsicainide provocation and treadmill exercise tests were performed; however, no triggering pvcs or vf occurred . The patient has been event free during a 48-month medication - free follow - up . In brugada syndrome (brs), icd implantation is recommended for patients experiencing vf . However, up to 48% of such high - risk patients experience frequent icd shocks that result in significant sequelae such as depression, post - traumatic stress, and difficult vf termination due to a relatively high defibrillation threshold in some patients . Pharmacologic therapy, typically an isoproterenol infusion, can be effective in suppressing vf, and deep sedation has occasionally yielded good results in isolated cases . However, because the patient was relatively stable on admission, suppressing his pvc / vf would have resulted in missing his culprit pvc because trigger pvcs are episodic, appear just before vf, and disappear within a narrow time window . Local ablation of vf - triggering pvcs after icd implantation has proven effective as adjuvant therapy in a few patients with electrical storm; however, such patients had already been exposed to the icd discharge sequelae . This is the first case to demonstrate the feasibility of ablation and implantation as an alternative approach in suppressing es during long - term follow - up . Unlike the culprit lesion in myocardial infarction, the culprit pvc of vf in brs cannot be targeted once the vf subsides, because brs patients rarely have frequent pvcs that can be mapped or have pvcs during holter monitoring . For this reason, this case suggests that careful monitoring and possible ablation of vf - triggering pvcs in the acute phase may be clinically significant in selected patients . Because epicardial mapping was not performed in this case, we could not identify whether the lp origin was epicardial or endocardial . However, endocardial ablation could have an epicardial modification effect because of the thin - walled rvot . While this approach is not first - line therapy for brs, by taking advantage of reducing the icd burden in the modern era of new catheter designs and mapping technologies, our approach might be effective in selected cases, especially when the origin of the culprit pvc is easily accessible, such as the rvot.
A 67-year - old female presented to the emergency room with abdominal pain secondary to diverticulitis and was found to have a large left renal mass . The patient's medical history was significant for hyperlipidemia and diverticulitis; however, there was no past or family medical history of urologic malignancies . An abdominal computed tomography (ct) scan revealed an infiltrative mass arising from the upper pole of the left kidney, which was suggestive of rcc . A ct scan of the chest demonstrated punctate lung nodules of indeterminate significance . There was no evidence of extrarenal tumor involvement noted at the time of the procedure . The radical nephrectomy specimen was routinely fixed in 10% buffered formalin, embedded in paraffin, and serially sectioned into 4-m - thick sections . Immunohistochemical staining was performed using the avidin - biotin - peroxidase complex method in a dako autostainer (dako, carpinteria, ca) with standard techniques . Primary antibodies included cd10, pax-8, vimentin, alpha - methyl - coa racemase (amacr), pin dual stain (cocktail of high molecular weight cytokeratin and p63), thrombomodulin, ulex europaeus lectin, cytokeratin 7 (ck7), and cytokeratin 20 (ck20). The nephrectomy specimen showed a 6.0 cm 6.0 cm 4.0 cm poorly circumscribed tumor in the upper pole of the kidney . Approximately 70% of the tumor cut surface was solid, fibrous tan - white, and 30% of that was soft, lobulated tan - yellow with focal areas of hemorrhage within the soft tan - yellow areas (figure 1). The first was a clear cell rcc, which corresponded to the bright yellow areas grossly identified within the tumor . The tumor cells in these foci were of low nuclear grade (fuhrman nuclear grade 2). The second component, which comprised the majority of the tumor, corresponded to the white fibrotic areas within the tumor and was composed of a high - grade tumor with glandular / tubular differentiation (figures 2a c). This tumor was of high nuclear grade (fuhrman nuclear grade 4) and was associated with extracellular mucin production and extensive desmoplastic stroma . Another unusual finding was the presence of extensive perineural invasion in this area, a feature that is rarely noted in renal tumors, as well as the presence of hyaline globules noted within the high - grade component . Immunohistochemical stains revealed that the clear cell component was positive for cd10, pax-8, vimentin, and amacr (p504s) and negative for pin dual, thrombomodulin, ulex europaeus lectin, ck7, and ck20 . The high - grade component was positive for cd10, pax-8, vimentin, ulex europaeus lectin, and ck7; focally positive for amacr; and negative for pin dual, thrombomodulin, and ck20 (figure 3). Although urothelial carcinoma was considered in the differential diagnosis, the lack of an in situ urothelial carcinoma component, coupled with the strong expression of pax-8, vimentin, and ulex europaeus lectin and the negative staining for pin dual (cocktail of high molecular weight cytokeratin and p63), helped bolster the diagnosis of collecting duct carcinoma . The histologic features and immunohistochemical profile of the higher - grade component were consistent with collecting duct carcinoma . Due to the close proximity of the two components, along with the presence of both the clear cell and the collecting duct carcinoma components at the interface, the tumor was best thought to represent a collision tumor, composed of clear cell rcc and collecting duct carcinoma . A fine needle aspiration of the lung showed numerous three - dimensional cell clusters and papillary groups . As in the primary renal tumor, intracellular and extracellular hyaline globules were present, seen especially on cell block sections . The findings were consistent with metastasis from the collecting duct carcinoma component of the primary renal tumor . There were no cells with features of clear cell carcinoma (figures 2d e). The majority of the tumor is gray - white and fibrotic and demonstrates collecting duct morphology (notched red arrow). Also identified is a soft yellow area that appears to be somewhat sharply demarcated from the above mentioned component, which histologically demonstrates clear cell histology (solid blue arrow). A, low power image demonstrates a sharp demarcation between the collecting duct carcinoma (top right) and clear cell carcinoma (bottom left). B, high power image demonstrates the low fuhrman nuclear grade clear cell renal cell carcinoma component . C, the collecting duct carcinoma component is composed of a high - grade tumor with prominent glandular features . D, fine needle aspiration specimen from the lung metastasis demonstrates high - grade carcinoma . E, cell block preparation demonstrates high - grade carcinoma with histologic features similar to the renal collecting duct carcinoma . Also noted within the aspiration specimen the patient had a clinical response, with decreased pain and improved performance status, and stable radiographic findings . After four cycles of treatment with paclitaxel and carboplatinum, she developed neuropathy necessitating a change of therapy and then proceeded to undergo doxorubicin and gemcitabine . She then developed clinical evidence of soft tissue and bone metastasis in the thoracic spine, for which she underwent radiation treatment . Despite undergoing treatment collision tumors arising in the kidney are unusual, with only a handful of cases documented thus far in the literature . The reported cases of renal collision tumors have included collecting duct carcinoma arising in conjunction with chromophobe rcc, or papillary rcc. Other reported tumor combinations have included chromophobe rcc and oncocytoma arising in association with papillary rcc. Cho et al . Reported a case of collision tumor of the kidney where the dominant tumor mass resembled a clear cell rcc . The tumor reportedly also demonstrated a smaller nodule with a tubulopapillary architecture that was felt to morphologically resemble a collecting duct carcinoma, despite the reported lack of immunohistochemical support (negative ck7, negative ulex europaeus lectin). Our case, in contrast, showed typical morphology (high - grade tubulopapillary carcinoma with a desmoplastic stroma, juxtaposed with a low - grade clear cell component) as well as immunohistochemical characteristics of collecting duct carcinoma (strong expression of pax-8, vimentin, and ulex europaeus lectin and negative staining for pin dual and thrombomodulin) in the high - grade component of the tumor . A, c, and e demonstrate the collecting duct carcinoma are strongly positive for ck7, ulex europaeus lectin, and pax-8, respectively . The clear cell carcinoma is negative for ck7 (b) and ulex europaeus lectin (d) and is positive for pax-8 (f). The existing theories include (a) two unrelated existing cell lines that simultaneously proliferate, thus resulting in two phenotypically different tumors; (b) tumors arising from a common precursor stem cell, which differentiates along two different lines into two unrelated neoplasms, and (c) incidental occurrence of two different isolated tumors within a common anatomic site . Because the two tumor types noted in this renal tumor had origins in the renal cortex (clear cell carcinoma) and the distal collecting duct (collecting duct carcinoma), any of the above theories may be applicable to our case, although the close proximity and abrupt transition between the two tumor types noted both grossly and microscopically may lend credence to the former two theories . Our patient developed disease progression, with bilateral pulmonary metastasis appearing within a few months after nephrectomy . Her clinical course was thought to be more consistent with collecting duct carcinoma rather than low - grade clear cell carcinoma, which was the second component in the primary tumor . This clinical impression was further confirmed by the findings in the fine needle aspirate specimen from the lung, which was histologically identical to that seen in the primary tumor . As has been previously reported, cytotoxic chemotherapy, including the combination of paclitaxel and carboplatinum, may provide palliation in some patients with collecting duct carcinoma . However, the role of targeted therapy in this disease has not been defined . In summary, although rare, collision tumors composed of more than one tumor type are well documented in the kidney . Careful gross examination is invaluable; close attention must be paid to areas that look grossly different to exclude the possibility of more than one tumor type existing in the same specimen, as prognosis is usually determined by the high - grade component.
Systemic local anesthetic toxicity is a rare but potentially fatal complication that is intractable to conventional cardiopulmonary resuscitation . Systemic local anesthetic toxicity also has a risk of progressing to " recurrent systemic local anesthetic toxicity after successful resuscitation " . Intravenous infusion of les reverses intractable cardiac toxicity in an animal model, and les are effective for treating local anesthetic - induced cardiac toxicity . Therefore, various studies associated with les have been actively conducted to understand the mechanism of lipid rescue and improve treatment regimens . Intralipid 20%, which contains only 100% long - chain triglycerides, is commonly used to treat local anesthetic - induced systemic toxicity, whereas lipofundin mct / lct 20% which is composed of 50% long - chain triglycerides and 50% mediumchain triglycerides, is occasionally used to treat local anestheticinduced systemic toxicity . However, both types of le affect hemodynamics in an ex vivo model but the associated cellular mechanism remains unknown . Therefore, we investigated the inotropic effect of two les (intralipid or lipofundin mct / lct) on a hanging heart model mounted in a langendorff perfusion system to elucidate the mechanism associated with changes in intracellular calcium level in myocardial cells . Male sprague dawley rats (koatech, pyeongtaek, korea; weight, 250350 g) were used for this study . All animals were maintained in accordance with the guidelines for the care and use of laboratory animals published by the us national institutes of health in 1996 . Briefly, the animals received general anesthesia with an intramuscular injection of 15 mg / kg tiletamine / zolazepam (zoletil50; virbac lab ., carros, france) and 9 mg / kg of xylazine (rompun; bayer, seoul, korea). If the tail moved (i.e. A sign of awakening) during the operation, an additional 5 mg / kg tiletamine / zolazepam and 3 mg / kg xylazine were injected to maintain anesthesia . Heparin (1000 iu / kg) was administered through the femoral vein after anesthesia was induced . A tracheostomy was performed, and the animals were mechanically ventilated with room air via a 16 g catheter . The heart was mounted quickly on a langendorff perfusion system and perfused with modified krebs - henseleit solution (118 mm nacl, 4.7 mm kcl, 1.2 mm mgso4, 1.2 mm kh2po4, 2.4 mm cacl2, 25 mm nahco3, 11 mm glucose, and 0.03 mm edta), equilibrated to ph 7.4 with a mixture of 5% co2/95% o2 . The perfusion solution was maintained at 37 0.2 using thermostatically controlled water circulating system (water bath ntt-2200; tokyo rikakikai co. ltd ., perfusion pressure was maintained at 70 mmhg with a 95 cm high fluid column and an overflow pump . The left atrium was removed and a 2f millar catheter (model spr-407; millar instruments inc ., houston, tx, usa) was inserted into the left ventricle . A pressure transducer (model ml 118; adinstruments pty . Sydney, australia) was connected to a digital analysis system to measure left ventricular hemodynamic function . Left ventricular systolic pressure (lvsp), maximum rate of intraventricular pressure increase (+ dp / dtmax), maximum rate of intraventricular pressure decrease (dp / dtmax), and heart rate (hr) were measured using a computer analysis program (charttm5 pro; adinstruments) as described previously . The hanging hearts were perfused with modified krebs - henseleit solution for 10 min to stabilize prior to recording hemodynamic function (n = 10). Hearts were excluded if the average values for the last 5 min of the stabilization period failed to meet the following criteria; lvsp, 80130 mmhg; and hr, 200350 beats / min . Each experimental group was injected with the drug using an infusion pump (auto syringe as50 infusion pump; baxter, singapore) through a three - way stopcock on the fluid column . The hanging hearts were assigned randomly to three groups as follows: (1) control group (hearts in which 1 ml / kg modified krebs - henseleit solution was infused through the three - way stopcock using an infusion pump (n = 10); (2) il1 group (hearts in which intralipid 20% (1 ml / kg) was infused through the three - way stopcock using an infusion pump (n = 10); and (3) mct1 group (hearts in which lipofundin mct / lct 20% (1 ml / kg) was infused through the three - way stopcock using an infusion pump (n = 10)., kaysville, ut, usa; alpha = 0.05, power = 92%). Changes in intracellular calcium were examined by measuring increased fluorescence of fluo-3/acetoxymethyl (am) (molecular probes, eugene, or, usa)-loaded cells with a confocal microscope (fv1000; olympus, tokyo, japan). Rat embryonic ventricular myocardial h9c2 cells were purchased from the american type culture collection (manassas, va, usa) and kept in complete growth medium (dulbecco's modified eagle's medium; invitrogen, carlsbad, ca, usa) supplemented with 100% fetal bovine serum (invitrogen) at 37 in a humidified atmosphere of 5% co2 . Basal and intracellular changes in calcium were examined by measuring increased fluorescence of fluo-3/am - loaded cells in the cytosol of h9c2 cells with a confocal microscope . H9c2 cells were attached to cover slips for 24 h at 37 before loading with 5 m fluo-3/am and incubating at 37 for 60 min . Cover slips were inserted into a chamber mounted on the stage of the confocal microscope and rinsed with a warm normal bath solution (140 mm nacl, 5.0 mm kcl, 1.0 mm cacl2, 1.0 mm mgcl2, and10 mm hepes [ph 7.4]). Baseline measurements were taken on quiescent cells for 34 min prior to the application of le . Fluorescent images were collected every 0.6 sec for fast signals and analyzed by fluoview image processing software ver . Twenty signal curves were taken from one view for each and averaged after each le treatment (n = 4). The le concentration used was 0.01%, which induced a maximal increase in intracellular calcium in the preliminary study . All analyses were performed using spss statistical software ver . 18.0 for windows (spss inc ., experimental outcomes were analyzed using one - way analysis of variance and the bonferroni post - hoc test . Male sprague dawley rats (koatech, pyeongtaek, korea; weight, 250350 g) were used for this study . All animals were maintained in accordance with the guidelines for the care and use of laboratory animals published by the us national institutes of health in 1996 . Briefly, the animals received general anesthesia with an intramuscular injection of 15 mg / kg tiletamine / zolazepam (zoletil50; virbac lab ., carros, france) and 9 mg / kg of xylazine (rompun; bayer, seoul, korea). If the tail moved (i.e. A sign of awakening) during the operation, an additional 5 mg / kg tiletamine / zolazepam and 3 mg / kg xylazine were injected to maintain anesthesia . Heparin (1000 iu / kg) was administered through the femoral vein after anesthesia was induced . A tracheostomy was performed, and the animals were mechanically ventilated with room air via a 16 g catheter . The heart was mounted quickly on a langendorff perfusion system and perfused with modified krebs - henseleit solution (118 mm nacl, 4.7 mm kcl, 1.2 mm mgso4, 1.2 mm kh2po4, 2.4 mm cacl2, 25 mm nahco3, 11 mm glucose, and 0.03 mm edta), equilibrated to ph 7.4 with a mixture of 5% co2/95% o2 . The perfusion solution was maintained at 37 0.2 using thermostatically controlled water circulating system (water bath ntt-2200; tokyo rikakikai co. ltd ., perfusion pressure was maintained at 70 mmhg with a 95 cm high fluid column and an overflow pump . The left atrium was removed and a 2f millar catheter (model spr-407; millar instruments inc ., houston, tx, usa) was inserted into the left ventricle . A pressure transducer (model ml 118; adinstruments pty . Sydney, australia) was connected to a digital analysis system to measure left ventricular hemodynamic function . Left ventricular systolic pressure (lvsp), maximum rate of intraventricular pressure increase (+ dp / dtmax), maximum rate of intraventricular pressure decrease (dp / dtmax), and heart rate (hr) were measured using a computer analysis program (charttm5 pro; adinstruments) as described previously . The hanging hearts were perfused with modified krebs - henseleit solution for 10 min to stabilize prior to recording hemodynamic function (n = 10). Hearts were excluded if the average values for the last 5 min of the stabilization period failed to meet the following criteria; lvsp, 80130 mmhg; and hr, 200350 beats / min . Each experimental group was injected with the drug using an infusion pump (auto syringe as50 infusion pump; baxter, singapore) through a three - way stopcock on the fluid column . The hanging hearts were assigned randomly to three groups as follows: (1) control group (hearts in which 1 ml / kg modified krebs - henseleit solution was infused through the three - way stopcock using an infusion pump (n = 10); (2) il1 group (hearts in which intralipid 20% (1 ml / kg) was infused through the three - way stopcock using an infusion pump (n = 10); and (3) mct1 group (hearts in which lipofundin mct / lct 20% (1 ml / kg) was infused through the three - way stopcock using an infusion pump (n = 10)., kaysville, ut, usa; alpha = 0.05, power = 92%). Changes in intracellular calcium were examined by measuring increased fluorescence of fluo-3/acetoxymethyl (am) (molecular probes, eugene, or, usa)-loaded cells with a confocal microscope (fv1000; olympus, tokyo, japan). Rat embryonic ventricular myocardial h9c2 cells were purchased from the american type culture collection (manassas, va, usa) and kept in complete growth medium (dulbecco's modified eagle's medium; invitrogen, carlsbad, ca, usa) supplemented with 100% fetal bovine serum (invitrogen) at 37 in a humidified atmosphere of 5% co2 . Basal and intracellular changes in calcium were examined by measuring increased fluorescence of fluo-3/am - loaded cells in the cytosol of h9c2 cells with a confocal microscope . H9c2 cells were attached to cover slips for 24 h at 37 before loading with 5 m fluo-3/am and incubating at 37 for 60 min . Cover slips were inserted into a chamber mounted on the stage of the confocal microscope and rinsed with a warm normal bath solution (140 mm nacl, 5.0 mm kcl, 1.0 mm cacl2, 1.0 mm mgcl2, and10 mm hepes [ph 7.4]). Baseline measurements were taken on quiescent cells for 34 min prior to the application of le . Fluorescent images were collected every 0.6 sec for fast signals and analyzed by fluoview image processing software ver . Twenty signal curves were taken from one view for each and averaged after each le treatment (n = 4). The le concentration used was 0.01%, which induced a maximal increase in intracellular calcium in the preliminary study . Male sprague dawley rats (koatech, pyeongtaek, korea; weight, 250350 g) were used for this study . All animals were maintained in accordance with the guidelines for the care and use of laboratory animals published by the us national institutes of health in 1996 . Briefly, the animals received general anesthesia with an intramuscular injection of 15 mg / kg tiletamine / zolazepam (zoletil50; virbac lab ., carros, france) and 9 mg / kg of xylazine (rompun; bayer, seoul, korea). If the tail moved (i.e. A sign of awakening) during the operation, an additional 5 mg / kg tiletamine / zolazepam and 3 mg / kg xylazine were injected to maintain anesthesia . Heparin (1000 iu / kg) was administered through the femoral vein after anesthesia was induced . A tracheostomy was performed, and the animals were mechanically ventilated with room air via a 16 g catheter . The heart was mounted quickly on a langendorff perfusion system and perfused with modified krebs - henseleit solution (118 mm nacl, 4.7 mm kcl, 1.2 mm mgso4, 1.2 mm kh2po4, 2.4 mm cacl2, 25 mm nahco3, 11 mm glucose, and 0.03 mm edta), equilibrated to ph 7.4 with a mixture of 5% co2/95% o2 . The perfusion solution was maintained at 37 0.2 using thermostatically controlled water circulating system (water bath ntt-2200; tokyo rikakikai co. ltd ., perfusion pressure was maintained at 70 mmhg with a 95 cm high fluid column and an overflow pump . The left atrium was removed and a 2f millar catheter (model spr-407; millar instruments inc ., houston, tx, usa) was inserted into the left ventricle . A pressure transducer (model ml 118; adinstruments pty . Sydney, australia) was connected to a digital analysis system to measure left ventricular hemodynamic function . Left ventricular systolic pressure (lvsp), maximum rate of intraventricular pressure increase (+ dp / dtmax), maximum rate of intraventricular pressure decrease (dp / dtmax), and heart rate (hr) were measured using a computer analysis program (charttm5 pro; adinstruments) as described previously . The hanging hearts were perfused with modified krebs - henseleit solution for 10 min to stabilize prior to recording hemodynamic function (n = 10). Hearts were excluded if the average values for the last 5 min of the stabilization period failed to meet the following criteria; lvsp, 80130 mmhg; and hr, 200350 beats / min . Each experimental group was injected with the drug using an infusion pump (auto syringe as50 infusion pump; baxter, singapore) through a three - way stopcock on the fluid column . The hanging hearts were assigned randomly to three groups as follows: (1) control group (hearts in which 1 ml / kg modified krebs - henseleit solution was infused through the three - way stopcock using an infusion pump (n = 10); (2) il1 group (hearts in which intralipid 20% (1 ml / kg) was infused through the three - way stopcock using an infusion pump (n = 10); and (3) mct1 group (hearts in which lipofundin mct / lct 20% (1 ml / kg) was infused through the three - way stopcock using an infusion pump (n = 10)., kaysville, ut, usa; alpha = 0.05, power = 92%). Changes in intracellular calcium were examined by measuring increased fluorescence of fluo-3/acetoxymethyl (am) (molecular probes, eugene, or, usa)-loaded cells with a confocal microscope (fv1000; olympus, tokyo, japan). Rat embryonic ventricular myocardial h9c2 cells were purchased from the american type culture collection (manassas, va, usa) and kept in complete growth medium (dulbecco's modified eagle's medium; invitrogen, carlsbad, ca, usa) supplemented with 100% fetal bovine serum (invitrogen) at 37 in a humidified atmosphere of 5% co2 . Basal and intracellular changes in calcium were examined by measuring increased fluorescence of fluo-3/am - loaded cells in the cytosol of h9c2 cells with a confocal microscope . H9c2 cells were attached to cover slips for 24 h at 37 before loading with 5 m fluo-3/am and incubating at 37 for 60 min . Cover slips were inserted into a chamber mounted on the stage of the confocal microscope and rinsed with a warm normal bath solution (140 mm nacl, 5.0 mm kcl, 1.0 mm cacl2, 1.0 mm mgcl2, and10 mm hepes [ph 7.4]). Baseline measurements were taken on quiescent cells for 34 min prior to the application of le . Fluorescent images were collected every 0.6 sec for fast signals and analyzed by fluoview image processing software ver . Twenty signal curves were taken from one view for each and averaged after each le treatment (n = 4). The le concentration used was 0.01%, which induced a maximal increase in intracellular calcium in the preliminary study . All analyses were performed using spss statistical software ver . 18.0 for windows (spss inc ., chicago, il, usa). Experimental outcomes were analyzed using one - way analysis of variance and the bonferroni post - hoc test . The ratio of lvsp in the mct1 group (110.6% 6.4%) increased significantly compared to that in the control group (103.2% 2.1%, p = 0.003, 95% confidence interval [ci], 2.412.5) and the il1 group (104.1% 3.7%, p = 0.009, 95% ci, 1.411.6) (fig . The ratio of + dp / dtmax (control, 98.5% 6.9%; il1, 103.2% 7.2%; mct1, 108.7% 15.7%), dp / dtmax (control, 97.6% 10.0%; il1, 103.9% 6.0%; mct1, 102.1% 9.6%), and hr (control, 93.2% 7.8%; il1, 96.6% 1.5%; mct1, 94.0% 5.0%) were not significant between the groups . The change of intracellular calcium level was estimated by comparing the cellular fluorescence ratio with the basal fluorescence ratio using the fluo-3/am total calcium imaging technique . Lipofundin mct / lct (0.01%) increased intracellular calcium levels more than that of intralipid (0.01%) (il group: 3.03 0.53; mct group: 3.92 0.60; p <0.05; 95% ci, 0.01.9). The ratio of lvsp in the mct1 group (110.6% 6.4%) increased significantly compared to that in the control group (103.2% 2.1%, p = 0.003, 95% confidence interval [ci], 2.412.5) and the il1 group (104.1% 3.7%, p = 0.009, 95% ci, 1.411.6) (fig . The ratio of + dp / dtmax (control, 98.5% 6.9%; il1, 103.2% 7.2%; mct1, 108.7% 15.7%), dp / dtmax (control, 97.6% 10.0%; il1, 103.9% 6.0%; mct1, 102.1% 9.6%), and hr (control, 93.2% 7.8%; il1, 96.6% 1.5%; mct1, 94.0% 5.0%) were not significant between the groups . The change of intracellular calcium level was estimated by comparing the cellular fluorescence ratio with the basal fluorescence ratio using the fluo-3/am total calcium imaging technique . Lipofundin mct / lct (0.01%) increased intracellular calcium levels more than that of intralipid (0.01%) (il group: 3.03 0.53; mct group: 3.92 0.60; p <0.05; 95% ci, 0.01.9). The major findings of our study are: 1) the lipofundin mct / lct infusion significantly increased lvsp in hanging hearts, 2) lipofundin mct / lct has had more of a positive inotropic effect than that of intralipid, and 3) the le treatments increased the intracellular calcium levels in h9c2 cells . Lipofundin mct / lct increased intracellular calcium levels more than that of intralipid. Although there are some reports indicate that long - chain triglycerides has have virtually no effect on hemodynamics, it is a generally accepted that le has a positive hemodynamic effect . However, a mixture of medium - chain triglycerides, long - chain triglycerides, and omega-3 polyunsaturated fatty acid emulsions increase mean aortic blood pressure . Thus, we investigated the effect of commercially available les (intralipid 20% and lipofundin mct / lct 20%) on hemodynamics in an ex vivo heart model . As results, lipofundin mct / lct had a more positive inotropic effect than that of intralipid. Therefore, careful observations of hemodynamic changes are needed during bolus infusion of les . In particular, lipofundin mct / lct should be used with caution as a total parenteral nutrition component in critically ill patients with compromised cardiovascular function . The second aim of this study was to elucidate the mechanism responsible for the le - induced increase in lvsp and intracellular calcium levels in myocardial cells . Long chain fatty acids directly activate calcium channels at some lipid sites near the channels or on the channel protein itself, as assessed by the standard whole cell voltage clamp technique in ventricular myocytes . Therefore, the positive inotropic effect of lipofundin mct / lct shown on the hearts connected to the langendorff perfusion system may be associated with cardiac myocyte calcium concentration . However, one study showed that 10% intralipid exerts a modest positive inotropic effect, although the intracellular calcium remains unchanged by intralipid . Thus, we measured the change in calcium current after adding les to rat cardiac myoblastic h9c2 cells to clarify their effect on calcium current . Most of the signal transduction pathways that stimulate inotropy ultimately involve calcium either by increasing calcium influx, by increasing release of calcium from the sarcoplasmic reticulum, or by sensitizing troponin - c to calcium . In this study, we found that les increased intracellular calcium level more than three times in h9c2 cells, and that lipofundin mct / lct increased intracellular calcium level more than that of intralipid, suggesting that lipofundin mct / lct has a more positive inotropic effect than that of intralipid. Les are used for various clinical purposes and have become an integral part of parenteral nutrition, effective treatment for local anesthetic - induced cardiovascular collapse, and treatment for lipophilic drug toxicity . The mechanism of action of les for treating local anesthetic - induced cardiac toxicity is not completely understood . However, local anesthetic - induced systemic toxicity is caused by inhibiting inotropic and metabotropic cell signal systems and possibly mitochondrial metabolism . The " lipid sink theory " (reduced tissue binding by re - establishing equilibrium in the plasma lipid phase) and the " energetic - metabolic effect " (reversal of inhibited mitochondrial fatty acid transport) are the most widely known theories for the mechanism of action of les for treating local anesthetic - induced systemic toxicity . In addition, a " positive inotropic effect " is proposed as another mechanism . In this regard, lipofundin mct / lct seems to be a more effective le for treating this condition than intralipid. Our study had some limitations . However, we did not verify the source of the increase or the channel involved . Thus, further research regarding the effect of calcium channel blockers on le - induced increase in calcium is needed to elucidate the calcium source . Third, we showed previously that 3 ml / kg intralipid increases lvsp in an in vivo rat model . However, as this large volume of le could change the hemodynamics in an ex vivo heart model, we chose 1 ml / kg in this study . We assume that this may have affected the limited increase in lvsp after the intralipid treatment despite the increased intracellular calcium level . In conclusion particularly, lipofundin mct / lct had more of a positive inotropic effect than that of intralipid. The inotropic effect of les may be related to increased intracellular calcium levels in the heart.
Skeletal muscle glucose uptake is the rate - limiting step of glucose utilization, and it is physiologically regulated by an insulin - dependent and an insulin - independent signaling pathways, both leading to the translocation of glut4 glucose transporter to the plasma membrane . While insulin - stimulated glucose utilization is impaired in type 2 diabetes, physical exercise results in regular glut4 translocation and glucose uptake [24], mediated by the activation of 5-amp - activated kinase (ampk), a cellular fuel sensor which detects atp depletion induced by several conditions [39]. Several evidences indicate that the levels of glut4 expression in skeletal muscle are crucial for the regulation of total body glucose homeostasis [1012]. Accordingly, the ampk - induced increase of muscle glut4 content has become a potential pharmacological target to ameliorate glucose control, as also indicated by in vitro and in vivo studies with exogenous administration of different compounds, including the nucleoside 5-aminoimidazole-4-carboxamide ribonucleoside (aicar) [1319]. Notably, aicar is also a naturally occurring molecule, an intermediate in the purine de novo synthesis, which is metabolized by aicar transformylase, a folate - dependent enzyme which catalyzes the conversion of aicar to formyl - aicar, using 10-formyl tetrahydrofolate (thf) as donor of the formyl group . Methotrexate (mtx), an anti - inflammatory and immunosuppressive drug commonly used in several chronic inflammatory disorders such as rheumatoid arthritis [2022], is a non competitive inhibitor of aicar transformylase . The inhibition of this enzyme may lead to an upstream accumulation of aicar, which in turns determines an increase of adenosine-5-phosphate and adenosine levels, that are responsible for the anti - inflammatory and the potential atheroprotective effects of mtx [2428]. Thus, it has been shown that a 4-week treatment with intermittent low doses of mtx, comparable to those currently used to treat chronic inflammatory disorders, was associated with a severalfold increase of aicar concentration in splenocytes . In the present study, we tested the hypothesis that the same weekly regimen with low doses of mtx would increase skeletal muscle glut4 expression and improve glucose control in a mouse model of type 2 diabetes . These effects may be mediated by the mtx - related inhibition of aicar transformylase, leading to an upstream accumulation of aicar, which in turn may activate ampk and its downstream pathways regulating glut4 expression . The research was reviewed and approved by the institutional animal care and use committee of the university of messina . Genetically diabetic female c57bl / ksj - m / lept mice (db / db) and their normal littermates (db / m) were obtained from the jackson laboratory (bar harbor, meusa). Db / db mice are a genetic model of type 2 diabetes that display many of the characteristics of the human disease (including hyperglycemia, insulin resistance, and obesity) and a marked decrease in skeletal muscle glucose utilization . The animals were 14 weeks old at the start of the experiments . They were obese, weighing 4050 g, compared with their nondiabetic littermates, which weighed 2532 g. during the experiments, the animals were housed one per cage, maintained under controlled environmental conditions (12 hour light / dark cycle, temperature approximately 23c). Animals were provided with water ad libitum and a low - folic acid diet (td00434, teklad diets distributed by harlan laboratories, italy). Both diabetic and control animals were divided into four subgroups (7 animals each). The first (diabetic) and second (control) subgroups were given weekly intraperitoneal (i.p .) Injections (1 ml, using 1 cc syringe and 30 gauge needle) of mtx usp at the dose of 0.5 mg / kg body weight (mtx groups) for 4 weeks; the other two subgroups of diabetic and control mice were treated with pyrogen - free (usp) normal saline (0.9%) (vehicle groups) for 4 weeks . There were no apparent adverse effects with either treatments that could be detected by visual inspection . At the end of each treatment period, mice were anesthetized with ketamine hydrochloride (110 mg / kg), sacrificed, and the hindlimb skeletal muscles were removed, snap - frozen, and stored at 80c until analysis . Non - fasting blood samples for glucose and insulin assays were obtained from the retro - orbital plexus . Retro - orbital blood was drawn in the morning, twenty - four hours after the last mtx injection, promptly centrifuged, and serum was stored at 80c until analysis . Serum glucose concentration was measured by a glucose - oxidase method (biosystems s.a ., barcelona, spain), and serum insulin concentration was determined using a mouse insulin elisa kit (linco research, inc . Glut4 mrna content in hind limb skeletal muscle was measured according to the method reported by buhl et al . . The specific primers were glut-4 sense: ttc tgg ctc tca cag tac tc; glut4 reverse: cat tga tgc ctg aga gctgt; -actin sense: tgg aat cct gtg gca tcc atg aaa c; -actin reverse: taa aac gca gct cag taa cag tcc g. the pcr products were stained with ethidium bromide, loaded on agarose gel for electrophoresis, and visualized at uv light . Total glut4 protein content in hind limb skeletal muscle extracts was measured by western blotting technique, using specific monoclonal antibodies . The primary antibody was a rabbit affinity purified polyclonal anti - glut-4 (catalog number cbl243 from chemicon, temecula, ca, usa). Tissues were weighed and homogenized in 10 ml of ice - cold buffer containing 100 mm hepes ph 7.6, 150 mm nacl, 5 mm edta, 5 mm mgcl2, 1% triton x-100, and the following protease inhibitors 2 mm phenylmethylsulphonyl fluoride (pmsf), 5 mg / ml leupeptin, 1 mg / ml pepstatin, 1 mg / ml aprotinin, and the following phosphatase inhibitor 100 mm sodium orthovanadate, 10 mm sodium fluoride, 10 mm sodium pyrophosphate . The homogenate was centrifuged at 10000 g for 20 min at 4c, and the resulting supernatant was centrifuged at 9000 g for 20 min at 4c . The protein content of the final supernatant was determined by the bradford protein assay (bio - rad) using bsa standards . Protein samples (40 g) were denatured in reducing buffer (62 mm tris ph 6.8, 10% glycerol, 2% sds, 5% -mercaptoethanol, 0.0035 bromophenol blue) and separated by electrophoresis on an sds (12%) polyacrylamide gel . The separated proteins were transferred on to a nitrocellulose membrane using the transfer buffer (39 mm glycine, 48 mm tris ph 8.3, 20% methanol) at 200 ma for 1 h. the membranes were blocked with 5% nonfat dry milk in tbs-0.1% tween for 1 h at room temperature, washed three times for 10 min each in tbs-0.1% tween, and incubated with a primary glut-4 antibody (chemicon, temecula, ca, usa) in tbs-0.1% tween overnight at 4c . After being washed three times for 10 min each in tbs-0.1% tween, the membranes were incubated with a second antibody peroxidase - conjugated goat anti - rabbit immunoglobulin g (pierce) for 1 h at room temperature . After three times washing for 10 min each in tbs-0.15%, the membranes were analyzed by the enhanced chemiluminescence system according to the manufacture's protocol (amersham). The glut4 protein signal was quantified by scanning densitometry using a bioimage analysis system (bio - profil). The results from each experimental group were expressed as relative integrated intensity compared with control normal muscles measured with the same batch . The results were expressed as mean sd . Data were analyzed by unpaired student's t - test . When the number of groups analyzed was greater than two, analysis of variance was used . The level for statistical significance was set at p <0.05 . The effects of 4-week mtx or vehicle treatments on glut4 mrna and protein expression were compared in diabetic (db / db) and control (db / m) mice . Total glut4 mrna levels in db / m and db / db mice chronically treated with mtx or vehicle are shown in figure 1(a). Skeletal muscle total glut4 mrna levels were comparable between diabetic and control mice treated with vehicle . In db / db mice, mtx treatment was associated with a> 4-fold increase in glut-4 mrna content as compared to vehicle (p <0.01), whereas in db / m mice the difference between mtx and vehicle groups was not significant . As shown in figure 1(b), total glut-4 protein content in skeletal muscle was significantly lower in vehicle - treated db / db than in db / m mice (p <0.05). In db / db mtx - treated mice, there was a ~2-fold increase in total skeletal muscle glut-4 protein concentration as compared to those treated with vehicle (p <0.01), whereas the difference between mtx- and vehicle - treated groups was not significant in controls (db / m). Effects of mtx or vehicle on metabolic control were then evaluated in both groups (table 1). As compared to baseline values, db / db animals treated with mtx showed a marked reduction of glucose and insulin serum levels (p <0.001), whereas these differences were not statistically significant in the vehicle - treated group . Serum glucose and insulin concentrations did not significantly differ from baseline values after vehicle administration in controls (db / m) (table 1). In this group, mtx treatment was associated with a lower, though still significant, decrease of serum glucose levels (p <0.05), whereas insulin concentrations remained unchanged from baseline values . Furthermore, mtx treatment was associated with a significant reduction of insulin resistance (homair) in both diabetic db / db and control db / m mice (p <0.001), whereas this decrement was not significant in the vehicle - treated groups (table 1). In all the study groups, both daily food intake and body weight did not significantly change throughout the experiments (table 1). In the present study we tested the hypothesis that weekly low doses of mtx would increase skeletal muscle glut-4 expression and improve metabolic control in a mouse model of type 2 diabetes . This hypothesis was based on the fact that mtx is a noncompetitive inhibitor of aicar transformylase, the folate - dependent enzyme that metabolizes aicar to formyl - aicar [23, 26]. The hypothesis predicts that blockage of this enzyme will lead to the upstream accumulation of aicar, a well - known activator of ampk and of its downstream pathways, which regulates insulin - independent glut4 expression and glucose metabolism [31, 32]. Accumulated aicar is concerted to be converted in monophosphorylated nucleotide 5-aminoimidazole-4-carboxamide ribonucleotide (zmp), which is able to activate ampk, by mimicking the effects of amp . Short - term incubation of both cardiac and skeletal muscles with aicar has been demonstrated to rapidly increase ampk activity, to induce glut4 translocation on plasma membrane, and to stimulate glucose uptake [3335]. Moreover, long - term activation of ampk - dependent pathways, by endurance exercise or aicar chronic administration, has been shown to increase glut4 expression, both at the protein and the mrna levels [1519]. There is a good evidence that the level of glut4 expression in skeletal muscle influences total body glucose homeostasis [10, 11]. The impairment of glucose uptake by the skeletal muscle glut4 is a primary defect in type 2 diabetes [1, 3, 4]. Total glut4 concentrations in skeletal muscle have been demonstrated to correlate with muscle glucose uptake capacity and whole body glucose disposal . The selective disruption of glut4 transporter in mouse muscle results in a severe insulin resistance and glucose intolerance, whereas its overexpression ameliorates both glucose and lipid metabolism in transgenic mice . Moreover, the expression of the human glut4 gene in the same strain of mice used in our experiments also resulted in improved basal glucose control, together with an increase in insulin sensitivity . Our data suggest that glut4 expression can be induced by substances such as mtx that enhance the natural ability of cells to accumulate aicar . In our experiments, the increase of glut4 expression in db / db mice was associated with a marked decrease of both glucose and insulin concentrations, confirming that the level of expression of this transporter in skeletal muscle may be crucial for the regulation of total body glucose homeostasis and insulin resistance . Similarly, the increase of glut4 expression induced by chronic aicar administration was associated with a reduction of blood glucose levels and an improvement of the other features of the metabolic syndrome . These evidences suggest that the manipulation of glut4 expression by different means might be useful for ameliorating overall metabolic control in diabetes . Our results, demonstrating that mtx is able to increase glut4 expression and to improve glucose metabolism in diabetic animals, are in line with these observations . Notably, beside the effects mediated by glut4 expression on metabolic control, aicar accumulation may improve glucose levels also through a direct inhibition of gluconeogenesis . An in vitro study on isolated rat hepatocytes showed that aicar was able to inhibit the production of glucose from several gluconeogenic precursors, in a dose - dependent manner, probably because of the inhibition of fructose-1,6-bisphosphatase by zmp . Nevertheless, since mtx is able to influence several other enzymes not thought to control ampk activity, we cannot rule out the possibility that this drug might exert its effects on glucose metabolism also through mechanisms different from aicar accumulation . The anti - inflammatory properties of mtx may have helped to ameliorate the severity of diabetic pathology in our study, given the known involvement of inflammatory cytokines such as hscrp, il-6 in the development of insulin resistance, type 2 diabetes, and its long - term cardiovascular complications [40, 41]. Mtx can modulate the expression of these cytokines, and recent studies suggest that it may also have a beneficial effect on cardiovascular mortality, which is not observed with other antirheumatic drugs . Interestingly, nf - kb pathway seems to be involved in the hypoglycaemic effects of anti - inflammatory drugs, and mtx has been shown to suppress nf - kb activation . Furthermore, at the same doses used in our study, mtx improved diabetic nephropathy in another animal model of diabetes, through the inhibition of nf - kb pathway . To date, the potential antidiabetic effects of nf - kb suppression induced by different anti - inflammatory drugs are currently being tested in several clinical trials [4547]. Unfortunately, clinical data on the effects of mtx on glucose control are sparse and often influenced by the concomitant use of other drugs, such as corticosteroids . In a study on children with lymphoblastic leukemia (all), halonen et al . Reported that hypoglycaemia was among the side effects associated with high - dose mtx and 6-mercaptopurine (6mp), but this effect was related to a reduced supply of neoglucogenic substrates . Another small study in rheumatoid arthritis patients with type 2 diabetes reported that hydroxychloroquine determined a greater reduction of glucose control, as assessed by hba1c levels when compared to mtx, although these results were not adjusted for concomitant therapy with corticosteroids, that was more used in mtx patients . Conversely, another intervention study in subjects with new onset type 1 diabetes reported that a combination therapy of cyclosporine and mtx induced a temporary remission of the disease with a decrease of the required insulin doses . Although our study shows that mtx alone can improve glucose metabolism in animal model of type 2 diabetes and although mtx is widely prescribed as the main therapy for a number of chronic inflammatory disorders, its potential use for the chronic treatment of type 2 diabetes is not practical because of its toxicity and potentially harmful side effects . Nevertheless, our study suggests that targeting aicar transformylase or using compounds that enhance intracellular aicar production might be able to exert the same downstream effects of artificial aicar administration on skeletal muscle glut4 expression and glucose homeostasis . These findings open new perspectives, encouraging the search of other less harmful antifolates that, either by inhibiting aicar transformylase or by increasing aicar in vivo production, might have a potential application for the treatment of type 2 diabetes and other insulin - resistant conditions.
The pioneering studies of ramon y cajal demonstrated that injured neurons in the central nervous system (cns) have a strong capacity to extend new axons into the peripheral nervous system (pns; cajal, 1928). This observation was reinvestigated by aguayo and colleagues (richardson et al ., 1980; aguayo et al ., 1987) cajal (1928) described that motor axons that had been severed due to spinal cord injury had the capacity to regrow to neighboring ventral roots . This observation was later confirmed with electron microscopy and intracellular labeling with horseradish peroxidase (risling et al ., 1983; lind et al ., the regrowing axons penetrate through a highly unusual cns environment which lacks a blood brain barrier (bbb) function (risling et al ., 1989) but possesses a high content of cells bearing neurotrophin receptors (frisen et al ., 1992, 1998; risling et al ., 1992) and matrix molecules (risling et al ., 1993; deckner et al ., 2000 a clinical counterpart to this injury is a ventral root avulsion at the border between the cns and pns, typically caused by a high energy trauma such as a motorbike accident causing excessive trauma to the shoulder and head resulting in stretching and rupturing of ventral roots . Ventral root avulsion is not followed by spontaneous regrowth, since the avulsed roots are widely separated from the spinal cord inside the subarachnoid space or even pulled to a position outside the vertebral channel . Replantation of avulsed spinal ventral roots into the spinal cord has been shown to be enable significant and useful regrowth of motor axons in both experimental animals and in human clinical cases (carlstedt et al ., 1986, 1995, 2009; the results from such treatment in humans are less successful in older patients and good reinnervation in distal muscles like in the hand is seldom possible . In a recent case report (2009) described a preadolescent boy with complete brachial plexus avulsion injury that was treated by replantation of five ventral roots . Shoulder muscle recovery started 810 months after the spinal cord operation . At 1215 months, elbow function began to recover, followed 2 years postoperatively by forearm, wrist, and intrinsic hand muscle activity . Bilateral motor cortex activity and activation of the sensory cortex on use of the affected hand was demonstrated by fmri . The findings of that case study suggested that the restored hand function might rely on cortical sensory programs established before the injury (carlstedt et al ., 2009). Although the time needed for recovery seems very long, it cannot be excluded that the final result is dependent on several biological programs that are elicited in the early acute stage . Previous studies indicate that ventral root replantation can be neuroprotective for motoneurons (hoang and havton, 2006; eggers et al ., 2010). If so, how rapidly after the avulsion should surgical intervention take place? In this study we have performed a gene array in the acute phase with subsequent cluster analysis to evaluate whether this type of analysis may be used to identify time points for critical events after ventral root avulsion and replantation . Six adult sprague - dawley rats were anesthetized by isoflurane inhalation and the lumbosacral spinal cord was exposed . The left l5 ventral root was identified and avulsed by gentle traction of the root . In three of the animals after 24 h the animals were euthanized with 0.5 ml pentobarbital (40 mg / ml) and the inferior vena cava was cut open . The lumbosacral spinal cord was rapidly dissected out, meninges and rootlets removed . Thereafter the spinal cord segment l5 was immersed in rnalater (qiagen, crawley, west sussex, uk). Lumbar spinal cord specimens from three unoperated animals were collected and treated accordingly and used as controls . For microarray analysis, samples comprising the left ventral quadrant (lesion side) were used . Rna samples were analyzed at the karolinska institutet core facility for bioinformatics and expression analysis, where target preparation and hybridization to the microarray were completed . Rna was labeled with biotin to produce the final target according to affymetrix standard procedures . Each of the 27,342 genes are represented on the array by approximately 26 probes spread across the full length of the gene . This 700,000 unique 25-mer oligonucleotide design is supposed to provide an accurate picture of gene expression . After probing and scanning, following normalization, the change in gene expression between the three controls, the three avulsed, and the three avulsed and replanted rats was compared using an unpaired t - test and fold change values . Lists of genes that passed the selected significance level were uploaded to the database for annotation, visualization, and integrated discovery (david) for functional annotation and detection of enriched functional - related gene groups and enriched biological themes, particularly go terms (dennis et al ., 2003; huang da et al ., 2009). A schematic representation of the employed experimental methods . Thus, about 30,000 transcripts were analyzed in the three groups (replanted, avulsed only, and controls). The material was evaluated with regard to signal intensity and fold change (signal ratio in cross comparison tests). P - values for the three intensity values for each gene in each group were calculated . Around 2000 genes in each comparison (replantation vs avulsion; replantation vs control; avulsion vs control) had a p - value of stronger than <0.05 . The aim of the study was to perform a broad comparison of biological themes, based on a comparison of the about 2000 genes in each group that had a strong p - value . It would therefore be difficult to validate the findings by examination of individual genes . Instead, the lists of significantly regulated genes from each group were evaluated with the aid of the david . It was possible to group responding genes into functional - related gene groups (go gene ontology search terms). All significantly regulated genes, both up- and down - regulated, were used in this part of the analysis in order to identify the most actively regulated go families . Distinctive profiles for each of the examined conditions were apparent when the families of genes related to development, differentiation, inflammatory response, apoptosis, neurogenesis, and synaptic transmission were compared . For example, a number of genes related to neurogenesis were found to be up - regulated in animals subjected to avulsion combined with replantation (figure 2). A distinct change in expression of genes related to synaptic transmission and conduction of nerve impulses was also observed in the replanted animals, but not after avulsion only . A diagram illustrating the number of significantly regulated genes in selected categories after avulsion and avulsion plus replantation . The x - axis indicates the number of genes that have undergone significant changes in expression . The number of cell death genes is similar in the two groups, while genes related to neurite development and neurogenesis show a much more prominent response after replantation than after avulsion only . The differences were also assessed by cluster analysis of enriched biological themes, including pathways . The enrichment score is based on the mean value of the log of the p - values (easescore) for the members in that cluster . A cut - off value of 2.0 was used, which corresponds to a p - value <0.01 . Thus, a higher enrichment score value indicates a low p - value and therefore means that the cluster is significant . The most enriched clusters (most significantly regulated) observed after replantation were related to development and differentiation as well as synaptic transmission (table 1). Avulsion injury only, induced large shifts in genes related to inflammation, signal transduction, and proliferation (table 2). Enriched themes in a comparison between replantation and avulsion were development / differentiation and synaptic transmission (table 3). Replantation vs control . Cluster analysis of regulated genes, employing the database for annotation, visualization, and integrated discovery (david). It was possible to group responding genes into functional - related gene groups (go gene ontology search terms) and cluster analysis of enriched biological themes . The enrichment score is based on the mean value of the log of the p - values (easescore) for the members in that cluster . A cut - off value of 2.0 was used, which corresponds to a p - value <0.01 avulsion vs replantation . A cluster analysis of the response to avulsion compared to the response to replantation after avulsion . . However, the interaction between the motoneurons and the environment appears to be very complex . The outcome of untreated ventral root avulsion may be paralysis, loss of sensory function, and neurogenic pain . Clinical studies show that replantation with subsequent motor reinnervation can reduce neuropathic pain as well (htut et al ., 2006). The replantation will result in a limited but unavoidable spinal cord injury as well as disruption of the bbb (sjgren et al ., 1991). ., 2001, 2002, 2004) that have been observed after lesions in the ventral funiculus can be assumed to occur also after this type of lesion . The replantation is performed to the lateral aspect of the spinal cord, a position more accessible for surgery than the ventral funiculus . It has been shown that regrowing axons are capable of finding a new route inside the spinal cord and navigate to the replanted root (cullheim et al ., 1989), while other axons use the pia mater as a conduit to enter the replanted root (risling et al ., 1991). It seems possible that the replanted ventral root, with its reactive schwann cells, may have a trophic and neuroprotective effect on injured motoneurons . Previous studies indicate that ventral root replantation can be neuroprotective for motoneurons (hoang and havton, 2006; eggers et al ., 2010). Thus, replantation appears to elicit a number of important events in the spinal cord that may be partly beneficial with respect to regrowth to the replanted root . The acute changes in gene expression that were detected in the present study should therefore be assumed to be related to the initiation of a large number of biological changes that occur after this type of injury and surgery . Important themes that were affected were related to neurite growth, cell death, inflammation, and synaptic transmission . Micro arrays have been employed to identify changes in gene expression after ventral root avulsion (hu et al ., 2002; yang et al ., 2006). (2002) revealed increases in the expression of genes coding for proteins involved in the apoptosis cascades, as well as decreases in expression of genes related to energy metabolism, transporter proteins, ion channels, and receptors . It was also shown that cathepsins, metalloproteinases, and proteasome - related protein products were highly up - regulated in motor neurons following axotomy . (2006) showed a decreased expression of genes that are known to facilitate neuronal survival and axonal regeneration . Careful mapping of gene regions regulating neurodegeneration has revealed that the gene response linked to neurodegeneration after avulsion is closely related to t cell infiltration and major histocompatibility complex class ii expression on microglia (lidman et al ., 2003; (2005): during the first few days following the injury, a first phase of microglial activation can be detected . This is paralleled by a sparse lymphocyte infiltration and commencing death of axotomized cells . During the second and third post - operative these studies have generated important data relevant for understanding of how degeneration of motoneurons is initiated following avulsion injury . The present study, however, is to our knowledge the first direct comparison of the response to avulsion and replantation based on micro arrays with aid of cluster analysis . The results suggest that this type of gene ontology comparison can be a powerful and effective way to deal with the complex information that is generated by micro arrays . The data of the present study show that the number of regulated genes related to neurite formation is much higher in the replanted animals, whereas the number of regulated cell death genes is similar in the two situations . Our data suggest that the inflammatory response is more prominent in animals subjected to avulsion without replantation . These data indicate that the axonal regenerative response from replantation is initiated at an earlier stage than possible differences in neuroprotective effects . Inflammatory changes that may precede degeneration seem be more pronounced already at 24 h in the animals subjected to avulsion only, although infiltration with t cells, other lymphocytes, and macrophages has not reached a maximum at this stage (cf . Thus, this part of the inflammatory response may be dependent on resident cells, such as microglia . It should also be pointed out that a regulation of genes for inflammatory molecules may relate to events that not are regarded as a component in the classical inflammatory response . For example the complement cascade molecule c1q has been shown to function as a molecular tag for synaptic removal . . However, microglia, the resident immune cells of the brain, produce large amounts of the receptors for c1q and c3 and thus are likely to be responsible for the removal of unwanted synapses (eroglu and barres, 2010). It should not be excluded that similar mechanisms could be activated during the early stage following ventral root avulsion and could be involved in the removal of excitatory glutamate synapses (lind et al ., 2000). In a recent study we have observed differences between rotational and penetrating brain injuries with the same type of gene arrays and gene ontology analysis (risling et al . Interestingly, the regenerative response that was observed in the present study after replantation could not be detected 24 h after a penetrating brain injury (risling et al . It is concluded that this type of gene expression analysis can be of value for the examination of time points for critical events after neurotrauma and that the events after a superficial lesion in the spinal cord has some differences compared to a superficial lesion in the brain . We suggest that gene ontology can be a valuable tool that can be used to establish the time window for a delayed ventral root replantation, since the method seems capable to detect important differences between a regenerative and a non - regenerative response . The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
United nations estimated that, in 2006, the number of elderly people in the world was 678,923,000, which is expected to increase to 1,968,153,000 by 2050 . In iran, the population is moving toward senility . According to the latest statistics of population census in 2011, lifestyle modification and paying attention to quality of life could significantly increase functionality and independence of the elderly and help them control multiple complications of aging and their different treatments . On the other hand, moving to a nursing home is considered to be one of the most stressful events of an individual's life and is usually accompanied with depression, anxiety, insomnia, and attempted suicide . According to corbin and strauss (1988), despite enhancement of living condition in the new residence, seniors who were forced to move to a nursing home would experience more cardiovascular diseases and strokes and would refer to hospitals more than those who did not move to a nursing home . Depression and anxiety are the most common mental problems among the elderly and mostly remain undiagnosed or untreated, affecting the elderly's quality of life and increasing their living expenses . Different studies have mentioned that seniors living in nursing homes have poorer health condition than those living with their families . For example, in a study conducted by momeni et al . To compare the general health of residents of nursing homes and nonresidence elderlies, 254 seniors were evaluated using general health questionnaire-28 (ghq-28). Results showed that the residents of nursing homes experienced more depression, physical, and social dysfunction symptoms than nonresidence seniors . Health is a multidimensional matter in a way that individual's physical problems affect their mind and their mental problems affect their body and both of these would affect the society and social disorders would affect other aspects of health . Therefore, health improvement measures must consider all the aspects of personal (physical, mental, and spiritual) and general health of the society . Health education has a key role in most of health improvement interventions by focusing on training people to participate in self - care activities, which provides a background for prevention . One of the most important methods for compatibility with old age and having a healthy and successful life is general and professional training for the elderly and their families regarding the needs and problems of old age using different educational tools . The trainer nurse, first, determines the special learning needs of the target population, and then prepares an appropriate philosophical view for providing those learning needs; considers educational principles that could increase learning; evaluates educational issues such as the target group's special concerns, obstacles to learning, and appropriate technological strategies to facilitate the learning process; designs and executes the educational program; and eventually assesses the effect of the educational program on learning and behaviors . In a study conducted by badertscher et al . In 2012 in switzerland to evaluate the approaches, barriers, and facilitators of elderly health improvement in general practitioners opinion as a focused group study and through interviews results showed that two of the most important perceived barriers by this group concerning the elderly health improvement were lack of time and inadequate reimbursement for following preventive and health improvement recommendations . In their opinion, one of the interventions that could be performed to improve the health of the elderly is involving nurses in health improvement and consultation interventions, which was widely discussed by the case group . According to imhof et al ., self - care programs and ability to manage the disease, that must be executed for patients with special diseases such as diabetes or cardiovascular diseases, have desirable results in the community and health care centers . Nowadays, authorities have realized that to reach an active and healthy old age all the aspects of physical, mental, social, economic, and spiritual heath must be considered, and since most of the diseases and problems of old age are due to unhealthy lifestyle, the basics of health in these aspects must be determined by using the right methods and improving the quality of life from the very first stages of life . Considering all the abovementioned concerns, most of the studies in the field of elderly health have been evaluations and less attention has been paid to educational interventions during old age based on the needs assessment of the trainees . Therefore, community health nursing, which is one of the most important pillars of the health team for community health improvement, must apply appropriate measures including educational interventions, which is one of the most important health improvement tools, to reach this goal . Lack of information regarding elderly health education based on their needs assessment that has been conducted through interviewing them and their caregivers, elderly's special educational needs about their health condition (which is the same as general health meaning physical, mental and social health of the elderly), and also the need for paying more attention to residents of nursing homes due to their undesirable living conditions compared to nonresidence elderly, led us to conduct a study to evaluate the effect of need - oriented education on the general health of seniors living at nursing homes . This is a semi - experimental study that evaluated the effect of independent variable of need - oriented educational intervention on dependent variable of general health score in the case group . In both the case and control groups, this study was conducted at the sadeghieh nursing home of isfahan, after obtaining permission from the ethics committee of isfahan university of medical sciences and written informed consent form from the participants . It must be noted that this center was selected as the study environment due to its availability and large number of residents . The inclusion criteria were than 60-year - old individuals, being familiar with farsi language, having the intellectual ability to understand the contents and physical ability to participate in sessions, having motivation for participating in educational sessions, and being able to at least read and write . The exclusion criteria were not participating in sessions for any reason, participant's death or sickness during the intervention, and missing more than 3 sessions . In the beginning, a pilot study was conducted to assess the educational needs . For this pilot study, after interviewing the senior manager of the center, 2 personnel (care givers) and 10 elderly who satisfied the inclusion criteria, educational need assessment was conducted . Need assessment was conducted using agreement assessment technique, which is a standard method for need assessment that starts with an open answer question such as if you were supposed to be educated about your health issues, what were the subjects you would like to learn? After interviewing center's management, staff, and residents regarding health education for residents of the nursing home (educational needs that are rooted in behavioral factors of the elderly, that could be said are the same as their health problems) 5 educational needs that had the most repetition among problems and proposed needs were selected . At the second stage, for prioritizing the selected needs, each of the participants were asked to give a score from 1 to 5 to each of the selected needs . Then, by summing up all the numbers, the needs were prioritized as follows: (1) musculoskeletal pains and physical inactivity, (2) chronic diseases (high blood pressure, diabetes, and alzheimer), (3) undesirable mental health, (4) poor nutrition, and (5) inappropriate personal health . Considering the pilot study, the educational program was designed to educate the elderly about their health needs which was assessed at the need assessment stage . For reaching the abovementioned educational objectives, eight 1-hour sessions were conducted for teaching the educational content according to the developed educational needs of the elderly . At each session, 15 minutes were allocated to physical exercises and 45 minutes were for lectures and discussions about the subject of the session . All the participants were obliged to do the physical exercise and take part in discussions . For better learning and more effectiveness of the training, the elderly were divided into four groups (two groups of women and two groups of men). Then, 70 seniors who satisfied the inclusion criteria (with their written consent forms) were selected through simple sampling . For data collection, a two - part questionnaire including demographic characteristics of the participants (age, sex, marital status, educational level, duration of living at the nursing home, and underlying diseases) and ghq-28 was used before and after the educational intervention . This questionnaire has 28 questions and evaluates four subscales of somatic symptoms, anxiety, social impairment and depression, pathological symptoms, and positive moods and wellbeing for an individual from 1 month prior to the intervention up to the time of the intervention . Each choice has a score from 0 to 3, and in total the least score could be 0 and the highest score could be 48 . This questionnaire evaluates four dimensions of physical health, anxiety, social functioning, and depression in the participants . According to the study of noorbala et al ., the cut - off point for the total score of this questionnaire is 23, implying that the score of 23 and less indicates healthy individual and higher scores refer to possible disorders . Ghq-28 is a standard tool that has been used by different researchers in many different studies, and its reliability has been reported to be 7895% . Selected participants were assigned into two groups of case and control by random allocation . It must be noted that physical exercises were conducted by the researcher who was trained by a physical education expert and the moves were approved by a specialist . During the intervention, the control group received the usual care and a booklet containing the educational content that was discussed at the sessions for the case group . After all the sessions ended, ghq28 was completed by both the groups 1 week and 1 month after the intervention, and the mean scores of general health before and 1 week and 1 month after the intervention were compared to each other between both groups and for each group separately . Regarding the 1-month interval between evaluations of general health, it must be noted that this interval was to evaluate the durability of the training . Other studies that have used the same questionnaire also had a time interval between evaluations; in some studies, the interval was 2 months, in some 1 month, and in some other 1.5 month . Because in the present study we were dealing with some sort of behavioral change, the participants must have had enough time to exercise the training, and if they would be applied correctly, they could increase the level of general health . Data was analyzed using the statistical package for the social sciences (spss inc ., chicago, il, usa) and through independent t - test, paired t - test, chi - square test and mann whitney test . At each session, 15 minutes were allocated to physical exercises and 45 minutes were for lectures and discussions about the subject of the session . All the participants were obliged to do the physical exercise and take part in discussions . For better learning and more effectiveness of the training, the elderly were divided into four groups (two groups of women and two groups of men). Then, 70 seniors who satisfied the inclusion criteria (with their written consent forms) were selected through simple sampling . For data collection, a two - part questionnaire including demographic characteristics of the participants (age, sex, marital status, educational level, duration of living at the nursing home, and underlying diseases) and ghq-28 was used before and after the educational intervention . This questionnaire has 28 questions and evaluates four subscales of somatic symptoms, anxiety, social impairment and depression, pathological symptoms, and positive moods and wellbeing for an individual from 1 month prior to the intervention up to the time of the intervention . Each choice has a score from 0 to 3, and in total the least score could be 0 and the highest score could be 48 . This questionnaire evaluates four dimensions of physical health, anxiety, social functioning, and depression in the participants . According to the study of noorbala et al ., the cut - off point for the total score of this questionnaire is 23, implying that the score of 23 and less indicates healthy individual and higher scores refer to possible disorders . Ghq-28 is a standard tool that has been used by different researchers in many different studies, and its reliability has been reported to be 7895% . Selected participants were assigned into two groups of case and control by random allocation . It must be noted that physical exercises were conducted by the researcher who was trained by a physical education expert and the moves were approved by a specialist . During the intervention, the control group received the usual care and a booklet containing the educational content that was discussed at the sessions for the case group . After all the sessions ended, ghq28 was completed by both the groups 1 week and 1 month after the intervention, and the mean scores of general health before and 1 week and 1 month after the intervention were compared to each other between both groups and for each group separately . Regarding the 1-month interval between evaluations of general health, it must be noted that this interval was to evaluate the durability of the training . Other studies that have used the same questionnaire also had a time interval between evaluations; in some studies, the interval was 2 months, in some 1 month, and in some other 1.5 month . Because in the present study we were dealing with some sort of behavioral change, the participants must have had enough time to exercise the training, and if they would be applied correctly, they could increase the level of general health . Data was analyzed using the statistical package for the social sciences (spss inc ., chicago, il, usa) and through independent t - test, paired t - test, chi - square test and mann whitney test . For this study among 320 seniors living at the sadeghieh nursing home, 70 who satisfied the inclusion criteria were selected through simple sampling and were randomly allocated to two groups of 35 participants in each group . Lost samples until the end of the study were one from the control group and two from the case group; hence finally, analysis was conducted among 33 participants of the case group and 34 participants of the control group . The mean age of the case and the control group was 74.2 and 76.2 years, respectively . In the case group, 16 were females (48.5%) and 17 were males (51.8%), and in the control group, 15 were females (44.1%) and 19 were males (55.9%). The mean duration of living at the nursing home was 2.2 years in the case group and 2.4 years in the control group . Regarding marital status, 6 were single, 17 were married, 40 were widowed, and 4 were divorced . According to table 1, independent t - test showed no significant difference between the mean of age and duration of living at the nursing home of both the groups . Chi - square test showed no significant difference between the frequency of sex and marital status in both groups . Chi - square test also showed no significant difference between the frequency of underlying diseases in both the groups . Whitney test showed no significant difference between the educational level of both groups . Comparing the mean (standard deviation) of age, duration of living at nursing house, and the frequency (percent) of sex and marital status in the case and the control group according to table 2, variance analysis with repeated observations showed a significant difference between the mean score of general health at three different time intervals for the case group (p <0.001), however, this difference was not significant for the control group . According to table 3, independent t - test showed no significant difference between the mean score of general health of both groups before the intervention, however, 1 week and 1 month after the intervention, the difference between the mean score of general health of both groups showed a significant difference (p <0.001). Variance analysis with repeated observations showed no significant difference between the mean score of general health at three time intervals in the control group, however, this difference was significant in the case group (p <0.001). In addition, independent t - test showed that the mean of changes in total score of general health of the case group 1 week and 1 month after the intervention compared to the score before the intervention was significantly more than the control group (p <0.001). Comparing the mean score of general health in different aspects between the case and the control group before and 1 week and 1 month after the intervention comparing the mean score of general health between the case and the control group before and 1 week and 1 month after the intervention results of this study confirmed the theory that need - oriented educational interventions have positive effects on general health of the elderly living at the sadeghieh nursing home of isfahan . In line with the results of the present study, gharamani et al . In 2009, in their study titled improving the quality of life of the elderly men living at kahrizak nursing home based on educational intervention, showed that educational intervention had a positive and significant effect on improvement of quality of life in elderly men (p <0.05). With regard to the methods and results of this study, educational needs of the elderly were achieved by analyzing the quality of life questionnaire before the intervention, however, in the present study, need assessment was conducted by interviewing the participants, the managers and staff of the center; this method provides a more comprehensive view of educational needs as well as the problems of the residents of the nursing home . In addition, educational planning based on this type of assessment, because it is based on the needs of the target population and the subjects that they have declared they need, could have a more desirable effect on health improvement; however, in the study by ghahramani et al . Educational intervention had a positive and significant effect on the improvement of quality of life in the elderly men too . Also ghahramani et al . Only studied the elderly men but in the present study elderly women were included too and this could make the results more generalizable . However, in the present study, considering the differences between the needs of men and women, common needs that were confirmed by the elderly themselves were selected . In the study of mortazavi titled the effect of regular physical exercise on mental health of the elderly of shahrekord results showed a significant reduction in the score of general health after the intervention in the case group compared to their score before the intervention . On the other hand, mortazavi et al . In their study showed that, although physical exercise had a positive effect on the mental health, it was not effective on anxiety, depression, and stress . The present study was specifically conducted on the residents of the nursing home, and the educational intervention included both physical exercises and lectures and discussions regarding their pre - determined needs and health problems, and results showed that need - oriented educational intervention could affect all the aspects of general health toward improvement . As it was mentioned before, a trainer nurse, by evaluating the educational needs of the target population in different aspects of health including physical, mental, and social would prepare a special educational protocol for individuals considering their facilities and conditions, and therefore, it could be said that the odds of reaching desirable results are higher . Moreover, it could be said that, in the present study, conducting physical exercises in groups and providing a place and time for the elderly to have more social interaction with each other could have been effective on their mental health . In the study by yumin et al . In 2011 titled the effect of functional mobility and balance on the health - related quality of life in the elderly living at home and living at nursing homes in turkey, results showed that balanced training in elderly care and rehabilitation programs could improve functional independence and increase health - related quality of life . According to the results of this study, it could also be said that regular physical exercise has a positive effect on enhancement of physical functioning, and consequently improvement health level in every aspect, i.e., physical, mental, and social . As shown in the present study, educational intervention, of which physical exercise was an important part of it, could have improved the level of general health in the elderly in its all the four fields . On the other hand, these physical exercises were simple and practicable moves for the elderly that were chosen from the physical exercises recommended by ministry of health and mentioned in guidebooks for improving healthy lifestyle in old age, as well as by the instructions of a physical education specialist . Furthermore, practicing physical exercises in groups, due to their entertaining atmosphere, would give the elderly more motivation for taking part in physical activities . Clark et al ., in 2011, conducted a clinical trial in america titled the effect of lifestyle interventions on the health improvement of seniors living independently . The results revealed that the case group showed more desirable changes than the control group regarding their scores of pain, vital signs, social functioning, mental health, satisfaction with life, and depression symptoms . Therefore, it could be concluded from the results that, since this program is cost - effective and applicable on a large population, by performing such programs physical and mental health of the elderly could be improved . Results of the present study showed that group interventions could have improved health level and quality of life in the elderly . As mentioned before, moving to a nursing home is considered as one of the most stressful events of an individual's life . Many studies have shown that living environment of the elderly is an important and effective factor in their health and longevity . Many studies have revealed higher levels of mental health among the elderly living with their families compared to those living in nursing homes . Momeni in their study reported that the mean score of general health of the elderly residents of nursing homes in all the 4 subscales was higher than those who were living among the community . In addition, ghasemi in their study revealed that the mean score of quality of life in the elderly living with their families was higher than those living at nursing homes . According to the results of the present study, it could be said that training based on need assessment from the target population, because it evaluated all the health aspects including physical, mental and social, and educational program has been designed based on that could have more effect than usual training . Therefore, need - oriented education, which is one of the most important roles of community health nursing, could be one of the effective, safe, and inexpensive methods for improving the general health and preventing the complications of senescence and diseases of the old age among the residents of nursing homes.
The online version of this article (doi:10.1007/s13539 - 011 - 0027 - 5) contains supplementary material, which is available to authorized users . Cachexia is a term originating from the greek: kakos and hexis meaning bad condition . The cachectic state is observed in many pathological conditions such as cancer, chronic obstructive pulmonary disease (copd), sepsis, or chronic heart failure . For several years, it has been considered essential to develop a standardized definition of cachexia . This represents a key issue for treatment, for reimbursement, and for inclusion and exclusion from clinical trials . The definition and diagnostic criteria must be clear on the identification of the early signs . Also a key point, the definition must include an appreciation that cachexia is found in a number of life - limiting illnesses that the management of this syndrome in end - of - life must be facilitated, albeit that this is not done the same way as in earlier stages . A group of international experts who met in washington dc (usa) in december 2006 for an international consensus meeting organized by the society for cachexia and wasting disorders stated: cachexia is a complex metabolic syndrome associated with underlying illness and characterized by loss of muscle with or without loss of fat mass . The prominent clinical feature of cachexia is weight loss in adults (corrected for fluid retention) or growth failure in children (excluding endocrine disorders). Anorexia, inflammation, insulin resistance and increased muscle protein breakdown are frequently associated with wasting disease . Wasting disease is distinct from starvation, age - related loss of muscle mass, primary depression, malabsorption and hyperthyroidism and is associated with increased morbidity . Very recently, a consensus on this one and other cachexia definitions [3, 4] has been reached and published . The consensus group reached two basic conclusions: (1) there is a need to incorporate the term pre - cachexia as a condition associated with no or very small weight loss (less than 5% of body weight loss in 6 months) which is associated with underlying chronic disease and characterized by anorexia, inflammation, and/or metabolic alterations . Clearly, the pre - cachectic population will be very heterogeneous, with some patients progressing rapidly but others remaining weight - stable . The development of suitable clinical identifiers or biomarkers to map out the different cohorts will be an area of intense interest; (2) some type of cachexia staging or score is essential to be able to classify patients according to the severity of the syndrome . The classification domains (phenotyping) of patients could comprise of measures of whole body and lean body mass loss, catabolic drivers (including immune and inflammatory response), anorexia, quality of life, and physical performance . Bearing all this in mind, the object of the present study is to fulfill the existing gap in the classification of cachectic cancer patients by introducing a new score that takes into consideration the stated parameters . In spite of the existence of different cachexia definitions and consensus, cachexia is infrequently diagnosed . This is, in part, due to the lack of clear standardized cachectic markers . Some of the criteria used in the past include weight loss, decreased physical performance, fatigue, anorexia, and metabolic alterations . The group of investigators who met in washington concluded that cachexia can be diagnosed in the following way: a weight loss of at least 5% or more in 12 months or less in the presence of underlying illness, plus three of the following criteria: decreased muscle strength, fatigue, anorexia, low fat - free mass index, abnormal biochemistry (increased inflammatory markers (c - reactive protein> 5.0 mg / l), il-6> 4.0 pg / ml), anemia (<12 g / dl), and low serum albumin (<3.2 g / dl)). However, other diagnostic tools should not be discarded, such as decreased physical performance (total activity, handgrip strength, stairs climb, or 6-min walk distance) or biochemical tissue analysis (activation of proteolysis or apoptosis in skeletal muscle biopsies). As already stated above, in addition to clear and objective diagnostic criteria, an essential requirement for both clinical trials and patient treatment is a staging system that allows for classification of the cancer patients according to the severity of the cachectic syndrome . Such a staging system would be beneficial not only for assessing the severity of the syndrome but also to decide the type of treatment . The result is the newborn cachexia score (casco) which, by means of a numerical scale, classifies cachexia into mild (025), moderate (2650), severe (5175), and terminal (76100). It is therefore clear that the higher the score, the worst the syndrome (table 1). Table 1casco staging scalebwc body weight loss and composition, imd inflammation / metabolic disturbances / immunosupression, php physical performance, ano anorexia, qol quality of life bwc body weight loss and composition, imd inflammation / metabolic disturbances / immunosupression, php physical performance, ano anorexia, qol quality of life the main components of casco are: body weight loss and composition, inflammation / metabolic disturbances / immunosupression, physical performance, anorexia, and quality of life . Indeed, body weight loss and composition is an essential component of all definitions of cachexia . It is by far the most important requirement, in addition to the presence of an underlying disease such as cancer, copd, chronic infection . However, and due to the fact that both loss of muscle and fat tissue coexist in the cachectic patient, it is also important to assess any changes that may occur in relation with lean body mass . From this point of view, a decrease in lean body mass in the cachectic patient represents impaired physical performance and therefore quality of life, weight changes may just give an idea of survival . Indeed, some authors claim that fat is associated with survival while skeletal muscle is associated with loss of quality of life . In the casco, lean body mass modulates the importance of body weight loss (table 2). Body weight loss and composition accounts for up 40% of the cachexia score (table 2). Table 2the cachexia score (casco): a new tool for staging cachectic patientssymptompercentmeasurementtotal pointsparametervaluesbwc40body weight loss32<5%5%, mild10%, moderate15%, severe20%, terminallean body mass8no change in lbmloss of lbm> 10%imd20inflammation8plasma crp5 mg / l crp 10 mg / l10 mg / l <crp 20 mg / lcrp> 20 mg / lplasma il64 pg / ml il6 10 pg / ml10 pg / ml <il6 30 pg / mlil6> 30 pg / mlmetabolic disturbances8plasma albumin<3.2 g / dlplasma pre - albumin<16 mg / dlplasma lactate>2.2 mmplasma triglycerides>200 mg / dlanemiahb <12 g / dlplasma urea>50 mg / dloxidative stress: ros plasma levels>300 fort uglucose tolerance test or homa indexalteredimmunosupression4il2 levels>500 pg / mlperipheral lymphocytes: proliferation assay or skin hypersensitivity testpositivephp1515total activityphysical performance, questionnaire, or monitoringhandgrip strengthstairs climb6-min walk distanceano1515simplified nutrition assessment questionnaireyesqol1010quality of life questionnairemildmoderateseverebwc body weight loss and composition, imd inflammation / metabolic disturbances / immunosupression, php physical performance, ano anorexia, qol quality of life 2010 copyright by the authors; licensee university of barcelona, barcelona, spain . From: josep m. argils, francisco j. lpez - soriano, mriam toledo, roberto serpe and slvia busquets the cachexia score (casco): a new tool for staging cachectic patients bwc body weight loss and composition, imd inflammation / metabolic disturbances / immunosupression, php physical performance, ano anorexia, qol quality of life 2010 copyright by the authors; licensee university of barcelona, barcelona, spain . From: josep m. argils, francisco j. lpez - soriano, mriam toledo, roberto serpe and slvia busquets the second component of casco is inflammation / metabolic disturbances / immunosupression (imd). Indeed, inflammation is a very important component of the cachectic response . Studies in pancreatic cancer patients clearly demonstrate an inflammatory response characterized by increased levels of acute phase proteins (such as c - reactive protein (crp)) and cytokines (such as il-6). Other studies involving cachexia in pathological conditions other than cancer also suggest the importance of the inflammatory response . In addition to inflammation, there are a number of metabolic disturbances that are present in most of the cachectic patients; such disturbances include glucose intolerance, anemia, and low levels of plasmatic albumin, among others . Finally, immunosupression might be an early marker of cachexia; therefore, assessment of the immune response could also be a good indicator for a cachexia staging system . Indeed, even if there is a relative small decrease in muscle mass due the cachectic syndrome, there may be a significant decrease in physical - related activities which are related to muscle performance [10, 11]. Physical performance accounts for up 15% of the cachexia score (table 2). A decrease in food intake, by itself, promotes changes in quality of life and also conditions with many metabolic alterations . Anorexia accounts for up 15% of the cachexia score (table 2). Finally, the last component of casco is quality of life . Indeed, quality of life reflexes are not just changes in weight and physical performance but also in metabolic alterations [11, 13]. Quality of life accounts for up 10% of the cachexia score (table 2). It is clear that the five different factors mentioned clearly interact with one another and represent the most important set of variables that might indicate the severity of cachectic syndrome . All of these can be carried out either with physical or biochemical tests together with the relevant questionnaires to be filled by the patients with or without sanitary assistance . In addition to weight determination, lean body mass can be measured using either bioelectrical impedance analysis (bia) [14, 15] or dual x - ray absorptiometry (dexa) [15, 16], although the latter is preferred . Concerning inflammation, both crp and il-6 the same applies for albumin, pre - albumin, lactate, triglycerides, hemoglobin, and urea . Decreases in plasma albumin have been related with the severity and the prognosis of different cachectic states . Elevations in plasma triglycerides are a common trend in catabolic conditions related with cachexia . In the case of lactate, elevations in this marker are very frequent in cancer patients but also indicative of the acidosis present in other types of catabolic states . Concerning hemoglobin, anemia is often a condition associated with cachexia, particularly in cancer . Plasma urea, to some extent, reflects nitrogen catabolism and is therefore included in the list . More time - consuming is the determination of glucose tolerance; however, this can be replaced by assessing the homeostasis model assessment (homa index), and finally, and to some extent, though not a normal clinical routine, is the determination of reactive oxygen species (ros) plasma levels . Oxidative stress is clearly associated with cachexia, particularly in cancer [22, 23]. It is for this reason that we have included a simple method for the determination of plasma levels of ros [24, 25]. In order to estimate immunosupression, in addition to the cytokine measurement, a peripheral lymphocyte proliferation assay will be undertaken since this is a very indicative measurement of immune response . This is particularly important since a previously stated immunosuppression may appear before any weight loss takes place . Concerning physical performance, standard measurements for total activity, handgrip strength, stairs climb, or 6-min walk distance [32, 33] will be undertaken (tables 2 and 3). We have to take into consideration the fact that monitoring will only be possible after diagnosis; therefore, we have included a physical performance questionnaire which will be used at the moment of diagnosis in order to be able to use this parameter in the staging of the cachectic patient (table 3, questionnaire). Table 3physical performancephysical performance staging of a cachectic patientquestionnaire (during the past week) have you noticed any particular decrease in the physical activities (i.e., at work, at home, at leisure, etc .) That you normally carry out during the day? Have you had any problems doing strenuous activities, like carrying a heavy shopping bag or a suitcase? Have you felt tired after walking approximately half a kilometer?monitoring total physical activity grip force stair - climb 6-min walk distanceadapted from eortc qlq - c30 (version 3) copyright 1995 eortc study group on quality of lifemonitoring will take place at the same moment as the questionnaire is filled, normally at the time of diagnose . The very first calculation of the cachexia score will use the values from the questionnaire . Subsequent calculations will use the monitored values of the items under monitoring adapted from eortc qlq - c30 (version 3) copyright 1995 eortc study group on quality of life monitoring will take place at the same moment as the questionnaire is filled, normally at the time of diagnose . The very first calculation of the cachexia score will use the values from the questionnaire . Anorexia will be estimated using a standard questionnaire (simplified nutrition assessment questionnaire (snaq); table 4). Table 4anorexia questionnairesimplified nutrition assessment questionnaire (snaq)my appetite is a. very poor b. poor c. average d. good e. very goodwhen i eat a. i feel full after eating only a few mouthfuls b. i feel full after eating about a third of a meal c. i feel full after eating over half a meal d. i feel full after eating most of the meal e. i hardly ever feel fullfood tastes a. very bad b. bad c. average d. good e. very goodnormally i eat a. less than one meal a day b. one meal a day c. two meals a day d. three meals a day e. more than three meals a daypoints are assigned for the patient s answers as follows: a = 1, b = 2, c = 3, d = 4, e = 5 . The sum of the scores for the individual items constitutes the snaq score anorexia questionnaire points are assigned for the patient s answers as follows: a = 1, b = 2, c = 3, d = 4, e = 5 . The sum of the scores for the individual items constitutes the snaq score concerning quality of life, the questionnaire is presented in table 5 . It has been adapted from eortc qlq - c30, where questions related to physical performance or food intake have been withdrawn . Table 5quality of life questionnaireduring the past week do you need to stay in bed or a chair during the day? Do you need help with eating, dressing, washing yourself, or using the toilet? Were you limited in doing either your work or other daily activities? Have you been constipated? Have you had diarrhea? Did pain interfere with your daily activities? Have you had difficulty in concentrating on things, like reading a newspaper or watching television? Have you had difficulty remembering things? Has your physical condition or medical treatment interfered with your family life? Has your physical condition or medical treatment interfered with your social activities how would you rate your overall quality of life during the past week?adapted from eortc qlq - c30 (version 3) copyright 1995 eortc study group on quality of life . First 23 questions: not at all: 1; a little: 2; quite a bit: 3; very much: 4; last two questions: excellent: 1, fine: 2, poor: 3, very poor: 4 quality of life questionnaire adapted from eortc qlq - c30 (version 3) copyright 1995 eortc study group on quality of life . First 23 questions: not at all: 1; a little: 2; quite a bit: 3; very much: 4; last two questions: excellent: 1, fine: 2, poor: 3, very poor: 4 as we have previously mentioned in section 1, there may be patients that, although they have not yet lost any significant weight (less or equal to 5% in the last 12 months) and are subjected to an underlying disease, which is often associated with cachexia, may already have some of the peculiarities associated with cachexia such as inflammation or decreased physical performance . However, no consensus on how to classify the pre - cachectic patients has been reached in spite of many suggestions . It is for this reason that the present publication also includes a tentative quantitative approach for the diagnosis of pre - cachexia (table 6). Pre - cachexia would exist if the patient had at least 35 as the sum of the different parameters that specifically exclude body weight loss and composition; as we mentioned, it is essential to have no significant weight loss for pre - cachexia to exist (table 6). Table 6pre - cachexiaquantitative approachbwc = 0(imd + php + qol + ano)> 35bwc body weight loss and composition, imd inflammation / metabolic disturbances / immunosupression, php physical performance, ano anorexia, qol quality of life bwc body weight loss and composition, imd inflammation / metabolic disturbances / immunosupression, php physical performance, ano anorexia, qol quality of life there is a clear need for high - quality international data, representative of the disease populations . Cachexia researchers need to agree and to gather a large prospective data set . Obviously, interpretation of the data by appropriate statistical methods is crucial . Correlation with patient prognosis may be useful, but the relationship between score and outcome may be different in different underlying diseases . Also, the relationship between score and treatment response to cachexia interventions is a possible approach to validating such a score . Although this may be the preferable approach, it depends on availability of several treatment studies and their having assessed all relevant parameters of interest . It may be useful to generate a set of (simple) parameters that all trials should assess in order to allow assessment of such scores in the future and emphasize on the key importance of similar developments in the definition of related terms like sarcopenia, fatigue, and frailty . Although mainly intended and designed for cancer patients, casco could also be tentatively used for other wasting disorders such as chronic heart failure or chronic obstructive pulmonary disease, since many of both the biochemical and metabolic alterations are similar . Obviously, this would have to be validated . In conclusion, a quantitative tentative (not yet validated) staging score for cancer cachectic patients is presented . It is already a tool for the (a) identification of pre - cachectic patients, and (b) classification and staging of the syndrome according to body weight loss and composition, inflammation / metabolic disturbances / immunosupression, physical performance, anorexia, and quality of life . When validated, the new casco might prove to be a useful tool for the treatment and nutritional recommendations of cachectic cancer patients in a similar way as other staging methodologies . The full casco calculation procedure and questionnaires can be found in the following address: http://www.fbg.ub.es / index.php?option = com_content&task = view&id=251&itemid= esm 1electronic supplementary material (pdf 103 kb) electronic supplementary material (pdf 103 kb)
The role of obesity in the pathogenesis of metabolic disease has received considerable attention since the discovery of biologically active adipose - tissue - derived circulatory proteins (adipocytokines) [13]. It is proposed over- or underproduction of adipocytokines in overweight individuals generates an adipose - specific inflammatory response which may be an important determinant of type 2 diabetes mellitus (t2 dm) [46]. Prospective evidence exists for this within certain populations, with low concentrations of the adipocytokine adiponectin correlating strongly with insulin resistance syndromes and or incident t2 dm independent of obesity [415]. Adiponectin may decrease t2 dm risk via a number of mechanisms including hepatic fatty acid oxidation, enhanced peripheral glucose uptake, and stimulated insulin secretion . The identification of particular biomarker profiles within well - defined high - risk groups may therefore provide important pathogenic insight as well as potential clinical utility through predictive capacity . Of particular interest are united kingdom populations tracing first or second ancestry to the indian subcontinent . Collectively termed south asians, it appears this diaspora is particularly susceptible to the effects of western urbanisation and manifest a disproportionate prevalence of premature t2 dm . There is some evidence that south asians have lower adiponectin and higher circulating hscrp concentrations than white europeans even in the absence of bmi - defined obesity and glucose dysregulation . This implies hypoadiponectinemia may be a generalised phenomenon within this group and a possible mediator of premature metabolic disease [4, 1923]. The majority of biomarker studies to date have attempted to correlate various topographical measurements and markers of metabolic dysfunction with adiponectin [2428]. We are unaware of any previous studies categorising adipokines across the glucose spectrum in uk south asians and then establishing their relationship with insulin resistance independent of measures of obesity . This study aimed to firstly characterise a range of adipokines (adiponectin, leptin, tumour necrosis factor- (tnf-)) within age - gender - matched groups of south asians with normal glucose tolerance (ngt), impaired glucose tolerance (igt) and type 2 diabetes mellitus (t2 dm) and secondly determine adipocytokine interactions with known predictors of metabolic risk and insulin resistance within this group . This was a retrospective case - control study embedded within a population - based screening programme for diabetes . Seventeen general practices initially invited listed patients with at least one risk factor for diabetes to a hospital or community - based screening appointment . Nine hundred and sixty - three male and female volunteers aged 2570 underwent a standard 75 g oral glucose tolerance test (ogtt). A diagnosis of normal glucose tolerance (ngt), impaired glucose tolerance (igt), or type 2 diabetes (t2 dm) was made using 1999 who criteria . Additional consent was obtained for adipocyte biomarker analyses in south asian individuals with no history of cardiovascular disease (figure 1). Approval was granted by the local research and ethics committee as a substudy amendment to the original screening programme protocol . The investigation was conducted in accordance with the principles outlined in the declaration of helsinki . Of the volunteers reporting south asian ethnicity in the parent screening study, 530 were eligible for and consented to the temporary storage of their serum for future adipocytokine biomarker analysis . Twenty - two percent of this group had a who - defined glucose disorder and their samples were selected within respective t2 dm and igt categories to produce equal sample sizes across the glucose spectrum . All t2 dm cases and 50% (40/79) of igt subjects were selected for biomarker analysis and an age - sex - matched normal glucose tolerant control allocated by an independent researcher blinded to biomarker data . There were no statistically significant demographic differences between those consenting for (n = 530) and those meeting the inclusion criteria (no cardiovascular disease) but not consenting for biomarker analysis (n = 328) (figure 1). Baseline demographic data captured at screening included age, sex, smoking behaviour, body mass index (bmi), waist circumference, and self - reported history of cardiovascular disease or its treatment . Waist circumference was measured by trained staff using a nonstretching measuring tape over the tops of the iliac crests . Blood pressure was measured according to a standardised operating procedure using a calibrated sphygmomanometer and brachial inflation cuff (hem-7200 m3, omron healthcare, kyoto, japan). They were immediately centrifuged and stored at 80c in 200 l aliquots to minimise repeated defrosting cycles . These analyses were performed in a single university research laboratory with expertise in adipocytokine assays . Adiponectin, leptin, and tnf- were all analysed using bioplex assay according to the manufacturer's instructions (linco research inc ., st . Bioplex assay sample measurement using fluorescent microbead technology allowed simultaneous quantitation of several target proteins within a single serum sample of 50100 l . For all the assays, the filter plate was prewetted using a specific wash buffer and then 65 l of assay buffer followed by 10 l of calibrator, controls or 10 l of diluted serum samples were added to the appropriate wells . The bead bottle was thoroughly vortexed for 1 minute before adding 25 l of the bead suspension to each well, taking care to mix intermittently to avoid settling . The filter plate was sealed, covered with aluminium foil, and incubated for 1618 hours overnight at 28c . The fluid was then gently removed by vacuum extraction and the plate was washed three times with wash buffer . Fifty microlitres of detection antibody cocktail was added to each well and then the plate was resealed, covered, and incubated with agitation for 30 minutes at room temperature . After removing contents by vacuum, the plate was washed three times, and then 50 l of streptavidin - phycoerythrin was added to each well . After further identical incubation at 30 minutes, the contents were removed by vacuum, the plate was washed three times and 100 l of sheath fluid was added to all wells . The beads were resuspended by shaking on a plate shaker for 5 minutes before the plate was run on the analyser . For bioplex, intraassay coefficient of variation was 1.47.9% and inter - assay coefficient of variation was <15% . A power calculation was undertaken for a biomarker (adiponectin) comparison based upon available data in south asian subjects with type 2 diabetes . A total sample size of 34 would give 80% power at the 5% level to detect a one standard deviation difference between south asian igt and t2 dm groups . All values are given as mean standard deviation (sd) unless otherwise stated . T - tests or non parametric comparisons of median values were used to determine statistical differences in biomedical data across glucose categories . Homa - derived insulin resistance (homa - ir) was calculated as fasting insulin (uml) fasting glucose (mmoll)/22.5, with a set value of more than 3.0 indicating likely significant insulin resistance . Conditional logistic regression analysis following logarithmic transformation of selected variables was used to determine independent biomarker relationships with insulin resistance . Only variables considered to be of importance and those significant at the level of bivariate analysis (see supplementary material available at http://dx.doi.org/10.1155/2013/561016) were entered simultaneously into the model . Categorical variables were coded as follows: gender: male or female, smoking: active or inactive, cardiovascular disease or lipid lowering medication: active prescription or no prescription . All statistical analyses were carried out using spss statistical software version 20.0 (spss, chicago, il, usa). 158 indian south asian subjects were included, 79 with normal glucose tolerance (ngt), 40 with impaired glucose tolerance (igt) and 39 with type 2 diabetes (t2 dm). The mean age of the study population was 53.6 years with men and women equally represented . There were statistically significant differences in body mass index (bmi), waist circumference, waist hip ratio (whr), serum triglycerides, glucose indices (fasting and two - hour plasma glucose), and derived insulin resistance (homa - ir) between ngt and t2 dm categories . Significant differences were also observed between igt and t2 dm groups for these parameters and serum hdl - cholesterol . Fewer ngt controls were prescribed antihypertensive and or lipid lowering therapies than either of the igt or t2 dm comparator groups . Table 2 depicts mean biomarker concentrations across ngt, igt, and t2 dm glucose categories . An incremental reduction in adiponectin between ngt and t2 dm groups reached statistical significance in women . Conversely a statistically significant increase in leptin concentration between ngt and t2 dm was observed in men . Table 3 demonstrates the independent effects of adiponectin, leptin, and tnf- on insulin resistance (defined by homa - ir> 3.0) using conditional logistic regression . Omnibus test of model coefficients indicated a good fit for all models (e.g., for adiponectin chi 64.4 p <0.001). An independent association was observed between the defined insulin resistant state and adiponectin in models adjusting for the effects of age, gender, bmi, waist circumference, smoking, cardioprotective medications, and lipids . No independent associations of insulin resistance with either leptin or tnf- were observed in this selected south asian group in the two models adjusting for these parameters . This study adds to the body of evidence implicating adipocytokine activity (or inactivity) in the pathogenesis of metabolic disease . South asians, whether westernised or residing on the indian subcontinent appear to have an adverse adipocytokine profile characterised by low total or fractionated hexameric adiponectin and increased leptin . Here we demonstrate an independent association of adiponectin with insulin resistance in a group known to develop diabetes and coronary heart disease earlier than indigenous white european populations . Like others, we found that adiponectin is low in south asians compared with similar published data for white europeans and other races [2328]. We found an independent relationship between homa measured insulin resistance and total adiponectin in south asians after adjusting for the effects of age, bmi, waist circumference, cardiovascular protective medication, and lipids . This was an expected finding as plasma adiponectin has previously been shown to predict type 2 diabetes within high - risk asian, native american and caucasian populations . Cross - sectional studies examining glucose and adiponectin relationships have demonstrated either strong relationships [19, 25, 33] with homa or independent relationships confined to various glucose indices [2325]. A recent study by luo et al . Demonstrated that total adiponectin associates with igt and t2 dm in asian indian women . Low adiponectin levels in pregnancy have recently been shown to predict postpartum insulin resistance and beta - cell dysfunctionindicating a major role in the pathogenesis of t2 dm . Interestingly, weight loss (and increased insulin sensitivity) through calorie restriction does not appear to effect presumed hyperinsulinaemia - induced reduction in adiponectin in obese women, suggesting pre - determined genetic causality or alternative adipocytokine biological activity . We found little evidence of this on our selected population with no independent association of insulin resistance with either serum leptin or tnf-. Adiponectin - insulin resistance interplay appears more complex than the relatively simplistic paradigm of causality currently postulated . Longitudinal work is warranted to further investigate this relationship in south asians and to characterise primary genetic alterations that may predispose this group to hypoadiponectinemia . Leptin is an adipocytokine with a key role in the hypothalamic satiety response regulating energy metabolism . Some studies in south asians link this molecule to inflammation, insulin resistance and other cardiovascular risk factors [37, 38]. Tnf- is markedly upregulated in obese states and probably promotes insulin resistance by interfering with insulin receptor signalling . Lack of any correlation between leptin / tnf- and insulin resistance in our south asian population was an unexpected finding . The absence of an association between insulin resistance and leptin independent of bmi or waist circumference in this high risk group suggests this molecule may not be a key driver to hyperinsulinemia in the advanced stages of dysmetabolism . Firstly, power to detect differences in biomarker concentrations other than adiponectin may be insufficient, especially for subgroup and gender comparisons . Longitudinal studies with many years of followup are required to determine true relationships between biomarker profiles and metabolic disease / diabetes risk . Thirdly, there is some evidence that adiponectin subfractions (high molecular weight adiponectin1218 multimers) rather than the total concentration measured here provides a better measure of biological activity and is a strong predictor of diabetes . This could provide an explanation for the lack of independent correlation of adiponectin with insulin resistance in other south asian groups although a recent prospective study showed similar associations of total and high molecular weight adiponectin with incident diabetes . There remain relatively few studies in migrant south asian populations who are at high risk of t2 dm and strengths of this approach included the robust phenotyping methodology employed and cardiovascular disease free sample . In summary, we have found an independent association of the biomarker adiponectin with insulin resistance in south asians . Further work to elucidate exactly how adipocytokine interplay contributes to metabolic risk across ethnic groups is needed.
Cancer is an aberrant net accumulation of atypical cells, which can arise from an excess of proliferation, an insufficiency of apoptosis, or a combination of the two . The frequency of apoptosis could contribute to cell loss in tumours and promote tumour regression . Thus, in cancer therapy, the focus is on strategies that suppress tumour growth by activating the apoptotic program in the cell . Evidence accumulated to this date has established that many agents of cancer chemotherapy affect tumour cell killing through launching the mechanisms of apoptosis . Manifestations of apoptosis are easily discernible by the appearance of cell shrinkage, membrane blebbing, chromatin condensation, dna cleavage, and finally, fragmentation of the cell into membrane - bound apoptotic bodies . Expressed as inactive proenzymes, caspases are members of a family of cysteine proteases that play a central role in the apoptotic pathway . Two major mechanisms exist that initiate the caspase cascade: the extrinsic, involving caspase-8; and the intrinsic pathway, involving caspase-9 as the apical caspase . Observations from several studies have suggested that a caspase-8 pathway can be up - regulated after drug treatment, and these include the drugs cisplatin, etoposide, doxorubicin and methothrexate . Once activated, caspase-8 is thought to activate the downstream caspases by proteolytic cleavage of their zymogen forms, thus amplifying the caspase signal . The other initiator caspase, caspase-9, controls the apoptotic response to lethal cellular insults such as ionizing radiation or certain chemotherapeutic drugs . In many systems, release of cytochrome c from the mitochondria to cytosol has been demonstrated to be a crucial step in the activation of apoptosis [12 - 14]. Once released from mitochondria, cytochrome c acts as a co - factor and interacts with apaf-1 and procaspase-9, which in turn activates caspase-9 . The role of active caspase-8 and -9 is to generate the active forms of downstream executioner caspases, including caspase-3 and -7, by limited proteolysis, and thereby transmit the apoptotic signal to the execution phase . Activation of these executioner caspases during apoptosis results in the cleavage of critical cellular substrates, thus disabling critical homeostatic and repair enzymes as well as key structural components that culminate in cell death . Styrylpyrone derivative (spd) is a pharmacologically active compound extracted from the plant goniothalamus sp . Of the annonaceae family . Among the species of goniothalamus previous studies on spd suggest this bioactive compound as an antiproliferative and selective cytotoxic agent . In vitro, spd was found to selectively inhibit the proliferation of several cancer cell lines without being significantly cytotoxic towards non - malignant cells [19 - 21]. On in vivo models, spd is reported to be capable of tumoricidal and tumoristatic effects on experimental rats with mammary tumours . Recent work done to elucidate spd's mechanism of action found evidence that spd modulates the gene expression of bcl-2 and bax in ovarian carcinoma . In breast cancer cells, spd induces an increase of the proapoptotic bax protein, culminating in cell death by apoptosis . In this study we show that procaspase-8 was not activated in mcf-7 cells but caspase-9 activation was detected in response to spd treatment, with the release of cytochrome c into the cytosol . This was followed by the activation of the executioner caspase-7 . To further examine the involvement of this executioner caspase, we found that caspase-7 activity decreased and apoptosis was abrogated when spd - treated cells were preincubated with the caspase-7 inhibitor, ac - devd - cho, suggesting a caspase-7-dependent apoptotic pathway induced by spd . Dna condensation and fragmentation characteristic of apoptotic cells were examined and quantitated by the tunel assay and nuclear fluorochrome hoechst 33258 . As reported previously, spd induced apoptosis in mcf-7 cells at 10 m in a time - dependent manner (figure 1). Spd treatment (10 m) significantly increased the level of apoptosis in mcf-7 cells when compared to untreated controls, as judged by apoptotic morphology by nuclear staining and dna fragmentation by tunel assay described in the experimental procedures . Results were presented as the means sd of 6 independent experiments . During apoptosis, initiator caspases are activated in response to proapoptotic signals . By sds - page and subsequent western blot analysis with a caspase-8 specific antibody, it was found that spd treatment did not lead to the activation of the initiator caspase-8 . Procaspase-8, expressed in two functionally active isoforms, caspase-8a and caspase-8b was not processed . From immunoblotting, the two bands observed were the 55/50-kda procaspase-8 isoforms (figure 2), similarly reported by sun et al ., and dirsch et al ., and the active p18 subunit could not be detected . As processing of this caspase did not occur, it is possible that the other initiator caspase, caspase-9 may be involved in spd - induced apoptosis . Proteins from mcf-7 cells treated with 10 m spd for the indicated times were resolved on 12% sds - page and submitted to western blotting with an anti - procaspase-8 antibody . Two bands were observed, corresponding to the uncleaved 55/50-kda procaspase-8 isoforms . The active p18 subunit was not detected . Samples were also detected for procaspase-9 with an anti - procaspase-9 antibody (clone b40). The anti - caspase-9 antibodies recognized the proenzyme; and the decrease of this band indicated activation of caspase-9 . When proteins from cytosolic fractions of mcf-7 cells treated with 10 m spd were resolved on 15% sds - page and submitted to immunoblotting with the cytochrome c antibody (clone 7h8.2c12), increasing amounts of cytochrome c all blots were then washed and reprobed with -actin to confirm equal loading . From immunoblot analysis, untreated mcf-7 cells exhibited the ~48-kda proform of caspase-9 . When mcf-7 cells were treated with 10 m spd, the observed zymogen of caspase-9 slowly diminished in the course of the experiment (figure 2). The disappearance of the procaspase-9 band reflects the processing of the zymogen to generate the active form of caspase-9, as has been interpreted in previous reports . For activation of caspase-9, a multimeric structure termed the apoptosome is involved, consisting of cytochrome c, the apoptotic protease activating factor-1 (apaf-1), and atp or datp . Cytochrome c seems to be a major trigger for the assembly of this complex, and various studies have found that cytochrome c is released from the mitochondria into the cytosol during cell death [29 - 31]. When cytochrome c levels in the cytosol were examined, we detected increasing levels in the spd - treated mcf-7 cells (figure 2). Untreated control cells did not exhibit similar high levels of cytochrome c, indicating that the release of cytochrome c from the mitochondria into the cytosol was an effect of spd treatment . The role of the initiator caspase-9 is to generate the active forms of executioner caspase-3 and -7 by limited proteolysis, and thereby transmit the apoptotic signal to the execution phase . As with previous reports, caspase-3 activity was not detected (data not shown). Immunoblot analyses of lysates obtained from mcf-7 cells treated with spd at 10 m found that caspase-7 was cleaved to the 17-kda fragment required for its activation (figure 3). When the activity of caspase-7 was assayed, spd - treated cells showed increase in activity compared to untreated controls (figure 4). To confirm that the spd - induced apoptotic cell death was due to the involvement of caspase-7, cells were also treated with spd in the presence of the specific inhibitor of caspase-7, ac - devd - cho . Spd - treated cells preincubated with the inhibitor exhibited repressed caspase-7 devdase activity . Also, preincubation of mcf-7 cells with this inhibitor at 50 m to 100 m inhibited apoptosis and brought apoptotic levels down to the level similar to controls (figure 5), thus purporting an apoptotic pathway dependent on caspase-7 . Proteins from mcf-7 cells treated with 10 m spd for the indicated times were resolved on a 15% page and submitted to western blotting using a monoclonal antibody against caspase-7 (b94 - 1), which recognizes the pro- (35-kda) and the active (17-kda) forms of caspase-7 . Following spd treatment, the caspase-7 proenzyme was cleaved, generating the catalytically - active 17-kda fragment . The activity of caspase-7 was measured with a colorimetric assay kit (chemicon) that recognizes cleavage of the sequence devd by active caspase-7 . Caspase-7 activity increased when cells were treated with spd, indicating the catalytic activation of this executioner caspase . When mcf-7 cells were incubated with the caspase-7 inhibitor, devd - cho, prior to spd treatment, caspase-7 devdase activity diminished . When mcf-7 cells were incubated with the caspase-7 inhibitor, devd - cho at (a) 50 m and (b) 100 m, prior to spd treatment, apoptosis levels decreased to control untreated levels as detected by nuclear staining, suggesting the important role played by this executioner caspase in spd - induced apoptosis . (c) results were presented as the means sd of 3 independent experiments . Dna condensation and fragmentation characteristic of apoptotic cells were examined and quantitated by the tunel assay and nuclear fluorochrome hoechst 33258 . As reported previously, spd induced apoptosis in mcf-7 cells at 10 m in a time - dependent manner (figure 1). Spd treatment (10 m) significantly increased the level of apoptosis in mcf-7 cells when compared to untreated controls, as judged by apoptotic morphology by nuclear staining and dna fragmentation by tunel assay described in the experimental procedures . During apoptosis, initiator caspases are activated in response to proapoptotic signals . By sds - page and subsequent western blot analysis with a caspase-8 specific antibody, it was found that spd treatment did not lead to the activation of the initiator caspase-8 . Procaspase-8, expressed in two functionally active isoforms, caspase-8a and caspase-8b was not processed . From immunoblotting, the two bands observed were the 55/50-kda procaspase-8 isoforms (figure 2), similarly reported by sun et al ., and dirsch et al ., and the active p18 subunit could not be detected . As processing of this caspase did not occur, it is possible that the other initiator caspase, caspase-9 may be involved in spd - induced apoptosis . Proteins from mcf-7 cells treated with 10 m spd for the indicated times were resolved on 12% sds - page and submitted to western blotting with an anti - procaspase-8 antibody . Two bands were observed, corresponding to the uncleaved 55/50-kda procaspase-8 isoforms . The active p18 subunit was not detected . Samples were also detected for procaspase-9 with an anti - procaspase-9 antibody (clone b40). The anti - caspase-9 antibodies recognized the proenzyme; and the decrease of this band indicated activation of caspase-9 . When proteins from cytosolic fractions of mcf-7 cells treated with 10 m spd were resolved on 15% sds - page and submitted to immunoblotting with the cytochrome c antibody (clone 7h8.2c12), increasing amounts of cytochrome c from immunoblot analysis, untreated mcf-7 cells exhibited the ~48-kda proform of caspase-9 . When mcf-7 cells were treated with 10 m spd, the observed zymogen of caspase-9 slowly diminished in the course of the experiment (figure 2). The disappearance of the procaspase-9 band reflects the processing of the zymogen to generate the active form of caspase-9, as has been interpreted in previous reports . For activation of caspase-9, a multimeric structure termed the apoptosome is involved, consisting of cytochrome c, the apoptotic protease activating factor-1 (apaf-1), and atp or datp . Cytochrome c seems to be a major trigger for the assembly of this complex, and various studies have found that cytochrome c is released from the mitochondria into the cytosol during cell death [29 - 31]. When cytochrome c levels in the cytosol were examined, we detected increasing levels in the spd - treated mcf-7 cells (figure 2). Untreated control cells did not exhibit similar high levels of cytochrome c, indicating that the release of cytochrome c from the mitochondria into the cytosol was an effect of spd treatment . The role of the initiator caspase-9 is to generate the active forms of executioner caspase-3 and -7 by limited proteolysis, and thereby transmit the apoptotic signal to the execution phase . Here as with previous reports, caspase-3 activity was not detected (data not shown). Immunoblot analyses of lysates obtained from mcf-7 cells treated with spd at 10 m found that caspase-7 was cleaved to the 17-kda fragment required for its activation (figure 3). When the activity of caspase-7 was assayed, spd - treated cells showed increase in activity compared to untreated controls (figure 4). To confirm that the spd - induced apoptotic cell death was due to the involvement of caspase-7, cells were also treated with spd in the presence of the specific inhibitor of caspase-7, ac - devd - cho . Spd - treated cells preincubated with the inhibitor exhibited repressed caspase-7 devdase activity . Also, preincubation of mcf-7 cells with this inhibitor at 50 m to 100 m inhibited apoptosis and brought apoptotic levels down to the level similar to controls (figure 5), thus purporting an apoptotic pathway dependent on caspase-7 . Proteins from mcf-7 cells treated with 10 m spd for the indicated times were resolved on a 15% page and submitted to western blotting using a monoclonal antibody against caspase-7 (b94 - 1), which recognizes the pro- (35-kda) and the active (17-kda) forms of caspase-7 . Following spd treatment, the caspase-7 proenzyme was cleaved, generating the catalytically - active 17-kda fragment . The activity of caspase-7 was measured with a colorimetric assay kit (chemicon) that recognizes cleavage of the sequence devd by active caspase-7 . Caspase-7 activity increased when cells were treated with spd, indicating the catalytic activation of this executioner caspase . When mcf-7 cells were incubated with the caspase-7 inhibitor, devd - cho, prior to spd treatment, caspase-7 devdase activity diminished . When mcf-7 cells were incubated with the caspase-7 inhibitor, devd - cho at (a) 50 m and (b) 100 m, prior to spd treatment, apoptosis levels decreased to control untreated levels as detected by nuclear staining, suggesting the important role played by this executioner caspase in spd - induced apoptosis . (c) results were presented as the means sd of 3 independent experiments . There is an increasing realization that chemotherapeutic agents act primarily by inducing cancer cell death through the mechanisms of apoptosis . However, there are many cancers that are intrinsically resistant to apoptosis, making it vital to develop novel drugs for combination chemotherapy . In the present study, we provide evidence that a compound of plant - origin, spd, may be a promising new anticancer agent for human breast cancers . Previously, we have shown that mcf-7 cells treated with spd displayed elevated levels of apoptosis and a marked increase in the expression of the proapoptotic bax protein . In addition to the loss of viability, bax expression produces other typical manifestations leading to apoptosis, namely caspase activation . Here, we found that caspase-9 was activated, together with accumulation of cytochrome c in the cytosol . Caspase-9 can activate downstream executioner caspases including caspase-7, which is termed caspase-3-like due to its similarity in specificity with caspase-3 . Caspase-3 deficiency in mcf-7 is due to a deletion mutation in exon 3 of the gene . Previous studies on mcf-7 with exogenously - expressed caspase-3 indicates that caspase-3 plays an important role in apoptotic pathways . Studies using etoposide and doxorubicin, active chemotherapeutic agents and key adjuvant drugs for breast cancer treatment, concluded that mcf-7 cells were sensitized to apoptosis only when these cells were reconstituted with caspase-3 . Chemoresistance is often caused by aberrant apoptosis that in some instances has been related to defects in caspase activation . Given the importance of caspase-3 in apoptotic execution, it is then postulated that caspase-3 deficiency might significantly contribute to chemotherapeutic resistance . In our studies, we observed manifestations of apoptosis in spd - treated mcf-7 cells . Previous reports by hishikawa and colleagues and heerdt et al ., have also demonstrated similar apoptotic hallmarks in mcf-7 cells when induced with connective tissue growth factor (ctgf) and tributyrin, respectively . These suggest that the mechanism for induction of apoptosis is present and functional in mcf-7 cells, but is dependent on the external stimuli . Caspase-7 is highly related to caspase-3 and shows the same synthetic substrate specificity in vitro suggesting that caspase-3 and -7 have possibly overlapping roles in apoptosis . Without caspase-3, spd - treated mcf-7 cells may utilize an alternate caspase pathway to affect cell death . Here, we demonstrated that caspase-7 was activated in spd - induced apoptosis . In mcf-7 cells treated with spd, overexpression of full - length caspase-7 in the mcf-7 does not induce apoptosis, whereas the activated 17-kda subunit induces apoptotic cell death . Activation of executioner caspases, caspase-3 or -7 results in the cleavage of critical cellular substrates and homeostatic enzymes, bringing about the manifestations of apoptosis . Experimental inhibition of apoptosis by peptide caspase inhibitors presents the opportunity to investigate the importance of this protease family . When mcf-7 cells were preincubated with the caspase-7 inhibitor ac - devd - cho before treatment with spd, apoptosis levels decreased to a level similar to controls . Cell death was thus inhibited and treated cells had morphology similar to controls, further supporting the involvement of caspase-7 in spd - induced apoptosis . Previous reports have found that mcf-7 cells are relatively insensitive to many chemotherapeutic agents due to the absence of caspase-3 . Our studies here have shown that the mechanism for apoptosis is functional in mcf-7 and spd is able to induce an alternate caspase pathway, possibly via caspase-7 . Tumours accumulate mutations that increase their resistance to apoptotic inducers; e.g. Abrogation of caspase-3 has been associated with acquired multidrug resistance . Therefore, finding new therapeutic agents that induce tumour cell apoptosis in a manner independent of caspase-3 may have important clinical implications . By not requiring caspase-3, spd may evoke an apoptotic pathway different from clinical oncology drugs such as doxorubucin and etoposide, thus making it a promising agent for combination chemotherapy that merits further study . Mcf-7 human mammary carcinoma cells were obtained from the american type culture collection (atcc) and maintained in dmem supplemented with 10% fetal bovine serum and 2 mm glutamine . Styrylpyrone derivative (spd) was isolated from the bark of goniothalamus umbrosus as described previously . Briefly, cells were treated with spd at 10 m for various incubation times . For inhibitor studies, cells were incubated with the caspase-7 inhibitor, ac - devd - cho (n - acetyl - asp - glu - val - asp - al) (sigma - aldrich) 1 h prior to spd treatment . After treatment periods, floating and trypsinized adherent cells were collected and washed with phosphate - buffered saline (pbs). After washing, cells were incubated in the nuclear fluorochrome hoechst 33258 (sigma) at a final concentration of 30 g / ml at room temperature for 30 min . Nuclear morphology was then examined with a zeiss fluorescent microscope and apoptotic cells were counted . Dna fragmentation characteristic of apoptotic cells was quantified by tdt - mediated dutp nick end labeling (tunel) with the apoptosis detection kit, fluorescein (promega) according to the manufacturer's instructions . To calculate the percentage of tunel - positive cells, four random microscopic fields at 100 and 400, treated cells were harvested by centrifugation and washed with ice - cold phosphate - buffered saline and resuspended in 5 volumes of extraction buffer containing 250 mm sucrose . Cells were homogenized and the homogenates were centrifuged twice at 750 g for 10 min at 4c . The supernatant was then centrifuged at 10,000 g for 15 min at 4c, and the resulting mitochondrial pellets were discarded . As previously described, cells were scraped with a rubber policeman after incubation in extraction buffer and put on ice . Cells were then submitted to 3 freeze - thaw cycles and centrifuged at 10,000 rpm for 20 min at -4c . Supernatant was collected and added with 1:1 sample buffer and boiled at 95c for 5 min . After protein concentration was determined by standard procedures, protein aliquots of 20 g were applied to 12% or 15% sds - polyacrylamide gels for separation . After electrophoresis, proteins were blotted onto polivynyl - difluoride membranes (polyscreen, nen life science). Membranes were dried, preblocked with 5% non - fat milk in phosphate - buffered saline and 0.1% tween-20, then incubated with a primary antibody for caspase-8, caspase-9 (clone b40), caspase-7 (clone b94 - 1) or cytochrome c (clone 7h8.2c12) (all from pharmingen), and detected with horseradish peroxidase - labeled antibodies to rabbit or mouse igg . Following exposure on a kodak biomax x - ray film, densitometry analysis was done with a gs 670 imaging densitometer with the software molecular analyst (bio rad). Blots were stripped with re - blot plus (chemicon) before reprobing with -actin antibody to determine equal loading . Caspase-7 activity in the caspase-3-deficient mcf-7 cells was assayed with the colorimetric assay kit (chemicon international, usa) that provides a means to assay the activity of caspases that recognize the sequence devd . Briefly, mcf-7 cells were treated with spd at 10 m for 24 and 48 h. after the treatment period, cells were counted and then pelleted at 1,500 rpm for 10 min . Cells were then resuspended in chilled cell lysis buffer and incubated on ice before centrifugation at 10,000 g for 5 min . The supernatant (cytosolic extract) was then transferred to a fresh microcentrifuge tube and put on ice . The protein concentration for each sample set assay mixture was prepared in a 96-well plate and mixed with assay buffer, dh2o and the caspase substrate, ac - devd - pna, and incubated at 37c for 1.5 h. for inhibitor studies, the sample was pre - incubated with the caspase-7 inhibitor, ac - devd - cho, for 10 min at room temperature before adding the substrate solution . After incubation, samples were read with a dynex mrx microtiter plate reader at 405 nm . Increase in caspase-7 activity was then determined by comparing the od reading from the spd - treated samples with the level of the untreated control . Mcf-7 human mammary carcinoma cells were obtained from the american type culture collection (atcc) and maintained in dmem supplemented with 10% fetal bovine serum and 2 mm glutamine . Styrylpyrone derivative (spd) was isolated from the bark of goniothalamus umbrosus as described previously . Briefly, cells were treated with spd at 10 m for various incubation times . For inhibitor studies, cells were incubated with the caspase-7 inhibitor, ac - devd - cho (n - acetyl - asp - glu - val - asp - al) (sigma - aldrich) 1 h prior to spd treatment . After treatment periods, floating and trypsinized adherent cells were collected and washed with phosphate - buffered saline (pbs). After washing, cells were incubated in the nuclear fluorochrome hoechst 33258 (sigma) at a final concentration of 30 g / ml at room temperature for 30 min . Nuclear morphology was then examined with a zeiss fluorescent microscope and apoptotic cells were counted . Dna fragmentation characteristic of apoptotic cells was quantified by tdt - mediated dutp nick end labeling (tunel) with the apoptosis detection kit, fluorescein (promega) according to the manufacturer's instructions . To calculate the percentage of tunel - positive cells, four random microscopic fields at 100 and 400 briefly, treated cells were harvested by centrifugation and washed with ice - cold phosphate - buffered saline and resuspended in 5 volumes of extraction buffer containing 250 mm sucrose . Cells were homogenized and the homogenates were centrifuged twice at 750 g for 10 min at 4c . The supernatant was then centrifuged at 10,000 g for 15 min at 4c, and the resulting mitochondrial pellets were discarded . As previously described, cells were scraped with a rubber policeman after incubation in extraction buffer and put on ice . Cells were then submitted to 3 freeze - thaw cycles and centrifuged at 10,000 rpm for 20 min at -4c . Supernatant was collected and added with 1:1 sample buffer and boiled at 95c for 5 min . After protein concentration was determined by standard procedures, protein aliquots of 20 g were applied to 12% or 15% sds - polyacrylamide gels for separation . After electrophoresis, proteins were blotted onto polivynyl - difluoride membranes (polyscreen, nen life science). Membranes were dried, preblocked with 5% non - fat milk in phosphate - buffered saline and 0.1% tween-20, then incubated with a primary antibody for caspase-8, caspase-9 (clone b40), caspase-7 (clone b94 - 1) or cytochrome c (clone 7h8.2c12) (all from pharmingen), and detected with horseradish peroxidase - labeled antibodies to rabbit or mouse igg . Following exposure on a kodak biomax x - ray film, densitometry analysis was done with a gs 670 imaging densitometer with the software molecular analyst (bio rad). Blots were stripped with re - blot plus (chemicon) before reprobing with -actin antibody to determine equal loading . Caspase-7 activity in the caspase-3-deficient mcf-7 cells was assayed with the colorimetric assay kit (chemicon international, usa) that provides a means to assay the activity of caspases that recognize the sequence devd . Briefly, mcf-7 cells were treated with spd at 10 m for 24 and 48 h. after the treatment period, cells were counted and then pelleted at 1,500 rpm for 10 min . Cells were then resuspended in chilled cell lysis buffer and incubated on ice before centrifugation at 10,000 g for 5 min . The supernatant (cytosolic extract) was then transferred to a fresh microcentrifuge tube and put on ice . The protein concentration for each sample set assay mixture was prepared in a 96-well plate and mixed with assay buffer, dh2o and the caspase substrate, ac - devd - pna, and incubated at 37c for 1.5 h. for inhibitor studies, the sample was pre - incubated with the caspase-7 inhibitor, ac - devd - cho, for 10 min at room temperature before adding the substrate solution . After incubation, samples were read with a dynex mrx microtiter plate reader at 405 nm . Increase in caspase-7 activity was then determined by comparing the od reading from the spd - treated samples with the level of the untreated control.
Stabilization exercise is an effective intervention method for relieving the pain and dysfunction associated with low back pain and for decreasing its recurrence . Stabilization exercise programs typically include the motor control training of abdominal muscle . Among the abdominal muscles, the transversus abdominis (tra) is of particular interest to physical therapists as a spinal stabilizer because of its anatomical characteristics1 . This is because the upper fibers of tra provide stability to the thorax, the middle fibers increase the tension of the thoracolumbar fascia (tlf) for controlling the spine, and the lower fibers provide compression for decreasing the laxity of the sacroiliac joint and supporting the internal organs of the abdomen2 . Independent contraction of tra is achievable through the abdominal drawing - in maneuver (adim)3 . The adim re - educates the functions of this muscle and is therefore effective at relieving lumbopelvic pain and dysfunction4 . For this reason, the adim is frequently used as a basic element in stabilization exercise programs . However, learning and teaching an accurate adim can be time consuming and difficult5 . For this reason, feedback tools such as the pressure biofeedback unit (pbu), electromyography (emg), and real - time ultrasound imaging (rusi) are often used . Surface emg is a non - invasive method, but it is limited in its ability to detect fine activities of the deeply located tra . Fine - wire emg can be used to observe these fine activities, but this is an invasive method and can cause pain and inflammation . On the other hand, rusi is a non - invasive method that enables observation of the fine activities, but its high cost is prohibitive . In contrast, a pbu is a non - invasive method that is more economical than either of these other feedback tools, and it can be easily used anywhere since it is portable . Pbus are used for clinical evaluation of the abdominal and cervical muscles, but it can also provide feedback to subjects who are receiving motor control training6 . In the case of adim, the prone and supine positions can be employed when using a pbu . In the prone position, the pbu is placed between the navel and the anterior superior iliac supine and air is infused into the bulb to create a pressure of 70 mmhg . A decrease of 4 mmhg in pressure in performance of the adim is believed to indicate a successful result of the exercise7, whereas a 410 mmhg pressure decrease indicates independent contraction of the tra8 . Obese patients, patients with respiratory diseases, and pregnant women must avoid prone positions and perform adim in the supine or other positions8 . In the supine position, the pbu is placed below the lumbar lordosis and air is infused into the bulb to create a pressure of 40 mmhg . However, unlike the prone position, no validated pressure variation values have been published for the performance of adim in the supine position . Rather, slight pressure increase or maintaining the pressure of 40 mmhg has been recommended for the performance of adim8 . This lack of definitive information has led to the use of diverse levels of pressure when using a pbu, depending on the researchers intentions9,10,11,12 . For this reason, the aim of the present study was to determine the appropriate pressure variation for performing a successful adim, by measuring thickness variations in the abdominal muscles and their contraction ratios in response to pressure variations of a pbu during performance of adim in the supine position . The subjects of the present study were 14 healthy males and 9 healthy females who were given an explanation of the purpose and method of the study, and who voluntarily agreed to participate in the study . Subjects who had experienced low back pain within the last six months, who had pain while performing adim, who showed deformation such as scoliosis, who had received a surgical intervention, who had neurological disease, or who had previous experience of adim training using a pbu were excluded . Three participants (2 males, 1 female) could not perform adim at any of the four pressure variations and were excluded from the analysis of the present study . Therefore, the final study subjects were 20 persons (12 males, 8 females) and their mean age, height, weight and bmi were 23.603.72 years, 169.158.49 cm, 60.3011.85 kg, and 20.912.80, respectively . A pbu (chattanooga group inc . Hixson, tn37343, usa) was placed between the lumbar lordosis and the ground, with subjects in the supine position with knees bent at 90 before performing adim . The bulb was then inflated to 40 mmhg of pressure and maintained while the subject performed the adim . The subject used an adim method in which the pelvic floor muscles were also contracted in order to increase the contraction of the tra, as described by critchley13 . All of the subjects were taught to pull the lower abdomen in slowly, without moving the spine, ribs, or pelvis, while simultaneously contracting the pelvic floor muscles . The subjects performed adim in the supine position targeting randomized pressure increase of 0, 2, 4, or 6 mmhg from the initially maintained 40 mmhg . Variations in tra and the thicknesses of the internal oblique abdominal muscle (io) and the external oblique abdominal muscle (eo) were measured using ultrasonography . To verify the accuracy of the pbu, a weight of 4.54 kg was placed on each pbu and the pbus were observed for 24 hours14 . The units that showed decreases of 0.5 mmhg or less were used in the study . A sonoace the effects of breathing were controlled by collecting all data at the end - point of expiration15 using a 7.5 mhz linear transducer . Abdominal muscle thicknesses were measured by placing the transducer transversely on the middle abdominal region between the border of the 11th costal cartilage and the iliac crest16 . The abdominal muscle thicknesses were first measured at rest, and were subsequently measured every time the pressure changed, while the subjects were performing adim . Muscle contraction ratios were calculated using equations presented in previous studies16,17,18 . Tra contraction ratio = tra thickness in contraction / tra thickness at rest eo contraction ratio = eo thickness in contraction / eo thickness at rest io + eo contraction ratio = io + eo thickness in contraction / io + eo thickness at rest tra preferential activation ratio = (tra in contraction / tra + io + eo in contraction) (tra at rest / tra + io + oe at rest) differences in abdominal muscle thickness variations in relation to pressure variations and the contraction ratios of individual muscles were compared using one - way anova . Statistical processing was conducted using spss 12.0 for windows, and the significance level,, was chosen as 0.05 . Unit: mm; * significant difference (p<0.05); values with different superscripts within the same columns are significantly different at p<0.05 . Values: meanstandard deviation; cr: contraction ratio; pcr: preferential contraction ratio; values with different superscripts within the same columns are significantly different at p<0.05 . The effects of pressure variations on abdominal muscle thicknesses at rest and during adim are shown in table 1 . Significant differences were found in muscle thickness between the resting and adim conditions for the io and the eo . Thickness variations in the io showed significant differences between pressure increases of 0 and 6 mmhg, and between 2 and 6 mmhg . Thickness variations in the eo also showed significant differences between pressure increases of 0 and 6 mmhg, and between 2 and 6 mmhg . Variations in abdominal muscle contraction ratios in relation to pressure variations showed significant differences among the io+eo contraction ratios, the eo contraction ratios, and the tra selective contraction ratios (table 2). The io+eo contraction ratios showed significant differences between 0 and 4 mmhg, 0 and 6 mmhg, and 2 and 6 mmhg . The tra selective contraction ratios showed significant differences between 0 and 6 mmhg, and 2 and 6 mmhg . The reliability within the measurers of the measurements of the thicknesses of each muscle was tested using icc (3,1). The reliability values for tra, io, and eo were 0.96, 0.96, and 0.97, respectively . The present study was conducted to determine the appropriate pressure variation for performing successful adim in the supine position, using a pbu . Increases in pressure of 02 mmhg resulted in significant decreases in the thicknesses of both the io and the eo compared to the changes seen following increases of 6 mmhg . In this study, 02 mmhg increases showed respective decreases of 1.131.54 mm, and 0.510.66 mm in io and eo thicknesses compared to 6 mmhg . Additionally, although the 4 mmhg increase was resulted in io and eo thicknesses that were not significantly different from the 02 mmhg increase, the 02 mmhg increase showed respective decreases of 0.540.95 mm, and 0.250.40 mm in io and eo thicknesses from their values at 4 mmhg increase . Increases in pressure of 02 mmhg may be more effective for decreasing the thicknesses of both io and the eo compared to other pressure variations . Increases of 46 mmhg resulted in increased io and eo thicknesses similar to those reported in a previous study19 in which no pbu was used, and this means that adim was not performed successfully . In the present study, the tra contraction ratio showed no significant differences in relation to pressure variations, but the tra preferential activation ratios between 02 mmhg and 6 mmhg pressure increases showed significant differences . This is because there was a significant difference between the io+eo contraction ratio and the eo contraction ratio . Successful performance of adim is determined by the selective activity of tra rather than the more superficially located abdominal muscles, such as the rectus abdominis (ra), io, and eo20 . In particular, unlike the case for ra, activity cannot be easily suppressed in eo while adim is being performed because of the anatomical characteristics of eo21 . In this study, 02 mmhg increases resulted in significant decreases in the eo contraction ratio compared to the 6 mmhg increase . The variation in eo contraction ratio resulting from 02 mmhg increases was similar to results reported in previous studies17, 18 in which adim was performed in the supine position using a feedback tool . However, the 02 mmhg increase resulted in an eo thickness that was 0.350.50 mm lower than that reported in a previous study19, in which adim was performed using the same method as in the present study, but without a pbu . Pressure increases of 02 mmhg also resulted in significant decreases in the io+eo contraction ratio compared to the 6 mmhg pressure increase and a significant increase in the tra preferential activation ratio . In the present study, while variations in tra thickness and the response of the tra contraction ratio to pressure variations did not show any significant differences between the resting state and adim, the variations in the tra preferential activation ratio showed significant differences between pressure increases of 02 mmhg and 6 mmhg . Given these results, pressure variations appear to regulate the thicknesses and contraction ratios of superficial muscles, such as io and eo, rather than those of tra, causing an indirect increase in the preferential activation ratio of tra . For 02 mmhg increases, the tra preferential activation ratio was higher than previously reported in studies using a feedback tool17, 18 and those shown by other pressure variations in the present study . Therefore, 02 mmhg increases are appropriate pressures for successful performance of adim . Among the subjects of the present study, 3 participants could not perform the exercise following a 6 mmhg increase and they were excluded from the final tests . Among the final subjects, only 5 participants (3 males, 2 females) succeeded in performing the exercise after an 8 mmhg increase . The other subjects had difficulty in performing adim after an 8 mmhg increase, since the movements of the pelvis and other joints were affected . In addition, almost all of the participants in the present study used many other movement strategies to perform adim when pressure was increased by up to 10 mmhg from 40 mmhg10,11,12 . Therefore, for successful adim, we recommend performing the exercise at a slightly increased pressure of about 02 mmhg . Since different movement strategies can be adopted at the same pbu pressure, the quantification of tra contraction using pbus has limitations11 . To solve this problem, all of the subjects in the present study performed the exercise in the same order and used the same method of contraction . However, since abnormal movement strategies were visually observed, we consider the lack of kinematic information for objective control of movement strategies is a limitation of the present study . We hope that future studies will account for these limitations and that diverse study tools will be applied to the investigation of abdominal muscle contraction ratios in relation to pressure variations for adim performance in the supine position.
Enantiomerically pure alcohols and amines constitute important synthetic building blocks and key targets in the manufacturing of a wide range of chemical products, such as agrochemicals, food additives, fragrances, and pharmaceuticals . Consequently, significant efforts have been dedicated to the enantioselective synthesis of these compounds, including catalytic protocols for carbon - heteroatom bond formation, hydrogenations of ketones / imines, nucleophilic addition to carbonyl compounds, and kinetic resolution (kr). Of these methods, enzymatic kr of racemic mixtures is the most common way to access enantiomerically pure alcohols and amines on an industrial scale, owing to its high performance in terms of activity and selectivity . For the kr of these compounds, the process can be made either (r)- or (s)-selective depending on whether a lipase or a serine protease is chosen as the enzymatic resolving agent . In most of the reported kr protocols of alcohols and amines, the enzyme resolves the racemic substrate through selective acylation of one of its enantiomers, which allows for the isolation of the enantiopure alcohol or amine using conventional purification techniques . The acyl group being transferred to substrate by the enzyme comes from a so - called acyl donor, which is added to the reaction in at least equimolar amounts in regard to the substrate . Since this transesterification process is fully reversible, highly activated esters or enol esters are commonly employed as acyl donors to push the reactions toward the formation of the acylated product . Unfortunately, enzymatic kr, as all other resolution methods, suffers from the limitation that the maximum theoretical yield is only 50% . An efficient way to overcome this drawback and achieve a theoretical yield of 100% is to combine the resolution process with in situ racemization in a so - called dynamic kinetic resolution (dkr) (scheme 1). To date, a variety of protocols for the racemization of alcohols and amines have been developed, and these involve for example acid / base catalysts, transition - metal complexes, metal nanoparticles, or enzymes . However, the design of a successful dkr system is far from simple, given that the following requirements must be fulfilled: (i) the kr must display a sufficient enantioselectivity (e value = kfast / kslow 20); (ii) the enzyme and the racemization catalyst must be compatible with one another; (iii) the rate of racemization (krac) must be at least 10 times faster than the enzyme - catalyzed reaction of the slow reacting enantiomer (kslow); and (iv) the racemization catalyst must not react with the product formed from the resolution . Among these requirements, the compatibility between the enzyme and racemization catalyst is generally the critical issue, since these catalysts often operate optimally under very different condition . It is also common that the racemization catalyst interferes with the enzymatic resolution or that the enzyme and its accompanying additives (e.g., surfactants and stabilizers) have an inhibitory effect on the racemization catalyst . As a result of this compatibility issue, the identification of reaction conditions that enable both high enantioselectivity of the kr and efficient racemization has been a reoccurring challenge within the field of dkr . This perspective summarizes the key features of the extensive research that has been dedicated to the chemoenzymatic dkr of alcohols and amines during the past two decades . The aim is to cover both the biological and chemical aspects of the dkr, by discussing topics ranging from the design of enzyme - compatible racemization catalysts to enzyme engineering . Further, we wish to point out the current state - of - the - art dkr protocols and their respective limitations, in an attempt to highlight novel avenues for future research . In 1996, williams reported the dkr of an allylic acetate derivative by the combinative use of pseudomonas fluorescens lipase and pdcl2(mecn)2 to give the corresponding allylic alcohol in 81% yield and 96% ee after 19 days (scheme 2a). In this reaction, the acetylated alcohol was deracemized by the coupling of a lipase - catalyzed ester hydrolysis to a racemization proceeding via palladium(ii)-mediated 1,3-acetate shift . Although, the reaction proceeded at an impractical rate, this seminal study was an important first step that demonstrated the possibility of combining transition metal catalysis with enzyme catalysis for achieving dkr . In a subsequent study, williams and co - workers developed a method for the dkr of secondary alcohols lacking adjacent c = c double bonds by utilizing racemization catalysts operating through a reversible hydrogen - transfer mechanism . Among the studied catalysts, rh2(oac)4 gave the best results and was combined with lipase - catalyzed transesterification, affording (r)-1-phenylethanol with 60% conversion and 98% ee (scheme 2b). Unfortunately, this method suffers from several critical drawbacks, such as a low conversion of the overall dkr and the necessity of both o - phenanthroline and acetophenone as additives for efficient racemization . However, despite the disadvantages of this particular dkr system, this study was important since it demonstrated the potential of using metal catalysts operating via transfer hydrogenation mechanisms as a general method for racemizing alcohols . This work became a great source of inspiration for subsequent catalyst design, triggering the development of a great number of racemization catalysts based on different transition metals, which all functioned through different transfer hydrogenation mechanisms (vide infra). Unfortunately, it is beyond the scope and purpose of this perspective to provide an in - depth mechanistic discussion for these transfer hydrogenative racemization processes, and thus we kindly refer interested readers to some recent reviews that cover this topic . Following the pioneering work of williams, the group of bckvall developed the first practical system for the dkr of secondary alcohols, which involved candida antarctica lipase b (calb) immobilized on acrylic resin (also known under the trade name novozyme-435) and shvo s dimeric ruthenium complex 1 (scheme 3). This protocol was found to be compatible with a wide range of aliphatic and benzylic alcohols, providing the corresponding (r)-acetates in high yields and ee s . A drawback of this dkr system is that the shvo complex 1 requires 70 c to efficiently split into the two monomeric species 1a and 1b, which mediates racemization through an outer sphere redox mechanism . Because of this heat activation, the shvo complex 1 can only be combined with thermostable lipases, which limits the number of enzymes that can be used in the dkr . For example, sensitive serine proteases that exhibit (s)-selectivity according to kazlauskas rule cannot be used together with 1 . Another issue of the shvo complex 1 was that it had to be used together with activated aryl esters such as p - chlorophenyl acetate, since simpler alkenyl acetates as acyl donors were found to interfere with the racemization and lead to substantial formation of ketone side products . Despite these limitations, complex 1 has been successfully combined with several lipases for the dkr of -azido alcohols, benzoins, -halo alcohols, heteroaryl ethanols, hydroxylalkanephosphonates, -hydroxy amides, hydroxyl acid esters, hydroxyl aldehydes, -hydroxy alkyl sulfones, and -nitrile alcohols . In addition, complex 1 has been applied as racemization catalyst in the dkr of -substituted primary alcohols, where racemization occurs through enolization of the intermediate aldehydes . Subsequent research aimed at discovering more active catalysts that could efficiently racemize alcohols under milder reaction conditions, enabling the use of a wider range of enzymes for dkr . The group of park reported on (-indenyl)rucl(pph3)2, 2, as an efficient racemization catalyst for alcohols at room temperature, which unlike 1 only produced negligible amounts of ketone byproduct . However, a severe drawback of complex 2 is that it requires koh to display catalytic activity, which is detrimental for applications in dkr as the base can hydrolyze the product acetates and also cause enzyme deactivation . It was later found that complex 2 could instead be activated by o2 and et3n, but unfortunately a higher reaction temperature (60 c) was needed for efficient racemization in this case . In the latter study, complex 2 was successfully combined with pseudomonas cepacia lipase (ps - c) for the dkr of a small scope of simple secondary alcohols (scheme 4). The initial success achieved by combining enzymes with ruthenium - based complexes strongly influenced the subsequent research within the field of dkr, which resulted in the development of a number of protocols utilizing different transfer hydrogenation - type ruthenium complexes as the racemization catalyst . However, the first main breakthrough came in 2002 when the group of park prepared the monomeric ruthenium aminocyclopentadienyl complex 3 and demonstrated that it could efficiently racemize secondary alcohols at room temperature . Unlike complex 1, this racemization catalyst did not require any heat activation but was activated by kotbu . In contrast to koh, kotbu shows a higher compatibility with most dkr systems commonly used . Complex 3 was successfully paired with novozyme-435 for the synthesis of a variety of functionalized aliphatic and benzylic (r)-acetates in high yields and ee s at room temperature (scheme 5). An advantage of this dkr protocol was that the cheap and readily available isopropenyl acetate could be used as the acyl donor instead of activated esters, such as p - chlorophenyl acetate . Unfortunately, the dkr reactions were found to progress slowly, requiring reaction times of up to 7 days, which is in sharp contrast to the separate racemization and kr reactions, which were generally complete within a few hours . This significant difference in efficiency between the dkr and the separate reactions suggests that complex 3 and calb are not fully compatible with one another, leading to partial deactivation of both catalysts . Because of its good racemization activity at room temperature, complex 3 could also be combined with the more sensitive protease subtilisin carlsberg, which opened up for (s)-selective dkr protocols of secondary alcohols . In addition, the group of kim and park has in a recent study demonstrated that complex 3 can be used together with ionic surfactant - stabilized burkholderia cepacia lipase for the dkr of allylic secondary alcohols at room temperature in excellent yields and ee s . Shortly after the development of 3, the group of bckvall prepared a related monomeric ruthenium pentaarylcyclopentadiene complex 4, which proved to be a highly efficient catalyst that managed to fully racemize enantiomerically pure 1-phenylethanol within 10 min, even at catalyst loadings as low as 0.5 mol% . This racemization catalyst displayed many similarities to complex 3, both in terms of structure and activation method; however, the absence of an amino - functionality in the cyclopentadienyl ligand resulted in an improved compatibility with enzymes . Thus, combination of complex 4 with calb (novozym-435) afforded a fast dkr of secondary alcohols, e.g., 1-phenylethanol was transformed to its acetate in high yield and> 99% ee in 3 h. complex 4 paved the way for a new generation of dkr and dynamic asymmetric transformation (dykat) protocols involving several different enzymes, many of which had not been possible to incorporate previously . Dkr protocols utilizing complex 4 have been applied to the deracemization of a wide range of functionalized secondary alcohols in excellent yields and ee s, including aliphatic alcohols, allylic alcohols, chlorohydrins, diols, homoallylic alcohols, and n - heterocyclic 1,2-amino alcohols (figure 1). In the case of the dkr of 1-phenylethanol, a large scale reaction with only 0.05 mol% of complex 4 was carried out on a 1 mol - scale to furnish 159 g (97% yield) of the corresponding (r)-acetate in 99.8% ee . Dkr and dykat systems involving complex 4 have also been employed in the synthesis of several biologically relevant molecules and pharmaceuticals . As with complex 3, the racemization activity of 4 at room temperature allowed it to be combined with subtilisin carlsberg for (s)-selective dkr protocols . For some chlorohydrins and for alcohols containing a distant olefin group, such as homoallylic alcohols and 5-hexen-2-ol, racemization occurs significantly slower with ruthenium - based catalysts such as 4, which calls for increased reaction temperatures in the dkrs . For these substrates, further research into more efficient racemization protocols one promising way to achieve a more efficient racemization of chlorohydrins could perhaps be to match the electronic properties of catalyst and substrate as recently reported by the group of bckvall . In this study, it was found that a highly electron - deficient analogue of complex 4 gave a 1030 times faster racemization of chlorohydrins than the standard catalyst . The authors ascribed the improved racemization rate to the higher efficiency of the electron - deficient catalyst in abstracting the hydride from this electron - deficient class of substrates . In recent years, several analogous enzyme - compatible racemization catalysts based on the cyclopentadienyl ruthenium core have been synthesized (figure 2). Particularly, the group of kim and park has made several key contributions to the field of alcohol dkr by developing ruthenium - based racemization catalysts exhibiting improved stability and broader scope . One of these catalysts is the benzyloxy derivative 5 that has been used as a racemization catalyst in the dkr of a number of aliphatic and benzylic secondary alcohols under air atmosphere . The possibility to run the reactions open to air constitutes a significant practical improvement compared to the previous systems involving catalysts 3 and 4, which both require the use of dry and inert conditions to prevent catalyst deactivation . Another advantage of the benzyloxy motif was that it could be exploited as a handle for linking 5 onto polystyrene to create a heterogeneous version . Interestingly, the dkrs involving the polymer - bound catalyst 6 gave comparable results in terms of yield and ee to those employing homogeneous 5, demonstrating that heterogenization of the catalyst had a negligible effect on the racemization activity . Moreover, catalyst 6 exhibited good recyclability that allowed it to be reused three times in the dkr of 1-phenylethanol, where the (r)-acetate could be obtained in 95% yield and 99% ee over all cycles . In a subsequent study, catalyst 6 was employed in the key step of the synthesis of the enantiomerically pure pharmaceutical ()-rivastigmine . Kim, park, and co - workers have also developed another air - stable analogue of complex 4 by replacing one of its carbon monoxide ligands with pph3 . The resulting catalyst 7 could be activated at room temperature by ag2o and used together with novozyme-435 for the dkr of a small set of aliphatic and benzylic alcohols in excellent ee s . Recently, the group of kim and park reported on an interesting ruthenium complex 8 containing an acyl substituted cyclopentadienyl ligand . This catalyst allowed for a significant extension of the scope of enantiomerically pure secondary alcohols that can be accessed through chemoenzymatic dkr . By combining catalyst 8 with ionic surfactant - coated burkholderia cepacia lipase, the dkr of a variety of secondary alcohols was accomplished at 2560 c, including -arylpropargyl alcohols, b(pin)-substituted benzylic alcohols, -chloro alcohols, and tms - propargyl alcohols . The groups of leino and kanerva reported on the preparation of the related pentabenzylcyclopentadienyl ruthenium complex 9, which displayed comparable activity and scope of utility to that of complex 4 . However, an advantage of 9 is that its benzyl - substituted ligand can be conveniently synthesized on a large scale from the simple and cheap starting materials cyclopentadiene and benzyl alcohol . This can be compared to the syntheses of complexes 1 and 3 - 8, which require the significantly more expensive precursor tetraphenylcyclopentadienone . Another useful racemization catalyst, which does not require the use of strong alkoxide bases, was very recently reported by nolan and co - workers . The cationic ruthenium indenyl complex 10 is efficiently activated by the mild base, k2co3, and was successfully combined with novozyme-435 for the dkr of a variety of secondary alcohols in high yields and ee s at room temperature . Recently, the group of martn - matute showed that a ruthenium catalyst, formed in situ from the readily available complex [ru(p - cymene)cl2]2 and the ligand 1,4-bis(diphenylphosphino)butane, could be employed in combination with lipase tl from pseudomonas stutzeri for the efficient dkr of -hydroxy ketones at room temperature . The dkr of these substrates provides straightforward access to a variety of functionalized molecules, such as enantiomerically pure amino alcohol and diol derivatives . So far this perspective has mainly described protocols employing ruthenium - based racemization catalysts, but it is important to also highlight the work on secondary alcohol dkr that involves other metals . For instance, feringa, de vries, and co - workers have developed a procedure for synthesizing enantiomerically pure epoxides in one step from the corresponding chlorohydrins, by utilizing the cationic iridacycle 11 together with a doubly mutated haloalcohol dehalogenase (hhec) in a biphasic system comprising toluene and 50 mm hepes buffer (scheme 6). As with the monomeric ruthenium - based racemization catalysts 3 - 9, iridacycle 11 was activated by kotbu, enabling efficient dkr at room temperature . Iridacycle 11 displayed an intriguing complementary reactivity to the ruthenium systems by exhibiting a significantly higher racemization activity and selectivity toward chlorohydrins compared to conventional benzylic secondary alcohols . Another iridium - catalyzed protocol for the base - free dkr of nonfunctionalized aliphatic and benzylic secondary alcohols was disclosed by marr et al . This dkr utilized a series of piano - stool-type iridium nhc complexes together with calb . A general topic of concern regarding ruthenium- and iridium - based catalytic systems for racemization is the relatively high cost and low natural availability of these metals . Therefore, efforts have been made to develop more cost - effective and readily accessible metal catalysts . An example addressing this requirement is the alme3/binol / calb system designed by berkessel et al ., which was used for the dkr of both aliphatic and benzylic alcohols at room temperature . In addition, a number of vanadium - based catalytic protocols for the dkr of alcohols have been developed during the past decade . Akai and co - workers demonstrated that the oxyvanadium(v) complex [vo(osiph3)3)] could racemize secondary allylic alcohols through 1,3-transposition of the hydroxyl group under mild reaction conditions . Accordingly, this catalyst was found to be compatible with several lipases, such as burkholderia cepacia lipase, novozyme-435 and pseudomonas fluorescens lipase, which allowed for dkr of a wide range of linear and cyclic allylic secondary alcohols . Moreover, the developed methodology could be used to transform a stereoisomeric mixture of dienols into a single dienyl acetate product in excellent yield and ee (scheme 7). The authors also prepared heterogeneous analogues of this oxyvanadium(v) catalyst, which were immobilized on both a polymer and a mesoporous silica . The latter heterogeneous catalyst proved to be recyclable over six cycles without any loss in activity, and furthermore, it was capable of racemizing benzylic, heteroaromatic and propargylic alcohols . The ability of this catalyst to mediate the racemization of substrates lacking the allylic alcohol motif indicates that it can also operate through a more general dehydrative mechanism proceeding via a carbocation intermediate . Another heterogeneous protocol for the dkr of secondary alcohols involving vanadium catalysis was reported by wuyts et al . In this system, voso4 was combined with novozyme-435 to achieve deracemization of several benzylic alcohols in octane at 80 c . There are also a number of reports on the use of heterogeneous acids and zeolites as racemization catalysts together with lipases for dkr of secondary alcohols . However, the major limitation of most of these protocols is that they can only racemize alcohols through a dehydration mechanism, which limits their scope to substrates that can form stable carbocations . Furthermore, many of these systems suffer from reduced yields of the desired dkr products due to substantial formation of elimination side products . In sharp contrast to secondary alcohols, tertiary alcohols are a significantly more cumbersome class of substrates for which there exist no practical dkr protocols . Although, there are a few enzymes that can resolve tertiary alcohols, it has proven difficult to couple these kr processes to in situ racemization . Since the quaternary stereocenter of tertiary alcohols lacks a hydride substituent, it is not possible to utilize any of the transfer hydrogenation - type racemization catalysts . Thus, the list of available racemization catalysts for tertiary alcohols is primarily limited to those operating through dehydrative mechanisms (e.g., lewis acids or vanadium catalysts) proceeding via the formation of a tertiary carbocation . The latter carbocation intermediate is formed much more readily than the corresponding secondary one, which should facilitate the racemization of tertiary alcohols . The development of a general and practical dkr protocol for tertiary alcohols would be considered as an important milestone within the field of asymmetric synthesis, given the high prevalence of this structural motif in natural products and pharmaceuticals . As with alcohols, there are a variety of efficient methods for obtaining enantiomerically pure amines by the use of enzymatic kr . However, the available dkr protocols are drastically fewer in number due to the lack of efficient amine racemization catalysts . The main reason for the difficulty of racemizing amines is that they can act as strong coordinating ligands, which may lead to inhibition or even complete deactivation of the metal catalysts . Thus, high temperatures are generally required to disrupt this undesired coordination and promote the racemization reaction . As previously discussed, the use of elevated reaction temperatures is undesirable from a dkr perspective, since it restricts the set of enzymes that can be employed . An additional challenge associated with the racemization of amines is that the generated imine intermediate is highly reactive and can thus take part in several side reactions, which reduces the yield of the desired dkr product . For example, the imine is prone to undergo hydrolysis into the corresponding ketone in the presence of water . The imine intermediate can also be subject to nucleophilic attack by another amine molecule to produce an aminal, which upon elimination of an ammonium ion forms a secondary imine that can be further reduced to a secondary amine byproduct . It has been found that both of these side reactions are usually favored by an elevated temperature, which further highlights the importance of efficient and mild amine racemization protocols . The first dkr of an amine was reported by reetz and schimossek in 1996, where resolution of 1-phenylethylamine was accomplished by coupling calb - catalyzed amine acylation to pd / c - catalyzed racemization . Unfortunately, the dkr reaction, which was performed in triethylamine at 5055 c using ethyl acetate as the acyl donor, was found to proceed slowly, and despite a reaction time of 8 days, it only gave a moderate conversion of 60% . Following this work, the group of bckvall demonstrated that the shvo dimer 1 can be used as an efficient racemization catalyst for primary amines at 110 c . As a result of the high temperature, the enzymatic resolution was run separately at a lower temperature, and therefore the racemization and resolution had to be done stepwise . However, this problem was later circumvented by changing to the methoxy - substituted shvo analogue 12, which enabled efficient racemization at 90 c . By using complex 12 together with novozyme-435, the one - pot dkr of several aliphatic and benzylic primary amines was achieved in high yields and excellent ee s (scheme 8). This protocol enabled the dkr of 1-phenylethylamine to be performed on a multigram scale, with a low catalytic loading (1.25 mol%) and with a substrate concentration of up to 0.9 m, affording the corresponding (r)-amide in good isolated yield and 98% ee . A noteworthy feature of the dkr protocol involving 12 was that isopropyl acetate could be used as the acyl donor . Although, this acyl donor may seem as the ideal choice given its low price and high availability, the use of carboxylic esters as acylating agents is generally undesired in amine dkr as they give an amide product that requires harsh reaction conditions to be reconverted back to the amine . Commonly, strong acids and elevated temperatures are required to cleave the stable amide bond, which may be detrimental for substrates containing sensitive functional groups . To address this issue, bckvall and co - workers developed an improved procedure for the dkr of both aliphatic and benzylic primary amines involving complex 12 and calb that worked efficiently with dibenzyl carbonate as the acyl donor . In contrast to the amide functionality, the installed benzyloxy carbonyl group can be easily removed under mild reaction conditions through pd - catalyzed hydrogenolysis . Together, the broad substrate scope involving both aliphatic and benzylic primary amines, the possibility of using carbonate - based acyl donors and the scalability make this catalytic protocol one of the most practical methods for the dkr of primary amines available to date . The group of bckvall has also demonstrated that complex 12 can be used in combination with the related enzyme candida antarctica lipase a (cala) immobilized on siliceous mesocellular foam (mcf) for the dkr of -amino esters . Inspired by the seminal findings of reetz and schimossek, several research groups continued to study heterogeneous racemization protocols based on palladium for application in amine dkr . The first steps toward a practical dkr method for amines using this strategy were taken by jacobs and co - workers with their investigation on how alkaline earth supports affected the racemization activity of immobilized pd particles . Among the tested catalysts, pd on baso4 was found to exhibit the highest activity and selectivity . The dkr with this racemization catalyst was performed at 70 c under 0.1 bar of h2, using novozyme-435 as the resolving agent and either ethyl acetate or isopropyl acetate as the acyl donor . Under these reaction conditions, a range of benzylic primary amines were converted into the corresponding (r)-amides in high yields and ee s within 2472 h (scheme 10). Andrade et al . Later demonstrated that this protocol can also be applied for the dkr of selenium - containing benzylic primary amines with good results . However, a significant drawback of this dkr system is that it is limited mainly to benzylic amines, while aliphatic primary amines generally react too slowly . The only aliphatic amine that was tolerated by this system was 1-methyl-3-phenylpropylamine, which contained a distant aryl group that was most likely the reason for the success . Despite, the presence of an aromatic moiety in the structure, this aliphatic amine was found to racemize significantly more slowly than the benzylic substrates and thus the corresponding dkr required both elevated temperatures and longer reaction times to give satisfactory results . In a subsequent study, the group of de vos demonstrated that the activity and selectivity of the pd / baso4 and pd / caco3 catalysts in the racemization of primary amines could be improved by using microwave irradiation as an alternative heating method . The reason for this phenomenon is that metal clusters are capable of efficiently absorbing microwave irradiation, which results in the generation of so - called hot - spots that can reach a temperature that exceeds that of the surrounding reaction media . The use of microwave irradiation was also found to lead to faster dkrs, although the ee s of these reactions were generally lower than those performed with conventional heating in an oil bath, because of a more facile background chemical acylation under the employed microwave conditions . A useful dkr method involving heterogeneous palladium has been reported by kim, park and co - workers (scheme 9). In this protocol, nanoparticulate pd immobilized on alo(oh) is employed as the racemization catalyst together with novozyme-435 . This catalyst combination proved effective in the dkr of a range of benzylic primary amines, enabling the preparation of the corresponding (r)-amide products in high yields and excellent ee s . However, in line with the protocol developed by jacobs and co - workers, this catalytic system required significantly harsher reaction conditions for the dkr of aliphatic substrates (12 mol% pd, 100 c and 1 atm h2). Interestingly, both the pd nanocatalyst and the enzyme could be recycled eight times in the dkr of 1-methyl-3-phenylpropylamine without any observable decrease in either conversion or ee . In a subsequent study, the group of kim and park extended the scope of this method to also include -amino amides . In addition, bckvall and co - workers have applied the pd / alo(oh) catalyst in combination with cala - mcf for the dkr of -amino esters . Xu et al . Reported on the preparation of a heterogeneous racemization catalyst based on pd immobilized on a layered double - hydroxide - dodecyl sulfate anion support and demonstrated that it could be used with novozyme-435 for the dkr of benzylic primary amines at 55 c . Unfortunately this protocol suffered from several drawbacks, such as high catalyst loadings, dilute substrate concentrations, and the need of the activated ester 4-chlorophenyl valerate as acyl donor . Recently, the group of bckvall also developed a palladium - based heterogeneous racemization catalyst, consisting of 1.53.0 nm - sized pd nanoparticles immobilized on aminopropyl - functionalized mcf (amp - mcf). This pd nanocatalyst (pd - amp - mcf) exhibited high activity in the racemization of 1-phenylethylamine, and moreover it displayed good enzyme - compatibility that allowed it to be used in dkr . The pd - amp - mcf catalyst was combined with novozyme-435 for the dkr of a range of primary benzylic amines at 70 c, producing the corresponding (r)-amides in high yields and excellent ee s (scheme 10). Furthermore, by increasing the catalytic amount of palladium from 1.25 to 5.0 mol% it was possible to maintain an efficient racemization even at 50 c, which allowed the catalyst to be used in a dkr of 1-phenylethylamine with the sensitive enzyme amano lipase ps - c1 (burkholderia cepacia lipase immobilized on ceramic beads). Remarkably, this is the first time that amano lipase ps - c1 has been successfully utilized in a dkr of an amine . It is also important to highlight the fact that the amount of pd nanocatalyst used in these dkr reactions with reasonably short reaction times is lower than previously reported for primary amines and that the reactions are run at a substrate concentration of 0.4 m, which is significantly higher than that used in previously reported systems . Other practical advantages of the pd - amp - mcf were that it displayed high stability and low leaching, which allowed it to be recycled up to four times in the dkr of 1-phenylethylamine without any observable decrease in performance . As with other palladium - based systems, this dkr system does not work well for aliphatic amines . The group of li has also studied this system for the dkr of primary amines; however, they used a slightly different version of the pd - amp - mcf catalyst that was impregnated with k2co3 and contained a lower palladium loading than the one used by bckvall and co - workers (2.0 versus 8.0 wt% pd). Even though this alternative protocol allowed for an efficient and selective dkr of several amines, it is difficult to compare its performance to the system published by the group of bckvall, as it was studied under very different reaction conditions involving increased enzyme loadings and significantly lower substrate concentrations . The mcf material that was employed by the group of bckvall and li to support the pd nanoparticles has also been used to immobilize cala . With this versatility of the mcf in mind, the group of bckvall explored the possibility of co - immobilizing pd nanoparticles and an enzyme into the cavities of this support . This was done by first preparing the pd - amp - mcf catalyst with a moderate loading of palladium to leave a number of free aminopropyl groups for the enzyme, then functionalizing the free aminopropyl groups of the support with glutaraldehyde, and finally exploiting the aldehyde groups as linkers for the anchoring of calb . By this co - immobilization strategy, a metalloenzyme - resembling bifunctional catalyst was obtained that can perform both racemization and kr (figure 3). This hybrid catalyst was evaluated in the dkr of 1-phenylethylamine using ethyl methoxy acetate as the acyl donor under 1 atm . Of h2 at 70 c . Under these conditions the desired (r)-amide product was obtained in 99% yield and 99% ee within 16 h. interestingly, the reaction involving the hybrid catalyst was found to proceed faster than that of separately supported pd(0)-amp - mcf and calb - mcf, highlighting that the close proximity of the two catalysts increases the rate of the dkr . The hybrid catalyst could be recycled, but unfortunately it was found to exhibit diminished activity from the third cycle as a result of partial enzyme denaturation caused by the hydrophilic silica support surface . Dkr of an amine with a bifunctional biomimetic catalyst in which pd nanoparticles and a lipase (calb) are co - immobilized in mcf . It is not only palladium- and ruthenium - based racemization catalysts that have been employed in amine dkr systems . The group of de vos showed that both raney ni and raney co catalysts could be combined with novozyme-435 for the dkr of primary amines . Unfortunately, these dkrs were found to proceed slowly, and even though they were performed at 7080 c for 25 days, the conversions and ee s were generally low . On the other hand, this catalytic system displayed an interesting preference for aliphatic primary amines, allowing for a faster dkr of these substrates . Surprisingly, by following the ee of the starting material throughout the reaction, it was established that the long reaction time was due to a rate - limiting kr process . Normally, the enzymatic kr of primary amines should proceed fast at these high temperatures . These results therefore suggest that the raney metal catalysts have an inhibitory effect on the enzyme . It was found that enzyme poisoning was caused by leaching of cobalt and nickel ions and that this problem could be circumvented by performing the kr and racemization in separate pots in a successive manner . However, this greatly diminished the practical utility of this dkr protocol . Another interesting dkr system based on homogeneous [ircp*i2]2 and candida rugosa lipase was reported by page and co - workers and was used for the deracemization of a secondary amine on a multigram scale . The dkr of secondary amines is significantly more challenging, because the extra substituent on the nitrogen brings additional steric bulk that prevents the substrate from being accepted by the enzyme . Despite the fact that several secondary amines could be efficiently racemized by the iridium catalyst, the authors only managed to construct a working dkr for one isoquinoline derivative (scheme 11). In nature, the stereoinversion of some amino acids is carried out by a family of racemases that utilize pyridoxal phosphate as the catalytically active prosthetic group . These enzymes operate through a so - called schiff base - type mechanism, where the catalytically active pyridoxal phosphate group reacts with an amino acid to produce an imine intermediate, from which racemization occurs via a base - mediated enamine - imine interconversion . Inspired by this class of natural racemases, felten et al . Developed a synthetic active - site analogue by complexating zn(otf)2 to picolinaldehyde this racemization catalyst was successfully combined with the enzyme alacase (another name for subtilisin carlsberg) for the dkr of a small series of -branched amino acids in high enantioselectivity at room temperature . Recently, several reports on metal - free methods for the dkr of amines have appeared . The group of gil and bertrand has shown that racemization of amines can be achieved by the use of in situ generated sulfanyl radicals and that it is possible to couple this process to enzymatic acylation . Although this method has so far only been applied to the dkr of simple primary amines containing no or little functionality, it is promising since the racemization occurs under mild reaction conditions, which enables the use of sensitive proteases . Another well - established method to racemize amino acid derivatives containing acidic -protons is to employ a base that is sufficiently strong to deprotonate these substrates . For example, tessaro and co - workers have successfully utilized the organic base 1,8-diazabicycloundec-7-ene (dbu) as a racemization catalyst in the mild dkr of several amino acid derivatives by combining it with subtilisin - catalyzed thioester hydrolysis . So far, this perspective has focused almost entirely on the design of efficient racemization catalysts as a means to broaden the scope of the dkr methodology . However, it is important not to overlook the considerable amount of work that has been done to improve enzymes as biocatalysts . The properties of an enzyme can be improved by immobilization, cross - linking, surfactant - stabilization, or enzyme engineering / directed evolution . The latter topic has been greatly propelled by advances in the field of molecular biology and genetic engineering, which has led to the development of new recombinant technologies that makes it possible to incorporate tailor - made dna fragments into organisms, such as escherichia coli and pichia pastoris, and use them as hosts for the expression of mutant enzymes with novel properties . Unfortunately, it is beyond the scope of this perspective to summarize all key contributions to this vast research area, and therefore we kindly refer interested readers to a number of excellent recent reviews that cover this topic thoroughly . Instead, our aim is to describe some selected techniques that we believe have the potential of making an impact on the field of alcohol and amine dkr . A classical way to improve the thermostability of enzymes and thus make them available for a wider range of dkr protocols is to immobilize them on a heterogeneous support . In fact, the majority of the commercially available enzymes that are used for dkr today are already supported on various types of carriers, including ceramic beads, diatomaceous earth, ionic liquids, resins, and silicas . In addition to improving the thermostability, the immobilization of enzymes also lead to several practical advantages, such as easier handling, simpler separation, and possibilities of recycling . Another intriguing method to improve the general performance of enzymes is to polymerize them into so - called cross - linked enzyme aggregates (cleas) by the use of a bifunctional cross - linking agent . Typically, glutaraldehyde is used for this purpose as it can react with free lysine residues on the surface of two neighboring enzyme molecules and covalently link them together through stable schiff - base - type bonds . This cross - linking leads to the formation and precipitation of large insoluble enzyme aggregates, which can be easily separated by either centrifugation or filtration . Remarkably, these cleas often display comparable catalytic activity to that of the free enzyme, suggesting that the enzyme is locked in its active conformation in the aggregate and that diffusion of substrate into the enzyme s active site is not significantly hindered . Furthermore, this aggregation strategy has been shown to lead to dramatic improvements of the stability of the enzyme toward elevated temperatures, hostile solvents, and autoproteolysis . These improvements are a direct consequence of the decrease in flexibility, which suppresses deactivation through denaturation . An additional advantage of the clea methodology is that it combines the processes of enzyme purification and immobilization into a single operation . Consequently, it is possible to apply this method directly on crude extracts instead of pure enzyme solutions . Today, a substantial number of cleas based on lipases and proteases have been developed and successfully used for the preparation of enantiomerically pure alcohols and amines . Despite these achievements, there is to the best of our knowledge only one group, who has so far studied clea for applications in dkr . Tessaro and co - workers studied the advantages of the clea methodology in dkrs of amino acid derivatives involving subtilisin carlsberg and dbu . Here, subtilisin carlsberg was found to exhibit a higher tolerance to dbu when it was turned into a clea, which enabled a more efficient dkr . The promising results from this work suggest that the clea methodology could find applications in other dkr protocols as well . For example, in the case of amine dkr, where the racemization catalysts require elevated reaction temperatures, there is a need for thermostable enzymes and here the use of cleas could be advantageous . An alternative approach to prepare heterogeneous enzyme composites reminiscent of the clea methodology was recently reported by the group of zare . In this method, flower - shaped protein - inorganic hybrid nanostructures could be generated upon addition of cu(ii) ions to enzymes, such as cala, carbonic anhydrase, laccase, and -lactalbumin . As in the case with the cleas, the nanoflowers were shown to exhibit a significantly higher thermostability than the free enzymes . Interestingly, the nanoflowers also exhibited significantly enhanced catalytic activities, which were ascribed to the high surface area and the confinement of the enzymes in the nanoflowers . Synthesized a similar protein - inorganic hybrid by mixing calb with pd(oac)2 in aqueous media . In this reaction, the calb acts as a reducing agent for the pd(ii) ions, which leads to the formation of small pd nanoparticles within the emerging polymeric enzyme composite . The pd / calb composite was shown to display both acylation and racemization activity, which allowed it to be employed as a bifunctional catalyst in the dkr of 1-phenylethylamine in excellent yield and ee (scheme 12). For most dkr applications, it is crucial that the enzyme operates efficiently in organic solvents since most substrates and racemization catalysts are not soluble in aqueous media . One way to improve the activity and stability of a protease in organic solvents is to coat it with a lipid or surfactant before lyophilization . This treatment generates a reversed micelle around the enzyme with concomitant solubilization of small amounts of water, which provides the protease with a stable aqueous microenvironment that is maintained even when it is suspended in an organic solvent . Several examples on the successful use of surfactants to stabilize enzymes and enable dkrs have already been presented in this perspective . Alternative ways of obtaining enzyme mutants with improved properties involve rational enzyme design and directed evolution . In the rational design approach, amino acid residues that are anticipated to play a key role for the function of the enzymes are first identified by the means of for example x - ray crystallography, homology studies, or computational models . These amino acids are then selectively replaced by other amino acid residues that are expected to yield a mutant variant displaying the desired properties . Unfortunately, the structural information on the enzyme that is needed to guide such efforts is in most cases limited, which imposes a severe restriction on when this methodology can be utilized . In fact, even with this knowledge in hand, it is often difficult to predict what structural modifications that should be incorporated in order to improve the performance of the enzyme . This is because our understanding of the chemical principles that govern the function and stability of enzymes is still very limited . Despite this issue, rational design has been successfully used at multiple occasions for improving the performance of lipases . For example, hult and co - workers used a rational design approach to create a calb mutant that exhibited reverse enantioselectivity (s) as well as an improved substrate tolerance toward bulky secondary alcohols . Interestingly, this dramatic alteration of the catalytic properties was achieved by exchanging a single amino acid residue in the so - called stereospecificity pocket of the enzyme . In the wild - type calb, the fast - reacting enantiomer places its medium - sized group in the stereoselectivity pocket and its large group toward the entrance of the active site . The access of the large group to the stereoselectivity pocket is effectively prevented by three sterically demanding amino acid residues: thr42, ser47 and trp104 . The authors identified that a mutant with fundamentally different substrate preference could be generated by changing the sterically demanding trp104 to a smaller alanine residue . Subsequently, bckvall and co - workers used this enzyme variant, denoted as calb w104a, together with complex 4 for the (s)-selective dkr of a series of bulky 1-phenylalkanols in high yields and ee s (scheme 13). Following this study, the group of bckvall and hult explored calb w104 as the resolving enzyme for diarylmethanols; however, satisfactory e values were only obtained for substrates where the two aryl substituents differed significantly in size . As a result, the development of a dkr protocol for the latter substrate class was never pursued . The group of kim and park recently solved the dkr of this substrate class by using ruthenium complex 8 together with activated lipoprotein lipase . Recently, ema, sakai, and co - workers redesigned burkholderia cepacia lipase by introducing two alterations, i287f and i290a, into the catalytically active site using a rational design approach . This double mutant removed a substantial part of the steric congestion in the active site, which enabled this enzyme variant to accept a wide range of extremely bulky secondary alcohols . Furthermore, it was found that the phenylalanine residue introduced at position 287 could participate in an additional c h/-interaction with the substrate alcohol, which helped to stabilize the transition state of the acylation reaction and led to an improved (r)-selectivity of the enzyme . Although, the authors only evaluated this burkholderia cepacia lipase variant for kr purposes, it is reasonable to envision that a mild dkr protocol could be constructed by combining this enzyme with any of the available ruthenium - based racemization catalysts . In comparison to rational design, generation of large enzyme libraries with subsequent screening and selection (e.g., directed evolution) is a more useful method for accessing enzyme mutants with improved properties . In this directed evolution approach, natural evolution is artificially mimicked under laboratory settings to create a darwinian - type selection process that will favor emergence of a desired mutant . In practice, this is done by performing iterative cycles of: (i) generation of gene libraries from the parent wild - type enzyme by the use of various mutagenesis techniques; (ii) expression of the corresponding enzymes from the gene libraries; (iii) screening of the enzyme mutants for a desired property using various high - throughput methods; and (iv) selecting an improved mutant as a template for the next round of mutagenesis / expression / screening (figure 4). To date, the directed evolution methodology has been successfully used to modulate several properties of enzymes, including solvent tolerance, thermostability, and higher enantioselectivity for a broader scope of substrates . Schematic representation of the directed evolution methodology, where an iterative number of mutagenesis, expression, screening and selection cycles is conducted until an enzyme mutant with desired properties has been obtained . The field of alcohol dkr has certainly advanced significantly during the past two decades and reached a high level of maturity . Today, a wide range of functionalized primary and secondary alcohols can be efficiently resolved by the use of chemoenzymatic dkr . The key to this progress has been the successful design of several racemization catalysts, particularly those based on ruthenium, that can racemize alcohols under mild reaction conditions, thereby enabling the use of an increased number of enzymes . Ultimately, it is the enzyme component of the dkr that determines what types of substrates that can be resolved and which enantiomer of the product that is favored . Therefore, it is essential to have access to dkr protocols that involve a variety of enzymes . So far, lipases have been the enzymes of choice for dkrs, owing to their high activity and selectivity . Moreover, these enzymes are associated with a number of practical advantages, including high commercial availability, high thermostability, and good tolerance toward organic reaction media . However, as mentioned previously most naturally occurring lipases preferentially give (r)-selective resolution of secondary alcohols, and this imposes a limitation for the dkr, since the (s)-product cannot be accessed directly . It is therefore important to have access to (s)-selective enzymes so that the (s)-product can be prepared directly by dkr . Examples of (s)-selective enzymes in kr of alcohols are serine proteases, but they are unfortunately not very thermostable . For most secondary alcohols, racemization can be accomplished in reasonable times at room temperature thanks to the most recently developed ruthenium catalysts, which enable dkr systems involving serine proteases . However, for certain challenging substrate classes, such as chlorohydrins and alcohols containing distant olefin groups, the performance of the available ruthenium catalysts is not sufficient to allow for mild dkr s, and here there exists an opportunity for new catalyst design . Another important topic of research within the field of alcohol dkr is to develop efficient racemization protocols for tertiary alcohols, which are compatible with the currently available enzymatic kr processes . In contrast to alcohols, the available dkr systems for amines are significantly fewer in number due to challenges associated with the racemization of these substrates . Despite the considerable amount of research that has been dedicated to amine dkr, most of the reported protocols still involve racemization catalysts that require high reaction temperatures to function efficiently, which greatly restrict the set of enzymes that can be employed . Moreover, the majority of these dkr protocols have only been successful with substrates that are readily racemized, such as -amino acid derivatives and benzylic amines . When it comes to aliphatic amines, the available dkr protocols are significantly fewer in number and generally involve harsh reaction conditions . Here, the recently developed metal - free methods to racemize amines by the use of sulfanyl radicals show great promise and might hold the key to mild dkr of both aliphatic and benzylic amines . However, a major concern regarding the racemization by sulfanyl radicals is that it has so far only been combined with a limited number of enzymes, and it is still unclear how widely applicable this method is for dkr . Research efforts dedicated toward improving the enzyme component will also play an important role in advancing the field of alcohol and amine dkr . With available molecular biological techniques, chemists now have access to methods for improving and expanding the portfolio of enzymes provided by nature . In particular, evolution of enzymes via generation of large libraries with subsequent screening and selection is a highly useful method for obtaining new enzyme variants with improved properties . Until very recently, all screening studies on lipase libraries for increased enantioselectivity had dealt with the hydrolysis of esters in an aqueous medium . However, most dkrs of alcohols and amines are carried out as transacylations in an organic solvent . Recently, a method was reported that enables evolution of a lipase for transacylation of secondary alcohols in organic solvent, and it was demonstrated that cala gave a double mutant (calay93l / l367i) with a significantly improved e value, 100 vs 3, in the transacylation of 1-phenylethanol in isooctane . This method is promising and may provide new improved enzymes for the dkr of alcohols and amines . Another promising technique to improve the thermostability of enzymes is the clea methodology, where enzymes are converted into heterogeneous aggregates through treatment with a bifunctional cross - linking agent . It is expected that the clea methodology will find future applications in dkr of alcohols and amines.
Over - the - counter (otc) and prescription drug misuse are the nonmedical use of medication, which is used without a prescription or for the feeling caused by the drug . Otc and prescription drugs are fast becoming the drugs of choice for adolescents, with the national center on addiction and substance abuse reporting a 212% increase in prescription drug misuse among adolescents between the 1992 and 2003 period . The national survey on drug use and health and the drug abuse warning network have also documented an increase in otc drug misuse since 1992 . Compton and volkow have reported that pain medication is second only to marijuana in being the most popular drug of choice for adolescents . Given that parent and peer influence have been highlighted as major predictors of substance use in adolescents and that pain medications are the most widely abused prescription drugs, we hypothesize that parent and peer influence will affect pain medication misuse, specifically misuse to get high (recreational use), in the same way these influences affect marijuana use . Very little is known about what is responsible for the increase in prevalence and incidence rates of prescription drug misuse . It has been suggested that adolescents' and young adults' otc and prescription drug misuse could be explained by their perception that such drugs are safer than illicit drugs, by the ease of access to drugs and by lower societal stigma [1117]. Additionally, because otc drugs are easily purchased, they can be used as an alternative when a prescription drug misuser is unable to access their preferred drug as well as mixed with alcohol to achieve a some researchers have shown that there is a strong relationship between illicit drug use and prescription drug misuse [13, 1924]. Additionally, ford highlighted the importance of family and school bonds as protective factors against misuse . Ford also suggested that adolescents whose parents and peers disapprove of substance use and whose peers use drugs are more likely to engage in prescription drug misuse . Marijuana use, on the other hand, has been thoroughly studied, and clear correlates of marijuana use in adolescents have been identified across the literature . Specifically, sensation - seeking, risk perception of use, parent and peer attitudes towards use, adolescent and peers' delinquent behavior, peer use, adolescent tobacco and alcohol use, and demographic variables including gender and ethnicity [2732] have all been shown to be related to adolescent marijuana use . To better understand the relationship between illicit drug use and pain medication recreational use, we explored the extent to which three known predictors of marijuana use were similarly predictive of otc and prescription pain medication recreational use . Specifically, we explored the extent to which risk perception, parent disapproval, and peer disapproval were predictive of recreational use and whether risk perception mediated the effects of parent and peer disapproval . Parent and peer disapproval have been strongly linked to risk perception and use in the marijuana literature [9, 28, 31, 33], hence their inclusion in the model (see figure 1). Additionally, risk perception has been indicated in the health risk behaviors literature and alluded to in the prescription drug literature as a contributing variable in adolescents' decisions to engage in these behaviors [12, 14, 27, 34]. We examined the extent to which these relationships were gender dependent as the marijuana use literature has suggested that different variables are predictive of males' and females' use . Additionally, because illicit drug use is correlated with otc and prescription drugs misuse [13, 20, 21], we propose that the relationship between risk perception, parent and peer disapproval, and otc and prescription pain medication recreational use will differ for marijuana users and nonusers . This study differs from ford, in that our measures of parents' and peers' disapproval of misuse (specifically recreational use) are specific to otc and prescription drug recreational use independent of other substance use . This is especially important since previous research has shown that perceptions of prescription drug misuse often differ from perceptions of illicit drug use [15, 17], and these differing perceptions will subsequently affect peers' and possibly parents' level of disapproval . Additionally, the inclusion of risk perception as a predictor variable provides some clinical utility to the study, in that it investigates the role of an easily targetable variable for intervention to prevent or decrease misuse . The inclusion of separate path analyses for otc pain medication recreational use, prescription pain medication recreational use, and marijuana use also provides for a comparison of predictors of use of the different drugs . The sample consisted of 465 college students between the ages of 18 and 24 years (mage = 18.57, sd = 0.86). The majority of participants (91%) were 18 or 19 years of age; the remaining 9% were ages 2024 years . Nineteen percent of participants (n = 88) reported some (nonzero) lifetime otc or prescription drug recreational use with 13% (n = 60) and 11% (n = 50) reporting otc and prescription pain medication recreational use, respectively . Twenty - nine percent of participants (n = 134) reported nonzero lifetime marijuana use . Risk perception / perceived susceptibility was measured by perceived personal risk, which was the extent to which participants felt they would be at risk of getting sick or hurt if they recreationally used otc pain medication, prescription pain medications, or marijuana, respectively . Risk perception was measured on a 7-point evaluation scale ranging from no risk at all (1) to very much at risk (7). To assess for parents' and peers' disapproval, participants were asked to report on how they felt their parents and peers would feel about them engaging in the recreational use of otc pain medication, prescription pain medication, or marijuana on a 5-point likert scale ranging from strongly approve (1) to strongly disapprove (5). Recreational use or misuse of otc and prescription pain medication was defined as use of medications to get high . Participants were asked about their lifetime misuse of otc pain medication, prescription pain medication, and marijuana use on a 5-point frequency scale (see table 1). Responses included never (1), 15 times (2), 619 times (3), 2040 times (4), and more than 40 times (5). Otc pain medication recreational use included the misuse of otc tylenol, motrin, advil, aleve, ibuprofen, and aspirin . Prescription pain medication recreational use included the misuse of vicodin, codeine, oxycontin, and percocet . Participants also reported on their recreational use of other classifications of otc and prescription drugs including tranquilizers, stimulants, sedatives, steroids, and cough and cold syrup, although these items were not included in the analyses . Data was collected as part of a larger project, media influences on health risk behaviors and prescription drug use in young adults . Data was collected using a survey developed by the authors specifically for the project . Participants were invited to complete an online survey at computer workstations separated by desk partitions . The survey was administered via http://www.surveymonkey.com/. The online survey took approximately 3550 minutes to complete, and participants received research credit for their class upon completion of the survey . To ensure participant privacy, descriptive statistics are shown in table 2 (for otc pain medication and prescription pain medication variables) and table 3 (for marijuana variables). Path models were estimated separately for each set of variables for one of the three drugs: otc pain medication, prescription pain medication, and marijuana . Parent and peer disapproval of misuse of a drug were used to predict risk perception for that drug . Both disapproval variables and risk perception misuse of the drug was entered using two variables, one representing whether a respondent reported zero misuse of the drug versus nonzero misuse and the other representing amount of use for respondents who reported a nonzero amount . This model allowed for the testing of whether risk perception mediated the effects of the disapproval variables on the misuse variables, which was done using the joint significance test . For each drug, the path model was first estimated using data from all participants . It was then of interest to test whether any of the associations among the variables differed as a function of gender or as a function of use or nonuse of the other drugs . Each path model was reestimated first with gender as a grouping variable and second with misuse of marijuana (for otc and prescription pain medication models) or otc and prescription pain medication misuse (for the marijuana model). In order to be used as grouping variables, misuse variables were dichotomized into zero use versus nonzero use . Because otc and prescription pain medication misuse were combined into a single grouping variable, a zero represented no misuse of either type and respondents reporting any use of either type, were scored as nonzero . The misuse - dependent variables were each entered using two variables in the model by way of the twopart feature of mplus, which scores all participants on a dichotomous use variable depending on whether they reported zero or nonzero misuse and also score amount of misuse as a separate continuous variable . Amount of misuse is scored as missing for respondents who have zero use, but data from these participants was still able to be included in the models because mplus can estimate models using full information maximum likelihood, which can include partially complete data . As the amount of misuse was skewed, the mlr estimator, a variation of maximum likelihood that is more robust to nonnormal data than the more typical maximum likelihood, was used to estimate the models . Regarding descriptive statistics, parent disapproval was positively correlated with peer disapproval and risk perception for marijuana and otc pain and prescription pain medication misuse variables . Parent disapproval for otc pain medication was also negatively correlated with marijuana use and lifetime use . Among marijuana use variables, parent disapproval was negatively correlated with lifetime use; however, this was only true for participants who did not report any pain medication misuse . Peer disapproval was positively correlated with risk perception and negatively correlated with lifetime use for marijuana and otc pain and prescription pain medication misuse variables . Peer disapproval of otc pain and prescription pain medication misuse was also negatively correlated with marijuana use . Risk perception was positively correlated with gender and negatively correlated with lifetime use and marijuana use for both types of pain medication variables . For marijuana variables, risk perception however, risk perception was only positively correlated with gender among participants who reported no pain medication misuse . Lifetime use was positively correlated with marijuana use and negatively correlated with gender for the prescription pain variables . Because mplus uses numerical integration to estimate models with dichotomous - dependent variables, it does not report the usual fit statistics or fit indices for such models . Fit of the models was not an issue, though, as they included all possible associations among the variables (note that no association between the two misuse variables could be included because the continuous variable only took on nonmissing values for respondents scoring one on the dichotomous variable) and so were effectively saturated . Note that because the data is cross - sectional, the term predictor is used for statistical purposes rather than to indicate causality . Results for the path models are shown in table 4 . For otc pain medication misuse, peer disapproval (= .516, p <.05) significantly predicted risk perception, with higher levels of peer disapproval predicting higher levels of risk perception . Both peer disapproval (= .401, p <.05) and risk perception (= .221, p <.05) significantly predicted dichotomous misuse, with higher levels of peer disapproval and risk perception predicting lower likelihood of nonzero misuse . Because peer disapproval predicted risk perception and risk perception predicted dichotomous misuse, risk perception was a significant mediator of the effect of peer disapproval on dichotomous misuse . There were no significant predictors of amount of misuse for respondents who reported a nonzero amount . Multiple groups analyses revealed no significant differences in path coefficients as a function of either gender groups ((8) = 3.44, p>.05) or groups defined by zero or nonzero marijuana misuse ((8) = 7.60, p>.05). For prescription pain medication misuse, both parent disapproval (= .183, p <.05) and peer disapproval (= .425, p <.05), significantly predicted risk perception, with higher levels of parent and peer disapproval predicting higher levels of risk perception . Both peer disapproval (= .424, p <.05) and risk perception (= .188, p <.05) significantly predicted dichotomous misuse, with higher levels of peer disapproval and risk perception predicting lower likelihood of nonzero misuse . Because peer disapproval predicted risk perception and risk perception predicted dichotomous misuse, risk perception was a significant mediator of the effect of peer disapproval on dichotomous misuse . Parent disapproval (= .286, p <.05) significantly predicted amount of misuse for respondents who reported a nonzero amount, but in an unexpected direction: higher levels of disapproval predicted greater amounts of misuse . Multiple groups analyses revealed no significant differences in path coefficients as a function of either gender groups ((8) = 12.35, p>.05) or groups defined by zero or nonzero marijuana misuse ((8) = 3.13, p>.05). For marijuana misuse, both parent disapproval (= .162, p <.05) and peer disapproval (= .493, p <.05) significantly predicted risk perceptions, with higher levels of parent and peer disapproval predicting higher levels of risk perception . Peer disapproval (= .356, p <.05) and risk perception (= .409, p <.05) significantly predicted dichotomous misuse, with higher levels of peer disapproval and risk perception predicting lower likelihood of nonzero misuse . Parent disapproval also significantly predicted dichotomous misuse, but this effect varied depending on whether respondents were in the zero misuse or nonzero misuse group for otc and prescription pain medications, so it is discussed below . Both peer disapproval (= .262, p <.05) and risk perception (= .454, p <.05) were significant predictors of amount of misuse for respondents who reported a nonzero amount, with higher levels of disapproval and risk perception predicting smaller amounts of use . Because both parent and peer disapproval predicted risk perception and risk perception predicted both dichotomous misuse and amount of misuse, risk perception was a significant mediator of the effect of both parent and peer disapproval on both dichotomous misuse and amount of misuse . Multiple group analyses revealed no significant differences in path coefficients as a function of gender groups ((8) = 10.02, p>.05). There was a significant difference in path coefficients as a function of groups defined by zero or nonzero use of otc or prescription pain medications ((8) = 18.81, p <.05). Tests of invariance of the individual paths revealed that the only path to differ significantly was for parent disapproval predicting dichotomous misuse . For respondents reporting zero otc or prescription pain medication misuse, this association was significant and negative (= .131, p <.05), so higher levels of disapproval predicted lower likelihoods of nonzero misuse . For respondents reporting nonzero otc or prescription pain misuse, this association was significant and positive (= .282, p <.05), so higher levels of disapproval predicted higher likelihoods of nonzero misuse . To add to the understanding of otc and prescription pain medication misuse and its relationship with other substance abuse in adolescents and young adults, we explored the relationship between parent and peer disapproval of recreational use, risk perception of recreational use, and reported recreational use . The results of this study indicate that similar to marijuana use, risk perception of otc and prescription pain medication recreational use are influenced by parent and peer disapproval of recreational use, and use itself is influenced by peer disapproval and risk perception of recreational use . Noteworthy was the ability of peer disapproval of misuse to predict dichotomous misuse over and above the mediated effect through risk perception, for all three drugs: otc and prescription pain medication misuse and marijuana use . This is consistent with findings in the substance abuse literature [31, 33] and suggests that peer subculture may either encourage or act as a protective variable against adolescents engaging in the recreational use of all substances including prescription drugs . This also highlights the role of development in adolescents' decisions to engage in health risk behaviors; that is, they are in a period in their lives where peers are their key counterplayers and they may follow the norms outlined by their subgroup; hence, peer disapproval has more influence on their perceptions of harm and use . These results also suggest that in order to increase risk perception and reduce recreational use of otc and prescription pain medication, program planners should work towards reducing the acceptability of otc and prescription pain medication misuse among adolescents, since they influence each others' perceptions . The office of national drug policy and partnership for a drug - free america launched a prescription drug abuse media campaign targeting parents and health and school professionals; however, no ads were directly marketed toward adolescents and young adults . Based on the significant influence of peer disapproval on risk perception and use, future campaigns should target adolescents and young adults . Parent disapproval was predictive of risk perception of prescription pain medication recreational use and marijuana use . We speculate that adolescents may take their parents' opinions into consideration when formulating their risk perceptions on both marijuana and prescription pain medication as opposed to otc pain medication because of the restrictive access to these substances; however, this hypothesis should be explored in future studies . Parent disapproval of misuse failed to directly predict dichotomous misuse of otc and prescription pain medications (although it did have a mediated effect through risk perception for prescription pain medications). This highlights the need for parents and by extension other adults working with adolescents to focus less on preventing behavior via direct methods (e.g., just say no campaigns) and focus more on educating adolescents on the risks associated with the behavior . The goal of redirecting adults' focus on educating adolescents on the risks of otc and prescription pain misuse is to influence other correlates of use, such as peer disapproval and risk perception, in order to prevent or decrease use . Parent disapproval predicting dichotomous misuse of marijuana is consistent with the marijuana use literature [39, 40]. However, the finding of reverse relationships when the sample was divided into otc and prescription pain drugs zero and nonzero misusers provides some additional data about the relationship of use for the top two drugs of choice for adolescents . Specifically, adolescents who engaged in otc and prescription pain misuse were more likely to be marijuana users the more their parents disapproved of marijuana use, whereas those who were zero otc and prescription pain misusers were less likely to engage in marijuana use if their parents disapproved of marijuana use . These results are suggestive of a deviant and high sensation - seeking subculture trend in adolescents who engage in both pain medication and marijuana use and this subculture is seen across the substance abuse literature [9, 31, 33]. It is possible that among this subculture, parent interventions may encourage adolescents to engage in substance use, providing further need for parents to focus less on preventing behavior and more on highlighting the risks associated with the behaviors . Another explanation may be that of reverse causality, whereby the more the adolescents engage in use, the more their parents disapprove of their behavior . Although risk perception was significantly predictive of use in the general models, the regression weights and significance values suggest that it was a weaker predictor for otc and prescription pain medication recreational use than for marijuana use . These findings suggest that although risk perception may play an important role in adolescents' decision making regarding substance use and other health risk behaviors [28, 34, 41, 42], risk perception is less of an important variable in adolescents' decision - making regarding recreational use of otc and prescription pain medication . Additional variables that are uncommon to the substance abuse literature, such as lower societal stigma, and comparative risk perception to street drugs may be more important in adolescents' decision making regarding prescription drug recreational use [12, 14]. Additionally, risk perception may interact with other variables not studied here to explain adolescents' decision making regarding use (e.g., general attitudes toward prescription drug use, frequency of family and friends' medical use of prescription drugs). Future studies should explore how other correlates of recreational use of otc and prescription pain medication interact with risk perception to influence misuse . This study was restricted to recreational users of otc and prescription pain medication; these users do not encompass all nonmedical use; therefore, generalizations about misuse are limited . Another limitation regarding generalization is the use of a convenience sample of college students; future studies should test this model on a community sample . Another limitation of this study is that the psychosocial characteristics of the sample were not considered . Adolescents and young adults are highly influenced by developmental characteristics and their external environment and future studies should explore the extent to which developmental characteristics interact with these environmental variables to predict risk perception and use . Additionally, future studies should retest these paths with a larger sample (preferably including more participants who report nonzero use) to check for consistency of the results across samples . Future studies should also compare otc and prescription pain medication misuse to other illicit drug use and other health risk behaviors . Finally, the present study was cross - sectional, so temporal precedence cannot be established for the assumed causal relationships between variables . Despite these limitations, this study provides evidence that suggests that predictors of otc and prescription pain medication recreational use are similar to predictors of marijuana use in adolescents in that peer disapproval is a significant predictor of risk perception and misuse . Additionally, both peer and parent disapproval are significant predictors of risk perception of prescription pain medication misuse . Unlike marijuana use, otc and prescription pain medication misuse in adolescents are relatively less explained by risk perception suggesting that other variables may be responsible for adolescents' decision to engage in the misuse of otc and prescription pain medication.
Complementary and alternative medicine (cam) is an additional health care system, comprising mind / body practices and natural products that are not regarded as part of conventional medicine12). Conventional medicine is used together when complementary medicine is applied, and alternative medicine is employed instead of conventional medicine1). Most patients who try to take non - prevailing approaches use them together with conventional treatments1). Natural products include herbs, minerals, vitamins, and probiotics, and mind / body practices include acupuncture, massage therapy, meditation, movement therapies, relaxation techniques, spinal manipulation, and others1). Neurologic diseases in children often tend to have a chronic course and require long - term management . Children with chronic health conditions use cam more frequently3), but it was found that only around 30% of patients with epilepsy and 50% of children with chronic health conditions who use cam reported this behavior to their physicians456). Physicians should be aware of their patients' use of cam and provide accurate information about cam to enable patients to make the right decisions . This review aims to investigate the characteristics of the use of cam in children with neurologic diseases such as epilepsy, migraine, cerebral palsy, and congenital malformations in order to improve management through analysis of several studies of cam use in children with chronic neurologic conditions2678910). Further, this review will discuss the differences in the use of cam between children and adults with neurologic diseases, and between patients with neurologic and nonneurologic conditions . Barnes et al.9) reported that approximately 12% of children (total sample size [n]=9,417) used cam in the united states (us), and mccann and newell3) reported that 12% of healthy children (n=25) used cam in the united kingdom (uk). They also reported that 40% (n=75) of children with chronic health conditions used cam in the uk, and this proportion is much higher than that in healthy children3). In the study by barnes et al.9), the most common modalities used were natural products (neither vitamin nor mineral) and osteopathic or chiropractic manipulation . Regarding significant factors, parental use of cam was associated with cam use in children compared to children whose parents did not use cam (24% vs. 5%). Parental use of cam was also found to be a strongly associated factor in a study by birdee et al.11). Additionally, for both adults and children, worry about cost was found to be one of the factors related to the use of cam and delaying using conventional medicine, and patients were more likely to use cam when expenses were a concern than when expenses were not a problem for conventional medicine9). Other factors significantly associated with pediatric use of cam, in the study of birdee et al.11), were adolescent age rather than that of toddler or infant, parent with a college education, more frequent use of prescription medication, stress or anxiety, musculoskeletal conditions, dermatologic conditions, and sinus infection . In a recent study on patterns of cam use in pediatric patients with common neurologic conditions (headaches, migraines, seizures), pediatric patients with common neurological conditions were found to use cam significantly more compared to children without these conditions (24% [n=586] vs.13% [n=7,083])7). Pediatric patients with neurologic conditions used biological therapies with a similar frequency and mind / body practices with a significantly higher frequency compared to other pediatric patients using cam . Among mind / body practices, deep breathing was used most commonly (33%), meditation was used in 15%, and progressive relaxation was employed in 10%7). In another study in 2010 in north jordan, 56% of children (n=176) with neurologic illnesses used cam for their care2). Regarding the most commonly used methods, prayer / reciting the quran was used in 77%, massage with olive oil in 32%, religious healers in 30%, and consumption of honey products in 29% . Among the reasons provided for the use of cam, religious beliefs were the most common (68%), and no patients described distrust in conventional medicine2). Other significant factors connected to the use of cam included belief in its effects, speech delay, father's age greater than 30 years, and mother's education less than high school2). Additionally, parents' experience or hearing of successful cases from acquaintances or mass media was found to be other reasons for using cam8). Side effects were rare8). In a study by soo et al.8) regarding the use of cam in a pediatric neurology clinic, 44% of patients (n=105) were found to use cam . In regard to the most commonly used cam modalities, chiropractic manipulation was used in 15%, dietary therapy was used in 12%, and homeopathy, herbal remedies, and prayer healing were each used in 8% . The difference in this study compared to other studies is that the parents' sociodemographic characteristics were not significantly associated with the use of cam . Pediatric health - related quality of life was also not a significant factor8). In total, 59% of patients who used cam experienced benefits . The total median cost of cam compared with conventional medicines was not different ($31.70 vs. $50.00 per month)8). In a study on cam use in pediatric neurology, the overall rates of cam use at two centers were 78% (n=151) and 48% (n=55), respectively6). As for the most commonly used cam products, multivitamins were used in 84%, vitamin c was used in 37%, homeopathic remedies were used in 24%, and fish oil / omega-3s were employed in 22%6). Regarding the most commonly used cam practices, massage was used in 47%, and 37% used chiropractic methods, 18% used faith - healing, and aromatherapy, homeopathy, and relaxation were each used in 16%6). Over half of patients disclosed to their physicians their use of cam in addition to conventional medicine6). In a study examining the use of traditional herbal medicines in korean elementary school children, 65% (n=905) of children were found to be taking herbal medicines12). In a 2008 study in korea, 65 of 378 children (17%) with epilepsy were found to be taking herbal medicines4). In our study in 2014, 19% (n=398) of children with epilepsy used traditional korean medicine (tkm) (acupuncture, moxibustion, herbal medicine)10). These results suggest that tkm is not the favored method for attaining seizure control and that patients are careful about using tkm to treat epilepsy . In addition, 60% of children with epilepsy were receiving other types of cam10). According to a study by lee et al.4), patients with psychosomatic disorders used herbal medicine significantly more frequently, whereas in a study by kim et al.13), neurologically normal patients used it slightly more frequently; however, the difference did not have statistical significance . In our study, among receivers of combination treatments besides tkm, tkm was used more frequently in those receiving language, music, or art therapy than in those undergoing physiotherapy or other combination therapies10). This finding suggests that the use of tkm is associated more with the purpose of treatment of cognitive function than motor functions, and parents of children with epilepsy may believe that tkm has an effect on the former rather than the latter10). Additionally, regarding significant factors, in the group of patients using a greater number of antiepileptic drugs and having low seizure - free rates, the use of tkm was more frequent10). Regarding the effect of cam on epilepsy, inconsistent results had been reported in previous studies . Recent cochrane reviews show that some studies on the use of acupuncture and chinese traditional herbal medicine did not succeed in providing clear evidence proving the effects of acupuncture and herbal medicine for epilepsy patients1415). According to the study by lee et al.4), 18% of respondents using herbal medicine reported its effectiveness for seizure control, but the rest of the respondents reported no effectiveness or even worsening of symptoms, although many patients (33%) agreed with using herbal medicine . It was also reported that most patients did not feel that cam was superior to general epilepsy treatments, although 32% of them continued using cam16). It is presumed that this persistent usage is due to people's beliefs that herbal medicines are safe (not dangerous) and help to improve health and enhance cognitive function10). In spite of these beliefs, however, according to the report of kuan et al.16), the most frequent adverse effect of cam was aggravated seizures . It is presumed that this is due to the effects of seizure - inducing materials of herbal medicine or drug - drug interactions . Regarding the frequency of cam use for epileptic patients in various countries, 49% (n=403) of taiwanese were found to use cam, 44% used it in arizona, 37% (n=265) of nigerians used cam, and 32% (n=1,000) in india and 24% (n=92) in ohio used cam516171819). Regarding commonly used forms of cam for treatment of epileptic patients, prayer and stress relief were used in the west, whereas traditional herbal medicines were employed both in the east and in africa516171819). In us, the preferred modalities were biological therapies and mind - body practices7). In canada, the commonly used methods were chiropractic manipulations, dietary therapy, multivitamins, and massage68). However, in north jordan, prayer / reciting the quran was the most commonly used modality2). In korea these differences in use of cam between countries may be owing to their different cultures, religions, and traditions10). The characteristics of the use of cam in children with neurologic diseases are summarized in table 2 . According to the study by barnes et al.9), almost 40% (n=23,393) of us adults used cam in 2007 and the most commonly used modalities were natural products (neither vitamin nor mineral) (18%) and deep breathing exercises (13% . ). Cam was used more frequently in american adults with common neurological conditions (migraines, regular headaches, strokes, back pain with sciatica, seizures, dementia or memory loss) than in those without such conditions (44% [n=6,587] vs. 33% [n=16,806])20). The frequency of use of each cam modality was higher in adults with common neurological conditions than in those without20). The most common modalities were mind / body therapies, and the least common were alternative medical systems20). The reasons why those with common neurological conditions used cam more frequently than those without such conditions included provider's recommendations or little effect achieved with conventional medicine or a cost that was too high20). About 50% of adults with common neurological conditions did not report their use of cam to their doctors20). Factors that significantly influenced the use of cam in those with common neurological conditions included higher educational level than high school education, positive history of anxiety, living in a western area, being a former smoker, and drinking alcohol lightly20). In the previous studies on the use of cam in various neurologic conditions, compared to the frequency of use of cam in children with common neurologic diseases, the frequency of use in adults with neurologic diseases was similar267810). For korean adults with other diseases, several studies showed the following findings regarding cam use: 60%70% of patients with stroke used cam, 53% of those with cancer used it and 53% of patients with asthma and preferred modalities of cam use in children and adults had diverse features, and these results may be influenced by individuals' different cultures and traditions of use of cam . The factor most commonly related to use of cam in children with neurologic conditions was parental cam use, and it could be presumed that the use of cam in children may be due to such usage running in the family, as well as belief in or experience with the efficacy of cam . In adults with neurologic conditions, increased educational level was the most common factor associated with use of cam202123), and this result may relate to economic level . Characteristics of the use of cam in adults with neurologic diseases are summarized in table 3 . In a systematic review on the use of cam in pediatric cancer patients, the prevalence of use of cam (since the diagnosis of cancer) the most common cam modalities were herbal medicines, diets / nutrition, and faith - healing28). The frequent reasons given for the use of cam were to help cure or fight the child's cancer, relief of symptom, and support of ongoing use of conventional medicine28). There were few factors related to patients' sociodemographic characteristics associated with use of cam, and this result was different from the results of several other studies28). According to the study by barnes et al.9), for pediatric patients with specific diseases, the proportions were 2% in insomnia, 3% in attention deficit hyperactivity disorder (adhd), 5% in other musculoskeletal diseases, 5% in stress or anxiety, 7% in head or chest colds, and 7% in back or neck pain9). From these results, it is presumed that patients in these cases use cam to manage symptoms, to maintain and manage health, or to prevent illness, rather than to treat specific diseases28). Many studies, however, reported a higher frequency of cam use in pediatric patients with chronic diseases, such as asthma, autism, adhd, cancer, and sickle cell anemia . Medical symptoms such as nausea and abdominal pain rather than certain medical diagnoses were found to be some of the factors associated with the use of cam28). In the study by oshikoya et al.29), the researchers interviewed parents of children with epilepsy (n=122), asthma (n=78), or sickle cell anemia (n=118). Three hundred three types of cam were used by 99 patients (31%) (epilepsy, 38%; sickle cell anemia, 36%; asthma, 25%). The most commonly used cams were biological products (58%), while alternative medical systems (27%) as well as mind / body interventions (14%) were also employed . Eighty - five parents (86%) were going to report the use of cam to their physicians, but had not yet done so . In 7% of the patients, levy and hyman30) investigated the use of cam for children with autistic spectrum disorder (asd). About 50%75% (n=50112) of children with autism were found to use cam31). Patients with comorbid intellectual disability may have a higher frequency of use of cam . In the study by levy et al.32), one - third of children requested for examination of asd were found to have already used cam, even before diagnosis . The most frequently used form of cam for children with asd were mind / body practices30). In children with inflammatory bowel disease, adverse effect was the significant predictor of cam use33). In cases of children with asthma, the significant predictors of use of cam were older age and worse control of symptoms . Also, more medications and more medical visits as well as more side effects were significant predictors in using cam34) a study in italy showed that the most common reason for the use of cam was a fear of side effects of conventional therapy for routine illness35). In the study by hanson et al.36), 75% of parents of children with asd chose the use of cam because they felt cam was perceived to be safe and it did not have side effect or they experienced side effects of conventional therapy previously . The purposes of the use of cam in children with asd are treatment of major symptoms of asd, improvement of attention, enhancement of relaxation, treatment of gastrointestinal symptoms, regulation of sleep and promotion of general health31). The characteristics of the use of cam in children with other chronic diseases are summarized in table 4 . In a recent study on patterns of cam use in pediatric patients with common neurologic conditions (headaches, migraines, seizures), pediatric patients with common neurological conditions were found to use cam significantly more compared to children without these conditions (24% [n=586] vs.13% [n=7,083])7). Pediatric patients with neurologic conditions used biological therapies with a similar frequency and mind / body practices with a significantly higher frequency compared to other pediatric patients using cam . Among mind / body practices, deep breathing was used most commonly (33%), meditation was used in 15%, and progressive relaxation was employed in 10%7). In another study in 2010 in north jordan, 56% of children (n=176) with neurologic illnesses used cam for their care2). Regarding the most commonly used methods, prayer / reciting the quran was used in 77%, massage with olive oil in 32%, religious healers in 30%, and consumption of honey products in 29% . Among the reasons provided for the use of cam, religious beliefs were the most common (68%), and no patients described distrust in conventional medicine2). Other significant factors connected to the use of cam included belief in its effects, speech delay, father's age greater than 30 years, and mother's education less than high school2). Additionally, parents' experience or hearing of successful cases from acquaintances or mass media was found to be other reasons for using cam8). Side effects were rare8). In a study by soo et al.8) regarding the use of cam in a pediatric neurology clinic, 44% of patients (n=105) were found to use cam . In regard to the most commonly used cam modalities, chiropractic manipulation was used in 15%, dietary therapy was used in 12%, and homeopathy, herbal remedies, and prayer healing were each used in 8% . The difference in this study compared to other studies is that the parents' sociodemographic characteristics were not significantly associated with the use of cam . Pediatric health - related quality of life was also not a significant factor8). In total, 59% of patients who used cam experienced benefits . The total median cost of cam compared with conventional medicines was not different ($31.70 vs. $50.00 per month)8). In a study on cam use in pediatric neurology, the overall rates of cam use at two centers were 78% (n=151) and 48% (n=55), respectively6). As for the most commonly used cam products, multivitamins were used in 84%, vitamin c was used in 37%, homeopathic remedies were used in 24%, and fish oil / omega-3s were employed in 22%6). Regarding the most commonly used cam practices, massage was used in 47%, and 37% used chiropractic methods, 18% used faith - healing, and aromatherapy, homeopathy, and relaxation were each used in 16%6). Over half of patients disclosed to their physicians their use of cam in addition to conventional medicine6). In a study examining the use of traditional herbal medicines in korean elementary school children, 65% (n=905) of children were found to be taking herbal medicines12). In a 2008 study in korea, 65 of 378 children (17%) with epilepsy were found to be taking herbal medicines4). In our study in 2014, 19% (n=398) of children with epilepsy used traditional korean medicine (tkm) (acupuncture, moxibustion, herbal medicine)10). These results suggest that tkm is not the favored method for attaining seizure control and that patients are careful about using tkm to treat epilepsy . In addition, 60% of children with epilepsy were receiving other types of cam10). According to a study by lee et al.4), patients with psychosomatic disorders used herbal medicine significantly more frequently, whereas in a study by kim et al.13), neurologically normal patients used it slightly more frequently; however, the difference did not have statistical significance . In our study, among receivers of combination treatments besides tkm, tkm was used more frequently in those receiving language, music, or art therapy than in those undergoing physiotherapy or other combination therapies10). This finding suggests that the use of tkm is associated more with the purpose of treatment of cognitive function than motor functions, and parents of children with epilepsy may believe that tkm has an effect on the former rather than the latter10). Additionally, regarding significant factors, in the group of patients using a greater number of antiepileptic drugs and having low seizure - free rates, the use of tkm was more frequent10). Regarding the effect of cam on epilepsy, inconsistent results had been reported in previous studies . Recent cochrane reviews show that some studies on the use of acupuncture and chinese traditional herbal medicine did not succeed in providing clear evidence proving the effects of acupuncture and herbal medicine for epilepsy patients1415). According to the study by lee et al.4), 18% of respondents using herbal medicine reported its effectiveness for seizure control, but the rest of the respondents reported no effectiveness or even worsening of symptoms, although many patients (33%) agreed with using herbal medicine . It was also reported that most patients did not feel that cam was superior to general epilepsy treatments, although 32% of them continued using cam16). It is presumed that this persistent usage is due to people's beliefs that herbal medicines are safe (not dangerous) and help to improve health and enhance cognitive function10). In spite of these beliefs, however, according to the report of kuan et al.16), the most frequent adverse effect of cam was aggravated seizures . It is presumed that this is due to the effects of seizure - inducing materials of herbal medicine or drug - drug interactions . Regarding the frequency of cam use for epileptic patients in various countries, 49% (n=403) of taiwanese were found to use cam, 44% used it in arizona, 37% (n=265) of nigerians used cam, and 32% (n=1,000) in india and 24% (n=92) in ohio used cam516171819). Regarding commonly used forms of cam for treatment of epileptic patients, prayer and stress relief were used in the west, whereas traditional herbal medicines were employed both in the east and in africa516171819). In us, the preferred modalities were biological therapies and mind - body practices7). In canada, the commonly used methods were chiropractic manipulations, dietary therapy, multivitamins, and massage68). However, in north jordan, prayer / reciting the quran was the most commonly used modality2). In korea these differences in use of cam between countries may be owing to their different cultures, religions, and traditions10). The characteristics of the use of cam in children with neurologic diseases are summarized in table 2 . According to the study by barnes et al.9), almost 40% (n=23,393) of us adults used cam in 2007 and the most commonly used modalities were natural products (neither vitamin nor mineral) (18%) and deep breathing exercises (13% . ). Cam was used more frequently in american adults with common neurological conditions (migraines, regular headaches, strokes, back pain with sciatica, seizures, dementia or memory loss) than in those without such conditions (44% [n=6,587] vs. 33% [n=16,806])20). The frequency of use of each cam modality was higher in adults with common neurological conditions than in those without20). The most common modalities were mind / body therapies, and the least common were alternative medical systems20). The reasons why those with common neurological conditions used cam more frequently than those without such conditions included provider's recommendations or little effect achieved with conventional medicine or a cost that was too high20). About 50% of adults with common neurological conditions did not report their use of cam to their doctors20). Factors that significantly influenced the use of cam in those with common neurological conditions included higher educational level than high school education, positive history of anxiety, living in a western area, being a former smoker, and drinking alcohol lightly20). In the previous studies on the use of cam in various neurologic conditions, the prevalence of use of cam ranged from 19% to 43%212223). Compared to the frequency of use of cam in children with common neurologic diseases, the frequency of use in adults with neurologic diseases was similar267810). For korean adults with other diseases, several studies showed the following findings regarding cam use: 60%70% of patients with stroke used cam, 53% of those with cancer used it and 53% of patients with asthma and 48% of patients with psychiatric disorders used herbal medicines24252627). Preferred modalities of cam use in children and adults had diverse features, and these results may be influenced by individuals' different cultures and traditions of use of cam . The factor most commonly related to use of cam in children with neurologic conditions was parental cam use, and it could be presumed that the use of cam in children may be due to such usage running in the family, as well as belief in or experience with the efficacy of cam . In adults with neurologic conditions, increased educational level was the most common factor associated with use of cam202123), and this result may relate to economic level . Characteristics of the use of cam in adults with neurologic diseases are summarized in table 3 . In a systematic review on the use of cam in pediatric cancer patients, the prevalence of use of cam (since the diagnosis of cancer) ranged from 6% to 91% (n=2,871). The most common cam modalities were herbal medicines, diets / nutrition, and faith - healing28). The frequent reasons given for the use of cam were to help cure or fight the child's cancer, relief of symptom, and support of ongoing use of conventional medicine28). There were few factors related to patients' sociodemographic characteristics associated with use of cam, and this result was different from the results of several other studies28). According to the study by barnes et al.9), for pediatric patients with specific diseases, the use of cam was not highly prevalent . The proportions were 2% in insomnia, 3% in attention deficit hyperactivity disorder (adhd), 5% in other musculoskeletal diseases, 5% in stress or anxiety, 7% in head or chest colds, and 7% in back or neck pain9). From these results, it is presumed that patients in these cases use cam to manage symptoms, to maintain and manage health, or to prevent illness, rather than to treat specific diseases28). Many studies, however, reported a higher frequency of cam use in pediatric patients with chronic diseases, such as asthma, autism, adhd, cancer, and sickle cell anemia . Medical symptoms such as nausea and abdominal pain rather than certain medical diagnoses were found to be some of the factors associated with the use of cam28). In the study by oshikoya et al.29), the researchers interviewed parents of children with epilepsy (n=122), asthma (n=78), or sickle cell anemia (n=118). Three hundred three types of cam were used by 99 patients (31%) (epilepsy, 38%; sickle cell anemia, 36%; asthma, 25%). The most commonly used cams were biological products (58%), while alternative medical systems (27%) as well as mind / body interventions (14%) were also employed . Eighty - five parents (86%) were going to report the use of cam to their physicians, but had not yet done so . In 7% of the patients, levy and hyman30) investigated the use of cam for children with autistic spectrum disorder (asd). About 50%75% (n=50112) of children with autism were found to use cam31). Patients with comorbid intellectual disability may have a higher frequency of use of cam . In the study by levy et al.32), one - third of children requested for examination of asd were found to have already used cam, even before diagnosis . The most frequently used form of cam for children with asd were mind / body practices30). In children with inflammatory bowel disease, adverse effect was the significant predictor of cam use33). In cases of children with asthma, the significant predictors of use of cam were older age and worse control of symptoms . Also, more medications and more medical visits as well as more side effects were significant predictors in using cam34). A study in italy showed that the most common reason for the use of cam was a fear of side effects of conventional therapy for routine illness35). In the study by hanson et al.36), 75% of parents of children with asd chose the use of cam because they felt cam was perceived to be safe and it did not have side effect or they experienced side effects of conventional therapy previously . The purposes of the use of cam in children with asd are treatment of major symptoms of asd, improvement of attention, enhancement of relaxation, treatment of gastrointestinal symptoms, regulation of sleep and promotion of general health31). The characteristics of the use of cam in children with other chronic diseases are summarized in table 4 . The use of cam in children with neurologic diseases is common, ranging from 24%78% and it is more frequent than the use in healthy children . Preferred modalities of cam differed according to patients' country of residence and due to their different cultures and traditions, with examples such as prayer / reciting the quran in jordan, biologic therapies, and mind / body therapies in the us, and tkm in korea . The most common factor significantly associated with the use of cam was parental cam use in most studies . The reasons for using cam included religious beliefs, parents' personal experience, or exposure to success stories from the media and acquaintances . The frequency of cam use in children and adults with neurologic diseases is higher than that in those without these conditions . Preferred modalities of cam in adults with common neurological conditions were diverse, including megavitamins and mind / body therapy (prayer and chiropractic care). The most common factor significantly associated with use of cam in adults with neurologic diseases was higher educational level . Among children and adults with neurologic diseases, less than half of patients who used cam told their physicians about this usage . Thus, physicians need to ask patients about their use of cam to allow further careful treatment . Additionally, further study is needed to determine the evidence - based efficacy of the use of cam in children with common neurologic diseases.
Abiotic stresses like drought, salinity, flooding, temperature extremes, and improper agricultural techniques have a negative impact on final yield of cultivated plants . Drought triggers the signal transduction of the phytohormone abscisic acid, aba, a key hormone involved in stomata closure to reduce transpiration . Drought also suppresses cell growth and photosynthesis efficiency, increases respiration, and induces several other genes involved in the response to abiotic stresses . Several drought - inducible genes involved in a broad range of functions have been identified by molecular and genomic analyses in arabidopsis, rice, and other plants [5, 6]. However, the level of a specific mrna does not always correlate well with the level of proteins . An mrna produced in abundance may be degraded rapidly or translated inefficiently, resulting in a nonproportional abundance of mrna and protein . Moreover, out of a given pool of mrna, only a fraction is recruited further into the polyribosome assembly for translation . Further, many transcripts give rise to more than one protein, through alternative splicing or alternative posttranscriptional modifications . The first group includes proteins that function in abiotic stress tolerance such as chaperones, late embryogenesis abundant (lea) proteins, osmotin, mrna - binding proteins, key enzymes for osmolyte biosynthesis, water channel proteins, metabolites transporters, detoxification enzymes, and various proteases . Osmotic adjustment including accumulation of sugar alcohols, amino acids, organic acids, and glycine betaine decreases the intracellular osmotic potential . The second group is comprised of regulatory proteins involved in further regulation of signal transduction and stress - responsive gene expression like protein kinases, protein phosphatases, enzymes involved in phospholipid metabolism, and other signaling molecules such as calmodulin - binding protein . Sorghum bicolor l. moench, a c4 grass, ranks the fifth economically important cereal crop worldwide . The availability of the full genome sequence makes sorghum a c4 model plant in addition to the c3 plants arabidopsis and rice to study gene products involved in adaptation to drought stress . In our previous study ten egyptian genotypes of sorghum bicolor were compared for their drought tolerance using the ojip test to analyse fast induced chlorophyll fluorescence from photosystem ii . In the present study, accession number 11434, drought tolerant, and accession number 11431, drought sensitive, were subjected to proteome analysis using 2d - dige system followed by maldi - tof - ms . The proteome alteration in response to drought conditions and following watering was compared to their relative controls to figure out difference between drought tolerant and sensitive genotypes . Accession number 11434, drought tolerant, and accession number 11431, drought sensitive, obtained from the egyptian national gene bank were used in this study . Three seedlings were planted in 11 11 11 cm plastic pots filled with 700 g soil containing 50% clay, 25% sand, and 25% humus . Plants were kept in a greenhouse under 16-hour photoperiod with light intensity of 135 mol quant m s at 24c . Field capacity was adjusted to 70% using an hh2 moisture meter (delta - t devices ltd . ). At the stage of 5 extended leaves, the soil was left to dry until the level of 10% field capacity and left further for 7 days without any watering . At the end of drought treatment, the soil water potential was approximately 2 mpa, as measured by a wescor psychrometer . Leaf relative water content, rwc, was measured for plants under full watering regime following drought treatment and 24 hours following recovery according to smart and bingham . Fast chlorophyll fluorescence induction curves to calculate fv / fm and piabs as parameters describing the fitness of the photosynthetic apparatus were measured between 9 and 10 a.m. following 60 min of dark adaptation on the third leaf of controls (full watered), at the end of the drought treatment, and 24 hours following recovery . Following drought treatment, in total 5 third leaves (from one or two out of the three plants per pot) were collected as bulk immediately after chlorophyll fluorescence measurements, frozen under liquid n2, and stored at 80c . 24 hours after recovery, samples of the third leaves were collected from the remaining plants, frozen under liquid n2, and stored at 80c . Protein extraction was carried out using 200 mg tissue following the established 10% tca - acetone extraction protocol with the modification of replacing the 0.07% 2-mercaptoethanol with 10 mm dtt in the 10% tca - acetone and absolute acetone . Proteins were resuspended in 1 ml of resuspension solution (7 m urea and 2 m thiourea). Resuspension was achieved with 3 times sonication on ice, 5 seconds each at 35% power output using a sonopuls mini 20 sonicator, and a ms 1.5 probe (bandelin). Samples were clarified by two subsequent centrifugations at 13000 rpm for 15 minutes at 20c . Protein concentration was measured and adjusted to 2 mg ml using resuspension solution . An aliquot of 50 g protein samples was labeled with cy-2, cy-3, or cy-5 for control, drought treated, and recovery treated samples, respectively, using cy - dye dige fluor minimal dye labeling kit (ge healthcare) following the manufacturer's recommendation . Following labeling, samples were mixed together and 200 g of unlabeled protein from drought and recovery plant extracts were added to allow sufficient proteins for maldi - tof - ms reaction . Samples were adjusted to 360 l with resuspension solution and 90 l 5x loading buffer, containing 20% (w / v) chaps, 200 mm dtt, 10% (v / v) ipg buffer ph 310, and 0.01% (w / v) bromophenol blue, was added . Samples were used to rehydrate 24 cm ph 310 nonlinear ief strips (ge - healthcare) overnight prior to ief using the multiphor ii electrophoresis system (ge - healthcare) at 70 kvh . Following ief and prior to separation on a 20 cm length 10% sds - page casted into low fluorescence glass plates, strips were equilibrated for 15 minutes in 15 ml of sds equilibration solution (6 m urea, 75 mm tris - hcl ph 8.8, 29.3% (v / v) glycerol, 2% (w / v) sds, and 0.002% (w / v) bromophenol blue) containing 1% dtt, followed by additional 15 minutes in sds equilibration solution containing 2.5% (w / v) iodoacetamide . Following electrophoresis, gels were scanned using a typhoon 9410 scanner (ge healthcare). Maldi - tof - ms was carried out on protein spots excised from polyacrylamide gels as described in ashoub et al . And the included references . Proteins were identified using mascot (matrix science; peptide mass tolerance: 60 ppm; setting of maximum missed cleavages at 1) using the ncbinr database . The criterion for identifying a protein as significant up- or downregulated was a 1.5-fold threshold change in relative fluorescence signal intensity by pairwise comparison of the dye signals from the three coelectrophoresed samples [19, 20]. Protein maldi - tof - ms results with a score above the identification threshold 84 (p <0.05) were considered significant for accuracy of identification . In this study, a comparison is made between two sorghum genotypes which differ in their response to drought based on the physiological differences of their photosynthetic apparatus . A soil water potential of approximately 2 mpa was applied to ensure that plants perceived severe drought under greenhouse conditions . The 2d - dige approach was performed to analyze the changes in the proteome after drought stress and following recovery . The study used the maldi - tof - ms analysis to identify differentially expressed proteins . The fv / fm parameter representing the maximum quantum efficiency of photosystem ii and the performance index, piabs, as an indicator of the overall internal strength of the sample to resist external stresses were used as parameters to demonstrate the physiological status of the sorghum genotypes #11434 (drought tolerant) and #11431 (drought sensitive) following drought treatment and recovery . One - way anova was used to assess the significance of the differences among treatments at each experimental stage, and dunnett test at p <0.05 separated the means . Figures 1(a) and 1(b) show the data of fv / fm and piabs for both genotypes, respectively . Both genotypes showed a reduction in fv / fm and the piabs values at the end of drought treatment in comparison to their control values, with a smaller effect in #11434 than in #11431 . After 24 hours of recovery, both fv / fm and piabs values indicated recovery of #11434 to the relative values of control, while the chl fluorescence parameters in #11431 had not reached the level of the control values again . Rwc was reduced to about 40% (#11431) and 50% (#11434) following drought treatment, respectively . After 24 hours of rewatering, the initial water content was reached again in both genotypes (figure 1(c)). In the proteome analysis experiments, we used the cy-2, cy-3, and cy-5 dyes for labeling protein extracts of control, drought, and 24 h recovered plants, respectively . This approach was used to allow the separation of samples from all three treatments of each genotype in one single gel under identical separation conditions to minimize false positive results due to differences in the running conditions between gels, which occasionally lead to misidentifications of presumably up- or downregulated proteins by automated scanning systems . The criterion for selecting proteins for maldi - tof - ms was a 1.5-fold threshold change in relative fluorescence signal intensity . In #11434, out of the 650 detected spots on the 2d - page, 12 protein spots were upregulated and 6 were downregulated in response to drought stress while 24 hours following recovery 13 protein spots were upregulated and 5 were downregulated . Out of 630 detected spots in #11431, 19 protein spots were upregulated and 4 were downregulated following drought stress and no protein spots were upregulated and 2 protein spots were downregulated after 24 hours of recovery . Figure 2 and supplementary figure 1 in supplementary material (available online at http://dx.doi.org/10.1155/2014/395905) represents the position of differentially expressed protein spots for both accessions in 2d gels that were picked for maldi - tof - ms analysis . The proteins identified with maldi - tof - ms; their accession numbers on the ncbi database and their value of alteration in comparison to control values are indicated in table 1 . The group of metabolism - related proteins included the alteration of methionine synthase (spots 6, 7), s - adenosylmethionine synthase (spot 16), and p-(s)-hydroxymandelonitrile lyase (spot 29). Methionine synthase (spot 6) was upregulated in both #11434 and #11431 following drought stress, while the more basic isoform (spot 7) was upregulated only in #11431 . Following recovery, expression levels remained upregulated in #114134 and returned to control values in #11431 . Methionine synthase has been found to increase under drought stress in roots of wild watermelon . Several environmental stresses have been shown to cause changes in the pool of various free amino acids in plant cells from arabidopsis and rice [25, 26]. The activation of methionine synthase is an early response to drought since increased flux through the pathway provides a source of methyl groups for secondary metabolism under stress . Thus, the increase or maintenance of high levels of methionine synthase may reflect more active methionine and osmoregulant metabolism . S - adenosyl - l - methionine synthase has been found to be upregulated in response to drought in both #11434 and #11431, remaining increased in #11434, and reduced to the level of control 24 hours following recovery in #11431 . It catalyzes the syntheses of s - adenosyl - l - methionine (sam) from l - methionine and atp . Sam is the major methyl - group donor for many transmethylation reactions in both prokaryotes and eukaryotes [28, 29]. Plants produce several secondary products that include one or more methyl groups added during their biosynthesis by methyltransferases, many of which use sam as the methyl - group donor . Sam is also a precursor for the biosynthesis of polyamines which are involved in response to abiotic stresses; in particular the polyamine spermine which is synthesized from putrescine via two steps using sam was shown to have a protective role against drought stress . Sam is further involved in lignin biosynthesis, a major step accelerated with lignification of water stressed sorghum roots and salt stressed maize plants [32, 33]. P-(s)hydroxymandelonitrile lyase was upregulated in #11431 following drought stress, but not following recovery . Hydroxynitrile lyases are involved in cyanogenesis, release of hydrogen cyanide from damaged tissues, and part of a defense mechanism against herbivores or fungi, respectively [34, 35]. Their upregulation in response to drought stress might reflect the damage of cells of the sensitive genotype or be explained as a cell death mechanism in response to drought stress . Two key enzymes of the c4-pathway showed significant changes in their abundance . For both lines drought stress induced an upregulation of pepc content and a downregulation of nadp - me . For sorghum bicolor, beyel and brggemann investigated possible mechanisms of pepc - regulation under drought stress for s. bicolor . First, c4 plants have to maintain a malate gradient to provide a carbon flow from the mesophyll to the cells of the bundle sheath . It is therefore likely that the observed increased overall malate concentrations in s. bicolor under drought stress also imply a high malate concentration in the mesophyll cells . Pepc is activated via phosphorylation by a light - induced kinase (pepc - kinase). Malate is an important inhibitor of the activity of pepc as well as of pepc - kinase . At a physiological ph of 7.3 malate concentrations of 5 in addition, the inhibitory effect of malate could be enhanced by drought - induced ph decrease . The authors concluded that, despite high in vitro pepc activities in drought stressed s. bicolor, the in vivo activities may be low enough to limit photosynthesis . From the regulation mechanisms of the pepc - activity different conclusions on the one hand plants may react with a compensation of decreased in vivo pepc - activity by an increasing amount of the enzyme, explaining the increases of the pepc isoforms of spots 14 in figure 2 . On the other hand figure 2 shows a much more prominent spot of pepc - equal mass (100 kda) in the acid part of the 2d - gels, and it is likely that this spot represents the active population of the pepc, while only the unphosphorylated or otherwise modified isoforms spots underwent concentration changes and were analysed . The changes of the abundance of the prominent spot were analysed subsequently and revealed a 1.7-fold decrease for #11431 under drought stress, while its abundance in the recovered plants of both lines and in the stressed plants of #11434 did not change strongly . Absence of the positive identification via mass - spec, however, has to be noticed . In future experiments, measurements of the in vitro pepc - activity under identical experimental conditions in the two egyptian landraces would help to interpret the results from the dige analysis . For nadp - me both lines showed a decrease in abundance under drought stress (spots 911 for #11434 and spot 11 for #11431). As for the pepc there are multiple spots identified as nadp - me which differ in their pi . Beyel and alfonso and brggemann showed a moderate reduction of the nadp - me activity for panicum bulbosum and sorghum bicolor under drought stress . Downregulation of the nadp - me activity leads to a decreased decarboxylation rate and a lowered malate consumption . The lower decarboxylation rate in the bundle sheath cells may also influence total photosynthesis rate (calvin - cycle). 30), was upregulated upon drought treatment only in #11434 both under drought and following recovery . However, the maldi - tof - ms data analysis did not indicate if it is the cytoplasmic or the chloroplastic form of the enzyme . The enzyme has been regarded as a putative rate limiting factor for c4 photosynthesis in sorghum and other nadp - me - c4 species under control conditions [37, 40, 41]. Under drought stress, in vitro activities exceeded the need for the observed photosynthesis rates . In naturally senescing leaves of c3 plants, both the cytosolic and chloroplastic isoforms of ppdk are upregulated: while cytosolic ppdk accumulates preferentially in veins, chloroplastic ppdk also accumulates in mesophyll cells . In arabidopsis, overexpression of ppdk during senescence can significantly accelerate nitrogen remobilization from leaves and thereby increase rosette growth rate and the weight and nitrogen content of seeds . This function might be implemented as an efficient mobilization of metabolites from old to young leaves for plant survival under drought . Changes in the levels of proteins that have an impact on photosynthesis, glycolysis, and tca - cycle are also observed . Fructose-1,6-bisphosphate aldolase, fba, is found in a cytosolic and a plastidic isoform in plants . #11431 revealed changes of both isoforms (upregulation of the cytosolic, downregulation of the plastidic isoform, spots 17, 23, and 24) under drought stress . #11434 showed a downregulation of the plastidic form only (spots 23, 24). The enzyme catalyzes the linkage of dihydroxyacetonephosphate and glycerine-3-phosphate to fructose-1,6-bisphosphate and initiates the regeneration of ribulose-1,5-bisphosphate, the co2-acceptor of the calvin cycle . Haake et al . Showed for transgenic tomatoes that a small decline of the fba activity leads to lower rates of photosynthesis . Drought - induced effects on the reductive as well as on the regenerative functions of the calvin cycle have been observed . The downregulation of fba and gapdh under drought stress has recently also been observed by gong et al . For tomato . In contrast to the plastidic isoforms, the cytosolic fba in #11431 (spot 17) and gapdh in #11431 and #11434 (spot no . 20) were found to be upregulated . In cytoplasm both enzymes play a role in glycolysis . Meanwhile, cytosolic aldehyde dehydrogenase which may also play a role in the detoxification of aldehydes which are produced under drought stress . In addition, the stressed plants of #11431 indicated an increased amount of aconitase (spot no . 5). This enzyme catalyzes the reaction from citrate to isocitrate in the tca - cycle . Besides its function in nadh production via the tca - cycle, isocitrate is essential for the glyoxylate - cycle and after oxidation to alpha - ketoglutarate it is used in the assimilation of nitrogen . An upregulation of enzymes of glycolysis and respiration has most recently also been reported by zhao et al . For cynodon plants may be forced to increase catabolic reaction to maintain the metabolic and energetic homeostasis of the cells . The chloroplastic form of heat shock protein 60 (hsp60, spots 1214) and disulfide isomerase (spot 32) were upregulated following drought stress after 24 hours of recovery in #11434 . Hsp60 is important in the assembly of plastid proteins such as rubisco [49, 50]. It was suggested to be involved in folding and aggregation of many proteins that are transported to chloroplasts and mitochondria . It binds different types of proteins after their transcription and before folding to prevent their aggregation . In addition, another protein with chaperone functions, protein disulfide isomerase (pdi), was upregulated in drought stressed #11434 . Pdi catalyzes disulfide bond formation in the endoplasmic reticulum and assists in protein folding and has been reported to be upregulated in bentgrass in response to drought stress and thellungiella rosette in response to cold stress [27, 53]. Pepsin / retropepsin dependent aspartate protease, aps, (spot 18) was only upregulated in #11431 following drought treatment . Aps have been implicated in protein processing and/or degradation in different plant organs, as well as in plant senescence, stress responses, programmed cell death, and reproduction . The expression of aps in the drought sensitive line might reflect the abundance of degraded proteins under drought stress . Similarly, mitochondrial processing peptidase, mpp, (spot 31) was upregulated only in #11431 following drought treatment . Mpp is responsible for removing the presequence upon import via proteolytic cleavage and additionally it has a metalloprotease feature . Nucleoredoxin, nrx, (spot 8) was upregulated following drought and recovery in #11434 while it was only upregulated following drought in #11431 . The presence of this protein in developing kernels indicates that it could regulate the activity of transcription factors, presumably by altering their redox state . Rna binding protein (spot 21) was downregulated in #11431 following drought treatment and recovered to normal level following recovery, indicating rna synthesis inhibition in the drought sensitive genotype . On the other hand, 40s ribosomal protein s3 (spot no . 15) was upregulated in both genotypes after drought stress and remained upregulated during recovery only in #11434 . These results might indicate more efficient rna transcription and protein synthesis in the drought tolerant genotype especially following recovery . Several proteins were upregulated in response to drought stress and following recovery (table 1). Of these is the aba stress- and fruit - ripening induced like protein (spot 22). It was suggested that aba stress- and fruit - ripening induced like protein might adjust the activity of other gene products via its dna - binding activity or it might function as a protective agent against dna damage at the earlier stages of stress . The drought tolerant genotype proteome analysis indicated that the combined activities of several protein groups may enable the plants to tolerate drought stress and efficiently recover after removing the stress conditions . An efficient mechanism for protein stability, reallocation of metabolites to the newly developed structures, and efficient protein synthesis are the most characteristic features obtained from this study . On the other hand, elements of cell death combined with the production of proteases were the most obvious characteristic for the drought sensitive genotype.
The health effects of smoking are well - documented and it is estimated that half of those who smoke and fail to stop will die from their habit . Cigarette smoking is the major cause of many chronic and deadly diseases, such as, heart disease, stroke, chronic obstructive pulmonary disease, peripheral vascular disease, periodontal disease, pneumonia, and many cancers . Tobacco smoking is the single most important preventable cause of morbidity and mortality from cancer and cardiovascular diseases . Although the greatest burden of disease in developing countries continues to be from infectious diseases, there is a growing recognition that non - communicable diseases are becoming significant public health concerns . Tobacco - attributable mortality is estimated to contribute to about 10% of the total global mortality by 2020 . This figure is expected to rise to 10 million deaths a year by 2030, with 70% of these deaths occurring in developing countries . However, there are currently about one billion smokers in the world and it is estimated that by 2030, one billion people among the younger adults will start smoking and now 47% of the men and 12% of the women in the world smoke . According to the world health organization, the prevalence of smoking among students aged 15 and older is more than 24%% . Per capita cigarette consumption of 930 cigarettes, for individuals 15 years and older, has been reported . Despite a dramatic reduction in smoking prevalence in some countries, there is still a high prevalence among adults, young adults, and even adolescents, in iran ., in tehran, 27.5% of the boys and 23.5% of the girls had experienced cigarette smoking . In other words, given that most smokers take up the habit before they reach the age of 18 years, and because of the increasing levels of use and the dire public health implications, tobacco use among young people has been referred to as, both a pediatric disease and a pediatrics epidemic. Hence, one of the most important strategies in reducing smoking prevalence in the population has been to prevent young people from becoming smokers . In this regard, special attention should be given to college and pre - college students, due to their vulnerability during this important transition . Those students who had never tried smoking in the past and started experimenting with cigarettes and those who smoked occasionally in high school were more likely to become frequent and heavy smokers when they were in this term . In order to prevent students from potential adverse health consequences from smoking and to improve their lifestyles to healthier ones, it would be important to understand the factors that might impact the students smoking behavior . Predictors and correlates of cigarette smoking among students have been studied and examined in the united states and other western countries . Many factors associated with cigarette smoking among college students have been studied, including depression, social normative beliefs, being men, high - risk behaviors (e.g., marijuana use), lifestyle choices (e.g., nonparticipation in athletics), family, and peer smoking, being students in public schools, low socioeconomic status (ses), and poor academic performance at school . Despite the high and increasing prevalence of cigarette smoking in iran, little attention has been paid to examination of the influential factors of cigarette smoking among students . In a qualitative study by alipour et al ., relieving anger, curiosity, a sense of dignity, fear of isolation, peer pressure, imitation, sense of joy, obstinacy, opposition to parents, lack of compassion in family, early love, unwanted stimulation of parents, smoking of family members, fight with loneliness, opposition to social authorities, and loneliness have been reported as being associated with smoking initiation among high school students, in orumia, iran . There are several studies that have been conducted in other countries to define factors associated with cigarette smoking . In the most recent study the association between cigarette smoking and a number of individual and psychosocial correlates, including the subjective norms of family and peer smoking, personal attitudes, and perception toward smoking, depressive symptoms, social relations, and engagement in other health - risk behaviors, have been assessed . In this study, some constructs of the health belief model (hbm), including perceived benefits of smoking, perceived cost (barriers) of non - smoking, and self - efficacy, have been assessed . More perceived benefits of smoking and a higher level of perceived cost of non - smoking have been positively associated with being a past or a current smoker, and there is no significant association between self - efficacy and smoking practice among college students . In the study of strencher, results showed that only a high level of perceived susceptibility along with high self - efficacy would be more likely to cause patients to reduce smoking . The hbm is one of the most widely used health behavior model that has been used extensively to organize theoretical predictors of preventive health actions . The hbm is a method used to evaluate and explain individual differences in preventative health behavior . And therefore, the current study is designed to assess the knowledge and examine the association between the constructs of the hbm (perceived susceptibility, perceived barriers, perceived benefits, perceived self - efficacy, and cues to action) with cigarette smoking among male pre - college students . This study was done among male pre - college students of isfahan, iran, in 2010 . The instrument was developed by the researchers based on an existing questionnaire and previous studies . The questionnaire consisted of demographics and five hbm construct measures, namely perceived susceptibility of smoking - related health problems, perceived benefits of non - smoking, perceived barriers to non - smoking, perceived self - efficacy of non- smoking, and cues to action of non- smoking . The demographic variables included age, average annual household income, smoking status of the family members, parent's job, and age at the first smoking incident . The reliability of the questionnaire was assessed by a panel of experts . To ensure the validity of the survey, the cronbach's alpha values were 0.875 for perceived susceptibility, 0.783 for perceived barriers, 0.790 for perceived benefits, 0.834 for self - efficacy, and 0.813 for cues to action, respectively . The variables included in the instrument are discussed below under measures . To classify the smoking status, the students were asked the question, have you ever smoked at least one cigarette in the last month. The students who responded with a yes were assigned as smokers and those who had not were assigned as non - smokers . Also students who had smoked at least one cigarette in their entire life were considered as experimenter smokers . The method of sampling was random sampling, as follows: eight high schools were selected from five educational areas of isfahan . The trained survey administrators informed the students that their participation was voluntary, that their data would remain confidential, and would only be reported by group . The students were permitted to leave if they were not interested in participating in this study . Cross - tabulation was first created to display characteristics of participants according to their smoking status . The chi - square test was applied to identify any significant association between smoking status and demographic variables . The independent t - tests were used to compare the difference in measurements of the hbm constructs between smokers and non - smokers . The mean age of the students was 17.72 0.62 years; 38.7% of their fathers were self - employed and 84.7% of their mothers were housewives . There were smokers in the family of 26% of the subjects; 7.2% of the subjects were smokers at the time of study and 32.7% of the samples reported ever having smoked in their life time [table 1]. Demographics of precollege students of isfahan, 2010 chi - square analyses showed that the smoking status was significantly associated with the smoking status of the family members (p <0.05). No significant associations were found between the smoking status and average household income . As shown in table 2, the current smokers had significantly higher scores on cues to action of smoking (p = 0.007), perceived susceptibility of smoking - related health problems (p <0.001), perceived benefits of non - smoking (p = 0.002), and perceived self - efficacy to non - smoking (p <0.001) compared to non - smokers . There was no significant difference between the score of perceived barrier to non - smoking between current smokers and non - smokers (p = 0.531). Comparing the scores of the health belief model structures in smokers and non - smokers the mean age of the students was 17.72 0.62 years; 38.7% of their fathers were self - employed and 84.7% of their mothers were housewives . There were smokers in the family of 26% of the subjects; 7.2% of the subjects were smokers at the time of study and 32.7% of the samples reported ever having smoked in their life time [table 1]. Demographics of precollege students of isfahan, 2010 chi - square analyses showed that the smoking status was significantly associated with the smoking status of the family members (p <0.05). As shown in table 2, the current smokers had significantly higher scores on cues to action of smoking (p = 0.007), perceived susceptibility of smoking - related health problems (p <0.001), perceived benefits of non - smoking (p = 0.002), and perceived self - efficacy to non - smoking (p <0.001) compared to non - smokers . There was no significant difference between the score of perceived barrier to non - smoking between current smokers and non - smokers (p = 0.531). Comparing the scores of the health belief model structures in smokers and non - smokers numerous studies have indicated that more than 80% of the adult current smokers started cigarette smoking before the age of 18 years . Early smoking initiation predicted longer duration of smoking, heavier daily consumption, and increased chance of nicotine dependence . According to the structure of the iranian population and the high percentage of risk population, this study aim was to determine the factors that influence smoking in adolescents . According to the findings of this research 7.2% of the pre - university students of isfahan were smokers . In a survey to determine the smoking patterns of young students in tehran, in 2009, stated that three per ten of the subjects had ever smoked and 13.1% of male high school students were current smokers and the rate of smoking in all of students was 7.4% . In a global youth tobacco survey (gyts) the incidence rates were 4% in sri lanka, 9.1% in singapore, 10.4% in greece, and 16.6% in jordan . There was a significant relationship between the smoking status of the subjects and having a smoker person in the family, in this research . In accordance with the results of this study, other studies, such as, that of mousavi f, in a research on smokers of tehran, with the aim of determining the relationship between the smoking status of smokers and smoking parents and friends, stated that smokers were more likely to have smoker parents . The trend of smoking at an early age can be a warning to public health . Previous studies had shown that the age of starting cigarette smoking was more likely to become a heavy smoker with a consumption rate was very high and smoking cessation was less likely . The data analysis showed that there was a significant difference in perceived susceptibility about smoking - related health problems between current smokers and non - smokers, among students [table 2]. This could indicate that students have good overall knowledge about the risk of cigarette smoking . These data confirmed the findings of a study that high school students who had received comprehensive smoking education had a higher perceived susceptibility to smoking - related health problems, as compared to their counterparts in the high school . Also findings showed that there was no significant difference between the perceived barrier to non - smoking in current smokers and non - smokers . In the study of the effect of health education, based on the health belief model, on preventive actions of smoking in grade one, middle school students, in 2006, stated that after the educational intervention, there was no significant discrepancy in the perceived barrier in the educated group compared to the other group . In the study of the effect of education on smoking prevention in students of zahedan, concluded that after intervention, the means scores of all variables of the hbm increased significantly in the case group compared to the control group . The perceived benefits of non - smoking in this study were related to being a current smoker, as shown in table 2 . Current smokers had a lower mean score of perceived benefits in comparison to non - smokers . Also smokers in this survey had a lower mean score of self - efficacy and cues to action, as a part of the hbm ., in the study of chinese students, to determine the psychosocial correlates of cigarette smoking, concluded that the male gender, low family socioeconomic status, perception of more peer smoking, more perceived benefits of smoking, a higher level of pro - smoking attitude, a higher level of perceived cost of non - smoking, and more involvement in other health risks, were positively associated with being a past or current smoker . In the study of mao et al ., there was no significant association between self - efficacy and the smoking habit . As also, in the present study and in the existing literature in the united states and elsewhere, the data did show a strong relationship between self - efficacy and smoking practice among students . First, the data are based on self - reporting by the college students and thus are subject to self - reporting bias . To our knowledge this is the first study based on hbm constructs that was done to determine factors influencing cigarette smoking behavior of teenagers in isfahan . On account of the complexity of smoking behavior, a theory - based study could explain the predictive factors systematically and would help us in better understanding this behavior . The results of this study suggested that the constructs of hbm can be incorporated when examining the predictors of cigarette smoking and developing smoking prevention programs among pre - college students . Furthermore, with a better understanding of the factors affecting this complex behavior (cigarette smoking), it can be a useful step to reduce the rate of death, costs, and improve the community health outcomes.
Undescended testis is one of the most common disorders of childhood, with a rate of 3.68% among full - term infants managed by surgical correction . Surgical intervention is warranted during early infancy to avoid secondary degeneration of the testis, to improve fertility later, to help with the detection of malignancy, and to reduce the chance of testicular torsion . The inguinal approach is the traditional method for correcting undescended testis . In this approach, two incisions are made: one inguinal or groin incision to open the inguinal canal to visualize the cord structure and a second scrotal incision to fix the testes within the scrotum . It was believed that inguinal incision is helpful for sufficient mobilization of the spermatic cord, separation of the processus vaginalis or hernia sac, high ligation of the hernia sac, and to achieve an adequate length for the testes to be relocated to the dependent portion of the scrotum . However, bianchi and squire introduced the high scrotal incision orchiopexy technique for a palpable cryptorchid testis to decrease the potential morbidity of traditional inguinal incision orchiopexy . Until now, few prospective studies have been reported regarding the success rate of this technique compared with traditional inguinal orchiopexy for undescended palpable testis . In the present study, therefore, we evaluated a single scrotal incision technique for palpable undescended testis within the inguinal canal or distal to the external inguinal ring compared with traditional inguinal orchiopexy . From january 2007 to december 2010, a total of 292 children (398 testes) with palpable undescended testes were randomly assigned to two groups: single scrotal incision orchiopexy (group i, 147 children with 201 testes) or traditional inguinal incision orchiopexy (group ii, 145 children with 197 testes). Patients were assigned to the scrotal or inguinal group in a 1:1 ratio through a simple randomization procedure . 1). A total of 107 children (146 testes) underwent single scrotal incision orchiopexy (group i) and 105 children (141 testes) underwent traditional inguinal incision orchiopexy (group ii). They were followed up and evaluated until 12 months after the operation and included in the final data analysis . The patients' mean ages (months) at the time of operation in groups i and ii were 40.110.3 and 41.811.4, respectively (table 1). All patients were seen at least 1 week postoperatively to evaluate the possible occurrence of wound infection or skin problems and to assess for any other operation - related complications . At 3 months and 12 months after the operation, the patients were followed up for evaluation of long - term complications, overall success rate, and parents' satisfaction rate . Success was defined as no complications, postoperative intrascrotal location of the testis, and no conversion to the other method . The parents' satisfaction with the cosmetic results of the operation was assessed by use of a simple questionnaire that consisted of the answers' satisfied,' ' not fully satisfied,' and' unsatisfied .' All parents signed an informed consent form before participation in this study allowing the use of the patients' medical records for a scientific purpose . Children who had undergone a previous inguinal or pelvic surgery or who had a secondary ascending testis, ectopic testis, or undescended testis related to ambiguous genitalia or intersex condition were excluded from the study . Patients with primary and secondary hypogonadism and a detected hormonal abnormality or history of hormonal treatment were not included . All children were examined twice, preoperatively in the supine position by the primary surgeon and again after induction of general anesthesia to exclude retractile testis . The first surgical step of the single scrotal incision orchiopexy after induction of general anesthesia was a transverse skin incision that was commonly made along the high scrotal skin fold . The dartos pouch was adequately created through this incision for later relocation of the affected testis . The assistant manipulated the testis and held it between the thumb and index finger in a stable position, and in sequence the surgeon used blunt and sharp dissection of the subcutaneous tissues to approach the testis . The scrotal wound was retracted in an upward direction to facilitate easier dissection, and the surgeon divided the various covering and adhesive tissues of the cord . The dissection was carried out to the most cephalad to secure sufficient cord length and to possibly enter the lower half of the inguinal canal from below . The gubernacular attachments were released to enable identification of the testes within the cremasteric fibers, a patent processus vaginalis, and the cord structures . The cremasteric fibers and hernia sac were carefully separated from the cord structures, and the cranial sac was mobilized under traction into the canal and was ligated with a suture, as in traditional inguinal incision orchiopexy . When additional cord length was required, additional dissection was done through this incision by opening the external ring and canal, as necessary . Despite the additional dissection, if more length was required, the surgeon converted to the traditional inguinal orchiopexy method . The testis was then relocated into the dartos pouch, and two fixing sutures were made between the testicular tunica albuginea and inner scrotal wall medially and laterally to prevent ascent . After inguinal skin incision, the cord structure and testis were taken out of the inguinal incision site and then sufficiently dissected for mobilization . High ligation was done with the processus vaginalis, and the surgeon made an incision along the scrotal crease and relocated the testis in the scrotum . The student's t - test and chi - square test were used for data analysis . From january 2007 to december 2010, a total of 292 children (398 testes) with palpable undescended testes were randomly assigned to two groups: single scrotal incision orchiopexy (group i, 147 children with 201 testes) or traditional inguinal incision orchiopexy (group ii, 145 children with 197 testes). Patients were assigned to the scrotal or inguinal group in a 1:1 ratio through a simple randomization procedure . 1). A total of 107 children (146 testes) underwent single scrotal incision orchiopexy (group i) and 105 children (141 testes) underwent traditional inguinal incision orchiopexy (group ii). They were followed up and evaluated until 12 months after the operation and included in the final data analysis . The patients' mean ages (months) at the time of operation in groups i and ii were 40.110.3 and 41.811.4, respectively (table 1). All patients were seen at least 1 week postoperatively to evaluate the possible occurrence of wound infection or skin problems and to assess for any other operation - related complications . At 3 months and 12 months after the operation, the patients were followed up for evaluation of long - term complications, overall success rate, and parents' satisfaction rate . Success was defined as no complications, postoperative intrascrotal location of the testis, and no conversion to the other method . The parents' satisfaction with the cosmetic results of the operation was assessed by use of a simple questionnaire that consisted of the answers' satisfied,' ' not fully satisfied,' and' unsatisfied .' All parents signed an informed consent form before participation in this study allowing the use of the patients' medical records for a scientific purpose . Children who had undergone a previous inguinal or pelvic surgery or who had a secondary ascending testis, ectopic testis, or undescended testis related to ambiguous genitalia or intersex condition were excluded from the study . Patients with primary and secondary hypogonadism and a detected hormonal abnormality or history of hormonal treatment were not included . All children were examined twice, preoperatively in the supine position by the primary surgeon and again after induction of general anesthesia to exclude retractile testis . All operations were performed by 1 surgeon (kim so). The first surgical step of the single scrotal incision orchiopexy after induction of general anesthesia was a transverse skin incision that was commonly made along the high scrotal skin fold . The dartos pouch was adequately created through this incision for later relocation of the affected testis . The assistant manipulated the testis and held it between the thumb and index finger in a stable position, and in sequence the surgeon used blunt and sharp dissection of the subcutaneous tissues to approach the testis . The scrotal wound was retracted in an upward direction to facilitate easier dissection, and the surgeon divided the various covering and adhesive tissues of the cord . The dissection was carried out to the most cephalad to secure sufficient cord length and to possibly enter the lower half of the inguinal canal from below . The gubernacular attachments were released to enable identification of the testes within the cremasteric fibers, a patent processus vaginalis, and the cord structures . The cremasteric fibers and hernia sac were carefully separated from the cord structures, and the cranial sac was mobilized under traction into the canal and was ligated with a suture, as in traditional inguinal incision orchiopexy . When additional cord length was required, additional dissection was done through this incision by opening the external ring and canal, as necessary . Despite the additional dissection, if more length was required, the surgeon converted to the traditional inguinal orchiopexy method . The testis was then relocated into the dartos pouch, and two fixing sutures were made between the testicular tunica albuginea and inner scrotal wall medially and laterally to prevent ascent . After inguinal skin incision, the cord structure and testis were taken out of the inguinal incision site and then sufficiently dissected for mobilization . High ligation was done with the processus vaginalis, and the surgeon made an incision along the scrotal crease and relocated the testis in the scrotum . The student's t - test and chi - square test were used for data analysis . At the 12-month follow up, a total of 107 children (146 testes) who underwent single scrotal incision orchiopexy (group i) and 105 children (141 testes) who underwent traditional inguinal incision orchiopexy (group ii) were included in the final data analysis . The mean follow - up time was 12.93.4 months in group i and 12.73.3 months in group ii, and the evaluation is still ongoing (table 1). When the overall success rate was compared between the groups, it was not significantly different: 92.5% (135/146 testes) in group i and 96.5% (136/141 testes) in group ii (p=0.86) at 12 months (table 2). There was a significant difference between groups i and ii in terms of the period of hospitalization (days) (2.10.8 vs 2.50.7; p=0.03) and the operation time (minutes) (40.525.9 vs 62.335.6; p<0.001) (table 2). In nine cases in group i, the dissected cord length was insufficient because of severe adhesion despite a distal location in seven cases and a higher location in two cases, and we converted to the traditional inguinal approach in these cases . In the converted cases, the period of hospitalization (days) was 3.30.7 and the operation time (minutes) was 5530.3 . Thus, it seemed to take more time compared with the rest of group i, but we did not perform statistical analysis . Ii, traditional incision failed because of the need for laparoscopic exploration of hidden testes in two cases and the need for orchiectomy due to already atrophied testes in two cases . Postoperative scrotal hematoma was found in one case in group i, and wound dehiscence was found in one case in each group . Other complications including wound infection, testicular ascension, and testicular atrophy were not detected even after long - term follow - up . Both groups were pleased with the cosmetic result of the operation in terms of the parents' subjective satisfaction rate: 96.6% in group i and 96.5% in group (table 2). Single scrotal incision orchiopexy for a palpable undescended testis is well tolerated and has a cosmetically satisfactory result . Compared with traditional inguinal incision orchiopexy, single incision orchiopexy showed several benefits such as a shorter operation time and shorter hospital stay . The results of this study suggest that single incision orchiopexy is a useful method in terms of simplicity without significant surgical difficulties . Also, the success rate of single incision orchiopexy was as high as 92.5%; only 11 testes required conversion to traditional inguinal incision orchiopexy or had postoperative complications . Traditional inguinal incision orchiopexy was previously regarded as a mandatory procedure for obtaining adequate mobilization of the spermatic cord, but requires two standard skin incisions for direct visualization of the cord structures, and separation and high ligation of commonly associated inguinal hernia is not easy without opening the inguinal canal furthermore, in the pediatric population, there is good mobility of the skin incision and a relatively short distance from the external to the internal inguinal ring . These points led others to believe that one scrotal incision rather than two may be sufficient for orchiopexy in patients with a palpable, low - lying undescended testis . Bianchi and squire proposed that moving the incision by retraction and the short distance from the internal to the external ring made it possible to dissect the hernia sac without opening the canal . Moreover, they suggested that achieving adequate palpable testis cord length was dependent more on releasing the hernial sac from the cord than on dissection around the spermatic cord vessels . The suggested that the benefits of using one incision in the scrotal skin fold included decreased pain, improved cosmesis, and a shorter operative time with less incision needed to close the wound window . Caruso et al evaluated the bianchi single scrotal incision technique for orchiopexy in patients with a palpable undescended testis distal to the external inguinal ring and reported that this technique is simple and safe in such cases . Only 1 of 42 testicles approached in this manner required a conversion to the traditional inguinal incision orchiopexy to gain adequate cord length . An important point in their report was that, after opening the inguinal canal when they converted to the inguinal approach, they found that the ligated hernia sac was retracted well into the low retroperitoneum above the level of the internal ring . Their findings support previous results showing that a palpable undescended testis may be surgically relocated into the dependent scrotum without sacrificing the traditional principles of orchiopexy . The present study is distinct from previous descriptions of scrotal orchiopexy . In previous reports, single scrotal incision orchiopexy was rarely tried in patients with an undescended testis in the inguinal canal and the exact success rate and satisfaction rate were rarely calculated . Bianchi and squire performed single scrotal incision orchiopexy in 120 patients with undescended testis and reported a 95.8% success rate . They reported that the testicular locations of failed cases were in high areas such as the inguinal canal . Dayan et al prospectively evaluated the success rate with or without inguinal hernia in patients with an undescended testis within the inguinal canal or beyond the external inguinal ring . They divided the patients into two groups: one with the testis located within the inguinal canal and the other with the testis located beyond the external inguinal ring . Scrotal orchiopexy was performed successfully (97.6%) in 42 of 43 testes in the distal to the external inguinal ring group, and only 1 patient required conversion to a traditional inguinal incision . The average operating time was 18 minutes, and no hydrocele or hernia was noted . In the 29 testes that were located within the inguinal canal, 3 cases needed conversion to traditional inguinal orchiopexy, with an average operative time of 25 minutes and a success rate of 89.7% . In the present study, the overall success rate was 92.5% (135/146) in the single scrotal incision orchiopexy group and 96.5% (136/141) in the traditional inguinal incision orchiopexy group, thus showing no statistically significant difference between the two procedures . However, the operation time and hospital stay period were significantly shorter in the single scrotal incision group than in the traditional inguinal incision orchiopexy group, as in the previous study . In our study, in two of the nine cases that were converted to traditional orchiopexy, the testes were located in the higher inguinal canal, and 7 were severely adhered with adjacent tissues . In those cases, the main reason for conversion was insufficient length of cord . In the failed orchiopexy cases in the traditional orchiopexy group, according to the results of our study, we suggest that possible conversion to traditional orchiopexy should be considered before the operation when the testis is located in the inguinal canal or higher . Our results show that single scrotal orchiopexy can be safely performed through a high scrotal incision . An additional inguinal incision is only required in a small number of subjects in whom the palpable testis has a high location and the vascular length is insufficient or the processus vaginalis is not sufficient . A possible controversy regarding this scrotal approach technique is whether the dissection is high enough to easily allow for adequate lengthening of the cord and placement of the testis into the scrotum without tension . Also, there is concern that a single scrotal approach may not allow sufficient ligation of the processus vaginalis to avoid hernia or hydrocele formation after the operation . Several others have used the high scrotal incision technique to correct abnormalities of the patent processus vaginalis, such as hernia and hydrocele . Moreover, many other studies have suggested that failed orchiopexy from a scrotal incision is not due to incomplete division of the hernia sac from the spermatic vessels . Despite the controversy over the relationship between the success rate of single scrotal incision orchiopexy and ligation of the patent processus vaginalis, we successfully ligated the processus vaginalis in all cases . Thus, it could be said that the scrotal incision orchiopexy was cosmetically feasible . In the single scrotal incision group compared with the traditional inguinal incision group, objective indexes such as operation time and hospital the results of the present study confirm our belief that single scrotal incision orchiopexy is a simple, safe, and cosmetically satisfactory technique . This study had some limitations, such as the relatively small number of patients included in the study . Also, important variables in this analysis, such as testis volume, were not considered in the follow - up evaluation . The results of our study showed that single scrotal incision orchiopexy is a simple technique associated with a short operation time and hospital stay and is a cosmetically feasible method . Most palpable testes can be safely approached through a scrotal incision, but an additional inguinal incision should be considered in some cases of high inguinal testes where insufficient dissection of vascular length or the processus vaginalis is encountered.
A 67-year - old female patient with adrenal insufficiency in drug - induced hepatic failure previously had a cancer on the left breast, which had been treated by modified radical mastectomy followed by an unknown regimen of adjuvant chemotherapy . Thereafter, she had experienced jaundice with mental change and had been diagnosed with drug - induced liver failure . Despite supportive care, her stuporous mental status did not return, making her a candidate for liver transplantation . Although she was semicomatose, her vital signs were stable and there was no evidence of sepsis . Mmol / l and k concentration of 4.8 - 5.4 mmol / l (table 1). A rapid adrenocorticotropic hormone (acth) stimulation test was performed to diagnose adrenal insufficiency . Her preoperative random total cortisol concentration was 9.0 g / dl (adrenal insufficiency: <10 g / dl). Thirty minutes after stimulation with 250 g synacthen, her delta cortisol concentration was 4.9 g / dl (adrenal insufficiency: <9 g / dl). Based on guidelines for the diagnosis of corticosteroid insufficiency in critically ill patients, she was diagnosed with adrenal insufficiency . The patient was started on hydrocortisone therapy (50 mg, tid) preoperatively, and it was maintained during liver transplantation . Hemodynamic data were recorded in real time during surgery using an online personal computer interfaced with a signal processing software (windaq, dataq instrument, akron, oh). Thirty minutes after surgical incision, the patient's mean arterial blood pressure (abp) started to fluctuate and decreased to less than 60 mmhg without significant blood loss . Because intermittent bolus administration of ephedrine was not effective, she was infused continuously with dopamine (5 - 10 g / kg / min), dobutamine (5 g / kg / min) and norepinephrine (0.15 - 0.2 g / kg / min), starting from the pre - anhepatic phase of liver transplantation (table 1)., she was administered 172.5 mg of methylprednisolone (3 mg / kg) for immunosuppression . Immediately after reperfusion, she was administered 40 g of an epinephrine bolus due to severe hypotension . However, although she was supported by increasing dose of inotropics and vasopressors after graft reperfusion, her abp continued to fluctuate until the end of the operation . Although she was maintained on hydrocortisone postoperatively, inotropics could not be tapered and hemodynamic instability continued (table 1). On postoperative day 9, the patient developed atrial fibrillation, and a chest radiograph showed pneumonic infiltration . On postoperative day 11, the patient died due to pneumonia and septic shock ., there is a high incidence of adrenal insufficiency in critically ill patients with liver disease . Harry et al . Reported that hemodynamically unstable patients with acute hepatic dysfunction showed significantly lower serum cortisol levels of acth stimulation test . They also revealed that the steroid replacement was associated with dose reduction of vasopressor, but not survival, in patients with adrenal insufficiency in liver failure . Furthermore, marik et al . Have observed a pathophysiologic association between adrenal insufficiency and low concentrations of high - density lipoprotein, the preferred source of seteroidogenic substrates in the adrenal gland, in patients with liver failure and in post - liver transplant recipients . Although hydrocortisone replacement started immediately after diagnosis of adrenal insufficiency, her hemodynamic status was unstable and she required continuous infusion of inotropics during and after liver transplantation . Therefore, she likely had hepatoadrenal syndrome, with adrenal insufficiency playing a role in her cardiovascular instability during and after liver transplantation . Because most of liver transplant recipients receive supplementary corticosteroids as postoperative immunosuppressants, adrenal insufficiency has been rarely documented in those patients . After the development of steroid - free immunosuppression, several reports have shown adrenal insufficiency in post - liver transplant recipients . For example, adrenal insufficiency, as manifested by severe multiple organ dysfunction, was observed in a post - liver transplant recipient who had not been administered with steroid immunosuppressants . That patient had been diagnosed with adrenal insufficiency 40 days after liver transplantation and was successfully treated with corticosteroid . However, there is little report focused on adrenal insufficiency that occurred before liver transplantation . Our report is a case of a liver transplant recipient to be diagnosed preoperatively with adrenal insufficiency, showing marked abp fluctuation during liver transplantation surgery . It is well known that the basic concept of adrenal insufficiency is the inadequate activation of hypothalamic - pituitary - adrenal axis with cortisol release to illness and stress . Even though the present patient showed relatively stable hemodynamic parameters before glucocorticoid replacement, she was treated with hydrocortisone throughout the hospital course after confirming adrenal insufficiency . However, surgical stress may not be tolerated and cause severe hemodynamic instability during liver transplantation despite hydrocortisone replacement therapy, implying importance of adrenal function in liver transplantation . Several previous studies on patients with liver failure and adrenal insufficiency have focused on sepsis or septic conditions and survival by corticosteroid administration . Previous studies have reported that corticosteroid therapy has beneficial effects on survival and hemodynamic stability in patients with liver failure and septic shock and in post - liver transplant recipients [3,11 - 13]. However, consistent with findings showing that corticosteroid therapy may not improve survival in vasopressor - dependent patients with adrenal insufficiency and liver disease, our patient with suspected hepatoadrenal syndrome did not effectively respond to corticosteroid therapy, eventually expired due to pneumonia and septic shock after liver transplantation . The specific mechanisms underlying these controversial effects of steroid therapy are unknown, but warrant further investigation . It has been well known that hemodynamic complications in patients with liver failure may be affected by several factors . For examples, low systemic vascular resistance, high cardiac output, combined cirrhotic cardiomyopathy, massive bleeding and coagulopathy, and metabolic status during liver transplantation hemodynamic instability in the present patient during and after liver transplantation was not explained completely by the general pathophysiology of liver failure . Because arterial ph, electrolytes, lactate level, and intravascular volume status during liver transplantation surgery were maintained adequately, adrenal insufficiency diagnosed preoperatively was thought to be an important reason for the marked abp fluctuation during and after liver transplantation surgery in our patient . However, we could not exclude the above mentioned pathophysiological effects . In conclusion, we found that a patient with adrenal insufficiency suffered severe hemodynamic instability during and after liver transplantation, reinforcing the importance of hepatoadrenal syndrome . These findings indicate that perioperative adrenal function should be monitored carefully in liver transplantation recipients with severe hemodynamic fluctuation.
The first two - dimensional (2d) and three - dimensional (3d) superlattices were observed with ag2s and cdse nanocrystals, respectively [1 - 4]. Since then, many researchers have studied various self - organized lattices of silver [5 - 14], gold [15 - 25], cobalt, and cobalt oxide . Thiol - stabilized gold nanoparticles, including nanocrystals and nanoclusters, have attracted significant research interest in recent years because of their importance in both fundamental science and technological applications such as catalysis, optics, biomedicine, and chemical sensing . Investigated characteristic 2d and 3d self - organized structures of surface - modified gold nanoparticles and discussed the importance of their surface chemistry . Despite the large volume of literature relating to synthesis, morphological development, assembling, and demonstrated applications of thiol - stabilized gold (au) nanoparticles, only a few studies exist on further structural development such as low - temperature coalescence and grain growth based on self - organized structures . Meli and green investigated the low - temperature coalescence of self - assembled thiol - stabilized gold nanoparticles in polymer film; however, the thermally induced coalescence to form larger single - crystal particles underwent at 423 k (150c). Supriya and claus also reported thermally induced coalescence of thiol - capped gold nanoparticles . However, the phenomenon was observed above 373 k (120c), which is still rather higher than room temperature . Recently, we have found, during investigation on the synthesis and self - organization of thiol - stabilized au nanoparticles, that the prepared au nanoparticles grew into larger single and/or twinned crystals at relatively low temperature of 323 k (50c), which is rather near to the room temperature than the previous reports . Here, we describe the growth of thiol - stabilized gold nanoparticles by low - temperature heat - induced (323 k) coalescence on amorphous carbon film . Synthesis of thiol - stabilized gold nanoparticles was achieved by reduction of aucl3 with dodecanethiol as a capping ligand . A 0.025 m micelle solution of didodecyldimethylammoniumbromide (ddab) was prepared in 10 ml toluene . Aucl3 was dissolved in this micelle solution under vigorous stirring, where 0.1 mm of au solution was prepared . Then, freshly prepared sodium borohydride (nabh4) aqueous solution was added to the former stirred solution drop by drop . The as - formed wine - colored solution was stirred for 2 h at room temperature . The as - prepared gold colloid was split into 5 ml parts, and 1-dodecanethiol was added to each part, where dodecanethiol / gold mole ratio was varied from 0.8 to 3.2 . The gold particles were separated from the solutions by ethanol precipitation to eliminate ddab, excess thiol and the reaction products . Gold nanocrystal organizations were prepared via the deposition of dodecanethiol - coated gold nanocrystals onto a copper grid covered with an amorphous carbon film . The grid was immersed in 50 l of a nanocrystalline solution and kept at 323 k (50c) and room temperature for a comparison . The morphology of the particles prepared on the copper grid was directly characterized by transmission electron microscopy (tem, model h-8100, hitachi co., ltd, tokyo, japan) operated at 200 kv . Visible (uv vis) spectroscopy (model 2550, shimazu, kyoto, japan) was used to determine both particle size and degree of aggregation of as - synthesized and annealed particles . Figure 1 shows tem images of as - prepared gold nanocrystals with various dodecanethiol concentrations . It is clear that synthesized gold nanoparticles self - organized to form a hexagonal close - packed (hcp) structure as schematically indicated in fig . 1a, 1b . With increasing dodecanethiol / gold mole ratio from 0.8 to 3.2, the average particle size increased from 5 to 8 nm and it has been reported that, generally, larger thiol / gold mole ratios yield smaller average core sizes and more monodisperse particles . In this study, however, the presence of dodecanethiol in excess, with thiol / gold mole ratio greater than 3.2, yields particle aggregates (fig . It is thought that the excess thiol ligands have this effect because the sulfur atom of a thiol is quite nucleophilic . Excess thiol ligands in the solution slow the evaporation of toluene, and the interaction between solvent - evaporation kinetics and the excess thiol might cause this aggregation . At a ratio of 0.8, tem images of as - prepared 2d - organized gold nanocrystals on amorphous carbon without any heat treatment for various dodecanethiol / gold ratios: a 0.8; b 1.6; c and d 3.2 figure 2 shows tem images of 2d and 3d gold nanocrystals with various annealing times at 323 k. four samples were prepared simultaneously . After the assigned annealing time, each sample was examined with tem to observe its general crystal configuration . With increasing annealing time from as - prepared (fig . 2d), the particles aggregated more and more, and finally changed to single or twinned crystals . After annealing for 6 h (fig . 2b), a small ordered domain formed by the stacking of a few coalesced nanocrystals as shown in fig . 3, which was somewhat similar to the 3d structure observed by fink et al . . 2c), some nanocrystals coalesced to reach a diameter of ~20 nm and the initial hexagonal close - packed monolayer organization found in as - synthesized sample (fig . 2d), the coalesced gold nanocrystals continued to grow to form several large (2060 nm) but triangular single - crystal particles and/or polygons with twinned structures (arrowed in fig . Twinned structures are thermodynamically favorable to form decahedral multi - twinned particles and contain more low - energy facets than do single - crystal particles . It has been suggested that atoms on different crystallographic facets might have different interaction strengths with a polymeric or surfactant capping agent, leading to the anisotropic growth of solid materials . Nanocrystal organization on amorphous carbon: a as - prepared without annealing; annealing at 323 k for b 6 h; c 12 h; d 24 h; e soaked at room temperature for 24 h for a comparison . The dodecanethiol / gold ratio is 1.6 tem image and schematic drawing for the formation of 3d structure (monolayer to multilayer) of gold nanoparticles by low - temperature heat treatment at 323 k for 12 h. the dodecanethiol / gold ratio is 1.6 uv vis spectroscopy was used to determine both particle size and degree of aggregation in colloidal particles (fig . 4). The absorption band, max around 500600 nm, is dependent on the size and shape of the particles, as well as thus, it is useful for identifying not only particle size but also phenomena such as aggregation . The formation of gold nanoparticles through reduction of aucl3 was examined by observing the change in the absorption band centered at 525 nm originating from the surface plasmon of the gold nanoparticles . With increasing reaction time, the absorption bands red - shifted from 525 nm (as - synthesized) to 565 nm (24 h annealing) and the peak sharpness decreased, indicating an increase in particle size . Vis spectra of gold nanocrystals: (a) as - prepared and annealed at 323 k for (b) 6 h, (c) 12 h, and (d) 14 h. the dodecanethiol / gold ratio is fixed to 1.6 from this observation, we suggest that the change observed is due to progressive coalescence of the self - organized 5 nm spherical gold nanoparticles at the rather low temperature of 323 k. however, it should be noted that after soaking at room temperature for 24 h, growth of organized gold nanoparticles was not observed (fig . The increased interparticle attraction probably arises from thiol desorption . As capping ligands desorb, the steric stability of the nanocrystals decreases and the inclination to aggregate increases . Although the capping ligands chemisorb on the particle surface, the bonds are relatively unstable; at low temperature, the alkyl chains behave as a solid with a rigid configuration, whereas on heating to 323 k, they behave more as a liquid . Investigated the temperature - dependent phase behavior and dynamic freedom of alkyl chains coated on silver and gold clusters and reported that at 325 k, about 70% of the chains contribute to the dynamic activity . Based on the above - mentioned facts, here, we discuss the plausible mechanism for the 2d organization of thiol - stabilized gold nanoparticles and their coalescence and growth (fig . 5). The relative values of the two energy components determine the nature of the final structure; specifically, whether it is superlattice, single crystal, and/or twinned crystal . As mentioned earlier, the capping ligands, although chemisorbed, form relatively unstable bonds with the particle surface, and driving forces for both adsorption and desorption exist . . Subsequently, the gold nanoparticles approach each other to form aggregates with partly 3d organization (fig . The interaction between nanoparticles is strong because of the large polarizability of the gold cores and the consequent van der waals attraction potential between them . Finally, the gold cores, attracted to each other, grow into other structures such as single and/or twinned crystals (fig . 2c, 2d) by the continuously generated heat from the exothermic formation of disulfides bonds . And hence, the growth must be followed by the diffusion of gold atoms and rearrangement of crystalline lattice . Schematic drawing of plausible mechanism for the 2d organization of thiol - stabilized gold nanoparticles and their coalescence and growth to form larger single and/or twinned crystals the coalescence mechanism of thiol - stabilized gold nanoparticles in the present study seems to be the same as that recently reported by meli and green to some extent; they concluded that, during the initial stage of heating at 423 k, coarsening occurred via simultaneous ostwald ripening mechanism and coalescence process based upon collision of nanoparticles, whereas during the second stage, coalescence was the dominant mechanism . And they pointed out the importance of desorption of the alkanethiol molecules during the annealing, which associated the transition of two distinct stages . However, it is clearly evident from the present study that thiol - stabilized gold nanoparticles could coalesce to form larger mono - crystals at lather low - temperature (323 k, i.e., 50c), due to the physico - chemical phenomenon as mentioned earlier . The present finding implies us the usefulness and advantage of this method to create self - organized nanoparticulate - derived low - dimensional structures / devices constructed on thermally unstable substrates and/or combined with organic - based functional materials . In summary, we have devised a method for growing self - organized gold nanoparticles at relatively low temperature (323 k). The morphology of gold nanoparticles was controlled by the presence of dodecanethiol; as the dodecanethiol / gold ratio increased from 0.8 to 3.2, the average particle size increased from 5 to 8 nm at room temperature . The growth of self - organized gold nanoparticles at relatively low temperature (323 k) occurs in three steps: (1) thiol molecules are desorbed on a gold surface and then oxidized to disulfides . (2) the gold nanoparticle cores approach each other because of van der waals attraction and then coalesce . (3) the attracting gold cores grow into larger single and/or twinned crystals via the diffusion and rearrangement of gold atoms, because of the heat generated from the exothermic formation of disulfide bonds . We therefore suggest that the dynamic motion of thiol molecules is the key to the growth of other shapes and sizes at the processing temperature . One of the authors (sym) acknowledges the financial support from japan society for the promotion of science, grant - in - aid for jsps fellows (no . This article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited . This article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.
In the management of patients with stiff thoracic scoliosis and kyphosis, anterior spinal release is helpful in increasing the spinal flexibility and therefore, the result of deformity correction . However, cutting of the chest - wall muscles is associated with complications such as reduced ventilation, post - operative atelectasis, extensive and painful scars, blood loss, and prolonged hospital stay . Video - assisted thoracoscopic surgery (vats) for anterior release of the spine is becoming increasingly more popular due to its minimally invasive nature [1, 19, 25]. However, opponents do not believe that vats is effective in improving the spinal flexibility as it is difficult to perform a radical discectomy, and to a lesser extent, rib - head excision by thoracoscopy [5, 23]. While vats supporters have used animals and cadavers to demonstrate the effectiveness of thoracoscopic spinal release [6, 20], these studies were performed in spines that did not have scoliosis . The fulcrum - bending radiograph, obtained with the patient lying sideways hinging over a fulcrum provides a simple and reproducible technique for the in - vivo assessment of spinal flexibility . It can accurately predict before surgery, the amount of correction that can be achieved by modern segmental spinal instrumentations [4, 11, 16, 17]. Using this method, one can assess the effectiveness of an anterior release by either directly comparing the spinal flexibility (as reviewed by the fulcrum - bending radiograph) before and after an anterior release, or indirectly by comparing the predicted correction by the pre - release fulcrum - bending radiograph and the actual correction achieved by the anterior release and posterior fusion . Either way, differences in the measured cobb angle would be attributable to the effect of the thoracoscopic release . In our institution, a number of thoracoscopic anterior release and posterior fusion surgeries for thoracic idiopathic scoliosis were staged . This gave the opportunity to perform the fulcrum - bending radiograph before and after the anterior release, thereby allowing direct assessments of flexibility changes as a result of the thoracoscopic procedure . Between 1997 and 1999, five patients with idiopathic scoliosis requiring anterior release for stiff thoracic curves were prospectively investigated . The authors define stiff curves as those which have a cobb angle of more than 40 with the fulcrum - bending radiograph; this was arbitrarily used as we felt that the residual curves of over 40 gave unacceptable cosmetic results, and therefore a flexibility - modifying procedure would be indicated . The mean age at the time of operation was 23.0 years (range 13.935.3). According to the king s classification, there were one type i, two type ii, and two type iii curves . For the patient with type i curve, both thoracic and lumbar curves were corrected and fused, and for the type ii and iii curves, only the thoracic curves were instrumented . According to lenke s classification, there were three type i, one type iii, and one type v curve . All the patients underwent an anterior thoracoscopic release, followed by a second - stage posterior instrumented correction, and fusion 1 week later . The instrumentations used for the posterior spinal fusion were texas scottish rite hospital (tsrh, n=2; sofamor - danek, memphis, tn, usa), isola (n=2; acromed corp ., cleveland, oh, usa), and cd - horizon (cd - h: n=1; sofamor - danek, memphis, tn, usa) systems . The mean number of thoracic discs resected was four, ranging from 3 to 5 (table 1). Posterior fixation was done by a pre - dominant hook construct using one upper and two intermediate hooks, and either a hook or pedicle - screw at the lowest fusion level . Table 1general patient datacase 1case 2case 3case 4case 5king s typeiiiiiiiiiiiage (years) at operation21.513.925.435.219.1levels releasedt7-t10t7-t11t6-t10t7-t12t6-t10number of discs released34454instrumentation used tsrhtsrhisolacdisola the thoracoscopic anterior release was performed with the patient under general anesthesia . The technique involved a discectomy by making a large annular window over the convex side of the scoliosis; the whole nucleus and cartilaginous end - plates were removed . Excision of the posterior annulus to the posterior longitudinal ligament is always attempted but is usually successful only at the apical discs . The effectiveness of the thoracoscopic anterior release in increasing spinal flexibility was investigated by two methods . First by a direct comparison of the cobb angle measured from a pre - release fulcrum - bending radiograph with that of the post - release fulcrum - bending radiograph . Second, by an indirect method, comparing the pre - release fulcrum - bending radiograph with the final post - operative correction . As the pre - operative fulcrum - bending radiograph has been reported to be able to accurately predict the post - operative coronal deformity correction for posterior surgery [4, 11, 17], the difference of the cobb angles between the pre - operative fulcrum - bending radiograph (which predicted the correction for the posterior surgery alone) and the post - operative standing x - ray (which shows the actual correction achieved by combined anterior release and posterior instrumentation) will indirectly demonstrate the in vivo effect of the anterior thoracoscopic spinal release . Statistical analyses were carried out using the student s t - test, with a significance level of (p<0.05). The fulcrum flexibility, a measure of the spinal flexibility as revealed by the fulcrum - bending radiograph [11, 17] was calculated based on the following formula: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document} $$\begin{aligned} {} & {\text{fulcrum flexibility (\%) =}} \frac{{{\text{preop cobb angle - fb cobb angle}}}} {{{\text{preop cobb angle}}}}{\text {$\times $100}} \\ & \\ \end{aligned} $$\end{document} where fb stands for fulcrum bending . This relationship was used to directly assess the changes in flexibility as a result of the anterior release . The patients were followed for an average of 4 years (range 2.24.9 years). The mean fulcrum flexibility before the anterior release was 39%; it increased by 1554% after the anterior thoracoscopic release (p<0.05). The mean pre - operative cobb angle on the postero anterior (pa) standing radiograph was 71, the mean pre - operative fulcrum - bending angle was 43, the mean post - release fulcrum - bending angle was 33, and the actual mean cobb angle after combined anterior thoracoscopic release and posterior surgery was 30. the latter correlated with the post - release fulcrum - bending result (p=0.09), and was significantly different (p<0.05) from the pre - release fulcrum - bending result to suggest that the thoracoscopic anterior release can effectively improve the surgical correction of the coronal curve . On an average, four discs were excised per patient, and as the mean improvement in correction is 13, it suggested that resection of one disc resulted in a mean improvement in correction by approximately 3 (table 2, fig . 1). It was not possible to perform a post - release fulcrum - bending xr because of wound pain)case 1case 2case 3case 4case 5meanpre - operative ap standing 657675786171pre - release fulcrum bending434145454043post - release fulcrum bending35284030n / a33ap standing latest follow - up322830282629fig . 1 apre - operative anteroposterior standing radiograph of case 2, showing a 76-curve from t6 to t12 . B pre - release fulcrum - bending radiograph showing a correction to only 41. c fulcrum - bending radiograph taken 1 week after an anterior thoracoscopic release of four levels, showing an improvement in the flexibility to 28. d post - operative standing radiograph taken 1 week after the posterior correction, showing the curve correction to 29 measured cobb angles for each case (for case 5, it was not possible to perform a post - release fulcrum - bending xr because of wound pain) pre - operative anteroposterior standing radiograph of case 2, showing a 76-curve from t6 to t12 . B pre - release fulcrum - bending radiograph showing a correction to only 41. c fulcrum - bending radiograph taken 1 week after an anterior thoracoscopic release of four levels, showing an improvement in the flexibility to 28. d post - operative standing radiograph taken 1 week after the posterior correction, showing the curve correction to 29 the immediate post - operative cobb angle of 30 (data not shown) was well predicted by the post - release fulcrum - bending radiograph of 33. there was no significant change in this correction at the latest follow - up (table 2). Anterior spinal release by open thoracotomy has been extensively used in the past to help improve spinal flexibility in stiff thoracic scoliosis . Its role has been increasingly taken over by vats as the latter is associated with a lower morbidity [8, 21]. However, some surgeons feel that an anterior thoracoscopic release is not as effective as an open release . This is because they believe that a successful anterior spinal release requires a rib - head resection and a radical discectomy, which cannot be easily performed through vats [5, 23]. Although studies using animals and cadavers have demonstrated that a thoracoscopic release can improve spinal flexibility [6, 20], it was not performed on actual patients with scoliosis . Thus, there is no definitive proof in human patients with scoliosis that the thoracoscopic spinal release is effective . Although some clinical studies have demonstrated that combined vats and posterior spine fusion resulted in good scoliosis correction [2, 21, 22], they did not assess the actual flexibility of the scoliosis and therefore were not able to directly demonstrate that the thoracoscopic release added to the spinal flexibility . The use of the fulcrum - bending radiograph, which reflects the spinal flexibility and accurately predicts the post - operative coronal deformity correction, provides an opportunity to assess the effectiveness of thoracoscopic release in vivo [24, 27, 28] the five cases included in this study had stiff curves, with a pre - operative fulcrum - bending angle of more than 40, a mean pre - operative fulcrum flexibility of only 39%, and a mean cobb angle of 71. as these cases had staged surgery, we were able to obtain a post - release fulcrum - bending radiograph for comparison with the pre - release and post - operative cobb angles . After anterior thoracoscopic release, flexibility was increased from 39 to 54%, thus representing a direct proof that the procedure can improve the spinal flexibility, in our cases by an average of 15% . One patient (case 5) was unable to lie on the fulcrum to perform a post - release fulcrum - bending radiograph due to wound pain . Nevertheless, case 5 has been included in the analysis, as a comparison of the pre - release fulcrum - bending radiograph with the post - operative radiograph will still provide an indirect evidence on the success of a thoracoscopic release (table 2). For those who were able to lie on the fulcrum the post - release fulcrum - bending radiograph correlated well with the post - operative result . It should be noted that the previous work on the fulcrum - bending radiograph are based on the use of hooks and hybrid systems only [4, 15]. The predictability of this method with reference to the use of pedicle - screw fixation is not known . It is widely believed that pedicle - screw systems give a superior degree of correction when compared to hook systems, and may obviate the need to perform anterior releases . However, there is no published data, which directly compares the two systems, taking into account the spinal flexibility . The authors are aware of two different ways to measure cobb angles before and after surgery . One method is to determine the cobb angles in the pre - operative standing radiograph, and then to use the same levels throughout, although in the post - operative radiograph, the same measured levels may no longer be the most tilted vertebra . The alternative method is always a measure from the most tilted levels even though the levels may change between pre- and post - operative radiographs . While the authors prefer the former method, use of the latter method would not alter the results . Using the presented case as an example (fig . 1), the pre - operative cobb angle from t6 to t12 was 76, the pre - release cobb angle from t7 to t10 was 50, the post - release cobb angle from t8 to t10 was 40, and the final cobb angle from t7 to t10 was 40. the technique of anterior spinal release is different amongst different surgeons, while some do only a discectomy; others routinely remove the rib - heads, and even disrupt the posterior longitudinal ligament . The use of vats limits the number of structures that can be easily released due to limitations in visualization and access to all disc levels . This study is not comparing the open thoracotomy and release with the thoracoscopic anterior release; this is because no data is available for the former . Moreover, an evaluation of open release versus thoracoscopic release using the present method is not possible, as patients undergoing the open release would still have a painful wound, which would prevent them from lying sideways over a fulcrum . One potential pitfall of this study is that three different types of implants were used, while the original study on the fulcrum - bending radiograph was based on tsrh . It maybe possible that different implants vary in their ability to correct scoliosis and therefore invalidate the indirect assessment . However, the authors feel that this is unlikely because it has been demonstrated by the same group that there was no significant difference in the ability of different instrumentation systems to correct thoracic scoliosis . Moreover, the direct comparison of fulcrum flexibility before and after an anterior release would still stand . This study was performed in the early part of our experience with thoracoscopic anterior release, hence relatively few discs were released and the surgeries were staged . However, it did serve the purpose of demonstrating that thoracoscopic anterior release does result in an improvement in spinal flexibility . With increasing experience, the authors tend to release five to six discs per patient and the posterior surgery is performed on the same day . With the advent of new techniques and instrumentation, the indications for a thoracoscopic release may change in time . In particular, pedicle - screw systems appear to provide a better correction of large magnitude curves [9, 13, 26]. However, to date, there are no randomized studies comparing hooks versus screw systems, nor a correlation of the correction to spinal flexibility assessment, such as the fulcrum - bending correction index [17, 18]. Additionally, the use of anterior instrumentation systems may mean that such surgeries are carried out as a single - stage anteriorly, avoiding the need for posterior surgery [3, 14]. In summary, this is the first study to provide a direct in vivo evidence demonstrating the effectiveness of thoracoscopic anterior release in improving the spinal flexibility in patients with scoliosis.
Vitamin d deficiency is prevalent in the us and has been attributed to multiple medical problems including rickets in children and osteoporosis in older adults . In addition to skeletal problems, deficient vitamin d states have been linked to extra - skeletal diseases including cardiovascular disease in some observational and experimental studies [36] but other studies have shown no association or mixed results . Vitamin d levels are inversely associated with hypertension, diabetes, atherosclerosis, myocardial infarction, congestive heart failure, stroke, microalbuminuria and decreased kidney function [4,914]. In children, the role that vitamin d plays in cardiometabolic risk is not well studied and the results are contradictory . National health and nutrition examination survey (nhanes) cross - sectional studies confirmed a high prevalence of vitamin d deficiency (defined by this group as serum levels <30 ng / ml) among the pediatric population and this was associated with adverse cardiovascular risk, such as hypertension, low high density lipoprotein cholesterol (hdl) levels, high body mass index (bmi), central adiposity, and metabolic syndrome . A recent study performed in urban school children with a high prevalence of obesity and vitamin d deficiency, however, confirmed no association between vitamin d deficiency (defined by this group as serum levels <20 ng / ml), adiposity, and cardiometabolic risk factors . The effect of vitamin d on vascular function and structure has been examined in several adult studies that have shown inverse correlations between vitamin d status and vascular endothelial function, brachial artery distensibility, and carotid artery intima - media thickness (cimt), a marker of atherosclerosis . There are, however, very few studies in children that examine the correlation between vitamin d deficiency and vascular function and structure . A recent report in children and adolescents found an inverse correlation between serum vitamin d levels and adiposity, metabolic syndrome, and hypertension but found no correlation with vascular endothelial function or cimt . In contrast, another study performed in children on dialysis showed that cimt had a u - shaped bimodal distribution across vitamin d levels so children with extremely low or high vitamin d had increased cimt . In view of these inconsistent reports in the literature and paucity of studies examining the vascular changes that may be associated with vitamin d deficiency in children, we undertook this study to investigate the relationship between vitamin d deficiency and vascular function as assessed by common carotid artery distensibility index and vascular structure as assessed by cimt in high - risk children . We hypothesized that vitamin d deficiency is associated with a decreased carotid artery distensibility index, an increased cimt, and a higher number of risk factors that promote atherosclerosis . This cross - sectional, cohort study involved 74 children, 13.73.1 years who attended the children s mercy hospital preventive cardiology clinic over a two - year period (january 1, 2009 to december 31, 2010). These children were referred for evaluation of obesity, dyslipidemia and other atherosclerosis - promoting risk factors . Demographic and anthropometric data including age, sex, race (per self report), weight (in kilograms), height (in centimeters), and bmi (kg / m) were recorded . Race data was obtained as vitamin d levels are known to be lower in african americans and hispanics . Exposure to tobacco smoke, defined as any exposure to primary or secondary tobacco smoke, was recorded . Blood pressure was obtained over the right arm in the sitting position using a dinamap blood pressure monitor . A fasting total cholesterol (tc), hdl c, triglyceride (tg), fasting insulin, and serum 25-hydroxyvitamin d levels were performed . The season in which this data was obtained was also recorded as spring / summer (march to august) and fall / winter (september to february). Children s mercy hospital institutional review board approved the study . A common carotid artery b - mode ultrasound was obtained for measurement of arterial distensibility and cimt at the clinic visit . The carotid arteries were imaged by trained sonographers using a standard ultrasound machine (philips ie 33, bothell, wash) and a high resolution, l9 - 3 mhz linear array transducer . The digital images of both the left and right common carotid arteries were stored for offline reading . A single, trained reader who was blinded to the clinical data performed all measurements prospectively . Scanning of the carotid arteries and reading of cimt were performed per previously published protocols . The common carotid arterial diameter was measured using b - mode images with ultrasonic calipers placed from the near - end intima to the far end intima of the arterial lumen . The diameter was measured on still frames at the qrs complex (qrs) reflecting diastole and on still frames between the qrs complexes (non - qrs), reflecting systole . . Twenty - five measurements of the arterial lumen at qrs and 25 at non - qrs were measured over both the right and left common carotid arteries within 10 mm from the carotid bifurcation . Diameter measurements were averaged to obtain a mean qrs diastolic diameter and the non - qrs diameter measurements were averaged to obtain a mean non - qrs systolic diameter for each child . Diameter qrs diameter)/qrs diameter]/(systolic blood pressure diastolic blood pressure) and reported as percentage per 10 mm / hg . This measure reflects how distensible the artery is with higher distensibility indices indicating healthier vasculature . In order to ensure the accuracy of arterial diameter measurements, intra - reader reliability was calculated . For this, the reader measured carotid artery diameters from identical frames on two separate occasions while being blinded to the other reading . Cimt measurements were taken from the far wall of both the left and right common carotid arteries using a semi - automated, edge detection software (qlab, philips ie 33). This software was used to measure the cimt within a 10-mm - wide box that was placed along the far wall of the common carotid artery within 2 cm of the carotid bifurcation . Cimt was measured in end - diastole (qrs), which started at 2 frames before the qrs complex to 2 frames after the qrs complex . Along with the cimt, the success rate of the measurement was also tabulated by qlab . This is the percentage of the cimt wall within the region of interest that was accurately measured . Only frames with cimt measurements with a success rate of 95% or above were accepted . Each study consisted of measuring cimt from 100 frames from the left and right common carotid artery (figure 1). In order to ensure the accuracy of cimt measurements, for this, the reader measured the cimt from identical frames on two separate occasions while being blinded to the other reading . Seven modifiable, atherosclerosis - promoting risk factors were considered in the data analysis bmi, sbp, tc, tg, hdl c, insulin, & tobacco smoke exposure history . The number of sub - optimal, modifiable, atherosclerosis promoting risk factors that were present in each child was counted and the total was reported as the risk factor score . For this, the risk factors were dichotomized based on the following cutoff levels that are either previously published or norms accepted in our clinic: bmi 95 percentile for age and sex, sbp 95 percentile for age, sex and height, tc 170 mg / dl, tg 100 mg / dl, hdl c <45 mg / dl, insulin 18 uiu / ml, and history of tobacco smoke exposure . We have previously noted that an increased number of risk factors (> 3) are associated with an increased cimt . The relation between the risk factor score and vitamin d status was further explored adjusting for age, sex and race . Vitamin d (predictor) was used as a continuous variable and was also categorized into two levels deficient defined as serum vitamin d level <20 ng / ml or sufficient defined as serum vitamin d level 20 ng / ml as per the institute of medicine and american academy of pediatrics recommendations . Continuous variables were described as mean standard deviation and categorical variables were described as percentages . We compared demographic, anthropometric and laboratory data, cimt, and distensibility indices between vitamin d sufficient and insufficient children using student t test for continuous variables and chi squared test for categorical variables . Vitamin d levels were compared among demographic variables (gender, race), season, and the dichotomized risk factors using a student t test . For univariate analysis, we assessed the association between vitamin d levels and the individual risk factors, risk factor score, distensibility index and cimt using the pearson correlation coefficient . We then performed multivariate analysis to assess the impact of risk factor score on vitamin d taking gender, age, and race into account using general linear models . Statistical analysis was performed using spss 18 and sas 9.2 (cary, nc). Statistical significance the common carotid arterial diameter was measured using b - mode images with ultrasonic calipers placed from the near - end intima to the far end intima of the arterial lumen . The diameter was measured on still frames at the qrs complex (qrs) reflecting diastole and on still frames between the qrs complexes (non - qrs), reflecting systole . Non - qrs point is the moment in which the vessel is maximally dilated . Twenty - five measurements of the arterial lumen at qrs and 25 at non - qrs were measured over both the right and left common carotid arteries within 10 mm from the carotid bifurcation . Diameter measurements were averaged to obtain a mean qrs diastolic diameter and the non - qrs diameter measurements were averaged to obtain a mean non - qrs systolic diameter for each child . This measure reflects how distensible the artery is with higher distensibility indices indicating healthier vasculature . In order to ensure the accuracy of arterial diameter measurements, intra - reader reliability was calculated . For this, the reader measured carotid artery diameters from identical frames on two separate occasions while being blinded to the other reading . Cimt measurements were taken from the far wall of both the left and right common carotid arteries using a semi - automated, edge detection software (qlab, philips ie 33). This software was used to measure the cimt within a 10-mm - wide box that was placed along the far wall of the common carotid artery within 2 cm of the carotid bifurcation . Cimt was measured in end - diastole (qrs), which started at 2 frames before the qrs complex to 2 frames after the qrs complex . Along with the cimt, this is the percentage of the cimt wall within the region of interest that was accurately measured . Only frames with cimt measurements with a success rate of 95% or above were accepted . Each study consisted of measuring cimt from 100 frames from the left and right common carotid artery (figure 1). In order to ensure the accuracy of cimt measurements, intra - reader reliability was calculated . For this, the reader measured the cimt from identical frames on two separate occasions while being blinded to the other reading . Seven modifiable, atherosclerosis - promoting risk factors were considered in the data analysis bmi, sbp, tc, tg, hdl c, insulin, & tobacco smoke exposure history . The number of sub - optimal, modifiable, atherosclerosis promoting risk factors that were present in each child was counted and the total was reported as the risk factor score . For this, the risk factors were dichotomized based on the following cutoff levels that are either previously published or norms accepted in our clinic: bmi 95 percentile for age and sex, sbp 95 percentile for age, sex and height, tc 170 mg / dl, tg 100 mg / dl, hdl c <45 mg / dl, insulin 18 uiu / ml, and history of tobacco smoke exposure . We have previously noted that an increased number of risk factors (> 3) are associated with an increased cimt . The relation between the risk factor score and vitamin d status was further explored adjusting for age, sex and race . Vitamin d (predictor) was used as a continuous variable and was also categorized into two levels deficient defined as serum vitamin d level <20 ng / ml or sufficient defined as serum vitamin d level 20 ng / ml as per the institute of medicine and american academy of pediatrics recommendations . Continuous variables were described as mean standard deviation and categorical variables were described as percentages . We compared demographic, anthropometric and laboratory data, cimt, and distensibility indices between vitamin d sufficient and insufficient children using student t test for continuous variables and chi squared test for categorical variables . Vitamin d levels were compared among demographic variables (gender, race), season, and the dichotomized risk factors using a student t test . For univariate analysis, we assessed the association between vitamin d levels and the individual risk factors, risk factor score, distensibility index and cimt using the pearson correlation coefficient . We then performed multivariate analysis to assess the impact of risk factor score on vitamin d taking gender, age, and race into account using general linear models . Statistical analysis was performed using spss 18 and sas 9.2 (cary, nc). 74 children (33 male), aged 13.73.1 years who had both a carotid artery ultrasound performed as well as vitamin d levels drawn at the same clinic visit were selected for this study . Vitamin d levels in white children (28.08.5 ng / ml) were significantly higher than in children of the other races (23.010.2 ng / ml) (p=0.03). Fifty percent had vitamin d levels drawn in the spring / summer seasons and there were no seasonal differences in vitamin d levels noted . Fifty - eight percent were obese (bmi 95 percentile for age and sex), 19% had sbp 95 percentile for age, sex and height, 85% had elevated tc, 62% had elevated tg, 47% had low hdl, fasting insulin was high in 30% and 30% had been exposed to tobacco smoke . The mean number of atherosclerosis promoting risk factors per child was 3.31.6 (table 1). For the entire cohort, vitamin d levels were 26.19.4 ng / ml (663 ng / ml) with 15 of the 74 (20%) being deficient . There was an inverse correlation between vitamin d and risk factor score (r=0.27, p=0.02) (figure 2). However, when each risk factor was considered as a continuous or a dichotomous variable (suboptimal versus optimal), there was no significant association between vitamin d and risk factors with the exception of obesity status (p<0.05) (table 2). After adjustment for age, gender, and race, the inverse correlation between vitamin d and risk factor score persisted (p=0.03) while the correlation between vitamin d and obesity status became insignificant . Vitamin d deficiency was not significantly associated with distensibility index; however, there was a trend towards lower distensibility indices in the vitamin d deficient children (2.480.81 vs. 2.650.89% per 10 mmhg). There was no difference in cimt between vitamin d deficient and sufficient children (table 3). This is one of the few reports describing the vascular effects of vitamin d deficiency in high - risk children . Our study confirmed that while vitamin d levels correlated with increased cardiometabolic risk as measured by cardiovascular risk factor score, there were no clearly discernible functional or structural vascular changes . To our knowledge, studies examining the vascular effect of vitamin d status in children are limited to a report by pacifico, et al . This study examined the link between total adiposity, metabolic profile, hypertension, and low vitamin d levels in children and they also confirmed a metabolic correlation with vitamin d deficiency but found no effects on vascular function or structure . The lack of correlation between vitamin d levels and vascular function or structure may be because vascular changes may manifest only after a substantial length of exposure to vitamin d deficiency, so the vascular effects may only been seen in youth with a history of long standing vitamin d deficiency . Hence, there may be a long - term vascular benefit in maintaining vitamin d at sufficient levels in children as per the institute of medicine recommendations . Vitamin d has been shown to be useful in optimal functioning of several extra - skeletal pathways including the circulatory system . Vitamin d is thought to be useful for maintaining appropriate levels of apolipoprotein a-1 (a main component of hdl) and for regulating lipoprotein lipase activity thus influencing triglyceride levels . Vitamin d has also been shown to negatively regulate the renin - angiotensin - aldosterone pathway thus helping regulate blood pressure . In addition, vitamin d can alter insulin sensitivity and influence pancreatic beta - cell secretory function . Although in our study the individual cardiometabolic risk factors showed no correlation with vitamin d levels, we did note an inverse correlation when all the modifiable risk factors were combined into a score, and this relationship persisted even after adjustment for age, sex, and race . This may suggest clustering effect, common underlying demographic and socioeconomic risks, or a not yet known mechanism by which vitamin d modulates cardiovascular function . Our findings are in agreement with two, large scale, cross - sectional, community based, nhanes studies that confirmed an inverse correlation between vitamin d and cardiometabolic risk in children . In contrast, a recent study performed in urban, inner city school children in winter did not confirm any correlation between vitamin d status and adiposity or cardiometabolic risk . However, this population had a uniformly high prevalence of vitamin d deficiency with very few vitamin d sufficient children . Vitamin d and obesity status were inversely correlated in our study; however, this correlation became insignificant after adjustment for age, sex, and race . Obese children are known to have lower vitamin d levels and this may be due to a combination of factors: less conversion of vitamin d from prometabolites in the skin due to reduced outdoor activity, reduced vitamin d intake due to poor diet choices (sugary beverages replacing dairy), and sequestration of vitamin d in fat tissue [15,16,3436]. Even though 58% of our study population was obese, only 20% had vitamin d deficiency . This contrasts to the findings by sacheck et al who confirmed a much higher prevalence of vitamin d deficiency in obese, urban, inner city school population . The differences or lack thereof between vitamin d status and obesity in our study may be due to the fact that our children were screened during both winter and summer months or the effect of latitude (39 n for kansas city). In our study, white children had higher vitamin d levels than non - white children, consistent with the findings of earlier studies . This is due to decreased production of vitamin d from precursors as a result of increased melanin in darker skins allowing less ultraviolet light penetration . Limitations of this study are that this small cohort is a convenience sample with variable stages of development and lack of healthy controls . The study sample is likely underpowered and the vitamin d deficient children in this cohort is underrepresented . It is likely that a study looking at adequate number of children with vitamin deficiency may contrast the changes in vascular function and structure, if any . We have examined the rarely reported relationship between vitamin d, cardiometabolic risk, and vascular function and structure (as measured by distensibility index and cimt respectively) in children and found that while vitamin d levels are inversely correlated with cardiometabolic risk factor score, there was a lack of clear association between vitamin d status and distensibility index or cimt . Considering these mixed results and similar conflicting reports in the literature, it is our recommendation that a prospective, case controlled study in a large population of children with varying cardiometabolic risks be designed to further investigate the vascular effects of vitamin d deficiency . In the interim, in view of the association between vitamin d levels and cardiometabolic risk factor score, we recommend vitamin d supplementation for vitamin d deficient, high - risk children.
The assessment of a new medical procedure requires comprehensive evaluation of all conceivable benefits and risks . In the context of coronary computed tomography angiography (ccta), measurements of the absorbed radiation dose using 64 row detector ct have been assessed and results previously published . Despite publication of these earlier studies, radiation risk assessment including secondary cancer risks for ccta screening guidelines is lacking . Deterministic radiation risk assessment is accomplished by comparing radiation dose measurements associated with ccta with known threshold numbers, whereas stochastic risk assessment requires more sophisticated calculations that are generally derived from past epidemiological low dose radiation exposures published in the biological effects of ionizing radiation (beir) vii report . Stochastic risk assessments are therefore scarcer and are usually based on data of individual studies, which do not properly account for all available variables in equipment and techniques used in performing ccta examinations . We measured and recorded absorbed radiation dose in radiosensitive organs using standard ccta protocols for 320 row detector ct . We employed mosfet detectors to measure the radiation dose by placing these on and within an anthropomorphic phantom . The measured absorbed dose was then used to estimate cancerogenesis risks for several radiosensitive organs using stochastic risk assessment models published in the beir vii report . Those cancer risks were then compared with the natural cancerogenesis risk associated with more common risk factors . Finally, a scenario of us wide decennial coronary artery screening was assumed for the age group 50 - 70 years and cancerogenesis risk to radiosensitive organs was estimated based on the cumulative absorbed radiation dose associated with such screening . The estimated cumulative risk was then compared with the potential benefits of detecting clinically occult coronary artery disease within this hypothetically screened population to determine if risks of decennial screening would outweigh the benefits . We have already published a manuscript on radiation dose estimates and this data was used to estimate cancerogenesis risk assessments w1]. Previous measurements had been performed with semiconductor field effect transistor detectors calibrated to match the primary beam quality of the ct scanner . Since the ct scanner had beam qualities in the range of 6.5 - 7.5 mmal half value layer (hvl) at 120 kvp, the detectors were calibrated against a conventional radiographic unit at 118 kvp with beam quality of 7.15 mmal hvl . This was done by adding 5.5 mm of aluminum to the faceplate of the collimator . The mosfet detectors were then subjected to radiation doses of 1, 3, 10, and 30 mgy . Individual calibration factors were obtained for all detectors by fitting these four data points with the least - squares fit using xlgenline software (version 1.0), the conversion factors were then stored in the mosfet software (mobile mosfet software version 2.0, revision 7.0, thomson - nielsen) for immediate readout after each protocol had been performed . Direct calibration data entry using mosfet's built - in calibration capability was employed to accommodate multiple tube potential calibrations, the least - square fit method was selected to verify that a given set of calibration factors obtained at 118 kvp with beam quality of 7.15 mmal hvl may be used for different tube potentials with reasonable accuracy (within 5%). Calibrated mosfet detectors were then used to measure absorbed radiation dose for thyroid, mid - breast, breast, and mid - lung in an anthropomorphic phantom at 100, 120, and 135 kvp at two different heart rate (hr) settings of 60 and 75 beats per minute (bpm) with a scan field of view (s - fov) of 320 mm, using 400 ma, 320 0.5 mm detectors/160 mm collimator width (160 mm range). The lifetime attributable risk (lar) based on absorbed radiation dose measurements of radiosensitive organs (lung, breast, and thyroid exposed to radiation) was adopted from beir vii report tabulation (table 1 2d-1, page 311). To provide the most conservative cancerogenesis risk assessment as possible, absorbed radiation doses for calcium scoring and contrast enhanced ccta data acquired with 120 kvp tube voltage were selected as being both the average and most frequently used maximum tube voltage used in clinical practice . Protocol and absorbed organs dose measurements for 320 row detector scanner calculating (2) cancerogenesis risk estimates the lar has been described in the beir vii report and is expressed by the formula: lar (d, e) = m (d, e, a) s (a)/s (e) with d being the absorbed dose (in the beir vii report set as 0.1 gy), a being the attained age, which is from e + l to 100 (l being the risk - free latent period that equals 5) accounting for remaining lifetime, s (a) being the probability of survival until age a, and s (e) being the probability of survival until age e. the lifetime attributable cancer risk (lar) based on absorbed radiation dose for a given organ for each age group of presumed decennial screening was calculated based on linear interpolation of a single time 0.1 gy radiation exposure data as presented in the beir vii report . For instance, the average dose for coronary cta to the lungs performed with a 320 detector row scanner was 29.45 mgy at 120 kvp and a hr of 60 bpm . From the beir vii report, the lung cancer incidence for 50-year - old women is 230 cases per 100,000 . Thus, the lar from a 29.45 mgy dose is (29.45/100) (230/100,000), or 0.07% . This risk estimation methodology has been described and reported as acceptable in prior literature . For a hypothetical us nationwide generalized ccta screening for coronary artery disease, the following assumptions were made: screening would be performed decennially for each individual for the ages 50, 60, and 70 years . Consequently, lars for female and male lung, female and male thyroid, and female breast were added for cctas for the age 50 (lar50), 60 (lar60), and 70 (lar70) to obtain the cumulative lar for female and male lung, female and male thyroid, and female breast cancer, respectively, for such screening guidelines . For ages between 50 - 60 years and 60 - 70 years our approach is similar to the one used by einstein et al ., and can be utilized to determine different cumulative lars . The population size that would be subjected to such screening was assumed to be 18.8 million people and the annual incidence of occurrence of sudden cardiac death was assumed to be 355.000, 94% of whom have at least one stenosis> 75% . We have already published a manuscript on radiation dose estimates and this data was used to estimate cancerogenesis risk assessments w1]. Previous measurements had been performed with semiconductor field effect transistor detectors calibrated to match the primary beam quality of the ct scanner . Since the ct scanner had beam qualities in the range of 6.5 - 7.5 mmal half value layer (hvl) at 120 kvp, the detectors were calibrated against a conventional radiographic unit at 118 kvp with beam quality of 7.15 mmal hvl . This was done by adding 5.5 mm of aluminum to the faceplate of the collimator . The mosfet detectors were then subjected to radiation doses of 1, 3, 10, and 30 mgy . Individual calibration factors were obtained for all detectors by fitting these four data points with the least - squares fit using xlgenline software (version 1.0), the conversion factors were then stored in the mosfet software (mobile mosfet software version 2.0, revision 7.0, thomson - nielsen) for immediate readout after each protocol had been performed . Direct calibration data entry using mosfet's built - in calibration capability was employed to accommodate multiple tube potential calibrations, the least - square fit method was selected to verify that a given set of calibration factors obtained at 118 kvp with beam quality of 7.15 mmal hvl may be used for different tube potentials with reasonable accuracy (within 5%). Calibrated mosfet detectors were then used to measure absorbed radiation dose for thyroid, mid - breast, breast, and mid - lung in an anthropomorphic phantom at 100, 120, and 135 kvp at two different heart rate (hr) settings of 60 and 75 beats per minute (bpm) with a scan field of view (s - fov) of 320 mm, using 400 ma, 320 0.5 mm detectors/160 mm collimator width (160 mm range). The lifetime attributable risk (lar) based on absorbed radiation dose measurements of radiosensitive organs (lung, breast, and thyroid exposed to radiation) was adopted from beir vii report tabulation (table 1 2d-1, page 311). To provide the most conservative cancerogenesis risk assessment as possible, absorbed radiation doses for calcium scoring and contrast enhanced ccta data acquired with 120 kvp tube voltage were selected as being both the average and most frequently used maximum tube voltage used in clinical practice . Protocol and absorbed organs dose measurements for 320 row detector scanner calculating (2) cancerogenesis risk estimates the lar has been described in the beir vii report and is expressed by the formula: lar (d, e) = m (d, e, a) s (a)/s (e) with d being the absorbed dose (in the beir vii report set as 0.1 gy), a being the attained age, which is from e + l to 100 (l being the risk - free latent period that equals 5) accounting for remaining lifetime, s (a) being the probability of survival until age a, and s (e) being the probability of survival until age e. the lifetime attributable cancer risk (lar) based on absorbed radiation dose for a given organ for each age group of presumed decennial screening was calculated based on linear interpolation of a single time 0.1 gy radiation exposure data as presented in the beir vii report . For instance, the average dose for coronary cta to the lungs performed with a 320 detector row scanner was 29.45 mgy at 120 kvp and a hr of 60 bpm . From the beir vii report, the lung cancer incidence for 50-year - old women is 230 cases per 100,000 . Thus, the lar from a 29.45 mgy dose is (29.45/100) (230/100,000), or 0.07% . For a hypothetical us nationwide generalized ccta screening for coronary artery disease, the following assumptions were made: screening would be performed decennially for each individual for the ages 50, 60, and 70 years . Consequently, lars for female and male lung, female and male thyroid, and female breast were added for cctas for the age 50 (lar50), 60 (lar60), and 70 (lar70) to obtain the cumulative lar for female and male lung, female and male thyroid, and female breast cancer, respectively, for such screening guidelines . For ages between 50 - 60 years and 60 - 70 years our approach is similar to the one used by einstein et al ., and can be utilized to determine different cumulative lars . The population size that would be subjected to such screening was assumed to be 18.8 million people and the annual incidence of occurrence of sudden cardiac death was assumed to be 355.000, 94% of whom have at least one stenosis> 75% . We used the data from our previously published manuscript to calculate cancer risks from radiation . Lar calculations for radiosensitive organs for ages 50, 60, and 70 years in males and females are tabulated in [table 2] and figure 1a and b. thyroid lar is negligible for all ages and both genders regardless of which scanner is used . Among radiosensitive organs, all evaluated ages and both genders, lar is otherwise lowest for female breast at age 70 (0.002%) and highest for female lung at age 50 (0.068%). Lifetime attributable risk for cancer induction based on prior organ dose measurements (a) reduction in lifetime attributable risk (lar) for breast cancer with 320 row ct vs. 64 row ct . (b) reduction in lifetime attributable risk (lar) for lung cancer with 320 row ct vs. 64 slice ct . Cumulative cancerogenesis risk calculation and cancer - specific mortality based on the beir vii report for men and women assuming decennial screening between ages 50 and 70 are shown in [table 3]. These risks are likewise negligible for the thyroid gland for both genders . Cumulative cancerogenesis risk for the recommended ccta screening assumption using the 320 row detector ct is 0.17% for the female lung and 0.026% for the female breast . Similarly, the cumulative cancerogenesis risk for ccta screening assumption is 0.079% for male lung using the 320 row detector ct . By comparison, common risk factors, which increase cancer risks, are as follows: 16-fold for lung cancer in persistent smokers, 2-fold for breast cancer with a first degree family member with history of breast cancer, and 10-fold for thyroid cancer with family member with history of thyroid cancer . By way of comparison, ccta screening in a population assumed to be 18.8 million in size would prevent occurrence of sudden cardiac death in at least some of estimated 355,000 patients, 94% of which have at least one stenosis> 75% . Lar (%) for cancer induction / mortality from decennial screening in ages 5070 for 64/320 row detector scanners in our study, we estimated cancerogenesis risks for a specific organ when using 320 row detector ct by measuring the amount of radiation absorbed by the organ using known methodologies . This is an improvement to earlier organ cancerogenesis estimates that solely relied on respective in house absorbed radiation dose measurements in association with ccta and are therefore more anecdotal in nature . In several previously published studies, radiation absorbed dose was calculated based on the volume ct dose index (ctdivol) and dose length product (dlp) as proposed by the european working group for guidelines on quality criteria for computed tomography . It should be noted that the ctdi is not meant to be used for dose calculations of individual patients, but rather as a quality assurance and an improvement tool that allows for dose comparisons for different types of ct scanners when the same protocol is applied, or for the same scanner if different protocols are evaluated . As such, it has no role in the calculation of absolute absorbed dose related to deterministic and stochastic risk assessment models . In this study, we focused on absorbed radiation measurements of radiosensitive organs that are either directly within the ct radiation beam (lung, breast, and skin tissue) or exposed to nearby scattered radiation (thyroid gland). Only one study that had been previously performed with a 320 row detector ct could be included in this analysis . Yet, the stark differences of cancerogenesis risk reduction of> 30% for the lung and> 50% for the female breast for the 320 row detector ct compared with 64 row detector ct suggest that an epidemiologically meaningful impact is likely due to the padding effects and internal filtration improvements associated with the 320 row detector ct . These improvements can reduce the stochastic risk with future coronary artery screening, and may cause a paradigm shift when weighing risks and benefits of such a screening program . Specifically, the cancerogenesis estimates data that were calculated based on the 320 row detector ccta would result in a combined cumulative cancer incidence of less than 1 in 500 for breast and lung cancer in women and a cumulative cancer incidence of less than 1 in 1000 for lung in men . As such, these cancerogenesis risk estimates are in magnitudes lower than common risk factors such as persistent smoking for the development of lung cancer (16-fold) or history of breast cancer in a first degree relative for the development of breast cancer (2-fold). It should be noted, that cancerogenesis incidence estimates do not equate to cancer - induced mortality data . Our data may underestimate the role of other causes of death and also do not account for the capability of ccta to detect other clinically relevant findings such as clinically occult pulmonary embolism, malignant pulmonary nodules, or other undetected cardiopulmonary abnormalities, which may also translate into improved patient outcome . In terms of expected benefits of a screening program as the one suggested, the population size that would be submitted to such screening was previously assumed to be 18.8 million people and the annual incidence of occurrences of sudden cardiac death as 355,000, 94% of which have at least one stenosis> 75% . As such, we believe that ccta screening along the lines suggested with use of 320 row detector scanning and associated improvements in padding and filtration techniques can be justifiably advocated . This is contradictory to prior statements that have identified absorbed radiation associated with ccta as a primary concern to reject ccta as a screening tool for coronary artery disease . Recent availability of the iterative reconstruction technique could reduce the radiation dose while maintaining the image quality of ccta . Unlike for lung and female breast, higher absorbed thyroid doses and resulting stochastic risks were found to the same for the 320 row detector ct when compared with a 64 row detector ct . Specifically, measurements with the 320 row detector ct were performed with the mosfet detectors on top of the phantom surface, whereas hurwitz et al ., obtained measurements within the phantom and more closely simulated the anatomic position of the thyroid gland, thus resulting in less scatter and more dose absorption of interposed tissue and hence lower absorbed dose readings of the detectors . However, thyroid dose absorptions are negligibly low in both studies, and the dose that is absorbed by the thyroid gland in association with ccta can be safely considered as clinically inconsequential as the likelihood of cancer induction is close to zero based on beir vii data for patients between the ages of 50 - 70 years . The studies that were selected for comparative purposes used either an anthropomorphic phantom or an anthropomorphic mathematical phantom to measure the absorbed dose . Thus, this provided a certain degree of methodological measurement consistency for a greater transparency in inter - study comparisons of the combined equipment and ccta protocol effects . Yet, the body mass index of the average patient as well as a potential screening subject may be greater than that of the phantom, which may result in underestimation of the scatter radiation dose associated with ccta . At the same time it should be noted that there are natural limitations to performing direct organ measurements in vivo and that internal organ point measurements in cadavers (the main conceivable alternative to a phantom) also has inherent inaccuracies due to tissue density differences between an actual patient and a bloodless cadaver fixated in formalin . In addition, the use of lar to estimate cancerogenesis risk was based on the beir vii data, which has its own inherent limitations . Subjective 95% confidence interval is assigned to the lar in the beir vii report in acknowledgment of the uncertainties associated with data extrapolated from the japanese survivors to the u.s . The studies that were selected for comparative purposes used either an anthropomorphic phantom or an anthropomorphic mathematical phantom to measure the absorbed dose . Thus, this provided a certain degree of methodological measurement consistency for a greater transparency in inter - study comparisons of the combined equipment and ccta protocol effects . Yet, the body mass index of the average patient as well as a potential screening subject may be greater than that of the phantom, which may result in underestimation of the scatter radiation dose associated with ccta . At the same time it should be noted that there are natural limitations to performing direct organ measurements in vivo and that internal organ point measurements in cadavers (the main conceivable alternative to a phantom) also has inherent inaccuracies due to tissue density differences between an actual patient and a bloodless cadaver fixated in formalin . In addition, the use of lar to estimate cancerogenesis risk was based on the beir vii data, which has its own inherent limitations . A subjective 95% confidence interval is assigned to the lar in the beir vii report in acknowledgment of the uncertainties associated with data extrapolated from the japanese survivors to the u.s . During ccta, among radiosensitive organs at risk, lar is highest for the lung but this risk remains relatively small compared with other more common cancerogenic risk factors such as smoking . Compared with the 64 row detector ct, technical improvements associated with the 320 row detector ct reduce radiation dose absorbed by the organs in the field of view (lung and female breast).
During the development of occlusion of teeth, a pediatric dentist is often faced with some challenging situations where deviations from the normal eruption sequence, position or abnormalities in the morphology of the teeth are observed . There are a series of factors that can influence the normal development of the occlusion and interfere in the correct alignment of the teeth and their harmonic relationship with the adjacent and antagonistic elements . Beyond these are the dental anomalies of number, such as, supernumerary teeth which is the most commonly reported cause of delay in the eruption of the maxillary incisors . Supernumerary teeth are those teeth that are present in excess to the normal set of teeth . The prevalence of supernumerary teeth varies among different racial and ethnic groups . In the caucasian population asians have a slightly higher frequency of the supernumerary teeth, which is greater than 3% . Black children have a prevalence of 0.42%, while children of hispanic descent were found to have a prevalence of 5.6% . The prevalence is between 0.15 and 1% in permanent dentition, with predilection of 2:1 for the male sex. [69] it is not only the mere presence of a supernumerary tooth that predisposes a tooth to delayed eruption . Their shape, number and position are some other determining factors that can play a role in the fate of the incisor eruption . There are four morphological types of supernumerary teeth: conical or peg shaped, tuberculate or invaginated, supplemental or incisiform and odontome like . The tuberculate or the invaginated supernumerary type has been shown to cause more cases of delayed eruption of the maxillary incisors. [1012] when the incisors do not erupt at the expected time, it is crucial for the clinician to determine the etiology and formulate an appropriate treatment plan . The most frequent complications generated by the presence of the supernumerary teeth in the anterior maxillary region are the prolonged retention of the deciduous teeth, delayed eruption of the permanent teeth, impaction of the permanent incisors, ectopic eruption, root dilaceration etc . The objective of this paper is to present a challenging case of an impacted permanent central incisor which was obstructed by multiple supernumerary teeth along with its surgical and orthodontic management . An eleven year old male patient reported with a complaint of the presence of a small sized tooth in the upper front region of the jaw since 4 years . Intra oral examination revealed that he was in the late mixed dentition period with retained maxillary primary left central incisor (61) and non eruption of the left permanent central incisor (21) [figure 1] and angle's class i molar relation . The radiographic examination consisting of intraoral periapical [figure 2], occlusal and panoramic views with an orthopantomogram revealed an irregular radiopaque mass suggesting of an odontome like structure between 21, 61 and 22 along with impacted 21 close to the nasal floor . A preliminary diagnosis of impacted permanent left central incisor due to the odontome like structure was made . The treatment plan included surgical removal of the calcified mass and guided eruption of 21 using closed - eruption technique . The following treatment objectives were established for this patient: surgical removal of the calcified massguiding the eruption of 21 and to align it orthodonticallyto achieve good gingival attachment and symmetrical gingival margins for both the maxillary central incisors; andto create a stable functional occlusion . Surgical removal of the calcified mass guiding the eruption of 21 and to align it orthodontically to achieve good gingival attachment and symmetrical gingival margins for both the maxillary central incisors; and to create a stable functional occlusion . Retained maxillary left primary central incisor seen during the introral examination of the patient presented in the case intraoral periapical view showing an irregular radiopaque mass suggesting of an odontome like structure between 21, 61 and 22 under local anesthesia, a full thickness mucoperiosteal flap was reflected from 11 till 22 . The bone covering the odontome like structure was carefully removed and the calcified mass was retrieved along with the extraction of primary central incisor . Six supernumerary teeth were retrieved from the calcified mass, four teeth were conical in shape and two were in tuberculate form [figure 3]. A final clinical diagnosis of an impacted maxillary central incisor due to multiple supernumerary teeth was made . The lingual surface of the exposed central incisor was etched, washed and a flat begg bracket was attached to it . Elastomeric chain was engaged to the bracket on one side and the other end was left intraorally through the extraction socket [figure 4]. The surgical area was thoroughly irrigated with betadine and normal saline, and the mucoperiosteal flap was sutured with 3 - 0 silk suture . The post - operative period was uneventful, healing was good and the sutures were removed after a period of one week . Retrieved multiple supernumerary teeth from the calcified mass, total 6 in number with four teeth being conical in shape, and two having a tuberculate form attachment of traction device to the lingual surface of 21 fixed orthodontic treatment with begg appliance was planned in the maxillary arch . The maxillary right central incisor, right lateral incisor and left lateral incisor were bonded with flat begg brackets . After the anterior teeth were aligned, a rigid base wire of 0.018 stainless steel (ss) australian wire with a helix in the horizontal plane was placed in the maxillary arch . Light forces in the range of 10 - 15 gm were applied from the helix to the impacted tooth with the help of the other end of the elastomeric chain . Once the impacted tooth was sufficiently extruded and the labial surface was accessible, a bracket was bonded on the labial surface to continue further alignment . When all the anterior teeth were aligned, a torquing auxillary was used to torque the root of the left central incisor [figure 5]. The appliance was debonded after a period of 9 months and a fixed retainer was bonded on the palatal surface of the maxillary incisors [figure 6] for stability . During the follow - up period, the patient showed an acceptable gingival contour and adequate width of the attached gingiva in relation to 21 [figure 7]. Torquing auxillary on the left maxillary central incisor intraoral periapical view showing aligned 21 and the fixed retention device bonded on the palatal surface of the maxillary incisors post orthodontic treatment photograph showing well aligned 21 and with acceptable gingival contour supernumerary teeth can be found in almost any region of the dental arch and can be erupted or unerupted, often found during routine radiographic examination . The etiology of this condition remains controversial; however, several hypotheses have been put forward such as dichotomy of the tooth bud, hyperactivity of the dental lamina and a phylogenetic relic of extinct ancestral tissue . They may be present both in the primary and permanent dentitions, and influence the adjacent permanent teeth by way of crowding, impaction, delayed eruption or ectopic eruption ., conservative management is the better solution, but most patients will require surgical and/or orthodontic manipulation . The method followed in this case is the closed - eruption technique in which a flap that incorporates the attached gingival tissue is raised and is fully replaced in its original position after the placement of traction devices . If the tooth is impacted in the middle of the alveolus or high in the vestibule near the nasal floor, the closed eruption technique is the treatment of choice as it produces good long term esthetic results when compared to methods like excisional gingivectomy, and apically positioned flap technique . Various factors to be considered for successful alignment of an impacted tooth are: position and direction of the impacted tooth, degree of root completion and the presence of space for the impacted tooth in the arch . Frequently, when an impacted central incisor is brought into the arch, there is a discrepancy between the gingival height and that of the adjacent incisor . Clinical experience has shown that light forces are more effective than heavy forces in moving the impacted and unerupted teeth and providing good gingival position and contour . In the present case, the force applied on the tooth was very light and measured in the range of 10 - 15 gm, and helped to provide an acceptable gingival contour and sufficient width of the attached gingiva after orthodontic treatment . Impacted maxillary permanent left central incisor was successfully guided to its designated place in the arch by closed - eruption technique and showed good stability . The presence of multiple supernumerary teeth in such young children further justifies a routine radiological examination for early diagnosis and appropriate intervention to prevent any future complications.
Orthodontic treatment ensures proper alignment of the teeth and improves the occlusal and jaw relationship . This not only aids in better mastication, speech, and facial aesthetics, but also contributes to general and oral health, thereby improving the quality of life . Like any other treatment modalities, orthodontic treatment, in addition to its benefits, has also associated risks and complications . However, the risk and complication associated with treatment are reported to be considerably lower compared to other surgical or nonsurgical interventions . However, the most commonly reported adverse effects of orthodontic treatment can be both local and systemic . This includes, tooth discolorations, decalcification, root resorption, periodontal complications, psychological disturbances, gastrointestinal complications, allergic reactions, infective endocarditis, and chronic fatigue syndrome [14]. It has been shown that orthodontic forces represent a physical agent capable of inducing an inflammatory reaction in the periodontium . One of the challenges of orthodontics is to finish the orthodontic treatment with the least effects on the root and periodontium . This review aims to highlight the main coordinates of risk issues like periodontal complication and root resorption in orthodontics . Periodontal health is an important factor that may be used to evaluate the success of orthodontic therapy . Periodontal complications are reported to be one of the most common side effects linked to orthodontics . Also, properly aligned teeth are easier to clean, and perhaps correct occlusion may promote healthier periodontium . The periodontal complications associated with orthodontic therapy mainly include gingivitis, periodontitis, gingival recession or hypertrophy, alveolar bone loss, dehiscences, fenestrations, interdental fold, and dark triangles [1, 2, 8, 9]. Presence of microbial plaque is reported to be the most important factor in the initiation, progression, and recurrence of periodontal disease in reduced periodontium . The reasons behind these periodontal complications involve patient factors and the technique used in the treatment . Smoking is also a known factor that affects the periodontal support [12, 13]. Orthodontic treatment and the procedures are known to induce both positive and negative local soft - tissue reactions in the gingiva . The presence of plaque is the considered as one of the main factors in the development of gingivitis [11, 12]. Orthodontic brackets and elastics might interfere with effective removal of dental plaque, thereby increasing the risk of gingivitis . Few clinical studies also reported poor periodontal health and greater loss of clinical attachment level distally in the dental arches . This could be a result of poor oral hygiene in molar regions and the presence of molar bands, which favors food lodgment . However, as a result of the orthodontic treatment a shift in the composition and type of bacteria can be expected . Orthodontic treatment is known to affect the equilibrium of oral microflora by increasing bacteria retention . In a study done by ristic et al . An increase in the value of periodontal indices and growth of periodontopathogenic bacteria were observed in adolescent patients undergoing fixed orthodontic treatment . In the majority of the patients, following placement of a fixed appliance, small amount gingival inflammation is visible, which could be transient in nature and does not lead to attachment loss . Some reports support the fact that the fixed orthodontic treatment may result in localized gingivitis, which rarely progresses to periodontitis . Gingival inflammation around orthodontic bands leads to pseudo - pockets, which usually disappear with debanding of the brackets . However, some of the published researches have reported reduced risk of gingivitis in the absence of plaque, orthodontic forces, and tooth movements [7, 19, 20]. If the orthodontic forces kept within the adequate limits in healthy reduced periodontal tissue support regions, the chances of gingival inflammation will be minimal . Alexander in his results has also reported lack of periodontal destruction over a longer period of time among patients wearing fixed appliances . Published reports on human periodontal tissues state that the orthodontic banding performed with great care and proper maintenance of oral hygiene the periodontal ligament mainly consists of type i collagen, although type iii collagen fibres are also present . The main function of pdl is sending proprioceptive signals to the brain and withstanding compressive forces during chewing movements . Various studies have reported significant recruitment of mononucleated cells, macrophages, dendritic cells, and mhc class ii ia - expressing cells in the pressure zone incident to orthodontic tooth movement [23, 24]. In the tension zone, however, minimal changes in the number and distribution of immune cells have been reported . Under stress from the orthodontic treatment neuropeptides are released from the periodontal nerve endings, which causes neurogenic inflammation in the compressed periodontal ligament . Furthermore, various immunoregulatory molecules, such as interleukin-1 a, interleukin-6, and tumour necrosis factor - a, are released during inflammation and participate in the remodelling of the periodontium . One of the challenges of orthodontics is to finish the orthodontic treatment with the least effects on the root and periodontium . Individual biologic variability, genetic predisposition, and the effect of mechanical factors are believed to influence apical root resorption [30, 31]. This undesirable complication of orthodontic treatment may result in tooth mobility and even permanent tooth loss . It is an inflammatory process resulting in an ischemic necrosis in the periodontal ligament when the orthodontic force is applied . It appears that apical root resorption is not just a result of orthodontic force but instead a combination of individual biological variability and the effect of mechanical factors . It appears that apical root resorption results from a combination of individual biological variability and the effect of mechanical factors . Loss of apical root structure is not predictable; when it progresses reaching the dentine is considered irreversible . The cause of root resorption is still unknown, but the possible etiological factors are known and considered to be complex and multifactorial . However, the majority of orthodontic root resorption does not affect the functional capacity of the dentition [3537]. Several studies on root resorption have been published in the last 20 years [30, 31, 34, 3941]. During this period, the terms used to describe root resorption in the literature were variable like (root shortening, idiopathic root resorption, frequent complication, and common consequence). Root resorption is defined as the destruction of the cementum or dentin by cementoclastic or osteoclastic activity; it may result in the shortening or blunting of the root . Root resorption is also defined as microscopic areas of resorption lacunae visualized with histological techniques . Root resorption is a general term that describes the general pathologic process which does not include any expression of the etiological factors . Several etiological factors for root resorption are known (trauma, periodontal diseases, etc . ), with almost similar outcome of root structure loss . Brezniak and wasserstein in 2002 suggested a new and more descriptive term of orthodontic root resorption based on the actual process and termed it orthodontically induced inflammatory root resorption (oiirr). Orthodontically induced inflammatory root resorption (oiirr) is a sterile inflammatory process that is extremely complex and composed of various disparate components including forces, tooth roots, bone, cells, surrounding matrix, and certain known biological messengers . Histological studies report greater than 90% occurrence of root resorption in orthodontically treated teeth with varying degree; in most cases the loss of root structure is minimal and clinically insignificant . Other studies reported that the average oiirr is usually less than 2.5 mm when using panoramic or periapical radiographs [46, 47]. Using graded scales, oiirr is usually classified as minor or moderate in most orthodontic patients . Severe resorption defined as exceeding 4 mm or 1/3 of the original root length, is seen in 1 - 5% of orthodontically treated teeth [48, 49]. The risk group where severe resorption may occur compromises one to three percent of the population . Lupi et al reported the incidence of root resorption before orthodontic treatment 15% and after orthodontic treatment 73% . Most studies have concluded that the risk and severity of external apical root resorption increase as the duration of orthodontic treatment increases [39, 44, 5156]. Sameshima and sinclair looked at a sample of 868 patients collected from 6 different specialist practitioners and found longer treatment times to be significantly associated with increased root resorption for maxillary central incisors . The reasons for the longer duration in treatment may also have had an influence on the increased levels of root resorption seen in these patients . However, others found no significant association between oiirr and treatment duration [51, 57, 58]. Many variables are associated with treatment duration such as complicated treatment plans or lack of the patient compliance and these variables may also contribute to oiirr . Fixed appliances have been shown to cause more root resorption than removable appliances which can be explained by the increased range of tooth movement afforded by fixed appliances . The risk of root resorption associated with different bracket designs has yielded inconclusive results [59, 60]. It is generally agreed that the use of a rapid maxillary expander is associated with increased levels of root resorption [6164]. There are no other strong studies that investigated this correlation, but a case report has shown a significant oiirr outcome with aligner treatment . They concluded that banded herbst appliance might deliver unphysiologic forces to immediate anchor teeth, thereby exposing these to a higher risk of root resorption than in other teeth incorporated into the anchorage either directly via bands or indirectly via occlusal or approximal contacts . When comparing straight wire and standard edgewise techniques, no statistically significant differences in the amount of tooth root loss or prevalence of root resorption were observed between groups . Some studies have suggested that the begg technique may induce more root resorption [60, 66, 67]. Other studies showed no significant difference between begg, tweed, or various straight wire edgewise techniques on root resorption [58, 59, 68]. L. linge and b. o. linge suggested that the use of intermaxillary elastics increased the amount of root resorption, but sameshima and sinclair did not find any correlation . Bioefficient therapy using contemporary orthodontic materials was found to produce less root resorption than the standard edgewise systems . The use of heat - activated and superelastic wires and a smaller rectangular stainless steel wire during incisor retraction and finishing played a role in this finding . When comparing conventional edgewise systems to self - ligating systems, three studies concluded that there are no statistically significant differences in root resorption between systems [43, 7072]. Human and animal studies agree that there is an increase in severity of root resorption with increasing force magnitude [63, 7378]. Harry and sims used a scanning electron microscope to examine extracted human premolar teeth that had 50 g, 100 g, and 200 g of intrusive force . They concluded that higher forces increased root resorption through an increase in the stress to the root surface which increased the rate of lacunae development . The more recent studies have confirmed that the higher forces increase the amount of external root resorption, thus confirming the previous studies . Chan and darendeliler used a volumetric analysis of resorption craters on extracted human teeth to compare controls with a force of 25 g or 225 g, with buccal displacement or intrusion . Reitan, on the other hand, found that external root resorption was poorly correlated with force magnitude . He examined 72 premolars after application of 25 g to 240 g of intrusive, extrusive, and tipping movement over a period of 10 to 47 days . They looked at tooth movement with regard to force magnitudes of 50 g, 100 g, and 200 g. they found that there was a large interindividual variance, but no significant differences in the frequency and severity of root resorption could be detected . They concluded that root resorption was independent of force magnitude, but that individual reactions may be more important . Debate exists as to whether more root resorption is associated with continuous or intermittent forces . Many believe that discontinuous forces produce less root resorption because the pause in tooth movement allows the resorbed cementum to heal [8388]. The patients were exposed to a continuous tipping force of 100 g on one side and on the other side an intermittent force was applied through elastics for 12 hours per day over a period of 9 weeks . The accuracy of these results is questionable because the intermittent forces were subject to patient compliance . Weiland studied 84 premolars from patients which had been moved buccally with an orthodontic appliance . On one side of the mouth, force on the premolar was applied with a stainless steel wire (0.016 inch), while force on the contralateral premolar was applied with a superelastic wire (0.016 inch). Their results support the findings of acar et al . That continuous forces cause more resorption . They showed that the teeth activated with the super elastic wire moved significantly more but had 140% more resorption than the teeth with stainless steel wire . . Found no difference in the amount or severity of root resorption between forces applied continuously or intermittently after application of a buccally directed force of 50 g to human premolars . Intrusion has been consistently implicated as the most likely type of tooth movement to cause root resorption [57, 81]. Displacement of the root apex horizontally or torquing has been proven beyond doubt to produce root resorption [54, 89]. The highest incidence of root resorption is reported to occur when 3 to 4.5 mm of torquing movement was performed . Reitan and thilander and colleagues suggested that the stress distribution associated with tipping movements is more likely to cause root resorption than the stress distribution associated with bodily movement [64, 83]. Sameshima and sinclair found that severe root resorption occurred in their samples when the root apex was displaced lingually, with a mean difference of 1 mm more than the control group . They concluded that root resorption is directly related to the distance moved by the tooth roots . Maxillary incisors tend to be moved more than other teeth in orthodontic treatment and therefore this is a possible explanation for why maxillary incisors are at a high risk of root resorption . It is generally recommended that orthodontics be preceded by periodontal therapy based on the belief that orthodontics in the presence of inflammation can lead to rapid and irreversible breakdown of the periodontium . Scaling, root planning (if necessary, by open flap debridement procedures for access), and gingival augmentation should be performed as appropriate before any tooth movement . The corrective phase of periodontal therapy, that is, osseous or pocket reduction / elimination surgery, ought to be delayed until the end of orthodontic therapy, because tooth movement may modify gingival and osseous morphology . Sameshima and sinclair examined the relationship of the extraction pattern in detail as a factor affecting the resorption process . They concluded that extraction procedures (all first premolars, all second premolars, mandibular incisors, and asymmetric extractions) have the potential to produce root resorption during space closure . They observed a statistically significant difference in the resorption process when extraction and nonextraction groups were compared; among the extraction groups, the extraction of all first premolars showed the greatest resorption potential . Other studies that examined this factor did not find it to be significant [92, 93]. Conducted a systematic review to this topic, where the factors have been grouped into likely, unlikely, and unclear risk - relationship categories . Adult patients must undergo regular oral hygiene instruction and periodontal maintenance in order to maintain healthy gingival tissue during active orthodontic treatment . Orthodontic treatment is usually contraindicated in patients with active periodontal disease or poor periodontal health as the chance of further periodontal deterioration is high in such case . Therefore, a thorough assessment of the periodontal health and level of attached gingival is recommended prior to the orthodontic treatment . Also, it is equally important to lay emphasis on the necessity of good oral hygiene in order to achieve the best treatment outcome . Oral hygiene instructions should be given before the start of orthodontic treatment and it should be reinforced during every visit.
As surgical specialties, neurosurgery and ophthalmology require the development of dexterity and skills for a variety of surgical procedures . In delicate organs such as the central nervous system and eye, the surgeon's individual skills play a crucial role in determining patients outcome . Hence, the emphasis has been placed on laboratory training, preparing surgical trainees for the operating room experience . Laboratory training models are indispensable for improving and purifying surgical skills before clinical application of microsurgery . Education and training in microsurgical techniques have historically relied on the use of live animal models . However, increasing sensitivity toward the ethical aspects of scientific research demands a significant reduction in the numbers of live animals used in surgical and academic education . Many articles are reporting on the use of alternatives to live animals in microsurgical training . We propose a simple fresh sheep cranium model for orbita and optic nerve microsurgical training . The fresh sheep cranium material has been previously described as a useful model to learn microneurosurgical skills and we have applied the same model in the current study . The model presented in this report is one step of a basic microneurosurgery training program that was used in the microneurosurgery laboratory at trakya university's department of neurosurgery . Second- to fifth - year residents regularly have to complete this basic laboratory training for microsurgery . The material for the model was obtained from a local butcher under official veterinary control and consisted of a one - year - old fresh sheep cranium with the scalp removed . Superior and lateral orbital border with supraorbital notch and supraorbital nerve were exposed [figure 1]. The microneurosurgical training was started under magnifications (6 to 10) of the operating microscope (opmi 99 zeiss inc ., bipolar forceps, an arachnoid knife, microscissors, and a suction tube were used for intraorbital and intracranial dissection . All surgical procedures, with the exception of craniotomies, were performed under operating microscope . Photographs were taken with a digital camera (nikon coolpix 4500, japan) from the microscope eyepiece . Part 1 consisted of a 2-step approach to dissect intraorbital structures, and part 2 consisted of a 3-step approach to dissect the optic nerve intracranially . Exposed superior and lateral orbital border with supraorbital notch and supraorbital nerve the model simulates standard microsurgical techniques using a variety of approaches to neural structures in and around the orbit . The first step consists of subperiostal dissection of the periorbita and bony removal of the superior orbital border and roof by rongeur [figure 2a]. The second step consists of microsurgical identification and gentle dissection of the retroocular anatomic structures in the orbital fatty tissue and approaches of the orbital apex [figure 2b]. (a) first step of the dissection consisting of subperiostal dissection of the periorbita and bony removal of the superior orbital border and roof by rongeur (b) microsurgical identification and dissection of the retroocular anatomic structures in the orbital fatty tissue in order to approach the orbital apex the simulation of the superior orbitotomy approach was performed using the same microsurgical maneuvers and manipulations, alike fatty tissue dissection of the orbit and differentiation of the normal anatomic structures . One burr hole is placed 3 cm to the midline and 3 cm to the superior orbital border after identifying the supraorbital nerve and removing the periosteum . The frontal bone was removed using rongeurs to make a 3 3 cm craniectomy to simulate the standard frontal craniotomy . The dura overlying the frontal (rostral) lobe is opened in a semicircular fashion, simulating the standard frontal approach in the human brain (first step) [figure 3a]. (a) following the craniectomy to simulate the standard frontal craniotomy and dura was opened in a semicircular fashion . This way it is possible to simulate the standard frontal approach in the human brain (b) the filled arteries in sylvian dissection step allows to feel a real surgery experience for inexperienced neurosurgery residents (c) at the end of the dissection, the last step is the opening of optic canal and exposure of the optic nerve within the canal the second step consists of identification and microsurgical dissection of the optic nerve [figure 3b]. The exposed brain was human - like: the arteries were light red, the veins were dark red and filled, and a clear fluid simulated the release of cerebrospinal fluid when the arachnoid was opened . The sylvian fissure was splitted, followed to the carotid and basal cisterns, and dissected the optic nerve in the anterior skull base . The third step consists of opening the optic canal and exposing the optic nerve [figure 3c]. Kerrison rongeur or high - speed drill was used for opening and unroofing the optic canal . Historically, learning, invention, and development in microsurgery started with the human subject, moved toward the animal subject, then synthetic models . In today's world, surgical residents need to start in the laboratory and work their way up to human subjects, focusing on exercises that closely mimic the real - life situation in order to facilitate skills transfer . Practicing surgical skills and gaining experience with microsurgical procedures on several models such as laboratory animals, human and animal cadavers, and synthetic materials before exposure to patients the best way to maintain surgical skills and consistent ability is to routinely perform procedures . Surgeons who are not routinely presented with such clinical experiences must regularly repeat correct rehearsals in order to maintain or improve their skills . Books, lectures, videotapes, and the assistance of experienced surgeons facilitate the development of cognitive and perceptual skills, but motor skills can be developed and maintained only with regular practice . The authors present a training model in sheep cranium that allows residents in neurosurgery and ophthalmology to practice the superior orbitotomy and frontal craniotomy procedure used in the surgical approach of various orbit pathology . The model comprises a two - part, five - step approach: intraorbital (part 1) and intracranial dissection (part 2); superior orbitotomy approach; subperiostal dissection of the periorbita and bony removal of the superior orbital border and roof; dissection of the retroocular anatomic structures; approaches of the orbital apex, frontal craniotomy, dissection of the optic nerve and opening the optic canal . The major advantage of this new training system is the possibility of learning to manipulate biological material that is very easily procured at a low cost . Sheep cranium is an ideal material because it is inexpensive, convenient to manage and easy to obtain; furthermore, it is a biologic human - like material, and neither specific facilities to maintain live animals nor anesthesia is needed . However, sheep may not be found very often in some parts of the world, as a result the general costs of this model may be increased . In that case, other animal models can be used in that particular areas . Generally, the abovementioned advantages remain true for fresh cadaveric animal models . The rationale behind the use of animal models is not because they mimick the human anatomy exactly, but they create a real - life surgical training opportunity for inexperienced residents . The main disadvantage related to the presented model is the absence of bleeding, as it is in any of the cadaveric animal models . One should note that real - life surgery contains a risk of bleeding and the ability to deal with hemostasis is essential for any kind of surgery . Also the surgical material is different than in real - life surgery, although it is a fresh cadaveric sheep cranium . The surgical feeling through the microinstruments, as well as tissue handling may be different . Live animal models may be a good complementary training alongside our suggested model, which resemble more to the real - life surgery by the means of bleeding, tissue handling and tissue preservation . Although the medical risk of contracting animal diseases, such as transmissible spongiform encephalopathie (scrapie), is low in younger sheep, precautions need to be taken . The specimen should be provided from a known source and from animals under veterinary control . We also recommend that surgical instruments used in the study should not be used in human subjects and all sterilization measures should be absolutely strict . The sheep brain and orbit are similar to that of the human with some differences . For instance, the volume of a sheep orbit is slightly more than half that of a human orbit, and the topographic anatomy of the orbit of the sheep cranium is different from that of the human orbit . The cadaveric sheep cranium model presented here is intended only for laboratory training . Ours is not an anatomic study of the sheep brain or orbit in the context of veterinary medicine; therefore, except for the microsurgical similarities to corresponding structures of the human orbit and brain, other definitions, locations and variations of anatomic structures mentioned in this article are not the subject of the training model and are beyond the scope of this study . Acquiring microsurgical skills is essential for neurosurgeons and physicians from several other disciplines like ophthalmology, otorhinolaryngology, plastic surgery etc ., recent studies have shown that programs focusing on early microsurgical training of physicians might result in early and better acquisition of the proper microsurgical technique . Are focused on the effects of the participants age, who have completed a standard microsurgical training program . Participants of younger age or medical students showed better results compared to older individuals or surgeons, by the means of microinstrument handling, tissue handling, time management and theoretical knowledge . However our microsurgical model is planned for the training of second to fifth year residents . As indicated in several other publications microsurgical courses or training programs aiming to train younger individuals, for example during medical school education or before the acceptance to the residency program may be more useful ., our aim is to familiarize junior residents of neurosurgery and ophthalmology with the basic techniques of microsurgery in dissecting major anatomic structures in and around the orbit under an operating microscope . For this reason, this training model should not be exchanged for other training, especially on live animal models, but should serve only as a supplementary training model in microsurgery for beginners . Advantages of using this model over traditional training techniques are ease of use, reproducibility, minimal cost, easy access to the materials; most importantly, this model allows surgeons to practice microsurgery outside of the operating room . We would argue that use of this model is helpful to improve microsurgical techniques and reduce time taken to perform basic microsurgical maneuvers, factors that will lead to greater success when performing microsurgery on patients.
Over the past few decades, and particularly since the world summit for children in 1990, there has been growing interest in measuring child mortality, both as a health indicator and as a basic measure of human development . More than 8 million children die each year all over the world and child mortality has received special attention as part of the united's millennium development goals (un mdg). This fact has brought renewed attention to the challenge of improving child survival, including, a focus on understanding why some populations are making progress and others are not. [57] some researchers have suggested that decline in child mortality can be at least partially attributed to the improved measurement of child mortality . Thus, increased policy discussion of investment in child health is leading to calls for more timely and more local measurements of child mortality . However, despite considerable efforts, our knowledge on the impact of intervention strategies for many countries is weak . A vital registration system that captures all births and deaths is the optimal way to monitor child mortality; however, a very few developing countries have complete vital registration systems . Child mortality is often used as an indicator of population health . Moreover, in developing countries, data on child mortality are comparatively reliable compared with other measures of population health . In fact, child mortality is a key health outcome in developing countries . In countries with complete vital registration systems that capture all births and deaths, child mortality can be directly calculated, considering that one of the most important indices of health in each age group is its own mortality rate . In the absence of a complete vital registration system, however, child mortality must be estimated using live births . Furthermore, with increasing concern about equity in child survival, it is arguably as important to be able to measure and monitor child mortality at the subnational level, which complete birth histories are clearly inappropriate for this purpose . Health policy makers always need appropriate and up - to - date information about mortality, in order to evaluate the efficacy of current system and to design of suitable intervention studies . There is a special emphasis on the health of iranian children and therefore, many preventive activities are carrying out to improve their health . Therefore, in 1997, the study on the registration of death and its cause has been carried out in bushehr province as a pilot study . In 1999, semnan, eastern azarbayejan and chahar mahal and bakhtiary provinces were added to this project . Another six provinces in 2000 and rest of the provinces have been added in 2002 . The primary results of the mentioned studies have revealed that despite favorable results of current activities of improvement of national health and declining mortality in children, the current information system needs revision . The main aim of this study is to explore the current process of referring system on mortality among 1 - 59 months children based on hospital records . There is also an assumption that there is an inequality among different universities, which are covering health of residents of different iranian provinces . As it is unknown to what extent 1 - 59 months mortality has been equally distributed within the country, this study is going to describe the inequality in 1 - 59 months mortality in iran . Birth history data and data on determinants of 1 - 59 months mortality were obtained from iranian demographic and health surveys, which are nationally representative surveys among ever - married women aged 15 - 49 years . It should be noted that since 1985, the responsibility of health in iran has been delivered to universities of medical sciences . In 2009, there were 40 medical universities (in 30 provinces) in iran . In the primary step, a national qualitative health survey (including new questionnaire for gathering better information) has been carried out among health experts of three selected medical universities: shahid beheshti, semnan and arak . Based on their comments, then, the revised questionnaires have been filled in arak . With resolving the observed practical problems, the final questionnaire has been prepared and was sent to 40 medical universities in order to be filled in all parts of iran in 2009 . The requested data on mortality of children 1 - 59 months in different parts of iran have been collected and sent to the main researcher in the health ministry . Using the designed questionnaire, in addition to age and sex of deceased children, some other information has also been collected across the country, based on hospital records . These information include, recommended refer, referred patients, suitable cardiopulmonay resuscitation (cpr), on time cpr, physician's recommended treatment, on time treatment, on time diagnosis, possibility of another diagnosis, available diagnosis in close hospital, necessity of referring, the reason of not referring (no request for refer, unavailable admission in target hospital and unavailable facilities for transfer), transferred patients, need for special surveillance, receiving special surveillance, diagnosis based on international classification of diseases- 10 revision or icd-10 categories (accident, congenital, pulmonary, cardiovascular, infectious and parasitic diseases, central nervous system (cns), gastroenteritis, metabolic disorders, blood diseases, cancer, urinary diseases, mental / behavioral diseases, around birth death and other reasons), correct diagnosis (based on laboratory results), reports of complications during hospitalization and true complications during hospitalization . All questionnaires have been entered inside the pre - designed program (microsoft access 2007). After determining the distribution of 1 - 59 months mortality in universities, anova and students t - test have been used for measuring the difference of continuous variables among groups . Mortality in 1 - 59 months children was unequally distributed across provinces (universities). The largest number of deaths was in razavi khorasan (643 deaths) and smallest number of deaths in fasa (4 deaths). Distribution of 1 - 59 months mortality across iranian universities by sex in 2009 the hospital records characteristics of iranian deceased children 1 - 59 months in different universities have been shown in table 2 . The recommended refer was 3466 but only 1620 patients were referred . For 3417 (95.4%) patients, physicians recommended treatment for 3275 (91.3%) of patients; however, only 1648 (66.1%) of patients had on time treatment . The diagnosis was on time only in 671 patients (19.2%) while there was the possibility of another diagnosis in 664 (18.9%) of patients . In 1471 (60.1%) children, diagnosis in their close hospital was available . In 295 (33.1%) patients, refer was necessary . The most important reasons of not referring were unavailable admission in target hospital . There was also no request for referring in 178 (36.3%) children . For 103 (21%) patients, facilities for transfer were not available . Special surveillance was necessary for 2168 (71.6%) of patients; however, only 773 children were received this special surveillance . Based on laboratory results, 2993 (95.7%) of all diagnosis finally, based on icd-10 categories, the first five important determinants of death were congenital (671 children or 20.9%), accident (547 children or 17.1%), pulmonary diseases (370 children or 11.5%), cardiovascular (266 children or less than 8.3%), cns (263 children or 8.2%), and infectious and parasitic diseases (245 children or 7.6%), respectively . This study is one of the first to show the spatial distribution of the inequality of 1 - 59 months mortality within a developing country . It shows that there is a lack of referring system related to children mortality across iran as a whole and within most of its provinces . Mortality in 1 - 59 months seems to be unequally distributed across provinces (universities). Various major health programs and initiatives focus on children mortality; and most un member states have agreed to the un millennium development goal (mdg) of reducing the under - five mortality by two - thirds between 1990 and 2015 . Therefore, reducing regional disparities in mortality within countries is an important objective of national governments and international organizations . Although, in the recent years, there have been carried out many studies on inequality and spatial distribution of children mortality in developing countries;[1725] however, not much is known about how inequalities change across iranian provinces, and what the determinants of these changes are . It should be noted that the objective of our study was not to rank provinces according to their inequality, however, to show the distribution of children 1 - 59 months mortality across iran, which can help health planning and policy - making for promotion of health in iranian provinces, especially, in the hospitals . Furthermore, based on the published report of iranian ministry of health, more than 80% of mortality in age group of 1 - 59 months take place in hospitals . Therefore, the further focus must be on the determination of inequality in hospitals . To do this, we should have standardized questionnaires to compare different hospital records . For instance, the large number of death in children of razavi khorasan might largely be explained by differences in access to first care facilities, especially, for afghanian immigrants . Furthermore, in some provinces, nutritional standards less improved, women's literacy less increased, and the number of health - care facilities have not been expanded yet . Moreover, during recent years, the iranian population in some provinces has better access to better and more facilitated hospitals with more medical experts and more skilled physicians . Our study implies that widening socio - economic inequalities in iranian provinces (universities) are not inevitable; declining inequalities may occur as well, certainly in absolute terms . An equitable distribution of primary health - care development might be an important factor for preventing widening in inequalities in children mortality . We can deduce the reasons for the existing conditions from experts as well as from local information in some provinces, but there is little research - based evidence to provide clear explanations, especially, in urban areas . For instance, utilization of health - care facilities in sistan and baluchestan are known to be far lesser than the rest of the country not only because of low - availability of health - care, but also as a result of people's attitude . This study indicates the necessity of better defining the determinants of both inequality and levels of children mortality as well as the contribution of each factor to different provinces focusing on hospital records . The referring system did not show a good process in iran; i.e. Although for most of deceased children referring was recommended; only part of them was referred . There are many barriers to have an efficient referring system such as: cooperation between different health - care workers, out - to - date transferring facilities, inefficient insurance policy that lead to not admission in target hospitals, and so on . It could also be due to wrong belief that special hospital could cure patient much better than the closer hospital . Our results suggest that inequality in 1 - 59 months mortality based on the hospital records needs more attention in iran as a whole and in most of its provinces by policy - makers . In addition, it is advisable to conduct provincially representative surveys to provide recent estimates of hospital access inequalities and to allow monitoring over time.