text
stringlengths 0
868k
|
|---|
Central noradrenergic pathways are involved in regulating cardiovascular function, as well as in the control of food intake [3, 4]. Norepinephrine (ne) levels and sympathetic activity are responsive to stressors and glycemic fluctuations [57]. Central - acting pharmacological compounds that have actions on norepinephrine and other biogenic amines are currently used (e.g., phentermine and related formulations) or have the potential (e.g., tesofensine and bupropion / naltrexone) to treat obesity [8, 9]. However, elevations in heart rate and blood pressure are adverse effects that are often associated with the long - term use of these medications [10, 11]. Therefore, understanding how central - acting noradrenergic compounds impact feeding behavior and related neural structures can provide more targeted approaches for the treatment of obesity . Nisoxetine (3-[2-methoxyphenoxy]-n - methyl-3-phenyl-1-propanamine) is a highly selective central - acting norepinephrine reuptake inhibitor originally developed as an antidepressant [12, 13]. In vitro studies with nisoxetine revealed that norepinephrine levels were 1,000-fold higher than serotonin (5-hydroxytryptamine; 5ht) levels and 300-fold higher than dopamine levels [13, 14]. After studies suggested it did not have the desired antidepressant effect, nisoxetine has been used instead as a pharmacological tool to discriminate the involvement of the noradrenergic system . Radiolabeled nisoxetine is also used to identify norepinephrine transporter (net) kinetics and density [14, 16, 17]. Relevant to feeding behavior, nisoxetine has been used to distinguish the contribution of net inhibition on the feeding suppression of sibutramine, a potent ne and 5ht reuptake inhibitor, and bupropion, a potent ne and dopamine reuptake inhibitor [18, 19]. Even though ne reuptake inhibition has an additive effect when combined with other monoamine reuptake inhibition, examinations of the feeding effect of nisoxetine alone have had mixed findings [1821]. Because sibutramine and its metabolites have relatively good bioavailability when orally administered [22, 23], an apparent discrepancy between studies is the route of administration of nisoxetine . That is, in experiments where the drug is compared with sibutramine and given by oral gavage, nisoxetine has little effect on food intake [19, 21]. In contrast, nisoxetine administered by intraperitoneal (ip) injection produces a dose - dependent feeding suppression (0.163 mg / kg). This suggests that nisoxetine has poor oral bioavailability and has limited effectiveness on food intake when orally administered . Since the susceptibility to diet - induced obesity has been associated with increased sympathetic and central norepinephrine activity [2426], the feeding suppression produced by an ip injection of nisoxetine can be used to determine how dietary conditions alter the noradrenergic controls of feeding . One aspect that has not been investigated is whether doses of nisoxetine that suppress food intake alter cardiovascular and blood pressure parameters . The present studies used acute nisoxetine (ip) to identify its dose - dependent effects on feeding behavior and hemodynamic measures . From these experiments, a subthreshold dose of nisoxetine was used to determine the influence of weight gain following prolonged exposure to a high - fat diet on the noradrenergic controls of feeding . To further assess whether exposure to a high - fat diet alters neural responses to nisoxetine, adult male sprague dawley rats (8 week old) acquired from harlan laboratories (frederick, md) were individually housed and placed on a 12/12 h light dark schedule (lights off at 1700 h). Rats were fed standard chow (purina rat diet 5012, 13% fat, 27% protein, 3.1 kcal / g), unless otherwise noted, and water was available at all times during the experiments . All procedures were approved by the institutional animal care and use committee of rutgers university and were in accordance with nih guidelines . Animals (n = 6) were food deprived 24 h before each injection . For this within - subject design, each animal received an ip injection of vehicle (saline) and nisoxetine hcl (tocris biosciences; 3, 10, and 30 mg / kg). Each injection was randomized and separated by a one - week wash - out period . Food intake measurements were recorded at 0.5, 1, 4, and 24 h after injection . Food intake was measured to the nearest 0.1 g. in an identical within - subject design as described above, animals (n = 12) were 24 h food deprived and, upon re - feeding and injection, cardiovascular parameters were measured by using a noninvasive tail - cuff volume pressure recording system (coda, kent scientific). Animals were habituated to the coda system for three consecutive days one week before beginning the nisoxetine or saline dosing . On recording days, animals were acclimated to the coda system 5 min before the recordings . Measurements for each time were determined by averaging the values for 3 successful recording trials at 1, 4, and 24 h after injection . These included measurements for mean blood pressure (bp), diastolic bp, systolic bp, and heart rate . After 1-week acclimatization to standard chow, animals were placed on a high - fat diet (hf), (n = 9; research diets d12492, 60% fat, 20% protein, 5.24 kcal / g) or control diet (cd), (n = 8; research diets d12450b, 10% fat, 20% protein, 3.85 kcal / g) for> 10 wks . Body weights were measured twice a week . After a statistical separation of body weight between groups at 10 weeks, animals began testing with a subthreshold feeding dose of nisoxetine (3 mg / kg), as determined from section 2.2 . Prior to each injection, animals were food deprived for 24 h. half of the animals in each group were injected with nisoxetine (3 mg / kg, ip), while the other half were injected with saline (ip). In order to control for the palatability and caloric differences in diets, all animals were returned to their cages with standard chow and food intake measurements were recorded at 0.5, 1, 4, and 24 h. immediately after the 24 h time point, all rats were returned to their respective diets (i.e., high fat or control). Two weeks following the nisoxetine feeding suppression test, animals in both diet conditions were given an ip injection nisoxetine (3 mg / kg) or saline . Groups consisted of high fat (nisoxetine); n = 5, high fat (saline); n = 4, control diet (nisoxetine); n = 4, control diet (saline); n = 4 . Two hours later, rats were deeply anesthetized with sodium pentobarbital (100 mg / kg), exsanguinated with 0.9% saline, and perfused with 4% paraformaldehyde . Brains were removed, stored overnight in 4% paraformaldehyde with 25% (wt / vol) sucrose at 28c, and then frozen and sectioned at 40 m on a cryostat through the forebrain and hindbrain regions . The immunohistochemistry procedure for free - floating sections with c - fos primary antibody (1: 20,000; calbiochem, emd millipore, rabbit polyclonal, pc38) was similar to a previously published protocol . To control for staining variability, each immunohistochemistry run contained matched sections from all between treatment groups and saline controls . Cell counts were performed using nih imagej software with value per animal for each region representing average counts from 4 anatomically matched sections . For the nisoxetine dose response, food intake (kcal) and individual hemodynamic parameters were analyzed using repeated measures anova . A two - way anova with repeated measures was used to determine whether exposure to the diet influenced the feeding suppression of nisoxetine . Cell counts for each region were analyzed using a factorial anova to determine whether there was an interaction between nisoxetine and diet exposure . Posthoc comparisons were made when appropriate with neuman - keuls test, unless otherwise noted . All statistical analyses were performed with statistica 7.1 software (statsoft inc .) And significance was set at = 0.05 . There was a dose - dependent effect of nisoxetine (030 mg / kg) on the re - feeding response of standard chow . A repeated measures anova indicated a dose effect (f(3, 15) = 14.8, p <0.001), time effect (f(3,15) = 737.3, p <0.001), and a dose x time effect that approached significance (f(9, 45) = 1.9, p = 0.05). Post - hoc testing revealed the 10 mg / kg and 30 mg / kg were significantly different from all other doses (p <0.05 for both), see figure 1(a). When data were expressed as a ratio of individual saline intake to illustrate dose suppression, see figure 1(b), there was a significant suppression with 30 mg / kg and 10 mg / kg from 3 mg / kg at all time points (p <0.05). Data indicated that the 3 mg / kg dose was subthreshold for the nisoxetine - induced feeding suppression of standard chow in animals maintained on standard chow . There was an overall dose effect for mean bp (f(3,30) = 6.1, p <0.005), systolic bp (f(3,30) = 5.8, p <0.005), diastolic bp (f(3,30) = 5.9, p <0.005), and heart rate (f(3,30) = 3.2, p <0.05). Post - hoc testing revealed that there was a significant decrease in mean bp at 1 h for 10 mg / kg and all time points for 30 mg / kg from saline (p <0.05 for all); see figure 2(a). The 30 mg / kg dose reduced systolic bp at 4 h and 24 h and diastolic bp at all time points from saline (p <0.05 for all); see figures 2(b) and 2(c). There was an increase in heart rate at 24 h in 30 mg / kg dose from saline (p <0.05); see figure 2(d). As illustrated in figure 3(a), there was increased caloric intake with animals on the high - fat diet . The kcal intake showed a significant overall diet effect (f(1,15) = 15.4, p <0.005) and time effect (f(9,135) = 36.2, p <0.005). This was accompanied by an increase in body weight over time (f(9,135) = 668.4, p <0.005), with a significant diet x time effect (f(9,135) = 6.0, p <0.005). Post - hoc testing revealed that the high - fat diet group had a significantly higher body weight from the control diet group at week 10 (p <0.05), see figure 3(b). Rats with high - fat diet exposure showed a higher sensitivity to the feeding suppression of nisoxetine (3 mg / kg). There was an overall diet effect (f(1,15) = 13.8, p <0.05) and nisoxetine effect (f(1,15) = 32.1, p <0.005). Post - hoc testing indicated that the high - fat diet exposed group had decreased chow intake at the 24 h time point (p <0.05). Nisoxetine in the high - fat diet exposed group resulted in feeding suppression from the saline at the 1 h time point (p <0.05 for both). There was a greater feeding suppression from all groups with nisoxetine in the high - fat diet exposed group at the 4 and 24 h time points (p <0.05 for both), see figure 4 . Several hindbrain and forebrain regions were examined for c - fos immunoreactivity, such as a2 cell group, locus coruleus, amygdala nuclei, and hypothalamic nuclei . The only structures to demonstrate immunopositive cells in response to nisoxetine (3 mg / kg) at the 2 h time point in the arcuate nucleus, see figures 5(a) and 5(b), there was an overall significant effect for nisoxetine (f(1,13) = 27.1, p <0.005) and a significant diet x nisoxetine effect (f(1,13) = 4.8, p <0.05). Post - hoc testing revealed animals injected with nisoxetine with high - fat diet exposure had more c - fos positive cells in the arcuate nucleus than animals injected with saline and exposed to either high - fat diet or control diet (p <0.05 for both). Planned comparisons between animals receiving nisoxetine revealed the high - fat diet exposed animals had significantly more c - fos positive cells than animals exposed to the control diet (p <0.05); see figure 6(a). In the orbitofrontal cortex (lateral and ventral regions), there was only a significant effect with nisoxetine increasing the number of immunopositive cells (f(1,13) = 14.6, p <0.05). There were no significant effects for diet or diet x nisoxetine, see figure 6(b). This study investigated the acute effects on feeding and hemodynamic measures of nisoxetine, a potent selective norepinephrine reuptake inhibitor, in adult male sprague dawley rats . It was determined that feeding a high - fat diet, which resulted in weight gain, increased sensitivity to the feeding suppression of low - dose nisoxetine . This increased sensitivity was accompanied by enhanced neural activation in the arcuate nucleus of the hypothalamus, a neural structure critical in the homeostatic control of feeding and body weight . The findings of this study indicated that nisoxetine, when given by intraperitoneal injection, produced a dose - dependent refeeding suppression of standard chow over 24 h. feeding suppression from saline was observed in the 10 mg / kg and 30 mg / kg doses, while the 3 mg / kg was subthreshold in normal - weight rats fed standard chow . In a study by billes and cowley comparing the additive effects of nisoxetine and a selective dopamine reuptake inhibitor (gbr12783) on feeding measurements, intraperitoneal nisoxetine (0.163 mg / kg) alone produced a similar dose - dependent refeeding (i.e., following a 16 h food deprivation) suppression of 24 h intake of standard chow in mice . In a follow - up study, billies and cowley found the feeding suppression of nisoxetine (4 mg / kg) did not affect locomotor activity over the 24 h feeding period, but did decrease average intrascapular temperature in mice . Our investigation extended these findings over a narrower dose range in rats (330 mg / kg) and measured the influence of these doses on hemodynamic measurements . Our results indicated that the 30 mg / kg dose reduced mean blood pressure at 1 h, 4 h, and 24 h after injection . At the 24 h time point, the 30 mg / kg dose produced tachycardia, possibly compensatory to the depressor effect . This dose also still had an approximate 40% feeding suppression, 24 h after injection . It is interesting to note that the 10 mg / kg nisoxetine dose suppressed food intake by approximately 40% at 0.5 h, 1 h, and 4 h and only had an approximate 10% decrease of mean bp at the 1 h time point . One potential limitation to our findings is that the animals had a 24 h food deprivation prior to measuring the hemodynamic parameters . The 24 h food deprivation was done to facilitate comparisons between the feeding suppressive and hemodynamic effects of acute nisoxetine . Although prolonged food deprivation (48 h) does decrease heart rate and increase heart rate variability in lean and obese animals, the effects of the 24 h food deprivation in our study was controlled by randomizing the dosing scheme and having a vehicle control . Altered hemodynamic measurements and hindquarter vasodilation have been demonstrated with acute administration of sibutramine (a potent ne and 5-ht reuptake inhibitor), effects that are reported mediated by actions on the net [3032]. Taken together, the decrease in intrascapular temperature observed by billes and cowley and the predominant decrease in blood pressure in our study suggests acute nisoxetine acts centrally to produce a short - term sympathoinhibitory effect . Another novel finding of the present study was that animals fed a high - fat diet with increased body weight, demonstrated increased sensitivity to the feeding suppression of low - dose nisoxetine . That is, feeding suppression in animals with high - fat diet exposure was observed with the 3 mg / kg dose . This nisoxetine dose did not alter the food intake in standard chow - fed animals or animals fed a low - fat control diet (10% fat). However, the cardiovascular effects of nisoxetine were not assessed in the animals exposed to the high fat diet and it is possible the sensitivity to low - dose nisoxetine on hemodynamic measures was altered as well . In previous studies, the acute feeding effects of nisoxetine (3.5 mg / kg, ip) were assessed in obese mice, but failed to demonstrate diet - induced alterations in feeding suppression . One difference between studies is the method used to measure the acute feeding response . In the study by billes and cowley, the feeding suppressive effects of nisoxetine were measured using a high - fat diet (45% fat, 20% protein). The high - fat diet was fed as a maintenance diet for the obese mice and the lean mice were exposed to the high - fat diet about 1 week prior to testing . Because the fat content and the length of diet exposure can influence acute palatability and intake, in our study rats were maintained (> 10 weeks) on either a high - fat diet (60% fat, 20% protein) or low - fat control diet (10% fat, 20% protein) and were tested on standard chow . The standard chow was not novel per se, since all animals received the diet one week prior to beginning their exposure to a high - fat or control diet . Animals with exposure to the high - fat diet demonstrated a reduced 24 h intake of standard chow, a suppressive effect that was enhanced with low dose of nisoxetine . It is possible that this alteration in the sensitivity to the feeding suppression of nisoxetine could have been masked if we had tested the animals with a more palatable high - fat diet, similar to the findings of billes and cowley . Another possibility is that the control diet, compared with the high - fat diet, was more similar in relative macronutrient content to the standard chow (13% fat, 27% protein), so there was less of a contrast effect in the control diet - fed animals . In addition, we did not include a group fed the high - fat diet calorie matched to the control fed group, so we are unable to determine if the feeding suppression by low - dose nisoxetine was due to the high - fat diet feeding or resulting weight gain . Future studies are needed to investigate whether nisoxetine or other noradrenergic - acting agents can reduce the intake of highly palatable foods and whether weight gain can alter the noradrenergic controls of palatable foods . The increased sensitivity in the feeding suppression of low - dose nisoxetine observed in the overweight animals suggests that the noradrenergic mechanisms involved in the neural and hormonal controls are altered in the development of diet - induced obesity . One limitation to our findings is that only a single dose of nisoxetine was used to determine the sensitivity to the feeing suppression . However, the increased sensitivity with high - fat feeding and weight gain was supported by our c - fos immunohistochemistry studies, which demonstrated that animals exposed to the high - fat diet had greater neural activation in the arcuate nucleus of the hypothalamus . Nisoxetine also increased the number of c - fos positive cells in the orbitofrontal cortex, but this activation was not influenced by diet . An increase in the lateral orbitofrontal cortex has been demonstrated with another selective noradrenergic reuptake inhibitor, reboxetine . The differential dietary activation of nisoxetine in the arcuate nucleus, however, is of considerable importance because this region is critically involved in the central and peripheral integration of the expression of feeding behavior and body weight controls . Although the exact role of ne in this region had not been delineated, it does appear ne plays a role in regulating neuronal activity of arcuate neurons . Using an in vitro slice preparation, ne application altered the spontaneous discharge rate of arcuate neurons . Most of the responses to ne were excitatory with 61.5% of these neurons increasing their firing rate, 22.9% decreasing their firing rate, and 15.6% were unresponsive . In addition, excitation of the arcuate neurons were mediated by both 1-adrenergic and -adrenergic receptors . Hindbrain noradrenergic input also appears to modulate orexigenic arcuate neuronal population . Using saporin - conjugated antidopamine hydroxylase (dsap), a selective immunotoxin that destroys ne and epinephrine (e) containing neurons, loss of ne / e input in the arcuate nucleus resulted in an increase in baseline levels of neuropeptide y / agouti - related peptide (npy / agrp) mrna expression . Norepinephrine / epinephrine in the arcuate nucleus appears to regulate glucoprivic feeding response, since animals with dsap immunotoxin lesions do not increase their food intake in response to 2-deoxy - d - glucose . Studies from levin and colleagues demonstrated the ne turn - over rate in the arcuate nucleus / median eminence is increased in animals as a result of diet - induced obesity or in rats prone to diet - induced obesity [37, 38]. In this sense, an increase to the feeding suppression to low - dose nisoxetine could have been a result of increased arcuate ne or increased net availability or both in this region . In addition, one aspect lacking in our study is that we did not determine the phenotype of the c - fos positive cells . Future work is certainly needed to determine the interaction between diet - induced alterations in arcuate ne, net availability, and the feeding suppressive and cardiovascular effects of nisoxetine . Obesity is associated with neural and metabolic alterations, which are involved in sustaining feeding behavior and increasing body weight . Even though noradrenergic mechanisms involved in feeding and cardiovascular controls are altered with obesity, it remains unclear how the feeding alterations, brain norepinephrine, and cardiovascular alterations interact in the development of obesity . This study used a selective norepinephrine reuptake inhibitor, nisoxetine, to focus on the diet - induced alterations in feeding that emerge with onset of weight gain . Data from these experiments demonstrate that the development of obesity resulted in an increased sensitivity to the feeding suppression effects of nisoxetine and increased nisoxetine - induced neural activation in feeding - related pathways . One thing to note is that the enhanced feeding suppressive effects of low - dose nisoxetine was demonstrated when tested on standard chow . Changes in diet are often accompanied (and are recommended by health care professionals) with the prescribing pharmacotherapy for the treatment of obesity . Therefore, our findings suggest that medications, which act on noradrenergic pathways, may facilitate the feeding suppression needed to reduce food intake and manage obesity, at least in the short - term . Future studies will be conducted to determine the long - term impact of central noradrenergic modulation, food intake, weight management, and cardiovascular control.
|
Uric acid (ua) is an end product of purine base metabolism and an antioxidant agent . Serum ua concentration is influenced by several factors such as overproduction, decreased glomerular filtration or renal hypoperfusion, enhanced tubular reabsorption or diminished elimination . That is degraded by urate oxidase (urease) to allantoin, which is freely eliminated in urine . Hyperuricemia is generally defined by ua levels> 6.5 mg / dl or 7 mg / dl in men and> 6 mg / dl in women . The role of ua as an independent causative or potential risk factor of mortality is controversial in patients with kidney disease, hypertension, obesity, cardiovascular events, diabetes mellitus, ischemic stroke, and cancer disease . The changes in ua in the clinical setting and pathophysiological events are related to oxidative stress, and provide evidence of impaired plasma antioxidant capacity in severe sepsis . A correlation has been found between serum ua level and inflammatory markers on population - based cohort studies . Serum ua concentrations can be considered as a marker of severity in critically ill patients without craniocerebral trauma and especially in patients with meningococcal infection . Changes in hypoxanthine, xanthine, ua concentrations, and oxygen transport parameters can be used to assess changes in the functioning of the microcirculatory bed . It has been established that an increased blood plasma level of hypoxanthine and xanthine may serve as an additional criterion of tissue hypoxia in critically ill surgical patients . Ua level during the 1 day of intensive critical care admission is not an independent risk of mortality in pediatric intensive care unit (icu), although the presence of sepsis and high level of ua have been associated with poor outcome . A number of scoring systems have been developed that circumvent the complexity and time constraints of traditional scoring systems developed to use in icu setting . These scoring systems contain many items that should be checked in different times after admission, and sometimes are very time - consuming . We presumed that ua level at the early hours of admission could predict the mortality of the admitted patients as a simple single test . This study was conducted to evaluate the validity of serum ua in prediction of mortality in patients in the emergency department . This is a prospective cohort study which was conducted during june december 2014 in observation unit of the emergency room of imam khomeini hospital, sari, iran . The unit has four beds with intensive care facilities . In this study, 120 (above 18 years old) patients who needed intensive care for the first time and maintained in the same condition for at least 24 h were included in the study and their blood samples were taken before initiation of any treatment . The exclusion criteria was; age under 18 years old, having trauma, acute coronary syndrome, myocardial infarction, hemodialysis, plasma creatinine of above three, any type of cancer, patients with hyperuricemia, and patients taking allopurinol . This study was accepted and confirmed by the ethics committee of mazandaran university of medical sciences . The epidemiological and clinical information of the patients was obtained by one physician and confirmed by another . Ua level was measured by using the colorimetric uricase methods in only one selected laboratory of imam khomeini hospital with the instrument selectra e device and ready to use ua toos commercial reagent kits obtained from ua pars azmoon co, iran . For evaluation of the severity of the disease, the scores range is between 0 and 27, with nine items and the scoring system are as follows: respiratory distress (defined as having respiratory rate above 20/min or o2sat <90% in the normal room air or needing oxygenation with mask or experiencing apnea): three points, septic shock (clinical symptoms indicative of positive systemic inflammatory response syndrome and suspicious or confirmed infectious foci accompanied with resistance to primary fluid therapy hypotension . Three points, platelet count <150,000: three points, bandemia> 5%: three points, age> 65 years: three points, lower respiratory tract infection (defined as infiltration in chest x - ray or clinical evidence indicative of this diagnosis): two points, needing in - home care nursing service: two points, and any change in the level of awareness: this system included nine items, scores ranged 0 - 27 . These scores explained as following: 04: very low risk, 57: low risk, 812: moderate risk, 1315: high risk, 15 <very high risk . Mortality in emergency department sepsis score mortality rate of the patients in the first 28 days of hospitalization was considered as the primary outcome . Furthermore, the requirement of using mechanical ventilation and taking vasopressor during the hospitalization time and severity of the disease based on meds score were measured . Finally, relationship of the serum ua level was evaluated by the cutoff point of 7.3 mg / dl for each outcome . Receiver operating characteristic (roc) curve area was used for determination of the validity of ua level test in prediction of mortality . For comparison of the groups below 7.3 mg / dl ua group and above 7.3 mg / dl ua group, chi - square and independent t - test used p <0.05 were considered statistically significant . Finally, relationship of the serum ua level was evaluated by the cutoff point of 7.3 mg / dl for each outcome . Receiver operating characteristic (roc) curve area was used for determination of the validity of ua level test in prediction of mortality . For comparison of the groups below 7.3 mg / dl ua group and above 7.3 mg / dl ua group, chi - square and independent t - test used p <0.05 were considered statistically significant . Sixty - two males (51.7%) and 58 females (48.3%) were included in the study . The patients were divided into two groups: patients with serum ua level of lower than 7.3 mg / dl and patients with serum ua level of equal or more than 7.3 mg / dl . Each group consisted of sixty patients: 29 (48.3%) males and 31 (51.7%) females in the serum ua <7.3 mg / dl group, 33 (55%) males and 27 (45%) females in the serum ua 7.3 mg / dl . No significant statistical differences were found according to the gender of patients in these groups . In general, the average age of the patients in the serum ua 7.3 mg / dl group was significantly higher . During the study, 31 patients underwent mechanical ventilation, from which the number of patients with serum ua levels of higher than 7.3 mg / dl were more than other group, but this difference was not statically significant (p = 0.061). In patients who needed mechanical ventilation, an average of serum ua was 7.82 2.82; however, in the patients who did not need mechanical ventilation this amount was 6.16 2.7, the difference was statically significant [table 2]. Comparison of patients in two groups of high and low uric acid level in according age, gender, requirement of ventilator and vasopressor medicine in the roc analysis with the cutoff point of 6.95 0.73 for ua level, the under the curve area of 0.667 (95% confidence interval [ci]: 0.5610.774) with 71% sensitivity and 55.1% specificity for prediction of patient's need to use mechanical ventilation were taken into account (p 0.006) [figure 1]. Receiver operating characteristic curve for predicting the need of using ventilator according uric acid level cutoff point during this study, majority of patients who needed to take vasopressor medication had serum acid uric level of above 7.3 mg / dl . Out of 120 participants, 96 patients who did not take vasopressor, the mean serum ua level was 6.39 2.84 . In the evaluation of meds, most patients having serum ua levels of lower than 7.3 mg / dl had lower meds points (on average 4.6 3.21) in compared to patients with high serum ua levels (on average 12 2.99). This difference was found to be statically significant which, indicates the patients with serum ua equal to 7.3 mg / dl or higher, were at higher risk of mortality [table 3]. Comparison of patients mortality in emergency department sepsis score in high and low serum uric acid levels twelve patients expired during the study, 9 of whom were older than 65 years old . Total mean serum ua level was 7.65 3.25, although, in patients who did not survive during the study it was higher than survived patients (6.47 2.76), this difference was not significant (p 0.171). Furthermore, results showed that expiry of patients underwent mechanical ventilation and took vasopressor, were significantly higher than other patients [table 4]. Comparison of patients mortality rate according serum uric acid level, needing ventilator, and taking vasopressor using serum ua level cutoff point for predicting possibility of patients' mortality via roc curve was not found to be significant (area under curve: 0.595 [ci: 0.4220.770], p = 0.27) [figure 2]. Therefore, serum ua level cutoff point could not predict possibility of patients' mortality in this study . Receiver operating characteristic curve for determination of serum uric acid cutoff point to predict mortality in patients based on the results of this study, there is no relationship between serum ua level and mortality rate of patients regardless of their underlying diseases . However, serum ua levels were meaningfully higher in patients who underwent mechanical ventilation . Using mechanical ventilation, infusion of vasopressor and age of higher than 65 years, ua level is an independent risk factor in the treatment of hypertension and is also associated with the cardiovascular accidents . Ua level is considered as an index in early diagnosis of renal failure and patients with asymptomatic hyperuricemia are at higher risk of progression to end - stage renal disease . Various factors effect on serum ua level and changes in ua level are related to oxidative stress in the clinical situation . These changes cause disturbance in the antioxidative capacity of plasma, especially in septic patients . By increase in acute physiology and chronic health evaluation (apache ii) score, a special pattern is noted in plasma metabolism, and plasma ua amount increases progressively in patients with poor medical conditions . In one study, it has been shown that the level of serum ua in the 1 day of admission in icu was not related to the mortality rate; however, effects of mechanical ventilation and resistant shock were the main mortality factors regardless of serum ua level . These research results are in agreement with our findings . However, in a study on fifty critically ill patients the level of serum ua was shown to be higher in nonsurvivor patients compared to the survivors . The serum ua levels of 7 mg / dl or higher, will extend the hospitalization time of patients in icu and also increases the time of using mechanical ventilation in patients . The level of serum ua increases in respiratory disorders, especially if hypoxia and systemic inflammation exist . Study, which was done on patients having respiratory diseases, revealed that serum ua level 6.9 mg / dl is an independent predicting factor in 1-month mortality of the patients . Moreover, duration of hospitalization in icu and using mechanical ventilation are longer in these patients in 1 month . One of the most important findings in our study was the relationship between needing to use the mechanical ventilation and the amount of serum ua; it means that serum ua level of 6.95 0.73 and above has 71% sensitivity and 55.1% specificity in prediction of demanding mechanical ventilation . Patients with acute respiratory failure who needed mechanical ventilation had a higher amount of ua urea and mortality rate . Similarly, in our study, the mortality rate was higher in patients who underwent mechanical ventilation and took vasopressor . In the hooman et al . Study, needing to administer vasopressor was shown to be an independent variable in poor outcome patients . The level of serum ua has a direct relationship with apache ii score, which means that patients with high apache ii score have higher serum ua levels . Similarly, in our study there was a direct association between serum ua and meds; however, the mortality rate was not associated with meds . In this study, there were various factors such as dehydration, taking nephrotoxic drugs, severity of the underlying disease, instability of the vital signs, and medical complications during hospitalization (e.g., nosocomial infections) which can influence the outcome of the patients; therefore, these factors and incidents, when occurring during the hospitalization time can have an effect on the mortality of the patients the same way as the primary condition of the patients . Considering this issue and limitations of this study, the predictive value of serum ua in patients' mortality can be improved by measuring the serum ua several times, taking into account the medical complications during hospitalization and uniform sampling of the patients . The serum ua level in the 1 day of hospitalization of a critically ill patient is not an independent indicative factor for mortality; however, age of above 65 years, requirement of mechanical ventilation and a shock which needs vasopressor infusion, indicate a poor outcome for the patient regardless of his serum ua level . However, high level of ua reveals critical status of the patient and requires mechanical ventilation.
|
In keeping with the mission of a liberal arts education, denison s neuroscience concentration provides our students with a challenging interdisciplinary perspective on the complex relationships between brain and behavior . In this way, students who pursue the concentration are exposed to a number of perspectives within neuroscience, from cellular and molecular analysis to broader, more molar systems approaches to behavior . Students pursuing our neuroscience concentration are most often biology or psychology majors, although there have been a few biochemistry majors completing the concentration . Since 2000, we have had close to 70 students earn the concentration, with an additional nine students completing self - designed majors in neuroscience, cognitive neuroscience, social neuroscience, or psychobiology . Our curriculum is structured in such a way that all neuroscience students must complete introductory psychology and introduction to the science of biology prior to enrolling in our introduction to neuroscience (neur 200) course . Neur 200 emphasizes the basics of the field, including cellular physiology, ionic movements, refractory periods, receptor dynamics, post - synaptic potentials, neuropharmacology, and neuroanatomy . The two introductory courses are also required for the 200- and 300-level elective courses in psychology or biology . Students must also complete four courses (including neur 200) designed to provide breadth in the concentration . Throughout the remainder of their tenure at denison, neuroscience students must complete biological psychology, biological psychology research, two upper - level electives depending upon the student s major and area(s) of interest, and our capstone course, advanced neuroscience (neur 400). Table 1 summarizes the neuroscience curriculum, identifying pre - requisite courses, courses required for breadth, and more advanced required and elective courses that offer depth in the concentration . Over the last several years, capstone courses have become increasingly more visible on college and university campuses . Indeed, the capstone experience is now fairly commonplace in smaller, private colleges, as well as in large public institutions (badway and grubb, 1999). Capstone courses are believed to provide valuable experiences for students, including opportunities for synthesis and integration of information (e.g., henscheid et al ., 2000), further development of critical thinking and writing and speaking skills (cuseo, 1998), and an ideal environment for assessing student learning (moore, 2005). In our program, the capstone experience for all neuroscience students is advanced neuroscience (neur 400). This course is designed for juniors and seniors who have completed the majority (if not all) of the courses required for the concentration . Typically, the course enrolls 1525 students, and is taught in the spring semester . From the inception of our neuroscience program, we envisioned neur 400 to be a course that brings together critical concepts and ideas from the students previous coursework in a format emphasizing discussion of primary literature and incorporating multiple learning activities and projects throughout the semester . Unlike the introductory course in neuroscience, neur 400 addresses contemporary molar issues in neuroscience . Importantly, our advanced neuroscience course is team taught by faculty from biology, psychology, chemistry, philosophy and computer science . In this way, students are exposed to cutting edge issues within a number of sub - fields of neuroscience by faculty whose primary interests reflect those issues and problems . One faculty member serves as the instructor of record (this person receives teaching credit for the course) and is responsible for the course organization and administration (syllabus creation, coordination among participating faculty, development of assignments, and grading). At denison, the instructor of record rotates every two years between the psychology and biology departments . In recent years, the course topics and readings have examined visual attention and computational neuroscience, autism, biochemistry of memory formation, explicit and implicit memory systems, amnesia, face recognition and cognitive neuroscience, artificial intelligence and face recognition, neuroscience of consciousness, neurophilosophy, nervous tissue differentiation and central nervous system development, glia and glioma, stress and neurodegeneration, affective neuroscience, educational neuroscience, and cultural neuroscience . Each faculty participant assigns research articles and will typically lead either one, two, or three class meetings that can include lectures and research presentations, student - led discussions and presentations, or active learning exercises . Students are also asked to post on blackboard, an on - line course management system, two or three discussion questions or talking points on the reading assignments prior to each class meeting . Several different assignments have been designed to help students enhance their ability to read and critique neuroscience research, develop an integrative understanding of neuroscience core areas, examine the intersections that connect neuroscience with other disciplinary areas in sciences, arts, and humanities, and explore the relevance of neuroscience to contemporary issues and personal applications . We present three of the activities below . The dissemination of neuroscience research to scientists, educators, professionals, and the general public has increased through the availability of internet sites . In particular, the range and complexity of neuroscience research introduces unique challenges for the presentation of informative and useful research summaries to an informed lay audience . Thus, the goal of this activity is to provide students with an opportunity to read a primary research article in a neuroscience journal and then to prepare and deliver an oral presentation about that research article to classmates in a session that is known as neuroscience in the news . Each student selects a research article from any field of neuroscience published in the past three years based upon his or her personal interests . Then they prepare a 5-minute presentation that will model the format of a news release and that will be similar in content and style to the neuroscience news reports on the webpage of the british neuroscience association (bna; http://www.bna.org.uk/news/). In the presentation, the students objectives are to explain why they selected the particular research article; describe the most significant theoretical issues, methods, and results; summarize the most meaningful conclusions including the importance or relevance of the research and/or its applications; and identify how the research contributed to an enhancement of personal knowledge and interests in neuroscience . It is stressed to the students that their neuroscience in the news presentation should be understandable to an informed lay audience as much as to neuroscientists . Students can augment their oral presentation with a small number of powerpoint slides or video clips in order to show results, equipment, or other pertinent information . Some of the recent neuroscience in the news presentations include does sleep deprivation put you in a better mood?, exercise training increases the size of the hippocampus and improves your memory, videogames and cognitive training in the elderly, brain - machine - brain interfaces: a new way to connect to the world, brain imaging: visualizing the developing and maturing brain, and therapeutic potential of omega-3 pufas for peripheral nerve injuries . Following each presentation many of our neuroscience students have educational and career goals involving the application of basic neuroscience research to medical, clinical, educational, or other professional settings . Therefore, in this assignment, pairs of students work together to develop a brain briefing, a written document that explains how basic neuroscience research has relevance to a general audience of policy makers in clinical, health, educational, or other fields and professions (e.g., sports, law, economics, and robotics). The model for this assignment is the brain briefings newsletter published online by the society for neuroscience (sfn) (lom, 2005) and more recently posted at the website, brainfacts.org (http://www.brainfacts.org/), a public information initiative of the kavli foundation, the gatsby charitable foundation, and the sfn . Students first review several brain briefings on the website in order to get a grasp of the content, format, and style of these papers . Then, each pair of students identify a particular area of application (e.g., medical treatments for alzheimer s disease) that can be informed by neuroscience and conduct an online search to find four to six relevant research articles . The students brain briefing report is not meant to be a research abstract; rather, their goal is to follow the format of the sfn brain briefings and provide information on recent neuroscience research that has exciting and valuable applications to neurological, psychological, and medical contexts . Each briefing has a limit of 1000 words and includes references and one or two visual objects (e.g., research data, brain images, or other illustrations). The evaluation of the brain briefing is based upon how well students identify and explain the connections between the research outcomes with the potential applications . Examples of brain briefings produced in the most recent class include an eye toward the future: sight restoration through neuroengineering and visual prosthesis, neuromarketing, transcranial direct current stimulation: shocking new therapeutic possibilities, and the neural truth: religion as an anesthetic . Case studies are a type of non - experimental research methodology that typically investigate one individual in depth or over time . Recently, case studies have also been used effectively in neuroscience pedagogy (meil, 2007) and are frequently included in textbooks and in popular books written by neuroscientists or neurologists (e.g., oliver sacks). This assignment is a major and culminating project for the course and the overall learning goal is to develop a deep understanding of the neurological condition that is presented in the case study through the evaluation and synthesis of contemporary neuroscience research . Students choose a case study after examining the strange brains and case studies internet resource compiled by william meil and jeremy skipper, http://lablab.hamilton.edu/lab-teaching/strange-brains-and-case-studies, or other resources noted by the instructor (e.g., ramachandran, 2004; bogousslavsky and boller, 2005; sacks, 2007, 2010). The 12-page written report for this project has three parts: 1) case description, 2) literature review, and 3) research proposal (cf . Meil, 2007). In part one, students are asked to describe the most salient aspects of the case . For example, who was the person and what happened to them? How did their condition influence their life? Why did you choose this case in order to deepen your study of neuroscience? In part two, the literature review should include articles that help to answer questions such as what are the typical symptoms and what are the neurobiological or neuropsychological basis of the condition? How is the condition treated and what is the treatment prognosis? In this section the students are asked to evaluate and synthesize the results of at least eight empirical articles and to discuss how the literature review is relevant to course topics and readings . In the final section of the paper, students identify at least one unanswered question about the condition described in the case (causes, symptoms, or treatment) and then propose an experiment to address this question . The research proposal includes rationale, hypotheses, participants, materials and apparatus, procedures, and statistical analyses . Finally, students are also asked to describe the potential significance of the proposed research for the field of neuroscience . The final three class meetings of the semester are devoted to oral presentations of the case studies . Each presentation is 12 minutes in length and can include powerpoint slides . In the presentation, students describe the very most salient aspects of the case in terms of the underlying neurological issue . They also explain their decision to choose the case and how the case is important for the study of neuroscience . Students briefly present the key research goals, methods, results, and conclusions from only two of the research articles selected from the literature review . The students also explain why or how these two articles have relevance to an understanding of the case study . Finally, each student describes how the case study project has enhanced their study of neuroscience and the neuroscience topics that have been examined in the course . The topics of the case studies chosen by students have included creutzfeld - jakob disease, capgras syndrome, post - traumatic stress disorder, autism, tourette s syndrome, amnesia, epilepsy, dissociative identity disorder, charles bonnet syndrome, and auditory and visual hallucinations . The dissemination of neuroscience research to scientists, educators, professionals, and the general public has increased through the availability of internet sites . In particular, the range and complexity of neuroscience research introduces unique challenges for the presentation of informative and useful research summaries to an informed lay audience . Thus, the goal of this activity is to provide students with an opportunity to read a primary research article in a neuroscience journal and then to prepare and deliver an oral presentation about that research article to classmates in a session that is known as neuroscience in the news . Each student selects a research article from any field of neuroscience published in the past three years based upon his or her personal interests . Then they prepare a 5-minute presentation that will model the format of a news release and that will be similar in content and style to the neuroscience news reports on the webpage of the british neuroscience association (bna; http://www.bna.org.uk/news/). In the presentation, the students objectives are to explain why they selected the particular research article; describe the most significant theoretical issues, methods, and results; summarize the most meaningful conclusions including the importance or relevance of the research and/or its applications; and identify how the research contributed to an enhancement of personal knowledge and interests in neuroscience . It is stressed to the students that their neuroscience in the news presentation should be understandable to an informed lay audience as much as to neuroscientists . Students can augment their oral presentation with a small number of powerpoint slides or video clips in order to show results, equipment, or other pertinent information . Some of the recent neuroscience in the news presentations include does sleep deprivation put you in a better mood?, exercise training increases the size of the hippocampus and improves your memory, videogames and cognitive training in the elderly, brain - machine - brain interfaces: a new way to connect to the world, brain imaging: visualizing the developing and maturing brain, and therapeutic potential of omega-3 pufas for peripheral nerve injuries . Following each presentation, there is a short period of questions and discussion among the students . Many of our neuroscience students have educational and career goals involving the application of basic neuroscience research to medical, clinical, educational, or other professional settings . Therefore, in this assignment, pairs of students work together to develop a brain briefing, a written document that explains how basic neuroscience research has relevance to a general audience of policy makers in clinical, health, educational, or other fields and professions (e.g., sports, law, economics, and robotics). The model for this assignment is the brain briefings newsletter published online by the society for neuroscience (sfn) (lom, 2005) and more recently posted at the website, brainfacts.org (http://www.brainfacts.org/), a public information initiative of the kavli foundation, the gatsby charitable foundation, and the sfn . Students first review several brain briefings on the website in order to get a grasp of the content, format, and style of these papers . Then, each pair of students identify a particular area of application (e.g., medical treatments for alzheimer s disease) that can be informed by neuroscience and conduct an online search to find four to six relevant research articles . The students brain briefing report is not meant to be a research abstract; rather, their goal is to follow the format of the sfn brain briefings and provide information on recent neuroscience research that has exciting and valuable applications to neurological, psychological, and medical contexts . Each briefing has a limit of 1000 words and includes references and one or two visual objects (e.g., research data, brain images, or other illustrations). The evaluation of the brain briefing is based upon how well students identify and explain the connections between the research outcomes with the potential applications . Examples of brain briefings produced in the most recent class include an eye toward the future: sight restoration through neuroengineering and visual prosthesis, alzheimer s dementia, sleep and your emotions, neuromarketing, transcranial direct current stimulation: shocking new therapeutic possibilities, and the neural truth: religion as an anesthetic . Case studies are a type of non - experimental research methodology that typically investigate one individual in depth or over time . Recently, case studies have also been used effectively in neuroscience pedagogy (meil, 2007) and are frequently included in textbooks and in popular books written by neuroscientists or neurologists (e.g., oliver sacks). This assignment is a major and culminating project for the course and the overall learning goal is to develop a deep understanding of the neurological condition that is presented in the case study through the evaluation and synthesis of contemporary neuroscience research . Students choose a case study after examining the strange brains and case studies internet resource compiled by william meil and jeremy skipper, http://lablab.hamilton.edu/lab-teaching/strange-brains-and-case-studies, or other resources noted by the instructor (e.g., ramachandran, 2004; bogousslavsky and boller, 2005; sacks, 2007, 2010). The 12-page written report for this project has three parts: 1) case description, 2) literature review, and 3) research proposal (cf . Meil, 2007). In part one, students are asked to describe the most salient aspects of the case . For example, who was the person and what happened to them? How did their condition influence their life? Why did you choose this case in order to deepen your study of neuroscience? In part two, the literature review should include articles that help to answer questions such as what are the typical symptoms and what are the neurobiological or neuropsychological basis of the condition? How is the condition treated and what is the treatment prognosis? In this section the students are asked to evaluate and synthesize the results of at least eight empirical articles and to discuss how the literature review is relevant to course topics and readings . In the final section of the paper, students identify at least one unanswered question about the condition described in the case (causes, symptoms, or treatment) and then propose an experiment to address this question . The research proposal includes rationale, hypotheses, participants, materials and apparatus, procedures, and statistical analyses . Finally, students are also asked to describe the potential significance of the proposed research for the field of neuroscience . The final three class meetings of the semester are devoted to oral presentations of the case studies . Each presentation is 12 minutes in length and can include powerpoint slides . In the presentation, students describe the very most salient aspects of the case in terms of the underlying neurological issue . They also explain their decision to choose the case and how the case is important for the study of neuroscience . Students briefly present the key research goals, methods, results, and conclusions from only two of the research articles selected from the literature review . The students also explain why or how these two articles have relevance to an understanding of the case study . Finally, each student describes how the case study project has enhanced their study of neuroscience and the neuroscience topics that have been examined in the course . The topics of the case studies chosen by students have included creutzfeld - jakob disease, capgras syndrome, post - traumatic stress disorder, autism, tourette s syndrome, amnesia, epilepsy, dissociative identity disorder, charles bonnet syndrome, and auditory and visual hallucinations . Students are strongly encouraged to provide written feedback and rating scale responses for the course as part of the end - of - semester course evaluation program in place at denison . Recent efforts on our campus have resulted in increased student participation in the course evaluation process by carving out class time during the last week of classes for this purpose . In neur 400, participation rates for course evaluations are high, typically at 93% or better . Students have evaluated the course quite favorably . In the past few offerings, the majority of students numeric ratings consisted of very good to excellent evaluations on items such as the course is challenging, their interest in neuroscience increased, their knowledge of the subject increased, and that faculty were clear, well - prepared, provided useful feedback, and were effective in their teaching . For example, one student commented that if i could i would take (the class) over again there has not been a single week that i did not learn something completely new . The depth of the material was something that i had not been exposed to previously; this gave me an extreme increase in knowledge of the subject matter . We were particularly interested in student feedback regarding the team taught nature of the course, as this is something that the majority of undergraduate students have little or no experience with . Generally, this was viewed as a positive aspect of the course . As one student noted, i like the variety of instructors and the variety of topics covered; while another wrote the use of professors from different backgrounds presenting their primary focus of work and research to us was excellent, while still another student commented i really liked the idea of having different faculty come in to teach on a subject that was an area of expertise for them . We had a wonderful group of faculty who were really passionate about what they were teaching . Finally, one student stated emphatically, the best part about this course has been the exposure to different professors through the rotation schedule . Some students, however, found that having multiple instructors for the course was confusing and challenging, as noted by the following student comment, sometimes the switching of instructors can feel a little sporadic . The class felt scattered because we jumped from one topic to another so quickly . Denison s required course evaluation form only contains a short list of course and instructor questions . In the future, we plan on administering an additional evaluation form in order to obtain information from specific open - ended questions about course content, organization, learning activities, and team - teaching . An integrative capstone course in neuroscience can provide a valuable culminating experience for students of the discipline (wiertelak and ramirez, 2008). We feel satisfied that our course challenges students to think about some of the larger contemporary issues and questions in neuroscience, to read and digest primary literature in the field, and to engage in multiple learning opportunities that enable integration of concepts and ideas acquired in previous courses . However, we do recognize that there are important challenges that our neuroscience faculty continue to discuss regarding ways to improve the course as our neuroscience program evolves . First and foremost, as a highly interdisciplinary field, neuroscience requires collaboration from individuals across departments . We feel that a successful team - taught capstone course in neuroscience, therefore, depends on faculty who are committed to an interdisciplinary neuroscience program, and who are willing to commit several hours out of their already busy schedules to the preparation that is necessary in order to meet with the class over two or three sessions with no monetary compensation or teaching credit provided . We have been quite fortunate over the years to have colleagues from across disciples eager to engage with our students in the capstone course . Most recently, eight faculty participated and represented the departments of biology, chemistry, computer science, philosophy, and psychology . In addition, guest lecturers from denison s library and ohio state university also presented research . Of course, when faculty are on leave or unable to participate for other reasons, the course content must be changed or modified in order to accommodate this change, or other faculty representing the same or some different area must be asked to participate in the course . Also, it is our hope to have more faculty from other disciplines including the social sciences, humanities, and the arts participate in neur 400 in future semesters in order to highlight the importance of neuroscience in the interdisciplinary focus of a liberal arts college (ramirez, 2007). In addition to the importance of a core group of interested and willing faculty, the instructor of record also has a critical role in the success of such a course . S / he presents three to four lectures on neuroscience research and throughout the semester must keep the class on track, provide linkages and continuity between topics and speakers and bridge the topics coherently, particularly when faculty speakers change . The instructor also is responsible for developing all of the learning activities and assignments described in this paper . However, our neuroscience faculty have contributed ideas and support for these assignments which share a focus on integration and application of neuroscience research . These learning objectives address the goals of a capstone course within the structure of our neuroscience curriculum but we recognize that there are other learning goals and assignments that could be present in a capstone course . The course instructor also is solely responsible for grading all of the assignments, exams, and student participation . Therefore, the instructor does have a challenge in ensuring that students will develop their integrative knowledge of neuroscience from the ongoing flow of topics, presenters, and learning activities that occur during the semester . Student comments regarding course flow reinforce the importance of this role, and we continue to work on this in our discussions of our curriculum, particularly when the instructor of record changes between departments . Another important consideration in planning for a neuroscience capstone course is that enrolled students should be near the end of their college career, preferably seniors or second - semester juniors . This is essential for the types of class discussions and thoughtful conversations that add to the success of such a course . The course as we design it assumes that students have mastered the basics of neuroscience and have completed adequate coursework that enables them to think critically, ask probing questions and offer meaningful comments in the classroom . For this to be the case, neuroscience curricula must be carefully structured around common core courses as well as prerequisite courses necessary for subsequent electives . Finally, the success of an interdisciplinary and team - taught course depends, in part, upon multiple levels of support . There must be support from faculty across disciplines as we have already discussed, but also support from multiple departments and the administration . Because the instructor of record earns one teaching credit for designing and coordinating neur 400, this may very well put some strain on the home department of the instructor in terms of course offerings, enrollments, etc . Having one of his / her courses a neuroscience course means that one fewer course in the home department (psychology, biology, for example) can be taught during that semester . Clearly, then, it is imperative that there be departmental support for the program, transparency in what the commitment to neur courses will be, how frequently they will be taught (every year? Every other year? ), and how many members of the department will be contributing regularly to the neuroscience courses and other activities associated with the concentration . On our campus, we had several departmental (primarily within the psychology and biology departments) discussions as the neuroscience program was in its early stages, and we continue to discuss particular aspects of the neur concentration and courses in departmental staff meetings as necessary; in addition, neuroscience faculty meet regularly to plan future neur course offerings, discuss staffing issues, enrollments, and consider other important agenda items relevant to our neuroscience program . Because our concentration and the capstone course require the involvement of multiple faculty representing multiple departments, it also is essential to have the support of a campus administration that encourages and rewards interdisciplinary efforts from faculty (flint and dorr, 2010). Careful planning and communication with colleagues both within and across departments --- are key when creating an integrative and team - taught course for students of neuroscience.
|
Despite recent developments in adhesive dentistry to reduce the number of working steps and to simplify the clinical procedure, bonding to dentin and complete sealing of the exposed dentinal surfaces remained problematic.1 the new simplified adhesives do not produce better results in in vitro tests2 or improve clinical efficacy.3 different modifications to the application protocols of these simplified etchandrinse adhesives have been reported . They include application of multiple layers,45 enhanced solvent evaporation,6 and prolonged curing time.7 all dentin adhesives are currently applied mechanically to tooth structures using either disposable sponges or brushes . An adhesive application protocol, based on the use of an electric signal to enhance monomer infiltration in dentin has been introduced . This technique utilizes an electric field to enhance resin infiltration into the demineralized collagen matrices of acidetched dentin.8 bonding to dentin and complete sealing of the exposed dentinal surfaces is troublesome because of highly hydrated and complex nature of the tissue . Dentin tubules constitute 20% to 39% of dentin, and the fluid within them represents 22% of dentin volume.9 the fact is easily overlooked in the design of most in vitro studies in which the effect of pulp pressure on the bonding interface is not considered . This study investigated the effects of an electric field produced by an experimental device for the application of a twostep etchandrinse adhesive on moist dentin surface . In order to simulate real conditions, the null hypothesis was defined as follows: there is no difference in the microleakage between a conventional mechanical adhesive application technique and the use of an electric impulse assisted adhesive application technique under simulated pulpal pressure condition . The teeth were cleaned thoroughly to remove both hard and soft deposits and were kept in distilled water at 4c for 24 hours . Class v cavities were prepared, with the gingival margin 1 mm below the cej, using a #4 round bur (brasseler, savannah, ga, usa) with a high speed handpiece and copious amounts of water . The preparations were standardized at 4 mm long, 3 mm wide and 2 mm depth and placed in the facial surfaces of each tooth . Pulp tissue was removed by means of endodontic kfiles (#20) taking care to avoid touching the pulp chamber walls . The pulp chambers were then irrigated with 2.5% sodium hypochlorite solution (naocl) for 30 s followed by immersion in distilled water for 30 min to neutralize the effects of naocl . All crown segments were luted with cyanoacrylate (zapit, dva, anaheim, ca, usa) to a plexiglass plate through which an 18gauge stainless steel tube had been inserted . This tube permitted communication with the pulp chamber and was attached to an empty 20 ml plastic syringe barrel which had 10 cm height . The barrel was filled with distilled water and raised 25 cm from the tooth level in order to produce a pressure of 35 cm h2o at the dentine surface to be bonded (figure 1). Schematic presentation showing how crown segments were created, attached to plexiglass and how fluid permeability was measured under 35 cm h2o pressure each prepared tooth was then etched with phosphoric acid (ultraetch 35%, ultradent, south jordan, ut, usa) for 15 seconds, rinsed for 20 seconds, and then gently blown to remove excess water, being careful to maintain a moist surface . I, the adhesive (single bond, 3 m espe, st paul, mn, usa) was applied using the experimental electric device (multifrequency current source, iran) which created an electric potential difference between the dentin substrate and the adhesive applicator tip . The device induced an electric flow over 15 a throughout the adhesive interface during the application procedure . In group ii, the adhesive was applied in the same manner, but the electric generator switched off . A single blind study design was used, in which the operator performing the bonding procedure was not aware of the operating state of the electrical device (i.e., switchedon mode or switched - off mode). Mw / cm using a quartztungstenhalogen light (coltolux 50, coltene / whaledent inc, cuyahoga falls, oh, usa). Prior to this stage, the curing light was tested with a curing radiometer (coltene / whaledent inc, cuyahoga falls oh, usa) and the output intensity was maintained at 600 mw / cm throughout the restorative procedures . One increment of microhybrid resin composite (valux plus a2, 3 m espe, st paul, mn, usa) was placed over the bonded dentin surface and polymerized for 40 seconds . The restorations were wet finished using soflex disks (3 m espe, st paul, mn, usa). The teeth were stored in distilled water for 24 hours at 37c before thermocycling which comprised 1000 cycles (20 seconds in a 55c water bath, followed by 20 seconds in a 5c water bath, with a dwell time of 5 seconds). An acidresistant varnish (nail polish) was applied to all surfaces of the teeth except for 1 mm adjacent to the restoration margins . All specimens were then immersed in 0.2% basic fuschin for 24 hours at 37c and washed in running water . The teeth were embedded in epoxy resin blocks then sectioned buccolingually through the center of the restoration with a diamond disk (kg sorensen ind com ltd, so paulo, brazil) at low speed . Dye penetration at the gingival margin was examined using a stereomicroscope at 40x and scored according to the following criteria: 0 = no dye penetration, 1 = dye penetration that extended up to 0 of the preparation depth, 2 = dye penetration greater than and up to of the preparation depth, 3 = dye penetration extending to the axial wall and 4 = dye penetration past the axial wall (figure 2). Table 1 shows microleakage scores for the two groups . When comparing the two groups, mann - whitney u test showed significantly less dye penetration in group 1 in which bonding agent was applied to dentin by the electric - current - assisted application technique(p = 0.047) frequency of microleakage scores the results of this study led to rejection of the null hypothesis (there is no difference in the microleakage between a conventional mechanical adhesive application technique and the use of an electric impulse assisted adhesive application technique under simulated pulpal pressure condition). According to results, using electric current for applying the etchandrinse adhesive (single bond) had a significant effect on reducing microleakage compared to the conventional application technique . In vitro studies examining the microleakage are useful but most are not done under in vivo conditions; that is, the teeth are nonvital and are not subjected to pulpal pressure . In the present study, the entire evaluation was carried out under simulated pulpal pressure and the teeth were submitted to thermocycling to obtain a condition as similar as possible to the in vivo conditions . Interpretations of the better microleakage results that accompanied the use of an assisted electric field may be explained with different hypotheses . Since single bond contains hema, acrylic acid copolymer and itaconic acid which are polar components, it is speculated that this adhesive may interact with the electric field generated by the electric device used in this study . Polyalkenoic acid polymers contain ionizable carboxylic acid groups with following formula: thus, iontophoresis may enhance the movement of ions across dentin.10 this should be related to a faster rate of impregnation as ionic monomers are moving across the dentin with increasing ion mobilities that are caused by the imposed electrical gradient.11 furthermore, because they are charged particles, these monomers are physically attracted by the electric field, thus increase the flow which is revealed by the reduced microleakage when applying the bonding agent with electric device . The difference in electric potential between the adhesive and etched dentin could enhance the penetration of adhesive monomers due to a biophysical modification of the organic matrix, or could enhance the wettability of the etched dentin surface, thereby improve the spreading of the adhesive . Electronic root apex locators,12 pulp vitality tester,13 and early caries lesion detectors14 are some of such devices . Since dentin is not a pure capacitor or resistor, the flow of electricity depends on the relative humidity of the environment.15 etching of the surface and subsequent exposure of the organic matrix in a wet environment increase the electric flow by reducing the resistance.16 furthermore, in our study the use of simulated pulpal pressure condition increased the fluid flow toward the bonding interface . Thus, to ensure consistency of results, we subjected all teeth to the same electrical experimental conditions, regardless of the tooth dimensions . The experimental electric device was adjusted to electrical values that are compatible with in vivo use.1315 it is worth mentioning that the intrinsic wetness of dentin and the perfusion of fluid from the pulp chamber should be considered when bonding to deep dentin . The density of waterfilled dentin tubules and hence intrinsic water content of dentin increases with dentin depth17 and these factors may increase the microleakage and affect the longevity of the restoration . Outward fluid flow from dentinal tubules in the mouth might contribute to a more rapid degradation of resindentin bonds in vivo.1819 in conclusion, this study represents an attempt in reducing microleakage that was associated with the use of an electric impulse assisted application technique for the bonding of a etchandrinse adhesive to acid etched dentin . The use of simulated pulpal pressure was a further step towards simulation of in vivo condition . The results of this in vitro study which was performed under simulated pulpal pressure showed that using electric current for applying the etchandrinse adhesive system (single bond) have a significant effect on reducing microleakage . Further in vivo studies should be carried out to confirm that an electric device is effective in improving the longevity of resindentin bonds through reducing the microleakage in vivo.
|
Although the efficacy and effectiveness, as well as the cost - effectiveness, of screening and brief alcohol interventions (sbi) have been shown to be strong, the implementation of sbi into routine care practice has not been satisfactory; it seems to be difficult to motivate health care professionals to deliver sbi [16]. Many implementation projects have tried to overcome known barriers such as lack of time, resources, training, and negative attitudes to working with sbi with limited success [4, 5, 79]. In a survey in the united kingdom comparing role security and therapeutic commitment between 1999 and 2009 among general practitioners (gps), it was seen that the main issue was lack of therapeutic commitment . The study also highlighted that lack of time and resources rather than negative attitudes was related to the lack of therapeutic commitment to sbi . Implementation of new methods has repeatedly been shown to need more than simple training sessions to be effective [4, 10]. Implementation research suggests that a multifaceted strategy addressing several barriers may be more effective than simple training sessions . In addition, implementation efforts involving more professionals than gps can improve how professionals work together towards increased sbi activities [4, 10, 11]. In a recent study from five european countries involving 120 primary care units, no evidence that sbi rates were influenced by role security or therapeutic commitment was found . Other factors, not specifically studied, such as clinical priorities and management support might be more important for implementation . This study underlines a review by nilsen et al ., which concluded that motivation to engage in sbi should be viewed as a dynamic process encompassing the characteristics of the individual health professional, the patients, the clinical setting, and the wider context . Thus, there is a knowledge gap on how to engage primary care staff in brief alcohol advice . How do we overcome the perceived lack of knowledge and reluctance to ask patients about their alcohol habits? Tentative answers might be found by giving office - based support material and management support rather than trying to change already positive attitudes among staff [4, 10]. How staff's performance changes over time if these preconditions are offered has not been sufficiently studied . Most previous researches have measured role security and therapeutic commitment at one point in time or just after a training session using standardized questionnaires [5, 10, 12]. The few studies that have measured role security and therapeutic commitment before and after an educational session do not provide information about how a change in engagement is accomplished or mediated [8, 14]. Thus, there is a lack of qualitative studies following staff practices over time in implementation projects aiming to establish new routines . The aim of this study was to explore how the perceptions and experiences of working with risky drinkers change over time among primary health care staff during a systematic implementation project . The study was part of the swedish implementation study spira (secondary prevention implementation research on alcohol) that aimed to study the implementation process of different sbi methods at primary health care centres (phcs) in sweden . This study was approved by the regional ethical review board in gothenburg, sweden (405 - 10/2010). The spira study was conducted during 20102012 in 16 phcs from three different regions in sweden . In brief, the spira study started with a baseline measurement of sbi rates over 2 days . After the baseline period, a 3-hour training session on how to perform sbi was given to all staff . It was then followed by the first implementation period of 4 weeks during which staff were asked to routinely offer sbi to their patients . Six months after the first implementation period, a booster education session of 1 - 2 hours was given followed by a second 4-week sbi implementation period . A significant increase in sbi rates was seen during the implementation periods, results reported elsewhere . As part of the study, qualitative data were collected during a series of focus group interviews with staff at baseline and 6 months after the second implementation period . For some participating units, a total of 30 focus group interviews were included in this study; 16 were conducted at baseline and 14 at follow - up . Two of the phcs did not participate in the follow - up because they were recruited too late, which explains why there are fewer interviews for the follow - up . The phcs included in the spira study were located in three counties, selected to ensure representation from various parts of sweden and to include both rural and urban areas . All phcs in these counties were invited to participate in the study . Because we did not reach the intended number of phcs with this procedure, we proceeded with snowball sampling using our research networks . We aimed to explore how the perceptions and experiences of working with risky drinkers change over time among primary health care staff during a systematic implementation project; therefore some of the staff were allowed to refrain from participating in the implementation . All staff who had actively participated in the implementation process were invited to participate in the focus group interviews . The individuals who volunteered to participate were then given more information about the aim and content of the study . Reasons for not participating included sick leave, vacation, terminated employment, lack of time, or other commitments at the phc . Our aim was to have the exact same participating staff at all different measurement points but that was not possible because all staff were not available at the time of the interviews due to the reasons stated above . The focus groups consisted of a mix of professionals working at the phc and included physicians, registered nurses, nurse assistants, social workers, psychologists, physiotherapists, and others (social manager, health educator, rehab coordinator, midwife, secretary, behaviourist, head of unit, dietician, secretary, and unknown); the details are presented in tables 1 and 2 . Two of the interviews were conducted as individual interviews because the work situation did not allow more than one person to participate at a time . The guide focused on themes including the staff's experiences with working with risky drinkers and sbi . At the follow - up, themes regarding how their experiences with working with risky drinkers and sbi had changed during the implementation period were added . The interviews took place in a separate room at each of the phcs where the participants worked except for the two individual interviews, which were performed by phone . Participation was voluntary and the participants were informed that they could abandon participation at any time . The participants were informed about the purpose of the interview and they were encouraged to discuss freely around the themes and to bring their perspectives into the open . The interviews lasted for 2330 minutes at baseline and 619 minutes at follow - up . The data were inductively analysed using content analysis, meaning that coding and categorization of data were done in a structured way, gradually deriving the categories from the data in an explorative and descriptive way [17, 18]. The analysis was conducted in several steps with the aim of identifying the experiences of the staff regarding working with risky drinkers and especially how these changed during the implementation process . Initially, the first author listened to all recordings and ensured that the transcripts were accurate . Then all texts were read through several times by the first author to provide a sense of the whole . A qualitative analysis software program, nvivo 10, was used to facilitate the analysis . The first step was performed using open coding by reading the texts line by line to identify meaning units, which were labelled with preliminary codes . The coded meaning units were then combined into preliminary categories based on similarity of content . This first analysis was mainly performed by the first author but continuously discussed with coauthor fredrik spak to prevent researcher bias and strengthen the internal validity . Disagreements were discussed until consensus was reached . In the second analysis step, the purpose and the specific aim of this study were taken into deeper consideration and the analysis process continued with identification of meaning units responding to the aim . The meaning units were then labelled with codes and the codes were compared regarding similarities and differences and then categorized based on similarity of content to build categories . In the third analysis step, the categories were discussed and then sorted and abstracted into main categories and subcategories that captured the main content of the data with regard to the aim of the study . This deeper analysis of the content was mainly performed by the first author but continuously supervised and discussed with coauthor ulrika mssener . The coding and interpretative levels of the categories quotations were identified to illustrate the categorization and translated from swedish . In the results, / / in a quotation shows that text has been omitted or means a pause or a short silence . The analysis of the interviews before and after the implementation phases revealed two main categories: (1) awareness of shortcomings, reflecting thoughts before the implementation phases, and (2) change in practice as expressed by the participants after participating in the study (table 3). Thus, the analysis displayed a pattern of change during the implementation period with regard to awareness, knowledge, and confidence that led to a change in practice . Before the implementation, the participants reported a lack of resources and engagement in working with alcohol and sbi . Before the implementation period, the participants reported a lack of engagement regarding working with alcohol - related questions . A majority of the participants expressed that they did not work as much with screening and brief interventions as they thought was needed and that they were motivated to do more sbi work but lacked the tools to do so . They also expressed that they lacked knowledge regarding both alcohol and risky drinking and how to advise risky drinkers . This was creating a lack of confidence and insecurity in asking about alcohol, not least because this was regarded as a sensitive issue . Most of the participants seemed to have an awareness of their lack of appropriate engagement despite their positive attitudes.i am too bad at asking questions about alcohol actually . But i don't do it.i believe health care has an obligation to ask questions about how life styles interfere with health . It should not be strange that health care brings it up; it has to be natural . To not do it is almost misconduct.despite awareness of lack of engagement staff expressed a positive attitude towards implementing sbi . This seemed to be grounded in the belief that the staff actually could facilitate change in patients' alcohol habits . It was also evident that the staff believed that alcohol problems could be the underlying cause of many of the symptoms that patients present at the phcs and that, through active work on alcohol, they might identify that cause and be able to help patients to a greater extent.but it is good in order to identify what is the actual problem with the patient, because it can be alcohol that lies behind a lot of what the patients seek care for . I believe health care has an obligation to ask questions about how life styles interfere with health . It should not be strange that health care brings it up; it has to be natural . But it is good in order to identify what is the actual problem with the patient, because it can be alcohol that lies behind a lot of what the patients seek care for . There was a wish for alcohol work to be more visible for both patients and staff in order to facilitate the work . The participants thought that if there was advertising material around the phcs, both staff and patients would remember and embrace the alcohol work to a greater extent . The participants could identify several situations where more systematic alcohol work could be performed and which they regarded as underutilized at the moment . Some participants also expressed motivation to learn more and work more with alcohol prevention and expressed that the implementation efforts that were planned were much needed and perceived that they would be very useful.i feel that this is very useful . Lack of knowledge regarding several important issues for alcohol preventive work was expressed among the interviewees . Almost all participants described that they were aware of their shortcomings in responding to risky drinkers and requested more training as planned in the implementation project.for some of us it would facilitate with more education in order to understand the limits for risky drinking.it would facilitate us a lot if we knew where to refer patients for additional help when we are insufficient / / and at the same time know what to do by yourself . How far should you go in trying to talk to people before you try to get help elsewhere?lack of knowledge on how to encounter risky drinkers was emphasized and it was revealed that this shortcoming had led to avoidance to ask about alcohol.the times i might have avoided asking is because i don't know how to deal with the answer . I simply don't have the knowledge.it can be quite hard if you ask and you get an answer . I think that is hard.the interviewees believed that the alcohol preventive work would be more efficient if they had more knowledge because patients tend to listen more if they perceive that the person is knowledgeable and confident in discussing the issue.i think that the patient understands if you have the right knowledge; they listen more to you . You can explain and talk about it in such a way, with such a tone, that they will take it in a better way and understand . For some of us it would facilitate with more education in order to understand the limits for risky drinking . It would facilitate us a lot if we knew where to refer patients for additional help when we are insufficient / how far should you go in trying to talk to people before you try to get help elsewhere? The times i might have avoided asking is because i don't know how to deal with the answer . I think that the patient understands if you have the right knowledge; they listen more to you . You can explain and talk about it in such a way, with such a tone, that they will take it in a better way and understand . Before the implementation period, most of the participants felt insecure asking about alcohol and intervening with risky drinkers, and this insecurity meant that patients were not being asked about their alcohol habits . One of the factors that contributed to the feelings of insecurity seemed to be the fact that alcohol was regarded as a sensitive issue and that the staff were afraid of offending patients . Some of the interviewees described how they sometimes came up with excuses to not ask about alcohol and that the alcohol questions were easy to forget.if you ask the question in the wrong manner, or in a way that the patients experience as offending // the relationship can be affected.but some staff had a different view and expressed that they were confident in asking about alcohol and had never felt that the patients were offended.that it is a sign of us caring . I rather think that more patients are dissatisfied because they are not asked.among those who expressed concern about offending patients, some solutions were proposed . They highlighted the importance of patients not feeling singled out and questions about alcohol should be brought up in a natural way or in a natural context . It was suggested that if more patients were asked about alcohol, the issue would become more natural and less sensitive to both the patient and the staff, and the patients would feel less singled out.it might be better accepted among the patients if they know that everyone is asked the question, so you they don't feel so singled out and that it is something that we always do . If you ask the question in the wrong manner, or in a way that the patients experience as offending // the relationship can be affected . That it is a sign of us caring . It might be better accepted among the patients if they know that everyone is asked the question, so you they don't feel so singled out and that it is something that we always do . After the implementation period, a majority of the participants expressed that their level of knowledge and their confidence in working with sbi had changed . The participants perceived that they asked more patients about their alcohol habits after the implementation of the project . It was also seen that the phcs had integrated sbi into routine practice and that the staff asked special patients group more systematically about alcohol . The participants appeared to have been given some of the tools to perform sbi work that they lacked at the baseline . They were also more aware about alcohol both at an individual level and at a phc level and discussed alcohol more among their colleagues . In general, the participants were positive about continuing to work with alcohol prevention . At the follow - up, many of the participants perceived that the sbi activities at their phcs had increased . They were convinced that, in general, they asked more patients about alcohol habits after the implementation and had integrated alcohol preventive measures into the daily routines to a greater extent . For example, at some phcs, the staff have started to systematically ask patients with certain diagnoses; others screened and intervened for alcohol problems systematically at certain visits such as annual health check-ups.yes, of course you ask more frequently, more often, i do that.in fact, i never asked my patients this question before we entered this project, and now it is at every annually check-up.some participants stated that they had started with new tools and approaches, such as health questionnaires or health consultations that included questions about alcohol . Increased systematic work was also evident from more notes about alcohol habits in the medical records.you can see a lot more notes in the medical records about the patients' alcohol habits.not only did sbi activities increase during the implementation, but also the participants expressed that they experienced greater general awareness about alcohol and risky drinking at the phcs and discussed the issue to a greater extent among colleagues at the phcs after the implementation.we talk about alcohol more in general now . Before nobody talked about it . Yes, of course you ask more frequently, more often, i do that . In fact, i never asked my patients this question before we entered this project, and now it is at every annually check - up . You can see a lot more notes in the medical records about the patients' alcohol habits . The greater awareness of alcohol and establishment of new routines seem to have been mediated by increased knowledge and skills about alcohol prevention . Also, the participants knew more about their own limitations and when and where to refer patients if needed.one thing that is important to know is what to do with patients who have a risky dinking behaviour or misuse . I think we have talked a lot about that here at the phc so it feels like you know what to with the patient.they also experienced increased knowledge about alcohol and risky drinking and felt that they knew how to respond to risky drinkers to a greater extent.there has been the issue of not knowing what to answer when you get a question back . Now you know a little bit more about where the patient can turn for help and what you can do . Maybe you can't do so much more than say cut down your intake to half but you know what advice you can give . One thing that is important to know is what to do with patients who have a risky dinking behaviour or misuse . I think we have talked a lot about that here at the phc so it feels like you know what to with the patient . There has been the issue of not knowing what to answer when you get a question back . Now you know a little bit more about where the patient can turn for help and what you can do . Maybe you can't do so much more than say cut down your intake to half but you know what advice you can give . At the follow - up interviews, it was highlighted by most of the participants that they experienced more confidence in screening and intervening for risky drinking . They expressed that it had become easier to ask patients about their alcohol habits; they dared to ask to a greater extent after the implementation and were more confident about intervening for risky drinking.yes, i believe it feels more secure to ask patients, to bring it up with the patients . Sometimes you can feel that it is sensitive, snooping into their life when it comes to alcohol . Yes, i believe it feels more secure to ask patients, to bring it up with the patients . Sometimes you can feel that it is sensitive, snooping into their life when it comes to alcohol . After the implementation, the participants also expressed that they were more comfortable in persisting with the alcohol issue and that they did not drop the subject if they met resistance from the patient, which implies greater confidence in their own ability to intervene with risky drinkers.but i am not as afraid anymore to continue . Before i could stop when i felt, oh, now i am in deep water . I don't anymore, i feel that i can continue, can coax so to speak . Go around and continue . Because if i back off, i confirm for that patient that this is a sensitive issue; if i continue, i can sometimes also explain that we always ask like this when it comes to alcohol because it can lead to pain in the body or bad sleeping habits or.the factors that seemed to contribute to this were that they did not regard alcohol as a sensitive issue as they did before and that they had more experience and knowledge as well as more tools . Before i could stop when i felt, oh, now i am in deep water . I don't anymore, i feel that i can continue, can coax so to speak . Go around and continue . Because if i back off, i confirm for that patient that this is a sensitive issue; if i continue, i can sometimes also explain that we always ask like this when it comes to alcohol because it can lead to pain in the body or bad sleeping habits or . The fear of offending patients that was expressed at the baseline was not highlighted at all at the follow - up . Many of the participants said that they had never experienced that patients were offended by being asked about alcohol . One reason that the participants felt contributed to alcohol becoming a less sensitive issue was that the patients felt less singled out when more patients were asked about their alcohol habits.and when someone looks a little hesitant or wandering, we say we ask everyone, both men and women, old and young so there is nothing odd about that . And we ask everyone, both men and women, old and young so there is nothing odd about that . Another factor that seemed to contribute to the decreased insecurity in screening and intervening for risky drinking was increased experience . The participants agreed that the more they worked with these issues, the more confidence they got . They expressed that with more experience it was easier, more natural, and less inconvenient to ask about alcohol.it is easier . It gave me experience, practice makes perfect, and if you have done it a couple of times, it becomes more natural to do it . It gave me experience, practice makes perfect, and if you have done it a couple of times, it becomes more natural to do it . The aim of this study was to explore how the primary health care staff's experiences of working with risky drinking changed during an implementation process that included two educational sessions and office - based material support . The project focused on inspiring staff to start offering sbi to patients and consequently getting more and more confident in applying sbi . At the baseline, the staff perceived that they did not work enough with sbi although they were motivated to do more . It appears that by participating in the focus group the staff were also given an additional chance to reflect upon their own attitudes and engagement, which might also have contributed to the results . At the follow - up 12 months later, a number of positive changes could be noted . Now, most staff perceived that sbi activities had clearly increased and a number of barriers such as lack of knowledge and confidence in asking about alcohol had been overcome . From the interviews, it became clear that the project had inspired staff to try using the material provided and they had learned by practicing to a great extent . The lack of knowledge and confidence in bringing up the issue of alcohol was strongly emphasized at the baseline and mentioned as an important reason for not bringing up the issue . The staff also expressed insecurity in how to introduce the issue and how to intervene, as seen previously in most studies [5, 6, 12, 14]. However, this is somewhat surprising since sweden has made a strong national effort over 5 years to educate large sections of primary health care in sbi from 2004 to 2010 at a total cost of 25 million euros . The project was a government initiative addressing primary, child, maternity, and occupational health care . A multifaceted approach with educational courses, workshops, and seminars was applied in order to encourage learning - by - doing . One important lesson learned from this project was the benefit of involving nurses in sbi in contrast to many other countries . It has been repeatedly suggested that nurses are an underutilized resource in alcohol prevention work [4, 11]. Since the phcs in this study were representative of phcs in sweden, in both rural and urban areas, the lack of knowledge and confidence in working with sbi could probably be generalized to large sections of swedish primary health care . So the effect of training postgraduate phc professionals appears to have had limited reach in sweden despite the great national effort . A better way forward might call for more systematic training in alcohol prevention work in medical schools and nursing schools . Based on what happened over time in the group of health care professionals participating in the present study, we identified a number of important changes after training and active use of the office - based material during the implementation phases . The health providers in the study felt that both knowledge and confidence had increased at the follow - up and they stated that they had more confidence in bringing up the issue and giving a response and were able to go into the issue in greater depth . This indicates that the implementation was successful in increasing knowledge and confidence and that that effect lasted longer than the implementation period itself . Involving staff other than gps may explain some of the positive outcomes in the present study . It was also obvious that some of the staff still regard alcohol as a sensitive issue and that this affected their lack of confidence in talking about alcohol and their reluctance to bring up the issue with patients . The fact that staff consider alcohol a sensitive and difficult issue has been shown in previous studies [2022]. This is a challenge that must be faced but as some of the caregivers stated, it might be easier for both staff and patients if more patients were asked routinely because it might decrease the risk of causing offense or feelings of being singled out . The fact that the alcohol issue is sensitive was not emphasized as much at the follow - up as at the baseline, indicating that more knowledge, experience, and confidence in talking about alcohol also reduces the sensitiveness of the issue . Staff had started to establish new routines when to ask patients about their alcohol habits and this also decreased the sensitivity of the subject . Although not measured, most staff stated that more patients were asked about alcohol at the follow - up, indicating success with the frequency of patients being asked, although this was not measured in more exact terms . However, staff expressed decreasing engagement over time; sbi rates increased initially during the implementation phase but they decreased somewhat over time . We studied engagement about 6 months after the last educational sessions and do not know whether the sbi activity will continue to fade out . However, there will probably be a need for repeated booster educational sessions and continuous managerial support . Variability in engagement among staff was noted in the interviews with early adopters and laggers who were more reluctant to adopt a new routine . Some phc centres decided to systematically screen certain groups of patients and were thus starting to integrate sbi into the daily routines, creating a precondition for continuous engagement over time . Another promising observation that might help establish new routines was increased awareness and discussion among the staff about the negative health consequences of alcohol . Among the lessons learned from this study, it is obvious that the previous educational efforts extended to the primary care sector in sweden were not evident . This calls for more effort to integrate alcohol prevention training in medical and nursing schools . Being part of an implementation project with education, new office - based material, and a commitment to try using the new knowledge and tools made them more confident and facilitated a change in practice . The effects of the study seemed to last for at least 6 months after the termination of the study . The positive changes in attitudes and engagement during the study could potentially secure continuous positive development . Also, the decision to specify when to ask patients about their alcohol consumption decreased the sensitivity of asking the question and increased confidence . In summary, the study shows that staff gain knowledge and confidence in working with alcohol screening and brief intervention when participating in an implementation study with an educational approach . In this study, the effects of participation lasted up to 6 months after the termination of the study . This adds new knowledge to the science of implementation studies concerning alcohol prevention measures, which have otherwise shown disappointing results, emphasizing the importance of practicing and learning in daily meetings with patients / clients [4, 5, 79]. In this study a semistructured interview guide was developed and used in order to explore how the perceptions and experiences of working with risky drinkers change over time . We used mainly focus group interviews to gather data because they are an effective method to explore attitudes and needs of professionals and may encourage the participants to share and discuss views, attitudes, and experiences [1618]. In focus group interviews, there is a risk that participants do not feel free to discuss sensitive or personal experiences and perceptions, especially if they know the other participants, as was the case in this study . The focus group interviews facilitated a relaxed discussion and provided a satisfactory framework in that it helped direct the participants toward the issues focusing on them but still allowed the participates to express their answers in their own way . The focus groups included participants from different categories of staff, which may add to the results with more in - depth perceptions and experiences from professionals with different educational and professional backgrounds sharing their different perspectives [16, 17]. We think it is was a benefit that different professionals were included but one must be aware that it may have affected the results because there is a hierarchy among these professionals, even though this was not perceived when listening to and analysing the interviews . The results predominantly showed that the implementation was successful and staff seem to have been learning - by - doing, gaining more confidence and security in offering sbi . But considering the fact that the phcs volunteered to participate, as did the staff at the phcs, this might have led to participants being more positive towards sbi work than occurs in general, thus making successful implementation more likely . As always when conducting qualitative research, voluntary participation may lead to the study sample differing from the broader population . One strength in this study was that the interviews revealed both challenges and shortcomings among the participants as well as positive standpoints, indicating that the staff felt they could speak freely . Our data are based on a relatively small sample and a specific group of professionals, and the results cannot be generalized to other groups . It is a limitation that the authors did not conduct the interviews themselves, that we did not include an observer, and that the moderator of the interviews was not included in the analysis process . This has been addressed by the first author listening to the recorded interviews several times . Several steps have been taken to ensure the validity of the results . In the present analysis two of the authors the meaning units, codes, and categories were discussed by the authors in different combinations and at several points during the process . The coauthors were all senior researchers and well experienced in either qualitative research or the alcohol research field with focus on early identification and intervention with risky drinkers . Some of the results are supported by previous results indicating an acceptable trustworthiness . Staff at phcs in sweden are aware of the negative health consequences of alcohol and perceive that they seldom engage in alcohol screening and brief intervention . However, they appear highly motivated to work more actively, which implies that, with the right tools and incentives, a positive change can be achieved as shown in this study . Staff perceived that lack of knowledge and the sensitivity of the topic contribute to low confidence in working with alcohol issues . Participating in an implementation study where staff agree to perform sbi after a training session appears to have continued the learning - by - doing process . Thus, 6 months after the termination of the project, positive attitudes and perceived engagement were prevailing . The more the patients or patient groups who were routinely offered sbi were, the less the staff perceived the alcohol issue to be sensitive, which increased their confidence in bringing up alcohol, leading to a sense of more knowledge, which also facilitated a change in practice.
|
Under various experimental conditions the onset of atrial fibrillation (af) has been attributed to aberrant electrical impulses originating in the area of the left atrium (la) providing a left to right atrial (ra) gradient for the initiation and perpetuation of reentry circuits . In turn these multiple circuits constitute the electrophysiological substrate for the disorganized and chaotic rhythm in the atrium known as af . Animal models have been developed to study this phenomenon . A seminal report in goats generated a new understanding of an underlying mechanism for af and coined the phrase atrial fibrillation begets atrial fibrillation . After several weeks of pacing induced af it was noted that longer and longer episodes were occurring without pacing until af became continuous . Electrophysiological remodeling, in the form of a consistent shortening of atrial refractoriness provided the substrate for triggers to initiate af . Perpetuation of af has been attributed to the establishment of multiple reentry circuits which became the hallmark of the of the multiple wavelet theory of af . Surgical procedures to treat patients with af by physically interrupting the reentrant circuits are now performed in patients worldwide based on the multiple wavelet concept for af . It is important to note that the investigators of these initial experimental studies also found structural remodeling four weeks after the onset of af in the form of changes such as increased myocyte size, myolysis and marked glycogen accumulation within the atrial myocytes . It is not easy to understand how certain changes in cellular structure, such as glycogen accumulation can play a role in the perpetuation of af . The present study describes the differences in glycogen content and distribution between the right atrial appendage (raa) and left atrial appendage (laa) of five normal goats . We hypothesized that glycogen content and distribution found in the laa would induce an favorable substrate for impulse conduction and thus explain the more frequent af origin in this chamber . Ethical statement: goat tissue samples were obtained at a local federally inspected slaughter house . Permission to harvest these tissues was granted by a public health veterinarian, on site, representing the united states department of agriculture (usda). The tissue samples were separately preserved in 10% buffered formalin (n = 3) and in 95% ethanol n = 2). Fixed tissue samples were routinely processed, paraffin - embedded and sectioned at 4 m . Following sectioning, the tissues were stained separately with either hematoxylin and eosin (h and e) or periodic acid - schiff (pas) stain performed with or without diastase digestion for demonstration of glycogen . Digital images of the pas - stained sections were acquired by olympus dp25 digital photomicroscopy . Five random, color photomicrographs were obtained from all regions of the myocardium (subendocardial, subepicardial and intervening myocardium). The digital images were transferred to nih image j and the total area of the image calculated (m) by setting the scale to scale bar acquired with the image . The color threshold was set to identify only glycogen (magenta stain from pas), which was converted to a black and white image and then set to binary for measurement . The binary image was regularly compared to the original to confirm scope and intensity of glycogen staining . Glycogen was reported as area covered (m) by staining in the binary image, which could then be compared to the total area of the image . A standard two tailed t - test was used to compare equal numbers of the 20 sections, taken from four goats, of the laa and raa samples . Fixed tissue samples were routinely processed, paraffin - embedded and sectioned at 4 m . Following sectioning, the tissues were stained separately with either hematoxylin and eosin (h and e) or periodic acid - schiff (pas) stain performed with or without diastase digestion for demonstration of glycogen . Digital images of the pas - stained sections were acquired by olympus dp25 digital photomicroscopy . Five random, color photomicrographs were obtained from all regions of the myocardium (subendocardial, subepicardial and intervening myocardium). The digital images were transferred to nih image j and the total area of the image calculated (m) by setting the scale to scale bar acquired with the image . The color threshold was set to identify only glycogen (magenta stain from pas), which was converted to a black and white image and then set to binary for measurement . The binary image was regularly compared to the original to confirm scope and intensity of glycogen staining . Glycogen was reported as area covered (m) by staining in the binary image, which could then be compared to the total area of the image . A standard two tailed t - test was used to compare equal numbers of the 20 sections, taken from four goats, of the laa and raa samples . Glycogen could be demonstrated in all laas and raas; however, there was marked variability in the intensity and distribution of glycogen deposition from animal to animal . Glycogen distribution was similar in both formalin - fixed and ethanol - fixed tissue samples . The formalin fixed tissue samples provided for more crisp images for photography and morphometric analysis (because of superiority of formalin for fixation). Glycogen deposition in both raas and laas was most consistently located in the subepicardial and subendocardial myocardium [figures 1 and 2 respectively]. Glycogen was also present in the mid - myocardium; however, this was most conspicuous in laas (only) and in goats with the highest levels of myocardial glycogen . Although the glycogen content was markedly variable from animal to animal, the laas consistently had higher glycogen levels based upon pas staining . Heart, goat . In the raas glycogen deposition delicately highlighted the intercalated discs (arrows). Also glycogen deposition was seen along and just beneath the sarcolemmal membrane (solid arrowhead). Some cells showed little periodic - acid schiff (pas) stain without diastase treatment (open arrowhead). In contrast to the raas, in the laas glycogen often concentrated against intercalated discs (arrows) with dense tails of glycogen extending into the cell along the lateral wall at the myocyte - myocyte junction (solid arrowhead). Bar = 50 m at the cellular level, glycogen in the raas occasionally highlighted the intercalated discs [arrows, figures 1 and 2] and was distributed along and just beneath the sarcolemmal membrane [solid arrowhead, figures 1 and 2]. This was not observed at other myocyte to myocyte connections [figure 1, open arrowhead]. In the laas, the glycogen often concentrated against the intercalated disc [arrows, figure 2], particularly in regions of heavy glycogen accumulation . Furthermore, not only was the glycogen found just beneath the sarcoplasmic membrane, but extended into and occupied the sarcoplasm [figure 2, arrowhead]. In heavily stained regions, morphometric analysis [figure 3] shows that pas stained regions of the laas averaged 2.6 3 m compared to raas, 0.8 1.3 m, p = 0.02 . Laas glycogen levels (per m) always exceeded raas levels in each individual animal . It should be noted that besides the three fold greater prevalence of the mean glycogen concentration in the laa compared to the raa, the larger standard deviation in the laa indicates the greater heterogeneity of glycogen in the laa . Glycogen was quantitated based upon area covered by pas - stained glycogen as a percent of the area of the total image . The pas - stained area of laas (2.6 3.0 m) was significantly greater than raas (0.8 1.3m), p = 0.02 histological sections made from tissues in normal goats showed a differential distribution and concentration of glycogen in left versus right atrial tissues . The concentration of glycogen in the laa was not only greater than in the raa but the density and location of the glycogen was critically distinct [figures 1 and 2]. We suggest that the potential arrhythmogenic aspect of these glycogen differences are a potential contributory mechanism for the initiation and maintenance for af and in particular the greater propensity for the development of an af substrate in the left than in the right atrium . The present study demonstrates that in the normal caprine heart there are intrinsic quantitative differences in glycogen concentrations between the laa and raa . Both sides showed subepicardial presence of glycogen [figures 4 and 5] that is notably displayed in a greater concentration in the laa . The significantly greater glycogen in the laa is heterogeneously found as high - density depositions against the intercalated discs and extending into the myocytes . Also condensed glycogen was observed at the sided to side junction of adjacent myocytes . In the raa granules of glycogen although there were individual myocytes in which the glycogen granules outlined the intercalated disc and side to side myocyte junctions, many other cells did not show this pattern [figure 1, open arrow head]. Raas myocardium showing pas staining (never as conspicuous as the laa) bar 1 mm . Please note that there is subepicardial glycogen concentration laas myocardium also exhibited consistent regions of subepicardial and subendocardial pas - positive glycogen staining (arrowheads) however, the intensity of raas staining was never as conspicuous or as widely distributed as laas glycogen particularly within the mid - myocardium (arrows). Bar = 1 mm of interest, one of the striking characteristic structural changes noted in the studies of the allessie group in the goat and also observed by others clinically was the accumulation of glycogen in the atrial myocytes associated with myolysis and a loss of contractile elements . It has been suggested that as a results of reduced contractility during af, lowered oxygen supply - demand ratio switches the energy metabolism of atrial cardiomyocytes from the use of fatty acids to the use of glucose leading to the accumulation of glycogen . However, this would not explain the presence and differential concentrations of glycogen in normal atria as shown in the present study . Early on, studies showed that anisotropic conduction, that is, differential longitudinal versus lateral conduction velocity of atrial myocytes predisposed to microreentry in old compared to young atrial bundles . More recently the contribution of the intrinsic autonomic nervous system innervating the atria appears to play a critical role in the initiation and persistence of af . We propose that the differential qualitative and quantitative distribution of glycogen in the normal goat heart demonstrated in the present study provides another intrinsic factor in the susceptibility of the atria for af . In the present study, there was a dense accumulation of glycogen concentrating at the intercalated discs and extending into the myocytes along the side to side connections between myocytes . As noted in [figures 1 and 2], this effect was notably observed in the laa albeit in a heterogeneous manner . We propose that the large glycogen molecules provide an impediment to electrical conduction both longitudinally and laterally . These heterogeneously distributed islands of impaired conduction create a non - uniform wavefront of activation with areas of slow conduction predisposing for reentry circuit development . For example, muir subjected stands of purkinje cells to centrifugation and found that the centrifugal movement of the pas - positive material, glycogen] appears to be arrested by transverse partitions, which correspond to the intercellular junctions . In uncentrifuged strands there is considerable variation in the concentration of stainable glycogen on the two sides of the intercellular junctions more recently, embi et al ., confirmed, in vivo, in atrial myocytes, this impermeability to be the result of the selectivity of the gap junction pore to allow particles of a given molecular size to pass from cell to cell . The observations of muir can then be explained as follows: glycogen particles have been reported to be 24.8 1.8 nm in diameter, whereas the atrial myocyte gap junction pore has a reported radius of 0.6 - 1.5 nm . As the intracellular glycogen level increases during af, it could cause fractionated intercellular communication, thus disrupting the stability of the atrial syncytium . Dhillon et al ., studied gap junction resistivity and measured conduction velocity in guinea pig atria and found significant differences between the left and right atria . They found that the left atrial gap junction resistivity was significantly higher and conduction velocity significantly lower compared to the right atrium . Moreover, addition of a gap junction uncoupling agent slowed atrial conduction more in the left than in the right atrial appendage . In another report from tai et al ., in a model of af caused by ventricular pacing induced heart failure, they compared activation of the left and right atria in control and heart failure dogs . They designated 3 different forms of activation: type 1, a single broad wavefront; type 2, a non - uniform wavefront associated with conduction block and/or slow conduction or the presence of two wavelets; type 3, the presence of 3 or more wavelets associated with areas of slow conduction and multiple arcs of conduction block . In the right atrium only 2 of the 5 control dogs had type 2 activation whereas in the left atrium, all five control dogs had type 2 activation . Furthermore, the left atrium had a greater dispersion of refractoriness (a biomarker for af susceptibility) than the right atrium . Other evidence supporting glycogen as a contributing factor promoting af relates to the finding that angiotensin ii receptor blockers (arbs) have had significant improvement in reducing the metabolic parameters such as glucose levels in large human clinical trials . The drug irbesartan is such a blocker and has been known to reduce glucose levels amongst other effects such as attenuating atrial stunning after cardioversion, and most important for our hypothesis it has been used as a stand alone or adjunctive therapy in controlling af . Arbs have also been used as intensive therapy to treat patients with glycogen storage disease . It is interesting to note that other areas of the normal heart have appreciable amount of glycogen . Indeed, the purkinje system is known to contain a high glycogen content yet conduction velocity in purkinje fibers is on the order of 2 - 4 times greater than in the atrium . Here again, it is not the concentration but the localization of the glycogen in relation to the myocytes that appears to determine conduction velocity and the activation wavefront . In an electron microscopic study of the purkinje system, legato clearly showed that the strands of purkinje cell were separated by pools of glycogen . This arrangement would favor rapid longitudinal conduction through unimpeded intercalated discs without loss by side to side cellular connections . In fact, this arrangement is associated with low internal resistance in these purkinje strands . Please note that the evidence obtained in our study and supported findings were restricted to normal atrial tissues taken from goat hearts . The translation of our hypothesis, developed in the normal goat heart to conditions of established af, is moot since we do not know the role of glycogen in perpetuating af . However, many studies in different species of normal animals have shown the inducibility for atrial fibrillation and the greater propensity of the left rather than the right atrium to initiate and maintain af . Indeed in humans (with valvular disease and af), the presence of myocytes with the total intercellular space filled with glycogen has been documented . Histological sections made from tissues in normal goats showed a differential distribution and concentration of glycogen in left versus right atrial tissues . The concentration of glycogen in the laa was not only greater than in the raa but the density and location of the glycogen was critically distinct [figures 1 and 2]. We suggest that the potential arrhythmogenic aspect of these glycogen differences are a potential contributory mechanism for the initiation and maintenance for af and in particular the greater propensity for the development of an af substrate in the left than in the right atrium . The present study demonstrates that in the normal caprine heart there are intrinsic quantitative differences in glycogen concentrations between the laa and raa . Both sides showed subepicardial presence of glycogen [figures 4 and 5] that is notably displayed in a greater concentration in the laa . The significantly greater glycogen in the laa is heterogeneously found as high - density depositions against the intercalated discs and extending into the myocytes . Also condensed glycogen was observed at the sided to side junction of adjacent myocytes . In the raa granules of glycogen although there were individual myocytes in which the glycogen granules outlined the intercalated disc and side to side myocyte junctions, many other cells did not show this pattern [figure 1, open arrow head]. Raas myocardium showing pas staining (never as conspicuous as the laa) bar 1 mm . Please note that there is subepicardial glycogen concentration laas myocardium also exhibited consistent regions of subepicardial and subendocardial pas - positive glycogen staining (arrowheads) however, the intensity of raas staining was never as conspicuous or as widely distributed as laas glycogen particularly within the mid - myocardium (arrows). Bar = 1 mm of interest, one of the striking characteristic structural changes noted in the studies of the allessie group in the goat and also observed by others clinically was the accumulation of glycogen in the atrial myocytes associated with myolysis and a loss of contractile elements . It has been suggested that as a results of reduced contractility during af, lowered oxygen supply - demand ratio switches the energy metabolism of atrial cardiomyocytes from the use of fatty acids to the use of glucose leading to the accumulation of glycogen . However, this would not explain the presence and differential concentrations of glycogen in normal atria as shown in the present study . Early on, studies showed that anisotropic conduction, that is, differential longitudinal versus lateral conduction velocity of atrial myocytes predisposed to microreentry in old compared to young atrial bundles . More recently the contribution of the intrinsic autonomic nervous system innervating the atria appears to play a critical role in the initiation and persistence of af . We propose that the differential qualitative and quantitative distribution of glycogen in the normal goat heart demonstrated in the present study provides another intrinsic factor in the susceptibility of the atria for af . In the present study, there was a dense accumulation of glycogen concentrating at the intercalated discs and extending into the myocytes along the side to side connections between myocytes . As noted in [figures 1 and 2], this effect was notably observed in the laa albeit in a heterogeneous manner . We propose that the large glycogen molecules provide an impediment to electrical conduction both longitudinally and laterally . These heterogeneously distributed islands of impaired conduction create a non - uniform wavefront of activation with areas of slow conduction predisposing for reentry circuit development . The centrifugal movement of the pas - positive material, glycogen] appears to be arrested by transverse partitions, which correspond to the intercellular junctions . In uncentrifuged strands there is considerable variation in the concentration of stainable glycogen on the two sides of the intercellular junctions more recently, embi et al ., confirmed, in vivo, in atrial myocytes, this impermeability to be the result of the selectivity of the gap junction pore to allow particles of a given molecular size to pass from cell to cell . The observations of muir can then be explained as follows: glycogen particles have been reported to be 24.8 1.8 nm in diameter, whereas the atrial myocyte gap junction pore has a reported radius of 0.6 - 1.5 nm . As the intracellular glycogen level increases during af, it could cause fractionated intercellular communication, thus disrupting the stability of the atrial syncytium . Dhillon et al ., studied gap junction resistivity and measured conduction velocity in guinea pig atria and found significant differences between the left and right atria . They found that the left atrial gap junction resistivity was significantly higher and conduction velocity significantly lower compared to the right atrium . Moreover, addition of a gap junction uncoupling agent slowed atrial conduction more in the left than in the right atrial appendage . In another report from tai et al ., in a model of af caused by ventricular pacing induced heart failure, they compared activation of the left and right atria in control and heart failure dogs . They designated 3 different forms of activation: type 1, a single broad wavefront; type 2, a non - uniform wavefront associated with conduction block and/or slow conduction or the presence of two wavelets; type 3, the presence of 3 or more wavelets associated with areas of slow conduction and multiple arcs of conduction block . In the right atrium only 2 of the 5 control dogs had type 2 activation whereas in the left atrium, all five control dogs had type 2 activation . Furthermore, the left atrium had a greater dispersion of refractoriness (a biomarker for af susceptibility) than the right atrium . Other evidence supporting glycogen as a contributing factor promoting af relates to the finding that angiotensin ii receptor blockers (arbs) have had significant improvement in reducing the metabolic parameters such as glucose levels in large human clinical trials . The drug irbesartan is such a blocker and has been known to reduce glucose levels amongst other effects such as attenuating atrial stunning after cardioversion, and most important for our hypothesis it has been used as a stand alone or adjunctive therapy in controlling af . Arbs have also been used as intensive therapy to treat patients with glycogen storage disease . It is interesting to note that other areas of the normal heart have appreciable amount of glycogen . Indeed, the purkinje system is known to contain a high glycogen content yet conduction velocity in purkinje fibers is on the order of 2 - 4 times greater than in the atrium . Here again, it is not the concentration but the localization of the glycogen in relation to the myocytes that appears to determine conduction velocity and the activation wavefront . In an electron microscopic study of the purkinje system, legato clearly showed that the strands of purkinje cell were separated by pools of glycogen . This arrangement would favor rapid longitudinal conduction through unimpeded intercalated discs without loss by side to side cellular connections . In fact, this arrangement is associated with low internal resistance in these purkinje strands . Please note that the evidence obtained in our study and supported findings were restricted to normal atrial tissues taken from goat hearts . The translation of our hypothesis, developed in the normal goat heart to conditions of established af, is moot since we do not know the role of glycogen in perpetuating af . However, many studies in different species of normal animals have shown the inducibility for atrial fibrillation and the greater propensity of the left rather than the right atrium to initiate and maintain af . Indeed in humans (with valvular disease and af), the presence of myocytes with the total intercellular space filled with glycogen has been documented . The present study demonstrates that glycogen is heterogeneously distributed in both atria in the normal goat heart . Glycogen granules were observed scattered throughout the raa myocytes and at the intercalated discs as well as the side to side connections between some but not all myocytes . In contrast, in the laa dense glycogen deposits were coalesced against the intercalated discs and side to side connections between myocytes with tailing into the cell interior . For the first time, evidence is presented suggesting that this results in an impediment of cell to cell conduction leading to a non - uniform wavefront of activation . In conjunction with areas of slowed conduction, these conditions predispose the la, when vulnerable, that is, in response to premature beats, for reentrant based af.
|
Clinical studies have already confirmed a strong relationship between obesity and hypertension with visceral obesity seeming to represent the most important risk factor for hypertension and cardiovascular disease . Although the exact mechanism of how obesity is a cause of hypertension is unknown, many theories have been suggested such as activation of the renin - angiotensin - aldosterone system, oxidative stress, sympathetic overdrive, chronic vascular inflammation and endothelial dysfunction, which leads to structural changes such as thickening of the intima and media of the vessel wall [3, 4]. Obesity is an increasing worldwide health problem phenomenon especially in adolescents, and it is one of the main factors, in addition to family history, contributing to the increase in the prevalence and rate of diagnosis of hypertension in children and adolescents, with primary hypertension being very common in adolescents . The consequence of adolescent obesity was reported in a study which showed that bmi greater than the 75th percentile in adolescence usually lead to an increased risk of death from cardiovascular disease in adulthood . Many studies have emphasized the increasing obesity among adolescents in kuwait . A study carried out in 2005 on adolescent kuwaiti girls showed that they rank the highest in obesity compared with the same sex and age group in egypt and lebanon . . Showed that in comparison to other arabic states, kuwaiti adolescents showed the highest prevalence of obesity for both males (34.8%) and females (20.6%). This extends to kuwaiti adolescents being among the highest in obesity prevalence not only in the gulf countries but in the world reaching up to 4046% [10, 11]. This was attributed to the rapid socio - economic growth in kuwait and arabian gulf states in general, with the availability and consumption of fast food increasing by adolescent individuals . In kuwait, the prevalence of hypertension in young and middle aged kuwaiti citizens of a minimum age of 21 years was determined, with the study emphasizing the influence of body mass index on blood pressure and a major lack of previous knowledge or awareness of hypertension in hypertensive individuals . Surprisingly, in spite of the high prevalence of obesity in kuwaiti adolescents, data on the prevalence of elevated blood pressure or hypertension in obese kuwaiti adolescents does not exist . Accordingly, the purpose of this study was (1) to preliminarily estimate the prevalence of elevated bp in a representative small sample of extremely obese kuwaiti adolescents and (2) to investigate the relationship between bp and body mass index (bmi) based on a single screening . As there is inconsistent or regular blood pressure monitoring in children and adolescents during visits to health centers in kuwait, the importance of this study is to emphasize the significance of early detection of hypertension and intervention in adolescents with hypertension in kuwait . 257 participants of different adolescent ages (1119 years) were selected on a volunteer - basis from kuwait university, capacity academy courses, kuwait science club (ksc), the scientific center, saad club, al - habara club, health center and shaab leisure park . The selection of subjects was based on examiners' subjective estimation of obesity by sight, and to avoid embarrassment to the obese volunteers, some non - obese subjects were also asked to volunteer . Information about the participants' age, gender, family history, smoking, alcohol, diet habits, exercise, cardiovascular disease and previous history of hypertension was also taken . Before blood pressure (bp) measurement, the participants were asked about their intake of any stimulants . The weight and height of the participants were measured in a standing position (bare feet) using a precision electronic scale (hd-313 digital weight scale, tanita) and a stadiometer (seca 222, seca) respectively . The weight was measured in kilograms (kg) and the height in centimeters (cm). After measuring the weight and height the body mass index (bmi) was calculated as weight divided by height squared (kg / m). Bmi has been recommended as the most acceptable, valid and reproducible measure of body fat in children and adolescents which is both valid and reproducible . In normal children, bmi increases slightly with age, thus bmi percentiles, which are age specific, are used to define risk categories [14, 15], and bmi criteria of the international obesity task force (iotf) were used to define obesity . The iotf classification system provides extended bmi cut - points by age and sex for overweight, obesity, and severe obesity among children aged 218 years . Subjects with a bmi> 30 kg / m were categorized as obese or severely obese according to the extended bmi cut - points . In this study, they would only be referred to as obese subjects . As the main aim of this study was to estimate the prevalence of elevated bp in a representative small sample of extremely obese kuwaiti adolescents, the sample size of non - obese subjects in this study was much smaller (n = 48; 27 females: 56.3% and 21 males: 43.7%) than the obese sample (n = 209; 81 females: 38.75% and 128 males: 61.25%). The subjects in the severely obese group were divided into three adolescence stages, but this was not carried out for the non - obese group due to the small sample size . An oscillometric fully - automated wrist device (bp w100, microlife, switzerland) was used to measure bp; the device had a blood pressure measurement range of 30280 mm hg and a statistic accuracy within 3 mm hg . As designated on the device, it was clinically validated according to the european society of hypertension (esh) and the british hypertension society (bsh) protocols that require that automated device be compared with blood pressures measured by trained observers using a mercury sphygmomanometer and stethoscope . The width of the cuff was adjusted to the wrist circumference, and bp was measured in a comfortable sitting position two times on the right wrist with the arm supported and the cuff at the level of the heart, with 1 minute interval between the measurements . Percentiles of systolic and diastolic bp was generated using the world health organization (who) reference tables for blood pressure levels by age and height percentile . Even though the new guidelines recommend multiple bp measurements at different sessions to define persistent hypertension and pre - hypertension, bp was measured two times in only one session in the present study . Accordingly, we adopted din - dzietham et al . Definition of high (elevated) blood pressure instead of hypertension however the same cutoff points of classification were used (table 1). Elevated or high bp was considered for systolic and/or diastolic pressures> 95th percentile for age . Comparison of means was carried out by the appropriate statistical test: two - sample student's t tests were performed for between group comparisons of continuous variables with a normal distribution, and the mann - whitney test on variables with non - normal distributions . Spearman's rho was used for testing statistical dependence between two variables . For treatment of frequencies, the mean age was 15.61 2.40 years for the non - obese subjects and 15.02 2.82 years for the obese subjects . The bmi values in the non - obese group followed a gaussian distribution . In the obese group, the bmi values of the whole sample and some of the different age groups did not follow a normal distribution . Accordingly the mean bmi for the non - obese group was 21.7 2.23 kg / m, with no difference between sexes (male: mean bmi = 22.31 2.25 kg / m; female: mean bmi = 21.30 2.22 kg / m, p = 0.14). Comparison as in table 2 between the obese and non - obese subjects shows very significantly larger values of bmi in the obese sample . Table 3 also illustrates the mean bmi values for each sex at different stages of adolescence . Clearly, the mean bmi value is greater than 30 kg / m for both sexes and coincides with cut - off values for severe obesity according to itfo . There was no significant difference at any adolescent stage when comparing with the mann - whitney test the median values for males and females (median: males: 33.90, females, 33.00; p = 0.21). Bp values in tables 2 and 3 represent measurement of a single screening . Comparison in blood pressure parameters between the non - obese and obese group shows that the systolic bp and map in the obese subjects were very significantly larger than the non - obese group, with the diastolic bp marginally showing a difference (table 2). Table 3 values focus on bp measures from the obese subjects at three adolescent stages . It is obvious that there was a progressive increase in blood pressure measures with adolescence age, and values of all bp measures were highest for the age group of 1719 years in both sexes . For systolic bp, the range in obese males was 102179.5 mm hg, and in obese females was 102158 mm hg, with the mean being significantly greater in males than females by almost 7 mmhg (t = 2.16, p = 0.03) in the middle adolescent stage and 8.5 mm hg (t = 2.89, p = 0.005) in late adolescent stages . For diastolic bp, the range in males was 59138 mm hg, and in females was 50129 mm hg . Even though there was no statistical significance, it is worth pointing out that it was only in the late adolescent stage the diastolic pressure in males was about 6 mm hg higher than in females . As for the frequency of subjects with high bp in each group, tables 2 and 3 show that 133 (63%) obese subjects had elevated bp on this initial screening according to the classification of the american heart association; there were only 6 subjects with elevated bp n the non - obese sample, representing a significantly less percentage than in the obese group (13% versus 63%; fisher's exact test, p <0.0001). In the obese group, males as compared to females, had a non - significantly higher rate of elevated bp on first screening (64% versus 60%; fisher's exact test, p = 0.66) however the spread along adolescence years was different in both sexes (table 3). In males the percentage of subjects with elevated bp increased with increasing adolescence stage, and an opposite pattern was evident in the females . In males there was an increase of 9% prevalence between early adolescence and middle adolescence, and there was a 12% increase between middle adolescence and late adolescence . In females, there was a decrease of 8% prevalence between early adolescence and middle adolescence and 6% between middle adolescence and late adolescence . In the 133 obese subjects with elevated bp, the type of elevated bp which was contributing to the elevated bp was evaluated by frequency plot (figure 1). The figure shows that more than half (70/133; 53%) of the obese subjects had both elevated systolic and diastolic bp . Males contributed more to the high isolated systolic bp (35/83; 42%) than females (17/50; 34%) but non - significantly (fisher's exact test, p = 0.37), while the opposite was true for females who non - significantly contributed more to the high isolated diastolic bp (7/50; 14%) compared to males (4/83; 5%) (fisher's exact test, p = 0.10). Spearman correlation analyses between body mass index (bmi) and different measures of bp show that bmi of the total obese sample was significantly and positively correlated with systolic, diastolic and very significantly with the mean arterial pressure (map), but with no association with the pulse pressure (table 4). Analysis further shows that in males, it was only the systolic bp that was significantly related to bmi, while in females both the diastolic bp and map were significantly correlated to bmi . The current study emphasizes many major findings relating obesity and hypertension in adolescents in kuwait . Due to inconsistencies in working definitions of severe obesity, we adopted the newly published iotf cut - points of obesity and extreme obesity, because they are now recommended for international use . Accordingly, all our obese adolescent subjects are considered obese to extremely obese, since the minimum bmi was 30 kg / m for both sexes and the range was up to 56.4 kg / m . In the obese sample, it is clear that the bp values were increasing with age, with minimal difference between the early stages of adolescence in the mean systolic bp in females, but occurring at later stages . The significant difference in systolic bp between males and females in mid and late adolescence stages this dimorphism persists throughout adulthood up to 60 years of age, with average systolic and diastolic pressures in men being higher than aged - matched females by 6 - 7 and 35 mm hg respectively . This may be attributed to the blood pressure lowering effect of estradiol in women and in our study to the possibility that menstrual regularity and sex hormone levels are still not well established in early adolescence . It is also evident from the results that there was a high rate of elevated bp in the obese adolescent group . The association of the presence of obesity with much higher rates of hypertension has been previously established in other countries . In the report by mcniece et al . On high school students, the prevalence of hypertension and pre - hypertension combined was more than 30% in obese adolescent boys and 2330% in obese adolescent girls depending on ethnicity . Another study by sorof et al . Reported a hypertension prevalence of 10.7% in multi - ethnic adolescents with bmi 95th percentile after 3 screenings . In our subjects, systolic, diastolic and mean bp was strongly associated with the bmi in the total obese sample . The high rate of isolated systolic high bp (39%), as well as elevated systolic along with elevated diastolic blood pressure (53%) in the obese adolescents in this study is alarming . In adults, isolated systolic hypertension was found to pose a strong and independent risk of cardiovascular mortality, with isolated systolic hypertension being more associated than isolated diastolic hypertension with risk of coronary heart disease, stroke and end - stage renal disease . A relatively recent systematic review and meta - regression analysis study that examined the tracking of blood pressure (bp) from childhood to adulthood has confirmed that childhood bp is associated with bp in later life . Initially, the size of the non - obese sample was small and may not be an appropriate representation of the non - obese kuwaiti adolescent population . However, the main aim of this paper was to focus on obese subjects and to estimate the prevalence of elevated bp in this representative group . An additional limitation is the high prevalence of elevated bp in the obese sample, and this could be attributed to methodological factors . The new guidelines recommend multiple bp measurements at different sessions to define persistent hypertension and prehypertension . This is because it was previously shown that the number of subjects showing elevated bp values at the first measurement was double or more the number of subjects having bp measurement on two or three different visits . In sorof's study on school - aged children, the prevalence of elevated blood pressure after first, second and third screenings was 19.4%, 9.5% and 4.5% respectively . Following this rational, this implies that if additional screening measurements had been performed on subsequent occasions in the current study, it is almost certain that the overall prevalence of elevated bp would have continued to decrease probably to 30% on the second screening . Nevertheless, elevated single bp measurements should not be undermined, because 68% of adolescent boys and 43% of adolescent girls diagnosed with prehypertension and hypertension combined, on the basis of a single bp measurement, had prehypertension or hypertension 2 years later . Another methodological factor for the high incidence of elevated bp could be the use of the automated oscillometric wrist bp monitor instead of the upper arm monitor . There has been much debate in recent years over the clinical accuracy of wrist bp monitors . A recent study led by doshi et al . Have shown that even when a validated wrist device was used for bp measurement in a standardized protocol, there were significant differences for systolic bp and diastolic bp measured at the arm and wrist . In their study on obese patients, they found higher wrist values, with the majority of patients having systolic bp or diastolic bp absolute differences of 5 mm hg between the two methods, and approximately one third having a difference of 10 mm hg in systolic bp and diastolic bp . In conclusion, the low degree of awareness among kuwaitis of the risks of adolescent obesity has to be rectified in the light of the risk of the rapid socioeconomic growth in kuwait . Actions such as increasing awareness programs in schools in kuwait as well as continuous monitoring of blood pressure in children and adolescents during health center visits have to be emphasized and implemented further in kuwait.
|
We report the case of a 25-year - old caucasian male who developed an acute right scrotum secondary to bile within peritoneal fluid that entered the scrotum through a previously undiagnosed communicating hydrocele . To the best of our knowledge, approximately 10 ml to 15 ml of bile was spilled during the procedure after inadvertent entry into the gallbladder during its dissection from the gallbladder fossa . After the gallbladder was removed, the abdomen was irrigated until aspirated fluid was clear . The right cremaster muscles were noted to be in spasm . A urologic consultation was obtained . The patient's complaints and examination were concerning for testicular torsion, and right scrotal exploration was performed 3 hours after completion of the laparoscopic cholecystectomy . Opening of the tunica vaginalis revealed 10ml of bile - stained fluid and a normal right testicle . The tunica vaginalis and right testicle were irrigated with saline, and a communicating hydrocele was identified and ligated . Postoperatively, the patient noted immediate relief of pain, and examination revealed minimal tenderness in the right scrotum . The total bilirubin value of the fluid drained from the scrotum was 10 mg / dl . The patients ranged in age from 7 to 20 years of age and presented with symptoms between postoperative day 1 and 10 . Acute postoperative scrotum due to early hernia recurrence has also been described in an infant after an open inguinal herniorrhaphy . Yasumoto et al reported a case of a 10-year - old male who underwent open appendectomy for perforated appendicitis on postoperative day 1 following incision and drainage of a left scrotal abscess . Infarction of the upper pole of the right testicle causing acute scrotal pain has been reported after a laparoscopic total extraperitoneal inguinal herniorrhapy . Bile causes peritoneal signs on examination in some patients with cystic duct stump leaks after cholecystectomy . Although the mechanism of irritation is not fully understood, bile salt concentration and bacteria are thought to be possible causes of bile - induced abdominal pain . The cause of acute scrotal pain in this case was due to bile within peritoneal fluid that entered the right scrotum through a communicating hydrocele . The fluid entered the right scrotum after spillage occurred while the patient was in a reverse trendelenberg position with increased intraperitoneal pressure due to carbon dioxide insufflation . The possibility of bile causing the patient's pain was included in our differential diagnosis; however, with no prior cases reported in the literature and our concern for testicular torsion, we felt urgent exploration was indicated . Future management of a similar patient may include the option of percutaneous aspiration of the hydrocele with laboratory examination to determine bile concentration . If symptoms persist following aspiration, urgent scrotal exploration would be indicated to rule out testicular torsion . The surgical literature is scattered with only a handful of reported cases of an acute scrotum developing after laparoscopic procedures . An acute suppurative process associated with laparoscopic appendectomy is the most common cause described to date . The patient's symptoms completely resolved after urgent scrotal exploration with drainage of bilious fluid that entered via a communicating hydrocele . To the best of our knowledge, this is the first case of an acute scrotum due to bile after laparoscopic cholecystectomy . As the volume of minimally invasive procedures performed increases, so does the number of unusual complications that develop . Reporting of such uncommon disorders developing after minimally invasive procedures provides a reference that may potentially allow earlier recognition and treatment of similar complications by fellow surgeons in the community.
|
According to the national statistical office (nso) of korea, korea became an aging society when elderly people above the age of 65 make up 13.1% of the population in 20151 . The nso of korea expects the population of the elderly would be 14.3% in 20182 . Although the increase in population of the elderly can be considered a good phenomenon in terms of lengthening lifespan, there is room for improvement in terms of satisfactory life quality . Korea institute for health and social affairs (kihsa) surveyed the life satisfaction among the elderly in 2014 and its result shows that 29.5% are satisfied, 26.2% are mediocre, and 44.2% are not satisfied with their life quality3 . Self - evaluation of one s health condition is one of the most influential predictable factors for the life satisfaction index of the elderly4 . Regarding this aspect, kihsa reported that 90.4% have more than one chronic illness requiring a long term treatment and recuperation and 72.2% have more than two chronic diseases among the elderly population . It is noteworthy that 32.4% thought they were healthy and 43.7% thought they were not healthy3 . Therefore, there has been an increase of concern and interest in healthy older age above 65 coupled with an interest for longevity . The interest in healthy older age gives rise to the necessity for improvement in cardiopulmonary function and cardiopulmonary capacity . The physical fitness test is used for a pivotal physiological indicator of physical activity performance, together with body composition, muscular strength and flexibility to evaluate physical fitness5 . In general, pulmonary function declines as morphological alteration occurs because of reduced elasticity of pulmonary alveoli and multiplied emphysema in the aging process6 . The research of americans showed that pulmonary function of men rose until the age of 27 and then declined, and that of women rose until the age of 20 and then declined7 . Especially the drastic decline of pulmonary function starts after the age of 60, so it has been known that even though a person enjoys normal health condition, he can suffer from dyspnea occurring frequently while engaging in some exercises8 . However, well - known prediction formula of pulmonary function test includes weight and height in addition to age10 . In general, a decline of cardiopulmonary function causes decrease of basal metabolic rate, which can be one reason for obesity11 . In turn, obesity can increase risk of cardiovascular disease12, hence, weight can be one of the influential factors for cardiopulmonary function . Kim et al.5 confirmed the relationship between weight and cardiopulmonary function in the study of senior high school male students . The relationship between height and cardiopulmonary function can be referred in the study conducted by rode and shephard13 . The caucasian americans and the inuit subjects featured relatively short height, and the study concluded that the inuit had similar pulmonary function with tall height americans since the inuit had well developed upper body . Namely, this study shows that the pulmonary function is relatively proportionate to one s height, however, the well - developed upper body can affect the pulmonary function as well . Per contra, most of the studies were conducted with young age subjects, so it is necessary for the study to be conducted with elderly subjects to examine their physical features affecting the pulmonary function . Therefore, this study purposes to recognize how physical features such as age, weight and height can affect the pulmonary function and to provide useful basic data for the programs to enhance the pulmonary function of the elderly . The subjects were the elderly of s university s lifelong education center and senior community centers of jurae and kangsundae in busan . The subjects were 83 elderly women agreed to participate, able to move freely, having no history of respiratory disease, no difficulty in breathing and non - smokers . This study complied with the ethical standards of the declaration of helsinki, and written consent was received from each participant . The physical features of the subjects were: age on average 71.0 8.6 years, height on average 153.6 5.9 cm, and weight on average 57.0 6.8 kg . The measuring equipment for the pulmonary function used in this study was spirometry (pony fx, cosmed inc ., this equipment can measure the speed and quantity of air flowing in and out of the lung . We checked and measured forced vital capacity (fvc), forced expiratory volume in 1 second (fev1), fev1/fvc, maximal expiratory flow 75% (mef 75%), mef 50%, and mef 25% . As the accuracy of measurement of pulmonary function is dependent on the examinee s cooperation and effort, the purpose and significance of the study were informed and the participants were told of the measurement method and ways . They were asked to stand on their feet which were spaced as wide as their shoulder and vertically grounded with their straightened shoulders and back14 . The measurement was performed 3 times at each session, and the mean value was used for analysis . The purpose of this study was to examine the influential factors affecting the pulmonary function of elderly women . Hierarchical regression analysis was performed in this study to check how age, height, and weight which were known as having linear relations with the pulmonary function, can affect the pulmonary function . Table 1table 1.an analysis of the influential factors of maximal - effort expiratory capacity (unit)variablesmodel 1model 2model 3setsetsetfvc (l)weight0.0080.2402.224 * 0.0070.0820.9130.0060.0030.043height0.0080.7248.026 * 0.0090.3973.746*age0.0060.4544.734*fev1 (l)weight0.0070.2522.348 * 0.0060.0270.2700.0060.0670.766height0.0070.6276.371 * 0.0080.2392.128*age0.0050.5375.268*fev1/fvc (%) weight0.1550.0320.2890.1740.0050.0440.1650.0930.788height0.1990.0600.4810.2440.3051.992age0.1540.5063.646*mef 75 (%) weight0.0220.1181.0700.0230.0800.7000.0210.0130.121height0.0260.4443.907 * 0.0310.0610.448age0.0190.5314.312*mef 50 (%) weight0.0150.1931.7740.0160.0490.4210.0150.1451.339height0.0180.3242.767 * 0.0210.0730.521age0.0130.5504.342*mef 25 (%) weight0.0060.0450.4080.0060.0730.6040.0060.0010.009height0.0070.2662.198 * 0.0090.0420.279age0.0060.4283.108**p<0.05 shows the results about the influential factors of maximal - effort expiratory capacity . Regarding fvc and fev1, it was found that weight was an influential factor in two variables of the model 1 (p<0.05). However, not weight but height (p<0.05) was an influential factor in the model 2 which was added with height factor . Not weight rather height (p<0.05) and age (p<0.05) were influential factors in the model 3 which was added with age factor . Therefore, it was observed that fvc and fev1 were the most affected by age, less affected by height, and not affected by weight . Regarding fev1/fvc%, it was observed that weight was not an influential factor in model 1 . In model 2, which was model 1 added with height factor, neither weight nor height affected pulmonary function . In model 3, which was model 2 added with age, age (p<0.05) was an influential factor, whereas neither weight nor height was . Consequently, it was found that the function of fev1/fvc% is affected by the age factor . Regarding mef 75%, mef 50%, and mef 25%, model 1 showed that weight was nt an influence in all the variables . In model 2, which was model 1 added with height, height (p<0.05) was an influential factor, whereas weight was not . In model 3, which was model 2 added with age, age (p<0.05) was found to be an influential factor, however, neither weight nor height was . Hence, it was found that the function of all mef% is affected by age, not by weight or height . Schoenberg et al.8 explained that they found in their study that age, gender, and weight were influence factors of pulmonary function, especially as weight increased, the muscle strength improved, so it led to strengthening pulmonary function . However, if weight kept increasing to the point of obesity, the movement of thorax came to reduce, and it led to a decline of pulmonary function . However, quanjer15 and degroodt et al.16 mentioned that the most influential factor for pulmonary function was height in the case of children and adolescents, even though age, weight, and height were influential factors, because children and adolescents grew fast in their height and their respiratory capacity changed accordingly . In addition to this, hwang and shim17 reported that vital capacity (vc) and fvc declined significantly as age advanced . On the other hand, lee et al.18 reported that fev1 and fvc increased significantly as age and height grew . These studies and reports show that age, weight, and height affect the pulmonary function . However, all these previous studies have a limitation since they did nt take into account the correlation among the influential factors such as age, weight, and height, even though they examined how age, weight, and height affected the pulmonary function respectively . Hence, this study aimed to check the influential factors of the pulmonary function in relationship to age, weight and height . The experiment showed that if weight was considered as a variable alone regarding fvc and fev1 which were understood to be related to the function of large airway, they were affected by the weight factor, however, if weight and height were considered as variables, they were affected only by height . However, if age, weight, and height were considered together, then the pulmonary function was affected by age and height, but not by weight . Nevertheless, the function of fvc / fev1% was affected by neither weight nor height but only by age . Regarding the function of mef 75%, mef 50% and mef 25% which were known as related to the function of small airways, weight could nt affect them, even though weight was considered as a single variable . However, when weight and height were considered together, height was found to be an influence factor . Furthermore, it was found that when age, weight, and height were considered together, neither weight nor height but only age could affect the pulmonary function . These results show that the pulmonary function of large airways is affected by age and height in the case of elderly women, however the function of small airways is affected by age only . Therefore, the pulmonary function of elderly women gets affected most greatly by their age . The results of this study are similar to the results of study done by janssens9 which reported that the pulmonary function declined as age advanced . The decline of the pulmonary function can be considered to be related to the aging process . In general, as aging progresses, the respiratory system goes through changes, because the elasticity of pulmonary alveoli and alveolar ducts reduce . The decrease of elastic properties of cells causes emphysema, imbalance of ventilation - perfusion, decrease of surface area per lung volume, and in turn, dyspnea . In addition, as aging progresses, osteoporosis of the ribs, calcification of costal cartilage, increase of stiffness of rib cage, respiratory muscle weakness, and imbalance of inspiratory and expiratory pressures occur, and in turn, these changes tend to cause more decline of the pulmonary function19,20,21 . Therefore, the results of this study are considered to be a phenomenon showing the reason why the pulmonary function declined because the function of pulmonary alveoli, airways and respiratory system were weakened in the aging process . However, this study was conducted with the elderly women aged above 65 years only, so the study has limitation and should expand its results to other age groups . Furthermore, although it was reported that fat distribution in the upper body reduced the pulmonary function22, 23, this study did nt consider the distribution rate of fat in the upper body and this could be viewed as a shortcoming of this study . Chen et al.24 pointed out that if weight was to be considered as a single variable, body fat and muscle mass could not be considered separately, and this could hinder from finding relationship between weight and pulmonary function . In addition to this, the elderly suffer from the weakening musculoskeletal system, and this causes their head to bend down outwardly and their cervical spine and lumbar spine to have less curve, and in turn, it leads to spine retroflexion25 . Besides, strength and endurance of the respiratory muscles decline and the muscle strength of diaphragm declines by 25% as the postural change and body frame becomes smaller as aging advances26 . As the facts are considered that the lung has passive elastic properties and is located inside the rib cage, and air flow in and out of the lung is made by respiratory muscles27, the weakening of respiratory muscles, diaphragm and pelvic floor muscle and other muscles can greatly affect pulmonary function . Therefore, even though it is difficult to recognize how the change of height of the elderly affects pulmonary function alone, this study has a limitation by not including these aspects . Hence, there is a necessity of research to see how the distribution rate of fat in the upper body of elderly women, deformation of body structure, and the function of respiratory muscles can affect the pulmonary function in the future.
|
Shm is characterized by specific types of base substitutions in the variable portion of immunoglobulin genes which occur at a million - fold higher frequency than normal somatic mutations (10/bp versus 10/bp). V region mutations at g: c and a: t sites occur on both strands of dna in vivo . Mutations at g: c sites tend to be favored in dna wrc hot spot motifs (wr: w = a or t, r = purine). These mutations are attributable to the c u deamination specificity of activation - induced cytidine deaminase (aid; reference 7) acting either on single - stranded dna (ssdna) or on the nontranscribed strand within a moving transcription bubble (79). Mutations at a: t sites show a preference for wa hot spot motifs reminiscent of the in vitro behavior of pol . Pol is highly error prone and tends to generate at gc mutations preferentially in ta motifs in vitro (10). The expression of aid, which occurs during a short time span in b cells, is essential for shm as is active transcription of the v gene (11, 12). In fact, biochemical studies with semipurified aid provided the evidence that ssdna was the substrate for aid, thus explaining the perplexing need for transcription (79, 13). A synopsis of potential shm pathways responsible for the v region mutations is shown in fig . C t mutations might be initiated by aid tracking along a moving transcription bubble and generating u residues on the nontranscribed dna strand or, less often, on the transcribed dna strand (79). Faithful copying of u by a high fidelity polymerase, such as pol or pol, would generate c to t transitions, whereas aberrant copying of u by a low fidelity polymerase, such as pol, could cause both transitions (the replacement of a purine with a different purine and pyrimidine with a different pyrimidine) and transversions (the replacement of a purine with a pyrimidine or vice versa) (fig . 1, left). However, this simplified picture cannot account for the equal numbers of mutations at c on the transcribed strand, nor can it explain mutations at a: t sites . Aid acting on ssdna exposed in the transcription bubble in an immunoglobulin v region deaminates c preferentially at wrc hot spot motifs . Subsequent copying of u by a high - fidelity dna polymerase results in c t transitions, or copying by error - prone pol could generate c n transition or transversion mutations . A second stage of diversification leading to mutations at a: t sites requires the action of either mismatch repair proteins, including msh2msh6, or base excision repair proteins, including ung and apurinic endonuclease (ape). Mutations at wa hot spot motifs could be made by pol during long (mismatch repair) or short (base excision repair) gap - filling synthesis . The mismatch repair pathway (solid arrow) has been suggested to play a greater role than the base excision repair pathway (dashed arrow) in introducing mutations at a: t sites (20), although the relative importance of each pathway remains to be determined . Further shm diversity could arise if the u residue created by aid is excised rather than copied . The removal of u residues by the enzyme uracil n - glycosylase (ung) results in an abasic site that can then be removed by base excision repair . Alternatively, a mismatched u: g base pair can be repaired by mismatch repair . In this process, single base mismatches are recognized by an msh2msh6 dimer which then recruits other proteins to excise the mismatch and replace the excised dna . In either case, the repair patches short in the case of base excision repair and much longer in the case of mismatch repair would expose the transcribed strand to the action of pol to generate mutations at a: t sites (fig . 1, right). Aid might also attack c residues on the transcribed strand . The holy grail from a biochemical perspective would be to reconstitute shm entirely in a cell - free system using purified proteins . This possibility might not be all that remote given the availability of eukaryotic base excision repair, mismatch repair, and rna pol ii transcription systems in vitro . However, defining where pol and aid might fit into any one of these systems is itself a difficult problem, and full reconstitution of shm would appear to require integration of all of the components of the base excision repair, mismatch repair, and transcription systems a daunting task . The reconstitution of the system is further complicated by the finding that deletions and mutations of the cooh - terminal end of aid result in the loss of class switch recombination (which requires aid - induced mutations in switch regions upstream from the constant regions, double - stranded dna breaks, and recombination), but the preservation of v region shm (14, 15), whereas mutations at the nh2-terminal end of aid affect shm but not class switch recombination (16). This suggested that proteins such as rna pol ii and replication protein a, which interact with aid (17, 18), and possibly other unidentified proteins, are required for the selective targeting of aid to certain parts of the immunoglobulin gene . A sensible point of departure, therefore, would be to take a step back and investigate individual protein protein and protein nucleic acid interactions . The paper by wilson et al . (1) identifies a potentially relevant functional interaction between msh2msh6 and pol, proteins that have been shown to be involved in shm diversification (fig . The authors show that endogenous msh2 binds to pol in cell extracts, and that msh2msh6 binds u: g mismatched base pairs, as has also been noted previously (19). The principal observation, however, is that the rate of pol catalyzed dna synthesis is increased 2.4-fold in the presence of msh2msh6 . This increase reflects an enhancement in the catalytic efficiency (vmax / km) of pol with no discernible change in polymerase processivity . Control experiments showed that dna synthesis was unaffected in the presence of msh2msh3 which recognizes larger mismatches, nor did msh2msh6 stimulate pol, an error - prone polymerase of unknown function . Admittedly, although the increase in dna synthesis is a modest 2.4-fold, it nonetheless may imply a coupling of mismatch repair and dna synthetic functions which could not be established solely by detecting protein protein binding interactions using analyses such as chromatin immunoprecipitation . A possible coupling of error - prone dna synthesis with mismatch repair should be viewed in the broader context of determining the temporal fate of a u: g base misrepair . 1, right), but competition for access to the u residue might also include high and low fidelity dna polymerases vying with proteins involved in base excision repair . Each process, depending on when it occurs, could leave its own mutagenic signature . Because a heavy enzymatic traffic jam is likely to converge at the u residue once do replication and repair enzymes encounter u residues in a temporally ordered process or in a random manner governed by mass action? A recent paper by rada et al . (20) addresses the temporal access to u by analyzing shm and class switch recombination in mice deficient for both mismatch repair and base excision repair machinery . The data showed that a: t hypermutation in immunoglobulin v regions was eliminated entirely in mice lacking both msh2 and ung . It had been shown previously that the elimination of either mismatch repair (msh2) or base excision repair (ung) caused a reduction in mutations at a: t sites, with the loss of mismatch repair having a far greater effect (4, 21). It was concluded from that study that mismatch repair is primarily responsible for shm at a: t sites with base excision repair used as a backup pathway (20). This suggests that aid - generated u residues do lead to a process in which msh2msh6 competes with ung for access to the u residue (fig . Studies using the msh2 ung double knock - out mice nicely defined the biochemical realities in vivo by, for example, eliminating a role for uracil dna glycosylases other than ung and focusing our attention on the origins of a: t mutation (20). However, many questions cannot be addressed in vivo, in short - term culture, or in cell lines because molecules such as proliferating cell nuclear antigen and rna pol ii are critical for all cell processes . For example, a possible queuing mechanism directing protein access to u: g might involve the proliferating cell nuclear antigen . Along with its role in increasing the processivity of pol during dna replication, proliferating cell nuclear antigen is known to bind pol (22) and is required for mismatch repair (23). It is possible that proliferating cell nuclear antigen facilitates binding of pol with msh2msh6 proximal to a u: g mismatch, thus coordinating the initiation of mmr with subsequent error - prone gap - filling synthesis . Now that we have learned that msh2msh6 appears to stimulate pol activity directly (1), we can begin to imagine how pol might be selectively recruited to generate mutations at a: t sites as part of the mismatch repair machinery . A biochemical approach to reconstitute shm using purified proteins should help us to advance beyond speculating on the molecular mechanisms . It might also make it possible to address the differences that govern the targeting of each of the repair mechanisms to v and switch region, since the different dna substrates that characterize these regions could be used . An attempt to model g: c and a: t hypermutation raises different questions and engenders different challenges . If we assume that both mutational processes originate from the action of aid on ssdna, perhaps by tracking along the nontranscribed strand of a transcription bubble, as suggested from in vitro experiments using a bacterial t7 transcription assay (79), then how do mutations originate at the same frequency at c sites on the transcribed strand in vivo (24)? The chance that aid might attack a transcribed strand gap during mismatch repair or base excision repair seems unlikely because msh2ung mutant and normal mice show a similar distribution of g: c - targeted mutations, except for the absence of transversions in mutant mice, which is presumably caused by the absence of ung - generated abasic lesions (20). Instead the mammalian rna pol ii transcription apparatus, in contrast to t7, may provide greater access to the transcribed strand . Thus, a mechanistic understanding of g: c and a: t hypermutation would benefit from studying aid in a mammalian transcription system for g: c mutations, and by studying pol in conjunction with msh2msh6-based mismatch repair for a: t mutations . The rationale for splitting the two classes of mutations into two distinct systems is based on the mouse data showing that msh2ung mice appear to mutate g: c but not a: t sites (20). However, if aid acting on ssdna during transcription is responsible for triggering shm (and class switch recombination), then what is responsible for confining these mutations to immunoglobulin v regions? Perhaps specialized transcription factors or chromatin accessibility restrict the targeting of aid to igv genes . One involves the possibility that aid may be acting on rna in vivo, not on dna (25). A second posits that antibody gene diversification requires the presence of ung during class switch recombination, not for its ability to excise u, but rather to stabilize a protein complex needed for the mutational process (26). Arguments for (27) and against (28) this hypothesis have recently appeared in the literature . A third controversy involves the suggestion that endonuclease - catalyzed blunt end double - stranded dna breaks, not aid, are responsible for initiating shm (29, 30). It would seem that the burden of proof in each of these examples rests on showing that aid can use rna as a substrate, that catalytically inactive ung is an essential subunit of a complex whose activity is currently unknown, and that an endonuclease can be identified having a specificity commensurate with the properties of class switching and mutagenesis . As a means of addressing the targeting and trafficking of mutator proteins to immunoglobulin v but not c regions, and in investigating why one repair pathway or error - prone polymerase is chosen in preference to another, biochemistry should play a decisive role in deciphering the mechanisms of antibody diversification . To paraphrase arthur kornberg (31), we cannot be fully confident in our fundamental understanding of somatic hypermutation until the process has been reconstituted successfully using purified proteins with the ultimate goal to capture it alive.
|
, stroke patients can usually recover to some extent, which may be related to structural and functional modifications in surviving brain tissue . Studies on stroke rats and patients have revealed that spontaneous recovery of the motor function after stroke is associated with brain plasticity [15]. Neuroimaging techniques, especially the multimodality mris, have significantly contributed to our understanding of the mechanisms of stroke recovery by characterizing brain structural and functional changes after stroke [610]. Electroencephalogram (eeg) has high temporal resolution; however, it exhibits low spatial resolution and cannot record signals from deep brain tissues . Positron emission tomography (pet) is a radioactive technique with a relatively low spatial resolution . However, mri is a noninvasive technique with high spatial resolution and is especially suitable for longitudinal connectivity studies . Moreover, mri is a multimodality imaging technique that can be used to investigate both anatomical and functional connectivities . Structural mri studies have revealed extensive atrophy in brain regions that connect with stroke lesions . More importantly, increased grey matter volume and cortical thickness were also found in the motor - related areas and hippocampus either during spontaneous recovery or after treatments [1113]. Task - based functional mri (fmri) or pet has been extensively used to investigate brain activation changes during stroke recovery [1416] and has provided important information on the patterns of functional reorganization after stroke [1419]. Movements of the stroke - affected hand are initially activated extensive brain regions in stroke patients [16, 2022] and rats [6, 2330]. However, this initial widespread activation does not predict good functional recovery [3133], whereas normalization of the activation pattern to prestroke level is associated with good outcome . Knowing brain structural or functional alteration in a particular region does not tell us how this region interacts with other regions, which modulates behavior in concert . Recently, connectivity - based methods have been used in stroke patients and rats to demonstrate anatomical and functional connectivity changes after stroke; these changes may be related to clinical deficits and functional recovery . These methods may provide great insight into network dysfunction [21, 3639] and functional reorganization [40, 41] from a system perspective; they will also contribute to predict outcomes and to develop new therapeutic interventions [40, 41]. In this review, we focused on recent neuroimaging studies employing connectivity - based analyses to investigate connectivity changes in the motor network after ischemic stroke . Connectivity models are based on the concept that the brain is organized by segregation of specialized and anatomically distinct brain regions which are functionally integrated in a network mediating motor, sensory, or cognitive processing . There are four common connectivity models: the anatomical connectivity, functional connectivity, effective connectivity, and network models . Diffusion tensor imaging (dti) is the most common method that can detect changes in anatomical connectivity in vivo . In normal white matter, water molecules move relatively freely in a direction parallel to fiber tracts in contrast to the restricted movement across the tracts; this phenomenon is referred to as diffusion anisotropy . Based on diffusion anisotropy, the white matter fiber tracts can be reconstructed using diffusion tensor tractography (dtt) [44, 45]. Fractional anisotropy (fa) and mean diffusivity (md) are the most commonly used dti measures; md reflects the average diffusion amplitude, and fa represents the degree of directionality of microstructures, such as axons, myelin, and microtubules [44, 46]. Dti measures can be analyzed by either data - driven methods (voxel - based analysis and tract - based spatial statistics) or hypothesis - driven methods (region of interest (roi) analysis and tractography - based analysis). Dti and dtt have been used in the evaluation of the white matter damage and reorganization in stroke patients [4751]. In different poststroke stages, alterations of dti measures represent different pathological processes: md decreases at acute stage represent cell swelling; md increases and fa decreases at subacute stage denote cell lysis and demyelination; and fa increases at chronic stage suggests axonal regeneration or remyelination [5255]. It is well recognized that diffusion - weighted imaging (dwi) is capable of yielding considerably more information than that contained in the diffusion metrics derived from dti due to the fact that dti is based upon a gaussian approximation of the diffusion displacement probability function . However, non - gaussian diffusion in the brain really exists [56, 57] and is believed to arise from diffusion restricted by barriers, such as cell membranes and organelles, as well as the presence of distinct water compartments [58, 59]. Diffusional kurtosis imaging (dki) has been proposed to quantify non - gaussian diffusion through the estimation of the diffusional kurtosis [6062]. The mean kurtosis (mk), a principal metric of the diffusional non - gaussianity, is of potential interest to the study of white and gray matter integrity . Dki can provide additional information (non - gaussian diffusion) that cannot be obtained from dti, and it has been suggested that dki may provide enhanced contrast between ischaemic and normal tissues . Besides, mk is sensitive to hyperacute and acute stroke changes and exhibits more significant differences between ischaemic and normal tissues than measures (md and fa) derived from dti . Thus, diffusional kurtosis is sensitive to diffusional heterogeneity and dki may be a promising method in the assessment of ischemic stroke [61, 63, 64]. The resting - state functional connectivity (rsfc) measures temporal coherence of low - frequency fluctuations (<0.1 hz) of the blood oxygenation level - dependent (bold) signals between spatially remote brain regions . Correlation of these signals with underlying neural activity indicates that these fluctuations are of functional significance [6567]. Strong rsfc is first reported in motor network and then is confirmed in other functional systems [69, 70]. The rsfc is present between brain regions with both monosynaptic and polysynaptic connections and depends on intact connections within a specific polysynaptic pathway . It is a promising means of assessing intrinsic information transfer within a functional network while avoiding task - induced confounds . A hypothesis - driven method has been extensively used to analyze rsfc changes . In this method, an roi should be predefined based on hypotheses, and then the rsfc pattern of this roi is obtained by computing correlations in the fmri time courses between the roi and every voxel of the whole brain . The independent component analysis (ica) is the most popular data - driven method to assess rsfc [74, 75]. It has been used to extract brain functional networks and to identify intranetwork rsfc changes . The functional connectivity density (fcd) mapping is another data - driven method and measures the number of functional connections per voxel [77, 78]. These rsfc analytic methods are suited for the investigation of how multiple distributed networks are disrupted by stroke and are reorganized after stroke and what patterns of connectivity are most likely to be behaviorally relevant [40, 41]. In contrast to the nondirectional, correlative nature of functional connectivity, effective connectivity measures the causal influence that one brain area exerts over another under the assumption of a given mechanistic model . This approach can provide crucial knowledge about the direction of information flow and ultimately what kinds of computations are being performed in the system by showing which nodes in a network are driven by which other nodes [35, 40, 41, 79]. Effective connectivity is based on mathematical models that are usually applied to task - based neuroimaging data . The psychophysiological interactions (ppi) model is a relatively simple method to estimate effective connectivity from neuroimaging data . This exploratory method explains activity of a cortical area by means of an interaction term between the influence of another area and some experimental or psychological parameter [80, 81]. Granger causality analysis of effective connectivity is another exploratory method that identifies those voxels that are sources or targets of directed influence for any seed region . In contrast to these exploratory methods, structural equation modelling (sem) and dynamic causal modeling (dcm) are hypothesis - driven approaches that require a priori defined network of brain regions to estimate effective connectivity from neuroimaging data . In addition, the effective connectivity analysis can also be used to resting - state fmri data . In the framework of graph theory, the brain is described as a graph comprising a certain number of nodes (corresponding to brain regions) that are connected by edges (corresponding to anatomical connectivity, functional connectivity, effective connectivity, or other measures of interregional interactions) [8588]. The network's structure can be assessed by measuring its clustering coefficient, a measure of segregation, that reflects the degree to which nodes are clustered, and the shortest path length, a measure of integration, that reflects the minimal number of edges between any pair of nodes . A high clustering coefficient and a low average shortest path length indicate a small - world network topology, which is proposed to be an optimal network configuration for global information transfer and local processing [85, 86, 88]. In addition to measures that assess the efficiency of the whole network, the node degree (i.e., the number of edges connected to a given node) and the betweenness centrality (i.e., the fraction of the shortest paths that pass through a given node) are used to assess the importance of a given node . Brain regions featuring a high node degree and a high centrality are assumed to serve as brain reorganization after stroke is a dynamic process, which considerably differs across patients, depending on lesion location, time since stroke, severity of motor impairment, premorbid state, and even genetics . These contributing factors make it unlikely that one universal measure exists which is suitable for all patients . Consequently, a variety of connectivity analyses have been performed to investigate motor recovery mechanisms after ischemic stroke . Dti and dtt are powerful methods to detect not only impairments but also modifications in anatomical connectivity after stroke [89, 90]. The motor recovery mechanisms in ischemic stroke patients have been summarized as (1) recovery of a damaged lateral corticospinal tract (cst); (2) subcortical perilesional reorganization; (3) ipsilateral motor pathway from the unaffected motor cortex to the affected extremities; and (4) collateral pathway of the pyramidal tract . . Investigated longitudinal cst white matter connectivity changes during stroke recovery using probabilistic dtt in 10 patients with cerebral infarcts . They found that the anatomical connectivity of the cst at the cortical regions within the affected hemisphere was enhanced over time and that the enhanced connectivity was correlated with stroke recovery . Examined the relationship between microstructural status of brain white matter tracts and motor skill of the stroke - affected hand in patients with chronic stroke . They found that motor skill significantly and positively correlated with fa values of the ipsilesional and contralesional cst in these patients . They also found that patients with better motor skill had elevated fa of the bilateral csts compared to controls . However, our previous study of dynamic evolution of the diffusion indices in the degenerated cst did not show any significant plastic changes after ischemic stroke although a slightly elevated fa was found 1 year after stroke . The discrepancy between these studies may be ascribed to methodological differences because we only studied the cst section at the level of pons, which may miss the portion of the cst that exhibits plastic changes . At subacute stage of stroke, decreased fa in ipsilesional white matter has been commonly reported, which reflects demyelination or axonal loss [8, 47, 94]. This initial decrease of fa may be chronically followed by normalization or elevation in the borderzone of the ischemic lesion, which could be further enhanced by treatments with neural progenitor cells, sildenafil, or erythropoietin . Pathological examination confirmed a high density of axons and myelin in this region [9, 95]. The subcortical perilesional reorganization is also reported at the levels of the corona radiata and pons in stroke patients [97101]. These findings suggest that rearrangement of white matter in the ischemic perilesional areas is accompanied by preservation or restoration of neuronal connectivity and may be used to predict motor outcome after stroke . The ipsilateral motor pathway from the unaffected motor cortex to the affected extremities has been regarded as one of the recovery mechanisms of stroke [102106]. However, this mechanism is not supported by other studies [107, 108]. The location and size of the lesions, the different recovery rates, and the analytic methods used in these studies may partly account for the discrepancy . As reviewed by jang, understanding the ipsilateral motor pathway mechanism is important because it is related to poor motor outcome and can be changed with time or manipulated by various rehabilitative interventions [102, 108113]. The pyramidal tract is known to possess collateral pathways in the human brain [114116]. The aberrant pyramidal tract refers to the collateral pathway of the pyramidal tract through the medial lemniscus in the brainstem, which separates from the original pyramidal tract at the level of the midbrain and the pons and descends through the medial lemniscus . Recently, several studies have suggested that the aberrant pyramidal tract may contribute to motor recovery in stroke [117120]. Other motor - related pathways, including the corticorubrospinal and corticoreticulospinal tracts and the transcallosal motor pathways, may also contribute to the potential for functional recovery [121, 122]. For example, rber et al . Reported increased white matter integrity in the corticorubrospinal tract within the vicinity of the red nuclei . They also found strong correlations between microstructural properties of this tract and the level of motor function in chronic stroke patients, which highlight a compensatory function of the corticorubrospinal system . In a longitudinal rsfc study of rats after unilateral stroke, the authors found considerable loss of rsfc between the ipsilesional and contralesional primary sensorimotor cortex regions, alongside significant sensorimotor function deficits in the first days after stroke . The interhemispheric rsfc restored in the following weeks but remained significantly reduced up to 10 weeks after stroke in rats with lesions that comprised both the subcortical and cortical tissues . Intrahemispheric rsfc between the primary somatosensory and motor cortex areas was preserved in the lesion border zone and moderately enhanced contralesionally . The temporal pattern of changes in rsfc between the bilateral primary motor and somatosensory cortices correlated significantly with the evolution of sensorimotor function scores . Subsequently, these authors confirmed that the decreased interhemispheric rsfc between the ipsilesional and contralesional primary sensorimotor cortex regions is associated with a decrease in transcallosal manganese transfer between these regions . Using the same stroke rat model, these authors recently found that the degree of functional recovery after stroke was associated with the extent of preservation or restoration of the ipsilesional corticospinal tracts in combination with reinstatement of the interhemispheric neuronal signal synchronization and normalization of small - world cortical network organization . Similar rsfc changes were also found in stroke patients . Immediately after stroke, significantly decreased rsfc of the ipsilesional primary sensorimotor cortex, especially the interhemispheric rsfc, was consistently reported [36, 124126]. These decreased rsfcs were then gradually increased during recovery process and finally restored to the levels of near normal, normal, or above normal [36, 124126]. In acute stroke patients, carter and colleagues reported that disruption of the interhemispheric rsfc within the attention network was significantly correlated with abnormal detection of visual stimuli . In the somatomotor network, in contrast, intrahemispheric rsfcs within the normal or damaged hemispheres were not correlated with performance in either of the two networks . Recently, a longitudinal study revealed that the rsfcs of the ipsilesional primary motor cortex (m1) with the contralesional thalamus, supplementary motor area (sma), and middle frontal gyrus at onset were positively correlated with motor recovery at 6 months after stroke . In subacute stroke patients, the interhemispheric rsfc was negatively correlated with the extent of corticospinal damage . Although corticospinal damage accounted for much of the variance in motor performance, the behavioral impact of rsfc was greater in subjects with mild or moderate corticospinal damage and less in those with severe corticospinal damage . In chronic stroke patients, different outcomes are found to be associated with different change patterns of the rsfcs . Moreover, the longitudinal changes of the rsfcs after stroke were correlated with modification of motor function . Besides the altered rsfcs within the motor network after stroke, reduced interhemispheric connectivity was also found between the attention - related areas in stroke patients with neglect [36, 128] and the language areas in stroke patients with aphasia . However, the effect of anatomical damage may extend beyond the lesioned area but remain within the bounds of the existing network connections . This concept is well elucidated by the finding of double dissociation of two cognitive control networks in patients with focal brain lesions . The degree of network damage correlates with a decrease in rsfc within that network while sparing the nonlesioned network . Applied dynamic causal modeling to investigate changes of effective connectivity among the m1, lateral premotor cortex (pmc), and sma in subacute stroke patients when they performed visually paced hand movements with their left, right, or both hands . Independently from hand movements, the intrahemispheric effective connectivity between the ipsilesional sma and m1 and the interhemispheric effective connectivity of both the smas were significantly reduced . Furthermore, movements of the stroke - affected hand showed additional inhibitory influences from the contralesional to the ipsilesional m1 that correlated with the degree of motor impairment . For bimanual movements, interhemispheric communication between the ipsilesional sma and contralesional m1 the study suggested that the motor deficit of patients with a single subcortical lesion was associated with pathological interhemispheric interactions among the key motor areas . A dysfunction of effective connectivity between the ipsilesional and contralesional m1, and between the ipsilesional sma and contralesional m1 underlied hand motor disability after stroke . Changes in effective connectivity among the m1, sma, and cerebellum (ce) were also assessed in chronic stroke patients using dynamic causal modeling . Relative to healthy controls, stroke patients exhibited decreased intrinsic neural coupling between the m1 and ce, but showed increased sma to m1 and sma to cerebellum couplings . The results demonstrate that connectivity alterations between motor areas may help to counterbalance a functionally abnormal m1 in chronic stroke patients . The temporal evolution of intra- and interhemispheric effective connectivity was also investigated during motor recovery from the acute to the early chronic phase after stroke [131, 132]. Results showed reduced positive coupling of the ipsilesional sma and pmc with the ipsilesional m1 in the acute stage . Coupling parameters among these areas increased with recovery and predicted a better outcome . Likewise, negative influences from the ipsilesional areas to the contralesional m1 were attenuated in the acute stage . In the subacute stage, the contralesional m1 exerted a positive influence on the ipsilesional m1 . Negative influences from the ipsilesional areas on the contralesional m1 subsequently normalized, but patients with poorer outcome in the chronic stage now showed enhanced negative coupling from the contralesional upon the ipsilesional m1 . These findings show that the reinstatement of effective connectivity in the ipsilesional hemisphere is an important feature of motor recovery after stroke . The shift of an early, supportive role of the contralesional m1 to enhanced inhibitory coupling might indicate maladaptive processes which could be a target of noninvasive brain stimulation techniques . Sharma et al . Investigated well - recovered stroke patients performing a motor imagery task, and found that the regional activations had returned to normal in the patients . In addition to reduced effective connectivity among the motor - related brain areas, they found significantly enhanced positive influences from the prefrontal cortex to both the sma and pmc in stroke patients using an sem analysis of effective connectivity . The authors suggest that enhanced coupling of the prefrontal areas might reflect the enhanced role of cognitive - related areas that facilitate movement planning to overcome the functional deficits caused by the damage to the motor pathways . The effective connectivity can also be investigated during resting state . Using an sem analysis, inman and coauthors focused on the intrinsic effective connectivity of top - down motor control in stroke patients exhibiting significant motor deficit . They found alterations in resting - state effective connectivity from the frontoparietal guidance systems to the motor network in stroke survivors . More specifically, diminished connectivity was found in connections from the superior parietal cortex to the m1 and sma . These findings suggest that characterizing the deficits in resting - state connectivity of top - down processes in stroke survivors may help optimize cognitive and physical rehabilitation therapies by individually targeting specific neural pathway . The first preliminary study on the functional network efficiency changes after stroke was performed using graph theoretical measures on electroencephalography (eeg) data of 1 stroke patient and 8 healthy subjects when they performed a finger tapping task . The authors found significant decrease in global and local efficiency in the patient's networks, reflecting a lower capacity to integrate communication between distant brain regions and a lower tendency to be modular . They also showed that these changes were associated with significant increases in the disconnected nodes and in the links of some other crucial vertices . The authors concluded that overall connectivity after stroke was governed by a lower number of brain regions in which increased connectivity could not compensate for the drastic reduction in information propagation . The poststroke longitudinal changes in motor network efficiency have been reported in a resting - state fmri study in which the authors used graph theory to assess changes in the topological configuration of the motor network from the acute phase to the chronic phase after subcortical stroke . They found that over a year of recovery, motor execution network showed lower local efficiency within the network suggesting a shift towards a nonoptimal network configuration with less functional segregation . The overall decrease in network efficiency was paralleled by a stronger betweenness centrality of the ipsilesional m1 and cerebellum, the latter being a measure of the functional importance of a node for information processing . The increased importance of the ipsilesional m1 within the motor network after recovery was also indicated by stronger functional connectivity of this area with the contralesional motor areas . Recently, the functional network characteristics of the whole brain were also investigated in stroke patients from the perspective of graph theory . A longitudinal design was adopted in the study and the network measures were calculated based on the fmri data when subjects were performing a finger tapping task . The authors showed that the brain networks shifted towards a nonoptimal topological configuration with low small worldness during the process of recovery . However, in an experimental stroke model, a rather different pattern of changes of network features were reported . They found that the clustering coefficient, shortest path length, and small worldness of the motor network of stroke rats were significantly increased in the first poststroke days, and then these network measures declined towards a normal level . The authors speculate that the initial increase of network measures may be associated with initial excessive neuronal clustering and wiring, whereas the later decline toward a baseline small - world topology may be related to the refinement of the reorganized network . They also explain the discrepancy between their study and the findings of wang et al . By the differences between the (re)organization of rat and human brain and the differences in the analytical methods . Using dtt data, crofts and colleagues investigated the anatomical network efficiency changes after stroke . They proposed a measure of communicability that estimates the ease through which information can travel across a network . They found reduced communicability in stroke patients in both regions surrounding the lesions in the affected hemisphere and homologous locations in the contralesional hemisphere . They also identified regions with increased communicability in patients that could represent adaptive, plastic changes after stroke . Much evidence has suggested that stroke patients will benefit significantly from rehabilitative therapies beyond spontaneous recovery of function [138, 139]. Recently, connectivity analyses have been used to investigate the intervention effects on brain connectivity . The preliminary experimental studies have suggested that treatments with neural progenitor cells, sildenafil, or erythropoietin induced increased fa in the ischemic lesion borderzone, which reflects a high density of axons and myelin in this region [9, 97]. In chronic stroke patients participating in a regimen of electrical stimulation targeting the paretic arm, after an 8-week therapy, these patients exhibited decreased mean diffusivity (md) in the middle cerebellar peduncle and posterior limb of the internal capsule following treatment, which suggests that active rehabilitative therapies augmented by electrical stimulation may induce positive behavioral changes by increasing white matter tract integrity in regions specific to sensory - motor function . In stroke patients with aphasia, both intense intonation - based speech therapy and constraint induced language therapy could induce increased fibers or white matter integrity in fiber tracts involved in language function . Wu and colleagues observed the longitudinal changes of dti measures after acupuncture treatment in rats with transient focal cerebral ischaemia . They found significantly increased fa at the edge of the ischemic lesions in stroke rats with acupuncture treatment . The effect of acupuncture therapy for postponing wallerian degeneration secondary to cerebral infarction has also been observed by dti in stroke patients . The authors found that acupuncture treatment was effective for protecting white matter integrity in stroke patients . The rsfc was assessed before and after a 12-week robot - aided motor rehabilitation program . The authors found that the rsfc between the ipsilesional and contralesional m1 reduced after a bout of motor rehabilitation . Greater reduction in the interhemispheric rsfc was associated with greater gains in motor function induced by the 12-week robotic therapy program . These findings suggest that greater reduction in interhemispheric rsfc in response to a bout of motor rehabilitation may predict greater efficacy of the full rehabilitation program . A recent study examined the effects of upper - extremity robot - assisted rehabilitation (manus) versus an electroencephalography - based brain computer interface setup with motor imagery (mi eeg - bci) and compared pretreatment and posttreatment rsfcs . The authors found that the individual gain in motor function over 12 weeks could be predicted by the rsfc changes before and after treatment . Both the motor function gain and increases in rsfcs of the sma, the contralesional and ipsilesional motor cortex, and parts of the visuospatial system with mostly association cortex regions and the cerebellum were correlated with individual upper - extremity function improvement . A placebo - controlled, double - blind, and crossover design study was performed to investigate the effects of noradrenergic stimulation on the cortical motor system in hemiparetic stroke patients . Effective connectivity analyses with dcm revealed that in stroke patients neural coupling with the sma or vpmc was significantly reduced compared with healthy controls . This hypoconnectivity was partially normalized when patients received reboxetine (rbx), especially for the coupling between the ipsilesional sma and m1 . The data suggest that noradrenergic stimulation may help to modulate the pathologically altered motor network architecture in stroke patients, resulting in increased coupling of the ipsilesional motor areas and thereby improved motor function . Resting - state fmri data were analyzed using the sem to evaluate therapy - related changes in motor network effective connectivity in stroke patients after 3 weeks of upper - extremity rehabilitation in the accelerated skill acquisition program (asap). The authors found that the behavioral improvement after training of the impaired upper extremity is accompanied by increased influence of the affected hemispheric pmc upon the unaffected hemispheric pmc and on the affected hemispheric m1 . The relationship between behavioral recovery and interhemispheric and intrahemispheric communication has been investigated by inhibiting the contralesional m1 using1-hz repetitive transcranial magnetic stimulation (rtms). After inhibiting the contralesional m1 using 1-hz repetitive transcranial magnetic stimulation (rtms) the connectivity analysis revealed that the behavioral improvements were significantly correlated with a reduction of the negative influences originating from the contralesional m1 during paretic hand movements . Concurrently, endogenous coupling between the ipsilesional sma and m1 was significantly enhanced after rtms was applied over the contralesional m1 . The connectivity analyses suggest that both a reduction of pathological transcallosal influences and a restitution of ipsilesional effective connectivity between the sma and m1 underlie improved motor performance . A growing body of evidence from connectivity - based analyses of functional imaging data has told us that a focal stroke lesion may affect not only the lesion site but also the network to which it belongs . Thus the connectivity - based analytic methods may be more appropriate for elucidating stroke - induced impairments from a network perspective and for clarifying the mechanisms of motor recovery after stroke . Moreover, connectivity analyses are likely to be better suited to investigate the mechanisms through which therapeutic interventions may facilitate the recovery of motor function and help us to develop new intervention therapies targeting the restoration of the function of the motor network . Finally, connectivity measures may serve to monitor the process of stroke recovery and to predict the outcomes of stroke patients at an early stage . However, conflicting findings exist and the exact mechanisms leading to changes in brain connectivity after stroke remain elucidated . Therefore, longitudinal studies with large sample size employing different neuroimaging modalities covering the whole period from the superacute stage to the late chronic stage are needed to further our understanding of how different types of brain connectivity evolve after stroke and how they relate to motor deficits and clinical outcome.
|
Accurately computing the free energy of binding a ligand to a protein is a task of essential importance in biochemical and biophysical studies that still presents us considerable difficulty to overcome . An effective approach in the current literature is to use the relationship between the potential of mean force (pmf) and the binding affinity . The equilibrium approaches, based on pmf or not, are not brute force in nature but require delicate choices of biasing / constraining potentials during the simulation processes . The nonequilibrium steered molecular dynamics (smd) approach, seemingly brute force, can be very efficient in sampling forced transition paths from the bound state to the dissociated state of the ligand but has not been used reliably for free - energy calculations with quantitative accuracy . In this paper, we present a hybrid steered molecular dynamics (hsmd) approach that produces binding affinities in quantitative agreement with experimental measurements (within a factor of 1.5 in terms of the dissociation constant kd defined as the ligand concentration at which the holoprotein concentration equals the apoprotein concentration). The hsmd approach is based on the relationship between the pmf and the binding affinity in the established literature . The widely used smd involves pulling one center of mass of one selection of the ligand atoms using a spring of finite, carefully chosen, stiffness . In contrast, the hsmd approach involves pulling n (n = 1, 2, 3, ...) centers of mass of n selected segments of the ligand (using n springs of infinite stiffness to disallow any fluctuation of the pulling centers along the way) to produce a 3n - dimensional (3n - d) pmf curve leading from the binding site on or inside the protein to the dissociated state in the bulk region far from the protein . This pmf difference between the bound state and the dissociated state gives a large (but not dominant) part of the absolute binding free energy . Another part of the hsmd approach is the equilibrium molecular dynamics (md) sampling of the ligand s fluctuations at the binding site that also contribute to the binding free energy . The third, final, part of the hsmd approach is smd stretching and equilibrium md sampling of the ligand in the dissociated state when one of the n pulling centers is fixed at a point in the bulk far from the protein . Protein complexes whose binding affinities were experimentally measured and whose crystal structures are available: oca glb, caprylic acid (25 atoms, neutral) bound to bovine -lactoglobulin; and gsh sjgst(y7f), glutathione (36 atoms, singly negatively charged) bound to schistosoma japonicum glutathione s - transferase tyrosine 7 to phenylalanine mutant . The computing times required were approximately 62 wall - clock hours for oca glb (all - atom model of 95 296 atoms) and 88 wall - clock hours for gsh sjgst(y7f) (all - atom model of 114 538 atoms), respectively, using 32 xeon e5 - 2628 processors (512 cores) in parallel . In each of the two cases, following the standard literature, the binding affinity at one binding site is1where c0 is the standard concentration . For clarity and for convenience of unit conversion, we use two different but equivalent forms: c0 = 1 m on the left - hand side and c0 = 6.02 10/ on the right - hand side of eq 1 . The three - dimensional (3d) integrations are over the x-, y-, and z - coordinates of the ligand s position r1 that can be chosen as the center of mass of one segment of or the whole ligand . The integral has the units of that renders the right - hand side dimensionless, as it should be . The subscripts site and bulk indicate that r1 is near the pmf minimum and r1 = r1 in the bulk region far from the protein, respectively . For a ligand whose size is not small and whose shape is not simple, the position of one segment center r1 will not be sufficient / efficient to represent its location and situation . Instead, the ligand can be better described with the positions (r1, r2,..., rn) of n centers of mass of its n chosen segments . Figure 1 shows an example of n = 3, where the positions (r1, r2, r3) of the three -carbons of glutathione are chosen to quantify the location and situation of the ligand . These n positions fluctuate without being in any way biased / constrained during the equilibrium md simulation of the bound state . They are steered during the smd runs from the bound state to the dissociated state for constructing the 3n - d pmf w[r1, r2,..., rn] as a function of these positions . In the dissociated state, one of them will be fixed at r1 = r1 while all others (r2,..., rn) rotate and fluctuate according to the stochastic dynamics of the system without any other bias / constraint . The three -carbons of gsh are shown as yellow balls marked with their position vectors . The protein surface is shown as wire frames and the ligand is shown as licorice, all colored according to atom names . Note that in the relationship between the 3d and 3n - d pmfs2the 3(n 1)-d integration over the (n 1) positions (r2,..., rn) is effectively in a defined neighborhood of r1 because the ligand as one whole molecule dictates that the n centers cannot be stretched much farther from one another than its molecular size . When r1 is near the binding site, when the ligand is in the dissociated state, r1 needs to be so far from the protein that integration over (r2,..., rn) will be all in the region far from the protein . C is the normalization constant that will be canceled out in the following expressions . Making use of eq 2 twice in eq 1 (for the binding site and for the bulk), one has the following expression for the binding affinity.3 now inserting the boltzmann factor at a single state (r10, r20,..., rn) chosen from the bound state ensemble and the boltzmann factor at the corresponding dissociated state (r1, r2,..., rn), the binding affinity can be expressed as three contributing factors: the partial partition function at the binding site zn0, the pmf difference between two chosen states (r10, r20,..., rn0) and (r1, r2,..., rn), and the partial partition function in the dissociated state zn. Mathematically4here (r1, r2,..., rn) can be connected to (r10, r20,..., rn0) via many curves in the 3n - d space, but the pmf is a function of state . Computation of the pmf difference between the two states can be achieved along a single curve passing through them both . The partial partition function zn0 of the bound state has the integration over all n centers and thus has the units of .5 the partial partition function zn of the dissociated state has the integration over n 1 centers and thus has the units of .6 again, the use of c0 = 6.02 10/ on the right - hand side of eq 3 renders it a pure number as desired . The dissociation constant will conveniently be in the unit of m = moles per liter . The 3n - d pmf difference7is between one chosen bound state and its corresponding dissociated state . This pmf difference can be computed by means of the smd simulations described in the latter part of this section . Note that the one chosen position of the ligand in the bound state8is the starting point for smd runs . It does not have to be the minimum of the pmf but any one state in its close neighborhood . Note that we take the collection of coordinate vectors, e.g., eq 8, as a single - row 1 3n matrix . Its transpose in the following eq 13 is a single - column 3n 1 matrix . The one state chosen from the dissociated state ensemble9is related to the smd starting point by a large enough displacement in the 3n - d space.10here vd is the constant velocity of the smd pulling and t is the time it takes to steer / pull the ligand from the binding site to the bulk . The reference point for the pmf, w[r1, r2,..., rn] = 0, is chosen as when the ligand is far from the protein . The absolute free energy of binding is11 with all this, one needs to compute three factors to determine the absolute free energy of binding . (1) the first factor is the pmf difference between one chosen bound state and its corresponding dissociated state that can be computed by running smd simulations of pulling the ligand forward and backward along a 3n - d line connecting the two states . Note that the pmf is a function of state (a point in the 3n - d space) and the pmf difference is independent of the paths connecting the two end points . (2) the second factor is the partial partition function in the bound state that can be approximated as gaussian in cases of strong binding or can be numerically evaluated by running equilibrium md simulation . (3) the third factor is the partial partition function in the dissociated state that needs to be computed case by case for n = 2, 3, .... when the binding is tight, one can approximate the integral of eq 5 as gaussian in the neighborhood of the pmf minimum . The coordinates of the minimum of a gaussian distribution are equal to the average coordinates, of course, (r1, r2,..., rn). Carrying out the gaussian integral, one has12here the dimensionless quantity n / kbt gives a measure of how far (r10, r20,..., rn0), the initial state chosen for smd, is from the pmf minimum (r1, r2,...n is the 3n 3n matrix of the fluctuations / deviations of the pulling center coordinates x1, in the bound state ensemble:14 n1 is the inverse matrix of n which can be accurately evaluated by running equilibrium md in the bound state of the ligand this approximation is generally valid if the ligand does not deviate much from the binding site . However, it is invalid if the binding is extremely weak or the binding site is not well localized . Then one would have to evaluate the 3n - d integral in eq 5 directly by numerical means . To decide whether the gaussian approximation is suitable or not, one can evaluate how far from the gaussian distribution is the distribution of the fluctuations at the binding site . Note that this evaluation does not require additional equilibrium md runs in the bound state of the ligand for example, by computing the first to the fourth moments of the fluctuations and checking their relationships, one can readily determine the non - gaussian - ness of the fluctuations . Unlike the partial partition function zn0 of the bound state, the computation of the partial partition function of the dissociated state, zn in eq 6, needs to be done individually for each case of n = 1, 2, .... in the following, we detail three cases: n = 1, 2, and 3 . When one center of mass is steered, n = 1, z1 = 1, all we have to do is to evaluate the fluctuations around the binding site (the 3 3 matrix 1) along with the pmf difference . In this case, we have the dissociate constant, within the gaussian approximation of the fluctuations at the binding site15and the absolute free energy of binding the ligand to the protein16 it needs to be pointed out that the method of pulling one center of the ligand is only practical for small ligands of simple shapes . Furthermore, the gaussian approximation of the ligand fluctuations at the binding site in eq 12 is inapplicable to cases of large fluctuations . For example, glycerol binds to glpf inside the conducting channel and its fluctuations inside the channel are large and non - gaussian . In the computation of its binding affinity, some special attention needs to be paid to the integral of eq 5 instead of using the gaussian approximation in eq 12 . When two centers of mass are steered, n = 2, one has17which is an integration over the second steering center when the first steering center is fixed in a position r1 far from the protein . All one needs to do now is to evaluate the integral of eq 17 around the position (r1, r2). Over there, far from the protein, the ligand s environment is spherically symmetrical around the position of the first pulling center r1 that is fixed while the second pulling center r2 is free to sample all space available . Therefore, the 3d integral becomes the following one - dimensional integral:18where r = |r2 w[r] here, as a function of r, is the pmf (reversible work) for stretching the ligand between the two pulling centers . It can be evaluated by conducting smd runs of steering the second pulling center r2 to and from the first pulling center that is fixed at r1 along the axis passing through (r1, r2). In this, we have the absolute free energy of binding the ligand to the binding site19and the dissociation constant20here the partial partition function of the dissociated state z2 is given in eq 18 and the partial partition function of the bound state is approximated below as gaussian.21where 2 is a 6 6 matrix of coordinate deviations defined in eq 14 and 2 is defined in eq 13 with n = 2 . It is worth noting that, for protein ligand complexes whose binding is strong, the computation of z20 and z2 can be carried out efficiently with sufficient accuracy . Particularly, if the orientational entropy plays a large role, one needs to pull three or more centers of the ligand segments . When three centers of mass are steered, n = 3, we need to evaluate the integral of eq 6 around the position (r1, r2, r3) when the ligand is far from the protein . Over there, the ligand s environment is spherically symmetrical around the position of the first pulling center r1 that is fixed while the second and the third pulling centers r2 and r3 are free to sample all space available . The pmf w[r1, r2, r3] is only dependent upon three of the six degrees of freedom contained in (r2, r3). Namely22where r21 = |r2 r1| and r31 = |r3 r1| are the distances between the second / third pulling center and the first pulling center that is fixed at r1. Is the angle between (r2 r1) and (r3 r1). Therefore, the six - dimensional integral of eq 6 becomes the following 3d integral:23 in terms of the 3d probability distribution (r21, r31,), the integral becomes24which can be evaluated by equilibrium sampling in the 3d space (r21, r31,) from md runs with r1 being fixed at r1. Is the angle between (r2 r1) and (r3 r1), of course . If the equilibrium sampling in 3d cannot be achieved with sufficient accuracy, we can approximate the pmf as three separable terms:25correspondingly, we obtain26here is a factor negating the possible error introduced in eq 25 . The pmf w[r21], as a function of the distance between the two pulling centers r21, can be evaluated by conducting smd runs of steering the second pulling center r2 to and from the first pulling center that is fixed at r1 along the axis passing through (r1, r2). The pmf w[r31], as a function of the distance between the two pulling centers r31, can be evaluated by conducting smd runs of steering the third pulling center r3 to and from the first pulling center that is fixed at r1 along the axis passing through (r1, r3). The -integral can be approximated by conducting equilibrium md runs with the first pulling center fixed at r1 to sample angular distribution . Note that the direct sampling method in eq 24 is exact but it requires sufficient sampling in the 3d phase space (r21, r31,), which is not an easy task . The approximation eq 26 can be evaluated with much less sampling effort in the dissociated state, but it involves the approximation in eq 25 that is somewhat arbitrary . When the two methods produce similar results (as is the case in this work), one can be confident of the computation, of course . After all this, we have the free energy of binding the ligand to the binding site:27 the corresponding binding affinity is 28 note that, by pulling three centers of the ligand, it is easier to compute the pmf difference w[r10, r20, r30] w[r1, r2, r3] as the overall orientation of the ligand is fixed along the pulling paths . Also, the computation of z30 is not difficult for complexes of strong binding whose equilibrium fluctuations can be well approximated as gaussian:29where 3 is a 9 9 matrix of coordinate deviations defined in eq 14 and 3 is defined in eq 13 with n = 3 . However, the computation of z3 will be considerably more elaborate than z2. Nevertheless, for long ligands of irregular shapes, pulling three or more centers should be the optimal method for accurately computing the binding free energy or binding affinity . In an smd simulation of the current literature, one steers / pulls one center of mass of one selection of atoms, using a spring with a carefully chosen stiffness (spring constant). The use of a spring of finite stiffness introduces fluctuations and dissipation in the added degrees of freedom . In this paper, we choose n segments (mutually exclusive n selections of atoms) of the ligand molecule for steering / pulling with n infinitely stiff springs (n = 1, 2, 3, ...). Namely, the n centers of mass of the chosen n segments will be controlled as functions of time t30while all the other degrees of freedom of the system are freely subject to stochastic dynamics . Here ri = (xi, yi, zi) is the center of mass coordinates of the ith segments . The + and signs are for the forward and reverse pulling paths, respectively . {ri} denotes (r1, r2,..., rn), etc . The path from the bound state to the dissociated state is divided into a number of sections . Within a given section whose end states are marked as a and b, respectively, multiple forward and reverse pulling paths are sampled along which the work done to the system is recorded . The gibbs free energy difference (namely, the pmf or the reversible work) is computed via the brownian dynamics fluctuation dissipation theorem (bd - fdt) as follows:31here the brackets with subscript f and r represent the statistical average over the forward / reverse paths . W{ria} {ri} is the work done to the system along a forward path when the ligand is steered from a to r. w{ri}{ria} = w{rib}{ria} w{rib}{ri} is the work for the part of a reverse path when the ligand is pulled from r to a. {ria}, {ri}, and {rib} are the coordinates of the centers of mass of the steered segments of the ligand at the end state a, the general state r, and the end state b of the system, respectively . At each end of a section, a / b, the system is equilibrated for a time long enough to reach conditioned equilibrium while the steered centers are fixed at {ria}/{rib}. In this way, running smd section by section, we map the pmf w[{ri}] as a function of the steered centers along a chosen path from the ligand s bound state to its dissociated state . In all the equilibrium md and nonequilibrium smd runs we implemented langevin stochastic dynamics with namd to simulate the systems at a constant temperature of 298 k and a constant pressure of 1 bar . Full electrostatics was implemented by means of particle mesh ewald (pme) at 128 128 128 . The time step was 1 fs for short - range interactions and 2 fs for long - range interactions . Selected -carbons on -helices and -sheets far from the binding site are fixed to their crystal structure coordinates, fully respecting the experimentally determined ligand protein structures . The pulling was along the z - axis at a speed of 2.5 / ns in all smd runs . Namely, vd = (0, 0, 2.5 / ns). The simulation system of the oca lgb complex is illustrated in figure 2, which was set up by taking the crystal structure of the protein ligand complex from the pdb (code 3nq9), putting it in the center of a box of water, neutralizing the system, and then salinating it with na and cl ions to the concentration of 150 mm . Running equilibrium md for 25 ns leads to the equilibrated system shown in figure 2 . In particular, the equilibrium structure of oca bound to the protein is shown in figure 2d, where the c8 (position vector r1) and c1 atoms (position vector r2) were highlighted with the green and red balloons, respectively . These two atoms were chosen as the two steering / pulling centers for the nonequilibrium smd runs . At the binding site, the two pulling centers (r1, r2) fluctuate inside the binding pocket with small amplitudes (shown in the supporting information, figure s1). These fluctuations give us the following statistics at the binding site: the determinant of the deviation matrix det(2) = 2.42 10 and the deviation of the smd initial state from the pmf minimum 2 = 1.68 kcal / mol . Lgb complex (95 296 atoms, 100 100 92 in dimension). Na and cl ions are represented by vdw (spheres) colored in yellow and cyan, respectively; water is represented by red and white dots; protein is represented by ribbons colored by residue types; and the ligand (not easily visible) is represented by licorices colored according to atom names . Caprylic acid, visible on top of the figure, is represented by licorice while protein is represented by ribbons and by cpk (ball - and - stick), both colored according to residue types . (c) caprylic acid (in licorice colored in green) resides in the binding pocket of the protein (in surface representation colored according to atom names). The two groups (highlighted in red and green respectively) are selected for steering / pulling . Conducting multiple smd runs starting from the initial state (r10, r20) to the final state (r1, r2) along the z - axis, we sampled four forward and four reverse pulling paths connecting the two states . The curves of work done to the system along the pulling paths are shown in the supporting information, figure s2 . From those work curves, we computed the pmf as a function of the z - displacement z shown in figure 3a . This pmf curve gives us the pmf difference between the one chosen bound state and its corresponding dissociated state:32 note that the pmf rises gradually all the way until z = 8 as the ligand is steered out of the binding pocket . This behavior clearly reflects the hydrophobic nature of the deep binding pocket of lgb and that of oca s long hydrocarbon chain . The van der waals attraction between oca and lgb is gradually reduced along the dissociation path, and meanwhile, the hydrophobic surfaces of lgb and oca are increasingly exposed to water as they are steered apart from one another . These two together are responsible for binding oca s hydrocarbon chain inside lgb s -barrel, giving rise to a large part of the binding free energy . There are two other parts of the binding free energy: first, fluctuations of oca inside the barrel as represented by z20 . Second, the rotation and fluctuations of oca in the dissociated state represented by z2. In the dissociated state, we fixed the c8 atom at r1 and steered the c1 atom (position vector r2) toward and away from c8, sampling four forward paths and four reverse paths (shown in the supporting information, figure s2). From the work curves along those pulling paths, we obtained the pmf w[r] in the dissociated state as a function of the c1c8 distance r shown in figure 3b . Carrying out the integral of eq 18 using this pmf curve, we obtained the partial partition function in the dissociated state z2 = 2.01 10 . (a) pmf w[r1, r2] as a function of the ligand displacement from its binding site along the pulling path when two centers are steered away from the protein . (b) pmf w[r] in the dissociated state as a function of the distance r between the two steered centers (the c1 and c8 atoms). W[r0] = 0 where r0 = 8.40 is the distance between c1 and c8 atoms of oca at the binding site . It is not surprising to note that the ligand conformation in the bound state represented by the distance between the two pulling centers (c1 and c8 atoms)33is not optimal in the dissociated state . For a range of r values, the pmf has lower values:34 in the bulk region, away from the protein, the linear oca hydrocarbon carbon chain will fluctuate more freely than in the binding pocket of lgb . These effects constitute a significant contribution to the binding free energy represented in the partial partition function z2. Putting all the afore - presented results together into eq 19, we obtain the absolute binding energy of 5.7 0.6 kcal / mol (corresponding to a dissociation constant of kd = 71 m) that is in comparison with the in vitro result of 5.5 kcal / mol (kd = 92.6 m). The simulation system box of the gsh sjgst(y7f) complex was set up by taking the crystal structure of the protein ligand complex from the pdb (code 1u87), putting it in the center of a box of water, neutralizing the system, and then salinating it with na and cl ions to the concentration of 150 mm . Running equilibrium md for 30 ns leads to the equilibrated system shown in figure 4 . In particular, the equilibrium structure of glutathione is shown in figure 4d, where the three -carbons ca1 (position vector r2), ca2 (position vector r1), and ca3 (position vector r3), were highlighted with the red, green, and blue balloons, respectively . These three atoms were chosen as the three steering / pulling centers for the nonequilibrium smd runs . At the binding site, the three pulling centers (r1, r2, r3) fluctuate inside the binding pocket with small amplitudes (shown in the supporting information, figure s3). These fluctuations give us the following statistics at the binding site: the determinant of the deviation matrix det(3) = 2.53 10 and the deviation of the smd initial state from the pmf minimum 3 = 5.78 kcal / mol . Conducting multiple smd runs starting from the initial state (r10, r20, r30) to the final state (r1, r2, r3) along the z - axis, we sampled four forward and four reverse pulling paths connecting the two states . The curves of work done to the system along the pulling paths are shown in the supporting information, figure s4 . From those work curves, we computed the pmf as a function of the z - displacement (shown in figure 5). This pmf curve gives us the pmf difference between the one chosen bound state and its corresponding dissociated state.35 (a) the in silico system box (114 538 atoms, 100 100 113 in dimension). Na and cl ions are represented by vdw (spheres) colored in yellow and cyan respectively; water is represented by red (oxygen) and white (hydrogen) balls and sticks (cpk); protein is represented by ribbons colored according to residue types; and the ligand gsh (not easily visible) is represented by licorices colored according to atom names . (b) gsh (licorice colored according to atom names) in complex with the protein (ribbons colored according to residue types and cpk colored according to atom names). (c) gsh (licorice colored according to atom names) in the binding pocket . Here the protein surface (colored according to atom names) near or around the binding site is shown . (d) gsh in licorice with its three -carbons bubbled in red (ca1), green (ca2), and blue (ca3) balloons . Pmf w[r1, r2, r3] along the path of pulling gsh out of the binding pocket . Pulling its center of mass (n = 1) would not be efficient for sampling the relevant phase space . Pulling three centers (n = 3) turned out to be effective as indicated in the pmf curve of figure 5 . The pmf rises most rapidly during the first 1.5 of displacement, showing effectiveness of pulling the three -carbons of gsh simultaneously to separate its backbone from the protein . From 1.5 to 7 the oscillatory rise in pmf indicates separation of gsh side chains from the protein . After that, the pmf gradually rises some more and then levels off after 15, indicating the ligand is in the bulk region (dissociated from the protein). Pulling three centers here is advantageous over pulling one center because the separation of the ligand from the protein, if pulled by one center, involves tight entanglement of the ligand s fluctuations in conformation and in orientation with the fluctuations of the many residues at and near the binding site . By pulling three centers, this disentanglement of two sets of fluctuations turned out to be very effective . In the dissociated state, we computed the partial partition function z3 in two ways . First, we used eq 24 on the long time equilibrium fluctuations of ca1 (r2) and ca3 (r3) around ca2 (fixed at r1) shown in the supporting information, figure s5 . Second, we computed the pmfs in eq 26 . Fixing ca2 at r1, we conducted smd runs steering ca1 (r2) toward and away from ca2, sampling four forward and four reverse pulling paths (shown in the supporting information, figure s6a). Likewise, steering ca3 (r3) toward and away from ca2, we sampled four forward and four reverse pulling paths (shown in the supporting information, figure s6b). From those work curves, we extracted the pmf w[r21] as a function of the ca1ca2 distance in figure 6a and the pmf w[r31] as a function of the ca3ca2 distance in figure 6b . All these put together into eq 26, we obtained the partition function z3 in the dissociated state . In two different ways described above, we obtained identical results for the partial partition function of the dissociated state, z3 = 1.2 10 . (a) pmf w[r21] as a function of the ca1ca2 distance in the dissociated state . (b) pmf w[r31] as a function of the ca3ca2 distance in the dissociated state . Ca2 is fixed at r1. Ca1 (position vector r2) and ca3 (position vector r3) are steered to and from ca2 in (a) and (b), respectively . It is interesting to note that the pmf w[r31] (figure 6b) has a deep, nearly harmonic well centered at a ca3ca2 distance r31 |r3 this indicates that binding gsh to the protein does not significantly stretch ca3 from ca2 . In contrast, the pmf w[r21] as a function of the ca1ca2 distance (figure 6a) behaves very differently . The pmf well is anharmonic and its minimum is lower than the pmf value at the ca1ca2 distance |r2 binding gsh to the protein actually causes ca1 to stretch away from ca2 and reduces the fluctuations of ca1 . Putting together the bound state fluctuations, the pmf difference, and the dissociated state fluctuations into eq 27, we obtain the absolute binding energy of 7.0 0.9 kcal / mol (corresponding to a dissociation constant of kd = 8.2 m) that is in comparison with the itc result of 6.75 kcal / mol (kd = 13 m). In terms of a computational approach, we have developed a hybrid steered molecular dynamics approach for computing absolute binding energy from the pmf along a dissociation path . Applying this hsmd approach with high - performance parallel processing, one can achieve, within a few wall - clock days, the computation of the binding affinity of one ligand the hsmd approach is brute force in the sense that one does not have to delicately devise biasing and constraining potentials during the course of simulations . Also, it does not involve sophisticated ways of removing the artifacts introduced by biasing / constraining the ligand in other pmf - based and non - pmf - based approaches . Hsmd can be implemented straightforwardly by steering / pulling the n centers of mass of n chosen segments of a ligand using n infinitely stiff springs along one predetermined dissociate path, disallowing any deviations from the path . This use of a single path is correct because the pmf is a function of state . Therefore, the pmf difference between two states is independent of the paths connecting them . All other contributions, in addition to the pmf difference between the two end states of this one dissociation path, are rigorously accounted for in the partial partition functions of the bound and the dissociated states . The segments chosen to be steered, however, need to be the most stable parts of the ligand in the bound state because the coordinate integrations of these centers then can be approximated as gaussian . The gaussian approximation is expected to be valid for a wide range of ligand protein complexes because there should always be at least one center of a ligand that does not deviate greatly from its bound - state coordinates but is tightly bound to the protein except for the cases of very weak binding . Another possible difficulty for the hsmd approach lies in the coordinate integration in the dissociated state when three segments centers of mass are steered . The approximation in eq 26 is based on the assumptions that two of the three pulling centers do not have significant contribution from the stereo collision between them and that the angle between the lines they form with the other center is approximately free to bend . When these two assumptions are not valid, the coordinate integration in eq 23 will necessitate further new schemes of approximation . In terms of biophysics, we have provided atomistic details in support of the binding mechanisms of two ligand protein complexes elucidated in the experimental investigations . For both oca glb and gsh sjgst(y7f) complexes, our equilibrium md simulations confirm the experimentally determined binding conformations . During the long time dynamics, the ligands were found to fluctuate with small deviations at the binding sites determined in the crystal structures of the ligand protein complexes (see figures 2b, c and 4b, c and the supporting information, figures s1 and s3). Also, our computed dissociation constants agree with the experimentally measured values within a factor of 1.5 . Therefore, it is expected that hsmd can be used to reliably predict binding affinities of ligand protein complexes whose structures are available in the pdb without data for binding affinities yet and that the hsmd predictions would be validated by future experimental measurements . Finally, the agreement between the computed results in this work and the experimental data was based on the charmm force field, indicating its accuracy . The hsmd approach, however, is independent of which force field to use . It can be implemented with other force fields, of course, which may or may not produce similar results.
|
Hydrometrocolpos is a rare congenital anomaly formed by cystic dilatation of vagina and uterus due to conditions like imperforated hymen, distal vaginal atresia or transverse vaginal septum . Ca 19 - 9 is widely used as a tumor marker for cancers of the pancreas, stomach, colon, cholangial duct, ovaries, endometrium, and lung (adenocarcinoma). However, several benign conditions are also known to increase serum ca 19 - 9 levels . Ca 125 is an antigenic determinant widely used for screening of ovarian, pancreatic, breast, colon and lung cancers . It also increases in some benign and physiological conditions like pregnancy, menstruation and endometriosis . The baby was born to 28 years old healthy mother in the 38th gestational week by cesarean section with an apgar score at 1 and 5 min were 8 and 9, respectively . The birthweight, height and head circumference were 3940 g (> 90p), 50 cm (5075p) and 34.8 cm (5075p), respectively . In the prenatal period the newborn was diagnosed with giant cystic mass that fills the all the abdominal cavity and amniotic fluid volume was normal . In preliminary diagnosis bilateral polycystic kidneys was reported . After the delivery, the patient was intubated because of respiratory failure . In the follow - up of patient requiring mechanical ventilation support with low pressure and there is good ventilation on chest radiograph we did not accept pulmonary hypoplasia . The main cause of intubation accepted as the compression of abdominal mass . Laboratory data (white cell count, c - reactive protein, biochemical tests) were normal . Abdominal ultrasound showed a cystic structure posterior to the urinary bladder measuring 61 46 77 mm, with a thick wall structure and anechoic fluid level, and dilatation of ureters (fig . Abdominal computed tomography confirmed the presence of a cystic structure in the uterine compartment (fig . The urinary outflow decreased in the postnatal 12th hour, which was thought to be compression by the mass and thus 400 ml of fluid was aspirated underwent ultrasound guided percutaneous drainage . Biochemical, cytological and microbiological analysis of the drainage fluid revealed no pathology . Among the tests performed for differential diagnosis, levels of alpha - fetoprotein and beta - hcg were normal but serum ca 19 - 9 level was 110.1 u / ml (reference value: <27 u / ml) and ca 125 level was 278.7 u / ml (reference value: <35 u / ml). The urinary system was found to be normal but distal vaginal atresia was found with cystoscopy . The drainage level decreased and ceased on the 7th day and abdominal distention did not recur . On the 8th day the levels of ca 19.9 and ca 125 turned back to normal (17 u / ml and 21 u / ml respectively). In the follow - up of patient requiring mechanical ventilation support with low pressure was discontinued on the eighth day . Hydrometrocolpos is a rare congenital anomaly with an estimated incidence of 0.13.8% (3). During the newborn period the condition occurs as a result of accumulation of cervical and vaginal secretions due to the obstruction of vaginal outlet . Most cases present with abdominal mass, recurrent urinary tract infections or primary amenorrhea in the pubertal period . In the neonatal period it may present with abdominal mass, recurrent urinary tract infection, sepsis, obstructive uropathy and respiratory failure . Ca 19 - 9 is widely used as a tumor marker for pancreatic, colon, ovarian, endometrial and lung carcinoma . However several benign conditions such as inflammatory or proliferative diseases (cholangitis, pancreatitis, bronchial cyst, bronchiectasis, pulmonary fibrosis, endometriosis, pregnancy and ovarian cysts), ductal obstructions (pancreatic and choledochal) and chronic diseases (hepatitis, glomerulonephritis, diabetes mellitus, hemodialysis, peritoneal dialysis) also increase serum ca 19 - 9 levels . Ca 125 is also used as a tumor marker for ovarian, pancreatic, breast, colon and lung carcinomas . Also some other physiologic conditions such as pregnancy and menstruation can cause elevated serum ca 125 levels . In a study which evaluated patients with ca 125 levels over 1000 u / ml; 37% of patients had non - malignant gynecological disease (43.9% endometriosis, 12.2% adenomyosis, 9.7% pelvic inflammatory disease, 7.3% uterine leiomyoma, 2.4% imperforated hymen). However serum ca 125 levels in non - malignant gynecological diseases were significantly lower than those in malignant diseases . There is two case report with elevated levels of ca 19 - 9 and ca 125 in hydrometrocolpos due to imperforated hymen which is a benign condition . Both reported cases were in premenarcheal age group and the levels were both higher than our case . This is the first incident reported in literature in the neonatal period presenting with hydrometrocolpos and elevated levels of ca 19 - 9 and ca 125 . Hydrometrocolpos is a rare benign condition which may be kept in mind in girl newborn baby with abdominal mass and associated with high ca 19 - 9 and ca 125 levels.
|
Ovarian cancer is the most lethal and second most common gynecologic malignancy in the united states, with an estimated 21,980 new cases and 14,270 deaths expected in 2014 . First progression typically occurs within 18 months, and overall survival (os) is typically <4 years [25]. Most patients are present with advanced disease, and the current standard of care in the primary setting is surgical debulking followed by platinum - based chemotherapy . Ovarian cancer is a heterogeneous disease with respect to histopathology, molecular biology, and clinical outcome, suggesting that a single standard treatment is unlikely to benefit all patients . Histologically, most ovarian cancer arises from the distal fallopian tube or ovarian surface, and the majority of these epithelial ovarian cancers (eoc) are serous / papillary pathological subtype, followed by endometrioid, mucinous, clear cell, and undifferentiated . These different subtypes together with other clinical factors including age, performance status, figo stage, differentiation, ascites presence, and surgical debulking status the cancer genome atlas project found that more than 30 growth - stimulating genes were altered across different ovarian cancer subtypes . These alterations included: pi3k pathway activation, brca1 or brca2 mutations, other dna repair defects and varied expression status of er, cyclin e2, and kit . This molecular heterogeneity may be linked to clinical heterogeneity, such as histological subtype presentation, disease prognosis, and chemotherapy efficacy . Carboplatin / paclitaxel has been widely accepted as the standard of care in treating primary eoc for nearly two decades [25]. Multiple alternate regimens have been investigated, most of them based on the platinum / taxane standard, but augmented with additional chemotherapies and/or altered sequencing (table 1) [25]. Many studies have randomized patients across various regimens in an effort to identify regimens superior to the carboplatin / paclitaxel standard . These studies have consistently demonstrated remarkably similar progression - free survival (pfs) and os between the standard of care and the various alternates, highlighting the therapeutic equivalence of the various regimens and the associated empiric treatment ambiguity.table 1patient characteristics of control arm and assay - informed arm cohortspatient characteristicscontrol armassay - informed armdu bois jnci 2003pfisterer jnci 2006du bois jco 2006bookman jco 2009herzog ajog 2010number of patients7831,3081,2824,312192median age5760595959pathological subtypeserous / papillary70% 71% 73% 80% 71% other30% 29% 27% 20% 29% figo stage distributionstage i<1% <1% stage ii8% 9% 9% stage iii75% 74% 74% 85% 84% stage iv17% 17% 17% 15% 16% debulking statusoptimal63% 67% 68% 68% 52% sub - optimal37% 33% 32% 32% 48% treatment regimenscpcispcpcptcpcpecpcpgcpdct / cpcg / cpcpcpgcispctother c carboplatin, p paclitaxel, g gemcitabine, d doxorubicin, e epirubicin, t topotecan, cis cisplatin patient characteristics of control arm and assay - informed arm cohorts c carboplatin, p paclitaxel, g gemcitabine, d doxorubicin, e epirubicin, t topotecan, cis cisplatin for patients with recurrent, persistent, or progressive disease, chemotherapy choice is currently based, in part, on the duration and type of response to initial therapy . For platinum - sensitive disease [progression - free interval (pfi) 6 months from the end of platinum / taxane therapy], a platinum - based combination regimen is usually empirically selected . For platinum - resistant disease (pfi <6 months), physicians empirically select from an array of non - platinum regimens, including pegylated liposomal doxorubicin (pld), topotecan, gemcitabine, etoposide, taxanes, and targeted therapies, all of which have been evaluated and demonstrated to be clinically equivalent and acceptable for use in this patient population . While marker identification and development in ovarian cancer is generally limited to early detection, monitoring progression, or detecting recurrence, there are some encouraging preliminary studies linking markers with drug response, thereby demonstrating early potential for informing effective individualized chemotherapy selection . For example, expression of copper importers / exporters, ercc1, tau, gst - pi, mlh1, and xiap, and mutations of mlh1, brca1/brca2, and p53 have been linked to platinum response, and expression of tgfbi, survivin, and mutation of tubulin are associated with response to paclitaxel [821]. However, none of these biomarkers have demonstrated sufficient clinical validation required to inform clinical treatment decisions . The national institutes of health (nih) biomarkers definitions working group, which includes leaders in the field from the food and drug administration (fda), nih, academia and industry, defines a marker as a characteristic that is objectively measured and evaluated as an indicator of normal biologic processes, pathogenic processes, or pharmacologic responses to a therapeutic intervention . A marker was similarly described by hayes et al . As a molecular, cellular, tissue, or process - based alteration that provides indication of current, or more importantly, future behavior of a cancer . A chemoresponse assay reports a panel of markers characterizing a tumor s response to multiple chemotherapy agents . Each of the multiple chemotherapy assay results reported is a singular marker associated with a distinct treatment . Such assays provide tumor response information aimed at aiding in the selection of effective, individualized treatment regimens . Chemoresponse assays provide the same utility as other treatment markers that are associated with patient outcome when the given marker s associated treatment is clinically administered (e.g., kras and cetuximab / panitumumab, egfr and erlotinib, her2 and trastuzumab). Chemoresponse assays are generally based on phenotypic rather than molecular characterization, thus enabling assays to simultaneously report multiple treatment markers, each associated with a distinct treatment, for a given patient . The concept of a chemoresponse assay or chemotherapy sensitivity and resistance assay (csra), originated in the 1950s . There are different types of csras such as the adenosine triphosphate (atp) assay, human tumor cloning assay (htca), methylthiazolyl - diphenyl - tetrazolium bromide (mtt) assay, extreme drug resistance (edr) assay, as well as assays utilizing drug - induced apoptosis as the end point [24, 26, 27]. A high - impact htca study published in 1978 was followed by decades of research from various academic groups and a few commercial entities with mixed results [2831]. While other csra reviews have been published previously [24, 26], this review will focus on progress made during the most recent decade . The value of csras to inform effective treatment selection for individual patients remains a compelling clinical question and a highly debated topic among oncologists . While the advantages and disadvantages of various csra methods have been published, clinical validations demonstrating association of assay results with patient outcomes through prospective studies have the most value . A prospective histoculture drug response assay (hdra) study in advanced eoc patients (n = 104) treated with carboplatin and paclitaxel after cytoreductive surgery demonstrated a lower recurrence rate and extended pfs, both of which were statistically significant, in the hdra - sensitive group as compared to the hdra - resistant group . Another prospective study, utilizing an atp - based chemoresponse assay, evaluated response rate and pfs in platinum - resistant recurrent eoc patients (n = 180) randomized to assay - directed or physician s empiric therapy choice, demonstrating trends for improved response rate and pfs for assay - informed treatment . And, finally, a prospective study of 113 recurrent eoc patients showed that patients whose treatment was determined by an atp - based chemoresponse assay had statistically longer pfs and higher overall response rates compared with patients receiving physicians - choice therapy . Numerous retrospective data have also been published in the past decade, with the majority reporting statistically significant associations between assay results and clinical outcomes [3537]. The results from these various studies reasonably demonstrate the clinical potential of chemoresponse assays in both primary and recurrent eoc . Although several chemoresponse assays clinical validity and clinical utility have been evaluated in clinical trials, there are currently only two assays commercially available in the united states: the microculture - kinetic (mick) assay (diatech oncology, franklin, tn) and the chemofx assay (precision therapeutics, inc ., pittsburgh, pa). The mick assay is based on drug - induced apoptosis and was originally developed in hematologic malignancies where it was noted that chemotherapeutic drugs have the ability to rapidly induce apoptosis in tumor cells in short - term culture . The assay was later applied to solid tumors, including breast, lung, and gynecologic malignancies [27, 3841]. Clinical validation of the mick assay in 73 ovarian cancer patients demonstrated that clinical treatment with the assay - indicated best chemotherapy is an independent predictor of os in multivariate analysis of chemotherapy - nave stage iii or iv primary ovarian cancer patients . A clinical utility study of 44 cancer patients showed that oncologists used the mick assay to determine chemotherapy selection in 28 patients (64%) and did not use the assay in treatment selection for the other 16 patients (36%). The median os was 10.1 months for the assay - informed patients vs. 4.1 months for the assay - uninformed patients (p = 0.02). However, the 44 tumors in the study included a variety of tissue types, such as breast and non - small lung cancers; only two ovarian cancer tumors were included in the study . Therefore, the clinical validation and clinical utility of this assay in ovarian cancer requires further investigation . The chemofx chemoresponse assay has been extensively evaluated in patients with ovarian cancer and will be the focus of the remainder of this review . Chemofx is a chemoresponse assay that characterizes both the sensitivity and resistance of a patient s tumor to various physician - selected, clinically applicable chemotherapy treatments . It quantifies chemotherapy effect by direct visualization and enumeration of live cells following exposure to these treatments . The assay is performed in a clinical laboratory improvement amendments (clia) and new york state department of health (nysdoh) approved facility . Icc immunocytochemistry, auc area under curve, s sensitive, is intermediate sensitive, r resistant chemofx assay process . Icc immunocytochemistry, auc area under curve, s sensitive, is intermediate sensitive, r resistant in contrast to other csras, this chemoresponse assay is characterized by several features that make it more reproducible and clinically accessible.the assay uniquely insures that tumor cells are proliferating prior to chemotherapy exposure, thereby measuring treatment efficacy at halting proliferation and/or killing tumor cells . This approach accommodates the cell cycle - specific, cytostatic, and cytotoxic natures of various chemotherapies.the assay s primary culture process is optimized to generate sufficient proliferating tumor cells for testing . As a result, 9 out of 10 ovarian cancer samples meeting the incoming sample criteria, such as sufficient sample size and absence of microorganism contamination, are successfully reported.the culture process favors epithelial tumor cell proliferation and incorporates an immunocytochemistry (icc) step to insure that the majority of cells tested are epithelial.the assay process is highly automated . Cell seeding into microtiter plates, serial treatment dilution and application, cell fixation, fluorescence staining, as well as cell enumeration are performed using automated liquid handling robotics, computer - assisted microscopy, and automated cell - counting algorithms and software . The automated process strongly contributes to the high throughput and reproducibility of the assay .lastly, this assay requires significantly less tissue (a minimum of 35 mm), as compared to historical assays . Tumor tissue from surgical excision, biopsy, or paracentesis is compatible, making the assay highly clinically accessible . The assay uniquely insures that tumor cells are proliferating prior to chemotherapy exposure, thereby measuring treatment efficacy at halting proliferation and/or killing tumor cells . This approach accommodates the cell cycle - specific, cytostatic, and cytotoxic natures of various chemotherapies . The assay s primary culture process is optimized to generate sufficient proliferating tumor cells for testing . As a result, 9 out of 10 ovarian cancer samples meeting the incoming sample criteria, such as sufficient sample size and absence of microorganism contamination, are successfully reported . The culture process favors epithelial tumor cell proliferation and incorporates an immunocytochemistry (icc) step to insure that the majority of cells tested are epithelial . Cell seeding into microtiter plates, serial treatment dilution and application, cell fixation, fluorescence staining, as well as cell enumeration are performed using automated liquid handling robotics, computer - assisted microscopy, and automated cell - counting algorithms and software . Lastly, this assay requires significantly less tissue (a minimum of 35 mm), as compared to historical assays . Tumor tissue from surgical excision, biopsy, or paracentesis is compatible, making the assay highly clinically accessible . The analytical performance of this assay has been previously reported [42, 43, 46]. Heinzman et al . Demonstrated a coefficient of variation (cov) of 3.64.6% for sk - ov-3 cells treated with doxorubicin, across three operators and 9 days . In addition to variability across operators and days, process variability due to inter- and intraday stability of the chemotherapeutic treatments has also been reported . The assay has demonstrated the necessary analytical performance characteristics required by both clia and nysdoh . Demonstrated the association of assay response with pfs in 256 eoc patients . In patients with either an exact or partial match between treatments assayed and those that were clinically administered, the hazard ratio (hr) for progression in patients clinically treated with an assay - resistant (r) vs. assay - sensitive (s) treatment was 2.1 (95% ci 1.23.6, p = 0.01). In the subset of 135 patients with an exact match, the hr for progression in patients clinically administered an assay - r vs. assay - s treatment was 2.9 (95% ci 1.46.3, p <0.01). The median pfs for patients treated with r therapies was 9 and 14 months for those treated with intermediate sensitive (is) therapies . Furthermore, at the time of study completion with a median follow - up time of 14.6 months, 60% of patients treated with s therapies remained relapse - free . Herzog et al . Subsequently reported an association between assay response and os in 192 patients with advanced eoc following first - line platinum - based chemotherapy . Median os was 72.5, 48.6, and 28.2 months for patients who were treated with agents reported as s, is, and r, respectively (hr = 0.7, 95% ci 0.500.97, p = 0.03). Multivariate cox regression analysis demonstrated that the assay prediction of response to platinum agents was a predictor of os independent of other prognostic factors of stage, age, and optimal debulking (hr = 0.68, 95% ci 0.490.95, p = 0.023). In another more recent observational study of 276 women with figo stage iii - iv eoc cancer uniformly treated with first - line carboplatin-/paclitaxel - based therapy, patients with assay - r results for carboplatin were at increased risk of disease progression (as defined by pfs) compared with patients with s or is assay results (hr = 1.87, 95% ci 1.292.70, p = 0.0009); these results were consistent after controlling for clinical covariates (hr = 1.71, 95% ci 1.122.62, p = 0.013). Median pfs for patients who were assay - r to carboplatin was 11.8 vs. 16.6 months for assay - is and assay - s patients . This study demonstrates that assay resistance to carboplatin is associated with reduced pfs in eoc patients treated with standard of care carboplatin / paclitaxel, supporting the assay s ability to identify platinum - resistant patients . Furthermore, of those patients who were resistant to carboplatin in vitro, 59% of them displayed assay sensitivity (s or is) to at least one other agent . Finally, a prospective study of 262 women with recurrent or persistent eoc reported that patients treated with an assay - s regimen experienced significantly improved pfs (hr = 0.67, 95% ci 0.500.91, p = 0.009) and os (hr = 0.61, 95% ci 0.410.89, p = 0.010) compared with those treated with assay - is or assay - r regimens, resulting in a 14-month improvement in median os . Assay - pfs association was consistent in both platinum - sensitive and platinum - resistant tumors (hr: 0.71 and 0.66, respectively) and was independent of other covariates (hr = 0.66, 95% ci 0.470.94, p = 0.020). Moreover, the results indicated that more than 50% of the patients had at least one s therapy identified by the assay, whereas only 25% of them were empirically treated with an s drug, suggesting that the number of patients potentially experiencing improved os may more than double when physicians reference the assay . A further analysis of the 262 recurrent or persistent eoc patients reported by rutherford et al . Was presented at the 2013 european cancer organization (ecco) biennial meeting and addressed the assay s ability to function as a predictive marker . A prognostic assay identifies patients likely to respond / not respond to (any) therapy, while a predictive assay identifies a patient's likely response to specific therapies, which is particularly important for individualized chemotherapy selection . Four different analytical methods were used in the study to assess the predictive value of the assay . These analyses provide the evidence that this chemoresponse assay is a predictive marker, demonstrating its ability to discern specific therapies that are likely to be more effective among multiple alternatives . As briefly outlined earlier, a chemoresponse assay, such as chemofx, is a panel of treatment markers, with the assay result for each treatment evaluated functioning as a distinct marker . When ordering the assay, a physician selects each of the multiple treatments under consideration for a given patient for inclusion in the assay . Clinically validated chemotherapy regimens, consistent with guidelines such as nccn, comprise the available treatment choices . Clinical trials designed to evaluate marker or assay efficacy are fundamentally different than trials designed to evaluate drug efficacy . Various different marker trial designs have been extensively studied and reported in the recent literature . However, discussion of effective marker validation trial designs that are appropriate for multiple markers / therapies to be assessed simultaneously (e.g., chemoresponse assays) remains very limited in the current trial design literature . Marker validation trial designs for this type of multiple markers / therapies assay may vary, to some extent, from marker trial designs appropriate for a single molecular biomarker associated with a single therapy (e.g., kras / panitumumab, egfr / erlotinib). Primarily, three marker study designs have been outlined in the literature for marker validation: enrichment, strategy, and stratified [5153]. Marker negative patients are excluded in the enrichment design, and thus, it is not applicable to chemoresponse assay evaluation . Historically, the strategy design, in many ways similar to a standard drug trial design, has been considered the gold standard for marker validation as it attempts to emulate what might occur in clinical practice . A variant of the strategy design has been recommended by the american society of clinical oncology (asco) and blue cross blue shield (bcbs) technical evaluation center (tec) assessments of validations of chemoresponse assays [54, 55] date back to the mid 1990s . However, multiple recent and updated marker trial design publications, including an evaluation by the center for medical technology policy (cmtp) in 2013, indicate that the strategy design is less than ideal for marker validation, in that it requires a larger sample size and cannot distinguish between a more effective treatment and marker efficacy, when compared to alternate marker trial designs . Show that the required sample size for a strategy design can exceed several thousand patients depending on the prevalence of the marker in the study population, presenting a large challenge in a small incidence / prevalence disease like eoc . Further and specific to chemoresponse assays where multiple markers are evaluated simultaneously, the pan - resistant and pan - sensitive patients dilute the ability to assess assay impact on patient outcome . Additionally, overlapping treatments between study arms still further increase the required sample size, rendering the strategy approach essentially pragmatically infeasible . Finally, a potential physician treatment bias or learning effect may be associated with the strategy design . The strategy trial design attempted by cree et al . Showed a trend toward improved response rate and pfs in assay - informed patients as compared to those treated with the physician s empiric choice, but did not achieve statistical significance . Asserted that physicians learned from the assay - informed arm and began administering treatments similar to those recommended for assay - informed patients to patients in the physician - directed arm as the study progressed . Analysis confirmed this effect; in early physician - choice arm patients, pfs was significantly shorter than that in subsequent year patients . The stratified design has been reported as more efficient, capable of answering the relevant clinical questions, and able to assess both prognostic and predictive marker properties, which is often at issue with evaluations of markers [52, 56, 57]. Have concluded that trial designs, such as the stratified design that use the marker to guide analysis, but not treatment assignment (i.e., blind or non - interventional designs), are recommended for marker validation . The stratified design has been successfully implemented in multiple clinical validations of clinical guideline recommended markers, including kras, egfr, oncotype dx (genomic health, inc ., redwood city, ca, usa), and veristrat (biodesix, boulder, co, usa). The prospective clinical validation trial for the chemofx assay required that both the prognostic and predictive properties of the assay be evaluated using an analytical method very similar to the stratified approach [49, 50]. An important aspect of clinical utility considers how use of an assay or marker affects patient outcome in terms of treatment selection, survival, and morbidity . Other considerations include the impact of the assay or marker usage on physician treatment plans as well as immediate and downstream healthcare costs [5759]. To further demonstrate the clinical utility of this chemoresponse assay, we conducted a comparative analysis based on a two - arm marker strategy approach . A 192-patient cohort, serving as the assay - informed arm, was compared to a non - assay - informed (historical control) arm, comprised of patients treated by non - assay - informed physicians from four large cooperative group drug studies in primary eoc, totaling more than 7,000 patients [246]. Patient characteristics in both the assay - informed and control arms were similar with the exception that between 11 and 16% more optimally debulked patients were included in the multiple literature cohorts that comprise the control arm (table 1). Additionally, while the assay - informed arm and the largest control arm cohort consisted of only advanced stage patients [5, 44], the other three control arm cohorts also included a small portion of earlier stage patients . Based on traditionally accepted adverse clinical variables, a worse prognosis was projected for the assay - informed cohort given the greater proportion of late - stage and sub - optimally debulked patients . Despite worse prognostic clinical factors, patients in the assay - informed arm experienced a 10% improvement in median os compared with the literature - derived control arm (48 vs. 44 months, respectively). Furthermore, at study completion (6 years follow - up), 39% of the assay - informed patients were alive compared to 29% of control arm patients (table 2).table 2comparison of median os in control, assay - informed, and assay - informed sensitive cohortssurvivaldu bois jnci 2003pfisterer jnci 2006du bois jco 2006bookman jco 2009control arm averageassay - informed herzog ajog 2010assay - informed herzog ajog 2010 sensitive groupmedian os44 month44 month44 month44 month44 month48 month72.5 month1-year92% 91% 90% 90% 91% 85% 90% 2-year74% 72% 73% 75% 74% 72% 86% 3-year59% 57% 58% 60% 59% 59% 75% 4-year47% 45% 46% 45% 46% 51% 70% 5-year38% 35% 38% 35% 37% 44% 60% 6-year29% na28% 30% 29% 39% 55% annual os rates in the four cohorts comprising the control arm are based on extrapolation of the published kaplan meier survival curves [25, 45] comparison of median os in control, assay - informed, and assay - informed sensitive cohorts annual os rates in the four cohorts comprising the control arm are based on extrapolation of the published kaplan meier survival curves [25, 45] median os for the assay - informed arm, stratified by assay response category, was s = 72.5 (n = 20), is = 48.6 (n = 133), and r = 28.2 months (n = 39) (table 2; fig . 2), representing a 28.5 month (72.5 vs. 44, 65%) increased os for patients treated with assay - s regimens and a 15.8 month (28.2 vs. 44, 36%) decreased os for patients treated with assay - r regimens, as compared to the control arm . When comparing annual os for assay - informed patients treated with an s regimen to control arm patients, 1025% more assay - informed patients were living in years 2 thru 6 . Notably, 55% of assay - informed patients treated with an s regimen were alive at year 6 compared to 29% in the control arm, despite the disparity in adverse clinical factors favoring the control arm (table 2).fig . 2kaplan meier survival curves comparing the control arm cohort (black) and the assay - informed arm cohort . Survival curves for the assay - informed cohort were stratified according to assay response category of clinically administered therapy (s sensitive, green; is intermediate sensitive, light green; r resistant, red) kaplan meier survival curves comparing the control arm cohort (black) and the assay - informed arm cohort . Survival curves for the assay - informed cohort were stratified according to assay response category of clinically administered therapy (s sensitive, green; is intermediate sensitive, light green; r resistant, red) an analysis of survival from patients in the control arm cohorts [246] indicates that the various treatment regimens had similar efficacy when therapies were randomly assigned in phase iii clinical trials [25, 44]. Therefore, even though therapies from the same pool of approved and recommended treatment options were administered to patients in the comparative analysis, patients whose treatment was assay - informed had improved survival when compared to patients whose treatment was randomly assigned . Furthermore, in the assay - informed arm, final treatment decisions for patients were made by their physicians, and assays were used to assist treatment selections in some cases and not in others . It is therefore rational to hypothesize that if physicians routinely had chemoresponse information available when choosing chemotherapeutic regimens for patients with ovarian cancer, os might be further improved . Average chemotherapy costs for patients with recurrent ovarian cancer treated with or without use of the assay have also been evaluated . Results based on ubs warburg market share data demonstrated mean costs for chemotherapy treatment were $48,758 for patients treated empirically (no assay), $33,187 for patients with assay results available (65% adhered to assay results), and $23,986 for patients modeled to have 100% adherence to assay results . Spanning the median os of 44 months, the majority of eoc patients experience multiple episodes of disease recurrence . Therefore, treatment costs typically include both surgery and multiple chemotherapy interventions . Considering that assay - informed treatment selection may result in delayed cancer progression and increased os, if one or more of the multiple chemotherapy interventions were delayed or avoided in assay - informed patients, treatment costs may be reduced by the costs associated with less effective chemotherapy regimens . Use of chemoresponse assays during primary therapy may help to identify patients with platinum - resistant disease, potentially allowing for consideration of alternate clinically validated or similarly appropriate [6567] treatments, as well as prognostic stratification of patients in prospective clinical trials and/or modification of primary therapies off trial such as the addition of bevacizumab or other targeted therapies to standard carboplatin / paclitaxel treatment [6264]. Likewise, in the recurrent disease setting where there is no single standard of care, crsas may assist oncologists with prioritization of the various single - agent therapies used with or without platinum therapies [5456]. Additionally, in both primary and recurrent eoc, in the event of a severe drug reaction, physicians may employ this assay to identify an effective (s or is) therapy with which to replace the toxic agent . Chemofx is a chemoresponse assay that characterizes both the sensitivity and resistance of a patient s tumor to various physician - selected, clinically applicable chemotherapy treatments . It quantifies chemotherapy effect by direct visualization and enumeration of live cells following exposure to these treatments . The assay is performed in a clinical laboratory improvement amendments (clia) and new york state department of health (nysdoh) approved facility . Icc immunocytochemistry, auc area under curve, s sensitive, is intermediate sensitive, r resistant chemofx assay process . Icc immunocytochemistry, auc area under curve, s sensitive, is intermediate sensitive, r resistant in contrast to other csras, this chemoresponse assay is characterized by several features that make it more reproducible and clinically accessible.the assay uniquely insures that tumor cells are proliferating prior to chemotherapy exposure, thereby measuring treatment efficacy at halting proliferation and/or killing tumor cells . This approach accommodates the cell cycle - specific, cytostatic, and cytotoxic natures of various chemotherapies.the assay s primary culture process is optimized to generate sufficient proliferating tumor cells for testing . As a result, 9 out of 10 ovarian cancer samples meeting the incoming sample criteria, such as sufficient sample size and absence of microorganism contamination, are successfully reported.the culture process favors epithelial tumor cell proliferation and incorporates an immunocytochemistry (icc) step to insure that the majority of cells tested are epithelial.the assay process is highly automated . Cell seeding into microtiter plates, serial treatment dilution and application, cell fixation, fluorescence staining, as well as cell enumeration are performed using automated liquid handling robotics, computer - assisted microscopy, and automated cell - counting algorithms and software . The automated process strongly contributes to the high throughput and reproducibility of the assay .lastly, this assay requires significantly less tissue (a minimum of 35 mm), as compared to historical assays . Tumor tissue from surgical excision, biopsy, or paracentesis is compatible, making the assay highly clinically accessible . The assay uniquely insures that tumor cells are proliferating prior to chemotherapy exposure, thereby measuring treatment efficacy at halting proliferation and/or killing tumor cells . This approach accommodates the cell cycle - specific, cytostatic, and cytotoxic natures of various chemotherapies . The assay s primary culture process is optimized to generate sufficient proliferating tumor cells for testing . As a result, 9 out of 10 ovarian cancer samples meeting the incoming sample criteria, such as sufficient sample size and absence of microorganism contamination, are successfully reported . The culture process favors epithelial tumor cell proliferation and incorporates an immunocytochemistry (icc) step to insure that the majority of cells tested are epithelial . Cell seeding into microtiter plates, serial treatment dilution and application, cell fixation, fluorescence staining, as well as cell enumeration are performed using automated liquid handling robotics, computer - assisted microscopy, and automated cell - counting algorithms and software . Lastly, this assay requires significantly less tissue (a minimum of 35 mm), as compared to historical assays . Tumor tissue from surgical excision, biopsy, or paracentesis is compatible, making the assay highly clinically accessible . The analytical performance of this assay has been previously reported [42, 43, 46]. Demonstrated a coefficient of variation (cov) of 3.64.6% for sk - ov-3 cells treated with doxorubicin, across three operators and 9 days . In addition to variability across operators and days, process variability due to inter- and intraday stability of the chemotherapeutic treatments has also been reported . The assay has demonstrated the necessary analytical performance characteristics required by both clia and nysdoh . Demonstrated the association of assay response with pfs in 256 eoc patients . In patients with either an exact or partial match between treatments assayed and those that were clinically administered, the hazard ratio (hr) for progression in patients clinically treated with an assay - resistant (r) vs. assay - sensitive (s) treatment was 2.1 (95% ci 1.23.6, p = 0.01). In the subset of 135 patients with an exact match, the hr for progression in patients clinically administered an assay - r vs. assay - s treatment was 2.9 (95% ci 1.46.3, p <0.01). The median pfs for patients treated with r therapies was 9 and 14 months for those treated with intermediate sensitive (is) therapies . Furthermore, at the time of study completion with a median follow - up time of 14.6 months, 60% of patients treated with s therapies remained relapse - free . Herzog et al . Subsequently reported an association between assay response and os in 192 patients with advanced eoc following first - line platinum - based chemotherapy . Median os was 72.5, 48.6, and 28.2 months for patients who were treated with agents reported as s, is, and r, respectively (hr = 0.7, 95% ci 0.500.97, p = 0.03). Multivariate cox regression analysis demonstrated that the assay prediction of response to platinum agents was a predictor of os independent of other prognostic factors of stage, age, and optimal debulking (hr = 0.68, 95% ci 0.490.95, p = 0.023). In another more recent observational study of 276 women with figo stage iii - iv eoc cancer uniformly treated with first - line carboplatin-/paclitaxel - based therapy, patients with assay - r results for carboplatin were at increased risk of disease progression (as defined by pfs) compared with patients with s or is assay results (hr = 1.87, 95% ci 1.292.70, p = 0.0009); these results were consistent after controlling for clinical covariates (hr = 1.71, 95% ci 1.122.62, p = 0.013). Median pfs for patients who were assay - r to carboplatin was 11.8 vs. 16.6 months for assay - is and assay - s patients . This study demonstrates that assay resistance to carboplatin is associated with reduced pfs in eoc patients treated with standard of care carboplatin / paclitaxel, supporting the assay s ability to identify platinum - resistant patients . Furthermore, of those patients who were resistant to carboplatin in vitro, 59% of them displayed assay sensitivity (s or is) to at least one other agent . Finally, a prospective study of 262 women with recurrent or persistent eoc reported that patients treated with an assay - s regimen experienced significantly improved pfs (hr = 0.67, 95% ci 0.500.91, p = 0.009) and os (hr = 0.61, 95% ci 0.410.89, p = 0.010) compared with those treated with assay - is or assay - r regimens, resulting in a 14-month improvement in median os . Assay - pfs association was consistent in both platinum - sensitive and platinum - resistant tumors (hr: 0.71 and 0.66, respectively) and was independent of other covariates (hr = 0.66, 95% ci 0.470.94, p = 0.020). Moreover, the results indicated that more than 50% of the patients had at least one s therapy identified by the assay, whereas only 25% of them were empirically treated with an s drug, suggesting that the number of patients potentially experiencing improved os may more than double when physicians reference the assay . A further analysis of the 262 recurrent or persistent eoc patients reported by rutherford et al . Was presented at the 2013 european cancer organization (ecco) biennial meeting and addressed the assay s ability to function as a predictive marker . A prognostic assay identifies patients likely to respond / not respond to (any) therapy, while a predictive assay identifies a patient's likely response to specific therapies, which is particularly important for individualized chemotherapy selection . Four different analytical methods were used in the study to assess the predictive value of the assay . These analyses provide the evidence that this chemoresponse assay is a predictive marker, demonstrating its ability to discern specific therapies that are likely to be more effective among multiple alternatives . As briefly outlined earlier, a chemoresponse assay, such as chemofx, is a panel of treatment markers, with the assay result for each treatment evaluated functioning as a distinct marker . When ordering the assay, a physician selects each of the multiple treatments under consideration for a given patient for inclusion in the assay . Clinically validated chemotherapy regimens, consistent with guidelines such as nccn, comprise the available treatment choices . Clinical trials designed to evaluate marker or assay efficacy are fundamentally different than trials designed to evaluate drug efficacy . Various different marker trial designs have been extensively studied and reported in the recent literature . However, discussion of effective marker validation trial designs that are appropriate for multiple markers / therapies to be assessed simultaneously (e.g., chemoresponse assays) remains very limited in the current trial design literature . Marker validation trial designs for this type of multiple markers / therapies assay may vary, to some extent, from marker trial designs appropriate for a single molecular biomarker associated with a single therapy (e.g., kras / panitumumab, egfr / erlotinib). Primarily, three marker study designs have been outlined in the literature for marker validation: enrichment, strategy, and stratified [5153]. Marker negative patients are excluded in the enrichment design, and thus, it is not applicable to chemoresponse assay evaluation . Historically, the strategy design, in many ways similar to a standard drug trial design, has been considered the gold standard for marker validation as it attempts to emulate what might occur in clinical practice . A variant of the strategy design has been recommended by the american society of clinical oncology (asco) and blue cross blue shield (bcbs) technical evaluation center (tec) assessments of validations of chemoresponse assays [54, 55] date back to the mid 1990s . However, multiple recent and updated marker trial design publications, including an evaluation by the center for medical technology policy (cmtp) in 2013, indicate that the strategy design is less than ideal for marker validation, in that it requires a larger sample size and cannot distinguish between a more effective treatment and marker efficacy, when compared to alternate marker trial designs . Show that the required sample size for a strategy design can exceed several thousand patients depending on the prevalence of the marker in the study population, presenting a large challenge in a small incidence / prevalence disease like eoc . Further and specific to chemoresponse assays where multiple markers are evaluated simultaneously, the pan - resistant and pan - sensitive patients dilute the ability to assess assay impact on patient outcome . Additionally, overlapping treatments between study arms still further increase the required sample size, rendering the strategy approach essentially pragmatically infeasible . Finally, a potential physician treatment bias or learning effect may be associated with the strategy design . The strategy trial design attempted by cree et al . Showed a trend toward improved response rate and pfs in assay - informed patients as compared to those treated with the physician s empiric choice, but did not achieve statistical significance . Asserted that physicians learned from the assay - informed arm and began administering treatments similar to those recommended for assay - informed patients to patients in the physician - directed arm as the study progressed . Analysis confirmed this effect; in early physician - choice arm patients, pfs was significantly shorter than that in subsequent year patients . The stratified design has been reported as more efficient, capable of answering the relevant clinical questions, and able to assess both prognostic and predictive marker properties, which is often at issue with evaluations of markers [52, 56, 57]. Friedlin et al . Have concluded that trial designs, such as the stratified design that use the marker to guide analysis, but not treatment assignment (i.e., blind or non - interventional designs), are recommended for marker validation . The stratified design has been successfully implemented in multiple clinical validations of clinical guideline recommended markers, including kras, egfr, oncotype dx (genomic health, inc ., redwood city, ca, usa), and veristrat (biodesix, boulder, co, usa). The prospective clinical validation trial for the chemofx assay required that both the prognostic and predictive properties of the assay be evaluated using an analytical method very similar to the stratified approach [49, 50]. An important aspect of clinical utility considers how use of an assay or marker affects patient outcome in terms of treatment selection, survival, and morbidity . Other considerations include the impact of the assay or marker usage on physician treatment plans as well as immediate and downstream healthcare costs [5759]. To further demonstrate the clinical utility of this chemoresponse assay, we conducted a comparative analysis based on a two - arm marker strategy approach . A 192-patient cohort, serving as the assay - informed arm, was compared to a non - assay - informed (historical control) arm, comprised of patients treated by non - assay - informed physicians from four large cooperative group drug studies in primary eoc, totaling more than 7,000 patients [246]. Patient characteristics in both the assay - informed and control arms were similar with the exception that between 11 and 16% more optimally debulked patients were included in the multiple literature cohorts that comprise the control arm (table 1). Additionally, while the assay - informed arm and the largest control arm cohort consisted of only advanced stage patients [5, 44], the other three control arm cohorts also included a small portion of earlier stage patients . Based on traditionally accepted adverse clinical variables, a worse prognosis was projected for the assay - informed cohort given the greater proportion of late - stage and sub - optimally debulked patients . Despite worse prognostic clinical factors, patients in the assay - informed arm experienced a 10% improvement in median os compared with the literature - derived control arm (48 vs. 44 months, respectively). Furthermore, at study completion (6 years follow - up), 39% of the assay - informed patients were alive compared to 29% of control arm patients (table 2).table 2comparison of median os in control, assay - informed, and assay - informed sensitive cohortssurvivaldu bois jnci 2003pfisterer jnci 2006du bois jco 2006bookman jco 2009control arm averageassay - informed herzog ajog 2010assay - informed herzog ajog 2010 sensitive groupmedian os44 month44 month44 month44 month44 month48 month72.5 month1-year92% 91% 90% 90% 91% 85% 90% 2-year74% 72% 73% 75% 74% 72% 86% 3-year59% 57% 58% 60% 59% 59% 75% 4-year47% 45% 46% 45% 46% 51% 70% 5-year38% 35% 38% 35% 37% 44% 60% 6-year29% na28% 30% 29% 39% 55% annual os rates in the four cohorts comprising the control arm are based on extrapolation of the published kaplan meier survival curves [25, 45] comparison of median os in control, assay - informed, and assay - informed sensitive cohorts annual os rates in the four cohorts comprising the control arm are based on extrapolation of the published kaplan meier survival curves [25, 45] median os for the assay - informed arm, stratified by assay response category, was s = 72.5 (n = 20), is = 48.6 (n = 133), and r = 28.2 months (n = 39) (table 2; fig . 2), representing a 28.5 month (72.5 vs. 44, 65%) increased os for patients treated with assay - s regimens and a 15.8 month (28.2 vs. 44, 36%) decreased os for patients treated with assay - r regimens, as compared to the control arm . When comparing annual os for assay - informed patients treated with an s regimen to control arm patients, 1025% more assay - informed patients were living in years 2 thru 6 . Notably, 55% of assay - informed patients treated with an s regimen were alive at year 6 compared to 29% in the control arm, despite the disparity in adverse clinical factors favoring the control arm (table 2).fig . 2kaplan meier survival curves comparing the control arm cohort (black) and the assay - informed arm cohort . Survival curves for the assay - informed cohort were stratified according to assay response category of clinically administered therapy (s sensitive, green; is intermediate sensitive, light green; r resistant, red) kaplan meier survival curves comparing the control arm cohort (black) and the assay - informed arm cohort . Survival curves for the assay - informed cohort were stratified according to assay response category of clinically administered therapy (s sensitive, green; is intermediate sensitive, light green; r resistant, red) an analysis of survival from patients in the control arm cohorts [246] indicates that the various treatment regimens had similar efficacy when therapies were randomly assigned in phase iii clinical trials [25, 44]. Therefore, even though therapies from the same pool of approved and recommended treatment options were administered to patients in the comparative analysis, patients whose treatment was assay - informed had improved survival when compared to patients whose treatment was randomly assigned . Furthermore, in the assay - informed arm, final treatment decisions for patients were made by their physicians, and assays were used to assist treatment selections in some cases and not in others . It is therefore rational to hypothesize that if physicians routinely had chemoresponse information available when choosing chemotherapeutic regimens for patients with ovarian cancer, os might be further improved . Average chemotherapy costs for patients with recurrent ovarian cancer treated with or without use of the assay have also been evaluated . Results based on ubs warburg market share data demonstrated mean costs for chemotherapy treatment were $48,758 for patients treated empirically (no assay), $33,187 for patients with assay results available (65% adhered to assay results), and $23,986 for patients modeled to have 100% adherence to assay results . Spanning the median os of 44 months, the majority of eoc patients experience multiple episodes of disease recurrence . Therefore, treatment costs typically include both surgery and multiple chemotherapy interventions . Considering that assay - informed treatment selection may result in delayed cancer progression and increased os, if one or more of the multiple chemotherapy interventions were delayed or avoided in assay - informed patients, treatment costs may be reduced by the costs associated with less effective chemotherapy regimens . Use of chemoresponse assays during primary therapy may help to identify patients with platinum - resistant disease, potentially allowing for consideration of alternate clinically validated or similarly appropriate [6567] treatments, as well as prognostic stratification of patients in prospective clinical trials and/or modification of primary therapies off trial such as the addition of bevacizumab or other targeted therapies to standard carboplatin / paclitaxel treatment [6264]. Likewise, in the recurrent disease setting where there is no single standard of care, crsas may assist oncologists with prioritization of the various single - agent therapies used with or without platinum therapies [5456]. Additionally, in both primary and recurrent eoc, in the event of a severe drug reaction, physicians may employ this assay to identify an effective (s or is) therapy with which to replace the toxic agent . Despite several years of chemoresponse assay development and clinical experience with these assays, studies have largely been confined to single - institutional, retrospective evaluations . Recent large, prospective, multi - site clinical studies that correlate chemofx assay results with overall and progression - free survival in both primary and recurrent ovarian cancers indicate that the assay may offer significant clinical benefit for patients, is predictive of treatment outcomes, and is potentially economically beneficial by reducing the chance that ineffective chemotherapy is administered . This overview supports the inclusion of chemoresponse assay results, along with other clinical factors and biomarkers, to support the individualized selection of effective chemotherapy agents for treatment of patients with ovarian cancer.
|
Since 2004, the province of quebec has devoted significant efforts to unify the governance of the main health and social care organizations of its various territories . Notwithstanding the uniformity of the national plan s prescription, the territorial integration modalities greatly vary across the province . This research is based upon a conceptual model of integration that comprises six components: inter - organizational partnership, case management, standardized assessment, a single entry point, a standardized service planning tool and a shared clinical file . We conducted an embedded case study in six contrasted sites in terms of their level of integration . Interestingly however, no link seems to exist between the quality of local prescriptions and the level of integration achieved in each site . This finding leads us to hypothesize that the variable quality of the operational accompaniment offered to implement these prescriptions is a variable in play.
|
Ozone is an important disinfecting agent due to its antibacterial action . Recent research revealed the bactericidal action of ozone against s. mutans and other bacteria commonly found in cervical carious lesions . In these studies, a 20 s healozone application resulted in a 99.9% reduction in microorganisms . Since it is not possible to confirm clinically that a dental cavity is bacteriologically aseptic, an antibacterial treatment of the dental surface prior to cavity restoration has been advised . This can be achieved by ozone application to prevent secondary caries and thus, restoration failures . However, studies of ozone influence on adhesion are very rare and few have been published . Due to its strong oxidizing effect, ozone might have negative consequences on resin - tooth adhesion, since oxygen is a well - known polymerization inhibitor . It has been demonstrated that oxygen and other oxidant agents (such as bleaching agents) have a negative influence on dental adhesives bond strength . Resin - enamel adhesion is one of the most significant advances in the history of dentistry and it is used in our days as a simple effective procedure when using an etch - and - rinse technique . However, the resin - dentin adhesion had to be improved through the years and new adhesive systems have been developed for that purpose the first evaluations of these new adhesive systems have shown satisfactory bond strengths to dentin, while adhesion to enamel was less effective . One of the questions that arises with the use of self - etch adhesive systems is whether the acidic monomer is capable of promoting enamel demineralization and developing a reliable and durable bonding to this tissue . In most studies the highest mean bond strengths were obtained with etch - and - rinse adhesives to intact or roughened enamel . Also, shear bond strength (sbs) evaluation of brackets and etch - and - rinse systems exhibited fewer failures when compared to self - etch systems . Since bonding procedures have to take into account not only adhesion to dentin but also the proximity of cavity margins to the prepared or intact enamel, the effectiveness of these adhesive systems, in terms of bond strength to enamel, has to be ascertained . Compromised bond strength to enamel results in microleakage and subsequent failure of the restoration over a period of time . This fact can be even more relevant if polymerization of the adhesive is compromised by the use of a potential inhibitor like ozone . In light of these developments, this study was undertaken to determine whether ozone gas pretreatment interferes with the sbs of an etch - and - rinse (excite and a self - etch adhesive system (adhese to enamel . Sixty sound bovine incisors were extracted and kept in distilled water at 4 c, for no longer than a month . After this period, teeth were kept in a 0.5% chloramine solution for a week and sectioned in a microtomer (accuton - struers, ballerup, denmark) to separate the crown from the root . The buccal surface was gradually polished with ascending grades of silicon - carbide sandpaper up to 320-grit (carbimet buehler - met, buehler, lake bluff, il, usa) to create a flat surface and simulate a smear layer ., de, usa), with a 3 mm diameter hole was used to confine the adhesion area . Materials used in this study are listed in figure 1 along with the manufacturers' compositions, batch numbers and code numbers . Restorative and adhesive materials specimens were randomly assigned to 4 experimental groups (n=15), and composite resin cylinders were added to the tested surfaces after the application of the adhesive, according to the manufacturer's instructions . G1 (excite with ozone [ivoclar vivadent ag, liechtenstein]) and g3 (adhese with ozone [ivoclar vivadent ag, liechtenstein]) were conditioned for 20 s with ozone gas from the healozone unit (kavo, dental gmbh, bismarckring, germany - continuous stream of ozone of 615 cc / min with a concentration of 2,100 ppm, more or less 5%) using a 5 mm delivery cup (green) immediately before the adhesive procedures . Specimens were then kept in distilled water for 24 h at 37 c to obtain the maximum resin polymerization, before being thermally cycled (aralab, mod 200e, cascais, portugal) for 500 cycles between 5 c and 55 c for 20 s in each bath and submitted to shear testing at a crosshead speed of 0.5 mm / min (instron, model 4502, series h3307, instron ltd, bucks, uk). The mode of failure was analyzed under a field emission scanning electron microscope (sem; jeol jsm 6301f / oxford inca energy 350/gatan alto 2500, tokyo, japan). Failures were classified as adhesive, cohesive (composite or enamel) or mixed . From the analysis of assumptions, the kolmogorov - smirnov test was used to check for normality of data among the groups . Sbs means and standard deviations were calculated and the differences between the groups were analyzed by one - way anova . The bonferroni method was employed for multiple comparisons of results and chi - squared statistical tests were used to evaluate the failure modes . A significance level of 5% sbs mean values were as follows: mean bond strength values and failure modes were as follows: g1- 26.856.18 mpa (33.3% of adhesive cohesive failure); g2 - 27.955.58 mpa (53.8% of adhesive failures between enamel and adhesive); g3 - 15.03.84 mpa (77.8% of adhesive failures between enamel and adhesive) and g4 - 13.13.68 mpa (36.4% of adhesive failures between enamel and adhesive). No statistically significant differences were found between g1 and g2 (p>0.05) or between g3 and g4 (p>0.05). Both g1 and g2 showed significantly higher mean sbs values than those of g3 or g4 (p<0.05). As observed with sem, the enamel surfaces conditioned by the acid from the etch - and - rinse adhesive system showed a more defined etching pattern than did the ones treated with the self - etch system (figure 2). Fe - sem (scanning electron microscope) micrographs at 2,000x of enamel surfaces after application of: a: a total - etch adhesive system (excite) and b: a self - etch adhesive system (adhese) regarding the failure mode, the results are presented in figure 3 . The most frequent type of fracture was adhesive between enamel and adhesive, which occurred 46.7% of the time . The less frequent type of fracture was adhesive between the adhesive and resin (8.9%). Different failure modes per group, in percentage figures 4 to 6 show sem micrographs of a typical adhesive fracture and a mixed fracture where the three layers appear in the same proportion . Fe - sem (scanning electron microscope) micrographs at 25x (a) and 600x (b) magnification . At 600x, three zones can be identified: the enamel on the top, on the middle there is the adhesive layer and at the bottom is the composite . This represents a typical adhesive failure mode, between adhesive and composite fe - sem (scanning electron microscope) micrograph at 25x magnification of a mixed failure . Both composite (a) and enamel (b) surfaces show adhesive, composite and enamel layers in the same proportion fe - sem (scanning electron microscope) micrographs at 25x magnification, showing composite surface mostly covered by adhesive (a) and enamel surface free of adhesive (b) and at 2,000x magnification, showing enamel surface, with visible enamel prisms (c) the application of ozone to enamel may be important for cavity disinfection in several situations, as for example, before fissure sealants or orthodontic bracket adhesion . Recent studies led to substantial evidence that indicates in vitro application of ozone as a useful prophylactic antimicrobial treatment, prior to etching and placement of dental sealants and restorations . However, like bleaching systems and other potential oxidants, ozone may cause inhibition of polymerization, leading to a decrease in conversion degree of the adhesive, which may in turn lead to a decrease in adhesion . Two different bonding systems were tested in the present work, each one chosen to represent a distinct category of available materials: an etch - and - rinse (excite) and a self - etch (adhese) adhesive system . Etch - and - rinse adhesives are applied on a demineralized substrate, due to preliminary application of phosphoric acid followed by extensive rinsing with water . Therefore, we may speculate that the etching removes both superficial mineralized components and residual oxidants . On the other hand, with self - etch adhesive systems no rinsing occurs, and residual oxygen may be incorporated within the smear layer and smear plugs, making this adhesion more susceptible to oxygen . Conversely, the result of this in vitro study showed no influence of ozone in 24 h sbs values of both tested adhesive systems . Once delivered to the enamel surface, gaseous ozone is unable to maintain its chemical stability and decomposes completely, reacting instantaneously with the organic compounds . Thus, we may speculate that only a residual amount of gaseous ozone is present on the dental substrate during bond resin application . In the present study, ozone was applied to enamel for 20 s. according to the literature, after this period, ozone seems to eliminate 99.9% of bacteria present, despite some more recent microbiological studies suggesting that gaseous ozone should be applied for a more sustained time . The very short time of ozone gas application when compared with the application time of other oxidants, like bleaching agents, could be another explanation for the lack of ozone effect on sbs values in the present study . Another critical factor that could potentially affect the adhesion to an ozone - pretreated substrate is ozone concentration . In a recent study, the use of an ozone generator operating at a high concentration showed that ozone might impair the bond strength of an etch - and - rinse adhesive system to dentin . Our findings also showed that sbs values were much superior for etch - and - rinse systems than for the self - etch systems, independent of ozone application . Two - step self - etch adhesive systems, like adhese, were developed to reduce application time and technical sensitivity of the adhesion process, since they may substitute wet bonding . However, our findings are consistent with other studies where adhese sbs values in enamel were lower than values with the excite adhesive system . The main reason for this fact might be the etch - and - rinse system's ability of deeper demineralization of enamel, exposing all the enamel prisms and leaving an adhesion surface superior to that in self - etch adhesive systems, as seen in the sem images of the conditioned enamel surfaces (figure 7). Mean shear bond strength (sbs) values (mpastandard deviation). Groups under the same line show no significant differences however, souza - junior (2012) found similar sbs values using self - etch adhesives with or without pre - etching the enamel surface, suggesting that a better and deeper demineralization might not mean higher sbs values . Other authors have shown that although demineralization patterns are not as accentuated with self - etch adhesive systems, they can reach highly satisfactory levels of bond strength . Concerning the failure mode, in g1, 33.3% of the failures were attributed to cohesive failures in the adhesive, whereas in the other three groups the predominant failure mode was adhesive between the enamel and the bonding agent . The use of this self - etch adhesive may be encouraged in the clinical adhesion of orthodontic brackets, since most failures are adhesive and when the bracket is removed, the enamel is not lost . Even though adhesive failures between enamel and the bonding agent seem to occur when bond strength is low, there is no consensus in the literature concerning the meaning of the failure modes experienced after shear bond tests . Laboratory testing of adhesive materials should always precede clinical application; however, adhesive testing must be performed in a standard manner to allow reliable comparisons . Unfortunately, due to the innovation and constant introduction of new products, this does not always happen . Owing to the difficulty in obtaining 60 sound human incisors, bovine enamel was used in the present study . Bovine enamel has been used in several other studies as a substitute model for human enamel and some authors have found no statistically significant differences in sbs when comparing bovine and human enamel . In this study, iso standards for adhesive testing were followed for the storage and disinfection of specimens, which contributed to minimizing changes on dental substrates likely to affect sbs values . According to the iso standards, to obtain the most real oral conditions, the specimens should be thermally cycled for 500 cycles . However, using an etch - and - rinse adhesive system, paradella (2007) observed similar sbs values despite the usage of iso - standard thermal cycling . This may lead us to believe that the 500 thermal cycling cycles recommended by iso and followed in the present study may not have been enough to age the samples up to the point of yielding differences in bond strength . In fact, a recent review concluded that 10,000 cycles correspond approximately to an one - year lifetime in vivo, which would suggest that iso thermal cycling standards are not sufficient to study long - term adhesive behavior . Research focusing on the long - term effects of ozone application in adhesive interfaces is recommended in further research . In addition, in vivo studies are recommended to better determine the disinfecting potential and oxidant ability of ozone gas . Sbs to enamel after a 24-h period was not influenced by pretreatment with ozone gas . It was also proven that the sbs mean values were higher for etch - and - rinse adhesive system than for the self - etch system, independent of ozone application.
|
The popular surgical methods among tissue grafts include thin thiersch's graft, suction blister graft, punch grafting and mini punch grafting (mpg). It is indicated in almost all sites especially in acral vitiligo involving palms, fingers, nipples and lips . The time consumed in mpg using punches of less than 1.5 mm is more when compared with punch grafting with 2 - 3 mm punches, more over the number of grafts required is also more with decrease in punch sizes . With the advent of motorised power punches the procedure can be done with more ease in lesser time to harvest more number of mini grafts (<1.5 mm) in a single session . We performed mpg in 10 patients of stable vitiligo on various sites with motorised power punch to see its efficacy and feasibility . Ten patients, two males and eight females, in the age group of 1255 years were treated with mpg using power punches . Three patients had focal, two had segmental, three had acral and two had generalised vitiligo . The different sites treated included face, lip, neck, hands, fingers, palm, waist, leg, ankle, areola and nipple . The stainless steel power punches of 1, 1.2 and 1.5 diameter, loaded into hand piece of micro motor designed by tejco, mumbai, were used for the procedure . The procedure was performed under infiltrative local anaesthesia (1% xylocaine), donor area was from extensor aspect of thigh and post - auricular region . The micro motor was adjusted to a speed of 900 - 1200 rotation per minute, with 1:8 torque to speed ratio, power punch of a required size was loaded into the hand piece . The total number of grafts required was estimated based on size of the vitiligo patch to be treated, which ranged from 125 to 185 with an average of 155 per session . Both donor and recipient sites were simultaneously prepared and punch grafts were harvested by scoring skin up to upper dermis using power punches and then cutting the graft from the base by castroviejo scissors from donor area . The grafts were handled with curved jeweler's forceps and transferred to a sterile bowl containing cold normal saline . Donor site homeostasis was achieved and covered with sterile gauze . In the recipient site, either same size punch or of 0.20 - 0.30 mm smaller punches were used to score the skin up to mid dermis about 3 - 5 mm apart . Punched vitiliginous skin was cut with castroviejo scissors and discarded . The harvested grafts were then placed in the recipient chambers and were secured by firm pressure with moist gauze till complete homeostasis was achieved . Tissue glue was used to fix the grafts and dressed in two layers with 1 cm framycetin tulle pieces followed by sterile gauze and dynaplast . The dressing was further stabilised with elastocrepe bandage in extremities and for lesions on joints, the area was immobilised with splints . At the recipient site donor area was dressed with a layer of framycetin tulle followed by sterile gauze pad, which was removed on the 10 day . All the patients were started on topical immunomodulators and excimer lamp or nbuvb therapy 15 day onwards . The patients were assessed every 15 days for 3 months and once a month for the next 3 months . Out of 15 treated sites in 10 patients, the average numbers of grafts harvested were 125 - 185 (mean 155) per session, the duration of surgery was 40 - 90 min . The transplanted tissue grafts changed from dark brown to black by the 10 day of the procedure . By the 15 day the scab dislodged to leave behind pink grafts, which turned to match the skin colour in 3 - 4 weeks . Pigment spread was observed in most of the grafts by 3 - 4 weeks and nearly completed by the end of 3 - 4 months [figures 24]. All 15 sites showed good cosmetic colour match especially on lips, face and neck . Graft take up was good on other sites . None of them developed donor site complications except for superficial scarring . Shows pre - operative and post - operative (day 0, day 10 and 3 month) photographs shows pre - operative and post - operative (3 month) photographs shows pre - operative, post operative and follow up images the demograph and results are depicted in table 1 . In 1972, norman orentriech first reported autograft repigmentation in humans by using 1 and 2 mm diameter autografts and observed 1 mm pigment spread . In 1983 falabella used miniature punches of 1.5 mm diameter and observed pigment spread of 25 mm . Falabella made an important observation with regard to the relationship between the donor graft area and the area of surgical repigmentation and found that a 1 mm donor graft could originate a pigmented spot 25 times larger than its size . Punch grafting is the easiest, fastest and least expensive method with high rate of success, with very few preventable or manageable side effects . Cobble stoning, variegated appearance and colour mismatch, static graft, depigmentation of graft, perigraft halo and graft rejection are complications at recipient site and hypertrophic scars and depigmentation are complications at the donor site . Cobble stoning is the most common and can be prevented by using punches of less than 1.5 mm and about 1 - 1.2 mm on face and neck . We observed that cobble stoning can be prevented by using same size punches at both donor and recipient sites or using 1.2 mm punch at donor site and 1 mm at recipient site on face and lips and 1.2 and 1.5 mm punches on recipient and donor sites, respectively, on the extremities . In this study, 13 out of 15 sites (86.7%) repigmented with excellent cosmetic colour match . The grafts harvested were of required depth and the depth assessment was easily done in the first 5 - 10 grafts, any thicker grafts in initial harvest was trimmed at base before transplant or by making the recipient punched out chamber beds deeper . Compared with our previous experience with manual mpg, the number of grafts harvested was more with motorised punches and were harvested with ease without surgeon's fatigability . Grafting was done in one session saving patient's time and consumables involved in each surgery and hence the cost of surgery . The rapidly rotating motorised punches can easily score by just touching the mucosa / skin without exerting pressure . So it can be used in difficult sites like lip, nipple, palms and soles . We can also use a simple micromotor, which is used for dental procedures / dermabrasion with same ease . In the donor area, close harvest was difficult to achieve in initial few surgeries . The other disadvantages are the cost, need for sterilisation (chemical sterilisation) of reusable punches and replacement of motorised punch after every 2000 grafts . To conclude we say that motorised power punches enable the operator to harvest more grafts in a single session much faster than manual mpg . Thus, it avoids the operator's stress and also avoids pain in the operator's thumb, which is otherwise experienced with manual mpg . However, it needs surgical expertise in assessing the proper depth and also requires extra care for closer donor graft harvest.
|
Acute sacroiliac joint pyogenic infections are rare and account for 1 - 2% of orthopedic infections . Up to 60% of these patients have predisposing risk factors such as previous trauma, immune deficiency, intra - venous drug abuse, pelvic inflammatory diseases and pregnancy . Most of the reports however are of cases in children and adolescents with limited reports in adults . The case outlined in this report adds to the body of knowledge by highlighting the difficulty in diagnosing the infection in patients with inflammatory arthropathy and by challenging the long - held belief that all such cases require surgical intervention . In addition we believe the report demonstrates the efficacy of daptomycin in the treatment of orthopaedic infections related to mrsa . We report the case of a 50-year - old gentleman who presented to the accident and emergency department at our institution with a 2 week history of malaise, fever and lower back pain . His examination revealed a fever of 39c and he was tender on palpation over the left side of the lower back and left sacroiliac joint . Radiographs of the lumbosacral spine and sacroiliac joints demonstrated evidence of lumbar spondylosis and reduced disc space between l5 and s1 (figure 1). Laboratory investigations revealed raised inflammatory markers with a c - reactive protein of 324 mg / l (normal 0 - 10), white blood cell count of 18x 10 /l (normal 4 - 11) and a neutrophilia of 14.9x10/l (normal 2.0 - 7.5). Blood cultures taken at the time were subsequently found to be positive for mrsa infection . Despite the evidence pointing towards sepsis as a cause for the gentleman's symptoms, preliminary examination and investigations failed to identify a clear focus for this . An mri scan of the lumbosacral spine and pelvis was requested on the presumption that this was the most likely source of the infection . Figure 2 shows the mri scan of the lumbosacral spine demonstrating degenerative changes in the l5-s1 disc with reactive endplate changes . Mri images extended over the pelvis revealed a left iliopsoas collection measuring 7x4 cm with inflammatory changes and oedema involving the iliacus muscle and extending into the left groin . A ct scan was also performed to further evaluate the sacroiliac joint and showed erosive changes within the left sacroiliac joint (figure 4). This may have been secondary to the infective process but equally there was a suggestion that these changes may be secondary to sacroiliac joint arthritis secondary to psoriasis . The patient had been commenced on intravenous vancomycin and linezolid on the basis of the blood cultures . The basis for an aggressive first line combined treatment was the absence of a clear septic focus prior to the mri findings and the abnormally high inflammatory markers . The treatment was converted to daptomycin on the advice of the microbiologists . Following the findings of the mri scan a surgical opinion was sought from the pelvic team who felt that access to the joint and the deep lying abscess was technically difficult . This was further compounded by the presence of active psoriatic plaques across the patient's abdomen and groin, impeding the surgical approach . In the context of the patient already having shown signs of improvement on the antibiotics, the patient did continue to improve and was treated with an 8 week course of daptomycin in all . His inflammatory markers remained marginally high (crp and esr between 40 - 50) for a period after his treatment but this coincided with a flare up of his psoriasis which was now being treated with ultraviolet light therapy . The patient had serial liver function and renal function tests, performed throughout his treatment with daptomycin and these remained within normal range . This was necessary whilst the patient was treated with daptomycin due to the reported side effects such as myositis, acute renal failure secondary to rhabdomyolysis and impairment of liver functions . Serial follow up mri scans demonstrated complete resolution of the iliopsoas abscess and iliacus muscle oedema . He however developed claustrophobia over the course of his many scans and for this reason his final imaging was with a ct scan (figure 6). Septic arthritis of the sacroiliac joint is a rare disease entity with non- specific symptoms and signs contributing towards the difficulty in diagnosing this condition . This can be further compounded by coexisting disease processes such as inflammatory arthritis and this has been demonstrated in the case reported above . Cases of sacroiliac joint infections in adults have been reported in the literature since the early nineties . It has been postulated that infections in the pelvic area occur due to the sluggish circulation in the venous plexus of batson . This coupled with the slow sub - chondral circulation initiates infections on the iliac side of the sacroiliac joint . The common routes taken are along the iliopsoas tendon, into the hip joint or the lower spine . Staphylococcus aureus has been reported as the commonest causative organism in sacroiliac joint infections and this is in keeping with most other orthopedic infections . Methicillin is a semi - synthetic group of penicillin that was introduced in the 1960s to overcome the resistance that staphylococcus aureus had developed to the conventional penicillin . It has an additional acyl group on the beta lactam ring that gives it resistance to the penicillinase enzyme produced by the organism . Resistance to methicillin is attributable to the mec a gene, which is a component of the staphylococcus cassette chromosome (scc). This gene encodes for the expression of an alternative penicillin binding protein pbp2a that renders methicillin ineffective . The main challenge in the early diagnosis of our patient was to differentiate septic sacroilitis from psoriatic sacroilitis . The original moll and wright criteria for diagnosis of psoriatic arthritis has been used prior to 2006 . The criteria included: inflammatory arthritis (peripheral, sacroilitis or spondylitis)presence of psoriasisnegative serological test for rheumatoid inflammatory arthritis (peripheral, sacroilitis or spondylitis) presence of psoriasis negative serological test for rheumatoid in 2006 the new classification of psoriatic arthritis (caspar) study group criteria were introduced . This included additional features such as dactylitis, nail psoriasis and positive family history to increase the sensitivity of the diagnosis particularly in patients without cutaneous manifestations of psoriasis . The patient in this report presented with bleeding psoriatic patches and dactylitis in addition to the lower back pain . The presentation could well have been attributed to a flare up of his psoriatic arthritis, however the presence of fever, elevated inflammatory markers together with leukocytosis and neutrophilia did not correlate with psoriatic sacroilitis alone . The diagnosis of septic arthritis of the sacroiliac joint was supported by the mri findings and the improvement seen in the patient's condition following antibiotic therapy . Surgical debridement with or without fusion of the sacroiliac joint is the main surgical option for this condition and the largest series reported in the literature consisted of 22 patients . We however managed to treat the patient in this report non - operatively in the form of an 8 week course of daptomycin . It contains a 10 carbon lipid side chain which is produced by addition of decanoic acid to the growth medium during fermentation (figure 7). The first step is calcium - mediated binding of the daptomycin molecule to the cell membrane of the organism with conformational change and oligomerisation of daptomycin . These side effects were not encountered during the 8 week course of treatment in our patient . The case presented here contributes to the body of existing literature on the treatment of sacroiliac joint septic arthritis . We believe this is the first case of an infection of this nature having been successfully treated with a course of daptomycin . The case also highlights the difficulty in establishing the diagnosis in the presence of inflammatory arthropathy.
|
Infectious diseases are the second - most common cause of death (after cardiovascular disease) in end - stage renal disease (esrd) patients . Cardiovascular diseases and infections account for 50% and 20%, respectively, of all deaths in esrd patients (2). Currently, the number of patients that require dialysis as a result of diabetes mellitus is increasing ., cryptococcosis occurs among human immunodeficiency virus (hiv)-infected patients, solid - organ transplant recipients, and patients who undergo exogenous immunosuppression . Exposure to cryptococcus does not usually lead to overt disease, but inhaled cryptococcus can survive in the alveolar macrophages or granulomas . The activation of cryptococcus in these locations is associated with the host immune status (3). However, disseminated cryptococcosis has also been reported in a few dialysis patients (4 - 6). We herein report a rare case of disseminated cryptococcosis with rapidly growing lung nodules in an esrd patient who received dialysis following percutaneous coronary intervention (pci). This case suggests that dialysis can cause innate immune disorder and the reactivation of cryptococcosis . A 73-year - old man who had been diagnosed with type 2 diabetes mellitus at 35 year of age, who had severe diabetic neuropathy and diabetic - esrd complained of respiratory distress and sudden chest pain . On the first day of treatment, he visited the emergency room . A physical examination revealed that his body temperature was 35.4c, his heart rate was 90 beats / min with a regular rhythm; and his blood pressure was 130/77 mmhg . The laboratory data showed a wbc count of 8,800/l with a shift to the left (neutrophils 82%), hb 10.2 g / dl, blood urea nitrogen (bun) 82.2 mg / dl, creatinine (cre) 6.50 mg / dl, hba1c 5.9%, creatine kinase (ck) 189 iu / l, c - reactive protein (crp) 8.51 mg / dl, brain - type natriuretic peptide (bnp) 127.4 pg / ml . 1). An electrocardiogram revealed st - segment elevation and poor r - wave progression in leads v1-v3, and echocardiography revealed apical and ventricular asynergy ., the patient went into cardiorespiratory arrest and cardiopulmonary resuscitation was performed, followed by mechanical ventilation . Ventilator assistance was discontinued . However, the patient produced an increasing volume of sputum, which began to appear purulent . Pseudomonas aeruginosa was identified from a sputum culture, and tazobactam / piperacillin (taz / pipc) (4.5 g q12h) was administered . Despite this therapy, the patient's respiratory condition worsened and a chest computed tomography (ct) scan on day 15 revealed bilateral perihilar opacities, pleural effusion, and atelectasis . We suspected the development of complications such as microbial substitution, pneumomycosis and thus performed sputum culturing and serum fungal antigen tests . The administration of taz / pipc was changed to meropenem (0.5 g / day). On day 16,, cryptococcal bodies were identified in two sets of blood cultures and liposomal amphotericin b (l - amb) (3 mg / kg / day) was administered . On day 23, cryptococcal bodies were identified in the sputum, cerebrospinal fluid, and bilateral pleural effusion (fig . The administration of l - amb (3 mg / kg / day) was continued . On day 31, chest ct revealed a solitary nodule in the left lingular segment for the first time, which was suspected to be a pulmonary cryptococcus lesion (fig . After several days, all of the sputum, blood, bilateral pleural effusion, and cerebrospinal fluid cultures tested negative . On day 52 although l - amb was considered effective, the c - reactive protein level remained elevated and the bilateral pleural effusion continuously increased . The patient lost consciousness because of decreased vital capacity with increasing bilateral pleural effusion and was diagnosed with co2 narcosis . The patient's general condition deteriorated . On day 87, ventricular fibrillation occurred and the patient died . A solitary nodule suspected to be a pulmonary cryptococcus lesion in the left lingular segment was revealed by chest computed tomography on day 31 . B, c: another lung nodule in the right pulmonary apical region on day 52 . The risk factors for this infection include hiv / acquired immune deficiency syndrome, connective tissue disease, diabetes mellitus, chronic kidney disease, liver cirrhosis, long - term steroid use, exogenous immunosuppression, and solid - organ transplant . C. neoformans and c. gattii are the main causative agents of cryptococcosis . They are commonly associated with pigeon excreta and plant materials . C. neoformans is widespread in the environment, whereas c. gattii almost all cases of cryptococcosis in japan are caused by c. neoformans (7). Following inhalation, cryptococcus localizes to the lungs where it can be phagocytized by the alveolar macrophages . Cryptococcus is surrounded by a polysaccharide capsule that helps the fungus survive in vivo by interfering with phagocytosis . Ifn- which is secreted from th1 cells activate macrophages to increase the intracellular killing of cryptococcus (3). The efficient control of cryptococcus requires a delicate balance of both th1- and th2-type responses (8). More cytokines are needed to control the th1/th2 balance and fungal infections, including il-12, il-18, il-13, il-4, il-23, il-17, upa, il-10, tgf- (9). Dialysis and the uremic milieu cause the inability to produce selected cytokines for the immune cells (10). Usually, the inhalation of cryptococcus causes focal pneumonitis, and the infection is generally detected as single or multiple pulmonary nodules (11,12). In immunosuppressed patients, focal infection worsens and can cause life - threatening respiratory failure, fungemia, and meningoencephalitis . Disseminated cryptococcosis most frequently infects the lung and central nervous system but can also infect the skin, prostate, and bones . The diagnostic tools that can be used to detect cryptococcosis include histology, fungal cultures, the serum cryptococcal antigen test, and radiography . Disseminated cryptococcosis is defined by either: 1) positive cultures of clinical samples taken from at least two different sites or 2) a positive blood culture (13). Dissemination to extrapulmonary sites is associated with acute respiratory failure and a high rate of mortality (14). In the present case, diabetes mellitus, uremia, hemodialysis, and mechanical ventilation were considered to be risk factors for the dissemination and activation of cryptococcosis, because they are closely related to disorders of both the innate and adaptive immune systems (15 - 17). Furthermore, the patient lived in a buddhist temple that had garden with pigeons; thus it was considered that he could have been infected with cryptococcus before admission . We thought he was not infected with human t - cell leukemia virus type 1 (htlv-1), because of absence of atypical cells in his peripheral blood, splenohepatomegaly and skin symptoms (18). Although cases of cryptococcosis have been reported in immunocompetent patients, cryptococcal pleurisy is rare (19,20). In the present case, multiple nodules were detected in both lungs, and cryptococcal bodies were identified in blood and bilateral pulmonary effusion cultures . In the present case, cryptococcus was therefore thought to have been disseminated through both the airway and the bloodstream . Induction therapy for disseminated cryptococcosis in non - hiv patients includes amphotericin b, flucytosine, and l - amb (21). Flucytosine may cause drug - induced anemia; thus, flucytosine was not administered to our patient because of his chronic renal anemia . On day 21, we initiated the administration of l - amb, which was effective in shrinking the nodules and clearing the patient's cultures . However, on day 31, we found that the pulmonary nodules had grown during treatment . This paradoxical reaction is similar that observed in mycobacterial infection and is considered to be related to a state of relative immunosuppression mediated by a shift in t - helper cell responses to the th2 phenotype . There is a previously reported case in which an hiv - seronegative patient with cryptococcus neoformans meningitis developed a severe inflammatory reaction during treatment (23). To the best of our knowledge, however, we did not find any pathological or bacteriological evidence to suggest that his pulmonary nodules were pulmonary lesions of cryptococcus . It is thought that the patient's ventricular fibrillation, which was caused by cardiac ischemia, was associated with hypovolemia and severe arteriosclerosis . Disseminated cryptococcosis generally reflects immunosuppression and is rarely found in immunocompetent patients . In dialysis patients, growing pulmonary nodules can suggest disseminated cryptococcosis; thus, appropriate testing and therapy should be immediately initiated.
|
Many japanese women experience health issues associated with menstruation; these can include menstrual pain also referred to as dysmenorrhea, heavy menstrual bleeding (hmb) also referred to as menorrhagia, and premenstrual syndrome (pms).13 dysmenorrhea is the most common gynecological complaint associated with menstruation with a prevalence of 25% among all women, and reaching up to 90% among adolescents.4 it has also been reported that one - third of japanese women require analgesic therapy for dysmenorrhea.5 in some women, dysmenorrhea cannot be attributed to any specific cause and is referred to as primary or idiopathic . It was reported that 47% of patients who consulted a physician for menstrual cramping had primary dysmenorrhea, based on a survey in 2000.6 in other cases, it is associated with a preexisting gynecological disorder, and the disease is referred to as secondary or organic dysmenorrhea . Regardless of the cause, dysmenorrhea can have a substantial impact on patient quality of life,7,8 yet many patients do not seek treatment.9 in a patient survey, some untreated women have expressed feelings of resistance or aversion toward seeking therapy, and many suggested that gynecologist consultations were unnecessary for their disorder.1 however, a substantial proportion of women who did seek medical treatment agreed that their daily lives were significantly improved after therapy, and it was also estimated that gynecologist visits saved over 7,000 jpy (70 usd) monthly costs per - patient, occurring due to time off work.1 according to the guidelines for gynecological practice in japan, by the japan society of obstetrics and gynecology (jsog) and japan association of obstetricians and gynecologists (jaog) (2011 edition), low - dose estrogen progestins (leps) and nonsteroidal anti - inflammatory drugs (nsaids) are primarily recommended for primary dysmenorrhea, and traditional chinese medicines (tcms) could be used for primary dysmenorrhea.10 other current clinical practice guidelines for the treatment of dysmenorrhea include the use of over - the - counter analgesics, nsaids, and oral contraceptives such as leps, progestin - only therapies, and the levonorgestrel - releasing intrauterine system.11,12 two kinds of combined oral contraceptives (cocs) are available on the japanese market: leps, (norethisterone / estrogen and drospirenone / estrogen), which are reimbursed for dysmenorrhea treatment, and the other cocs for contraceptive purposes, which are not reimbursed . For example, leps have been reported to be effective in alleviating symptoms in up to 80% of women.13 additional studies have shown efficacy of both gonadotropin - releasing hormone (gnrh) analogs and testosterone derivatives for treating underlying causes of secondary dysmenorrhea, such as endometriosis.1417 existing evidence on treatment patterns, health care resource use, and associated costs in japanese patients with dysmenorrhea is limited . Information on treatment patterns and the economic burden of disease would be useful to guide the allocation of health care resources for the treatment of dysmenorrhea . Furthermore, the analysis of treatment patterns and resource utilization may shed light on any potential challenges related to the current diagnosis and management of dysmenorrhea in japan . The objectives of this study were to describe treatment patterns and estimate health care resource use and costs among japanese women with newly diagnosed dysmenorrhea in a real - world setting . This included a detailed description of the baseline characteristics and comorbidities of these patients, their initial and subsequent therapies for dysmenorrhea, and the probability of surgical procedure related to dysmenorrhea . To assess health care resource utilization and costs among patients, a comparison was made between patients with dysmenorrhea (cases) and those without dysmenorrhea (matched control group). Furthermore, all results were differentiated between women with primary and secondary dysmenorrhea and treatment patterns were evaluated by prescriber s specialty . The reason why we took prescriber s specialty into consideration is that the japanese health care system allows patients free access to any clinic irrespective of specialty . This was a retrospective claims analysis of the japan medical data center (jmdc) database, which includes deidentified medical (inpatient and outpatient) and pharmacy claims from up to 3.0 million beneficiaries (both employees and their dependents) from 2005 onward . The jmdc database covers nearly 10% of the 30 million individuals in the japanese social insurance system, equating to approximately 2.5% of the total japanese population . Data were extracted for patients with records between july 1, 2009, and june 30, 2014, and included information on patient demographics, diagnoses, drug prescriptions, medical procedures, medical facility characteristics, and reimbursement costs . Included patients were women between ages 18 and 49 years who had two separate diagnoses of dysmenorrhea within 3 months . In japan, patients with dysmenorrhea are generally asked to come back to the clinic within the 3 months following a first medical consultation, as it was considered that only one visit would not be enough for selecting patients requiring medical care for dysmenorrhea . Diagnoses were identified by icd-10 (international classification of diseases 10th revision) codes n944 (primary dysmenorrhea) or n946 (dysmenorrhea, unspecified) or one of the following medical information system development center (medis - dc) standard disease names: functional dysmenorrhea, menstrual pain, or dysmenorrhea . Medis - dc consists of standardized names of diseases and injuries for reimbursement by the national health insurance.18 the index date was defined as the date of the first diagnosis of dysmenorrhea . Primary dysmenorrhea was defined as patients without underlying causes (endometriosis, adenomyosis, and fibroids) during the preindex period and from 60 days after the index date, whereas secondary dysmenorrhea was defined as patients presenting at least one diagnosis of one of these conditions during this period . This criterion was defined based on the publications by copher et al19,20 and an assumption that imaging procedures for detecting underlying causes would be performed within 2 months following the first visit . Patients were also required to have insurance records for at least 6 months with a diagnosis of dysmenorrhea prior to their initial diagnosis (preindex period) and for a continuous postindex period of at least 1 year, to be included in the study . Patients were excluded if they had been diagnosed with gynecological cancers or bleeding disorders during the study period (including both pre- and postindex), if they underwent gynecological surgery (hysterectomy, endometrial ablation, or myomectomy) during the preindex period, or if they were treated with hormonal agents during the preindex period (figure 1). For the resource utilization analysis, matched controls were identified among females in the jmdc database who did not suffer from dysmenorrhea (ie, no diagnosis between july 1, 2009, and june 30, 2014). Controls and cases were matched 2:1 by year of birth (within 5 years), charlson comorbidity index (cci) at baseline (15 days from index date), and at least the same 18 months of follow - up period . The study assessed therapies that fit into one of the following categories: hormonal treatments (leps, progestin, testosterone derivatives, and gnrh analogs), nsaids, hemostatic agents, and tcm therapies . Relevant gynecological surgeries, including hysterectomies, endometrial ablations, and myomectomies, were also considered . The treatment patterns were analyzed based on prescription records, with a treatment line defined as a group of consecutive prescriptions of the same agent or combination of agents (combination therapy), with no interruption exceeding 90 days . For each treatment line, the start date, end date, duration, and treatment category were determined . When a period exceeding 90 days was observed between the end of one treatment line and the beginning of a new one, therapy switches were defined when an overlap shorter than 21 days between the end of one therapy and the beginning of a new one was observed and the interval did not exceed 90 days . If an overlap occurred for 21 days or more, however, this was considered a combination therapy . Because surgery was considered as a permanent treatment, a separate combination therapy type (surgery combination) was assigned . Treatment patterns were analyzed among the entire cohort and according to the type of dysmenorrhea (primary or secondary). A subgroup analysis was also conducted according to the prescriber s specialty for the first treatment line . The resources used and their associated costs were calculated based on the 1-year follow - up period after the index date for each patient . Data were collected on inpatient costs, outpatient costs, and costs associated with both prescriptions and imaging procedures . From this information, resource utilization data collected in this analysis included the number of inpatient admissions, cumulative length of stay, number of outpatient visits, and number of imaging procedures . Imaging procedures, which included echography, computed tomography scan, and magnetic resonance imaging, were determined to be related to a diagnosis of dysmenorrhea when they occurred within a 1-month period around the date of the diagnosis (15 days). The use of imaging procedures in controls was evaluated during the same 1-month period as it was for their corresponding matched cases . Nonadjusted comparisons were conducted for outcomes with respect to primary vs secondary dysmenorrhea and cases vs controls . For continuous variables, a fisher s f mean values were then compared using a student s t - test (for variables showing homoscedasticity) or satterthwaite test (heteroscedasticity). For categorical variables, a or fisher s exact test (in cases of insufficient theoretical size of subgroups) time - to - event variables were assessed using kaplan meier curves and log - rank tests for between - group comparisons . (ie, end - of - treatment events such as treatment switch, discontinuation of treatment, surgery, add - on therapy, and step - down therapy) were analyzed using the competing risks survival method, estimating the cumulative incidence . The analyses of costs and resources were conducted through generalized linear models (glms), testing normal, poisson, negative binomial, zero - inflated poisson, and zero - inflated negative binomial distributions . The goodness of fit of the models was assessed with the deviance, and the dispersion with the pearson value divided by the number of degrees of freedom . The models minimizing the deviance or with the best compromise deviance / dispersion (in case of high dispersion) were retained . Models were adjusted for age, the category (based on quartiles) of total health care costs over the preindex period, the quantity corresponding to the modeled variable computed over the preindex period (eg, the inpatient costs over the preindex period while modeling the inpatient costs over the 1-year postindex period), hospitalization during the preindex period, and the type of health insurance membership (employee or dependent). All analyses were performed using sas analytics pro release 9.3 and r (version 3.2.1, sas institute, cary, nc, usa) software (for time - to - event data). In general, a p - value of 0.05 was determined to represent statistical significance . This study was approved by the ethics committee of the nonprofit organization, clinical research promotion network japan . The informed consent of patients was not applicable based on the ethical guidelines for epidemiological research issued by the ministry of health, welfare and labor . This was a retrospective claims analysis of the japan medical data center (jmdc) database, which includes deidentified medical (inpatient and outpatient) and pharmacy claims from up to 3.0 million beneficiaries (both employees and their dependents) from 2005 onward . The jmdc database covers nearly 10% of the 30 million individuals in the japanese social insurance system, equating to approximately 2.5% of the total japanese population . Data were extracted for patients with records between july 1, 2009, and june 30, 2014, and included information on patient demographics, diagnoses, drug prescriptions, medical procedures, medical facility characteristics, and reimbursement costs . Included patients were women between ages 18 and 49 years who had two separate diagnoses of dysmenorrhea within 3 months . In japan, patients with dysmenorrhea are generally asked to come back to the clinic within the 3 months following a first medical consultation, as it was considered that only one visit would not be enough for selecting patients requiring medical care for dysmenorrhea . Diagnoses were identified by icd-10 (international classification of diseases 10th revision) codes n944 (primary dysmenorrhea) or n946 (dysmenorrhea, unspecified) or one of the following medical information system development center (medis - dc) standard disease names: functional dysmenorrhea, menstrual pain, or dysmenorrhea . Medis - dc consists of standardized names of diseases and injuries for reimbursement by the national health insurance.18 the index date was defined as the date of the first diagnosis of dysmenorrhea . Primary dysmenorrhea was defined as patients without underlying causes (endometriosis, adenomyosis, and fibroids) during the preindex period and from 60 days after the index date, whereas secondary dysmenorrhea was defined as patients presenting at least one diagnosis of one of these conditions during this period . This criterion was defined based on the publications by copher et al19,20 and an assumption that imaging procedures for detecting underlying causes would be performed within 2 months following the first visit . Patients were also required to have insurance records for at least 6 months with a diagnosis of dysmenorrhea prior to their initial diagnosis (preindex period) and for a continuous postindex period of at least 1 year, to be included in the study . Patients were excluded if they had been diagnosed with gynecological cancers or bleeding disorders during the study period (including both pre- and postindex), if they underwent gynecological surgery (hysterectomy, endometrial ablation, or myomectomy) during the preindex period, or if they were treated with hormonal agents during the preindex period (figure 1). For the resource utilization analysis, matched controls were identified among females in the jmdc database who did not suffer from dysmenorrhea (ie, no diagnosis between july 1, 2009, and june 30, 2014). Controls and cases were matched 2:1 by year of birth (within 5 years), charlson comorbidity index (cci) at baseline (15 days from index date), and at least the same 18 months of follow - up period . The study assessed therapies that fit into one of the following categories: hormonal treatments (leps, progestin, testosterone derivatives, and gnrh analogs), nsaids, hemostatic agents, and tcm therapies . Relevant gynecological surgeries, including hysterectomies, endometrial ablations, and myomectomies, were also considered . The treatment patterns were analyzed based on prescription records, with a treatment line defined as a group of consecutive prescriptions of the same agent or combination of agents (combination therapy), with no interruption exceeding 90 days . For each treatment line, the start date, end date, duration, and treatment category were determined . When a period exceeding 90 days was observed between the end of one treatment line and the beginning of a new one, therapy switches were defined when an overlap shorter than 21 days between the end of one therapy and the beginning of a new one was observed and the interval did not exceed 90 days . If an overlap occurred for 21 days or more, however, this was considered a combination therapy . Because surgery was considered as a permanent treatment, a separate combination therapy type (surgery combination) was assigned . Treatment patterns were analyzed among the entire cohort and according to the type of dysmenorrhea (primary or secondary). A subgroup analysis was also conducted according to the prescriber s specialty for the first treatment line . The resources used and their associated costs were calculated based on the 1-year follow - up period after the index date for each patient . Data were collected on inpatient costs, outpatient costs, and costs associated with both prescriptions and imaging procedures . From this information, resource utilization data collected in this analysis included the number of inpatient admissions, cumulative length of stay, number of outpatient visits, and number of imaging procedures . Imaging procedures, which included echography, computed tomography scan, and magnetic resonance imaging, were determined to be related to a diagnosis of dysmenorrhea when they occurred within a 1-month period around the date of the diagnosis (15 days). The use of imaging procedures in controls was evaluated during the same 1-month period as it was for their corresponding matched cases . Nonadjusted comparisons were conducted for outcomes with respect to primary vs secondary dysmenorrhea and cases vs controls . For continuous variables, a fisher s f mean values were then compared using a student s t - test (for variables showing homoscedasticity) or satterthwaite test (heteroscedasticity). For categorical variables, a or fisher s exact test (in cases of insufficient theoretical size of subgroups) was performed to compare the distributions . Time - to - event variables were assessed using kaplan meier curves and log - rank tests for between - group comparisons . (ie, end - of - treatment events such as treatment switch, discontinuation of treatment, surgery, add - on therapy, and step - down therapy) were analyzed using the competing risks survival method, estimating the cumulative incidence . The analyses of costs and resources were conducted through generalized linear models (glms), testing normal, poisson, negative binomial, zero - inflated poisson, and zero - inflated negative binomial distributions . The goodness of fit of the models was assessed with the deviance, and the dispersion with the pearson value divided by the number of degrees of freedom . The models minimizing the deviance or with the best compromise deviance / dispersion (in case of high dispersion) were retained . Models were adjusted for age, the category (based on quartiles) of total health care costs over the preindex period, the quantity corresponding to the modeled variable computed over the preindex period (eg, the inpatient costs over the preindex period while modeling the inpatient costs over the 1-year postindex period), hospitalization during the preindex period, and the type of health insurance membership (employee or dependent). All analyses were performed using sas analytics pro release 9.3 and r (version 3.2.1, sas institute, cary, nc, usa) software (for time - to - event data). In general, a p - value of 0.05 was determined to represent statistical significance . This study was approved by the ethics committee of the nonprofit organization, clinical research promotion network japan . The informed consent of patients was not applicable based on the ethical guidelines for epidemiological research issued by the ministry of health, welfare and labor . A total of 6,315 patients with dysmenorrhea, 3,441 (54.5%) primary and 2,874 (45.5%) secondary, were identified, with an average follow - up duration of 4.00.9 years . Patients with secondary dysmenorrhea were significantly older compared with patients with primary dysmenorrhea (35.78.0 vs 31.67.9 years; p<0.0001; table 2), and over half of the secondary dysmenorrhea cohort were older than 35 years (59.3% vs 36.8% in the primary dysmenorrhea cohort). Primary ovarian dysfunction was the most common comorbidity (22.1%) at baseline and was more frequent in patients with primary dysmenorrhea than secondary dysmenorrhea (25.0% vs 18.6%; p<0.0001; table 2). The other comorbidities were more frequently reported in patients with secondary dysmenorrhea than primary dysmenorrhea, including erosion and ectropion of cervix uteri (21.8% vs 15.6%; p<0.0001), anemia (19.7% vs 6.2%; p<0.0001), acute vaginitis (14.5% vs 10.2%; p<0.0001), and low back pain (11.2% vs 8.1%; p<0.0001), respectively . Over three - quarters of patients had a cci score of 0, and less than 4% had a score greater than 1 (table 2). For both cohorts, first diagnoses of dysmenorrhea were reported in clinics (019-bed) (76.4%) and in hospitals (20-bed) (23.6%). In more detail, 81.3% of primary and 70.6% of secondary dysmenorrhea cases were reported in clinics and 18.7% of primary and 29.4% of secondary dysmenorrhea cases were reported in hospitals . Patients who were diagnosed in large hospitals (500-bed) represented 5.7% of the primary dysmenorrhea cohort and 11.7% of the secondary dysmenor - rhea cohort . Thus, patients in the secondary dysmenorrhea cohort were significantly more likely to be diagnosed in hospitals (p<0.0001) and very large (500-bed) facilities (p<0.0001) compared to the primary dysmenorrhea cohort . The majority of patients were diagnosed in obstetrics and gynecology facilities (53.0% and 64.6% for primary and secondary dysmenorrhea cohorts, respectively), whereas the remainder were typically diagnosed in general internal medicine facilities (32.1% and 27.6% for primary and secondary dysmenorrhea cohorts, respectively). At least one diagnostic imaging procedure within 2 weeks before or after diagnosis was reported for 38.7% of patients with primary dysmenorrhea and 69.2% of those with secondary dysmenorrhea; in most cases, this was echography . Among women with secondary dysmenorrhea, a total of 83.4% of patients in the primary dysmenorrhea cohort and 89.2% in the secondary dysmenorrhea cohort were treated with at least one pharmacological agent or surgical procedure . Median times to any treatment initiation after diagnosis of dysmenorrhea were 9 and 3 days, in primary and secondary dysmenorrhea cohorts, respectively . In the primary dysmenorrhea cohort, tcm therapies were the most frequently prescribed first - line treatment and were administered in 38.8% of all patients with primary dysmenorrhea (including treated and untreated patients), leps were prescribed in 27.4% of patients, and the use of hemostatic agents was reported in 12.8% (figure 2). In the secondary dysmenorrhea cohort, the proportion of patients treated with leps was higher, with 50.2% receiving these agents as a first - line treatment, whereas 19.5% were treated with tcm therapies (figure 3). Substantial differences in the treatment of dysmenorrhea were observed according to the specialty of the prescriber: leps were prescribed in first line by obstetricians and gynecologists in 57.2% and 67.7% of treated patients from the primary and secondary dysmenorrhea cohorts, respectively, while internal medicine physicians prescribed leps to 11.6% and 35.7% of treated patients, respectively . Hemostatic agents were prescribed in first line in 3.8% and 3.4% by obstetricians and gynecologists, and in 25.4% and 21.8% by internal medicine physicians, of treated patients in the primary and secondary dysmenorrhea cohorts, respectively . Tcms were prescribed in first line in 34.0% and 20.6% by obstetricians and gynecologists, and in 56.1% and 25.3% by internal medicine physicians, of treated patients in the primary and secondary dysmenorrhea cohorts, respectively . The time to treatment discontinuation was longer for leps compared with other therapies . In patients with primary dysmenorrhea, 35.1% were still receiving lep treatment at 1 year, compared to 10.4% for tcm therapies . Similarly, 33.9% of patients with secondary dysmenorrhea continued to receive leps at 1 year, while only 11.5% continued taking tcm therapies for this duration . Hemostatic agents and nsaids were administered only briefly, with a median treatment duration of 5 days for both agents, regardless of the cohort . Of those patients who did not continue with their first - line treatment for the first 12 months postindex date, only a minority switched to a new therapy (17.1% and 21.3% for the primary and secondary dysmenorrhea cohorts, respectively) and most did not receive any second - line treatment (73.7% and 63.3%, respectively). The most widely used treatments in both second and third lines were also leps and tcm therapies . The probability of surgery at 1 year was 4% in the secondary dysmenorrhea cohort and 0.2% in the primary dysmenorrhea cohort . Patients with dysmenorrhea and the matched control cohort of patients without dysmenorrhea had similar baseline characteristics and resource utilization levels prior to the index period, with all groups reporting a mean number of inpatient admissions of 1.1 for the pre - index period . The analysis of inpatient care demonstrated a significant increase in the number of hospital admissions and length of stay due to dysmenorrhea in the secondary dysmenorrhea cohort vs the controls (5.7 additional admissions per 100 persons over 12 months; 2.2 times longer cumulative length of stay; both p<0.0001), whereas there was no change in admissions compared to controls in the primary dysmenorrhea cohort . Outpatient care visits occurred substantially more often in patients with dysmenorrhea vs controls, with primary and secondary dysmenorrhea cohorts reporting 8.0 and 8.5 additional outpatient visits over 12 months, respectively, after adjusting for baseline characteristics (both p<0.0001; table 3). Primary and secondary dysmenorrhea cohorts had significantly higher mean total health care costs than controls (mean sd: 191,680 jpy (1,917 usd) 261,226 jpy (2,612 usd) vs 83,615 jpy (836 usd) 246,093 jpy (2,461usd) for primary dysmenorrhea cohort and 246,488 jpy (2,465 usd) 295,936 jpy (2,959 usd) vs 90,711 jpy (907 usd) 297,513 jpy (2,975 usd) for secondary dysmenorrhea cohort; p<0.001; table 3). After adjusting for baseline characteristics, costs were 2.2 times and 2.9 times higher in patients in the primary and secondary dysmenorrhea cohorts, respectively, than controls (both p<0.0001). Furthermore, total costs in secondary cases were higher by 33.5% compared to primary cases (p<0.001; table 3). A total of 6,315 patients with dysmenorrhea, 3,441 (54.5%) primary and 2,874 (45.5%) secondary, were identified, with an average follow - up duration of 4.00.9 years . Patients with secondary dysmenorrhea were significantly older compared with patients with primary dysmenorrhea (35.78.0 vs 31.67.9 years; p<0.0001; table 2), and over half of the secondary dysmenorrhea cohort were older than 35 years (59.3% vs 36.8% in the primary dysmenorrhea cohort). Primary ovarian dysfunction was the most common comorbidity (22.1%) at baseline and was more frequent in patients with primary dysmenorrhea than secondary dysmenorrhea (25.0% vs 18.6%; p<0.0001; table 2). The other comorbidities were more frequently reported in patients with secondary dysmenorrhea than primary dysmenorrhea, including erosion and ectropion of cervix uteri (21.8% vs 15.6%; p<0.0001), anemia (19.7% vs 6.2%; p<0.0001), acute vaginitis (14.5% vs 10.2%; p<0.0001), and low back pain (11.2% vs 8.1%; p<0.0001), respectively . Over three - quarters of patients had a cci score of 0, and less than 4% had a score greater than 1 (table 2). For both cohorts, first diagnoses of dysmenorrhea were reported in clinics (019-bed) (76.4%) and in hospitals (20-bed) (23.6%). In more detail, 81.3% of primary and 70.6% of secondary dysmenorrhea cases were reported in clinics and 18.7% of primary and 29.4% of secondary dysmenorrhea cases were reported in hospitals . Patients who were diagnosed in large hospitals (500-bed) represented 5.7% of the primary dysmenorrhea cohort and 11.7% of the secondary dysmenor - rhea cohort . Thus, patients in the secondary dysmenorrhea cohort were significantly more likely to be diagnosed in hospitals (p<0.0001) and very large (500-bed) facilities (p<0.0001) compared to the primary dysmenorrhea cohort . The majority of patients were diagnosed in obstetrics and gynecology facilities (53.0% and 64.6% for primary and secondary dysmenorrhea cohorts, respectively), whereas the remainder were typically diagnosed in general internal medicine facilities (32.1% and 27.6% for primary and secondary dysmenorrhea cohorts, respectively). At least one diagnostic imaging procedure within 2 weeks before or after diagnosis was reported for 38.7% of patients with primary dysmenorrhea and 69.2% of those with secondary dysmenorrhea; in most cases, this was echography . Among women with secondary dysmenorrhea, a total of 83.4% of patients in the primary dysmenorrhea cohort and 89.2% in the secondary dysmenorrhea cohort were treated with at least one pharmacological agent or surgical procedure . Median times to any treatment initiation after diagnosis of dysmenorrhea were 9 and 3 days, in primary and secondary dysmenorrhea cohorts, respectively . In the primary dysmenorrhea cohort, tcm therapies were the most frequently prescribed first - line treatment and were administered in 38.8% of all patients with primary dysmenorrhea (including treated and untreated patients), leps were prescribed in 27.4% of patients, and the use of hemostatic agents was reported in 12.8% (figure 2). In the secondary dysmenorrhea cohort, the proportion of patients treated with leps was higher, with 50.2% receiving these agents as a first - line treatment, whereas 19.5% were treated with tcm therapies (figure 3). Substantial differences in the treatment of dysmenorrhea were observed according to the specialty of the prescriber: leps were prescribed in first line by obstetricians and gynecologists in 57.2% and 67.7% of treated patients from the primary and secondary dysmenorrhea cohorts, respectively, while internal medicine physicians prescribed leps to 11.6% and 35.7% of treated patients, respectively . Hemostatic agents were prescribed in first line in 3.8% and 3.4% by obstetricians and gynecologists, and in 25.4% and 21.8% by internal medicine physicians, of treated patients in the primary and secondary dysmenorrhea cohorts, respectively . Tcms were prescribed in first line in 34.0% and 20.6% by obstetricians and gynecologists, and in 56.1% and 25.3% by internal medicine physicians, of treated patients in the primary and secondary dysmenorrhea cohorts, respectively . In patients with primary dysmenorrhea, 35.1% were still receiving lep treatment at 1 year, compared to 10.4% for tcm therapies . Similarly, 33.9% of patients with secondary dysmenorrhea continued to receive leps at 1 year, while only 11.5% continued taking tcm therapies for this duration . Hemostatic agents and nsaids were administered only briefly, with a median treatment duration of 5 days for both agents, regardless of the cohort . Of those patients who did not continue with their first - line treatment for the first 12 months postindex date, only a minority switched to a new therapy (17.1% and 21.3% for the primary and secondary dysmenorrhea cohorts, respectively) and most did not receive any second - line treatment (73.7% and 63.3%, respectively). The most widely used treatments in both second and third lines were also leps and tcm therapies . The probability of surgery at 1 year was 4% in the secondary dysmenorrhea cohort and 0.2% in the primary dysmenorrhea cohort . Patients with dysmenorrhea and the matched control cohort of patients without dysmenorrhea had similar baseline characteristics and resource utilization levels prior to the index period, with all groups reporting a mean number of inpatient admissions of 1.1 for the pre - index period . The analysis of inpatient care demonstrated a significant increase in the number of hospital admissions and length of stay due to dysmenorrhea in the secondary dysmenorrhea cohort vs the controls (5.7 additional admissions per 100 persons over 12 months; 2.2 times longer cumulative length of stay; both p<0.0001), whereas there was no change in admissions compared to controls in the primary dysmenorrhea cohort . Outpatient care visits occurred substantially more often in patients with dysmenorrhea vs controls, with primary and secondary dysmenorrhea cohorts reporting 8.0 and 8.5 additional outpatient visits over 12 months, respectively, after adjusting for baseline characteristics (both p<0.0001; table 3). Primary and secondary dysmenorrhea cohorts had significantly higher mean total health care costs than controls (mean sd: 191,680 jpy (1,917 usd) 261,226 jpy (2,612 usd) vs 83,615 jpy (836 usd) 246,093 jpy (2,461usd) for primary dysmenorrhea cohort and 246,488 jpy (2,465 usd) 295,936 jpy (2,959 usd) vs 90,711 jpy (907 usd) 297,513 jpy (2,975 usd) for secondary dysmenorrhea cohort; p<0.001; table 3). After adjusting for baseline characteristics, costs were 2.2 times and 2.9 times higher in patients in the primary and secondary dysmenorrhea cohorts, respectively, than controls (both p<0.0001). Furthermore, total costs in secondary cases were higher by 33.5% compared to primary cases (p<0.001; table 3). This analysis demonstrated that the most commonly prescribed treatments for dysmenorrhea in japan excluding non - reimbursed agents were leps and tcm therapies, and patients with secondary dysmenorrhea had the highest utilization rates of leps . Important differences in treatment patterns were observed according to the specialty of the prescriber of the first treatment line: obstetricians and gynecologists mainly prescribed leps, whereas internal medicine physicians prescribed tcm therapies most frequently . This might be due to differences in severity of dysmenorrhea among women who seek medical care from obstetricians and gynecologists vs internal medicine physicians and because women suffering from more severe dysmenorrhea may be more likely to consult an obstetrician or gynecologist and to receive leps . Our findings were generally compatible with the guidelines for gynecological practice by the jsog and jaog 2011 edition.10 although such guidance suggests nsaid treatment for initial pain relief, our findings show relatively low levels of nsaid use . One of the reasons may be that many patients may have used over - the - counter therapies including nsaids, which are not captured by the database.1 persistence on leps was higher in this analysis than for any of the other therapies assessed, including tcm therapies . It was found by adding up the proportions of patients without defined treatment (13.0% of both primary and secondary dysmenorrhea cases) and those with hemostatic agents (11.2%) and nsaids (1.6%) that around 25% of patients diagnosed with dysmenorrhea received no reimbursed treatment or short - term treatments only . This study also demonstrated that affected patients have more frequent physician visits, equating to roughly one additional visit every 45 days that can be attributed to dysmenorrhea . This high frequency suggests that the disease has a strong impact on the quality of life of these patients . Furthermore, dysmenorrhea does require inpatient care in some cases, with approximately six additional inpatient admissions per 100 patients over 12 months attributed to dysmenorrhea in patients with secondary dysmenorrhea . As a result, health care costs in women with dysmenorrhea are two to three times higher than costs in women who do not suffer from this disorder . Estimates of the prevalence of dysmenorrhea in japan ranged from 15.8% to 25%.4,21 a survey conducted in 2004 by the josei rodo kyokai (the japan association for the advancement of working women) reported that 80% of working women has menstrual pain and 3% of women had severe symptoms resulting in absence from work.22 the prevalence of dysmenor - rhea in this jmdc database was only 1.6%, and it is possible that the restriction to patients with at least two recorded diagnoses within 3 months led to the exclusion of less severe cases . Compared to a study by tanaka et al,1 which was a population - based survey of japanese women aged 1549 years, patients in this analysis had a higher rate of lep utilization . One potential explanation is an increase in the general utilization of leps over time that has been captured by our more recently collected jmdc data . Comparatively, our analysis also has a more restrictive patient sample than that of tanaka et al,2 who surveyed women with menstrual symptoms in general, as our study only included patients who consulted for dysmenorrhea at least two times within 3 months, and not for any other menstrual symptoms . In addition to an estimate of prevalence and resource utilization, tanaka et al1 estimated the willingness to pay for a drug that would eliminate all menstrual symptoms . The average willingness - to - pay amount for a drug that would eliminate all menstrual symptoms in outpatients was 4,834 jpy (48 usd) per month . Furthermore, willingness - to - pay to eliminate interference of their menstrual symptoms with the activities of daily life was estimated at 3,304 jpy (33 usd) per month . Interestingly, the annual pharmacy costs attributable to dysmenorrhea, which were derived from differences of annual pharmacy costs between cases and controls in the current analysis, were estimated to be 31,840 jpy (318 usd), or 2,653 jpy (26.5 usd) per month, which was below those of the average monthly costs that outpatients in the aforementioned survey were willing to pay for a drug that would eliminate all menstrual symptoms, and costs that would eliminate interference with daily life due to menstrual symptoms . However, the jmdc pharmacy costs might be less than the pharmacy costs that patients actually paid, as the analysis excluded nonreimbursed therapies, such as nsaids and cocs . Therefore, it is uncertain that the total pharmacy costs paid by patients and health insurance are below the willingness - to - pay amount for dysmenorrhea treatments . Study limitations include those related to any retrospective claims data analysis, including the lack of data supporting the specific reason for each treatment choice . Furthermore, dysmenorrhea is certainly underreported in claims databases and women included in this study may represent severe cases consulting a practitioner . It was previously estimated that 64.6% of women with menstrual symptoms do not seek medical care.1 in addition, treatment patterns observed in this analysis may not fully reflect all medications taken to treat dysmenorrhea if they are not reimbursed by insurance, such as cocs or over - the - counter pain medications such as nsaids . As a result, women who were identified as having no treatment may have received nonreimbursed or over - the - counter therapies during the study period; this could have artificially increased the observed no treatment rate . Because the jmdc is an administrative database, its diagnostic reporting may be incomplete as physicians may report codes for which reimbursement is provided instead of the full or actual diagnoses . For example, nsaids prescribed for diagnosis with other pain symptoms not associated with menstruation were not included in this study . Patients who require surgery may not receive a diagnosis of dysmenorrhea as they will instead receive a diagnostic code for the underlying condition requiring surgery (eg, fibroids). The burden of the disease was estimated over the first year of follow - up and not over the whole available period . Building on this research, future analyses may look at costs beyond 12 months, which are likely lower than in the year following diagnosis . Finally, assumptions used to define treatment patterns were somewhat arbitrary, including the use of 90 days as the cut - off point for treatment discontinuation . These assumptions were, however, supported by expert opinion, owing to the fact that physicians typically prescribe such therapies for a maximum of 3 months . Considerable heterogeneity in treatment patterns was observed among patients with dysmenorrhea, with relatively low utilization of leps in patients with primary dysmenorrhea compared to secondary dysmenorrhea, and those treated by internal medicine physicians compared to obstetricians and gynecologists . Total health care costs were significantly higher among women with dysmenor - rhea compared with similar women who do not suffer from this condition, and excess costs are primarily driven by outpatient care . Further research is recommended to evaluate whether a different allocation of resources, for example with higher utilization of leps, may yield better health outcomes and reduce the economic burden of dysmenorrhea.
|
Data on case investigation timelines in 2002 were collected from records at state and local health departments and public health laboratories in each of 6 states for <100 salmonella spp . Participating states included 1 with a large population (> 6 million), 3 with a medium - sized population, and 2 with a small (<2 million) population from 5 different geographic regions . Rules mandated reporting of diagnosed cases from physicians or clinical laboratories to local health departments (2 states), to the state health department (2 states), or to both (2 states). Cases were selected by systematically choosing every nth record on the basis of the number of cases reported and the number sampled . For 1,319 cases, dates were collected for the following: onset of symptoms (873 [66%]), stool specimen collection (1,088 [82%]), culture result (633 [50%]), report to state or local health department (553 [42%]), submission of isolate to public health laboratory (882 [98%] of 899 isolates that were submitted), case interview (648 [49%]), and molecular subtyping by pulsed - field gel electrophoresis (pfge) (634 of 635 isolates that were subtyped). Although stool culture result dates were recorded for 633 cases, most were for final culture results based on confirmation by the public health laboratory . For each case, intervals between milestones were calculated from the dates available . For 112 outbreaks of foodborne disease, dates were collected for the following: implicated meal or event (100 [89%]), onset of symptoms of index case - patients (112 [100%]), first stool collection (65 [79%] of 82 outbreaks for which stool samples were collected), foodborne illness complaint or report of outbreak - related case to health department (99 [88%]), initiation of outbreak investigation activities (90 [80%]). For each outbreak, intervals were calculated from the dates available . The median intervals from onset of symptoms to surveillance milestone events for individual cases were as follows (table 1): collection of stool samples, 24 days; initial stool culture results, 58 days; case report to health department, 79 days; isolate submission to public health laboratory, 810 days . For case - patients who were interviewed, the median interval from onset of symptoms to interview was 12 days for e. coli o157:h7 cases, 14 days for salmonella spp . And shigella spp . Cases, and 18 days for campylobacter spp . Cases . For isolates that were subtyped by pfge, the median intervals from onset of symptoms to subtyping were 15 days for e. coli o157:h7, 18 days for salmonella spp ., and 21 days for shigella spp . * pfge, pulsed - field gel electrophoresis . A higher percentage of isolates were submitted to the public health laboratory in states where submission was required (98% for salmonella spp . Isolates, 100% for e. coli o157:h7) compared to states where submission was not required (75% for salmonella spp . However, no difference was found between these states in length of time for isolates to be submitted . Of 112 confirmed foodborne disease outbreaks, 83 (74%) had an etiologic agent confirmed by laboratory testing (table 2) (5). Of 29 outbreaks that were not confirmed, norovirus was the suspected cause in 17 (59%) outbreaks, and toxigenic bacteria were suspected in 7 (24%) outbreaks . Median intervals from onset of symptoms to outbreak complaint or recognition were 1 day for bacterial toxins, 3 days for norovirus, 8 days for e. coli o157:h7 and campylobacter spp ., and 16 days for salmonella spp . Overall, 83 (74%) outbreaks were detected by a consumer complaint, 12 (11%) were detected by a healthcare provider, 11 (10%) were detected by pfge cluster evaluation, and 6 (5%) were identified through an interview with an individual case - patient . Intervals from onset of symptoms to consumer complaint (median 3 days, range 021 days) or to report by healthcare provider (median 3 days, range 011 days) were similar . Outbreaks identified by case interview (median 11 days, range 616 days) or pfge cluster evaluation (median 23 days, range 783 days) followed case surveillance timelines described above . The median interval from detection of the outbreak to the initiation of the first outbreak investigation step was 0 days (range 041 days) for all outbreaks . The median duration of exposure for all outbreaks with a confirmed etiologic agent was 1 day (range 121 days). However, 12 (29%) of 41 norovirus, 2 (67%) of 3 e. coli o157:h7, and 9 (75%) of 12 salmonella spp . The median duration of multiday outbreaks was 4 days for norovirus (range 213 days), 5 days for e. coli o157/h7 outbreaks (range 56 days), and 10 days for salmonella spp . The multiple steps between onset of a foodborne illness and its investigation by a public health agency result in delayed recognition of outbreaks caused by reportable enteric diseases . One important way to speed the detection of outbreaks is to encourage clinicians to immediately notify health departments when they suspect a patient is part of an outbreak . Since many outbreaks caused by e. coli o157:h7 and salmonella spp . Last multiple days, physician reporting concurrent with stool collection may provide opportunities for a public health intervention that could prevent outbreak - associated cases . The speed with which clinical laboratories receive, process specimens, and report results varies by setting, agent, and location . The lack of detail available about these steps is an important limitation of this study . However, health departments generally receive reports from clinicians a median of 2 days after the culture result, and isolates are submitted to public health laboratories within 23 days of the initial culture result . These data suggest that improving physician and laboratory reporting practices and logistics could shorten the reporting timeline by 1 or 2 days for most cases . Timeline elements directly under control of public health agencies include the interval from case report to interview and from submission of the isolate to subtyping by pfge . Our results demonstrate more variability for these intervals than for earlier steps in enteric disease surveillance . In particular, half of e. coli o157:h7 cases but less than one fourth of salmonella spp . Cases were contacted by a local health department on the same day the report was received . In addition, outbreaks caused by e. coli o157:h7 were detected a median of 8 days sooner than outbreaks caused by salmonella spp . Given the risk for hemolytic uremic syndrome after e. coli o157:h7 infections and the potential for person - to person transmission, such attention is warranted . Even so, the intervals from onset of symptoms to pfge subtyping documented in the nationwide outbreak of e. coli o157:h7 infections associated with spinach demonstrated that little has changed across the public health system from 2002 to 2006 (6). Infection reinforce the need to increase the timeliness of case follow - up, molecular subtyping, and the linkage of results between them that can reduce delays in the investigation of foodborne outbreaks (7).
|
In spite of the efficacy of standard androgen deprivation therapy for metastasis tumors of prostate gland, almost all of the patients progress with their disease . In the last few years the prostate tumors progress although the androgen blockade is defined as castration - resistant prostate cancer despite obvious efforts for revealing the reasons for hormonal resistance after androgen deprivation, the treatment remains a challenge . The duration of remission after treatment of hormone - resistant tumors of prostate gland with secondary hormonal manipulation is short and there is no serious impact on survival . Up to 1990 the results after chemotherapy for hormone - resistant tumors of prostate gland are disappointing . Later a canadian researcher drew our attention to the potentialities of the combination mitoxantrone with prednisone where an improvement in pain and quality of life was indicated but there was no effect on the survival [3, 4]. In 2004 two trials registered and prolonged survival after using docetaxel . The overall survival with docetaxel was 18,9 months against 16,5 months with mitoxantrone and prednisolone . There were registered improvements also in toxicity and quality of life . At this moment the treatment with docetaxel in combination with prednisone is accepted as standard of care for metastatic castration - resistant prostate tumors [5, 6]. In a process of investigation there are some new chemotherapeutic agents like epothilones and satraplatin [7, 8]. In standard chemotherapy used for treatment of diverse tumors, we usually use the maximum tolerated dose (mdt) as we intend to achieve better results . Despite many clinical researches with different combinations of chemotherapeutics, the progress in effectiveness is very modest and there are many toxic effects . On the other hand prolonged intervals between the applications of the chemotherapeutics are factors which contribute to chemoresistance . In searching other possibilities for reducing the toxic effects of chemotherapy without decreasing its antitumor efficacy in the last few years intensive researches have been made on chemotherapy in low doses and in short intervals between the applications the so - called metronomic chemotherapy . Preclinical research and small clinical research show serious possibilities for lowering the toxic effects without diminishing the efficacy [9, 10]. Usage of low doses chemotherapeutics with increased frequency suggests another method called insulin - potentiated therapy (ipt) or now called insulin - potentiated targeted low - dose therapy (iptld), where standard schemes of chemotherapy are used in combination with intravenous insulin, 10 times lower doses of chemotherapeutics, and short intervals between the applications . This treatment has very low toxicity and our personal experience shows that efficiency is not deferring from the standard chemotherapy . According to our previous experience in implementation of iptld in different tumors including castration resistant prostate, tumors we conducted a research for new possibilities where our main target was to improve the quality of life [12, 13]. This study is focusing on the potential of iptld in combination with hormone therapy for treatment of patients with castration - resistant prostate tumors . Between april 2006 and may 2011 a total of 406 patients with diverse tumors were treated with iptld and 21 out of them were with prostate cancer . Sixteen of them were with advanced prostate cancer (stage iii - stage iv and nodal, bone, or visceral secondary) and cynically apparent hormonal independence entered the study . They were divided into two groups: group a: 8 patients treated with epirubicin, vinblastine, and cyclophosphamide in combination with lhrh agonist (goserelin depot 3,6 mg). In group b another 8 patients were treated with docetaxel in combination with lhrh agonist (goserelin depot 3,6 mg). Before the treatment all patients gave informed content . The main requirement for eligibility was objective and subjective data for progression of the disease after surgical castration, androgenic therapy, and androgen withdrawal . In table 1 pretreatment evaluation of the patients includes history of the disease, physical exam, karnofsky performance status (kps), subjective condition evaluated with beretta, fbc, biochemistry including af, prostate - specific antigen (psa), urine analysis, chest radiographs, ultrasound, bone scan, and ct . Control lab exams include tumor markers after 6th ipt application and after every fourth ipt after that and control exams of bone scan and ct after the 10th application and after that on 3- or 6-month intervals from the beginning . Every month patients complete berettas questionnaire for their subjective state and we note only sections a and b in table 4 . (0,4 ui / kg .) In combination with cyclophosphamide (0,100,15 g / m)/epirubicin (3 mg / m); vinblastine (0,5 mg / m) i.v . In 8 patients . (0,4 ui / kg .) In combination with docetaxel (3,6 mg / m) i.v . In 8 patients . Length of one scan treatment: 6 applications in every 5-day interval, then sustaining treatment in gradual increasing intervals (four applications in 10 days, 2, 3, and more weeks). In the interval, have dexamethason, 20 mg; cyclophosphamide, 50 mg p.o . ; doxycyclin, 100 mg; legalon, 3 140 mg; celebrex, 2 7,5 mg; antioxidants, and ozone therapy . Maintaining treatment consists of no more than 24 ipt applications . Hormone therapysix application (one per month) with lhrh agonist (goserelin depot 3, 6 mg) in every 28 days for six months . Six application (one per month) with lhrh agonist (goserelin depot 3, 6 mg) in every 28 days for six months . Objective responseto treatment was assessed as per psa levels and bone scan results . A complete response required normal psa levels and normal bone scan . A partial response required a decrease of> 50% of the baseline value of psa and decrease in the measurable lesions seen on the bone scan and also the absence of signs of disease progression . Stabilization of disease was defined as decrease of <50% of the baseline levels of psa, an absence of increase of lesions seen on the bone scan . Patients were considered to have disease progression if they showed an increase in 2 successive psa level measurements and/or appearance of new neoplastic lesions . To treatment was assessed as per psa levels and bone scan results . A complete response required normal psa levels and normal bone scan . A partial response required a decrease of> 50% of the baseline value of psa and decrease in the measurable lesions seen on the bone scan and also the absence of signs of disease progression . Stabilization of disease was defined as decrease of <50% of the baseline levels of psa, an absence of increase of lesions seen on the bone scan . Patients were considered to have disease progression if they showed an increase in 2 successive psa level measurements and/or appearance of new neoplastic lesions . Additional parametersfor evaluation the effect of the treatment includes mean remission duration and median overall survival . For evaluation the effect of the treatment the toxicitythe toxicity of treatment is recorded according to the criteria of world health organization (who). The toxicity of treatment is recorded according to the criteria of world health organization (who). The mean follow - up period was 7,6 months (2 to 23 months). After 6th ipt application 3 patients of group a and 4 patients of group b discontinued the treatment because of social reasons . In group common side effects include light weakness and sleepiness on the day of the procedure . Two (16) patients complained of nausea and vomiting a few hours after the procedure but this disappears on the next day . Blood transfusion was necessary before treatment in 3 and during it in 2 patients with low starting hemoglobin . The results after 6th ipt concerning psa criteria for both groups show partial effect in 8 of 16 p. (50%), stabilization in 4 out of 16 (25%), and progression in 4 out of 16 (25%). The results after 10th ipt show complete response in 3 of 9 (33%), partial response in 1 of 9 (11%), stabilization in 2 of 9 (22%) and progression in 3 of 9 (33%). In table 2 are presented the results of treatment according to psa criteria after the end of the core 6 weekly course of ipt . In table 3 the mean values of psa in those who responded to the treatment decrease from 256,7 to 94,6 ng / ml in group a and from 2215,3 ng / ml to 956,2 ng / ml in group b after 6th (course of treatment) ipt . After the 10th course of treatment the values were, respectively, 36,3 nag / ml in group a and 4,9 nag / ml in group b. the mean duration of the remission in group a is 7,6 months (range 318 months) and for group b it is10 months (range 318 months). The median survival for all treated patients is 11,7 months (range 330 months). Subjective improvement is observed in all patients in both groups, average from 24,2 points before treatment to 8,9 points after 6th iptld . More than 50% decrease in symptomatic index is observed in 7 (8) from group a and 3 (8) from group b. in figures 1 and 2 are presented the results from the subjective improvement in both groups after 6th ipt . The method of insulin potentiation therapy was empirically invented in 1930 from mexican doctor d. perez garsia, who was applying it successfully for the treatment of chronic and oncology diseases for 41 years . Lately his practice is continued by his son and grandson who now gathers more and more popularity and the method is used in practice from increasing number of doctors (more then 400) and clinics all around the world . The theoretical conception for the mechanisms of action of ipt is explained in two publications of ayre s. g., d. perez garcia y bellon, and d. perez garcia, in 1986 and 2000 [10, 16]. Same authors in 1990 submitted in european journal of cancer one case from their practice demonstrating complete tumor regression of ductal breast carcinoma in 32-year woman explaining the mechanisms and method that they had use . In 2003 published in cancer chemotherapy and pharmacology the first clinical research investigating the effect of the combination of insulin and methotrexate in patients with breast cancer . Basic role for the efficacy of the method plays the usage of hormone insulin in diabetics . Despite of the diversity of the actions of the insulin in the human body many investigations were conducted and they show that besides its effect in lowering the blood sugar insulin has serious effect in the whole metabolism: increases the permeability of cell membrane, influences the metabolic processes in human body with the increase of the regenerating processes, facilitates the transport of intra and extra cellular liquids which helps the organism to eliminate the toxic products, have other endocrine effects: directly stimulates suprarenal gland to produce epinephrine and glucocorticoid hormones and stimulates acth secretion . Various researches show that insulin hormone has a significant impact also on the tumor cells themselves . As a result of the current knowledge of the effect of insulin on biology of tumor cells increased permeability after the insulin effect on the cellular membrane results in increased intracellular quantity of antitumor agents . Insulin influences the intracellular metabolism of the tumor cell, which leads to increase of the number of cells in phase s, where they are with highly sensitive to specific chemotherapeutics . The increased number of insulin receptors on the tumor cell, in comparison to the normal one, allows the before mentioned 2 factors to act predominantly . Despite the serious achievements in the field of revealing the intimate mechanisms of the action of the insulin hormone in the human body we are still far away from getting answers to all our questions . Future researches will probably reveal more details regarding the effective clinical usage of insulin . Having in mind the serious problems of the treatment of hormone - resistant prostate tumors and taking into consideration previous experimental researches, we conducted a clinical research on the direct inhibitory effect of lhrh analog triptorelin acetate depot on the cellular proliferation . The results confirmed local inhibitory action from the experimental researches and showed that they can successfully be combined with chemotherapy [19, 20]. In search of a new method for lowering the toxicity of the chemotherapy for treating oncological diseases, we began in 2006 to implement iptld combined with lhrh agonist gosrelin depot 3,6 mg . Among the all treated patients 21 are with advanced prostate tumors, 16 are hormone - resistant, and those 16 are divided according to the used chemotherapeutics into 2 groups group a and group b. after the first 6 ipt applications overall (groups a and b) response to treatment on psa criteria shows partial effect and stabilization in 12 of 16 (75%) patients . After the 10th iptld application or 3 months after starting treatment, complete response, partial response, and stabilization were observed in 4 of 9 (66.6%), while in 3 of 9 (33.3%) was registered complete effect . Symptomatic improvement of the treatment after the sixth iptld is observed in all patients in both groups . More than 50% improvement in symptomatic index was reported in 10 of 16 (62.5%) for the same period . The mean duration of remission in patients with complete response in both groups was 17 (range 1518 months) months . In one patient treated with docetaxel, after a 15-month remission that progressed we used again iptld with cyclophosphamide, epirubicin, and vinblastin in combination with i lhrh agonist . After the sixth application the psa values decreased from 399,9 ng / ml to 35,0 ng / ml . Despite the advanced stage of disease in patients treated by us, the treatment is well tolerated without any serious side effects . Quality of life after the second iptld application is significantly improved, and this applies even to patients with treatment failure in terms of psa criteria . The research was carried out in a private medical centre and the financial expenses are not covered by the national health insurance institution . Still the small number of treated patients and the short - term of the follow - up do not allow us to do a serious comparative analysis of the results of the treatment in both groups, as well as making definitive conclusions regarding the effectiveness of the treatment . The preliminary presented results give us reason to assume that extensive comparative researches are necessary for better proving the effectiveness of the method . Our present experience with iptld (in more than 400 treated patients) with various tumors as well as the practical experience of the growing number of doctors practicing the method gives us a reason to assume that iptld method provides a real opportunity for resolving one of the most serious problems of toxicity associated with chemotherapy using maximum tolerated doses . A certain advantage of the method along with its effectiveness is the significantly improved quality of life of the treated patients . In spite of the small number of patients treated by us with castrate - resistant prostate tumor, the preliminary results are promising and this gives us hope and expectations for future serious researches on the potential of widespread clinical use of iptld.
|
Japanese encephalitis, one of the leading forms of endemic encephalitis in eastern and southern asia, is caused by japanese encephalitis virus (jev), which belongs to the family flaviviridae . Approximately 45,000 cases of the disease are reported annually, resulting in 10,000 to 15,000 deaths . The clinical symptoms include headache, fever, vomiting, diarrhea, reduced levels of consciousness, and signs of meningeal irritation with polymorphic and diffuse pathological changes involving various parts of the nervous system [2, 3]. Patients infected with jev characteristically experience persistent motor defects and severe cognitive and language impairments . Jev targets the central nervous system (cns), leading to neuroinflammation with typical features of immune cell infiltration, neuronal death, and the activation of resident glial cells . Various mechanisms including virus - mediated killing and cytokine - mediated cytotoxicity have been reported as the causes of neuronal death . Microglia comprise the resident mononuclear phagocytic population in the cns parenchyma and represent an important component of the innate immune response against invading pathogens [5, 6]. Uncontrolled overactivation of microglia may play an important role in inducing neuron death owing to the production of proinflammatory mediators . These factors, including inducible nitric oxide synthase, cyclooxygenase-2, interleukin- (il-) 6, il-1, tumor necrosis factor- (tnf-), chemokine (c - c motif) ligand 2 (ccl2), and ccl5, are significantly increased in microglia following jev infection . The cross - talk between neurons and microglia often influences the outcome of jev pathogenesis . Activation of various pattern recognition receptors (prrs), such as toll - like receptors (tlrs) and retinoic acid - inducible gene 1- (rig - i-) like receptors, provides the first line of defense in the antiviral immune response by inducing the release of cytokines and chemokines . Tlr3 and rig - i recognize double - stranded rna (dsrna) in innate immune cells during viral replication [9, 10]. The interaction of viral rna with tlr3 and rig - i may trigger several intracellular signaling pathways leading to activation of mitogen - activated protein kinases (mapks), extracellular signal - regulated kinase (erk), p38, and c - jun n - terminal kinase and culminate in the activation of nuclear factor b (nf-b) and induction of the expression of proinflammatory cytokines . Tlr3 and rig-1 are widely expressed in the cells of the innate immune system, but they induce distinct cellular responses depending on the cell type . Tlr3 is responsible for the secretion of cytokines such as tnf-, il-12p40, and il-6 in primary murine microglia following stimulation with poly(i: c). Tlr3 upregulation has been observed in experimental simian immunodeficiency virus (siv) infection and hiv encephalitis in humans, suggesting that enhanced tlr3 expression during viral infection may predispose cells to a greater response . Rig - i activates p38mapk, leading to secretion of c - x - c motif chemokine 10 (cxcl-10) and il-12 in bone marrow - derived dendritic cells following viral infection . Rig - i also recognizes jev dsrna and activates p38mapk and nf-b signaling in various cells including neurons . However, the mechanism by which jev induces the activation of microglia remains unknown . In this study, we investigated the roles of tlr3, rig - i, and the adaptor molecules involved in the activation of signaling for regulating the inflammatory response of microglia following jev infection . The mouse microglia cell line bv-2 was grown in dulbecco's modified eagle medium (dmem) supplemented with 10% fetal bovine serum (fbs, gibco) and 1% penicillin / streptomycin (sigma) at 37c . Jev strain p3 was propagated in bhk-21 cells, and the viral titer was measured with a plaque assay . After incubation for 24 hours (h), the bv-2 cells were switched to serum - free medium for 12 h and then adsorbed with jev at a multiplicity of infection (moi) of 0.01 or 1 for 1 h (moi = 0.01 for the viral proliferation assay, or moi = 1 for determining cytokines and chemokines and signaling kinase expression). After adsorption, unbound viruses were removed by gentle washing with phosphate - buffered saline (pbs). Short hairpin rnas (shrnas) targeting tlr3 and rig - i, negative control shrna (ctr) targeting an irrelevant sequence, and primers used for qpcr of tlr3 and rig - i expression were purchased from genecopoeia . Bv-2 cells were cultured at 1.5 10 cells / well in 12-well plates and then transfected with rig - i and tlr3 shrna at 1.6 g / well with x - tremegene hp dna transfection reagent (roche, inc . ). The concentrations of inhibitors were selected and used as described [16, 17]. Briefly, inhibitors u0126 (sigma - aldrich) (10 m) and sb302580 (sigma - aldrich) (10 m), respectively, against phosphorylated erk and p38mapk were added to the medium immediately after 1 h of viral adsorption and continuously incubated during the experimental periods . At 48 h postinfection (hpi), cells were fixed with methanol for 10 min and then permeabilized with 0.1% (w / v) triton x-100 in pbs for 2 min on ice before incubating with 1% bovine serum albumin in pbs for 45 min at room temperature . After incubation with 10 mg / ml of a monoclonal antibody against jev e protein for 2 h at room temperature, cells were incubated with a 1: 300 dilution of alexa fluor 555-conjugated goat anti - mouse igg (invitrogen) for 45 min at room temperature before observation under a fluorescence microscope . Total cellular rna was isolated using trizol reagent (invitrogen) and reverse transcribed using a revertra ace- kit (toyobo). Levels of viral rna and cytokine mrna were determined with qrt - pcr using sybr green real - time pcr master mix (toyobo). Specific forward and reverse primers for the jev c gene and inflammatory cytokine genes are shown in table 1 . The thermal cycling program was 95c for 10 min, followed by 40 cycles of 95c for 15 s and 60c for 30 s, with a final step of 72c for 30 s. moreover, a plasmid, pcdna3.0-ha - c, was used to construct a standard curve to quantify the viral load in 10-fold dilutions with an initial concentration of 4 10 copies / ml . The levels of cytokine mrnas were normalized to the levels of the mouse housekeeping gene -actin . Commercially available elisa kits (ebioscience) were used to quantify tnf-, il-6, and ccl-2 in the supernatants of bv-2 cells . The nuclear proteins were extracted using ne - per(r) nuclear and cytoplasmic extraction kit (thermo). Total cellular or nuclear extracts were separated with sds - page and electrophoretically transferred to a polyvinylidene difluoride membrane . After blocking with 5% nonfat milk in tris - buffered saline for 1 h at room temperature, the membrane was incubated with primary antibodies against ap-1 (santa cruz biotechnology), rig - i, tlr3, nf-b, erk, phospho - erk, p38mapk, and phospho-38mapk (cell signaling technology). After washing with tris - buffered saline containing 0.5% (w / v) tween, the membrane was incubated with an appropriate peroxidase - conjugated secondary antibody (boster). Each blot was developed using supersignal west pico and supersignal west femto (thermo). The images were captured using the mf - chemi bio imaging system (dnr). To correct the results for potential variations in sample load, each blot was stripped and reprobed with anti--tubulin or anti - gapdh (santa cruz biotechnology). Both rig-1 and tlr3 have been recognized as important prrs in viral infection, but their roles in jev - infected microglia are not fully understood . To determine whether microglial cells use these prrs for jev recognition and induction of inflammatory mediators, the expression of rig - i and tlr3 in jev- or mock - infected bv-2 cells was analyzed with western blotting . The levels of both rig-1 and tlr3 were markedly increased in jev - infected and poly(i: c)-treated cells compared with controls (figure 1), suggesting that jev infection stimulates the expression of rig - i and tlr3 in microglia . Tlr and rig - i - like receptor signaling activates transcription factors such as nf-b and ap-1, which induce production of proinflammatory cytokines . The levels of phosphorylated erk and phosphorylated p38mapk in jev - infected cells were remarkably upregulated at 5 hpi compared with levels in control cells (p <0.01) (figure 2). Nf-b and ap-1 levels were elevated in nuclear extracts of jev - infected cells at 5 hpi (p <0.01) (figure 3). These results implied that jev infection activates a signaling pathway involving erk, p38mapk, ap-1, and nf-b . To investigate the role of rig-1 and tlr3 in the activation of nf-b and ap-1 signaling by jev, shrnas specifically targeting rig-1 and tlr3 were transfected into bv-2 cells (figure 4). Following rig - i knockdown, the levels of phospho - erk (p <0.01), phospho - p38mapk (p <0.001) (figure 5), and nuclear - localized ap-1 (p <0.001) and nf-b (p <0.001) in jev - infected cells were significantly reduced compared with levels in jev - infected cells treated with control shrna (ctr) at 5 hpi (figure 7). Tlr3 knockdown also reduced the expression of phospho - erk (p <0.01) and nuclear - localized ap-1 (p <0.001) and nf-b (p <0.01) (figures 6 and 7). However, the expression of phospho - p38mapk was only slightly decreased upon tlr3 knockdown . These results indicated that rig - i and tlr3 mediate the activation of signaling involving erk, p38mapk, ap-1, and nf-b and that rig - i likely plays a more important role than tlr3 . We next investigated the importance of tlr3 and rig - i in the expression of cytokines and chemokines, which were elevated upon jev infection of bv-2 cells . The release of tnf- (p <0.01), il-6 (p <0.05), and ccl-2 (p <0.05) was significantly reduced in the rig - i knockdown cells compared with ctr cells (figures 8(a)8(c)). Interestingly, only tnf- was reduced in tlr3 knockdown cells (p <0.05), and we observed no obvious change in expression of il-6 or ccl-2 (figures 8(d)8(f)). These results indicated that rig - i likely plays a more critical role than tlr3 in activation of proinflammatory mediators in microglia following jev infection . The erk inhibitor u0126 or the p38mapk inhibitor sb302580 was added to jev - infected cells, and the expression of proinflammatory cytokines and chemokines was detected with qrt - pcr and elisa . Remarkably, a decrease in jev - induced tnf-, il-6, and ccl-2 was observed in cells treated with these inhibitors (figure 9), confirming that jev - induced expression of proinflammatory cytokines and chemokines was mediated by the erk and p38mapk pathway . Qrt - pcr was performed to detect viral replication in bv-2 cells that were transfected with shrna targeting rig - i or tlr3 . We observed increased levels of jev rna in both rig - i knockdown and tlr3 knockdown cells compared with levels in ctr cells . The number of copies of the c gene in rig - i knockdown cells was greater than that in tlr3 knockdown cells at 2448 hpi (figure 10). Microglia play a key role in the proinflammatory response in the cns and provide the first line of defense against invading microbes . Previous studies showed a strong association between the presence of activated microglia and significant neuronal damage during jev infection . Neuronal death caused by jev infection leads to astroglial and microglial activation and the release of proinflammatory mediators . In addition, jev - infected microglia express elevated levels of a number of proinflammatory mediators including il-18, il-1, tnf-, il-6, and rantes [16, 21, 22], which can induce neuron death . Thus, microglial cells may contribute to increased neuronal death via both infective and noninfective pathways . Dsrna, a type of pathogen - associated molecular pattern, can be recognized by prrs such as tlr3 and rig - i . Tlr3 is critical for inducing the cytokines, chemokines, and type i interferons in response to poly(i: c) treatment in microglia . Rig - i is essential for the recognition of jev that ultimately leads to the production of type i interferon in vero (epithelial) cells, and rig - i modulates the inflammatory response in jev - infected neurons . However, the role of tlr3 and rig - i in jev - induced inflammatory responses in microglia is unclear . Here we show the importance of the tlr3 and rig - i signaling pathways in the jev - induced inflammatory response in microglia . Recent studies have reported that microglia and astrocytes express numerous prrs, which allow the recognition of diverse pathogen - associated molecular patterns . The direct demonstration that tlr3 regulates glial and/or neuronal responses to dsrna prompts the examination of the response of primary cells isolated from tlr3-deficient mice . Rig - i is undetectable in uninfected neurons; in jev - infected neurons, however, an upregulation of rig - i and its downstream effectors ips-1, traf6, fadd, and ib as well as an increase in p38mapk and nf-b phosphorylation was reported [6, 8]. Our study demonstrates that both tlr3 and rig - i are detectable in normal bv-2 cells, and their levels are upregulated following jev infection . Induction of proinflammatory cytokines occurs primarily at the level of transcription initiation, through coordinate activation of several transcriptional factors, including nf-b and ap-1 . Increasing evidence suggests that p38mapk and erk signaling cascades are involved in the activation of nf-b and ap-1 . Our study showed that inhibition of erk and p38mapk activity effectively attenuated the expression of proinflammatory cytokines induced by jev in bv-2 cells, indicating that jev induces an inflammatory response via the erk / p38mapk pathway in microglia . This observation is partly consistent with a previous report which suggested that the src / ras / erk signaling cascade is activated in jev - infected neurons / glia . Furthermore, significant reduction of phospho - erk and phospho - p38mapk was observed in jev - infected cells after rig - i knockdown (p <0.01). When tlr3 was knocked down, however, only reduction of phospho - erk was observed (p <0.01; figures 6(a) and 6(b)), suggesting that erk but not p38mapk was activated via the tlr3 pathway by jev or that the effect of tlr3 knockdown was countered by activation of rig - i signaling . Regarding the expression of the nuclear transcription factors ap-1 and nf-b, a greater difference was seen in rig - i knockdown cells than in tlr3 knockdown cells (figure 7). Elisa results showed that only the level of tnf- was considerably reduced after tlr3 knockdown, and a decrease in tnf-, il-6, and ccl-2 expression was found following rig - i knockdown (figure 8). These observations indicate that rig - i rather than tlr3 plays a leading role in modulating the levels of proinflammatory factors in microglia following jev infection . Interestingly, knockdown of rig - i and tlr3 was associated with increased viral load in a proliferation assay (figure 10), which was consistent with the results in rig - i - knockdown neurons . This phenomenon may be due to the fact that the antiviral innate immune response is subverted following rig - i ablation . The effect of rig - i knockdown on viral replication was more obvious than knockdown of tlr3, which further suggests that rig - i plays a more important role than tlr3 in restricting jev replication . In the case of west nile virus (wnv) infection, however, tlr3 plays a protective role against infection of neurons with this virus . In conclusion, our research demonstrates that sensing of jev via tlr3 and rig - i leads to modulation of the erk / p38mapk and ap-1/nf-b pathways, which mediate the participation of microglia in the inflammatory response in the cns.
|
Causality assessment of adverse drug reactions (adrs) is formally undertaken by the pharmaceutical industry, regulators and researchers in clinical trials but rarely by clinicians . For example, regulatory authorities use causality assessment to assess spontaneous adr reports to help with signal detection and inform risk benefit decisions regarding medicines . Anecdotally, clinicians' assessment of adr causality is generally done informally and sometimes subconsciously, which leads to variability in decision making, specifically in terms of when to alter drug therapy and reporting of adrs . The naranjo tool is probably the most widely used worldwide . In two recent large paediatric adr studies, the naranjo tool was found to be inadequate for adr causality assessment and have poor reproducibility. [2, 3] for instance, in the assessment of adrs detected in children acutely admitted to hospital over a 12 month period, interrater reliability using the naranjo tool was poor . The investigators concluded that some of the questions in the tool were not appropriate, leading to a lack of sensitivity, with the overall score obtained being artificially lowered . In addition, the weighting for each question within the naranjo tool was not justified in the original publication . Subsequently, a new causality assessment tool, the liverpool causality assessment tool (lcat, see appendix s1), was developed, formally tested and internally validated . This tool aimed to overcome the issues identified with the naranjo tool, while (1) making it as easy, or easier, to use than the naranjo tool and (2) maintaining the basic principles of causality assessment . Given that there is variability in clinical decision making around adrs, we aimed to develop a means to disseminate this new approach of adr causality assessment to practitioners . We developed an interactive, webbased elearning package designed to improve assessment by individual practitioners: the liverpool adr causality assessment elearning package (lacaep) (see box 1 for the attributes of this package). The use of elearning packages for medical training has been shown to have good uptake and to be effective . Content and navigation the elearning package takes approximately 1 hour to completethe package contains interactive bespoke learning activities that require the user to interact with the software in order to continue, and will offer instructive feedback . The package includes: an interactive diagram (based on the causality flowchart) that allows the use to zoom / pan / rollover to navigate the tool and to gain more information about items in the diagramlogical question arrangement that underlines the sequential nature of the assessment toolreallife case studies: use reallife case studies to build a causality assessment by answering each of the questions on the lcat in turnexpert opinion: the package includes the availability of an expert or panel of expert characters who can provide feedback and hints on decisions made by the user during the case studies exercise the interface contains a straightforward navigation system, with a short tutorial available explaining the functionability of all buttons in the interfacea content menu and glossary are includedthe package has no formal assessment but will require users to complete interactive activities in order to progress the elearning package takes approximately 1 hour to complete the package contains interactive bespoke learning activities that require the user to interact with the software in order to continue, and will offer instructive feedback . The package includes: an interactive diagram (based on the causality flowchart) that allows the use to zoom / pan / rollover to navigate the tool and to gain more information about items in the diagramlogical question arrangement that underlines the sequential nature of the assessment toolreallife case studies: use reallife case studies to build a causality assessment by answering each of the questions on the lcat in turnexpert opinion: the package includes the availability of an expert or panel of expert characters who can provide feedback and hints on decisions made by the user during the case studies exercise an interactive diagram (based on the causality flowchart) that allows the use to zoom / pan / rollover to navigate the tool and to gain more information about items in the diagram logical question arrangement that underlines the sequential nature of the assessment tool reallife case studies: use reallife case studies to build a causality assessment by answering each of the questions on the lcat in turn expert opinion: the package includes the availability of an expert or panel of expert characters who can provide feedback and hints on decisions made by the user during the case studies exercise the interface contains a straightforward navigation system, with a short tutorial available explaining the functionability of all buttons in the interface a content menu and glossary are included the package has no formal assessment but will require users to complete interactive activities in order to progress reporting and user tracking the package bookmarks user progress between sessions and retain options chosen in completed activitiesadministrators of the package will be able to access the following information (via the learning management system where the package will be hosted): the participant demographic details; the current progress of the participant; which activities they have undertaken; the outcome of each assessment made, i.e. What was the classification, what path did they take on the lcat to get there and was the classification correct . At the end of the package, the user is asked to complete a feedback survey which assesses the usability and usefulness of the package and of the lcat the package bookmarks user progress between sessions and retain options chosen in completed activities administrators of the package will be able to access the following information (via the learning management system where the package will be hosted): the participant demographic details; the current progress of the participant; which activities they have undertaken; the outcome of each assessment made, i.e. What was the classification, what path did they take on the lcat to get there and was the classification correct . The participant demographic details; the current progress of the participant; which activities they have undertaken; the outcome of each assessment made, i.e. What was the classification, what path did they take on the lcat to get there and was the classification correct . At the end of the package, the user is asked to complete a feedback survey which assesses the usability and usefulness of the package and of the lcat accessibility an ebook provides alternative testbased content for the packagethe package has been tested for sharable content object reference model (scorm) compliance with the adl test suitethe package complied with world wide web consortium (w3c) web standards wherever possibleflash or javascriptbased content is accompanied by alternative html content an ebook provides alternative testbased content for the package the package has been tested for sharable content object reference model (scorm) compliance with the adl test suite the package complied with world wide web consortium (w3c) web standards wherever possible flash or javascriptbased content is accompanied by alternative html content the purpose of this pilot randomised controlled trial was to gain feedback on the usability and usefulness of the lcat and the lacaep . Feedback obtained for the latter will be used to identify areas for improvement and development . This trial also aimed to generate data on effect size enabling a larger hypothesis testing study to be conducted . This was a pilot, singleblind, parallel group study conducted by the university of liverpool . This pilot aimed to inform a larger scale study that would formally compare the effect that the lacaep has on improving the consistency of assigning causality using the lcat . The study obtained organisational approval from nhs north of england, and permission was obtained from the head of schools at the north west and mersey deaneries to include trainees from that region . Eligibility criteria were defined to ensure that improvements in classifications were attributed to the intervention and so that prior knowledge or experience of the participants could be managed as appropriate . In the uk, trainees in paediatrics progress through specialty training (st) levels, st 1 being the first year of training . Eligible participants were specialist trainees in paediatrics (st level 1 and above) within the mersey (n = 165) and north west deaneries (n = 214). Trainees who had previously received formal training in causality assessment or had obtained a professional qualification in clinical pharmacology or pharmacy were excluded . Eligible trainees were recruited through email and by advertising the trial on the alder hey children's hospital intranet and in workplaces . Invitations to participate all participants completed a consent form when they registered to participate and returned an electric or hard copy . Random allocation sequence was generated by computer by an independent statistician and was stratified by speciality training level . Both the control and intervention arm received access to the lcat to assist causality assessment . Participants in the intervention arm accessed an interactive training module with selfdirected elearning components that guided users when making causality assessments using the lcat (lacaep). Appendix s2 and s3 show illustrative screenshots of the introduction page and a worked example, respectively . Although trainees were aware of the allocated arm, data analysts were kept blinded to the allocation until after the analyses were finalised . Each trainee was issued a username, password and web link which would allow access to the trial platform according to the randomisation schedule . Following any training, trainees in both arms were required to assess the same 20 adr cases using the lcat tool . The elearning package was tested rigorously by the study team for functionality and content before the trial was opened . Several iterations of testing were undertaken until all aspects of the trial and package were suitable for a full pilot study to commence . Participants were able to access the trial platform from 29 february to 15 march 2013 . Email reminders were sent to those who had not completed the assessments during this period to improve completion rates . Trainees who completed the trial were given a training certificate for their training records and entered into a cash prize draw . Adr case studies used both for post intervention assessment and within the training phase of the elearning tool were taken from two previous adr studies. [6, 7] within these studies, causality classification (unlikely, possible, probable or definite) was reached by consensus by a multidisciplinary panel of experts . For the purpose of this trial, gold standard. Case studies were selected using quota sampling methods from this cohort of cases to mirror the distribution of possible, probable, definite and unlikely adrs observed in these studies . The number of correct classifications when compared against the gold standard was defined as the primary efficacy outcome . As a second efficacy outcome, the route taken on the lcat flowchart was recorded to ensure that classifications were obtained following a route defined by a multidisciplinary panel of experts . Upon completing the intervention, trainees were encouraged to provide feedback on both lcat and lacaep (appendix s4) by completing an optional survey, built in to the package, made up of a series of open and closed questions . As this was a pilot study, intended to generate data on effect size to enable a larger hypothesis study to be conducted, no formal power analysis was completed prior to the trial . A pragmatic sample of 80 participants of the total 379 trainees at that time was considered a minimum requirement . Closed items on the feedback questionnaire were analysed quantitatively and reported as count data and percentages . No formal qualitative analysis was conducted on open items which are presented verbatim . To ensure participants remained anonymous, each was given a unique participant number made up of a letter to indicate the intervention arm (a for the intervention arm and b for the control arm) and a sequential number within arm . Overall series agreement postintervention was summarised for each treatment group, both overall and split by speciality training level (groups: 3 and below, 4 and above), using descriptive statistics, means with 95% confidence intervals (ci) or medians with an interquartile range if the scores was nonnormally distributed . The effect of the intervention was summarised using descriptive statistics, means with 95% confidence intervals (or medians with an interquartile range if the scores was nonnormally distributed). All statistical analysis was carried out using the statistical software package r (version 2.13.2, r core team (2013). As this was a pilot study, intended to generate data on effect size to enable a larger hypothesis study to be conducted, no formal power analysis was completed prior to the trial . A pragmatic sample of 80 participants of the total 379 trainees at that time was considered a minimum requirement . Closed items on the feedback questionnaire no formal qualitative analysis was conducted on open items which are presented verbatim . To ensure participants remained anonymous, each was given a unique participant number made up of a letter to indicate the intervention arm (a for the intervention arm and b for the control arm) and a sequential number within arm . Overall series agreement postintervention was summarised for each treatment group, both overall and split by speciality training level (groups: 3 and below, 4 and above), using descriptive statistics, means with 95% confidence intervals (ci) or medians with an interquartile range if the scores was nonnormally distributed . The effect of the intervention was summarised using descriptive statistics, means with 95% confidence intervals (or medians with an interquartile range if the scores was nonnormally distributed). All statistical analysis was carried out using the statistical software package r (version 2.13.2, r core team (2013). All paediatric trainees within the mersey (n = 165) and north west (n = 214) deanery were approached to participate . Sixty participants provided consent during the recruitment phase; three were found to be ineligible upon screening; one had a pharmacology phd, one had pharmaceutical industry experience, and the st level was unknown for the third . The 57 remaining participants were randomised 1: 1 to the two intervention arms . Twentynine participants were randomised to the intervention (training) arm, 13 were st level 13, and 16 were st level 48 . Twentyone (72%) of those randomised to the intervention arm started the training package and assessment, and of those, 18 (62%) completed the assessment and the feedback questionnaire . Twentyeight participants were randomised to receive no training, 13 were st level 13 and 15 st level 48 . Twentythree (82%) of those randomised to the control arm started the assessment, 17 (61%) completed the assessment, and 16 (57%) completed the feedback questionnaire . Thirtyfour participants provided feedback on the lcat, and 18 provided feedback on the lacaep . Results of the feedback questionnaire is given in tables 1, 2, 3, 4 . Summary statistics of categorical answers to feedback questionnaire free text responses to q4 of the feedback survey: please write any comments you might have about this tool free text responses to q7 of the feedback survey: give an example of what you have learnt free text responses to q11 of the feedback survey: please write any comments about the elearning package feedback about the lcat was generally positive . Threequarters (n = 26, 76%, table 1) of participants found the lcat easy to use, approximately the same proportion (n = 25, 74%, table 1) said that they would or would probably use the tool in their role, and twothirds (n = 23, 68%, table 1) stated that they would be likely or very likely to recommend the tool to others . The majority of participants (n = 14, 78%, table 1) felt that the elearning package was useful, and many learned something from the package (n = 13, 72%, table 1). Almost all of those that said that they had learnt something from the package felt that they could use what they have learnt in practice (n = 12, 92%, table 1). The majority of participants in the intervention arm (11, 61%, table 1) said that they would be unlikely to recommend the training to others . Four participants felt that the feedback was inadequate and more explanation was needed (a1, a5, a7 and a17, table 4). A7 felt that the language was unhelpful and that the package needed work (table 4), while a10 also thought that the package needed work due to its technical problems (table 4). The average score by correct classification was 9.22 (95% ci, 7.96 to 10.48) in the intervention arm and 7.88 in the control arm (95% ci, 6.76 to 9.00). The effect of the intervention was to increase the score by 1.34 on average (95% ci, 0.3 to 3.0). Participants in the intervention arm of st level 13 and st level 48 had scores on average of 9.14 (95% ci, 6.45 to 11.84) and 9.27 (95% ci, 7.65 to 10.89), respectively . Similarly, participants in the control arm that were st level 13 and st level 48 had an average score of 7.86 (95% ci, 5.39 to 10.33) and 7.90 (95% ci, 6.53 to 9.27). Outcome data for 35 participants split by group at trial closure the maximum score is 20 . The secondary outcome, score based on correct route, ranged from a minimum of 2 to a maximum of 8 out of 20 across both arms . The effect of the training package increased the score by correct route by 1.01 correct classifications (95% ci, 0.3 to 2.3). All paediatric trainees within the mersey (n = 165) and north west (n = 214) deanery were approached to participate . Sixty participants provided consent during the recruitment phase; three were found to be ineligible upon screening; one had a pharmacology phd, one had pharmaceutical industry experience, and the st level was unknown for the third . The 57 remaining participants were randomised 1: 1 to the two intervention arms . Twentynine participants were randomised to the intervention (training) arm, 13 were st level 13, and 16 were st level 48 . Twentyone (72%) of those randomised to the intervention arm started the training package and assessment, and of those, 18 (62%) completed the assessment and the feedback questionnaire . Twentyeight participants were randomised to receive no training, 13 were st level 13 and 15 st level 48 . Twentythree (82%) of those randomised to the control arm started the assessment, 17 (61%) completed the assessment, and 16 (57%) completed the feedback questionnaire . . Results of the feedback questionnaire is given in tables 1, 2, 3, 4 . Summary statistics of categorical answers to feedback questionnaire free text responses to q4 of the feedback survey: please write any comments you might have about this tool free text responses to q7 of the feedback survey: give an example of what you have learnt free text responses to q11 of the feedback survey: please write any comments about the elearning package feedback about the lcat was generally positive . Threequarters (n = 26, 76%, table 1) of participants found the lcat easy to use, approximately the same proportion (n = 25, 74%, table 1) said that they would or would probably use the tool in their role, and twothirds (n = 23, 68%, table 1) stated that they would be likely or very likely to recommend the tool to others the majority of participants (n = 14, 78%, table 1) felt that the elearning package was useful, and many learned something from the package (n = 13, 72%, table 1). Almost all of those that said that they had learnt something from the package felt that they could use what they have learnt in practice (n = 12, 92%, table 1). The majority of participants in the intervention arm (11, 61%, table 1) said that they would be unlikely to recommend the training to others . Four participants felt that the feedback was inadequate and more explanation was needed (a1, a5, a7 and a17, table 4). A7 felt that the language was unhelpful and that the package needed work (table 4), while a10 also thought that the package needed work due to its technical problems (table 4). The average score by correct classification was 9.22 (95% ci, 7.96 to 10.48) in the intervention arm and 7.88 in the control arm (95% ci, 6.76 to 9.00). The effect of the intervention was to increase the score by 1.34 on average (95% ci, 0.3 to 3.0). Participants in the intervention arm of st level 13 and st level 48 had scores on average of 9.14 (95% ci, 6.45 to 11.84) and 9.27 (95% ci, 7.65 to 10.89), respectively . Similarly, participants in the control arm that were st level 13 and st level 48 had an average score of 7.86 (95% ci, 5.39 to 10.33) and 7.90 (95% ci, 6.53 to 9.27). Outcome data for 35 participants split by group at trial closure the maximum score is 20 . The secondary outcome, score based on correct route, ranged from a minimum of 2 to a maximum of 8 out of 20 across both arms . The effect of the training package increased the score by correct route by 1.01 correct classifications (95% ci, 0.3 to 2.3). In our programme of research into adrs in children, we have developed the lcat, which has been internally validated . In order to progress this further, we went on to develop an elearning package (lacaep), the utility of which was tested in this pilot trial . Before embarking on a larger trial, it is also important to assess the feedback received from the participants on the tools used . Feedback on the lcat was mostly positive, with trainees indicating they had learnt something about adr assessment from the tool and would use it in their clinical practice . The user feedback on both the lcat and lacaep has highlighted a number of areas that need to be addressed in the educational package such as giving more explanation of some of the terms used and the routes taken to determine causality . Our data indicate that the lacaep did not improve causality assessment in trainees, but participants who were given training by the lacaep in causality assessment obtained a higher score by approximately 1.5 (out of 20) on average for correct classification (mean = 1.34, 95% ci, 0.3 to 3.0). This was a pilot study to inform a main trial, and data were not available to inform a sample size calculation prior to recruitment . We selected a pragmatic sample size (n = 80) based on the eligible population, but we did not reach this recruitment target . However, the inclusion of 35 participants was adequate to fulfil the aims of this pilot study . We consider that a difference of 2 correctly classified adrs out of 20 between the groups would be the minimum worthwhile clinical difference . Based on the results obtained and this consideration, a trial with 90 participants (45 per group) is required to have adequate power to detect a true clinically relevant difference of 2.0 at the 5% significance level and 80% power . First, it shows that a novel trial design where participants can take part remotely is feasible and results in a reasonable proportion of participants completing the trial; overall, 61.4% of participants who were randomised completed the trial . Second, this pilot offers a template for easy expansion to a larger trial that will represent the package utility in a larger cohort, not only in size but also in geographical expansion to represent a wider proportion of trainees across the uk . A similar elearning approach has been used by gordon et al . Who conducted an rct to investigate the effectiveness of an elearning course on paediatric prescribing in north west england . This research attained a sample size of 206 from a pool of 1150 (17.9%) of which 113 completed the trial (54.9%). This is comparable with our sample size of 57 from a pool of 379 (15.0%) of which 35 completed the assessment phase of the trial (59.5%). Third, the use of trainees as participants means that differences observed are indeed down to the intervention and not prior knowledge or experience . The inclusion of a preintervention assessment of all participants would have been the optimum approach to determining the impact of the intervention . However, the study relied on the availability of trainees to participate, so the design was adapted to minimise the time commitment required from participants, with the aim of enhancing participation rates . Second, and for the same reason, the study was held remotely hosted on a server such that trainees could participate in their own time, and so, the possibility of participants discussing their responses cannot be eradicated . However, the study management team did not consider this likely as participants consented to not discussing aspects of the trial with their peers . Third, as this trial relied on the participation of volunteers, the generalisability of the results may be questionable . We have recently shown the importance of adrs in paediatric medicine,[6, 7, 8] and previously in adult medicine. [2, 3] the burden overall is very large leading to a great deal of morbidity in patients, occasional mortality, unnecessary investigations, increased length of stay in hospital and a huge cost burden . It is incumbent on all healthcare professionals to recognise adrs and act accordingly (stop the drug and/or reduce the dose, and report the adr to their own hospitals and regulatory authorities). However, because adrs can affect any bodily system, and can present in a multitude of ways, they are sometimes difficult to recognise, and even when recognised, there may be difficulties in assigning causality . Many causality assessment tools have been developed; more complicated tools may potentially be more accurate but extremely difficult to use in clinical practice . Our aim with the lcat was to develop a userfriendly and easytocomplete tool which would improve assessment of adrs and their reporting in daily clinical practice . The feedback from participants that they would use such a tool in their clinical practice is thus encouraging . Although this trial included medical trainees, the lcat was developed by a multidisciplinary team and has been used by nurses and pharmacists for the evaluation of causality in a research setting. [6, 7] therefore, we anticipate it being used by both medical and nonmedical professionals in a clinical setting . Nevertheless, the appropriate use of the tool needs an educational package such as the one developed as part of this study . Feedback on the lcat and lacaep was mainly positive although we have identified areas of the lacaep that need improving before conducting a trial to formally assess the effectiveness of the tool . This study was not powered to detect a difference between allocation arms though preliminary findings show a nonsignificant improvement of 1.5 (out of 20) on average in the lacaep arm . The data collected were sufficient to enable a formal sample size calculation for a main study, and thus, our next step will be to improve the educational tool and then test it again in an appropriately powered trial of 90 participants (n = 45 per group). All authors are members of the research team on the adverse drug reactions in children project . Outputs of this project included the liverpool causality assessment tool and the liverpool adr causality assessment elearning package . The authors thank the nihr for providing funding for the adric (adverse drug reactions in children programme grant) and the merseyside and cheshire health innovation and education cluster (hiec) for funding the development of the educational tool . All authors state that they had complete access to the study data that support the publication . All authors are members of the research team on the adverse drug reactions in children project . Outputs of this project included the liverpool causality assessment tool and the liverpool adr causality assessment elearning package . The authors thank the nihr for providing funding for the adric (adverse drug reactions in children programme grant) and the merseyside and cheshire health innovation and education cluster (hiec) for funding the development of the educational tool . All authors state that they had complete access to the study data that support the publication.
|
Though a vertebral artery (va) anomaly is rare, tokuda et al.10) have reported that in a series of 300 va angiograms, 2.3% had va anomalies . Mostly cases are asymptomatic, but a few cases have been reported with cervical pain, occipital pain, and myelopathy . Here, we report a rare case of cervical compressive myelopathy by an anomalous bilateral va entering the spinal canal at the c1 level . Vas on both sides deeply indented into the spinal cord and resulted in symptomatic myelopathy . A 70-year - old woman, recently diagnosed with hypertension, presented with symptoms of gradually progressive gait disturbance and weakness in lower extremities for about 8 months . When she was admitted, she could not go up a flight of stairs alone . The long tract signs were positive on both sides such as hyperreflexia, toe sign and the hoffmann sign . Mri revealed large flow voids in the region of the craniovertebral junction that resulted in compression of the cord (fig . 1). Computed tomography (ct) angiography revealed bilateral vertebral arteries looped medially, like having the appearance of kissing each other on the dorsal surface and deeply indented into the cord substance (fig . A midline suboccipital craniotomy with c1 laminotomy and c2 partial laminectomy for preserving paraspinal muscle of c2 was performed . Both vertebral arteries were showed tortuous, looped medially each other on the posterolateral surface of the cord, and spinal cord was compressed by them . First, right side arachnoid membrane around va was dissected and excised dentate ligament to release va from spinal cord . And then anchoring suture from va to the arachnoid membrane and dentate ligament was made using 6 - 0 nylon . And then teflon sponge was inserted to the space between va and the spinal cord for microvascular decompression . Same procedure was performed to left va and enough decompression was achieved . At the end of the operation we repaired occipital bone flap & c1 lamina . Vas were separated from each other without interruption in blood flow at the c1 level (fig . 3). She could walk and go up a flight of stairs at the one month follow - up and the symptoms of the patient gradually improved over 2 years of the postoperative period . Six months after the operation, the mri showed the full recovery of the spinal cord contour and the laterally transposed va (fig . A 70-year - old woman, recently diagnosed with hypertension, presented with symptoms of gradually progressive gait disturbance and weakness in lower extremities for about 8 months . When she was admitted, she could not go up a flight of stairs alone . The long tract signs were positive on both sides such as hyperreflexia, toe sign and the hoffmann sign . Mri revealed large flow voids in the region of the craniovertebral junction that resulted in compression of the cord (fig . 1). Computed tomography (ct) angiography revealed bilateral vertebral arteries looped medially, like having the appearance of kissing each other on the dorsal surface and deeply indented into the cord substance (fig . A midline suboccipital craniotomy with c1 laminotomy and c2 partial laminectomy for preserving paraspinal muscle of c2 was performed . Both vertebral arteries were showed tortuous, looped medially each other on the posterolateral surface of the cord, and spinal cord was compressed by them . First, right side arachnoid membrane around va was dissected and excised dentate ligament to release va from spinal cord . And then anchoring suture from va to the arachnoid membrane and dentate ligament was made using 6 - 0 nylon . And then teflon sponge was inserted to the space between va and the spinal cord for microvascular decompression . Same procedure was performed to left va and enough decompression was achieved . At the end of the operation we repaired occipital bone flap & c1 lamina . Vas were separated from each other without interruption in blood flow at the c1 level (fig . 3). She could walk and go up a flight of stairs at the one month follow - up and the symptoms of the patient gradually improved over 2 years of the postoperative period . Six months after the operation, the mri showed the full recovery of the spinal cord contour and the laterally transposed va (fig . A driving aberrant va course is a clinical problem sometimes at the time of surgery such as acdf or posterior c1 - 2 fixation . However, ectatic and anomalous vertebral arterial loops resulting in cord compression have been identified only rarely1,2,4 - 9,11). From literature review, the authors found isolated 14 cases of symptomatic cord compression due to anomalous va . While two patients had evidence of myelopathy, rest of the cases had symptoms that could be related to nerve root compression and manifested as neck pain, arm pain or torticollis1,2,4 - 9,11). Continuous pulsations of the large arteries over long period might be apparently the cause of compressive myelopathy . Hasegawa et al.3) proposed a hammering effect to the spinal cord by the arterial pulsation of the anomalous va based on arteriosclerosis . As in the previous reports, we also suggest that intermittent stimulation of the spinal cord by the anormalous vertebral artery was responsible for the cervical myelopathy in our case . Mri, ct angiography and/or cerebral angiography are the investigations of choice to diagnose such patients . Treatment options for patients with anomalous va with root or cord compression include vessel transposition, duroplasty, detachment of roots from the vertebral arteries or the placement of inert material between the vessel and the cord . One of them is microvascular decompression . Since jannetta4) introduced this microvascular decompressive technique, it has been used to treat disorders such as hemifacial spasm and trigeminal neuralgia . Most commonly, prosthesis such as muscle graft or sponge is inserted into the space between the responsible vessel and the affected nerve or brainstem region to transpose the responsible vessel and resolve the pulsatile pressure on the nerve fiber . Following bilateral vasculopexy, the cervicomedullary junction was relieved of compression resulting in lasting relief of the symptoms of the patient . In the present case, va at v4 segment entered the spinal canal and formed a kissing loop on the dorsal surface of the cord . The patient underwent surgery of vertebral artery repositioning by anchoring suture between artery and around arachnoid membrane and dentate ligament and microvascular decompression using insertion of teflon to the space between vertebral artery and the spinal cord . After surgery, clinical symptom and radiologic follow - up such as ct angiography and mri were both satisfactorily improved . Even though it is rare, we should include vertebral artery anomaly in the differential diagnosis of upper cervical lesions presenting with cervical myelopathy . Additionally, an anchoring suture and microvascular decompression around the va could be a sufficient and safe method to indirectly decompress the spinal canal.
|
Atopic dermatitis (ad) is a most common chronic inflammatory skin disease, affecting about 10 million people in the world, leading to a significant reduction in quality of life, and its incidence is continuously increasing in westernized countries [1, 2]. The pathogenesis of ad is unknown, but the disease seems to be correlated with specific immune and inflammatory mechanisms . The general characteristics of ad include excessive infiltration of inflammatory cells such as lymphocytes, macrophages, and granulated mast cells into the skin lesions, eosinophilia in peripheral blood, and a high level of serum immunoglobulin e (ige). Mast cells are tissue - based inflammatory cells of bone marrow origin, which respond to signals of innate and adaptive immunity . They play a major role in immediate hypersensitivity reaction and are activated through the high - affinity ige receptor, fcr . In addition, it has been reported that a large number of mast cells can be found in ad skin lesion . The majority of ad patients have elevated blood ige level and it is mediated of mast cell activation . Mast cell activation by ige is release inflammatory mediators, such as histamine, as well as cytokines, including th2 cytokines, such as il-4, il-5, and il-13 . Thus, cell - bound ige is cross - linked allergens and it is contributed to the development of ad through mediating activation of mast cells localization . Proinflammatory cytokines that are released by activated mast cells, including il-6 and il-8, play an important role in allergic inflammation; il-6 mediates allergic inflammation, while il-8 induces the migration of neutrophils into inflammatory regions as a potent chemotactic cytokine [9, 10]. Cp001 is a mixture of four oriental herbal medicines composed of houttuynia cordata thunb, rehmannia glutinosa libosch, bark of betula platyphylla var . Houttuynia cordata thunb has long been used in traditional oriental medicine for the treatment of inflammatory diseases . Also, several studies demonstrated that houttuynia cordata thunb has been associated with a broad range of pharmacological activities, including anti - inflammatory, antiviral, and anticancer effects . Rehmannia glutinosa libosch has traditionally been used as an ingredient herb in east asian medicine for the effects of hemostasis, activation of blood circulation, and improvement of kidney function . Several studies indicated that rehmannia glutinosa libosch has antiallergic effects and anti - inflammatory function [1517]. Japonica is known to have antioxidant, anti - inflammatory, and anticancer effects and inhibits the development of ad in nc / nga mice [19, 20]. Rubus coreanus miq . Is a type of red raspberry that grows wild in korea, japan, and china . The fruit, known as bokbunja in korean, has been used in traditional oriental medicine for reducing the risk of diseases such as asthma and allergy . It is also known that rubus coreanus miq . Has anti - inflammatory and antioxidative activities [2123]. These collective observations indicate that cp001 may be good candidate for control of ad and beneficial in the treatment of human allergic disorders . Therefore, in our previous study, we already confirmed that topical application of km110329 (cp001 modifying herbal mixture) inhibits the atopic dermatitis in ovalbumin- and dncb - induced mouse model . Therefore, in this study, we investigated whether 30% ethanol extract of cp001 oral administration has anti - inflammatory activity in 2,4-dinitrochlorobenzene- (dncb-) induced ad mice model . In addition, we also investigated whether 30% ethanol extract of cp001 has antiallergic effect inhibiting cytokine production in human mast cells, hmc-1 . Cp001 was prepared by hanpoong pharmaceutical (jeon - ju, korea) following good manufacturing practices (gmp) procedure . Cp001 is 30% ethanol extracted brown - colored powder, and it is composed of houttuynia cordata thunb, rehmannia glutinosa libosch, bark of betula platyphylla var . The powder from the extract was dissolved in distilled water for in vivo and in vitro experiments . Six - week - old male balb / c mice were purchased from orient (sung - nam, korea). The mice were randomized into 6 groups (normal, dncb, and 25, 50, 100, and 200 mg / kg (cp001)), each comprising five mice . All mice were kept under pathogen - free environment and allowed free access to the diet and water . All procedures performed on the mice were approved by the animal care center of kyung - hee university (approval number khuasp (se)-2012 - 004). Induction of ad - like skin lesions procedure is described in figure 1 . For that purpose, mice back skin was painted dermally with 200 l of a 1% dncb using 1 1 cm patches after shaving . Two weeks after sensitization, the back skin was challenged with 200 l of a 0.2% dncb solution twice per week . This procedure was repeated for 2 weeks and cp001 was orally administrated together . At the end of the experiment, mice were sacrificed by co2 inhalation, and samples were collected . A portion of the skin biopsies were fixed in 4% paraformaldehyde (pfa) and embedded in tissue - tek optical cutting temperature (o.c.t .) Compound (tissue - tek, sakura, aa zoeterwoude, the netherlands) on dry ice . Skin sections of 20 m were cut and stained with hematoxylin and eosin (h & e) for inflammatory cells or with toluidine blue for mast cells counts and examined under light microscopy (olympus). Mast cells were counted in 10 parts of high - power fields (hpf) at 400x magnification . After final cp001 administration, whole blood samples were collected by cardiac puncture for measurement of blood ige level . The blood was placed in vacutainer tubes containing edta (bd science, nj, usa) and blood plasma was isolated . Total ige levels in plasma were determined by sandwich elisa using the bd pharmingen mouse ige elisa set . Briefly, plates were coated with capture antibody in elisa coating buffer (sigma - aldrich) and incubated overnight at 4c . Plates were washed with pbs - tween 20 (0.05%) and subsequently blocked (10% fbs in pbs) for 1 h at 20c . Serial dilutions of standard antigen or sample in dilution buffer (10% fbs in pbs) were added to the plates and plates were incubated for 2 h at 20c . After washing, biotin - conjugated anti - mouse ige and sav - hrp (streptavidin - horseradish peroxidase conjugate) were added to the plates and plates were incubated for 1 h at 20c . Finally, tetramethylbenzidine (tmb) substrate solution was added to the plates and after 15 min incubation in the dark, optical densities were measured at 450 nm on an automated elisa reader (versa max, molecular devices, ca, usa). Il-6 and il-8 levels were measured in hmc-1 supernatant by sandwich elisa using bd pharmingen human elisa set . Mice skin was immediately frozen in liquid nitrogen and kept at 70c until use . For real - time pcr assay, mice skin was homogenized with ultra - turrax t10 (ika labortechnik, seoul, korea) and rna extraction was performed using trizol (invitrogen life technologies, ny, usa). Rna content was measured using the nanodrop nd-1000 spectrophotometer (nanodrop technologies inc . ). 1 g of total cellular rna from each sample was reverse transcribed using cdna synthesis kit (takara, japan). Quantitative pcr was performed using sybr green imaster and a lightcycler 480 (roche, switzerland). Cells were harvested by centrifugation and the pellet was washed with ice - cold pbs . Rna was isolated from the pellet using easy - blue rna extraction kit (intron biotech, republic of korea) according to the manufacturer's instructions . Isolated rna content was measured using the nanodrop nd-1000 spectrophotometer (nanodrop technologies inc . ). 2 g of total cellular rna from each sample was reverse transcribed using cdna synthesis kit (takara, japan). Pcr was conducted out in a 20 l reaction mixture consisting of dna template, 10 pm of each gene - specific primer, 10x taq buffer, 2.5 mm dntp mixture, and 1 unit of taq dna polymerase (takara, japan). Pcr was performed using the specific primer and primer sequences for human il-6, il-8, and gapdh are shown in table 1 . Ellagic acid, quercitrin hydrate, and catalpol were purchased from sigma chemicals (saint louis, mo). Hplc grade acetonitrile, methanol, and formic acid were purchased from j. t. baker (phillipsburg, nj). Catalpol, ellagic acid, and quercitrin were chosen as marker compounds to standardize the extract sample . Cp001 was dissolved in distilled water at a concentration of 100 mg / ml and the solution was filtered through a 0.45 m membrane filter . A 10 l aliquot of the sample solution was injected into a hplc system (agilent technologies, palo alto, ca). The sample was analyzed on a capcell pak ug120 c18 analytical column (250 4.6 mm, 5 m; shiseido, japan). Statistical analyses presented as the mean standard error of the mean (sem) and were analyzed for statistical significance using the unpaired student's t - test . To determine whether cp001 decreases infiltration of inflammatory cells into ad - like skin lesions, we performed h & e staining on the skin after oral administration of cp001 . We observed infiltration of inflammatory cells into the epidermis and dermis in dncb group, whereas cp001 decreased such infiltration of inflammatory cells into the skin (figure 2). Moreover, cp001 (25200 mg / kg) abrogated skin thickening induced by dncb (figure 2). Next, we also performed toluidine blue staining for mast cell observation . Repeated cutaneous application of dncb increased dermal mast cell number . The th2 type cytokines are important in an acute phase of ad whereas mixed th2/th1 type inflammation is characteristic to a chronic phase of ad . To determine whether cp001 decreases th2 type cytokines expression, we performed real - time pcr to measure il-4 and il-13 levels . We found that oral administration of cp001 decreased il-4 mrna expression in ad - like skin lesions (figure 4(a)). We also found that cp001 administration decreased il-13 mrna expression in ad - like skin lesions in a dose - dependent manner (figure 4(b)). In histology analysis, repeated cutaneous application of dncb increased dermal mast cell number and this feature was suppressed by cp001 oral administration . Activated mast cells secrete various chemokines and cytokines including il-6 and il-8 . To determine whether cp001 decreases il-6 and il-8 cytokines mrna levels oral administration of cp001 did not affect the suppression of il-6 and il-8 mrna expression in ad - like skin lesions (figures 4(c) and 4(d)). Hyperproduction of ige is a major characteristic of ad and patients with ad often exhibit elevated levels of total and allergen specific ige antibodies (abs) in their serum . To further test whether suppression of the progression of ad - like skin lesions by cp001 is associated with serum ige levels, we performed total ige elisa assay . We found that total ige levels were dramatically elevated in dncb - treated group compared with normal group . However, increased serum ige levels induced by dncb were significantly decreased by cp001 treatment (figure 5). For that purpose, mast cells were pretreated with various concentrations of cp001 for 1 h and then treated with pma and a23187 for 24 h. the levels of il-6 and il-8 in culture supernatants were measured by elisa assay . We found that il-6 secretion induced by pma and a23187 was significantly suppressed by cp001 (figures 6(a) and 6(c)). We also performed rt - pcr to measure il-6 and il-8 mrna expression in hmc-1 . We observed that il-6 and il-8 mrna induced by pma and a23187 were decreased by cp001 (figures 6(b) and 6(d)). Cp001 administration decreased il-4 and il-13 mrna expression in ad - like skin lesions (figure 7(b)). Therefore, we characterized the regulatory effect of cp001 on il-4 and il-13 mrna expression in hmc-1 using rt - pcr . We found that il-13 expression induced by pma and a23187 was significantly suppressed by cp001 (figure 7(a)). Il-4 expression level was not increased by pma and a23187, but it is suppressed by cp001 (figure 7(a)). To further evaluate the effective compounds of cp001 extract, hplc analysis was employed . In order to analyze catalpol, the mobile phase consisted of water (w) and methanol (m) and the flow rate was 1 ml / min . The initial composition of the mobile phase was 97: 3 (w: m), which was linearly changed to 95: 5 (w: m) over 1 min and changed to 91: 9 (w: m) for 9 min . At 11 min, the composition of mobile phase returned to the initial condition, which was maintained for 9 min for column reequilibration . Chromatograms were acquired at 210 nm by uv detection (figure 8). For ellagic acid and quercitrin, the mobile phase consisted of 0.1% formic acid (f) and acetonitrile (a) and the flow rate was 1 ml / min . The initial composition of the mobile phase was 90: 10 (f: a), which was linearly changed to 85: 15 (f: a) over 5 min and changed to 60: 40 (f: a) for 35 min . At 41 min, the composition of mobile phase returned to the initial condition, which was maintained for 9 min for column reequilibration . The retention times of catalpol, ellagic acid, and quercitrin were 6.2, 14.4, and 18.6 min, respectively (figures 7(a) and 7(b)). The concentrations of catalpol, ellagic acid, and quercitrin in the extract sample were determined using hplc analysis as described above . The extract was standardized to contain 1.8% catalpol, 0.4% ellagic acid, and 0.3% quercitrin . Ad is a chronic inflammatory disease, which is accompanied by erythema, edema, and scaling in ad skin lesions . Recently, korean medicine has been the subject of increased interest for its potential in the treatment of inflammatory diseases, including atopic dermatitis and airway inflammation [16, 17, 25, 26]. The present study demonstrates that oral administration of korean herbal mixture extract, cp001, inhibits dncb - induced ad . We observed that cp001 decreases infiltration of inflammatory cells into ad - like skin lesions and dermal mast cell number . Generally, steroid therapy is used for ad treatment, but it cannot be administrated over the long term because of the many side effects . Therefore, we find a new drug, which is effective in the treatment of ad without any side effects . Recently, we reported that topical application of km110329 (cp001 modified drug) reduced ovalbumin- and dncb - induced atopic dermatitis . Therefore, we were wondering whether cp001 oral administration may inhibit dncb - induced atopic dermatitis . Mast cells degranulation can be regulated by the recruitment, trafficking, and function of inflammatory response . For example, il-4 and il-13 induce cell adhesion molecules on endothelium which can be recruitment of leukocytes [2729]. Also, the production of il-4 cytokine in epidermal cells has been known to be the main factor for initiation of ad . In our data, we show that cytokine production and mrna levels of il-4, il-13, il-6, and il-8 were suppressed by cp001 in hmc-1 . Also, quantitative real - time pcr of the skin lesions also showed that oral administration of cp001 diminished the mrna level of il-4 and il-13 in the ad - like skin lesions . In addition, we found that cp001 reduces mast cell in dncb - induced ad - like skin lesion . It seems that inhibition of infiltration of mast cell downregulates secretion of il-4 and il-13 cytokines and it may inhibit recruitment of leukocytes . Thus, mast cell may be main factor for suppression of th2 cytokines in the ad - like skin lesions by oral administration of cp001 . Ige is mediator of mast cell activation and we observed that cp001 oral administration reduced elevated blood ige levels induced by repeated dncb sensitization . Cp001 also suppressed il-6 secretion and elevated il-6 and il-8 mrna expression induced by pma and a23187 in hmc-1 . It seems that the reduction of infiltration of mast cells is related to decrease of degranulation of mast cells and maturation of eosinophils suppressing the release of various inflammatory cytokines . Our present study clearly demonstrates that cp001 suppresses the progression of ad induced by dnbc . In addition, inflammatory related cytokine production and mrna levels of il-4, il-13, il-6, and il-8 were suppressed by cp001.
|
Acute kidney injury (aki) is a severe complication of several different clinical conditions . Apart from intrinsic renal diseases (i.e., glomerulonephritis, acute tubular necrosis, and interstitial nephritis) or postrenal diseases triggered by an obstruction along the urinary tract, aki development is mainly related with prerenal azotemia due to an inadequate renal blood supply . Per se predisposes patients to renal hypoperfusion because of central hypovolemia, arterial hypotension, and the consequent activation of different neurohormonal systems . Indeed, aki is a quite frequent occurrence in patients with advanced liver disease and it affects about 1/5 of the hospitalized patients with liver cirrhosis . The international club of ascites has recently further stressed the association between aki and cirrhosis, also adopting the definition by the aki network which defined aki as an increase in serum creatinine (scr) 0.3 mg / dl or 50% in 2 measurements 48 hours apart . An additional and well recognized risk factor of aki development is the contrast medium administration in patients undergoing computed tomography . Since hepatocellular carcinoma (hcc) is an event usually occurring in the course of cirrhosis, cirrhotic patients very often undergo radiological procedures enhanced with the use of contrast media for the early diagnosis of hcc as well as during the follow - up of hcc patients after treatment of cancer lesions . Altogether, the above considerations suggest that cirrhotics might be a subset of patients particularly prone to develop contrast - induced aki (ci - aki). The aim of this study was to investigate occurrence and possible predisposing factors of ci - aki in cirrhotic patients undergoing contrast - enhanced computed tomography (cect). One thousand two hundred seventy - nine cirrhotic patients were consecutively hospitalized at the clinical and molecular hepatology division of the university hospital of messina from january 2008 to december 2014 . Clinical, biochemical, instrumental, and radiologic data recorded in electronic charts from each of these patients were retrospectively analyzed . According to the scope of the study, 249/1279 patients (mean age 64 11 years, 165 male) who had undergone cect were selected on the basis of the availability of scr values evaluated both within 5 days before and 48 hours after cect (cect group). In analogy, 203/1279 cases (mean age 66 10 years, 132 male) who had not undergone cect but had been tested twice for scr in 7 days during hospitalization were also included in the study as controls (control group) (table 1). Eight hundred twenty - seven of 1279 cases excluded from the analysis were patients lacking double scr checks, patients with an estimated glomerular filtration rate (egfr) <30 ml / min (calculated by the modification of diet in renal disease-6 formula), patients with active bacterial infections, patients with history of recent intake of potentially nephrotoxic drugs (i.e., nonsteroidal anti - inflammatory drugs) or history of exposure to contrast medium within 6 months before admission as well as of liver transplantation . Demographic, clinical, and laboratory data of patients exposed (cect group) or not exposed (control group) to contrast medium . Turcotte (cpt) and model for end - stage liver disease (meld) scores . The contrast iodine medium used for all cect was iopromide (ultravist; bayer healthcare pharmaceuticals inc ., whippany, nj, usa) (370 mg / ml, intravenously at a dosage of 1.2 ml per kilogram of body weight). The study was conducted in accordance with the declaration of helsinki, and all patients gave their written informed consent to participate in the study . The numerical data are expressed as mean and standard deviations and the categorical variables as count and percentage . Comparison between cect and control groups was performed using 2-sample student t test and the test for numerical and for categorical variables, respectively . Variables considered were sex, age, etiology of cirrhosis, cpt score, meld, egfr, international normalized ratio, ascites, serum sodium, albumin, bilirubin and creatinine, azotemia, chronic kidney disease (ckd), diabetes, arterial hypertension, hcc, and treatment with diuretics as well as beta - blockers, antihypertensives, and antidiabetics drugs . Univariate logistic regression model was estimated on the cumulative study population (cect and control patients) in order to identify predictive factors of ci - aki occurrence . Variables statistically significant at univariate analysis were then included in the multivariate logistic regression model to identify independent predictive factors of ci - aki occurrence . Results of univariate and multivariate analyses are reported as p values, odds ratio (or), and 95% confidence interval (ci). Statistical analyses were performed using ibm spss statistics for windows, version 22 (ibm corp ., armonk the numerical data are expressed as mean and standard deviations and the categorical variables as count and percentage . Comparison between cect and control groups was performed using 2-sample student t test and the test for numerical and for categorical variables, respectively . Variables considered were sex, age, etiology of cirrhosis, cpt score, meld, egfr, international normalized ratio, ascites, serum sodium, albumin, bilirubin and creatinine, azotemia, chronic kidney disease (ckd), diabetes, arterial hypertension, hcc, and treatment with diuretics as well as beta - blockers, antihypertensives, and antidiabetics drugs . Univariate logistic regression model was estimated on the cumulative study population (cect and control patients) in order to identify predictive factors of ci - aki occurrence . Variables statistically significant at univariate analysis were then included in the multivariate logistic regression model to identify independent predictive factors of ci - aki occurrence . Results of univariate and multivariate analyses are reported as p values, odds ratio (or), and 95% confidence interval (ci). Statistical analyses were performed using ibm spss statistics for windows, version 22 (ibm corp ., armonk no significant statistical difference was found between the cetc and the control groups in terms of etiology of the liver disease, cpt classes, presence of hcc, esophageal varices, diabetes, and arterial hypertension (table 1). In fact, in the cect group, 98/249 patients (39.4%) had hepatitis b virus (hbv) (29 cases) or hepatitis c virus (hcv) (69 cases) chronic infection, 106 (42.6%) had nonalcoholic fatty liver disease (nafld)-related or cryptogenic cirrhosis, 35 (14%) had alcoholic cirrhosis, 10 (4%) had autoimmune liver disease or primary biliary cholangitis (pbc). In the control group, 80/203 patients (39.4%) had hbv or hcv chronic infection (20 and 60 cases, respectively), 88 (43.3%) had nafld or cryptogenic cirrhosis, 27 (13.3%) had alcoholic liver disease, and 8 (3.9%) had autoimmune liver disease or pbc . In the cect group, 143/249 cases (57.4%) belonged to the cpt class a, 88 (35.3%) to cpt class b, and 18 (7.2%) to cpt class c. in the control group, 96 cases (47.3%) belonged to the cpt class a, 84 (41.4%) to cpt class b, and 23 (11.3%) to cpt class c. hcc was present in 86 (34.5%) patients in the cect group and in 53 (26.1%) patients in the control group . Esophageal varices were detected in 134 (53.8%) patients of the cect group and in 116 (57.1%) patients of the control group . Arterial hypertension was present in 90 (36.1%) patients of the cect group and in 74 (36.5%) patients of the control group . Ninety - four (37.8%) patients had diabetes in the cect group, and 89 (43.8%) patients had diabetes in the control group (table 1). On the contrary, the cect group significantly differed from the control group for presence of ascites (70 vs 89 patients, p <0.001), hepatic encephalopathy (50 vs 61 patients, p = 0.01), ckd (54 vs 70 patients, p = 0.002), scr (0.8 0.3 vs 0.9 0.4, p <0.001), and egfr (83 30 vs 72 29, p <0.001) (table 1). Aki developed in 22/249 (8.8%) and in 6/203 patients (3%) of the cect and the control groups, respectively (p = 0.01). In particular, 20/22 cases (90.9%) had aki stage 1 and 2/22 (9.1%) aki stage 2 in the cect group, whereas 5/6 patients (83.3%) had aki stage 1 and 1 patient had aki stage 2 in the control group . The univariate logistic regression analysis performed on the cumulative population of the cect and control groups showed that aki was significantly associated with contrast medium administration (p = 0.014), female sex (p <0.001), age (p = 0.04), scr at baseline (p = 0.008), and egfr (p = 0.04) (table 2). At multivariate analysis, the use of contrast medium (or: 3.242, 95% confidence interval [ci]: 1.2558.375; p = 0.015), female sex (or: 0.339, 95% ci: 0.1390.827; p = 0.017), and baseline scr (or: 0.124, 95% ci: 0.0160.975; p = 0.047) maintained statistical significance (table 2). Variables analyzed at univariate and multivariate analyses in the entire study population for possible association with ci - aki . Limiting the analysis to the cect group, presence of ascites (p = 0.024), female sex (p = 0.001), serum sodium levels (p = 0.024), and azotemia at baseline (p = 0.049) correlated with ci - aki development at univariate analysis (table 3). Ascites (or: 2.796, 95% ci: 1.1097.052; p = 0.029), female sex (or: 0.192, 95% ci: 0.0730.510; p = 0.001), and azotemia at baseline (or: 1.018, 95% ci: 1.0011.037; p = 0.043) maintained the statistical significance at multivariate analysis (table 3). Variables analyzed at univariate and multivariate analysis in the cect group for possible association with ci - aki . Reevaluation 3 months after discharge from hospital was available in 17/22 and 6/6 patients who developed aki in the cect and in the control groups, respectively . Aki persisted in 10/17 patients (58.8%) and in 1/6 patients (16.6%) in the cect and the control groups, respectively . Of note, none of the patients with persistence of worsened kidney function showed signs of liver decompensation . Despite the limitations of the retrospective analysis, this study quite clearly indicates that the risk of aki development in cirrhotics is significantly increased when patients undergo computed tomography with intravenous iodinated contrast . Moreover, although the ci - aki was not usually severe (stage 1 in 90% of the cases), it seemed to persist over time since the worsening of kidney function was still present 3 months after the cect execution in the majority of cases . The multivariate analysis revealed that presence of ascites, female sex, and increased levels of azotemia but not of creatininemia at baseline were risk factors of ci - aki development . The fact that ascitic patients may be oversensitive in developing aki is not surprising considering that kidney dysfunction is a major factor in ascites occurrence and thus advanced liver disease per se may be considered a clinical pathological condition prone to an acute renal injury . It is more difficult to interpret why female sex and hyperazotemia at baseline may favor ci - aki occurrence . Indeed, previous studies had already reported the association between female sex and ci - aki . In their study focused on liver transplanted patients, hilmi et al stressed that all the women enrolled were in menopausal age and thus had lost the beneficial protective effects exerted by estrogens against cardiovascular and renal diseases, and would therefore be more exposed to various kidney insults . Of note and in accordance with this hypothesis, increased azotemia values in cases with normal creatininemia are usually considered an indicator of hypercatabolic condition and are indeed quite often present in the advanced phases of cirrhosis . Why hyperazotemia at baseline was the only biochemical parameter significantly associated with the subsequent ci - aki development in our series of patients is not easy to explain . One might speculate a hypothetical involvement of hypercatabolism in favoring renal impairment in these patients, and therefore high azotemia levels may, better than hypercreatininemia, indicate basal conditions of kidney dysfunction that predispose to aki induced by contrast medium administration . In conclusion, this study reveals that development of ci - aki is not a rare event in cirrhotic patients, particularly if in women and/or in a decompensated phase with ascites and hyperazotemia . Renal impairment occurrence is a complication of cirrhosis and a frequent cause of dramatic worsening of the clinical picture and death . The results of this study suggest caution in performing cect in patients with advanced cirrhosis, and reserving this radiologic approach for cases in which the clinical benefit for the patients of obtaining the information provided by this tool is clear.
|
Compound 1 was isolated as a white powder after multiple rounds of chromatography . High - resolution mass spectrometry gave a protonated molecule at m / z 317.1747 [m + h]. This datum is consistent with a molecular formula of c19h24o4 and indicated eight double - bond equivalents . The carbon spectrum showed seven sp carbons, six of which were c = c bonds and one of which was a conjugated carbonyl carbon (c-2 195.4). Therefore, the compound had four rings to account for the remaining double - bond equivalents . The planar structure of 1 was assembled by analyses of cosy and hmbc correlations . Beginning with the tertiary methyl group (h3 - 20, 0.88 ppm), the observation of hmbc correlations to two methines, a quaternary carbon, and a methylene (c-1, c-5, c-9, c-10) was critical toward the assembly of fragment 1 (figure 1). This alkyl chain was elongated through cosy correlations between h-5 2.62 and h-6a 1.91 and between h-6a 1.91 and an adjacent methylene (h-7b 1.41). Hmbc correlations from the proton resonance at h-19 1.88 indicated a chain of two sp carbons connecting to c-5, but were unable to distinguish which of the two sp carbons was attached directly to the methyl group h3 - 19 . A set of hmbc correlations between the signal at h-1a 2.73 ppm and signals at c-2 195.4 ppm and c-3 145.7 ppm resolved the ambiguity of the order of sp carbons, creating an,-unsaturated ketone moiety within a six - membered ring . The two downfield protons at h-16 7.14 and h-15 7.17, as well as four remaining sp carbons, hinted at the possibility of a heteroaromatic ring . The jc h value for position 16 extracted from the hmbc data suggested the heteroaromatic ring was a furan moiety (jc h = 201 hz vs a reference value of 202 hz in furan). With a furan moiety in mind, hmbc correlations from h-16 7.14 to c-14 and c-15, in addition to correlations from h-15 7.17 to c-16 and c-13, suggested the furan ring is as shown in figure 1 . Fragments 1 and 2 were joined based on hmbc correlations observed from the methylene proton resonance of the primary alcohol (h-17a 3.87) to c-7, c-8, c-9, and c-14 . Of the remaining two methylenes, c-12 was placed nearer the sp center (c-13), on the basis of being the more downfield resonance . The more shielded methylene c-11 was then attached to c-12 and c-9 in order to satisfy the last degree of unsaturation . Hmbc correlations from the proton resonance at h-12a 2.80 ppm confirmed the position of c-11 and c-12 in the c - ring . The remaining hydroxy group, required by the molecular formula, was attached to c-3, to provide the structure of 1 depicted, based on the chemical shifts of the carbons in the a - ring . Roesy correlations between h3 - 20 and h2 - 17 indicated they were syn and axial . The axial orientation of the methine h-5 was evident due to the observation of a 12.9 hz coupling to h-6 . For the fourth stereogenic center, it should be noted that the relative configuration deduced for 1 is in accord with the configuration of these centers in all known spongians . Evidence that indicated these compounds belong to the spongian structural class included the resonances for the primary alcohol at c-17, the aromatic proton resonances (h-15, h-16), and the two methyl singlets (h-19, h-20). Carbon and proton resonances for these three analogues are tabulated in tables 2 and 3, and their structure elucidation is discussed below . Compound 2 was clearly an analogue of 1, as it possessed many of the same carbon and proton resonances . A close inspection of the nmr data indicated the quaternary carbon at c-5 was shifted downfield, which suggested an alcohol functional group was present (c-5 76.8). Hmbc correlations from h-19 and h-20 supported c-5 as the oxygenated carbon (figure 2), while hrms analyses supported the required molecular formula c19h24o5 through the observed m / z of 315.1580 [m + h h2o]. Of the four stereocenters of 2, only three could be determined . Specifically, an noe correlation between h3 - 20 and h2 - 17 indicated a syn axial relationship, while the 13.2 hz coupling constant observed at h-9 indicated it was axial as well . The last stereocenter at c-5 could not be assigned due to rapid exchange, on the nmr time scale, of the alcohol proton in aprotic solvents (cdcl3 and cd3cn) and at lower temperatures (down to 20 c). J value extracted from the 1d tocsy spectrum obtained by irradiating the resonance at 1.75 ppm . Spongiapyridine (3) had an observed hresi - tofms m / z of 342.1701 [m + h], being consistent with a molecular formula of c20h23no4 . Comparison of the nmr data for this compound with those of 1 showed that 3 contained identical features in the a- and b - rings and contained a primary alcohol as well . The c- and d - rings, however, included a nitrogen atom, a second carbonyl carbon (c-12 199.1), a third aromatic proton, and downfield shifts of the aromatic protons (h-15 8.71, h-16 8.58, h-17 7.82). In contrast to the jc h value observed in 1, the resonance at h-16 8.58 displayed a jc h value of 182 hz, which was no longer consistent with a furan moiety . Instead, this one - bond coupling constant was consistent with a carbon adjacent to the nitrogen in a pyridine moiety . N hmbc experiment was performed to help support this supposition . In this experiment, a correlation was observed from the signal at h-15 8.58 to a nitrogen resonating at n 68 (referenced to nitromethane), further supporting the inclusion of a pyridine moiety in 3 . Additional structural modifications were deduced based on hmbc correlations from h-18b 3.74 to c-14 145.6, which connected the pyridine ring to ring b, and between h-17 7.82 and c-12 199.1, indicating the carbonyl was at c-12 (figure 2). The final structural fragment left unaccounted for in 3, according to a phase - sensitive hsqc experiment, was a putative methine that resonated at h-11 2.60 and showed a cosy correlation to h-9 2.36 . However, if a methine was present at c-11, then this would result in a molecular formula inconsistent with the observed mw of 341 . Upon closer investigation of the c spectrum, it became clear that the carbon at c-11 35.9 was not a singlet, as would be expected in a broad - band - decoupled carbon spectrum, but instead was coupled to another nucleus, displaying a triplet with lines in a ratio of 1:1:1 . The multiplicity of this carbon resonance suggested coupling with a nucleus that had a quantum spin number of one . One possible explanation for the observed coupling was that deuterium from the solvent was exchanging with one of the protons alpha to the c-12 ketone . To test this hypothesis of deuterium exchange, the result was the collapse of the carbon triplet into a singlet and the appearance of an additional proton at h-11 3.04, showing that c-11 was a methylene . It is interesting to note that only the axial proton adjacent to the ketone, not the equatorial proton, is exchanged, likely due to the well - known stereoelectronic effect, i.e., overlap of the axial c h bond with the ketone s p*-orbital as documented by corey and sneen that favors removal of that proton . The relative configuration of 3 was determined in a manner similar to that described for 1 . An noe correlation between h3 - 20 and h2 - 18 indicated they were syn and axial . H-5 and h-9 had j values of 11.4 and 14.5 hz, respectively, suggesting they are also axial, resulting in proposed structure 3 . Hresi - lcms of 4 gave a protonated molecule at m / z 363.1790 [m + h], consistent with the molecular formula c20h26o6 . All the major spectral differences were assigned to the a - ring by comparison of the nmr spectra of 1 and 4 . These changes were two ester / carboxylic acid functional groups, an oxygenated methylene, and an sp quaternary carbon . These changes were at the expense of the,-unsaturated carbonyl and were satisfied via a seven - membered lactone ring . All of the hmbc correlations from h-19 1.25 and also from h-1 2.87 supported this structure (figure 2). An noe correlation between h-19 1.25 and h-20 1.03 confirmed the configuration at c-4, indicating that 4 was the known compound 17-hydroxy-4-epi - spongialactone a. this molecule has previously been isolated, but only as the diacetyl methyl ester derivative by gunasekera and schmitz from a spongia sp . All of the spongian diterpenes for which the absolute configurations have been determined belong to the same enantiomeric series . After oxidation to yield 6, attack on the carbonyl carbon by the primary alcohol yields 7b . A 1,4-elimination of h2o establishes the furan 8b, which is followed by several oxidations to yield our new compound 1 . For example, oxidation from 7b leads to the known compound zimolactone b, and further oxidation of 7a to a carboxylic acid before cyclization leads to the framework required for zimolactones a and c (not shown). Also, from 8b, partial oxidation may account for spongiadiol, spongiatriol, and their c-3 epimers . Decarboxylation, oxidation at c-12, and a - ring oxidation yields spongiapyridine 3 . There are many strategies for decreasing cancer mortality through chemoprevention, and a variety of assessments were performed with 14 . Modest inhibition of tnf--activated nf-b activity was observed for all compounds with ed50 values around 50 m (data not shown). No significant activity was observed for inhibition of inos activity in lps - induced raw 264.7 murine macrophage cells, and no significant induction occurred in a retinoic x receptor response element luciferase reporter gene assay . Aromatase, a key cytochrome p450 enzyme, catalyzes the rate - limiting aromatization step in the conversion of androgens (testosterone and androstenedione) to estrogens (estradiol and estrone). Aromatase inhibitors decrease bioavailable estrogen and have shown considerable activity in the prevention of certain breast cancers . Such compounds ultimately reduce estradiol receptor stimulation and reduce the formation of genotoxic estrogen metabolites . Certain nonsteroidal aromatase inhibitors are already in clinical use for the treatment of breast cancer, and several naturally occurring nonsteroidal aromatase inhibitors have shown promising chemopreventive activity . In the current investigation, compound 2 inhibited aromatase in a dose - dependent manner with an ic50 value of 34.4 m . The other compounds did not achieve 50% inhibition at a concentration of 50 m . Nad(p)h: quinone reductase 1, a cytoprotective enzyme, can exhibit cancer protective activity by inhibiting the formation of intracellular semiquinone radicals and by generating -tocopherolhydroquinone, which acts as a chemopreventive agent . One parameter used to compare the qr1 induction potential of different compounds is the cd value, i.e., the concentration of test compound required to double qr1 activity . With cultured hepa 1c1c7 cells, 2 demonstrated a cd value of 11.2 m, which is similar to the cd value of resveratrol (21 m), a weak qr1 inducer . Lastly, all of our isolated compounds were screened against bace 1 as part of our ongoing search for drug leads for alzheimer s disease (ad). Bace1 is an aspartic protease and one of the major players in the amyloid cascade hypothesis for ad . All compounds showed no significant activity toward the aspartic protease bace1 (<100 m). Optical rotations were measured on a jasco dip-370 digital polarimeter at the sodium d - line (589 nm). Uv absorbances were measured on a varian cary 50 bio uv vis spectrophotometer . Ir spectroscopy was measured as a thin film on a caf2 disk using a shimadzu iraffinity-1 ftir . H, c, and 2d nmr experiments were performed on a varian unity inova 500 mhz spectrometer . Nmr spectra were referenced to the appropriate residual solvent signal (h 3.30, c 49.1 for meoh - d3/4) with chemical shifts reported in units (ppm). The hsqc experiments were optimized for jc, h = 140 hz and hmbc experiments for jc, h = 7 hz . Mixing times for roesy and noesy experiments were 500 ms and were generally 80 ms for the 1d tocsy experiments . High - resolution mass spectrometric data were obtained on an lc - ms - tof spectrometer using esi mode . The sponge was collected from bunaken marine park, sulawesi, indonesia, in 1992, and freeze - dried and stored at 20 c . The freeze - dried voucher appears to have come from a cavernous encrusting sponge with surface conules, the color in life appears to be charcoal gray, and the interior is tan . The skeleton is composed of slightly fasciculated primary fibers cored with foreign spicule detritus, and a light dusting of foreign spicules is found in the collagenous ectosome . The sponge is most closely comparable to species in the genus spongia (order dictyoceratida, family spongiidae) with homogeneous spongin fibers, but the primary fibers are slightly fasciculated as in species of the genus cacospongia . A voucher specimen has been deposited at the natural museum, london (nhmuk2012.3.27.3). The freeze - dried sponge (50 g) the resulting extract (7.4 g) was subjected to a liquid liquid partitioning protocol between hexanes, ch2cl2, buoh, and h2o . The ch2cl2 partition (2.6 g) was then dry loaded and separated by reversed - phase (c8) chromatography (four steps: 25%, 50%, 75%, 100% meoh / h2o) to yield three fractions at each step and 12 fractions in total . The first 75% meoh fraction (550 mg) was separated by hplc (luna c8; 250 10 mm, 5) using a flow rate of 2.75 ml / min and a linear gradient of 3060% meoh in h2o over 30 min, followed by 60100% over the next 10 min . This afforded pure 18-nor-3,17-dihydroxyspongia-3,13(16),14-trien-2-one (1, tr = 24 min, 12 mg, 0.16% yield) and 17-hydroxy-4-epi - spongialactone a (4, tr = 16 min, 8.0 mg, 0.11% yield). The third 75% meoh fraction (73 mg) was subjected to reversed - phase hplc on the aforementioned luna c-8 semipreparative column using a linear gradient of 3080% ch3cn in h2o over 30 min at a flow rate of 2.75 ml / min . This afforded pure 18-nor-3,5,17-trihydroxyspongia-3,13(16),14-trien-2-one (2, tr = 26.5 min, 2 mg, 0.03% yield). The second fraction of the 50% meoh step (160 mg) underwent reversed - phase hplc on a luna c-18 semipreparative column (250 10 mm, 5 m) with the gradient 2030% ch3cn in h2o over 30 min at 2.75 ml / min in order to yield spongiapyridine (3, tr = 24 min, 4.5 mg, 0.061% yield). White, amorphous powder; []d 7.0 (c 0.5, meoh); uv (meoh) max (log) 281 (3.25), 202 (3.54); ir max 3390, 1651 cm; see table 1 for nmr data; hresi - tofms m / z 317.1747 [m + h] (calcd for c19h25o4, 317.1753, 1.9 ppm error). White, amorphous powder; []d 7 (c 0.2, meoh); uv (meoh) max (log) 276 (2.95), 202 (3.65); ir max 3394, 1641 cm; see tables 2 and 3 for nmr data; hresi - tofms m / z 315.1580 [m + h white, amorphous powder; []d 0.5 (c 0.2, meoh); uv (meoh) max (log) 282 (3.39), 203 (3.82); ir max 3373, 1693 cm; see tables 2 and 3 for nmr data; hresi - tofms m / z 342.1701 [m + h] (calcd for c20h24no4, 342.1705, 1.2 ppm error). White, amorphous powder; []d 2.0 (c 0.20, meoh); uv (meoh) max (log) 276 (2.99), 202 (3.69); ir max 3419, 1696 cm; see tables 2 and 3 for nmr data; hresi - tofms m / z 363.1790 [m + h] (calcd for c20h27o6, 363.1808, 3.4 ppm error).
|
Recently, a covered self - expandable metal stent (sems) is being used . The advantages of the covered sems is prolonged patency, lower failure, few complications, and more easiness in its removal.1 however, a rare complication of stent fracture is reported due to the possibility of metal fatigue, tearing of polyurethane stent cover, or application of laser, electrocoagulation.2 proximal or distal migration is another complication after stent insertion . So far, just a few cases of proximal migration of sems have been reported . This report describes that the complication of sems fracture during endoscopic retrieval of the stent and proximal migration of the remnant stent in patient with chronic pancreatitis . A 62-year - old man with benign biliary stricture due to chronic pancreatitis underwent 10-mm diameter, 60-mm lengthened covered biliary sems (shim - hanaro; mi tech, seoul, korea) (fig . 1). After 5 months, removal of sems was attempted by using forcep to grasp the extraductal portion of the distal sems . During the procedure, 2), and remnant sems moved proximally into the common bile duct (fig . 3a). Despite multiple trials were attempted to retrieve the remnant sems by using various grasping accessories or balloon catheter, methods failed . Endoscopic papillary balloon dilatation with maximal diameter of 12 mm diameter (cre wire - guided dilator; boston scientific, marlboro, ma, usa) was performed below the remnant sems to make a space between the outer surface of sems and the inner surface of common bile duct (fig . 3b). Snare was advanced through the space, then the stent was grasped and retrieved without any complication (fig . The frequency of sems using is gradually increasing in alternative treatment for benign biliary strictures.3 it is difficult to remove uncovered sems coated with epithelial hyperplasia . In comparison, it is easier to remove covered sems.1,4 therefore, recently, the frequency of covered sems using is increasing . Complications related to sems are failure of stent release, malpositioning of the stent, stent occlusion with epithelial hyperplasia, duodenal bleeding or perforation due to trauma to duodenal wall, stent fracture and stent migration . The causes of fracture were not only therapeutic thermal overstrain during the electrocoagulation but spontaneity.2,5,6 the fracture might be related to bile induced corrosion or metal fatigue from constant and repeated bending in the duodenum.5 - 7 the anatomic sites of fracture were mostly around the ampulla,5 - 7 and a literature7 reported that 75% (3/4) of the fracture sites were at the ampulla with disconnection of the distal part of the stent in patients with periampullary malignant biliary obstruction . The cause of fracture of sems in this case was unclear and might be multifactorial . In case of distal biliary stricture, it could be suggested that there is a possibility of the structural characteristics of weak point of the sems at the ampulla as a causative factor . To the best of our knowledge, fracture of sems during the endoscopic removal has of been previously reported . In our case, the fracture of distal part of stent at the level of ampulla occurred during the retrieval of the normally situated sems . We presume that the event related to shearing force by pulling the stent through the grasp device at the damageable site of unseen stress fracture . Biliary stent migration can reduce the function of stent and make injury of duodenal wall, perforation, or bleeding.8 if stent migration occurred, the stent should be removed . In the case of retrieval of distally migrated sems, snare or forcep can be used to grasp the free end of sems.3 however, it is difficult to remove proximally migrated biliary sems, and methods to remove proximally migrated sems are stent cannulation and subsequent balloon retrieval, balloon placement parallel to the stent with traction retrieval, and use of a wire basket, snare, or forceps.9 - 11 in our case, we successfully removed the distal fragment of the fractured sems at the beginning, but we failed to remove proximally migrated fragment of the fractured sems with use by several tools such as the forcep, snare, balloon, or retriever . Therefore, to grasp firmly remained stent, we allocated spaces between the sems and inner part of bile duct through the balloon, then successfully we removed the stent . In our case, we realized that the endoscopist must be careful to inspect the complication such as the fracture and migration of stent which can occur during the endoscopic removal of sems.
|
Incidence in the head and neck region is rare and it is usually found in muscles of the extremity . In the head and neck region, involvement of temporalis, masseter, buccinator, platysma, and sternocleidomastoid muscles is known . Fifty - one cases of myositis ossificans traumatica involving the head and neck region have been reported so far . There is a male predominance of 3:1 and masseter is the most commonly affected muscle . To the best of our knowledge, this is a unique case of pseudomalignant myositis ossificans with involvement of multiple masticatory muscles . A young woman aged 20 years presented with chief complaints of progressive painful limitation of jaw opening for 4 years axial and coronal ct scans of head and neck were obtained which revealed a high - attenuation mass [1200 - 1400 hounsfield units (hu)] seen extending from the right lateral pterygoid plate to the ramus of mandible, replacing the entire medial pterygoid muscle . Another similar mass was seen extending from the lateral pterygoid plate to condylar neck, involving the lateral pterygoid muscle [figure 1a - d]. A linear high - attenuation band was seen in the inferior portion of left temporalis muscle connecting with the coronoid process [figure 1d and e]. Volume - rendered technique (vrt) showed a bony bar connecting the right lateral pterygoidplate to the ramus of the mandible [figure 1f]. Magnetic resonance imaging (mri) of head and neck on a 1.5 t magnet [with axial t1-weighted (t1w), t2-weighted (t2w), coronal t1w, and multiple - echo recombined gradient echo (merge) sequences] revealed ahypointense mass extending from the right lateral pterygoid plate to the ramus of mandible; coronal t1w and merge images showed a hypointense mass extending from the right lateral pterygoidplate to the condylar neck, involving the lateral pterygoid muscle [figure 2a - d]. No abnormal hyperintense signals were seen in these regions or in the adjacent soft tissue on t2wi and short t1 inversion recovery (stir) images . No abnormality was seen in rest of the head and neck on ct and mr images . Laboratory tests that included serum calcium, phosphate, alkaline phosphatase, and parathyroid hormone were within normal limits . Based on ct, mri, laboratory findings, and clinical history of absence of trauma, a diagnosis of pseudomalignant myositis ossificans involving medial and lateral pterygoid muscles on the right and temporalis muscle on the left was made . (a) axial and (b) coronal ct reveals a high - attenuating mass (1200 - 1400 hu) extending from the right pterygoid plate to the condyloid process of mandible replacing lateral pterygoid muscle . Bone window (c) shows a high - density lesion extending from the right pterygoid plate to the ramus of mandible involving medial pterygoid muscle (arrowhead). (d and e) show a linear band of ossification involving the left temporalis muscle inserting into the coronoid process (arrowhead). 3d vrt (f) shows a bony bar connecting the right lateral pterygoid plate to the ramus of the mandible (asterisk) mri - axial t1w (a) t2w (b) coronal t1w (c) and merge (d) images show a darkly hypointense mass extending from the lateral pterygoid plate to the ramus of mandible on the right side (asterisk). Coronal t1w (e) and merge (f) images show a hypointense band extending from the lateral pterygoid plate to the condylar neck on the right side (arrow) histopathology report showed distinct zonal pattern of innermost immature loosely textured richly vascularized fibroblastic zone with mild degree of pleomorphism intermingled with sparse inflammatory cells with fibrinous material and few multinucleated giant cells . An intermediate zone of ill - defined trabeculae and a peripheral zone of osteoid showing calcification and, at places, mature lamellar bone was seen figure 3a - c . Areas of focal hemorrhage, fibrin, and entrapped muscle fibers were also seen figure 3d . Histopathology slide shows distinct zonal pattern of innermost immature loosely textured richly vascularized fibroblastic zone with mild degree of pleomorphism intermingled with sparse inflammatory cells, fibrinous material, and few multinucleated giant cells . An intermediate zone of ill - defined trabaculae and a peripheral zone of osteoid showing calcification and, at places, mature lamellar bone is seen (a - c). Areas of focal hemorrhage, fibrin, and entrapped muscle fibers are also seen (d) after, surgery patient underwent intensive physiotherapy and maximum spontaneous mouth opening recovered from pre - operative 03 mm to 30 mm . The most common form is myositis ossificans circumscripta which is a localized, self - limiting form secondary to blunt, penetrating, thermal, or iatrogenic trauma . This type is usually seen in the flexor muscles of the upper arm the quadriceps femoris and adductor muscle of the thigh in adolescent and young adults . Masseter is most commonly involved due to its superficial nature and being more prone to trauma . Injury is followed by swelling of the soft tissue, and as the swelling subsides, a painful firm mass starts growing after 1 or 2 months . The second variety is associated with neurological disorders such as closed head or spinal cord injury . The third type is pseudomalignant myositis ossificans of unknown origin presenting without history of trauma . The fourth type is a rare genetic disease called fibrodysplasia ossificans progressiva which is an unusual autosomal dominant inherited disease characterized by congenital malformations and osseous metaplasia of the facial muscles and connective tissue, leading to ossifications . This is fatal and, on an average, death occurs around the age of 35 years . The present case belonged to the third type as there was no history of trauma . Early lesions appear as amorphous calcifications within soft tissue; mature lesions appear as well - circumscribed lesions with a ring of calcification surrounding a radiolucent central portion and longstanding lesions may appear diffusely calcified .. plain radiographs can only detect signs of ossification after 6 - 12 months of progression . The pathognomonic appearance is a well - circumscribed high - attenuating periphery with a low - attenuating central portion that mimics a histological zonal architecture . Lesions are generally separated from neighboring native bone by a thin radiolucent cleavage plane; however, older lesions can appear attached to the adjacent bone by a broad calcified stalk . Mri reveals various characteristics depending on the stage of the lesion . In the early stage, the signal intensity may change depending upon the blood products and surrounding edema, with heterogeneous enhancement also being seen . Hence, myositis ossificans in the early stage may mimic an aggressive soft tissue neoplasm or inflammatory mass . In subacute or intermediate stage, a hypointense border corresponding to peripheral calcification is observed, whereas in the late stage, the intensity is decreased due to dense ossification and fibrosis . Ultrasonography(usg) is useful in early superficial lesions and shows presence of soft tissue with a central echogenic zone surrounded by a well - defined hypoechoic zone . These changes are seen 3 months before the calcification can be visualized on conventional radiographs . They stated that techniques such as conventional radiography and ct do not typically disclose characteristic findings before calcification . Scintigraphy may reveal abundant isotope uptake at the level of ectopic ossification sites at the onset of disease . Since scintigraphy gives a planar whole body image, known foci of ossification can be monitored and new sites which are undetectable by radiographic examination can be identified . The differential diagnosis of myositis ossificans includes parosteal or periosteal osteosarcoma, juxtacortical osteoma, osteochondroma, chondroma, chondrosarcoma, and nodular fasciitis . Soft tissue osteosarcomas are rarely encountered as they are seen in middle - aged and elderly and grow slowly . They are seen in shoulders, thigh, and retroperitoneum . Lesions present as soft tissue masses with calcification or ossification . Mri findings are not specific; lesions may contain cystic, solid, and hemorrhagic contents . They are divided into myxoid, mesenchymal, and well - differentiated extraskeletalchondrosarcoma based on histology . Myxoid tumors are of low - grade variety but associated with tumor recurrence and distant metastasis . Mesenchymal variety shows low signal intensity ont1w and increased signal intensity on t2w and post - contrast sequences . Radiographically, mature bone forms at the periphery of the lesion in myositis ossificans, while foci of ossification are located centrally in osteogenic sarcoma . Ossifying muscle metastasis from adenocarcinomas involving the esophagus, colon, stomach, and small bowel may mimic myositis ossificans . Reported that in 20% of published cases, there have been diagnostic problems distinguishing a benign from a malignant lesion like osteosarcoma . Ackerman recognized and described the zonal phenomena of histological changes in myositis ossificans . He emphasized that this zonal phenomena permits reorganization of this disease as benign, as this pattern is not typically found in soft tissue sarcoma . Zone 1 represents the central region of lesion, showing mitotic activity, variation in size and shape of the cells, and high level of cellularity . The middle or intermediate zone is considered zone 2, in which immature osteoid formation may be present . Zone 3 is situated at the outer aspect of the lesion and shows mature bone with more collagenous fibrous stroma . In the maxillofacial region, treatment of myositis ossificans is generally surgical excision of the ossified lesion . It is accepted that surgical treatment should not be attempted until the bone mass is mature and the bone scan activity has diminished, usually between 6 and 12 months, so as to prevent recurrence . So, it is recommended that surgery be attempted when the lesion does not regress or it becomes a functional handicap . The secondary effects of post - surgical scarring should not be ignored and intensive physiotherapy should be a part of postoperative care . In addition, disodium etidronate, biphosphonates, nonsteroidal anti - inflammatory drugs, indomethacin, corticosteroid, low - dose radiation, warfarin, and retinoids are the other alternatives attempted in the treatment of myositis ossificans . Early lesions appear as amorphous calcifications within soft tissue; mature lesions appear as well - circumscribed lesions with a ring of calcification surrounding a radiolucent central portion and longstanding lesions may appear diffusely calcified .. plain radiographs can only detect signs of ossification after 6 - 12 months of progression . The pathognomonic appearance is a well - circumscribed high - attenuating periphery with a low - attenuating central portion that mimics a histological zonal architecture . Lesions are generally separated from neighboring native bone by a thin radiolucent cleavage plane; however, older lesions can appear attached to the adjacent bone by a broad calcified stalk . Mri reveals various characteristics depending on the stage of the lesion . In the early stage, the signal intensity may change depending upon the blood products and surrounding edema, with heterogeneous enhancement also being seen . Hence, myositis ossificans in the early stage may mimic an aggressive soft tissue neoplasm or inflammatory mass . In subacute or intermediate stage, a hypointense border corresponding to peripheral calcification is observed, whereas in the late stage, the intensity is decreased due to dense ossification and fibrosis . Ultrasonography(usg) is useful in early superficial lesions and shows presence of soft tissue with a central echogenic zone surrounded by a well - defined hypoechoic zone . These changes are seen 3 months before the calcification can be visualized on conventional radiographs . As the disease progresses they stated that techniques such as conventional radiography and ct do not typically disclose characteristic findings before calcification . Scintigraphy may reveal abundant isotope uptake at the level of ectopic ossification sites at the onset of disease . Since scintigraphy gives a planar whole body image, known foci of ossification can be monitored and new sites which are undetectable by radiographic examination can be identified . The differential diagnosis of myositis ossificans includes parosteal or periosteal osteosarcoma, juxtacortical osteoma, osteochondroma, chondroma, chondrosarcoma, and nodular fasciitis . Soft tissue osteosarcomas are rarely encountered as they are seen in middle - aged and elderly and grow slowly . Mri findings are not specific; lesions may contain cystic, solid, and hemorrhagic contents . They are divided into myxoid, mesenchymal, and well - differentiated extraskeletalchondrosarcoma based on histology . Myxoid tumors are of low - grade variety but associated with tumor recurrence and distant metastasis . Mesenchymal variety shows low signal intensity ont1w and increased signal intensity on t2w and post - contrast sequences . Radiographically, mature bone forms at the periphery of the lesion in myositis ossificans, while foci of ossification are located centrally in osteogenic sarcoma . Ossifying muscle metastasis from adenocarcinomas involving the esophagus, colon, stomach, and small bowel may mimic myositis ossificans . Reported that in 20% of published cases, there have been diagnostic problems distinguishing a benign from a malignant lesion like osteosarcoma . Ackerman recognized and described the zonal phenomena of histological changes in myositis ossificans . He emphasized that this zonal phenomena permits reorganization of this disease as benign, as this pattern is not typically found in soft tissue sarcoma . Zone 1 represents the central region of lesion, showing mitotic activity, variation in size and shape of the cells, and high level of cellularity . The middle or intermediate zone is considered zone 2, in which immature osteoid formation may be present . Zone 3 is situated at the outer aspect of the lesion and shows mature bone with more collagenous fibrous stroma . In the maxillofacial region, treatment of myositis ossificans is generally surgical excision of the ossified lesion . It is accepted that surgical treatment should not be attempted until the bone mass is mature and the bone scan activity has diminished, usually between 6 and 12 months, so as to prevent recurrence . So, it is recommended that surgery be attempted when the lesion does not regress or it becomes a functional handicap . The secondary effects of post - surgical scarring should not be ignored and intensive physiotherapy should be a part of postoperative care . In addition, disodium etidronate, biphosphonates, nonsteroidal anti - inflammatory drugs, indomethacin, corticosteroid, low - dose radiation, warfarin, and retinoids are the other alternatives attempted in the treatment of myositis ossificans . Present imaging modalities like ct and mri can diagnose this condition and may also help in ruling out other differential diagnoses.
|
Due to the habit of eating raw foods, parasitic infection does occur in many developing areas of the world . Humans are accidental hosts and become infected by ingesting third - stage larvae from raw intermediate hosts such as snails, slugs, frogs, prawns, and crabs . Infection has also rarely occurred by consuming contaminated water or uncooked vegetables . In only 1.1% of angiostrongyliasis cases is an angiostrongylus cantonensis larva identified in the eye.1 evidently, 35 cases of ocular angiostrongyliasis have been previously reported,2 most of which were found in asia, especially thailand, including the first case in the world.3 ocular findings as a result of parasitic infection have included lateral rectus paralysis, facial palsy, uveitis, glaucoma, subretinal tracks, necrotizing retinitis, disc swelling, disc atrophy, retinal pigment alteration, and exudative retinal detachment.2 herein, we report a case of ocular angiostrongyliasis with retrobulbar optic neuritis, in which the parasite was found in the subretinal space . A 27-year - old thai male presented with progressive visual loss and a membrane - like floater in the right eye that had persisted for 1 month . He had a history of eating raw foods, in particular of raw pila sp . . Initial visual acuity of the affected eye was counting fingers at 1 ft and he had a relative afferent pupillary defect . A live roundworm, nearly 15 mm in length, with subretinal tracks was found near the normal optic disc . During indirect ophthalmoscopy, topical prednisolone acetate and oral prednisolone 40 mg daily, tapered after 2 weeks, were prescribed to reduce the subsequent inflammation . Due to the patient s history of ingesting raw food, from a review of 35 cases in the literature, the typical presenting symptom of ocular angiostrongyliasis is blurred vision without headache, although the eosinophilic meningitis may also present prior to, or coexisting with, the ocular symptoms . In some patients with angiostrongyliasis who reported having mild headache, their illness was not recognized or was misdiagnosed as migraine, tension headache, psychoneurosis, or even malaria.4 initial visual acuity varied widely from 6/9 to light perception . The incubation period is between 2 weeks and 2 months.1 punyagupta et al undertook clinical studies of 484 cases of typical eosinophilic meningitis and found 16% of patients had visual impairment, while 12% had an optic disc abnormality such as papilledema or atrophy.4 in these cases, we hypothesize the intraocular parasite was not identified because no ophthalmologist was available who could perform slit - lamp ophthalmoscopy and indirect ophthalmoscopy . Three decades later, sawanyawisuth et al conducted a 10-year review of angiostrongyliasis in the northeast of thailand and reported that the larva could be identified in only 1.1% of patients.1 almost all previous reports have indicated that only one living larva was found in the eye of each patient . Further, in about half of all cases, the motile worms were located in the vitreal cavity.2 we have also found that intravitreal and intracameral larvae are usually localized by fibrin, but that subretinal parasites usually move freely.5 pathological study has indicated that a. cantonensis may move along the cranial nerves after reaching its fifth - stage at the brain surface.4 cranial nerves 2, 5, and 7 have a long intracranial course, which may make them more susceptible than others . The larva can migrate to the orbit by traveling between the optic nerve and the sheath and penetrate the eye by way of the cribriform plate . A. cantonensis is easily identified by slit - lamp ophthalmoscopy and indirect ophthalmoscopy because this helminth can be easily distinguished from other parasites by its physical characteristics, so ocular examination is crucial for diagnosis . The other common intraocular roundworm is gnathostoma spinigerum, a nematode that reaches only 4 mm in length and has a tapering end . Because the typical physical features of the parasite were observed and it could be treated nonsurgically, local antibody evaluation such as polymerase chain was not performed in this case report . Although blood leukocytosis and eosinophilia have been demonstrated in 56% and 73%, respectively, of eosinophilic meningitis cases, eosinophilia has not been observed in ocular angiostrongyliasis without meningitis but leukocytosis has been observed in a few cases.1,4 in cases presenting with severe headache or neurologic abnormalities, lumbar puncture indicated eosinophilic pleocytosis.1a . Cantonensis larvae and eggs have seldom been found on stool examination, while o. viverrini and hookworm eggs have commonly been found.1 several treatments have been used to treat ocular angiostrongyliasis, including intravenous methylprednisolone, topical prednisolone, oral prednisolone, laser photocoagulation, and surgical removal.2 over three decades ago in thailand, we found that the intravitreal parasite often moved to the anterior chamber after the patient was placed in a facedown position . The motile worm could then be removed much more easily once in the anterior chamber . Many patients in rural and remote areas often cannot be referred due to financial and transportation problems . If the intravitreal parasite moves to the anterior chamber after the patient is placed in the face - down position, general ophthalmologist can remove it . We recommend applying laser treatment before surgical removal in every case because the motile worm may disappear in the operative field . Our laser technique involved directing a laser aiming beam of 200300 um on the pigmented gut of the larva . For a subretinal parasite, it is very important to use the laser to drive the larva away from the posterior pole, as in the case described here . In previous cases of secondary optic neuritis caused by a. cantonensis, most of the patients experienced only a slight improvement in visual acuity after treatment . In previous studies, steroids have been shown to have a beneficial effect on the clinical course of ocular angiostrongyliasis.6 however, anti - helminthic drugs should be used with caution because although they have been shown effective in experimental animals, larvicidal drugs can result in serious adverse neurological effects . Cuckler et al revealed that thiabendazole treatment in experimental rats that had been infested with a. cantonensis for 34 weeks comparable to persons with a serious infestation of this parasite resulted in the inhibition of parasitic migration from the animals brains.7 however, the death of many worms simultaneously in the brain or spinal cord might produce catastrophic effects from toxic substances released by the dying and necrotic worms . Therapeutic success in ocular angiostrongyliasis mainly depends on early diagnosis and complete surgical removal of the parasite . Unfortunately, visual prognosis depends largely on the initial pathology and visual acuity; ocular angiostrongyliasis often still results in permanent visual impairment, even blindness . In the case of surgical removal, the parasitologist can clearly identify the sex and stage of the larva . Although several treatments are available and used, most patients attain only slight visual improvement following treatment . Optic neuritis can be secondary to mechanical injury due to the migrating nematodes, granulomatous inflammatory reactions due to a dead worm, or localized antigen - antibody reactions . Oral or intravenous steroid treatment is recommended for secondary optic neuritis caused by a. cantonensis.
|
Participants were selected from the framingham heart study multidetector ct substudy of the community - based framingham heart study offspring cohort; inclusion criteria have been described previously (1). Beginning in 1971, the offspring study enrolled the offspring and spouses of the offspring whose parents were in the original cohort of the framingham heart study . A subset of the offspring cohort had measurements of adipokine concentrations at their seventh examination cycle between 1998 and 2001 . Of 1,418 participants in the offspring cohort of the multidetector ct study, 1,342 participants had interpretable ct measurements of visceral, subcutaneous, pericardial, and intrathoracic fat volume between 2002 and 2005 . After excluding participants with clinically prevalent cardiovascular disease (cvd), prior coronary artery bypass graft, and an incomplete covariate profile, the final sample size was 916 (501 women and 415 men). The institutional review boards of boston university medical center and massachusetts general hospital approved this study . Written informed consent was obtained from all participants . Circulating concentrations of adiponectin and resistin were measured by enzyme - linked immunosorbent assay (r&d systems, minneapolis, mn) in plasma collected after a> 8-h fast and frozen at 80c . Single, random plasma adiponectin and resistin concentrations have been shown to be stable over a 1-year period (9). An 8-slice multidetector ct (lightspeed ultra; general electric, milwaukee, wi) was used to image the abdomen and thorax . While lying in a supine position, participants had an average of 25 contiguous 5-mm - thick cross - sectional images (120 kvp; 40 ma; gantry rotation time, 500 ms; table feed, 3:1) of the abdomen and 48 contiguous 2.5-mm - thick cross - sectional images of the heart (120 kvp; 400 ma; temporal resolution, 330 ms). The specific protocols used to obtain images of the abdomen and thorax have been described elsewhere (5,10). Visceral, subcutaneous, pericardial, and thoracic fat volumes were measured (aquarius 3d workstation; terarecon, san mateo, ca) using an image display window width of 195 to 45 hounsfield units (hu) and window center of 120 hu . The readers manually traced the abdominal muscular wall separating the visceral and subcutaneous depots and outlined the pericardium to distinguish pericardial from thoracic fat . Total thoracic fat volume consisted of adipose tissue from the right pulmonary artery to the diaphragm and from the chest wall to the descending aorta, including fat within the pericardial sac . Interreader reproducibility was excellent for visceral, subcutaneous, pericardial, and thoracic fat volume measurements (1,10). Intrathoracic fat was derived after subtracting pericardial fat from total thoracic fat to identify two mutually exclusive fat compartments . Bmi was measured as weight (in kilograms) divided by the square of height (in meters). Participants were classified as current smokers if they smoked on average at least one cigarette per day in the previous year . Women who drank 7 alcoholic drinks per week and men who consumed 14 alcoholic drinks per week were considered alcohol users . The physical activity index was based on the average number of hours per day spent sleeping and doing sedentary, slight, moderate, and heavy activity . Women were considered postmenopausal if they had not had any menstrual periods for at least 1 year . Hypertension was diagnosed as a systolic blood pressure 140 mmhg, a diastolic blood pressure 90 mmhg, or treatment with antihypertensive agents . Fasting morning plasma samples were collected to measure fasting plasma glucose, total cholesterol, hdl cholesterol, and triglycerides . Diabetes was defined as a fasting plasma glucose 126 mg / dl (7 mmol / l) or treatment with insulin or a hypoglycemic medication . Adiponectin, vat, sat, pericardial fat, and intrathoracic fat volumes were approximately normally distributed . All analyses were a priori performed specific to sex due to strong sex interactions we had previously observed with sat and vat (1). Sex - specific and age - adjusted pearson correlation coefficients were calculated to determine the correlation between each fat compartment, adiponectin, and log resistin . Sex - specific multivariable linear regression was used to evaluate the associations of adiponectin and log resistin (dependent variables; separate models for each) with fat depots (independent variables), after adjustment for age, smoking, alcohol use, menopausal status (women only), and hormone replacement therapy (women only). Vat, sat, pericardial fat, and intrathoracic fat were standardized to a means sd of 0 1; the covariate - adjusted average change in adiponectin and log resistin per sd of adipose tissue volume was estimated . Using this approach, the multivariable models for vat, pericardial fat, and intrathoracic fat were then additionally adjusted for bmi and waist circumference in order to assess whether relations were maintained after adjusting for measures of generalized adiposity . As secondary analyses, multivariable models for vat, sat, pericardial fat, and intrathoracic fat were also additionally adjusted for physical activity and education status . Multivariable linear and logistic regressions were used to relate vat and sat (independent variables) to cardiometabolic risk factors (dependent variables). Models for systolic blood pressure, fasting plasma glucose, log triglycerides, hdl cholesterol, and metabolic syndrome were evaluated (separate model for each risk factor). Age, smoking, alcohol use, menopausal status (women only), hormone replacement therapy (women only), and treatment of hypertension, dyslipidemia, and diabetes were entered as covariates in each of the models . Each multivariable model was also adjusted for either adiponectin or log resistin (separate models for each adjustment) to assess the extent of attenuation of the association of vat and sat with each cardiometabolic risk factor upon adjustment for these adipokines . All analyses were performed using sas version 9.1 . A two - tailed value of p <0.05 was considered statistically significant . Circulating concentrations of adiponectin and resistin were measured by enzyme - linked immunosorbent assay (r&d systems, minneapolis, mn) in plasma collected after a> 8-h fast and frozen at 80c . Single, random plasma adiponectin and resistin concentrations have been shown to be stable over a 1-year period (9). An 8-slice multidetector ct (lightspeed ultra; general electric, milwaukee, wi) was used to image the abdomen and thorax . While lying in a supine position, participants had an average of 25 contiguous 5-mm - thick cross - sectional images (120 kvp; 40 ma; gantry rotation time, 500 ms; table feed, 3:1) of the abdomen and 48 contiguous 2.5-mm - thick cross - sectional images of the heart (120 kvp; 400 ma; temporal resolution, 330 ms). The specific protocols used to obtain images of the abdomen and thorax have been described elsewhere (5,10). Visceral, subcutaneous, pericardial, and thoracic fat volumes were measured (aquarius 3d workstation; terarecon, san mateo, ca) using an image display window width of 195 to 45 hounsfield units (hu) and window center of 120 hu . The readers manually traced the abdominal muscular wall separating the visceral and subcutaneous depots and outlined the pericardium to distinguish pericardial from thoracic fat . Total thoracic fat volume consisted of adipose tissue from the right pulmonary artery to the diaphragm and from the chest wall to the descending aorta, including fat within the pericardial sac . Interreader reproducibility was excellent for visceral, subcutaneous, pericardial, and thoracic fat volume measurements (1,10). Intrathoracic fat was derived after subtracting pericardial fat from total thoracic fat to identify two mutually exclusive fat compartments . Bmi was measured as weight (in kilograms) divided by the square of height (in meters). Participants were classified as current smokers if they smoked on average at least one cigarette per day in the previous year . Women who drank 7 alcoholic drinks per week and men who consumed 14 alcoholic drinks per week were considered alcohol users . The physical activity index was based on the average number of hours per day spent sleeping and doing sedentary, slight, moderate, and heavy activity . Women were considered postmenopausal if they had not had any menstrual periods for at least 1 year . Hypertension was diagnosed as a systolic blood pressure 140 mmhg, a diastolic blood pressure 90 mmhg, or treatment with antihypertensive agents . Fasting morning plasma samples were collected to measure fasting plasma glucose, total cholesterol, hdl cholesterol, and triglycerides . Diabetes was defined as a fasting plasma glucose 126 mg / dl (7 mmol / l) or treatment with insulin or a hypoglycemic medication . Adiponectin, vat, sat, pericardial fat, and intrathoracic fat volumes were approximately normally distributed . All analyses were a priori performed specific to sex due to strong sex interactions we had previously observed with sat and vat (1). Sex - specific and age - adjusted pearson correlation coefficients were calculated to determine the correlation between each fat compartment, adiponectin, and log resistin . Sex - specific multivariable linear regression was used to evaluate the associations of adiponectin and log resistin (dependent variables; separate models for each) with fat depots (independent variables), after adjustment for age, smoking, alcohol use, menopausal status (women only), and hormone replacement therapy (women only). Vat, sat, pericardial fat, and intrathoracic fat were standardized to a means sd of 0 1; the covariate - adjusted average change in adiponectin and log resistin per sd of adipose tissue volume was estimated . Using this approach, the multivariable models for vat, pericardial fat, and intrathoracic fat were then additionally adjusted for bmi and waist circumference in order to assess whether relations were maintained after adjusting for measures of generalized adiposity . As secondary analyses, multivariable models for vat, sat, pericardial fat, and intrathoracic fat were multivariable linear and logistic regressions were used to relate vat and sat (independent variables) to cardiometabolic risk factors (dependent variables). Models for systolic blood pressure, fasting plasma glucose, log triglycerides, hdl cholesterol, and metabolic syndrome were evaluated (separate model for each risk factor). Age, smoking, alcohol use, menopausal status (women only), hormone replacement therapy (women only), and treatment of hypertension, dyslipidemia, and diabetes were entered as covariates in each of the models . Each multivariable model was also adjusted for either adiponectin or log resistin (separate models for each adjustment) to assess the extent of attenuation of the association of vat and sat with each cardiometabolic risk factor upon adjustment for these adipokines . All analyses were performed using sas version 9.1 . A two - tailed value of p <0.05 was considered statistically significant . The mean age was 59 years (table 1), and slightly more than one - quarter were obese . Clinical characteristics of 916 study participants data are means sd or median (25th75th percentile). * defined as 7 drinks / week (for women) or 14 drinks / week (for men). Conversion to si units: multiply waist circumference by 2.54 for cm, triglycerides by 0.01129 for mmol / l, hdl and total cholesterol by 0.02586 for mmol / l, and fasting plasma glucose by 0.05551 for mmol / l . Vat, sat, pericardial fat, and intrathoracic fat were negatively correlated with adiponectin (r = 0.19 to 0.34, p <0.001 [women]; r = 0.15 to 0.26, p <0.01 [men] except sat) and positively correlated with resistin (r = 0.160.21, p <0.001 [women]; r = 0.110.14, p <0.05 [men] except vat) (table 2). Age - adjusted pearson correlation coefficients between fat depot volumes and adipokines in women, adiponectin concentration was 2.1 0.3 g / ml lower per sd increase of vat, 1.2 0.3 g / ml lower per sd increase of sat, 1.2 0.3 g / ml lower per sd increase of pericardial fat, and 1.2 0.3 g / ml lower per sd increase of intrathoracic fat (p <0.001) in multivariable - adjusted models (table 3). The regression coefficients for adiponectin concentration were larger per sd of vat than per sd of sat (p <0.001). In men, the multivariable - adjusted effect sizes of vat, sat, pericardial fat, and intrathoracic fat on adiponectin concentration were weaker but still significant in nearly all cases (table 3). A sex - by - vat interaction was observed for adiponectin (p <0.001), as well as a sex - by - sat (p = 0.001) and sex by pericardial fat interaction (p = 0.03). Sex - specific multivariable - adjusted * regressions for fat depot volumes with adipokines * adjusted for age, smoking, alcohol use, menopausal status (women only), and hormone replacement therapy (women only). Effect size refers to the average change in adiponectin or resistin concentration per sd of visceral, subcutaneous, pericardial, or intrathoracic fat volume . P value for sex interaction obtained from multivariable regression analysis on entire sample, adjusted for sex, age, smoking, alcohol use, menopausal status (women only), hormone replacement therapy (women only), and a sex - by - fat interaction term . R of model with covariates only is 2% in women and 4% in men . R of model with covariates only is 4% in women and 3% in men . In women, vat remained associated with adiponectin after additional adjustment for bmi and waist circumference (p = <0.001); pericardial fat and intrathoracic fat did not remain associated with adiponectin (p = 0.15 [pericardial fat], p = 0.5 [intrathoracic fat]). In contrast, among men, vat, pericardial fat, and intrathoracic fat were associated with adiponectin after further adjustment for bmi and waist circumference (all p <0.02). Covariates (age, sex, smoking, alcohol use, menopausal status, and hormone replacement therapy) explained 2% of the circulating variability in adiponectin concentration in women and 4% in men; adding vat to this model increased the model r to 13% in women and 10% in men (table 3). Multivariable - adjusted models for sat, pericardial fat, and intrathoracic fat accounted for a smaller portion of the variation in adiponectin concentration (r range 48%). Additional adjustment for bmi and waist circumference attenuated associations between vat, pericardial fat, intrathoracic fat, and resistin (all p> 0.2). Results were similar for men, except intrathoracic fat remained associated with resistin after additional adjustment for bmi and waist circumference (p = 0.02). None of the multivariable - adjusted models explained a substantial portion of the variability in resistin concentration (r range 36%). When physical activity and education status were included as additional covariates, relations between adipose tissue volumes, adiponectin, and resistin were not materially different (data not shown). Vat was associated with all cardiometabolic risk factors in both sexes as previously reported (1), except for systolic blood pressure in men (online appendix tables 1a and 1b [available at http://care.diabetesjournals.org/cgi/content/full/dc08-1733/dc1]). In women, we observed some attenuation of the effect size of vat on log triglycerides and hdl cholesterol after additional adjustment for adiponectin, but strong associations were still observed . After multivariable adjustment, hdl cholesterol was 5.1 0.7 mg / dl (0.13 0.02 mmol / l) lower per sd increase of vat . After further adjustment for adiponectin, mmol / l) lower per sd increase of vat . Fasting plasma glucose and diabetes did not appreciably change after adjustment for adiponectin . For sat, similar results were observed . In men, there was more attenuation of the effect size of vat on fasting plasma glucose, but not for diabetes, after additional adjustment for adiponectin . The effect size of vat on hdl cholesterol was minimally weakened after additional adjustment for adiponectin . Relations between vat, log triglycerides, and metabolic syndrome, as well as between sat and cardiometabolic risk factors, did not appreciably change after adjustment for adiponectin in men . None of the associations between vat, sat, and cardiometabolic risk factors appreciably changed upon adjustment for resistin (online appendix tables 1a and 1b). The mean age was 59 years (table 1), and slightly more than one - quarter were obese . Clinical characteristics of 916 study participants data are means sd or median (25th75th percentile). * defined as 7 drinks / week (for women) or 14 drinks / week (for men). Conversion to si units: multiply waist circumference by 2.54 for cm, triglycerides by 0.01129 for mmol / l, hdl and total cholesterol by 0.02586 for mmol / l, and fasting plasma glucose by 0.05551 for mmol / l . Vat, sat, pericardial fat, and intrathoracic fat were negatively correlated with adiponectin (r = 0.19 to 0.34, p <0.001 [women]; r = 0.15 to 0.26, p <0.01 [men] except sat) and positively correlated with resistin (r = 0.160.21, p <0.001 [women]; r = 0.110.14, p <0.05 [men] except vat) (table 2). In women, adiponectin concentration was 2.1 0.3 g / ml lower per sd increase of vat, 1.2 0.3 g / ml lower per sd increase of sat, 1.2 0.3 g / ml lower per sd increase of pericardial fat, and 1.2 0.3 g / ml lower per sd increase of intrathoracic fat (p <0.001) in multivariable - adjusted models (table 3). The regression coefficients for adiponectin concentration were larger per sd of vat than per sd of sat (p <0.001). In men, the multivariable - adjusted effect sizes of vat, sat, pericardial fat, and intrathoracic fat on adiponectin concentration were weaker but still significant in nearly all cases (table 3). A sex - by - vat interaction was observed for adiponectin (p <0.001), as well as a sex - by - sat (p = 0.001) and sex by pericardial fat interaction (p = 0.03). Sex - specific multivariable - adjusted * regressions for fat depot volumes with adipokines * adjusted for age, smoking, alcohol use, menopausal status (women only), and hormone replacement therapy (women only). Effect size refers to the average change in adiponectin or resistin concentration per sd of visceral, subcutaneous, pericardial, or intrathoracic fat volume . P value for sex interaction obtained from multivariable regression analysis on entire sample, adjusted for sex, age, smoking, alcohol use, menopausal status (women only), hormone replacement therapy (women only), and a sex - by - fat interaction term . R of model with covariates only is 2% in women and 4% in men . R of model with covariates only is 4% in women and 3% in men . In women, vat remained associated with adiponectin after additional adjustment for bmi and waist circumference (p = <0.001); pericardial fat and intrathoracic fat did not remain associated with adiponectin (p = 0.15 [pericardial fat], p = 0.5 [intrathoracic fat]). In contrast, among men, vat, pericardial fat, and intrathoracic fat were associated with adiponectin after further adjustment for bmi and waist circumference (all p <0.02). Covariates (age, sex, smoking, alcohol use, menopausal status, and hormone replacement therapy) explained 2% of the circulating variability in adiponectin concentration in women and 4% in men; adding vat to this model increased the model r to 13% in women and 10% in men (table 3). Multivariable - adjusted models for sat, pericardial fat, and intrathoracic fat accounted for a smaller portion of the variation in adiponectin concentration (r range 48%). Additional adjustment for bmi and waist circumference attenuated associations between vat, pericardial fat, intrathoracic fat, and resistin (all p> 0.2). Results were similar for men, except intrathoracic fat remained associated with resistin after additional adjustment for bmi and waist circumference (p = 0.02). None of the multivariable - adjusted models explained a substantial portion of the variability in resistin concentration (r range 36%). When physical activity and education status were included as additional covariates, relations between adipose tissue volumes, adiponectin, and resistin were not materially different (data not shown). Vat was associated with all cardiometabolic risk factors in both sexes as previously reported (1), except for systolic blood pressure in men (online appendix tables 1a and 1b [available at http://care.diabetesjournals.org/cgi/content/full/dc08-1733/dc1]). In women, we observed some attenuation of the effect size of vat on log triglycerides and hdl cholesterol after additional adjustment for adiponectin, but strong associations were still observed . After multivariable adjustment, hdl cholesterol was 5.1 0.7 mg / dl (0.13 0.02 mmol / l) lower per sd increase of vat . After further adjustment for adiponectin, fasting plasma glucose and diabetes did not appreciably change after adjustment for adiponectin . For sat,, there was more attenuation of the effect size of vat on fasting plasma glucose, but not for diabetes, after additional adjustment for adiponectin . The effect size of vat on hdl cholesterol was minimally weakened after additional adjustment for adiponectin . Relations between vat, log triglycerides, and metabolic syndrome, as well as between sat and cardiometabolic risk factors, did not appreciably change after adjustment for adiponectin in men . None of the associations between vat, sat, and cardiometabolic risk factors appreciably changed upon adjustment for resistin (online appendix tables 1a and 1b). In the community - based framingham offspring cohort, vat, sat, pericardial fat, and intrathoracic fat were negatively correlated with adiponectin but positively correlated with resistin . For both sexes, the strongest correlation was between vat and adiponectin, but the correlation coefficients were still weak . Furthermore, the addition of vat only increased the model r for adiponectin from 24% to 1013% . Vat is not a primary determinant of systemic total adiponectin concentration, and circulating levels of adiponectin cannot be used as a surrogate for vat . Adjustment for adiponectin attenuated relations between vat, sat, and cardiometabolic risk factors, but adiponectin did not fully account for the strong relations between vat and cardiometabolic risk factors . Easily obtainable anthropometric measures (bmi and waist circumference) did not explain the associations between vat and adiponectin in women or men and between pericardial fat, intrathoracic fat, and adiponectin in men . Therefore, ectopic fat depots may provide some additional insight about systemic adiponectin concentrations not apparent with measures of general adiposity . The modest inverse association between vat and adiponectin has been observed previously (6,8,11). We observed strong sex interactions in the effect size of vat on systemic adiponectin concentration . Other studies have demonstrated significant sex interactions in the associations between vat and cardiometabolic risk factors (1,7). Sex differences in free fatty acid delivery to the liver may account for the observed sex interactions, but the mechanisms are still not clear . The role of resistin in human obesity is controversial, but a recent candidate gene study (13) suggests an association between resistin and regional fat distribution and metabolic complications in hiv lipodystrophy . The strong relations between vat, diabetes, dyslipidemia, hypertension, and metabolic syndrome have been observed previously . The results of the present study reveal that adiponectin does not fully explain the relations between vat, systolic blood pressure, diabetes, and metabolic syndrome . The associations between vat, log triglycerides, hdl cholesterol, and fasting plasma glucose were attenuated, but not fully accounted for, by adiponectin . These findings contrast with prior work in the health, aging, and body composition cohort, where the association between vat and diabetes in a multivariable model was minimally attenuated by adjustment for combination of adiponectin, leptin, and plasminogen activator inhibitor-1 (11). However, pai-1 was the only adipokine found to be independently associated with incident diabetes . Given the modest correlations between vat, sat, and adiponectin, it is not surprising that we did not observe more attenuation in these models . Adjustment for resistin did not weaken any of the associations between vat and cardiometabolic risk factors . The differential associations between vat, sat, and adiponectin may be explained by differential adipocyte adipokine production and regulatory feedback of local inflammatory signals . Several small studies in lean and obese nondiabetic participants have shown that adiponectin mrna levels are lower in vat compared with sat (14,15), although these findings are not universal (16). Vat is associated with several inflammatory markers, even after adjustment for bmi and waist circumference (17). Tumor necrosis factor-, interleukin-6, and c - reactive protein can suppress adiponectin gene expression . In addition, adiponectin binds to complement factors and injured vessel walls (18); therefore, adiponectin concentrations may be further reduced in the presence of a high vat volume and systemic inflammation . In humans, resistin is primarily derived from macrophages that have infiltrated adipose tissue (19). A rodent study (20) revealed that macrophage content is higher in vat compared with sat in db / db mice but had similar concentrations in control mice . Given the modest correlations between vat and adiponectin, adiponectin does not appear to be a good serum proxy for vat . Adjustment for adiponectin affected relations between vat and fasting plasma glucose in men, hdl cholesterol, and log triglycerides, albeit minimally . These findings suggest that additional circulating biomarkers and hormones may mediate the relations between vat and cardiometabolic risk factors . It is also possible that high molecular weight adiponectin, rather than total adiponectin, may be a more potent mediator of the associations between vat and cardiometabolic risk factors . The strengths of this study include a well - characterized study sample and precise volumetric quantification of adipose tissue . The limitations include the cross - sectional design of the study, lack of ethnic diversity, noncontemporaneous ct and adipokine concentrations, and adiponectin assay . Given the cross - sectional, observational nature of our study design, causality cannot be inferred . Because the sample is comprised of primarily white participants, generalizability to other ethnic groups is uncertain . Adipokine concentrations, as well as glucose, cholesterol, and anthropometric measurements, were obtained several years before the cts were performed . Serum adiponectin levels and cardiometabolic risk factors may have changed at the time of the cts, and regional fat depot measurements may have been different at the time of adipokine concentrations . However, adipokine measurements have been shown to be stable over a 1-year period (9). Nonetheless, we cannot rule out misclassification based on the 4-year time lag between the adipokine and ct measurements that may have affected our results . Any minor variation in adipokine measurements should not impact the relative association among vat, sat, pericardial fat, intrathoracic fat, and adipokines, which is the primary focus of this study . We measured systemic levels and not local adipokine concentrations, and systemic levels may not reflect local production and release by all regional fat depots . Adipokines produced by vat are released into portal circulation, where hormones can be metabolized . Therefore, systemic adiponectin concentration may underestimate adiponectin concentration that is actually secreted by vat . However, a recent study did not demonstrate a difference between portal and systemic adiponectin concentrations (21); therefore, this is unlikely to explain our results . Lastly, high molecular weight adiponectin is more strongly associated with regional adiposity and metabolic diseases than total adiponectin (22). Thus, our results may have been stronger if we had measured high molecular weight adiponectin instead of total adiponectin . Adiponectin and resistin are correlated with fat depots cross - sectionally, but none of these adipokines can serve as surrogates for these fat depots . Relations among vat, sat, and cardiometabolic risk factors were not fully explained by adiponectin or resistin concentrations.
|
Obesity, declared a global epidemic by the world health organization, is associated with a number of illnesses such as diabetes, cardiovascular disease and cancer (http://www.who.int). Equally, obesity is a significant risk factor for obstructive sleep apnea (osa), the most prevalent sleep disordered breathing problem . Osa affects 226% of the general population, depending on gender, age and definition of the used criteria [2, 3]. To make matters worse, obesity is dramatically on the rise . In 2005, 400 million adults worldwide were obese . The who projects that in 2015, 700 million adults will be obese (http://www.who.int). The exact pathophysiology of osa in obese patients remains poorly understood, but it is thought that in obese patients the local fatty tissue deposition in the neck results in reduction of the lumen of the upper airway, thereby reducing airflow and inducing airway collapse . In patients with morbid obesity, who have failed conservative treatment, bariatric surgery (bs) can be considered . Bs is not only the most effective, long - term treatment modality in these patients for losing weight, but is also known to have a positive effect on comorbidities . The benefits of bariatric surgery are increasingly reported, but concern about the safety is also heightened . Patients with osa are particularly vulnerable during anesthesia and sedation and at an increased risk of developing respiratory and cardiopulmonary complications postoperatively . Furthermore, a recent study by the longitudinal assessment of bariatric surgery group (labs) shows that a history of osa is significantly associated with an increased risk of major perisurgical adverse outcomes in patients undergoing bs . Additionally, osa was found to triple the risk of perioperative death in a recent single - surgeon report of 1000 roux - en - y gastric bypass procedures . Anesthetist and surgeons should be aware that undiagnosed osa is common; osa remains undiagnosed in an estimated 93% of women and 82% of men [6, 8]. Bearing this in mind, and with the aim of preventing osa - related complications of bs, we were interested to see which percentage of patients undergoing bariatric surgery in our clinic had osa . We were interested in measuring the predictive value of various clinical parameters: body mass index (bmi), neck circumference (nc) and epworth sleepiness scale (ess). We performed a prospective, multidisciplinary, single - center observational study involving a consecutive series of patients being evaluated for bs in our clinic from june 2009 until june 2010 . Patients meeting the international federation for the surgery of obesity (ifso) (http://www.ifso.com) criteria were eligible for bs, specifically patients aged 1865 years, with a bmi> 40 kg / m or bmi> 35 kg / m with associated comorbidity (e.g., hypertension, diabetes, osa or joint problems). Secondly, patients were required to have made sufficient attempts at weight loss using conservative measures and must be motivated for dietary and behavior modification . Various bs types are performed in our clinic: laparoscopic gastric banding, swedish type of adjustable gastric banding (sagb), laparoscopic gastric bypass and gastric sleeve resection . All patients eligible for bs underwent a mandatory preoperative screening for osa in addition to our routine preoperative workup . Apart from patients with osa previously diagnosed elsewhere, preoperatively all patients on the waiting list for bs visited the ent outpatient department . Information was gained using patient history, ent and general examination and a full overnight polysomnography (psg). Weight, length (bmi) and nc at the level of the cricothyroid membrane were measured . The following bmi grading system was implemented: obese (bmi 3034.9 kg / m), severely obese (bmi 3539.9 kg / m), morbidly obese (bmi 4049.9 kg / m) and super obese (bmi> 50 the patients completed a questionnaire containing various questions concerning possible daily or nocturnal symptoms, intoxications, medication and medical history . Patients scored themselves on a scale of 03 on how easily they would fall asleep in eight different situations, giving an overall score between 0 and 24; the higher the score, the sleepier was the individual . Besides patients with osa previously diagnosed elsewhere, all patients underwent a full night comprehensive sleep study using a digital embla recorder (flaga medical devices, reykjavik, iceland). This records the sleep architecture (derived from electroencephalogram, electrooculogram and submental electromyogram), respiration (thoracic and abdominal measurement), movements of limbs, nasal airflow and the intensity of the snoring (the last two measured by pressure sensor). Transcutaneous pulse oximetry was used to monitor oxygen saturation (sao2) and heart rate . Hypopneas were defined as periods of reduction of> 30% oronasal airflow for at least 10s and a 4% decrease in oxygen saturation . Was calculated as the sum of total events (apneas and hypopneas) per hour of sleep . An ahi of 515/h is mild osas, an ahi of 1530/h is moderate and ahi> 30/h is severe osas, as assessed by polysomnography [2, 10]. Statistical analysis was performed using microsoft excel and spss statistical software (version 18, spss inc ., the distribution of recorded variables was characterized by calculating the mean and standard deviation . Since some parameters (especially the ahi) were expected to be non - normally distributed, also the median and range were calculated . Data are given for both the total study population and subdivided for women and men . The results of women and men were compared using an unpaired t test, with additional non - parametric mann differences were considered significant when p <0.05 . The prevalence of osa and osa severity was subdivided for obesity severity subgroups . The relation between the ahi and patient characteristics was further evaluated employing stepwise linear regression and binomial logistic regression . The sensitivity and specificity of the clinical predictor variables for the presence versus absence of osa (ahi> 5/h) and moderate to severe osa (ahi> 15/h) were used to plot receiver operating characteristic (roc) curves . We performed a prospective, multidisciplinary, single - center observational study involving a consecutive series of patients being evaluated for bs in our clinic from june 2009 until june 2010 . Patients meeting the international federation for the surgery of obesity (ifso) (http://www.ifso.com) criteria were eligible for bs, specifically patients aged 1865 years, with a bmi> 40 kg / m or bmi> 35 kg / m with associated comorbidity (e.g., hypertension, diabetes, osa or joint problems). Secondly, patients were required to have made sufficient attempts at weight loss using conservative measures and must be motivated for dietary and behavior modification . Various bs types are performed in our clinic: laparoscopic gastric banding, swedish type of adjustable gastric banding (sagb), laparoscopic gastric bypass and gastric sleeve resection . All patients eligible for bs underwent a mandatory preoperative screening for osa in addition to our routine preoperative workup . Apart from patients with osa previously diagnosed elsewhere, preoperatively all patients on the waiting list for bs visited the ent outpatient department . Information was gained using patient history, ent and general examination and a full overnight polysomnography (psg). Weight, length (bmi) and nc at the level of the cricothyroid membrane were measured . The following bmi grading system was implemented: obese (bmi 3034.9 kg / m), severely obese (bmi 3539.9 kg / m), morbidly obese (bmi 4049.9 kg / m) and super obese (bmi> 50 the patients completed a questionnaire containing various questions concerning possible daily or nocturnal symptoms, intoxications, medication and medical history . Patients scored themselves on a scale of 03 on how easily they would fall asleep in eight different situations, giving an overall score between 0 and 24; the higher the score, the sleepier was the individual . Besides patients with osa previously diagnosed elsewhere, all patients underwent a full night comprehensive sleep study using a digital embla recorder (flaga medical devices, reykjavik, iceland). This records the sleep architecture (derived from electroencephalogram, electrooculogram and submental electromyogram), respiration (thoracic and abdominal measurement), movements of limbs, nasal airflow and the intensity of the snoring (the last two measured by pressure sensor). Transcutaneous pulse oximetry was used to monitor oxygen saturation (sao2) and heart rate . Hypopneas were defined as periods of reduction of> 30% oronasal airflow for at least 10s and a 4% decrease in oxygen saturation . Was calculated as the sum of total events (apneas and hypopneas) per hour of sleep . An ahi of 515/h is mild osas, an ahi of 1530/h is moderate and ahi> 30/h is severe osas, as assessed by polysomnography [2, 10]. Statistical analysis was performed using microsoft excel and spss statistical software (version 18, spss inc ., the distribution of recorded variables was characterized by calculating the mean and standard deviation . Since some parameters (especially the ahi) were expected to be non - normally distributed, also the median and range were calculated . Data are given for both the total study population and subdivided for women and men . The results of women and men were compared using an unpaired t test, with additional non - parametric mann differences were considered significant when p <0.05 . The prevalence of osa and osa severity was subdivided for obesity severity subgroups . The relation between the ahi and patient characteristics was further evaluated employing stepwise linear regression and binomial logistic regression the sensitivity and specificity of the clinical predictor variables for the presence versus absence of osa (ahi> 5/h) and moderate to severe osa (ahi> 15/h) were used to plot receiver operating characteristic (roc) curves . Ten patients did not show up for their ent outpatient clinic and psg appointment . Of the remaining 279 patients, 214 (76.7%) patient baseline characteristics are shown in table 1.table 1patient characteristics: clinical and polysomnographic parameterspatient characteristicsmeanmedianrangewomen214 (76.7%)men65 (23.3%)age (years)45.1 10.646.0(1767)bmi (kg / m)44.2 6.442.8(3366)neck circumference (cm)42.6 4.842.0(3459.8)ess4.3 3.83.0(017)ahi (per h)23.9 27.712.4(0142)ai11 21.41.6(0127)arousal index (per h)7.5 8.45(054.7)mean sao2 (%) 93.8 3.394.7(7499)minimum sao2 (%) 80.8 10.783.0(5095)desaturation index (di)16.3 23.45.3(0106) indicates standard deviationai apnea index; ahi apnea hypopnea index; bmi body mass index, ess epworth sleepiness scale; osa obstructive sleep apnea; sao2 oxygen saturation patient characteristics: clinical and polysomnographic parameters indicates standard deviation ai apnea index; ahi apnea hypopnea index; bmi body mass index, ess epworth sleepiness scale; osa obstructive sleep apnea; sao2 oxygen saturation an unpaired t test was conducted to compare baseline characteristics in men and women . There was a significant difference in the ahi (p <0.0003), ai (p <0.0004), arousal index (p <0.006), di (p <0.0003), mean o2 saturation (p = 0.001), minimum o2 saturation (p <0.0007) and nc (p <0.0003) between men and women . In our study population, men were found to have a higher ahi, ai, arousal index and di, and lower mean and minimum o2 saturation (table 2). Application of a non - parametric test provided no new insights.table 2patient characteristics subdivided for women and menpatient characteristicsmenwomenage (years)48.5 9.344.0 10.8bmi (kg / m)44.3 7.144.2 6.2neck circumference (cm)48.0 3.941.2 4.0ess5.0 4.24.2 3.6ahi (h)45.9 29.917.3 23.3ai (h)25.7 27.17.0 17.5arousal index (h)10.6 8.96.7 8.1mean sao2 (%) 92.3 3.094.1 3.4minimum sao2 (%) 74.6 11.382.5 9.9desaturation index (di)32.2 26.811.8 20.3 indicates standard deviationai apnea index; ahi apnea hypopnea index; bmi body mass index, ess epworth sleepiness scale; osa obstructive sleep apnea; sao2 oxygen saturation patient characteristics subdivided for women and men indicates standard deviation ai apnea index; ahi apnea hypopnea index; bmi body mass index, ess epworth sleepiness scale; osa obstructive sleep apnea; sao2 oxygen saturation three (1.1%) of the patients were obese, 75 (26.9%) severely obese, 149 (53.6%) morbidly obese, 51 (18.3%) super obese . Osa stratified by bmi and the severity of osa by bmi are depicted in table 3 and fig . 1, respectively . A total of 112 (40.1%) patients underwent or are on the waiting list for sagb (average bmi 41 sd 4 kg / m), 155 (55.6%) laparoscopic gastric bypass (average bmi 46.1 sd 6.7 kg / m) and 12 (4.3%) gastric sleeve surgery (average bmi 49.4 sd 8.5 patients had been previously diagnosed with osas (ahi: 42.5 sd 27.2 per h) in our hospital (12 pts) or elsewhere (25 pts) before being placed on the waiting list for bs . Based on the psg results, 195 (69.9%) patients were diagnosed with osa, specifically 67 (34.7%) with mild osa, 48 (24.9%) with moderate osa and 78 (40.4%) with severe osa . 69.2% of the patients diagnosed with osa were female and 30.7% male.table 3number of patients with osa stratified by bmiosa stratified by bmiosano osatotal no.osa (%) obese (3034.9 kg / m)12333.3severely obese (3539.9 kg / m)49267565.3morbidly obese (4049.9 kg / m)1034614969.1super obese (> 50 kg / m)41105180.4bmi body mass index, osa obstructive sleep apneafig . 1severity osa stratified by bmi number of patients with osa stratified by bmi bmi body mass index, osa obstructive sleep apnea severity osa stratified by bmi stepwise linear regression was performed with ahi as the dependent variable . Independent variables evaluated were the bmi, nc and ess [adjusted r = 0.236; f = 22.9, p <0.0001 (using the stepwise method)]. In men, only the bmi was associated with the ahi (adjusted r = 0.167; f = 10.2, p = 0.003). Addition of nc made significant improvement to the model, but ess did not (adjusted r = 0.113; f = 11.5, p <0.0001). The ahi data are not strictly normally distributed . However, also after normalizing the data with a square root transformation, there was no improvement in the association between nc, ess and the dependent variable (ahi). Binomial logistic regression was used to identify independent variables associated with the presence or absence of (1) an ahi greater than 5/h or (2) 15/h . Results showed that in women, the bmi was the only significant predictor of an ahi greater than 5/h (odds ratio [or] = 1.072, p = 0.018, 95% ci 1.0121.135) and of an ahi greater than 15/h ([or] = 1.102, p = 0.001, 95% ci 1.0421.165). In men, nc was a significant predictor of an ahi greater than 15/h ([or] = 1.278, p = 0.026, 95% ci 1.0301.586). The results of the roc curves were disappointing; of all three clinical parameters, no cutoff values were found to have both a sensible sensitivity (> 0.8) and a useful specificity (> 0.9). The neck circumference was found to be the most accurate predictor of the presence of osa when the ahi as greater than 5/h (fig . 2). 2roc curve comparing sensitivity and specificity of neck circumference (nc), body mass index (bmi) and epworth sleepiness scale (ess) of an ahi> 5/h . The mean area under the curve (auc) for nc, bmi and ess were 0.69 0.4 (95% ci 0.620.77), 0.61 0.4 (95% ci 0.530.69), 0.54 0.4 (95% ci 0.450.62), respectively . No cutoff values were found to have both a sensible sensitivity (> 0.8) and a useful specificity (> 0.9)fig . 3roc curve comparing sensitivity and specificity of neck circumference (nc), body mass index (bmi) and epworth sleepiness scale (ess) of an ahi> 15/h . The mean area under the curve (auc) for nc, bmi and ess were 0.76 0.4 (95% ci 0.690.82), 0.62 0.4 (95% ci 0.540.69) and 0.59 0.4 (95% ci 0.510.67), respectively . No cutoff values were found to have both a sensible sensitivity (> 0.8) and a useful specificity (> 0.9) roc curve comparing sensitivity and specificity of neck circumference (nc), body mass index (bmi) and epworth sleepiness scale (ess) of an ahi> 5/h . The mean area under the curve (auc) for nc, bmi and ess were 0.69 0.4 (95% ci 0.620.77), 0.61 0.4 (95% ci 0.530.69), 0.54 0.4 (95% ci 0.450.62), respectively . No cutoff values were found to have both a sensible sensitivity (> 0.8) and a useful specificity (> 0.9) roc curve comparing sensitivity and specificity of neck circumference (nc), body mass index (bmi) and epworth sleepiness scale (ess) of an ahi> 15/h . The mean area under the curve (auc) for nc, bmi and ess were 0.76 0.4 (95% ci 0.690.82), 0.62 0.4 (95% ci 0.540.69) and 0.59 0.4 (95% ci 0.510.67), respectively . No cutoff values were found to have both a sensible sensitivity (> 0.8) and a useful specificity (> 0.9) in this series of consecutive patients undergoing bs, we found a 69.9% prevalence of osa . More than 40% of these patients were diagnosed with severe osa . Of the 195 patients diagnosed with osa, 69.2% were female: a 1:2.3 ratio (:), which is opposite to the typical osa male female ratio of 2:1 (:). The raised percentage of women with osa is caused by a skewed gender distribution within our study population . More than three - quarters of our study population was female; comparative to earlier reports that women seek surgical weight loss treatment nearly four times more often than men . Unlike many other studies, we used no selective inclusion criteria such as the ess as a screening tool . Irrespective of history or clinical findings, all patients being evaluated for bs underwent a polysomnography, unless performed previously . Our results are consistent with similar studies (see table 3). Using synonyms for: bariatric surgery, obstructive sleep apnea and polysomnography, an online systematic search was performed of the medline and embase database on the 4th april 2011 . Ten relevant articles were found . In each study, all patients being evaluated for bariatric surgery underwent a polysomnography as part of routine screening for osa regardless of symptoms and without use of screening tools such as the ess . Four articles were omitted from our overview (see table 4), owing to various applied inclusion criteria (a bmi 40 kg / m or asian race) and articles, which did not apply the aasm osa guidelines [1215].table 4outcomes of similar studies, in which all patients being evaluated for bariatric surgery underwent a polysomnography, irrespective of history or clinical findingsreferencetotal nosa nprevalence osa (%) severe osa (%) mean ahi (h)mean bmi (kg / m)frey et al . 17612671.648.028.042.0all1268100479.233.125.748.8ahi apnea hypopnea index, bmi body mass index, osa obstructive sleep apneaonly studies presenting percentage severe osa dataonly studies presenting mean ahi dataonly studies presenting mean bmi data outcomes of similar studies, in which all patients being evaluated for bariatric surgery underwent a polysomnography, irrespective of history or clinical findings ahi apnea hypopnea index, bmi body mass index, osa obstructive sleep apnea only studies presenting percentage severe osa data only studies presenting mean ahi data only studies presenting mean bmi data to our knowledge, following sareli et al . And lopez et al . [16, 17], our results are more in line with the results of frey et al . And lee et al ., but it should be noted that lee et al . Studied a predominantly asian population several studies reported that the prevalence of osa increased as the bmi increased, which may explain why our prevalence was lowest of all [17, 18]. We have two main study limitations, the first being that osa was an inclusion criterion for bariatric surgery, in accordance with the ifso guidelines: a potential bias, which could result in an overestimation of the prevalence of osa in our bariatric surgery population . A mere 13.3% (37) patients were diagnosed with osa before being placed on the waiting list for bs; 62.2% of these patients had a bmi greater than 40 kg / m and were therefore eligible for bs regardless of the presence of osa . As this group was minimal, we chose to include these patients in the series so as to avoid underestimating the prevalence of osa in our bariatric surgery population . The second limitation of the study is absent data, in particular from patients who had previously been diagnosed with osa elsewhere . These patients did not visit our outpatient department, consequently patient information such as ess or nc was unavailable . Ess data were available for 78.5% of the patients, and nc measurements for 82.4% . Ess is considered a useful screening tool for osa in the adult population; but as reported by sareli et al ., in the bariatric population, ess cannot independently reliably predict the presence of osa . Our data support this observation; we found ess not to be significantly related to the presence of osa in patients undergoing bs . Hence, ess is not a reliable predictor of osa in this patient population, despite often being used in bs centers as a screening tool . We used various statistical techniques to analyze the data . The various regression models and the roc curves give discrepant results, mainly due to the non - normal distribution of the data and data values of zero or close to zero . The poor statistical power and discrepancy of the results we contend that all three clinical parameters are inadequate predictors of osa and that psg is an essential component of the preoperative workup of patients undergoing bs . Despite the high test probability of moderate to severe osa in obese patients, the high costs and patient burden of psgs as well as the increasing prevalence of obesity and bs, the task force of the aasm does not advise the use of unattended portable monitoring (pm) for general screening, as there is yet insufficient evidence to guide the use of pm . A recent, unique study by hallowell et al . Compared a series of consecutive patients who underwent mandatory osa evaluation with a second group who were selected for a preoperative sleep study based on clinical suspicion and a raised ess in preparation for the bariatric surgery program . The authors suggest that osa is grossly underdiagnosed in the bariatric population and concludes that clinical evaluation including the ess is inadequate to identify the true prevalence of osa . We found that a substantial number of patients, even patients with extremely high ahis, were completely unaware of their osa . A mere 13.3% of the patients were diagnosed with osa before being placed on the waiting list for bs; 37 (13.3%) patients had an ahi> 60/h and only 11 patients were aware of their extreme osa . Patients are often asymptomatic or relate complaints of fatigue and hypersomnolence to their obesity and/or other comorbidities (e.g., diabetes) and do not realize that these are actually osa related . More often than in the general population, these patients sleep / live alone and a history of a bed partner is often lacking, which collaborates with patients being often unaware of their breathing abnormalities during sleep . The finding of osa may in fact influence the indication for bs being a bmi> 40 kg / m in patients without comorbidity, or bmi> 35 kg / m with comorbidity . Therefore, in otherwise healthy patients with a bmi between 35 kg / m and 40 kg / m, the finding of osa widens the indication for bs . Patients with osa have been shown to have increased preoperative risk and specific perioperative measures have to been taken [4, 23]. To what extent perioperative cpap therapy should also be applied in mild osa remains to be elucidated . Intubation might be difficult, and specific methods of intubation can be indicated . In case intubation is impossible and a tracheostomy must be performed, longer than usual tracheal cannulas might be necessary . Postoperatively, the use of morphinomimetic painkillers and other muscle tone reducing medication is contraindicated in patients with osa, or can only be used with postoperative monitoring . Increased neck circumference, bmi or ess cannot reliably predict the presence of osa . We are currently following these patients and aim to publish a paper showing the results of postoperative psg results shortly.
|
Much of the extant research on weight loss and weight management in adults has focused on the factors associated with adherence during, or after, programs which are typically staged in academic or clinical settings, using randomized controlled designs [1, 2]. Despite the controlled settings and the high level of staff training in these programs, mean dropout from such interventions remains at 2040% [3, 4] despite incentives to complete regular assessments and frequent follow - up contact from staff members . Therefore, the accuracy of dropout rates reported by such interventions may be misleading, and these studies may not help researchers understand the process of dropout in community - based settings . To evaluate and understand attrition in community - based settings, grave et al . Examined the predictors of dropout from the quovadis observational study of community - based weight loss programs in italy . Grave and colleagues addressed an important research question: are all drop - outs treatment failures? Findings showed that, despite significantly lower mean percentage weight loss than program completers at 36-month follow - up, dropouts achieved encouraging outcomes . For example, dropouts reported a higher mean percentage weight loss of 9.6% and 6.5%, respectively, than continuers (5.2%). Other studies have shown that program participants who disengage may still join other behaviors or programs . Tracked elderly participants in a community center for three years and noticed that 21% of participants tried out or transferred between programs within the center, while others concurrently participated in exercise programs outside of the center . In addition, stiggelbout and colleagues found that 31% of older adults who dropped out of a diverse range of organized exercise programs simply switched to another type of exercise . Thus, people who drop out from a program at one stage of their life may return to the same program after more than a year away, or after addressing personal or health problems, or they may express intentions to return in the future . Research examining other health behaviors, such as smoking cessation, has shown that it can take a sequence of repeated, unsuccessful attempts before long - term healthy behaviors are maintained . For example, related research has found that, following short - term commercial weight management interventions (of six months or less), some participants report strong intentions in maintaining newly learned behaviors, increased self - efficacy in achieving a future weight target, and positive changes in habitual physical activity at one - year follow - up . It is possible, therefore, that unsuccessful attempts can be part of the path to a healthy lifestyle because they contain some useful lessons in health education (i.e., exercise technique and eating preferences), stress management, or self - regulation . As weight management programs increasingly become translated into community settings, a certain degree of dropout can be expected as participants manage multiple time commitments and as program staff members manage multiple job responsibilities . Translation into community settings will bring along with it a greater need for accountability and compliance . Private fitness centers, health departments, and public and private insurers will want to know if these programs are sustainable or profitable . For example, programs established by health insurance agencies tend to have compliance guidelines to which participants must adhere to remain eligible to receive subsidized services . Fitness centers and community clinics benefit from these subsidized programs because they earn money by providing professional services to the policy holder . The main reason for stringent compliance guidelines is that providing such programs can be costly, particularly for insurance - funded programs, which aim to address various health risks that impact chronic disease and curb insurance expenses associated with chronic disease . Thus, a dropout from an insurance - sponsored program may either voluntarily quit the program or be administratively removed due to noncompliance . Little is known about the reasons for, and consequences of, dropout from insurance - sponsored health promotion programs . Understanding more about these patterns of behavior may help insurance agencies maximize the benefit of the programs they deliver in communities while keeping costs at a reasonable level . Finally, if positive consequences of dropout are found, these data will help support the continued spending of public and private insurance dollars on health promotion programs . Thus, the purpose of this study was to examine reasons for and consequences associated with dropout (or removal) from a state - wide, insurance - funded weight management program . The research questions included the following: (1) what are the reasons people drop out from an insurance - funded weight management program? (2) what are the positive and negative consequences associated with dropout? And (3) what are the differences in consequences and future health behavior intentions for those who drop out early, middle, or late into the program? West virginia is a small, appalachian state ranked among the least healthy states in the us based on adult prevalence of obesity (33% versus 27.5% us median), diabetes (12% versus 8.7% us median), and heart disease (6% versus 4% us median), all of which rank in the top 10 in the united states . The estimated direct medical costs associated with obesity in west virginia (wv) increased by $51 million usd between 2001 and 2009, which is a meaningful increase for a state with a population of just under two million . These negative health trends, and the economic consequences of them, have driven the need for programs which can help curtail the growth of obesity and promote healthy lifestyles . To combat these trends, the state's largest public insurer, the west virginia public employees insurance agency (peia), has established a comprehensive weight management program to provide policy holders with opportunities to learn how to be physically active and eat a healthful diet . The program is a two - year benefit offered by peia for people with a bmi of 25 kg / m or higher or an eligible waist circumference (i.e., 35 inches or greater for women and 40 inches or greater for men). The program, which requires a $20 monthly copay, includes access to a fitness facility in the local community and services provided by a personal trainer, dietitian, and exercise physiologist . Previous single - site and large - scale evaluations of this program's effectiveness have shown low reach, moderate to high effectiveness in short - term and long - term weight loss, and strong potential for sustainability [10, 1315]. The requirements for ongoing participation (for up to two years) are maintaining at least eight monthly visits to the fitness facility, attending appointments with professionals, and showing improvements in weight or other measured health parameters . For example, in the first six months, participants receive 120 minutes of personal training per month, three 3060-minute consultations with a dietician, and two 60-minute fitness assessments by an exercise physiologist . However, there is no standard model of service delivery as each professional is allowed the freedom to deliver fitness and dietary services within their own scope of practice . Facility staff are responsible for entering objective data on participant attendance and body measurements (i.e., waist, weight, body fat, and blood pressure) on a monthly basis into a secure, web - based platform used for evaluation and billing . Those participants that do not meet the eight visits per month minimum attendance criteria for two or more consecutive months are removed from the program . Therefore, participants may be administratively removed for noncompliance with these requirements or other issues may arise that cause the termination of their program (e.g., medical issues and change of insurance). In addition, participants may voluntarily choose to drop out from the program for personal reasons . When they are removed or choose to drop out from the program, they receive a letter informing them of their change in status . The study used a mixed methods design including quantitative data on objective outcomes (i.e., length in the program,% weight loss) as well as self - reported reasons and consequences in both quantitative and qualitative forms collected from the program evaluation survey . All program participants over the age of 18 who exited the program during 2014 (n = 973) received the program evaluation survey containing questions related to their participation in the program . The survey was sent first via email through a unique link to the participants who provided their email addresses at the start of the program . The electronic version of the survey was sent twice via survey monkey with a one - week interval between the first attempt and the reminder . If they did not respond to the email survey, a hard copy of the survey was mailed, which is the first step for participants without an email address . After a week without response from the paper - based survey, a reminder post card was sent to the participant . Using this dillman modified recruitment method, 400 of 973 participants responded to the survey resulting in a 41% response rate . The program evaluation survey sent to the participants included questions regarding their reasons for dropping out of the program, their satisfaction with different services of the program, and their future intentions . First, all participants were asked to choose between the reasons for leaving the program from why have you chosen to leave the weight management program at this time? Next, two sets of questions assessed participants' satisfaction with different services of the program . These questions asked participants to rate their exercise facility, personal training, and dietary services using a scaled response from 1 (not at all satisfied) to 4 (completely satisfied). The final question analyzed in this study inquired about the participants' intentions of carrying out the following health - related behaviors in the future, in a categorical format (yes, no, or i don't know): (a) continue as a private fitness member at the facility; (b) exercise for 30 minutes per day, five days per week; (c) exercise for 60 minutes per day, five days per week; (d) seek out a registered dietician; (e) enroll in a group exercise program; or (f) enroll in a group nutrition program . After inquiring about their future intentions, two demographic questions (i.e., gender and date of birth) preceded a final question where they could express other thoughts about the program . Because of the wording of this last question, many of its responses were related to satisfaction or dissatisfaction with the program (i.e., do you have anything else you would like to add about your level of satisfaction so far with the weight management program and the different services you have received?). In addition to satisfaction / dissatisfaction, participants also tended to express the positive and negative consequences related to their participation in the program and thus these data were included in the subsequent qualitative analysis . Then, a frequency analysis of their overall intentions for future health - related behaviors was performed . Finally, the two open - ended questions were analyzed through content analysis to address the research questions . For the analysis of the open - ended data, two researchers independently analyzed and open - coded different subsamples of the data using descriptive coding . Subsequently, they met, contrasted their codes, and agreed on pattern codes (i.e., categories) that provided more meaningful and parsimonious units of analysis . These categories and their codes were organized into a coding book that served as a source for the later provisional coding of the entire sample, allowing a combination of inductive and deductive coding . The software program nvivo 10 was utilized for this step, which allowed for a check of the interrater reliability . A near identical process was used to analyze the consequences and dropout open - ended items . However, data from the items were analyzed independently, that is, by separate sets of researchers and using separate coding books . Among all codes across both analyses, these values are considered moderate to strong agreement values . In any instance where the two raters disagreed, a third rater was engaged so that consensus could be reached in each coding moment before finalizing the code . For the final research question, respondents were classified into three groups depending on the timing of their program exit: (1) early drops (participation of 6 months or less); (2) mid drops (between 7 and 12 months of participation); and (3) late drops (between 13 and 24 months of participation). Two - way chi - square analysis was used to explore the future intention data as well as the patterns of consequences experienced across the three groups . These bivariate analyses were used to determine if there was any relationship between the length of time in the program prior to exit and their coded consequences and stated intentions . Effect size estimates for all analyses are reported as the contingency coefficient, and values>.3 can be considered moderate . The respondents were aged between 24 and 70 years, with a mean age of 48.6 years (sd = 11.1). The mean length of participation in the program was 9.8 months (sd = 5.6), with 33.7% exiting the program within the first six months, 35.7% exiting between 7 and 12 months, and 30.6% completing 1324 months . Among the male participants, mean weight at the beginning of the program was 262.2 lbs (sd = 57.3), while women had a mean weight of 210 lbs (sd = 49.6). Men's mean waist circumference at the beginning of the program was 46.9 inches (sd = 6.9) and women's was 42.4 inches (sd = 9.8). On a 6-point likert scale, with one meaning not at all satisfied and six meaning completely satisfied, participants had a mean satisfaction of 4.4 (sd = 1.5). At the time of survey completion, the average percent body weight loss for the respondents was 2.27% (sd = 4.9). Additionally, upon program exit, 21% of respondents lost at least 5% of their baseline body weight during the course of the program, while 26.7% had gained weight . To check for demographic differences between the survey respondents and nonrespondents, a series of independent samples t - tests analyses indicated that mean bmi, waist circumference, body fat percentage, and length of participation in the program of participants who dropped out from the program and responded the survey were not significantly different from the participants who dropped out and did not respond the survey (p>.05). However, the nonrespondents' age (m = 44.6, sd = 11.6) was significantly lower than the respondents' (m = 48.6, sd = 11.1), t(971) = 5.33, p <.001 . Despite this small difference in age, survey respondents and nonrespondents appear to report similar profiles related to their weight and program participation, thus reducing the concern for selection bias in the subsample of respondents . Among the 400 survey respondents, 375 participants responded to the question about their reasons to drop out from the program, while 272 responded to the final open - ended question . Reasons for dropout were allowed to emerge from either of these two questions . In total, reasons to drop out from the program were coded 420 times, with some participants indicating more than one reason and some leaving the question blank . Seven major themes regarding the participants' reasons to drop out from the program emerged from the survey responses: competing priority (36.9%), medical (22.8%), negative experience (13.1%), programmatic issues (12.4%), administrative drop (7.4%), insurance coverage change (6.4%), and completed attempt (1.0%). The competing priority theme was the largest emergent theme with 155 occurrences (36.9%) and included the subthemes of time (18.3%), caregiving (5.7%), distance (5.2%), lack of motivation (4.1%), personal reasons (2.1%), and grief (1.4%). Time was a frequently coded subtheme, including statements of limited or lack of time to comply with the program requirements (e.g., not enough time at the moment). Caregiving meant having to take care of older family members (e.g., family commitments due to sick family member) or children (e.g., my child playing sports kept me from coming at the scheduled times of the classes that i enjoyed taking). Distance included the gym being far from home or work and moving to another place . Lack of motivation included need for external motivation, not being able to meet requirements, and just not wanting to participate anymore (e.g., i was no longer invested in the program and wanted to do something else). Personal reasons contained personal or family reasons that were not specified (e.g., personal family difficulties were drawing me away from working out regularly). Finally, grief regarded difficulties in adherence due to grieving the death of a close person (e.g., death of my spouse, so i haven't adhered as well as i should have). The medical reasons theme included other physical limitation (20.9%), injury at facility (1.7%), and weight loss surgery (0.2%). Other physical limitation was the most frequently coded subtheme and included a variety of health issues other than injury at facility and weight loss surgery (e.g., i have been diagnosed with blood clots in the lungs and cannot work out for several months until i heal). Getting injured at the facility was reported by seven respondents, which prevented further exercise participation (e.g., weight loss surgery (e.g., bariatric surgery) was indicated by one participant . The theme negative experience (13.1%) included the subthemes of dissatisfaction (7.4%), negative feedback (2.4%), price (2.1%), and lack of support (1.2%). Dissatisfaction included disappointment with results, training, and services in general (e.g., negative feedback included negative feedback from measurements (1.0%) and pain (1.4%). The negative feedback made me feel like a failure instead of acknowledging my improvement, so i quit going, while the second involved any kind of pain related to the participation of the program (e.g., price comprised unwillingness or impossibility of paying for direct or indirect costs of the program (e.g., cost of daycare while i participate in the program). Finally, lack of support included family and social support . Lack of family support (1.0%) was coded when family members were unsupportive of the participant's compliance with the program (e.g., conflict with my spouse, he felt i was spending too much time at the gym), while lack of social support (0.2%) contained only one respondent who wished to have a buddy exerciser: programmatic issues was divided into the subthemes facility problem (11.7%) and gym culture (0.7%). The subtheme facility problem was further divided into professionals (6.2%), facility closure (4.5%), and facility hours (1.0%). The professionals subtheme regarded problems with the staff delivering the services offered by the program, such as trainer's or dietitian's ineffectiveness, limited availability, and lack of support (e.g., didn't feel i had the support needed from staff). Facility closure represented when the gym closed or stopped offering the program and this situation triggered the participants' dropout (e.g., the facility closed and i chose not to select an alternate facility). Finally, facility hours included dissatisfaction with the facility hours (e.g., hours at the facility did not coincide with my work hours). Gym culture included expressions of uncomfortable feelings due to the gym environment (e.g., [i] did not like the gym environment). The themes completed attempt, insurance coverage, and administrative drop (14.8% total response among the three categories) were less meaningful since they involved administrative issues . Insurance coverage contained participants who left for another job or retired, thus losing the insurance benefits, and administrative drop encompassed respondents who were removed by the program administration due to noncompliance . Completed attempt included people who believed that they had already completed the program and ceased going to the facility . Among the 400 survey respondents, 272 responded to the final open - ended question about their experiences in the program . Two major themes emerged from these 272 responses: positive and negative consequences from participation in the program . Positive consequences were coded 150 times (88.2%) and negative consequences 20 times (11.8%). Positive consequences included three subthemes: psychological (52.7%), behavioral (22.0%), and physical (25.3%). The negative consequences were composed of two subthemes: psychological (80%) and physical (20%) consequences . The first was attitude change (41.3%), which included the codes positive intentions (32%), perception of success (6.7%), and appreciate exercise (2.7%). The most common subtheme within the attitude change was positive intentions, which comprised intentions such as continuing to exercise, joining another weight management or exercise program, and seeking nutrition guidance (e.g., i will continue to work at home on my own equipment). The second most common was perception of success, including subjective comments regarding achieving success (e.g., i have worked very hard and have had great success). The last subtheme within the attitude change was appreciate exercise, which included liking exercise and realizing positives of exercising (e.g., the program made me realize how good i feel when i do work out). Another subtheme included in the positive psychological consequences was learning (8%), which contained several learning experiences, such as learning about exercise, eating, self - motivation, and weight loss (e.g., i learned a great deal from both the trainer and dietitian i have continued to utilize info from both). Finally, the last subtheme within the positive psychological consequences theme was feelings (3.3%), which contained general positive feelings such as being proud (e.g., i'm very proud of myself for what i have accomplished with some help from the program). The second major theme within the positive consequences was behavioral (22%), which comprised maintenance (14.7%) and changes (7.3%). Behavioral maintenance included continuing to exercise and eating healthy (e.g., as of right now i am once again working on my fitness and diet on my own). Behavioral changes referred to changes in exercise and eating habits without referring to the maintenance of these changes (e.g., i have changed my eating and exercise habits since i began [the] program). The final major subtheme within the positive consequences was physical (25.3%), which included the subthemes weight loss (15.3%), health improvement (5.3%), and fitness improvement (4.7%). Weight loss subtheme was subcoded into lost weight (13.3%) and continue to lose weight (2%), which differed regarding when the weight loss happened (during the program or after dropping out of it). I lost 45 pounds in the program and one of continue to lose weight is since leaving the program i have lost about 15 pounds . Health improvement regarded improvements in health - related markers (e.g., hemoglobin a1c), stress, energy, and pain (e.g., while working through this program my a1c level dropped from 7 to 5.7). Fitness improvement was related to enhancement in physical capability such as strength, flexibility, stamina, and resistance (e.g., 6 months ago it took me 30 minutes for a mile . Now i can do 3 miles in 31 minutes). Among the negative consequences (n = 20), the psychological consequences was the most frequent coded subtheme and was further subcategorized into attitudes (40%), feelings (35%), and lack of learning (5%). Attitudes included dissatisfaction with weight loss (15%) and lower motivation for being dropped (25%). The first comprised expressions that weight loss was not enough to satisfy the participant (e.g., i only lost 1015 lbs and after i felt that wasn't enough). The latter regarded the participant's decrease in motivation as a consequence of being removed from the program (e.g., i was kicked out of the program twice, it has been very discouraging). Still within the negative psychological consequences, the code feelings included negative feelings such as guilt, disappointment, and shame (e.g., i feel guilty for not continuing exercising as faithfully on my on). Finally, the last negative psychological consequence was lack of learning and it was coded once: the physical negative consequences were comprised of only one subtheme: weight gain (20%). It included statements of weight gain during the program or after leaving it (e.g., i actually gained more weight after enrolling this program). Regarding the respondents' (n = 400) intentions for future health - related behaviors, 64% intended to exercise 30 minutes per day, five days per week, 16% intended to exercise 60 minutes per day, five days per week, 11% intended to join a group exercise program, and 21% intended to continue as a private member of the fitness facility that they were attending during the program . Additionally, 7% intended to seek the help of a registered dietitian to make nutrition changes and 13% intended to enroll in a group nutrition program . When comparing these intentions among respondents who dropped out of the program early (6 months or less of participation), in the middle (between 7 and 12 months), or later (between months 13 and 24) chi - square analysis showed that respondents who stayed for seven or more months in the program were more likely to intend to continue exercising five days a week for at least 30 minutes (68.6% combined for the mid and later groups) compared to early dropouts (55%); however this effect was not significant, (4, n = 382) = 7.09, p = .131, cc = 0.14 . This trend was not found for intentions to exercise five days a week for 60 minutes, which overall remained low in the overall sample (16.1%). However, early dropouts (8.2%) were significantly more likely to intend to seek a dietitian help to make weight changes than middle dropouts (5.8%), (4, n = 371) = 12.97, p = .011, cc = 0.18 . The pattern of intentions to seek out group exercise classes or group nutrition services did not differ in a meaningful way across the three groups . In general, the final set of chi - square analyses targeted the relationship between stage of dropout (early, middle, and late) and consequences expressed . First, two analyses were conducted to see if the percentage of respondents reporting positive or negative consequences differed across the three groups . Positive consequences experienced in the program did show an increasing trend across the three groups, from 30.4% to 31.3% to 38.8%, but this relationship was not significant (2, n = 268) = 1.59, p = .451, cc = 0.07 . Overall, one - third of those who answered this open - ended question reported a positive consequence of program participation . Those participants who dropped out after 12 months (32.5%) were nearly twice as likely to report a positive psychological outcome compared to those who dropped out early (17.4%); however, this small effect failed to reach significance, (2, n = 268) = 5.30, p = .071, cc = 0.14 . A different trend was revealed for the negative consequences, with those who dropped out in the middle group reporting a negative outcome 35 times as often (12.5%) as the early (2.2%) or late (3.8%) dropouts, (2, n = 268) = 9.723, p = .008, cc = 0.19 . This pattern held true for all of the subthemes of negative consequences, with the exception of dissatisfaction with weight loss . The results of this mixed methods study support the idea that there are both positive and negative consequences experienced in a sample of weight management program dropouts . Overall, 1 in 5 respondents lost a clinically significant amount of weight during the program (> 5% of baseline body weight), regardless of the time of program exit, and 1 in 3 experienced a positive consequence, while only 6% expressed a negative outcome of participation . Additionally, nearly 90% of all of the consequences that emerged from the data were positive . Thus, some of the dropouts appear to have experienced substantial success in terms of outcomes or lessons learned through participation, and five times as many respondents reported a positive consequence compared to those who reported a negative consequence of participation . Skill acquisition were major themes, including positive health intentions, perceived success, learning skills, and new appreciation of exercise . These findings support previous theories of health behavior change including the theory of planned behavior's connection between intentions, self - efficacy, and past behavior as well as similar work on barriers to the self - management of diabetes . Specifically, based on these models, if programs can help individuals increase their health intentions, self - efficacy, and specific behavioral skills, regardless if they dropout or not, then they will increase the probability of future health behavior change among participants . Approximately two - thirds of the respondents indicated they intend to continue exercising five days a week for 30 minutes, an amount of physical activity that would meet guidelines for general health . Some respondents may have received as much out of the program as they needed, and they felt ready to move onto a self - managed program . Others simply learned some new skills and experienced a change in attitude toward eating or physical activity . Since intentions are widely regarded as being the closest psychological predictor of future behavior, it is possible that if these intentions are sustained, a subsequent attempt at behavior change will stick [6, 23]. Thus, the failure of dropout may have resulted in a valuable learning experience where participants identified activities they enjoyed and learned new meals to prepare for themselves and their families . These findings support previous research that also found positive intentions among former program participants [9, 24] and research that has identified a subset of dropouts who may have experienced substantial success . Additionally, it is possible that a shift in identity occurred moving some former participants towards a newer, active identity . Using self - determination theory as another frame of reference, if participants of health behavior interventions can develop more intrinsic forms of motivation, by identifying activities they enjoy and that confirm their sense of self, their future efforts may be sustained over a longer period of time . Not all participants reported positive outcomes, however, and approximately 1 in 4 of the dropouts gained weight during the program . It is important to note that most of the negative consequences reported were also psychological in nature (including lower motivation and dissatisfaction with weight loss), and there were no strong themes for things such as injury or worsened disability . Integrating the objective and subjective data on consequences allows an observation that approximately 20% (percent of sample with clinically significant weight loss) to 33% (percent of respondents who self - reported a positive consequence) of dropouts of this community - based weight management program experienced a meaningful positive consequence resulting from program participation . Future research may consider capturing some of these possible benefits along with reporting the outcomes of those who complete intervention programs . The average respondent dropped out approximately 10 months into this two - year - long program, and negative consequences were reported at a higher rate among middle dropouts compared to early or late dropouts . This particular phase of the program (between 7 and 12 months of participation) appears to be the highest risk of dropout and may warrant additional attention . Competing priorities (i.e., lack of time) was the most widely cited reason for program exit (noted by 37% of respondents), suggesting that the working adults in the program often struggle to manage the multiple commitments of work, family, and health . This evidence supports the idea that some people need more support than others based of the timing of their attempt and the strength of their motivation at program entry . These data also support the finding from grave et al . That some participants may need help managing logistics to increase long - term adherence . In this particular program, there is also a significant change to the services provided to participants during this time frame . In particular, their access to personal training drops from 120 minutes per month to 60 minutes per month, and they are not scheduled for another fitness or dietary reassessment until month 13 . This reduction in professional services and the lack of accountability that comes along with those reductions may cause some participants to lose motivation and commitment . It is also possible that adhering to the facility - based program that requires at least eight in - person visits per month is not sustainable for everyone over two years . Anecdotally, many participants report traveling substantial distances to reach the facility, particularly in rural parts of the state . Adding further support in the form of behavioral services may be needed considering that many program enrollees enter with various comorbidities or physical limitations . This issue highlights a key difference in populations who are enrolled in community - based programs compared to clinical trials; prior to group assignment, many participants with comorbidities are often excluded from trials . Adding behavioral services (in various forms and at various stages of the program) could help participants learn new skills and stay engaged long enough to maintain the multiple health behaviors they have initiated . The final discussion point worth noting relates to the differences observed when working with high risk adults and translating programs into communities . Though this program is a fitness facility based program, the weight management program participants are often dissimilar from typical gym members . They are typically obese, possess low fitness at baseline, and present with additional health risk factors including hypertension, hyperlipidemia, and/or diabetes . As insurance companies try to build connections with the fitness industry, it is imperative that fitness staff are trained to safely and accurately assess, prescribe modified exercise to, and train high risk clients . A mismatch between the needs of these participants and the staff training may be contributing to weak outcomes, injuries, and program noncompliance . These issues were noted by some participants who dropped out, thus highlighting the difficulty of ensuring high treatment fidelity in a large, community - based program . The results of this study should be interpreted given the following limitations . Despite the analyses indicating the responders are not that different from the nonresponders, there is still the potential for self - selection bias in the data . With a 40% response rate, it is possible that survey responders were more likely to report positive consequences than those who chose not to respond . Next, in our analyses of those who were dropped from the program, we did not differentiate between those who left the program voluntarily and those who were dropped due to noncompliance . All participants self - enroll in the program and decide on their own to attend the facility or to stop coming . Some participants are conscientious enough to call program staff, and the others simply stop going to the facility and then are dropped within 2 - 3 months for noncompliance . Finally, the study is limited because there is no follow - up data indicating if the positive intentions expressed at program exit led to future observable behaviors . Future studies will explore these patterns over time and should address the relative importance of the psychosocial and environmental factors and barriers that emerged among participants . There is strength in the study's design and data given the unique mix of quantitative, objectively observed changes in body weight and attendance along with the qualitative reasons, and consequences expressed by several hundred respondents . The loss of internal validity when programs are disseminated into multiple community settings is unavoidable . However, we cannot expect to treat or reverse the obesity epidemic in the us with the limited reach of randomized controlled trials in clinical settings . We must embrace the messiness of community - based programs, especially those funded by insurance agencies, because they are sustainable and possess strong external validity . Findings of the current study can be used to inform and improve future community - based research and multisite intervention programs with similar rural populations in the united states that experience the greatest health disparities in chronic disease.
|
Aortic dissection is a life - threatening condition affecting up to 30 people per million each year . It remains a devastating disease with one of the highest mortality rates of cardiovascular diseases and multiple unanswered questions regarding treatment . Endovascular repair of uncomplicated acute aortic type b dissections (aad - b) is especially controversial and its associated post - implantation syndrome (pis) vague . We present a case of a 57-year - old man with an uncomplicated aad - b managed with tevar; and the subsequent refractory pains, only later managed with steroids as atypical pis . Although most definitions do not include local features of inflammation (including pain) as part of pis; its place in systemic inflammatory response syndrome (sirs) and pis is highlighted . A 57-year - old man of african descent known to have hypertension; presented with acute onset, progressively worsening chest pain radiating to the back (severity> 8; numeric pain rating scale). He had no other comorbidities, was a non - smoker and did not volunteer any history of alcohol use . He was on metoprolol, irbesartan and hydrochlorothiazide for his hypertension; which he admitted to using only when he felt unwell . On examination, he had a blood pressure of 172/119 (right arm) and 137/92 (left arm). High - sensitivity troponin t was elevated (19.29 ng / ml), but not rising . An electrocardiogram (ecg) and a transthoracic 2d - echocardiogram showed left ventricular hypertrophy and no wall motion abnormalities . A computed tomography aortogram (cta) was done showing an aortic dissection involving the descending aorta extending to the left common iliac, with iliac, superior mesenteric and both renal arteries arising from true lumen (fig . He was admitted to the intensive care unit and started on morphine and labetalol infusion at 2 mg / h . Figure 1:(a) ct aortogram showing the dissection, 3d reconstruction; (b) immediate post - tevar showing contrast only in true lumen . (a) ct aortogram showing the dissection, 3d reconstruction; (b) immediate post - tevar showing contrast only in true lumen . The patient was selected for tevar according to cooper's proposed algorithm and the decision reinforced by the history of non - compliance to medical therapy . A valiant captiva (medtronic) 38 200 mm stent was deployed through the right femoral artery into the aorta, landing proximally just distal to the left subclavian artery and distally just distal to the celiac artery with an overlap of 110 mm and effective occlusion of the false lumen (fig . 1b). Of note, 12 h post - tevar however; the patient started complaining of colicky, non - specific abdominal pains; associated with a leukocytosis, decreased platelet counts, the absence of fever and rising c - reactive protein (crp) (fig . He was managed conservatively with non - steroidal anti - inflammatory agents (nsaids), antispasmodics and proton pump inhibitors (ppis). Five days later, pains persisted, increasing in severity; with minimal relief with nsaids and antispasmodics . An array of tests were done including procalcitonin (normal); blood cultures (negative); liver function tests (normal), serum amylase / lipase (normal); abdominal ultrasound (minimal gall bladder sludge); repeat ecgs (no changes); oesophagoscopy (normal) and magnetic resonance imaging of the thoracic and lumbar spine (normal). A repeat cta showed the graft in place without endoleaks . In total, 16 days post procedure; he was started on intravenous steroids (for possible pis) with dramatic clinical improvement and subsequently discharged home after 48 h in a stable condition . Note the initial attenuation of crp, with normalization of wbc / plt on fifth day post - tevar and the drastic drop in crp / plt with initiation of steroids on day 14 . Note the initial attenuation of crp, with normalization of wbc / plt on fifth day post - tevar and the drastic drop in crp / plt with initiation of steroids on day 14 . Described over two centuries ago; aortic dissections result from an intimal tear that leads blood into a false lumen between the intimal and medial layers of the aortic wall . As classified by daily et al . In 1970 at stanford; type a dissections involve the ascending aorta and type b involve only the descending aorta . The latter account for over a third of aortic dissections [1, 5]; a majority hypertension - related and are uncomplicated so assigned by the absence of malperfusion, hypotension, refractory hypertension or findings suggestive of impending rupture . Once a diagnosis of an uncomplicated aad - b is established, a majority of patients are started on medical therapy; and this has been widely accepted as the standard treatment [2, 3]. This entails intensive anti - impulse therapy; the cornerstone of which is reduction of pressure on the aortic wall and subsequent decreased propagation of the false lumen . While a majority of patients so treated are discharged with no complications; the long - term outcomes are perturbing with high mortality and complication rates . Subsequently, questions abound about the possibility of multimodal therapy with adjunctive tevar in a bid to improve the outcomes . This stent graft placement occludes the primary intimal tear promoting false lumen thrombosis and subsequent aortic remodeling; with resultant reduction of disease progression, late adverse events and aorta specific mortality [7, 8]. Despite this, however, the use of tevar in uncomplicated aad - b remains controversial; and is not without risks, one of which is pis . First described in 1999, pis, is a vaguely defined sirs following endovascular repair that presents with a noninfectious fever, leukocytosis (> 12 000/l), elevated crp (> 10 mg / l) and coagulation disturbances including thrombocytopenia in the context of negative blood culture results; and occurs in up to 60% patients . Though the exact pathophysiology remains an enigma, it is believed to result from complex endothelial - stent fabric interactions where tissue injury activates complement and induces production of various pro - inflammatory mediators including tumor necrosis factor-, interleukin (il)-1, il-6; with local and systemic effects . While the systemic effects are well appreciated, and define pis; there is hardly any mention of its local effects, including local pain . In kenya, compliance to antihypertensives has been shown to be low, and thus an added benefit with tevar in management of this case postulated . While the patient developed evident sirs with tachycardia, leukocytosis, thrombocytopenia and high serum crp post - tevar; it is his refractory pain that was worrying . Evaluation for the etiology of this, from endoleaks to cord ischemia yielded no positive result and thus the eventual management as an atypically presenting pis, refractory to nsaids . Although pis is a largely systemic inflammatory response; perigraft inflammation has been shown in experimental studies and thus features of local inflammation (like pain in our case) should be borne in mind to avoid delayed treatment with associated lengthy hospital stays . H.g . Was the primary doctor in the care of this patient and was involved in providing data needed (including images) in preparation of this report . He was also very resourceful in literature review especially on hypertension locally and internationally; and in the preparation of the manuscript, including revising it critically for important intellectual content . P.w . Was the lead author with significant contribution in case report framework, literature review, draft revision and final submission . Patient consent was obtained (available for review if needed) for publication of this case report.
|
Cancer survivors are at an increased risk for developing cancers compared to the general population . In the united states, where cancer survivors comprise 3.5% of the total population, approximately 10% of all new cancers are diagnosed from a population of cancer survivors, and 8% of survivors have been affected by cancer more than once [4 - 6]. In korea, cancer survivors comprise 2% of the total population, and an estimated 3% to 4% of all new cancer cases have been diagnosed among survivors . Because cancer screening can reduce the risk of dying from selected cancers via their early detection, screening for spc should be included as one of the key components of survivorship care . However, spcs are often undetected during a regular oncological follow - up process, and spc cancer screening practices have not been optimal [12 - 14]. Although cancer patients have an increased risk of spc compared to the general population, their cancer screening rates were either slightly higher or similar compared to the general population [15 - 18]. The lack of information concerning spc and knowledge among cancer patients were identified as the key barriers to spc screening . Cancer screening and routine surveillance tests. Many survivors said that they would have undergone screening for spc if they were aware of it and would have liked to receive information related to spc from their physicians . However, only 21.5% of them received a recommendation for spc screening from their doctors . Because oncologists are key personnel for educating survivors and guiding spc screening, we explored oncologists experience, current practice, perceived barriers, and appropriate care models and recommendations to develop appropriate clinical strategy for spc screening in our previous qualitative study . In this nationwide study the present study is part of a nationwide survey that was conducted to explore medical care and treatment views of physicians involved in cancer care . Physicians at the national cancer center and 12 participating government - designated regional cancer centers across korea participated in the survey . The current study was approved by the institutional review board of the national cancer center of korea . Of the 901 physicians invited to participate in this study we administered questions regarding spcs only to 505 oncologists who see cancer patients for diagnosis and treatment of primary cancer, while the rest175 physicians who provide other supportive care or services (e.g., radiologist, pathologist, cardiologist, rehabilitation specialist, pain specialist, and psychiatrist)were excluded from the study . Additionally, 19 oncologists who did not answer the questions regarding spcs were excluded from the analyses, leaving a final total of 486 subjects in the current study . The questionnaires included questions regarding the oncologists experiences with spc patients, feelings they had when their patients developed spcs, current spc screening practice, barriers to providing spc screening information, and appropriate care models and recommendations to develop the appropriate clinical strategy for spc screening . The survey also inquired about age, gender, specialty, years since board certification, and patient volume (average number of outpatients per week). Chi - squared tests were used for the comparison of the responses in accordance to the subgroups . All statistical analyses were conducted using stata ver . 12.0 (stata corp ., college station, tx), and a p - value of less than 0.05 was considered to be statistically significant . The present study is part of a nationwide survey that was conducted to explore medical care and treatment views of physicians involved in cancer care . Physicians at the national cancer center and 12 participating government - designated regional cancer centers across korea participated in the survey . The current study was approved by the institutional review board of the national cancer center of korea . Of the 901 physicians invited to participate in this study we administered questions regarding spcs only to 505 oncologists who see cancer patients for diagnosis and treatment of primary cancer, while the rest175 physicians who provide other supportive care or services (e.g., radiologist, pathologist, cardiologist, rehabilitation specialist, pain specialist, and psychiatrist)were excluded from the study . Additionally, 19 oncologists who did not answer the questions regarding spcs were excluded from the analyses, leaving a final total of 486 subjects in the current study . The questionnaires included questions regarding the oncologists experiences with spc patients, feelings they had when their patients developed spcs, current spc screening practice, barriers to providing spc screening information, and appropriate care models and recommendations to develop the appropriate clinical strategy for spc screening . The survey also inquired about age, gender, specialty, years since board certification, and patient volume (average number of outpatients per week). Chi - squared tests were used for the comparison of the responses in accordance to the subgroups . All statistical analyses were conducted using stata ver . 12.0 (stata corp ., college station, tx), and a p - value of less than 0.05 was considered to be statistically significant . The mean age of cancer care physicians was 42.6 years, and the mean time since board certification was 11.6 years . Among the 486 study participants, 384 (79.1%) were male . The sample comprised surgical oncologists (n=274, 56.4%), medical oncologists (n=182, 37.4%), and radiation oncologists (n=30, 6.2%). The mean number of patients per week was 117.5 (standard deviation, 77.4) (table 1). More than three - fourths of the oncologists surveyed (76.3%) had reported that their own patients developed spcs while being followed - up after primary cancer treatment . With regard to the feelings they had about their own patients who developed spcs, approximately half of the oncologists (48.1%) stated that they felt embarrassed being the doctor in charge, and one - third (30.7%) felt sorry for the patients . As many as 37.0% of oncologists felt that patients appeared to not have accepted the situation, and 25.9% felt that patients blamed them (table 2). Some oncologists (39.1%) reported that they proactively provided information on the necessary screening for spcs to most patients . Others (28.2%) proactively provided information on necessary screening for spcs to only high - risk patients . While another group (30.9%) did not typically discuss screening for spcs during routine practice . In addition, oncologists differ in how they deal with the necessary second cancer screening . Of those (43.4%) that reported they prescribe necessary screening tests alone, many (24.5%) provide information regarding the national cancer screening program, which is a basic cancer screening package provided to all koreans over 40 years of age (appendix 1). A portion of oncologists (27.4%) refer their patients to private comprehensive screening programs, which are commonly provided by university hospitals (table 3). Most oncologists (80.2%) agreed to the need for proactive provision of information regarding screening for spcs . However, many barriers were identified by oncologists: short consultation times (52.3%), lack of guidelines and evidence for spc screening (47.7%), patients lack of knowledge about spcs (45.1%) or spc screening (41.4%), lack of a system for spc screening (37.7%), their own lack of knowledge about spc screening (36.2%), and lack of connections with the national cancer screening program (33.7%) (table 4). Regarding the appropriate care model for spc screening, more than half of oncologists (57.6%) indicated the need for a cooperative spc screening program within the cancer center that is managed by physicians other than the oncologists who performed the follow - up on patients for their primary cancer . Approximately one - fourth of oncologists (22.8%) prefer direct provision of spc screening by oncologists alone, and 15.4% answered that spc screening is better provided by local hospitals or clinics within the patients vicinity . Several recommendations were suggested by the oncologists: developing specific screening programs or guidelines according to the type of primary cancer (65.9%), developing an internal system for spc screening within the hospital (59.7%), educating patients about the needs for spc screening after primary treatment (48.9%), developing a systematic connection with the national cancer screening program (44.3%), educating oncologists about spc screening (41.4%), and allocating resources for oncologists to have sufficient time for spc screening consultation (27.7%) (table 5). The mean age of cancer care physicians was 42.6 years, and the mean time since board certification was 11.6 years . Among the 486 study participants, 384 (79.1%) were male . The sample comprised surgical oncologists (n=274, 56.4%), medical oncologists (n=182, 37.4%), and radiation oncologists (n=30, 6.2%). The mean number of patients per week was 117.5 (standard deviation, 77.4) (table 1). More than three - fourths of the oncologists surveyed (76.3%) had reported that their own patients developed spcs while being followed - up after primary cancer treatment . With regard to the feelings they had about their own patients who developed spcs, approximately half of the oncologists (48.1%) stated that they felt embarrassed being the doctor in charge, and one - third (30.7%) felt sorry for the patients . As many as 37.0% of oncologists felt that patients appeared to not have accepted the situation, and 25.9% felt that patients blamed them (table 2). Some oncologists (39.1%) reported that they proactively provided information on the necessary screening for spcs to most patients . Others (28.2%) proactively provided information on necessary screening for spcs to only high - risk patients . While another group (30.9%) did not typically discuss screening for spcs during routine practice . In addition, oncologists differ in how they deal with the necessary second cancer screening . Of those (43.4%) that reported they prescribe necessary screening tests alone, many (24.5%) provide information regarding the national cancer screening program, which is a basic cancer screening package provided to all koreans over 40 years of age (appendix 1). A portion of oncologists (27.4%) refer their patients to private comprehensive screening programs, which are commonly provided by university hospitals (table 3). Most oncologists (80.2%) agreed to the need for proactive provision of information regarding screening for spcs . However, many barriers were identified by oncologists: short consultation times (52.3%), lack of guidelines and evidence for spc screening (47.7%), patients lack of knowledge about spcs (45.1%) or spc screening (41.4%), lack of a system for spc screening (37.7%), their own lack of knowledge about spc screening (36.2%), and lack of connections with the national cancer screening program (33.7%) (table 4). Regarding the appropriate care model for spc screening, more than half of oncologists (57.6%) indicated the need for a cooperative spc screening program within the cancer center that is managed by physicians other than the oncologists who performed the follow - up on patients for their primary cancer . Approximately one - fourth of oncologists (22.8%) prefer direct provision of spc screening by oncologists alone, and 15.4% answered that spc screening is better provided by local hospitals or clinics within the patients vicinity . Several recommendations were suggested by the oncologists: developing specific screening programs or guidelines according to the type of primary cancer (65.9%), developing an internal system for spc screening within the hospital (59.7%), educating patients about the needs for spc screening after primary treatment (48.9%), developing a systematic connection with the national cancer screening program (44.3%), educating oncologists about spc screening (41.4%), and allocating resources for oncologists to have sufficient time for spc screening consultation (27.7%) (table 5). Although spc screening has become a key issue for survivor care, no clinical strategy has been established . In addition, oncologists were not trained to manage the issues during their career development . To our knowledge, this is the first quantitative study to examine oncologists experiences with patients who develop spc and the current practices related to spc screening, as well as recommendations to develop appropriate clinical strategy in providing spc screening . More than three - fourths of oncologists had patients who developed spcs during follow - up, and more than half of these oncologists stated that they were embarrassed by the situation . Approximately one - third of oncologists felt that a significant portion of patients appeared to not have accepted the situation and blamed their oncologists; additionally, the oncologists felt sorry for their patients . As revealed in our study, the cause may be because most oncologists usually do not provide any information or recommend spc screening during their routine practice . Indeed, only 21% of cancer patients reported that spc screening was recommended by their physicians . A large variation existed in the oncologists current practice of spc screening, ranging from no recommendations, referral to other programs, and direct provision by the oncologists themselves . These findings may partly reflect the oncologists individual situations, such as clinical burden, self - perceived identity as an oncologist, personal interests, knowledge, training in these issues, and environmental conditions . However, such unwarranted variations in care suggest poor quality of care regarding spc screening . In addition to this variation in individual oncologists general patterns of dealing with spc screening, actual decisions on spc screening are reportedly made on a case - by - case basis, since spcs are provided at the patient s request, rather than proactively, leading to further variations in the screening practices . Considering the increasing number of spcs, most oncologists agreed to the need for proactive provision of spc screening information . However, several barriers and potential solutions were recognized that are related to (1) the health system, (2) the provider, and (3) the patient . In concordance with the previous qualitative study, a short consultation time was identified as the most common barrier against the guidance of appropriate screening for spc . In korea, oncologists see 20 - 60 patients in a single session (lasting 3 - 4 hours), and the average consultation time is only 7 minutes . Referral of cancer survivors to a systematic cancer screening program would overcome this clinical environmental barrier, and approximately 40% of the respondents of this study felt that the lack of such a system was a significant barrier to providing adequate spc screening . More than 70% of the oncologists preferred to refer their patients to other physicians, either in their own institution or in community clinics . The latter finding reflects the oncologists low level of interest in participating in primary care services, including spc screening . Personal identity as a cancer treatment specialist and the lack of an opportunity to be educated about preventive services and cancer screening could be the potential explanations for this lack of interest . While cancer survivors expect oncologists to cover all of their health problems, including spcs, oncologists were more likely to focus on active treatment of the disease . Such discrepant expectations were also reported in a united states study, in which the rate of agreement between oncologists and their patients about spc screening was only 29% . The lack of clear guidelines for spcs was also considered as a major barrier in providing adequate spc screening . The cause may be that oncologists lack confidence about their guidance for spc screening if no guidelines exist for such screening . Furthermore, in our previous study, a portion of oncologists reported that some survivors showed negative attitudes in response to their recommendation for spc screening, simply because they suspected that oncologists would obtain more financial benefit from prescribing the screening test . Therefore, without clear guidelines, the oncologists would have difficulties for guiding spc screening to patients, and they could be suspected of over - prescribing by their patients . Over 45% of the oncologists stated that a patient s lack of knowledge concerning spcs or spc screening was also among the significant barriers to appropriate spc screening practice . Previous studies have shown that patients do not undergo spc screening due to a lack of information, and inadequate knowledge about spc screening was associated with lower adherence to cancer screening practice . The results of the current study seem to support previous findings, because medical dialogue is the many oncologists were willing to provide consultation about spc screening when their patients prompted the issue . Several recommendations are suggested in accordance with the above barriers . From a perspective of the system, the development of an internal connection for spc screening within the cancer center was suggested . Institution - based shared care model was preferred due to the facilitated information that is shared through electronic medical records, easy access and communication with primary care physicians if necessary, and patient s preference for being treated at the same institution where they undergo cancer treatment . By contrast, communication with physicians at local primary care clinics is more complicated due to technological difficulties and legal problems . From the physician s perspective, the development of primary cancerspecific programs or guidelines would enable oncologists to be more confident in guiding appropriate screening for spcs . Finally, patient education about the need for spc screening after primary treatment would encourage patients, facilitate discussion, and increase acceptance regarding the appropriate spc screening . One significant limitation of our study was its specificity to korea, where healthcare is provided in a fee - for - service system with universal health insurance coverage with the existence of a national cancer screening program . Therefore, the results cannot be generalized to other countries with different healthcare systems . In summary, our study revealed that spcs are a common experience for oncologists, a finding that is embarrassing and difficult to manage effectively . Current practice varies; however, most oncologists that were surveyed agreed to the need for a proactive provision of information regarding spcs . Many barriers were identified, including a short consultation time and the lack of established guidelines, oncologists own knowledge, patients knowledge, and systematic programs . A cooperative spc screening program within a cancer center that is managed by physicians other than the oncologists was the most preferred option . Other recommendations included the development of specific screening programs or guidelines according to the type of primary cancer and the development of a systematic connection for spc screening within the hospital or with a national cancer screening program to educate oncologists, as well as patients about spc screening . Given the variations in the current practice and the lack of consensus, further studies are warranted to develop the optimal clinical strategy to provide spc screening for cancer survivors.
|
Excess or prolonged inflammation can cause harm even though it is essentially beneficial to maintaining homeostasis . Systemic inflammatory response syndrome can result in multiple organ failure, which is associated with a high death rate . Polymorphonuclear (pmn) cells form an essential part of early induced innate immunity . During the acute phase of inflammation, pmn cells are recruited to the site of inflammation and have been reported to be important in triggering organ damage after shock and resuscitation . Toll - like receptors (tlrs) are also key components of the innate immune system . Ten human tlrs have been discovered so far, the targets of which are predominantly pathogen - associated molecular patterns . They are involved in multiple steps in the inflammatory reaction, eliminating invading pathogens and coordinating systemic defenses . Tlr-1, -2, -4, -5, and -6 are expressed on the cell surface, where their major role is the recognition of bacterial products . Tlr-3, -7, -8, and -9 are confined to intracellular compartments, where they specialize in viral detection or the recognition of nucleic acids . Chemokine receptor expression and function in neutrophils are regulated by tlr activation, which presumably facilitates recruitment and localization of these cells to sites of infection and inflammation . Fluid resuscitation is essential in urgent situations such as trauma, sepsis, and hypovolemia . Prompt fluid resuscitation administered to patients with such conditions can improve survival by shortening the duration of the shock period and decreasing the inflammatory response . For resuscitation, clinical resuscitation with lactated ringer s solution activates neutrophils; shed blood and hypertonic saline (hts) do not . Hts effectively raises blood pressure, improves microcirculatory blood flow, and protects tissues against reperfusion injury . Furthermore, the immunomodulatory effect of hts has also been demonstrated in many studies . In our study, we investigated the immunomodulatory effect of hts on pmn cells by evaluating the changes in tlr-4 receptors and proinflammatory cytokines . The study protocol and the written informed consent form were reviewed and approved by korea university guro hospital (institutional review board no . A sterile processing environment was maintained with a clean bench, and 5 ml of each collected whole blood sample was separated in aliquots into 15-ml test tubes with 5 ml polymorphprep (axis - shield, oslo, norway), followed by centrifugation for approximately 35 minutes at 500 g. among the resulting cell layers after centrifugation, the pmn cell layer, located between the monocyte and red blood cell layers, was collected with a pipette . To remove the red blood cells remaining in the collected pmn cell sample, the sample was incubated with a 0.2% saline solution for 30 seconds, after which a 1.8% saline solution was added to create 0.9% normal osmotic pressure . The samples were centrifuged at 450 g for 10 minutes, followed by 2 washes with phosphate - buffered saline . The isolated pmn cells were incubated in roswell park memorial institute tissue culture medium 1640 containing 10% fetal bovine serum, 1% penicillin - streptomycin, 10 mm 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid, and 0.005% 2-mercaptoethanol . We confirmed cell densities of 1 10 cells / ml and viabilities> 95% using trypan blue dye . Isolated pmns were plated at a density of 1 10 cells / ml in 6-well flat - bottomed culture plates and were stimulated with 1 g / ml lipopolysaccharide (lps) (sigma - aldrich, st louis, missouri) or 1 m n - formyl - methionyl - leucyl - phenylalanine (fmlp) (sigma aldrich). Lps is an endotoxin found in the outer membrane of gram - negative bacteria and fmlp is a synthetic analogue of a chemotactic peptide derived from a variety of bacteria . The stimulated pmn cells were cultured in the presence or absence of hts at 10 mmol / l, 20 mmol / l, and 40 mmol / l above isotonicity . This resulted in sodium concentrations of 150 mmol / l, 160 mmol / l, and 180 mmol / l, respectively, which was measured by a gem premier 3000 blood gas analyzer (instrumentation laboratory, lexington, massachusetts). After 2 hours of incubation, total rna was extracted from cells using an rneasy mini kit (qiagen, hilden, germany) and treated with dnase (turbo dna - free kit; invitrogen, carlsbad, california). An amount of 200 ng total rna from each sample was reverse transcribed into complementary dna using a high - capacity complementary dna reverse transcription kit . Expression of tlr-4, interleukin (il)-1, and tumor necrosis factor- (tnf-) mrna was analyzed by qrt - pcr . The qrt - pcr reactions were performed using the abi 7300 (applied biosystems, foster city, california), and amplifications were done using the taqman gene expression master mix (applied biosystems, foster city, california) with the following taqman probes (gene name, reference sequence number): gapdh, hs99999905_m1; tlr4, hs00152939_m1; il1b, hs00174097_m1; and tnf, hs01113624_g1 . The thermal cycling conditions were 50c for 2 minutes followed by an initial denaturation step at 95c for 10 minutes, 45 cycles at 95c for 15 seconds, and 60c for 1 minute . The cells were washed with ice - cold phosphate - buffered saline, then resuspended in flow cytometry staining buffer (ebioscience, san diego, california) and blocked for 20 minutes on ice . The cells were then stained with 5 l (2 g) phycoerythrin - conjugated anti tlr-4 monoclonal antibody (clone hta125; ebioscience) or 5 l (0.5 g) isotype control (pe - conjugated mouse igg2a k; ebioscience) per test in the dark for 1 hour on ice following the manufacturer s recommended protocol . After washing, the stained cells were resuspended in 100 l staining buffer and analyzed by flow cytometry using cytomics fc 500 (beckman coulter, brea, california) and cxp software (beckman coulter). In each case one - way anova and the post hoc test were used for statistical analysis with the spss software package (version 13.0, ibm - spss inc, chicago, illinois). A p value the study protocol and the written informed consent form were reviewed and approved by korea university guro hospital (institutional review board no . A sterile processing environment was maintained with a clean bench, and 5 ml of each collected whole blood sample was separated in aliquots into 15-ml test tubes with 5 ml polymorphprep (axis - shield, oslo, norway), followed by centrifugation for approximately 35 minutes at 500 g. among the resulting cell layers after centrifugation, the pmn cell layer, located between the monocyte and red blood cell layers, was collected with a pipette . To remove the red blood cells remaining in the collected pmn cell sample, the sample was incubated with a 0.2% saline solution for 30 seconds, after which a 1.8% saline solution was added to create 0.9% normal osmotic pressure . The samples were centrifuged at 450 g for 10 minutes, followed by 2 washes with phosphate - buffered saline . The isolated pmn cells were incubated in roswell park memorial institute tissue culture medium 1640 containing 10% fetal bovine serum, 1% penicillin - streptomycin, 10 mm 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid, and 0.005% 2-mercaptoethanol . We confirmed cell densities of 1 10 cells / ml and viabilities> 95% using trypan blue dye . Isolated pmns were plated at a density of 1 10 cells / ml in 6-well flat - bottomed culture plates and were stimulated with 1 g / ml lipopolysaccharide (lps) (sigma - aldrich, st louis, missouri) or 1 m n - formyl - methionyl - leucyl - phenylalanine (fmlp) (sigma aldrich). Lps is an endotoxin found in the outer membrane of gram - negative bacteria and fmlp is a synthetic analogue of a chemotactic peptide derived from a variety of bacteria . The stimulated pmn cells were cultured in the presence or absence of hts at 10 mmol / l, 20 mmol / l, and 40 mmol / l above isotonicity . This resulted in sodium concentrations of 150 mmol / l, 160 mmol / l, and 180 mmol / l, respectively, which was measured by a gem premier 3000 blood gas analyzer (instrumentation laboratory, lexington, massachusetts). After 2 hours of incubation, total rna was extracted from cells using an rneasy mini kit (qiagen, hilden, germany) and treated with dnase (turbo dna - free kit; invitrogen, carlsbad, california). An amount of 200 ng total rna from each sample was reverse transcribed into complementary dna using a high - capacity complementary dna reverse transcription kit . Expression of tlr-4, interleukin (il)-1, and tumor necrosis factor- (tnf-) mrna was analyzed by qrt - pcr . The qrt - pcr reactions were performed using the abi 7300 (applied biosystems, foster city, california), and amplifications were done using the taqman gene expression master mix (applied biosystems, foster city, california) with the following taqman probes (gene name, reference sequence number): gapdh, hs99999905_m1; tlr4, hs00152939_m1; il1b, hs00174097_m1; and tnf, hs01113624_g1 . The thermal cycling conditions were 50c for 2 minutes followed by an initial denaturation step at 95c for 10 minutes, 45 cycles at 95c for 15 seconds, and 60c for 1 minute . The cells were washed with ice - cold phosphate - buffered saline, then resuspended in flow cytometry staining buffer (ebioscience, san diego, california) and blocked for 20 minutes on ice . The cells were then stained with 5 l (2 g) phycoerythrin - conjugated anti tlr-4 monoclonal antibody (clone hta125; ebioscience) or 5 l (0.5 g) isotype control (pe - conjugated mouse igg2a k; ebioscience) per test in the dark for 1 hour on ice following the manufacturer s recommended protocol . After washing, the stained cells were resuspended in 100 l staining buffer and analyzed by flow cytometry using cytomics fc 500 (beckman coulter, brea, california) and cxp software (beckman coulter). In each case, 100,000 cells were acquired . One - way anova and the post hoc test were used for statistical analysis with the spss software package (version 13.0, ibm - spss inc, chicago, illinois). A p value <0.05 was considered to indicate statistically significant differences . As shown in figure 1, tlr-4 mrna expression was clearly induced upon stimulation with lps . The mean (sd) tlr4/gapdh - relative gene expression was 2.06 (0.40) in the only lps - stimulated pmn cells . Hts mildly increased the mean (sd) tlr4/gapdh - relative gene expression to 2.36 (0.54) at 10 mmol / l above isotonicity, but without a statistically significant difference . Hts decreased the mean (sd) tlr4/gapdh - relative gene expression to 1.75 (0.27) at 20 mmol / l above isotonicity and 1.25 (0.22) at 40 mmol / l above isotonicity . One - way anova showed the difference in the mean values among 5 groups (p <0.001). The tlr4/gapdh - relative gene expression at 40 mmol above isotonicity was significantly different from that of only lps - stimulated pmn cells and 10 mmol / l above isotonicity (p <0.05) (figure 1a). On the other hand, the mean (sd) tlr4/gapdh - relative gene expression was decreased in pmn cells stimulated with fmlp (0.99 [0.52]). The mean (sd) tlr4/gapdh - relative gene expression was 1.00 (0.60) at 10 mmol / l above isotonicity, 0.89 (0.45) at 20 mmol / l above isotonicity, and 0.74 (0.26) at 40 flow cytometry was used to examine the changes in cell surface tlr-4 protein levels on lps - stimulated pmn cells . The addition of hts decreased the proportion of tlr4-positive cells in lps - stimulated pmn cells . The mean (sd) percentage of cells stained with anti tlr-4 monoclonal antibody was 22.2% (3.8%) in the control group, 41.3% (6.0%) in the lps - stimulated group, 25.7% (5.9%) at 10 mmol / l above isotonicity, 22.9% (4.5%) at 20 mmol / l above isotonicity, and 22.7% (6.1%) at 40 mmol / l above isotonicity (figure 2). Mrna expression decreased to 1.09 0.31 at 20 mmol / l above isotonicity and 0.93 0.55 at 40 mmol / l above isotonicity (p<0.05). Mrna expression increased to 2.66 1.54 at 10mmol / l above isotonicity, however, without statistical difference . On the other hand, the tnf-/gapdh mrna expression was 1.41 0.24 at 10 mmol / l above isotonicity, 1.38 0.25 at 20 as shown in figure 1, tlr-4 mrna expression was clearly induced upon stimulation with lps . The mean (sd) tlr4/gapdh - relative gene expression was 2.06 (0.40) in the only lps - stimulated pmn cells . Hts mildly increased the mean (sd) tlr4/gapdh - relative gene expression to 2.36 (0.54) at 10 mmol / l above isotonicity, but without a statistically significant difference . Hts decreased the mean (sd) tlr4/gapdh - relative gene expression to 1.75 (0.27) at 20 mmol / l above isotonicity and 1.25 (0.22) at 40 mmol / l above isotonicity . One - way anova showed the difference in the mean values among 5 groups (p <0.001). The tlr4/gapdh - relative gene expression at 40 mmol above isotonicity was significantly different from that of only lps - stimulated pmn cells and 10 mmol / l above isotonicity (p <0.05) (figure 1a). On the other hand, the mean (sd) tlr4/gapdh - relative gene expression was decreased in pmn cells stimulated with fmlp (0.99 [0.52]). The mean (sd) tlr4/gapdh - relative gene expression was 1.00 (0.60) at 10 mmol / l above isotonicity, 0.89 (0.45) at 20 mmol / l above isotonicity, and 0.74 (0.26) at 40 flow cytometry was used to examine the changes in cell surface tlr-4 protein levels on lps - stimulated pmn cells . The addition of hts decreased the proportion of tlr4-positive cells in lps - stimulated pmn cells . The mean (sd) percentage of cells stained with anti tlr-4 monoclonal antibody was 22.2% (3.8%) in the control group, 41.3% (6.0%) in the lps - stimulated group, 25.7% (5.9%) at 10 mmol / l above isotonicity, 22.9% (4.5%) at 20 mmol / l above isotonicity, and 22.7% (6.1%) at 40 mmol / l above isotonicity (figure 2). The il-1 /gapdh mrna expression decreased to 1.09 0.31 at 20 mmol / l above isotonicity and 0.93 0.55 at 40 mmol / l above isotonicity (p<0.05). Mrna expression increased to 2.66 1.54 at 10mmol / l above isotonicity, however, without statistical difference . On the other hand, the tnf-/gapdh mrna expression was 1.41 0.24 at 10 mmol / l above isotonicity, 1.38 0.25 at 20 mmol / l above isotonicity and 1.42 0.24 at 40 mmol / l above isotonicity (figure 3). Isotonic crystalloid has been commonly used in fluid resuscitation in shock due to trauma or sepsis . However, it has unavoidable limitations such as an inflammatory response caused by administration of a large volume . In contrast, hts has been reported to be a fluid therapy method that confers many advantages, including a rapid increase in plasma that can be achieved by a relatively small resuscitation volume . Although there is still controversy regarding the feasibility of initial treatment using hts, several studies have been performed on the effectiveness of small volume resuscitation, which is defined as a rapid infusion of hts in combination with dextran or hetastarch . Hts has also been studied experimentally for the treatment of sepsis and has been reported to have some promising beneficial effects . From a clinical perspective, hannemann et al conducted the first study on the effect of small volume resuscitation in severe sepsis . Oliveira et al reported that an hts / dextran solution improved cardiovascular performance and resuscitated patients with severe sepsis through a volume effect, but may also directly improve cardiac function . Blunt t - cell suppression is associated with hts treatment in both in vivo and in vitro models . According to their study, hts increases the expression of il-2 through a mechanism that involves the release of cellular adenosine triphosphate and activation of t cell receptor . We investigated the immunomodulatory effect of hts on pmn cells by evaluating the change in tlr-4 and associated proinflammatory cytokines . Lps is well known to be a potent stimulator of cytokine synthesis and tlr-4 is the membrane receptor that can recognize lps . Fmlp binds g - protein receptor on cell surfaces and causes the generation of superoxide anions and stimulates the production of chemokines . However, 1 report showed that the tnf- and il-1 mrna expression induced by fmlp is not different from that induced by lps in human peripheral blood monocytes . So we investigated if tlr-4 expression on pmn cells can be influenced by fmlp stimulation . As shown in figure 1, the level of tlr-4 mrna expression decreased after stimulation with fmlp . Varying the osmolarity did not affect the tlr-4 mrna expression . In light of all this, we concluded that fmlp does not involve the tlr-4 signaling pathway and hts has no association with fmlp - stimulated pmn cells . The increased tlr-4 mrna expression with lps stimulation was suppressed after adding hts, according to the qrt - pcr results . From the flow cytometry results, the number of cells expressing tlr-4 on the membrane surface also decreased after adding hts . The hts changed the il-1 mrna expression on lps - stimulated pmn cells similar to the pattern of change in tlr-4 . We believe that hts has an immunomodulatory effect on pmn cells through the tlr-4 pathway . In addition, hts appears to have more influence on the il1 - associated intracellular signaling pathway than the tnf-associated intracellular signaling pathway . Hatanaka et al also reported that sodium chloride does not significantly affect the production of tnf- and inhibits the production of il-1 in lps - stimulated monocytes by the enzyme - linked immunosorbent assay . Gundersen et al pointed out that the question of clinical relevance for hts exists because its reported in vitro effects have been difficult to demonstrate in vivo . In vitro studies mild hyperosmolarity increased the tlr-4 mrna expression in qrt - pcr in this study, although the result was not statistically significant, and also showed that a high osmolarity has a greater immunosuppressive effect in qrt - pcr . Our study was done in only pmn cells and did not include interaction with other factors such as the endothelium . The numbers of measured immune parameters were limited and pmn cells were collected only from healthy donors . Further research should be carried out to investigate the effect of hts on intracellular signaling pathways . In addition, the result of our study was descriptive and did not provide any details of how hts modulates tlr-4 expression . Hts has an immunomodulatory effect on pmn cells through the tlr-4 pathway, and the il1 - associated pathway is influenced more by hts than is the tnf-associated pathway . The authors have indicated that they have no conflicts of interest regarding the content of this article.
|
Closure of large soft tissue defects following ablative surgery or trauma, constitutes a substantial and common reconstructive challenge . Immediate primary suture closure of wounds is commonly the optimal solution because of its simplicity and acceptable outcome, yet it may be impeded by high - tension closure . The alternative application of skin grafts, flaps, or tissue expansion is often associated with relatively more complex surgical procedures, significant morbidity and extended hospitalization and recovery periods . Previous reports of external tissue expanders are inherently limited by the size of the defects that can be managed and the need for staged surgical procedures for the closure of large wounds . The topclosure tension - relief system (trs) is an innovative method that enables the employment of both mechanisms of stress relaxation and mechanical creep for skin stretching . Its use has been previously reported to enable the primary closure of medium to large soft tissue defects . The system is comprised of 2 malleable polymer attachment plates (aps) that are fixed to the skin by adhesive or regular skin staples or sutures through a large area of adherence . The aps are placed a distance from the wound margins, and are pulled together manually by an interconnecting flexible approximation strap (as) for incremental advancement of wound edges, through a lock / release ratchet mechanism . The aps may also serve as a tension - relief platform for tension sutures when high tension is indicated, to avoid damage to the underlying skin, such as in high - tension closure of large gaps and inelastic skin . This enables application of acute, intra - operative cycling of stress relaxation by an ultra - high force (up to 5060 n). Immediate primary wound closure is achieved, with infliction of 10 less stress to the skin, compared with conventional suturing (table 1). Delayed primary closure can be achieved using trs, through gradual pre- and post - operative approximation of the skin by mechanical creep, thus serving as an external tissue expander . Multiple sets of trs can be applied perpendicular to the wound's longitudinal axis to accommodate selective local vectors of tension along the wound margins, thus fitting a wide range of wound sizes . Shear stress inflicted at suture tearing force and at break down force of the topclosure trs we present the implementation of stress relaxation in extreme range of stress through the tension - relief system concept for immediate primary closure of large to huge skin defects, where suture closure would not be considered feasible . A 60-year - old schizophrenic male patient was admitted to the hospital following a fall resulting in head injury . On physical examination, an incidental finding revealed a large ulcerated soft - tissue tumor on his right flank (figure 1a). Following discharge, the patient was readmitted for elective resection of the tumor . With the patient under general anesthesia and lying in a lateral position the tumor was resected including the involved superficial muscular fascia, resulting in a 15 25 cm soft tissue defect (figure 1b). A closure trial with the topclosure trs (ivt medical ltd . Three pairs of aps (topclosure, 8 mm sets) were attached by adhesive to the skin, 1.5 cm away from the wound edges, and secured by skin staples (weck visistat 35w, 6.5 4.7 mm, teleflex medical, nc, usa). A tension suture (ethilon 1 kp-3 conv, 90 mm 3/8c, johnson & johnson international) was inserted for each ap, first through one ap, then deep into the subcutaneous tissue across the tissue gap, and then out through the contralateral ap on the other side of the skin defect . The suture was then passed through the designated holes in the front part of the aps and over to the first plate . Multiple alternating pull (30 s) and release (12 min) cycles of stress relaxation were performed over a period of about 20 min . Intermittent absorbable subcutaneous sutures (vicril 0, johnson & johnson international) were applied concurrent with the pull on the tension sutures . The skin edges were gradually approximated without undermining until complete primary closure, within less than 30 min (figure 1c). Histological findings revealed eroded basal cell carcinoma invading the subcutaneous fat and the underlying skeletal muscle . The tumor was completely excised . Reconstruction of a huge soft tissue defect in right flank (representative case 1) by the tension - relief system . B. ablative tumor resection resulted in a defect of 15 25 cm . D. post - operative day 1, a small, limited dehiscence . Wound edges are secured by tension sutures, avoiding complete dehiscence of surgical wound . E. six months following surgery, uneventful recovery, with minor widening and depression of the scar and additional skin tumor to be excised . The post - operative course was complicated by minor dehiscence of the wound edges due to both patient non - compliance and initial inadequate application of trs sets and tension sutures, in order to properly accommodate the high - tension closure of the wound (figure 1d). Two extra sets of trs and the application of 2 sets of tension sutures per trs set would have been required in order to better secure high tension closure and to avoid dehiscence . It should be noted that there was no ischemia or necrosis of the wound edges in spite of the high - tension closure . The topclosure system, sutures and staples were removed in stages until 3 weeks following the surgery . Final complete closure of the wound with minimally depressed scar is demonstrated in figure 1e . A 35-year - old male patient was admitted for a wide excision of malignant melanoma of the right scapular region, following prior excisional biopsy confirmed histologically as an ulcerated nodular malignant melanoma incompactly excised at its margins . A wide excision was performed under general anesthesia, resulting in a 7 11.5 cm soft tissue defect that conventionally would have been closed by a split thickness skin graft (figure 2a). An immediate primary closure of the defect was planned, applying 3 pairs of aps (topclosure, 8 mm sets) that were attached to the skin 2 cm away from the wound edges by adhesive, and secured by skin staples . A tension suture was inserted through both plates as described above, to advance the deep subcutaneous tissue on both sides of the wound . There was repeated cycling of stress relaxation, (applying tension for 30 s and relaxation for 12 min), alternating between the trs sets . The entire wound margins could be approximated within 35 min, bringing the skin and subcutaneous tissue, en bloc, into tight contact with practically no dead space, following placement of deep subcuticular vicryl 0 sutures and tightening of the tension sutures . Tension sutures were tightened and locked on top of the aps, and ass were inserted for additional minimal approximation of skin and secured by the lock / release mechanism . Trs were retained for up to 4 weeks to accommodate for the high tension closure, thus securing complete closure of the wound . The melanoma was fully resected with no immediate post - operative complications (figure 2d), 18 months post operation a mild widening of the scar was observed (patient being an amateur bodybuilder), with no apparent local or distant recurrences (figure 2e). B. tumor ablation resulted in a defect of 7 11.5 cm . D. six weeks following surgery, acceptable aesthetic result, mild, partial hypertrophic scar . A 41-year - old woman presented with recurrent low to moderate - grade spindle cell sarcoma of the supraclavicular area, extending to the lateral neck, measuring 25 18 cm (figure 1a, b). The patient underwent a resection of the tumor, resulting in a defect reaching a width of 26 cm (figure 1c). Six pairs of aps (topclosure, 8 mm sets) were attached by adhesive to the skin, 2 cm away from the wound margins, and reinforced by skin staples . A pair of tension sutures were inserted through each trs set, connecting both plates, as described above, to advance the deep subcutaneous tissue on both sides of the wound . Repeated cycling of stress relaxation were applied, initiating at the highest tension region, at the center of the wound (inducing tension for 30 s. and relaxation for 12 min), and alternating between the trs sets during the closure process . The entire wound margins could be approximated, bringing the skin and subcutaneous tissue, en bloc, into tight contact with practically no dead space, following placement of deep subcuticular and tension sutures . Tension sutures were tightened and locked on top of the aps, and ass were inserted for additional minimal tightening of the skin and were then secured by the lock / release mechanism . The huge defect was primarily closed in just over 2 hours, under ultra - high tension (figure 3d). The skin was not undermined, thus maintaining good blood supply to the wound margins and, as dead space was minimal, a drain was not applied to the wound . Topclosure, tension sutures and staples were retained, in order to secure the wound closure for up to 23 days, achieving full closure of the wound . Complete tissue viability along the entire wound edges was observed during the post - operative period . Additionally, there was early patient ambulation, minimal local morbidity, elimination of donor site morbidity, acceptable cosmesis, with late limitation in range of lt . Shoulder motion in abduction that was improved by physical therapy, all preferable to the alternative conventional skin graft or free flap closure techniques (figure 3d, e). Reconstruction of a huge soft tissue defect in the right supraclavicular region, extending to the base of the neck by the topclosure tension - relief system (representative case 3). A. large recurrent tumor of the right cervical / supraclavicular region, 18 25 cm . B. coronal mri section demonstrating the extent of tumor . C. twenty - six centimeter wide defect following tumor ablation . D. immediate, direct primary closure was achieved in just over 2 hours . E. post - operative day 23, uneventful recovery . F. ten months following surgery, slight widening of scar the topclosure was approved for clinical use in compliance with the clinical trial that was approved by the institutional review board, research no . Patient's informed consent was given prior to all surgical procedures performed is this study . A summary of the patient's details and comparison between surgical procedures and follow - ups is presented in table 2 . Clinical and pathological characteristics of cases presented, intra and post - operative wound management and results there are 2 main mechanisms for skin stretching that may assist in primary wound closure: stress relaxation and mechanical creep . Mechanical creep is the phenomenon where skin will stretch and elongate incrementally with time as long as force is applied . This can be comprehended and visualized by the physiological process of skin stretching during pregnancy or under the impact of the forces created by extreme body weight gain or inflation of tissue expanders leading to steady skin expansion . If the skin is acutely stretched to a constant distance, tension will rise sharply and will decrease with time in a state of gradual relaxation . If stress relaxation is repeatedly applied over time, a deformation of the skin will result in permanent elongation . These biomechanical mechanisms allow skin to stretch beyond the conventional suturing limits of its inherent extensibility and is made possible by alteration of its basic structural components . Under external tension, the interrelated networks of collagen, elastin, and ground substance in the extracellular matrix of the tissue deform, inflicting tissue elongation, allowing skin stretching to a limited extent . These mechanisms assist primary suture closure of wounds of minor to moderate skin defects only . In vitro laboratory work strain hysteresis pattern curve is limited in its clinical application by the concurrent ischemia and necrosis that results from the application of excessive tension on sutures approximating wound edges, leading to wound closure failure and dehiscence of suture line . The resulting strain that could be achieved so far by stress relaxation through conventional suturing techniques is thus limited in its clinical application to few percent only . External tissue expansion was developed over 20 years ago with the intention to better harness the viscoelastic properties of the skin by fixing the device to the skin externally and applying mechanical creep mode of stretching in order to gain extended length, thus overcoming some of the major shortcomings of the internal tissue expansion techniques . All these devices have an inherent limitations: they adhere to the skin edges at a relatively small area of contact thus the size of the gap that can be managed is relatively small, their adherence to the skin is close to the vulnerable wound edges, all of them can be applied invasively only and their ability to stretch the skin is mainly by mechanical creep . While serving as a tension relief platform, the topclosure trs was shown in these cases to allow the clinical application of ultra - high stress by tension sutures to the skin without inflicting ischemia, necrosis and wound failure . Trs has provided the phenomenal ability of stretching the skin for immediate or delayed primary closure of large skin defects as was previously reported, and of an even huge skin gaps being immediately, primarily closed, as now further demonstrated in the current case series . There are notable advantages for applying the topclosure trs: the ability to apply pre- and post - operative mechanical creep as through external skin stretching and acute intraoperative stress relaxation as by trs, for both low and high tension wound closure, respectively . Trs downgrades the surgical complexity, operating time is reduced and hospital stay can be substantially shortened . The resulted skin coverage quality in primary wound closure is by far superior to skin grafting . Undermining of the skin edges and adjacent tissues can be avoided maintaining blood supply to the wound margins and securing skin edges viability even under extreme tension . Avoidance of undermining eliminates dead space, seroma and hematoma accumulation and the need for drainage and reduces the risk of infection . Skin can be further approximated following stress relaxation by advancing the as as a bedside procedure by mechanical creep, some cases under local anesthesia . When serving as a topical tension - relief platform for tension sutures, it alleviates the typical tearing and scarring, traditionally inflicted by tension sutures . The topclosure trs can be applied for a wide scope of indications in a wide range of global standards of surgical settings . The sample of cases presented above demonstrates the extreme stretching capacity inherent in the viscoelastic properties of the skin that can be utilized by stress relaxation coupled by the trs . It is important to note that the technique presented in this case series especially in cases 1 and 3 are by far an extreme manifestation of the application of stress relaxation in clinical use . The authors indicate that the inexperienced surgeon could stop wound closure at any time, dress the wound, and further apply the topclosure trs by mechanical creep for delayed primary closure at a later stage . This novel technology changes the concept of wound closure with its ability to reduce the applied stress to the skin during the process of wound closure by up to 5 orders of magnitudes, thus safely enabling the clinical application of both stress relaxation and mechanical creep . It simplifies the surgical technique by reducing ischemia during the process of wound closure to facilitate immediate primary wound closure in a relatively short time . This could not be achieved so far through the conventional suturing methods that have been applied in the same conceptual way for ages . To our knowledge, this is the first time that such large defects have been successfully closed by immediate primary closure, within a very short time, with very minor complications . This case series report, together with our previous reported findings, demonstrate the vast potential harnessed by the viscoelastic properties of the skin for stretching to the extreme limits of its extensibility by stress relaxation . This is made clinically possible through coupling with the unique trs, to form a new wound closure concept that has not been previously conceivable using conventional suturing methods due to the inherent ischemia and necrosis inflicted by suture closure attempt of high - tension wounds . Further laboratory and clinical investigation is warranted in order to better comprehend the viscoelastic properties of the skin: stress strain properties, mechanism of stress relaxation and skin preconditioning under these extreme conditions and when coupling tension sutures with the topclosure trs, for further optimization of wound closure . The prospective is quite positive for global implementation of this new / old concept in a wide range of surgical applications.
|
Renal tubular potassium (k) channels are involved in a wide spectrum of the transepithelial transport in the kidney [1, 2]. They contribute to the formation of the cell - negative potential, which serves as a driving force for the electrogenic passive transport of solutes, such as apical na entries through the na - glucose cotransporter (sglt) in proximal tubule cells and the epithelial na channel (enac) in the principal cells of cortical collecting duct (ccd) [1, 2]. The apical k channels in the principal cells of ccd are the major pathway of k secretion [1, 2]. The renal tubular k channels also play important roles in k recycling for the apical na - k-2cl cotransporter (nkcc) in the thick ascending limb (tal) and the basolateral na - k atpase along the nephron [1, 2]. In addition to the physiological importance, the renal tubular k channels seem to be involved in the pathogenesis of renal cell injury or renal dysfunction . Some investigators reported that the blockade of k channel activity ameliorated hypoxic renal cell injury [35]. Others reported that the decrease in k channel activity exacerbated renal ischemia / reperfusion injury [6, 7] or endotoxemic renal failure . The cytokine family comprises a variety of multifunctional proteins, which play pivotal roles in immune modulation and inflammation [9, 10]. The nervous system [11, 12], cardiovascular system, respiratory system, gastrointestinal tracts, and kidney are also targets of cytokines . It is widely accepted that cytokines are secreted mainly by immune cells in response to microbial infection . However, other cell types are also capable of secreting cytokines [9, 10]. The kidney proximal tubule cells produce proinflammatory cytokines in response to lipopolysaccharide (lps) or albumin . It is thought that the proximal tubule cells function as the proinflammatory cells or immune responders, which play roles in the pathogenesis of renal dysfunction [19, 20]. The tal [21, 22] and collecting ducts are also the sources of proinflammatory cytokines . Furthermore, renal tubule cells express specific receptors which mediate effects of individual cytokines [2426]. Several proinflammatory cytokines, such as interferon- (ifn-), interleukin-1 (il-1), and tumor necrosis factor- (tnf-), have been reported to affect na reabsorption in renal tubular epithelia [2734]. Considering that the driving force of the transepithelial na reabsorption is dependent on the k channel activity, as well as na - k - atpase [1, 2], it is important to know whether cytokines would affect the k channels . These proinflammatory cytokines were also reported to cause cell injury in various organs, including the kidney . Since the alterations in k channel activity were involved in renal cell injury as described above, it is possible that the cytotoxic effects of proinflammatory cytokines would partly be mediated by their action on renal k channels . To date, however, information is restricted, regarding the effects of cytokines on k channel activity in renal tubule epithelia . This is in sharp contrast to the accumulating evidence for the effects of cytokines on neuronal ion channels . In this review, we discuss the effects of proinflammatory cytokines on renal tubular k channels and the relevance of such effects to renal cell damage . In the kidney, the proximal tubule reabsorbs about 70% of na filtered in glomeruli [1, 2]. The basolateral k channels provide the driving force for the apical na entry by forming the cell - negative potential and serving as the k recycling pathway coupled with the na - k - atpase activity [1, 2]. The effects of cytokines on the k channels in human proximal tubule cells have recently been reported, using the patch - clamp technique [3638]. In cultured human proximal tubule cells (rptecs) derived from the normal kidney, an inwardly rectifying k channel with an inward conductance of 40 ps is predominantly observed under the control condition . Although the molecular characteristic of this k channel is still unknown, electrophysiological studies revealed various functional properties . The 40 ps k channel possesses a relatively high open probability (0.8 on average) with no voltage dependence and contributes to the formation of cell - negative potential . Furthermore, the activity of this k channel is regulated by intracellular atp, ph, and protein phosphorylation processes mediated by protein kinase a (pka) and protein kinase c (pkc) [38, 41], all of which are consistent with the properties of the basolateral k channels in animal proximal tubule cells [1, 2, 42]. It was reported that two proinflammatory cytokines, ifn- [36, 37] and il-1 [36, 38], affected the activity of the 40 ps k channel in rptecs . Ifn- possessed a time - dependent biphasic effect on the 40 ps k channel: a delayed suppressive effect and an acute stimulatory one [36, 37]. Both effects were blocked by inhibitors of janus kinase (jak) which was closely related to the ifn- receptor, suggesting that the effects of ifn- would be receptor specific . The delayed suppressive effect of ifn- on channel activity was mediated, at least in part, by overproduction of no in rptecs [36, 37]. It was reported that no stimulated activity of the 40 ps k channel in rptecs at low concentrations (micromolar level) through activation of the cgmp / protein kinase g (pkg) pathway, whereas it suppressed channel activity at higher concentrations (millimolar level). The mechanism for the delayed suppressive effect of ifn- is depicted in figure 1 . When rptecs were treated with ifn- for 24 h, expression of inducible no synthase (inos) was greatly enhanced, producing a large amount of no . This peroxynitrite would suppress the k channel activity by oxidating or nitrosylating the channel and/or its related proteins [37, 40]. Thus, the responses of the channels to no modulators were reversed in ifn--treated cells, compared to the control cells [36, 37]. A nos inhibitor, l - name, stimulated channel activity and a no donor, l - arginine, suppressed channel activity in ifn--treated cells, whereas l - name suppressed channel activity and l - arginine stimulated channel activity in control cells [36, 37]. With regard to the acute stimulatory effect of ifn-, although the activity of the 40 ps k channel was upregulated by pka- and pkg - mediated phosphorylation processes [39, 43], inhibitors of these protein kinases failed to block the stimulatory effect of ifn- . Phosphatidylinositol-3-kinase (pi3 k) is one of the molecules that mediate the ifn- signaling . However, pi3 k inhibitors were also ineffective in blocking the ifn--induced activation of the channel . Il-1 also acutely affected the activity of the 40 ps k channel in rptecs and the mode of action was suppressive [36, 38]. The effect of il-1 was highly likely receptor mediated, since the il-1 receptor antagonist (il-1ra) completely abolished it . With regard to the existence of il-1 receptors in the kidney, it was reported that the type i il-1 receptors were widely distributed in renal tubules, as well as glomeruli . In addition to il-1ra, the acute suppressive effect of il-1 was blocked by a pkc inhibitor and an inhibitor of phospholipase c . These observations strongly suggested that the effect of il-1 was dependent on the pkc pathway (figure 2). In support of this notion, pkc directly suppressed the activity of the 40 ps k channel in inside - out patches, and fluorescent ca imaging using fura 2 revealed that il-1 increased intracellular ca, which was prerequisite for the activation of conventional pkc . Furthermore, the pkc - dependent effects of il-1 were also observed in other ion channels, including the hippocampal ca channel, the middle ear na channel, the intestinal cl channel, and the k channel in the cultured mouse ccd cell line, m1 cells (our unpublished observation). Although several investigators reported that il-1 increased inos expression in some tissues, such effect was not observed in rptecs or the nonpassaged primary culture of human proximal tubule cells . Thus, il-1 did not possess the no - dependent delayed suppressive effect on the 40 ps k channel, which was demonstrated by ifn-. Huang et al . Have recently reported that transforming growth factor-1 (tgf-1) upregulated the kca3.1 channel in immortalized human proximal tubule cells, hk2 . According to their report, the whole - cell current sensitive to tram34, an inhibitor of kca3.1, was profoundly increased after treatment of hk2 cells with tgf-1 for 48 h, while the tram34-sensitive current was not observed in control cells . Kca3.1 is an intermediate conductance ca - activated k channel and widely distributed throughout the body, excepting most of excitable tissues . Much more attention has been paid to this ca - activated k channel because of its pathological relevance in various diseases, including asthma, atherosclerosis, autoimmunity, and renal fibrosis . Indeed, huang et al . Suggested that the activation of kca3.1 would play an important role in the tgf--induced renal fibrosis . Tgf- increased kca3.1 activity, which in turn contributed to the activation of mitogen - activated protein kinase signaling and increased expression of monocyte chemoattractant protein-1 . The first report that cytokines affect k channel activity was presented in 2003 by wei et al ., who clearly demonstrated that tnf acutely stimulated activity of a 70 ps k channel in the apical membrane of rat tal, using the patch - clamp technique . Although the pka- and nitric oxide- (no-) dependent pathways had been shown to stimulate the activity of the 70 ps k channel [53, 54], both a pka inhibitor and an inhibitor of no synthase did not affect the tnf - induced activation of the channel . In contrast, an inhibitor of protein tyrosine phosphatase (ptp) blocked the stimulatory effect of tnf on channel activity . Furthermore, an inhibitor of protein tyrosine kinase (ptk) increased channel activity, and the subsequent administration of tnf in the presence of the ptk inhibitor did not cause additional increase in channel activity . It was also demonstrated that tnf significantly increased the ptp activity in cultured rat tal cells . Therefore, they concluded that the stimulatory effect of tnf on the 70 ps k channel was dependent on tyrosine dephosphorylation processes mediated by ptp, as shown in figure 3 . It is well known that a romk - like 30 ps k channel, as well as the 70 ps k channel, is present in the apical membrane of tal [52, 53]. Both k channels contribute to the k recycling across the apical membrane of the tal, which maintains the normal function of the nkcc [1, 2]. Wei et al . Also found that tnf did not affect the activity of this 30 ps k channel . With regard to romk, there are also reports demonstrating that the gene expression of this k channel was modulated by cytokines . Schmidt et al . Reported that administration of proinflammatory cytokines, such as il-1, ifn-, and tnf-, to the mouse decreased mrna expression of romk in the whole kidney . Although the systemic administration of cytokines resulted in hypotension and reduced blood flow in the kidney, renal ischemia itself had no apparent effect on romk gene expression . In addition, il-1, ifn-, and tnf- suppressed romk gene expression in the mouse ccd cell line to the same extent observed in the whole animal experiments . Therefore, they strongly suggested that the proinflammatory cytokines directly suppressed the romk gene expression . The activities of renal tubular k channels are functionally coupled to various transporters [1, 2]. Basolateral k channels in proximal tubule cells cooperate with the basolateral na - k atpase to provide a driving force for na entry through the apical transporters, such as sglt [1, 2]. Similar cooperation of basolateral k channels with the na - k atpase also exists in distal nephron segments [1, 2]. In the tal, apical k channels serve as the k recycling pathways for the apical nkcc, which facilitates reabsorption of na and cl [1, 2]. In principal cells of ccd, apical na entry through the enac is partly dependent on the cell - negative potential generated by apical and basolateral k channels [1, 2]. Thus, the changes in renal k channel activity would result in alterations in the transport activity of solutes and water . If the transport activity in the kidney drastically changes, the homeostasis of body fluid would be profoundly perturbed . In contrast to the renal k channels, there are relatively many reports demonstrating the effects of cytokines on renal transporters . Tnf- reduced ouabain - sensitive rb uptake in the tal and nkcc expression in the kidney [31, 33]. These observations are inconsistent with the stimulatory effect of tnf- on the 70 ps k channel in the tal reported by wei et al . . The apical 70 ps k channel acts as the recycling pathway for the apical nkcc [1, 2]. Therefore, the tnf - induced increase in channel activity should be related to increased na transport . Tnf- reduced rb uptake after 24 h and nkcc expression after 4 h or 7 days, whereas stimulation of channel activity by tnf- occurred in a few minutes . Besides the acute stimulatory effect on k channel, tnf- induces expression of cyclooxygenase (cox) which subsequently generates prostaglandin e2 (pge2). It was reported that pge2 suppressed the activity of the 70 ps k channel in the tal . The effects of tnf- on channel activity might be time - dependently biphasic similar to the effect of ifn- on k channel activity in rptecs . If so, the delayed cox / pge2-dependent channel suppression would be consistent with the tnf--induced inhibition of transport activity and transporter expression . Tnf- was also reported to increase sglt2 expression in the porcine proximal tubule cell line, llc - pk1, which well fits with the stimulatory effect of tnf- on k channel activity . These include na - k atpase [32, 58, 59], na - h exchanger (nhe), na - ca exchanger, na - cl cotransporter (ncc), nkcc, sglt, glucose transporters, and urea transporters . On the other hand, ifn- seems to be involved in the upregulations of nkcc and ncc in the distal nephron and nhe in the proximal tubule, which would contribute to the salt and water retention during the angiotensin ii - induced hypertension . The stimulatory effect of ifn- on k channel activity might play a role in such an upregulated na transport . Similar to tnf- and ifn-, the effects of il1- on renal transporters are mainly suppressive, which is in good agreement with its suppressive effect on k channel activity . Il-1 inhibits na reabsorption in the ccd and expression of na - k atpase in medullary and cortical kidney cells or cultured llc - pk1 cells . It also reduces many other transporters, as was observed with ifn- [32, 58, 59, 61]. The effects of proinflammatory cytokines on renal k channels would be implicated in renal dysfunction or renal cell injury . Proinflammatory cytokines are the key molecules, which promote cell injury in many organs during inflammatory diseases [9, 10]. They are involved in the pathogenesis of acute kidney injury and chronic kidney disease [62, 63]. The endotoxemia - induced acute renal failure is one of the clinical manifestations that highlight the detrimental effects of proinflammatory cytokines on the kidney . Therapeutic use of cytokines sometimes brings about adverse effects . For example, application of ifns in renal cell carcinoma or viral hepatitis may well result in undesirable severe renal dysfunction . Furthermore, it has been reported that proinflammatory cytokines cause glomerulonephritis accompanied by proteinuria, tubulointerstitial fibrosis, and apoptosis / necrosis of tubular cells in various experimental models [66, 67]. These effects are generally thought to be mediated by activation of caspases and various transcription factors [9, 10]. The activated transcription factors initiate synthesis of many effector proteins, such as other cytokines, chemokines, matrix metalloproteases, inos, and adhesion molecules [9, 10]. All of these effector proteins could participate in the promotion of renal cell injury . As described below thus, it is possible that the cytokine - induced renal cell injury would be mediated by modulation of k channel activity . In fact, tgf- upregulates a ca - activated k channel in hk2 cells, which in turn contributed to the generation of a chemokine crucial for the pathogenesis of renal fibrosis . Modulation of k channel activity by tnf- was also reported to induce cell death in a rat liver cell line and prolonged action potential duration, which was involved in the sudden cardiac death, in dog cardiomyocytes . Many reports have demonstrated that changes in activity of renal tubular k channels would be involved in renal cell injury . With regard to the mode of action of k channel activity on renal cell injury an atp - sensitive k channel (katp) blocker, glibenclamide, was reported to reduce hypoxia- or ischemia / reperfusion - induced renal cell injury in isolated rat proximal tubules, perfused rat kidneys, and rats in vivo . Glibenclamide also improved kidney structure and function in the rat model of chronic kidney disease . Blocking the activity of kca3.1 k channel by tram34 inhibited production of inflammatory mediators, which contributed to renal fibrosis, in hk2 cells [50, 71] or diabetic mice . It was reported that the downregulation of kir4.1 by intracellular acidification would contribute to cell protection in the rat proximal tubule . In contrast, other investigators reported that maintaining or increasing k channel activity is rather protective for renal cells . According to their reports, blockade of k channel by glibenclamide enhanced renal cell injury in isolated perfused rat kidney, llc - pk1 cells, hk2 cells, and mouse proximal tubule cells . Furthermore, a katp opener, nicorandil, was reported to ameliorate ischemia / reperfusion injury in the rat kidney [74, 75]. Another katp opener, levosimendan, also protects the kidney against the lps - induced inflammatory responses and ischemia / reperfusion injury . The discrepant effects of altered k channel activity among reports would partly be due to the differences in experimental systems and cellular conditions . The precise mechanisms by which changes in k channel activity cause renal cell injury are not completely revealed . It is likely that the loss of intracellular k through the activated k channel facilitates cell shrinkage, which triggers apoptotic volume decrease . Furthermore, changes in k channel activity alter the driving force for ca entry through ca - permeable channels, such as trp channels [78, 79]. Subsequent changes in intracellular ca concentration will activate or suppress various factors, including apoptotic or inflammatory molecules [50, 71, 72, 78, 79]. It also remained to be elucidated whether the cytotoxic effects of proinflammatory cytokines would actually be mediated by their modulation of renal k channel activity . Renal k channels play important roles in maintaining the normal transport function of renal tubule epithelia . The kidney sometimes suffers from renal ischemia, endotoxemia, and diabetic nephropathy, where proinflammatory cytokines are produced . However, it was only during the last decade that the effects of proinflammatory cytokines on renal k channels were reported . The effects of cytokines on k channels may be involved in alterations of tubular transport or onset of renal cell injury . However, the physiological and pathological significances of proinflammatory cytokines in modulating renal tubular k channels are not well understood . To complicate the matters, the complexity of cytokine actions gives rise to difficulties in interpreting the final outcome of their effects . Additional studies are required to further clarify the effects of proinflammatory cytokines on renal k channels.
|
The restorative treatment of deep carious lesions in young permanent molars presents a challenge for dentists because complete caries removal can expose the pulp tissue, leading to more complex treatments such as an endodontic procedure . To avoid this, the complete removal of the carious tissue is no longer recommended because partial caries removal or the sealing of the infected dentin tissue, allows dentin repair, prevents unnecessary tissue loss, and permits the conservative treatment of deep carious lesions . Unlike the step - wise excavation technique, a single clinical session (without tooth reopening) is the current trend in carious lesion management . After cavity sealing / dental restoration, tissue remineralization, reduction in bacterial counts, and histological dentin reorganization with intertubular dentin thickening and formation of a dense collagen network were reported . If the glass ionomer cement (gic) is used as a liner, an ion exchange of calcium, phosphate, and fluorine between demineralized dentin occurs . This fact generated a discussion about the role of the lining material on the reorganization of the remaining carious tissue . Some authors reported that gic can supply bioactive molecules promoting dentin regeneration, whereas others argued that caries arrestment is not dependent on the cavity liner materials . Therefore, this study aimed to evaluate the impact of the liner material on the morphological and mineral changes of carious dentin of permanent teeth after tooth restoration . This study was approved by the ethics committee of the state university of ponta grossa (ponta grossa, paran, brazil) under protocol #78/2011 and evaluated infected permanent dentin at baseline and 60 days after cavity sealing (60-day), using laser fluorescence (lf) readings and morphological and mineral analysis under scanning electron microscopy (sem). After an initial screening of 772 children from rural area schools, 35 children of both genders with ages ranging from 7 to 15 years (average = 11.0 2.7) were included in the study . The carious lesions should reach the inner portion of dentin (2/3 or more of the dentin thickness). Teeth should not exhibit signs or symptoms of pulp pathology (i.e. Fistula, tooth mobility, periapical alterations, and spontaneous pain). If any of these signs were observed, the tooth was excluded . The teeth were randomly designed to group 1 (n = 23 - gic liner + composite resin restoration) or group 2 (n = 22 - inert material wax + composite restoration). After local anesthesia and rubber dam isolation, teeth were cleaned with a new toothbrush and water, washed thoroughly with air / water spray, and air dried without desiccation . At baseline, we examined the characteristics of the mesial portion of the tooth, whereas the distal portion was examined 60 days after restoration at the reopening of the tooth . The research protocol consisted of lf readings (as described later in this session) followed by the removal of the carious dentin; this process was repeated at baseline and at the 60-day follow - up period . To facilitate the removal of the mesial and distal portions of the dentin, the carious lesion was divided at baseline into two equal portions using a hollenback carver in a buccal - lingual direction . The dentin samples were removed using a sterile dentin excavator, and immediately after removal, the dentin fragments were processed for morphological and mineral analysis . The cavity preparation involved only the removal of the carious tissue from the cavosurface margin to promote appropriate cavity sealing . In the gic group (g1), the pulpal floor of the cavity was covered with high - viscosity gic (ketac molar easymix, 3 m espe, st . Polyacrylic acid was not used to aid cavity reopening 60 days after the procedure . In the wax group (g2), a piece of utility wax (lysanda, so paulo, sp, brazil) approximately 1 mm thick was placed on the pulpal floor . All cavities were etched with 37% phosphoric acid gel (villevie, joinville, sc, brazil), rinsed with water and slightly air dried . A two - step etch - and - rinse adhesive (adper single bond 2, 3 m espe) was applied according to the manufacturer's instructions, and the composite resin (llis, fgm, joinville, sc, brazil) was placed in slim increments . After the composite resin placement, a sealant (fluroshield, dentsply, petrpolis, rj, brazil) was applied on the restoration margins for extra protection . The light - curing process was performed with a quartz - tungsten - halogen - light under ramped curing (dx turbo led 1200, d - x, ribeiro preto, so paulo, brazil). The initial light intensity was 450 mw / cm, with an automatic increase to 1200 mw / cm after 10 s. sixty days after the procedure, the marginal integrity of the restorations was evaluated using the united states public health service criteria: (1) cavosurface marginal discoloration, (2) recurrent caries, (3) contour or loss of substance (wear), (4) marginal integrity, and (5) surface texture . These variables were ranked with the following scores: alpha (no defect clinically detectable, needing only a polish), bravo (clinically acceptable, but repair is needed), and charlie (clinically unacceptable, needs restoration replacement). If there were signs or symptoms of pulp pathology or restorations defects that compromised cavity sealing, the tooth was excluded . Then, the restorative material was removed with a sterile diamond bur (#1092 - kg sorensen, so paulo, brazil) under water cooling until the gic and wax were reached . Dentin samples from the distal portion of the tooth were removed for morphological and mineral analysis in the same manner as described for the mesial portion . After the collection of the dentin samples in both periods, the teeth were restored with composite resin restorations . All of the clinical procedures were performed by a single operator (eunice kuhn), a trained and experienced pediatric dentist . Dentin lf was measured with diagnodent 2095 (kavo, biberach, germany) following the manufacturer's instructions . The device was calibrated against a porcelain reference object and recalibrated on a sound surface of each tooth before the examination . Optimal cutoff limits of the lf device to detect in vivo occlusal caries lesion depth are as follows: 014 - sound teeth; 1521 - enamel lesions; 2237 - caries lesion in the outer half of the dentin; and> 38 - caries lesion in the inner half of the dentin . Three measurements on carious dentin in the mesial (baseline measurement) or distal portion (60 days after tooth restoration) of the cavity were taken, and the mean value from each period was calculated to represent the individual tooth . Dentin fragments from the mesial (baseline) and distal (60-day sample) portions were stored into a 2% glutaraldehyde solution with a sodium phosphate buffer of 0.1 m (ph 7.4) for 7 days, rinsed thoroughly with 50% sodium phosphate buffer (0.3 m) and distilled water solution (three 30-min rinses), and dehydrated in acetone at 30%, 50%, and 70% for 10 min, 90% for 20 min, 100% for 10 min, and 100% for 20 min . Samples were kept at 37c for at least 3 days to remove any residual water . They were analyzed with sem using secondary electron mode with a voltage of 12 kv . The same sample was analyzed using dispersive x - ray spectrometry energy to measure the relative percentage of calcium, phosphorus, and fluorine among the 12 most common chemical elements in the dentin substrate . The weight percentages of calcium, phosphorus, and fluorine before and after tooth restoration were assessed at a magnification of 200 for 100 s. all of the microphotographs were analyzed by the same examiner (ana claudia rodrigues chibinski), who was blinded to the group to which the specimen belonged . The characteristics evaluated were the presence of bacteria, the collagen network, and the mineralization of inter- and peri - tubular dentin . The software statistical package for social sciences (ibm corporation, spss 17.0, chicago, illinois, usa) was used for statistical analysis with the significance level set at 0.05 . Before submitting the data to statistical analysis, kolmogorov smirnov test was performed to assess the normality of the data, and bartlett's test was used to verify if the assumption of equal variances was valid . As the data from the lf reading failed in both analysis of variance (anova) assumptions (p <0.05), we used nonparametric statistics for data analysis . In each group, the lf readings before and after cavity sealing were compared by wilcoxon signed - rank test . In each period, the lf readings of the gic and wax groups were statistically analyzed with mann for the mineral data, the anova assumptions were valid (p> 0.05), and therefore, parametric statistics were employed . For each tooth, the percentage value of each mineral obtained at 60 days was subtracted from the baseline value . A paired t - test was used to compare the differences in wt% of calcium, phosphorus, and fluorine between the two study groups . After an initial screening of 772 children from rural area schools, 35 children of both genders with ages ranging from 7 to 15 years (average = 11.0 2.7) were included in the study . Children with systemic pathologies the carious lesions should reach the inner portion of dentin (2/3 or more of the dentin thickness). Teeth should not exhibit signs or symptoms of pulp pathology (i.e. Fistula, tooth mobility, periapical alterations, and spontaneous pain). If any of these signs were observed, the tooth was excluded . The teeth were randomly designed to group 1 (n = 23 - gic liner + composite resin restoration) or group 2 (n = 22 - inert material wax + composite restoration). After local anesthesia and rubber dam isolation, teeth were cleaned with a new toothbrush and water, washed thoroughly with air / water spray, and air dried without desiccation . At baseline, we examined the characteristics of the mesial portion of the tooth, whereas the distal portion was examined 60 days after restoration at the reopening of the tooth . The research protocol consisted of lf readings (as described later in this session) followed by the removal of the carious dentin; this process was repeated at baseline and at the 60-day follow - up period . To facilitate the removal of the mesial and distal portions of the dentin, the carious lesion was divided at baseline into two equal portions using a hollenback carver in a buccal - lingual direction . The dentin samples were removed using a sterile dentin excavator, and immediately after removal, the dentin fragments were processed for morphological and mineral analysis . The cavity preparation involved only the removal of the carious tissue from the cavosurface margin to promote appropriate cavity sealing . In the gic group (g1), the pulpal floor of the cavity was covered with high - viscosity gic (ketac molar easymix, 3 m espe, st . Polyacrylic acid was not used to aid cavity reopening 60 days after the procedure . In the wax group (g2), a piece of utility wax (lysanda, so paulo, sp, brazil) approximately 1 mm thick was placed on the pulpal floor . All cavities were etched with 37% phosphoric acid gel (villevie, joinville, sc, brazil), rinsed with water and slightly air dried . A two - step etch - and - rinse adhesive (adper single bond 2, 3 m espe) was applied according to the manufacturer's instructions, and the composite resin (llis, fgm, joinville, sc, brazil) was placed in slim increments . After the composite resin placement, a sealant (fluroshield, dentsply, petrpolis, rj, brazil) the light - curing process was performed with a quartz - tungsten - halogen - light under ramped curing (dx turbo led 1200, d - x, ribeiro preto, so paulo, brazil). The initial light intensity was 450 mw / cm, with an automatic increase to 1200 mw / cm after 10 s. sixty days after the procedure, the marginal integrity of the restorations was evaluated using the united states public health service criteria: (1) cavosurface marginal discoloration, (2) recurrent caries, (3) contour or loss of substance (wear), (4) marginal integrity, and (5) surface texture . These variables were ranked with the following scores: alpha (no defect clinically detectable, needing only a polish), bravo (clinically acceptable, but repair is needed), and charlie (clinically unacceptable, needs restoration replacement). If there were signs or symptoms of pulp pathology or restorations defects that compromised cavity sealing, the tooth was excluded . Then, the restorative material was removed with a sterile diamond bur (#1092 - kg sorensen, so paulo, brazil) under water cooling until the gic and wax were reached . Dentin samples from the distal portion of the tooth were removed for morphological and mineral analysis in the same manner as described for the mesial portion . After the collection of the dentin samples in both periods, the teeth were restored with composite resin restorations . All of the clinical procedures were performed by a single operator (eunice kuhn), a trained and experienced pediatric dentist . Dentin lf was measured with diagnodent 2095 (kavo, biberach, germany) following the manufacturer's instructions . The device was calibrated against a porcelain reference object and recalibrated on a sound surface of each tooth before the examination . Optimal cutoff limits of the lf device to detect in vivo occlusal caries lesion depth are as follows: 014 - sound teeth; 1521 - enamel lesions; 2237 - caries lesion in the outer half of the dentin; and> 38 - caries lesion in the inner half of the dentin . Three measurements on carious dentin in the mesial (baseline measurement) or distal portion (60 days after tooth restoration) of the cavity were taken, and the mean value from each period was calculated to represent the individual tooth . Dentin fragments from the mesial (baseline) and distal (60-day sample) portions were stored into a 2% glutaraldehyde solution with a sodium phosphate buffer of 0.1 m (ph 7.4) for 7 days, rinsed thoroughly with 50% sodium phosphate buffer (0.3 m) and distilled water solution (three 30-min rinses), and dehydrated in acetone at 30%, 50%, and 70% for 10 min, 90% for 20 min, 100% for 10 min, and 100% for 20 min . Samples were kept at 37c for at least 3 days to remove any residual water . They were analyzed with sem using secondary electron mode with a voltage of 12 kv . The same sample was analyzed using dispersive x - ray spectrometry energy to measure the relative percentage of calcium, phosphorus, and fluorine among the 12 most common chemical elements in the dentin substrate . The weight percentages of calcium, phosphorus, and fluorine before and after tooth restoration were assessed at a magnification of 200 for 100 s. all of the microphotographs were analyzed by the same examiner (ana claudia rodrigues chibinski), who was blinded to the group to which the specimen belonged . The characteristics evaluated were the presence of bacteria, the collagen network, and the mineralization of inter- and peri - tubular dentin . The tooth was employed as an experimental unit for data analysis . The software statistical package for social sciences (ibm corporation, spss 17.0, chicago, illinois, usa) was used for statistical analysis with the significance level set at 0.05 . Before submitting the data to statistical analysis, kolmogorov smirnov test was performed to assess the normality of the data, and bartlett's test was used to verify if the assumption of equal variances was valid . As the data from the lf reading failed in both analysis of variance (anova) assumptions (p <0.05), we used nonparametric statistics for data analysis . In each group, the lf readings before and after cavity sealing were compared by wilcoxon signed - rank test . In each period, the lf readings of the gic and wax groups were statistically analyzed with mann for the mineral data, the anova assumptions were valid (p> 0.05), and therefore, parametric statistics were employed . For each tooth, the percentage value of each mineral obtained at 60 days was subtracted from the baseline value . A paired t - test was used to compare the differences in wt% of calcium, phosphorus, and fluorine between the two study groups . Of the 45 permanent molars at baseline, four teeth were not evaluated in the 60-day assessment . In g1 (the gic group), the teeth were not evaluated due to pulp necrosis . In g2 (the wax group), three students did not attend the 60-day recall, so we could not evaluate their teeth . In addition, after 60 days, one restoration was classified as charlie, so it was not included in the sample . No significant difference in lf readings was detected for the gic and wax groups in either period (mann whitney u - test, p> 0.05). Significant reductions in lf means were detected between periods for both groups (wilcoxon signed - rank test, p <0.05) [table 1]. Means and standard deviations of laser fluorescence for both groups at baseline and in the 60 days follow - up baseline samples from both groups showed highly infected tissue and a clearly exposed collagen matrix [figures 1 and 2]. After cavity sealing, fewer bacteria with a more compact arrangement of collagen fibers were seen in both groups [figures 1 and 2]. A similar gain in calcium and phosphorus was detected for both groups (t - test, p> 0.05) [table 2]. An uptake of fluorine was significantly detected only for the gic group (t - test, p = 0.032) [table 2]. After restoration, we observed some dentinal tubules without microorganisms (arrows) for g1 and g2, and a decrease in the bacterial contamination is evident although some microorganisms can still be seen in the intertubular dentin (pointer) the demineralized dentin tissue with exposed collagen fibers was observed at baseline for both groups . However, the remineralization process also occurred on g2 in peri- and inter - tubular dentin (arrows) means and standard deviations of the 60-day vs. baseline difference in the weight percentage of calcium, fluorine and phosphorus for both groups no significant difference in lf readings was detected for the gic and wax groups in either period (mann whitney u - test, p> 0.05). Significant reductions in lf means were detected between periods for both groups (wilcoxon signed - rank test, p <0.05) [table 1]. Means and standard deviations of laser fluorescence for both groups at baseline and in the 60 days follow - up baseline samples from both groups showed highly infected tissue and a clearly exposed collagen matrix [figures 1 and 2]. After cavity sealing, fewer bacteria with a more compact arrangement of collagen fibers were seen in both groups [figures 1 and 2]. A similar gain in calcium and phosphorus was detected for both groups (t - test, p> 0.05) [table 2]. An uptake of fluorine was significantly detected only for the gic group (t - test, p = 0.032) [table 2]. After restoration, we observed some dentinal tubules without microorganisms (arrows) for g1 and g2, and a decrease in the bacterial contamination is evident although some microorganisms can still be seen in the intertubular dentin (pointer) the demineralized dentin tissue with exposed collagen fibers was observed at baseline for both groups . However, the remineralization process also occurred on g2 in peri- and inter - tubular dentin (arrows) means and standard deviations of the 60-day vs. baseline difference in the weight percentage of calcium, fluorine and phosphorus for both groups the clinical success of conservative procedures (step - wise excavation / indirect pulp capping) is achieved when pulp vitality is maintained, and no adverse symptoms are reported after treatment . In the present study, therefore, the overall success rate is 98% (95% confidence interval 88%100%), which is in agreement with other published papers . Although this study was not pioneering research in demonstrating caries arrestment after dentin carious lesions sealing, few papers have compared a bioactive versus inert material as a liner . This article provided evidence that dentin reorganization and mineral changes were not dependent on the material placed in contact with the carious tissue, suggesting that the carious arrestment is a host - driven process rather than a material - induced process . The concept that dentin remineralization is a material - driven process was based on the benefits of the fluoride in the enamel remineralization . Some authors believe that fluoride release from gic could favor the remineralization of carious dentin . However, if fluoride was necessary for dentin remineralization, we should have detected remineralization (by increased percentage of calcium and phosphorus) only in the gic group, and this was not observed . The cessation of the caries process allows the biological response of the teeth . Sealing the cavity isolates bacteria from the oral environment and active biofilm, arresting the carious process, and providing time for the defense mechanism from the pulp - dentin complex . In general, repair and regeneration in the dentin - pulp complex are similar to natural wound - healing responses seen in many of the body's systems . To respond to the inflammatory process induced by the caries lesion, odontoblasts produce a reactionary tertiary dentin matrix, along with high levels of growth factor secretion in an effort to remodel and repair the extracellular matrix damaged by the disease process . Thus, the dense collagen matrix seen 60 days after sealing is the result of tissue remodeling . Considering that we used a destructive method, the images obtained were not from the same area, but the dentin sample collected was from the same tooth (which was reopened after 60 days) and depth . This was possible because the carious tissue on the cavity floor was divided into two portions (mesial and distal). The decreased means of lf after restoration are consistent with the bacterial reduction detected in the sem images . The lower lf readings are associated with the reduction of the bacterial aggregates and their metabolic by - products such as protoporphyrin ix, mesoporphyrin, and coproporphyrin, but not the mineral content of the dentin . However, the means of lf in the 60-day sample are still far from those reported for sound dentin (which ranges between 3 and 6) and dentin caries (which ranges between 35 and 40). A possible explanation is that the residual metabolic products are still readable by an lf device even after cavity sealing . By no means has the present study suggested the placement of an inert material (such as wax) inside the cavity, which was used only as a negative control for research purposes . The selection of the liner / provisional or definitive restorative material should consider its biocompatibility, longevity and ability to bond to the dental structures . Caries arrestment with dentin reorganization occurs regardless of the lining material placed in contact with the infected dentin . 525/10) from the brazilian research agency, the araucaria foundation for supporting scientific and technological development of paran, brazil . 525/10) from the brazilian research agency, the araucaria foundation for supporting scientific and technological development of paran, brazil.
|
Renewable chemical fuels can be synthesized through solardriven electro, photo, and thermochemical splitting of co2 and h2o.1 the latter approach utilizes the entire spectrum of concentrated solar radiation as hightemperature process heat for the production of co and h2 (syngas) via metal oxide redox cycles.1b, 2 a critical drawback of this approach is the inert gas consumed to lower the partial pressure of oxygen (po2) for shifting the thermodynamic equilibrium of the reduction step to lower temperatures.3 this, in turn, requires separation of o2 from the product gases for recycling the inert carrier gas and closing the material cycle.3a, 4 the separation of o2 has been a requirement in a variety of commercial applications such as oxycombustion, autothermal gasification of carbonaceous feedstock, and o2 removal to avoid catalyst passivation by o2 in fuel cells and when deoxygenating biofuels to make these more akin to petroleumderived fuels.5 industrially, o2 can be separated from air by pressure swing adsorption (psa) using zeolites and carbon molecular sieves, by ceramic mixed ionicelectronic conducting (miec) membranes,6 and by cryogenic distillation . Psa and miec membranes cannot produce highpurity inert gas,6b and separating o2 from gas mixtures at low po2 using membranes relies on a stripping gas with even lower po2 . These separation technologies further require an input of electrical work ranging from 100 to 350 kwh per metric ton o2,6, 7 which penalizes the solartofuel energy conversion efficiencies . Since solar thermochemical cycles inherently suffer from heat losses, it would be beneficial to utilize an oxygen separation technology driven by waste heat . Thermochemical solidstate o2 separation (tssos) using metal oxide redox materials such as cu2o / cuo,3a, 8 mn3o4/mn2o3,8 and coo / co3o4 8, 9 utilizes lowgrade process heat and does not require electricity . Tssos has the potential to separate and concentrate o2 at low po2 via temperatureswing.3a the current stateoftheart tssos redox material, cu2o, has a maximum oxygen exchange capacity (, i.e., the difference in the oxygen nonstoichiometry between reducing and oxidizing conditions) of about 200 mmol o2 per mol cu2o, exchanged at approximately 10 mol o 2 min g cu 2o when cycled between 11201450 k.3a we show below that cu2o cannot be employed with lowgrade process heat at 600900 k. with the aim of augmenting the o2 exchange capacities and rates of tssos redox materials for a more energyefficient o2 separation process that utilizes lowgrade solar thermal energy at lower temperatures, such as waste heat from solar fuel production processes, we evaluate perovskites that offer high o2 conductivities and a stable crystal structure over a large range of oxygen nonstoichiometry.6a, c, 10 the o2 exchange capacity characterizes the tradeoff between high energy conversion efficiencies at low temperature during the endothermic reduction and high rates and extend of the oxygen separation process at high oxide reduction temperatures . For a perovskite with abo3 stoichiometry where a and b are metal cations in twelve and sixcoordinated interstices the tssos redox cycle can be represented by equations (1) and (2):(2) (1)equation image (2)equation image conceptually, o2 is stripped from a gas mixture at low po2 through oxidation of the perovskite at low temperatures . This yields as an output of the oxidation step an inert gas with a lowered po2 while concentrated o2 is evolved from the solid at an elevated temperature and increased po2 through partial reduction of the metal oxide . In principle, these reactions are analogous to the electrochemical oxygen reduction and evolution reactions (orr / oer), where the bonding of o / oh or oh / ooh reaction intermediates to the catalyst surface controls the catalytic activity of the electrode surface.10, 11 the ideal catalytic activity of a surface is determined by an intermediately strong bonding of the key reaction intermediates, which facilitates coverage of the surface with reactants and desorption of products from the surface, as described by the sabatier principle.12 analogously, we hypothesize that metal oxide redox materials for removal of o2 from gas mixtures with a lower po2 than the po2 during the extraction of o2 from the solid can be characterized with an intermediately strong binding of the lattice oxygen . To test this hypothesis, we screened the redox energetics of binary metal oxides across the periodic table using experimentbased thermochemical data.13 figure 1 a shows the free energy (g) of the oxidation and reduction reactions for 32 solid metal oxide and six metal / metal oxide pairs14 versus the thermochemical oxide stability . A) free energy of the oxide oxidation at 600 k and oxide reduction at 900 k (g rxn) versus the enthalpy of the oxide reduction at 298 k (h red). B) the limiting free energy of the redox cycle (g rxn, lim) versus h red . The colored compositions were examined experimentally, with blue and red marked materials limited by the oxide reduction and oxidation, respectively, and purple marking materials that facilitate a redox tradeoff . C) dftmodels of the oxidized and reduced srcoo3 and srcoo2.5 surface, representatively for strontium cobaltite . The analysis utilizes the enthalpy of the oxide reduction at room temperature as a descriptor1012 of the correlated reaction energetics, which is equivalent to the amount of energy required to break metal generally, either one of the two reactions is slightly more endergonic, thereby limiting the o2 exchange capacity . Figure 1 b shows the limiting free energy of a redox cycle near the intersection of both correlations . As indicated by the volcanoshaped curve, the ideal redox material binds oxygen strongly enough to oxidize the oxide at relatively low temperatures stronger than the ag / ag2o reference but weakly enough to reduce the oxidized redox material at moderately higher temperatures the ideal metal oxide compositions are where these effects balance, located near the top of the volcano curve . Ideally, this region corresponds to negative free energies for both reactions . For the temperatures chosen in our analysis, this can be achieved with rare materials such as rh2o / rho or toxic materials such as pbo / pb3o4.15 generally, the volcanolike shape of this correlation is due to the fact that the amount of energy absorbed for breaking metal oxygen bonds during the reduction step correlates with the amount of heat liberated when forming these bonds during the oxidation step . Thus, as shown in figure s1, the location of the volcanotop can be determined from only computing the reduction enthalpy as the entropy of o2 gas participating in either reaction is the same for all specific redox couples and as entropic contributions of the solids introduce significant deviation from these correlations only at significantly higher temperatures when approaching melting and boiling points . To tailor inexpensive and nontoxic metal oxides, we calculated the free energy of oxygen vacancy formation (g v[o]) using density functional theory (dft) for twelve perovskites that have attracted attention for solidoxide fuel cells,6a, 10 air separation,6c and solarthermal applications.16 stoichiometric abo3(010) and oxygendeficient abo2.5(010) facets (a = sr, ba, or la; and b = mn, co, ni, or cu) were modeled (figure 1 c), using the gridbased projectoraugmented wave (gpaw) and atomic simulation environment (ase) electronicstructure code.17 figure 1 b shows the thermochemical stability and the reaction energetics as calculated from the scaling of g v[o] and the redox energetics of the bulk oxides (see the supporting information).18 the analysis predicts an ideal o2 exchange capacity for srcoo3, relative to too strong and too weak oxygen binding for bamno3 and bacoo3, respectively . We validated this descriptorbased design for metal oxide redox materials by means of dynamic o2 exchange experiments using srcoo3, bamno3, and bacoo3, synthesized via the pecchini method3b and commercial ag2o and cu2o as reference materials . The composition and surface morphology of all solids were characterized using hightemperature xray diffraction (htxrd) and scanning electron microscopy (sem). The o2 exchange capacity and exchange rates were determined by thermogravimetric analysis (tga). Figure 2 a and b display dynamic tga runs for srcoo2.95, bacoo2.58, bamno2.94, ag2o, and cu2o (initial stoichiometries) that were cyclically reduced at 900 k and 0.2 bar o2 (simulating air) and oxidized at 600 k and 0.035 bar o2 (simulating the composition of the gas phase from reducing ceria for solardriven splitting of co2 and h2o19). As expected, cu2o and ag2o oxidize and reduce strongly to cuo and ag, respectively, essentially without exchanging o2 reversibly . Compared to these reference materials, we find augmented o2 exchange capacities for the perovskites . Srcoo2.95 reaches a maximum o2 exchange capacity of 440.012 mmol o2 per mol srcoo2.95 and a maximum o2 exchange rate of 12.10.003 mol o 2 min g srcoo 2.95 whereas bacoo2.58 and bamno2.94 perform at much lower capacities of 3.40.015 and 0.50.015 mmol o2 per mol of perovskite and lower exchange rates of 0.80.003 and 0.040.005 mol o 2 min gperovskite, respectively . As predicted by dft, the performance of bacoo3 and bamno3 appears limited by reoxidation and reduction, respectively . This theorybased screening of twelve perovskites identifies a wellknown composition, srcoo3, that shows a significantly augmented performance for this novel application compared to the o2 exchange capacities and rates of the reference materials at the same conditions . Additionally, with an o2 exchange rate of 12.1 mol o 2 min gperovskite, srcoo3 outperforms the stateoftheart cu2o / cuo cycle, which cannot be used with lowgrade process heat at 600900 k and which has an o2 exchange rate of only 10 mol o 2 min g cu 2o (for both, oxide reduction and oxidation) at significantly higher and thereby economically less attractive temperatures of 11201450 k and comparable po2.3a dynamic o2 exchange: tga runs of a) ag2o and cu2o and b) srcoo3, bacoo3, and bamno3. C) lattice constants of srcoo3, bacoo3, and bamno3 derived from htxrd analyses of oxide reduction at 0.2 bar po2 (empty circles) and oxide oxidation at 0.035 bar po2 (filled circles). Error bars are standard deviations within a 68% confidence interval . To support that the tga data is indicative of reversible o2 exchange, figure 2 c shows the perovskite lattice constants computed using data from htxrd analysis . Although all perovskites exhibit thermal expansion upon heating, only srcoo3 shows a major difference in the lattice expansion at varied po2, which can be attributed to the formation and filling of o vacancies.20 this, along with the electronic structure trends and the tga analysis, suggests that srcoo3 is particularly suitable as a redox material for tssos . To understand how the oxide composition controls the o2 exchange, figure 3 a plots g v[o] versus the dftcalculated bond length between the transition metal and the nearest o atom (d b o) at abo2.5(010). Generally, we observe stable o vacancies (negative g v[o] values) correlating with large d b o values . This is in agreement with the lattice expansion shown in figure 2 c, as the lattice expansion due to a higher chemical potential for oxygen in the gas phase decreases the bonding of oxygen in the solid, which, in turn, increases the length of the metal oxygen bond . Although the slope of this correlation is essentially due to the metal at the bsite interstices, the absolute value of d b o is governed by the metal at the a site, as demonstrated by the consistently higher d b o values of the ba versus the sr compounds however, the scatter of the correlation shown in figure 3 a suggests that the trends in the free energy of the o vacancy formation and in the metal oxygen bond length cannot alone be rationalized with geometric arguments . Correlation of g v[o] with a) d b o and b) q o (empty, lightgray, and darkgray symbols mark srbo2.5, labo2.5, and babo2.5, whereas circles, squares, diamonds, and triangles mark acuo2.5, anio2.5, amno2.5, and acoo2.5). C) charge density differences (cdd) of the marked surface after o vacancy formation relative to the stoichiometric surface and the reference gasphase o2 (given at the height of the transition metal cation). Figure 3 b plots g v[o] versus the dftcalculated partial charge21 of oxygen (q o). Bacoo3, for instance, accumulates less charge at the o anion than srcoo3 and bamno3, which correlates with the facile reduction of bacoo3 . Generally, g v[o] scales with q o, with the slope corresponding approximately to the ionization energy of oxygen, 13.62 ev per electron22 and the intercept reflecting entropic contributions to g v[o] and the reference chemical potential of oxygen in the gas phase (see the supporting information). The quality of this linear correlation suggests that the trend in the free energy of the o vacancy formation is controlled by the enthalpy of breaking metal oxygen bonds, that is, by the quantity of electric charge transferred from the o atom to the lattice when forming the o vacancy . This is illustrated with figure 3 c, which shows the difference in the charge density distribution due to o vacancy formation at srcoo3(010) and bamno3(010). Although the partial charge of the o anion yielding the vacancy is approximately equal at both surfaces (figure 3 b), the charge transfer from the bonding o 2p states to the 3d states of the transition metal is significantly higher at bamno3(010) relative to srcoo3 (010). We note that this analysis describes the width of the 2p3d gap for 3d transition metals at the b site of abo3 perovskites . Incorporating other metal cations into the b interstices, such as lanthanides with f states, may alter these trends due to a different entropycontrolled shape of the states that are accepting electrons when forming o vacancies . In summary, analogous to the enthalpy difference of bulk oxide reduction, we suggest that the charge transfer from o 2p to bsitemetal 3d states explains the higher o2 exchange capacity of srcoo3 versus bamno3 at the atomic scale . In accord with charge transfer controlling the formation of o vacancies at the oxide surface, our sabatier analysis employs the enthalpy of the bulk oxide reduction as a descriptor of the redox energetics . To demonstrate how this information can be used practically to predict the o2 exchange capacity of a metal oxide, we have determined the o2 exchange capacity for five metal oxides as the difference of the oxygen nonstoichiometry at equilibrium between o2 evolution at 900 k and 0.2 bar po2 and o2 fixation at 600 k and 0.035 bar po2 (figure 4). The plot shows that the o2 exchange capacity resembles the volcanoshaped trend of the limiting redox energetics . Relative to this trend across three orders of magnitude are minor deviations, such as for bacoo3, which are presumably due to differences in surface morphology, crystal structure, and the computational versus experimental nonstoichiometry (see the supporting information). This demonstrates how computing the enthalpy of the oxide reduction from first principles allows predicting the o2 exchange capacity of metal oxides . Predicting the o2 exchange capacity and the limiting free energy of solidstate o2 separation from the enthalpy of the oxide reduction at 298 k and 1 bar . Although the present article focuses on the thermodynamics of o vacancy formation, the kinetics of conducting these vacancies from and to the surface are of equal importance when designing metal oxides for solidstate o2 separation . The defect chemistry of several perovskite families, including la2nio4+ with a relatively high mobility of o interstitials, has been investigated previously.23 in these perovskites excess oxygen is incorporated as interstitial o or o anions with anion frenkel pairs being the predominant intrinsic lattice defects.23 oxygen transport may be anisotropic23 or isotropic, such as in sr0.75y0.25coo2.625.24 a low frenkel energy may yield high o vacancy concentrations, in prbaco2o5.5 for instance,25 with an ordered sublattice of the a cations ensuring high oxygen ion mobility.25 similarly, dft was used previously to predict and understand oxygen conduction trends in metal oxides.18 these and other studies23, 26 outline the prospects of an advanced understanding of oxygen conduction for designing advanced redox materials . Based on the sabatier principle applied to the bonding of lattice oxygen atoms, we implemented a descriptorbased design principle for predicting the o2 exchange capacity of metal oxides and perovskites in particular . The computations were validated through dynamic o2 exchange experiments using ag2o, cu2o, and three perovskites and rationalized based on the compositiondependent bond geometry and charge transfer during the formation of o vacancies at the metal oxide surface . Srcoo3 was identified as an ideal material for solardriven thermochemical separation of o2 . In a broader context, the presented principles may also aid the design of oxygen conductors for related applications, such as solidoxide fuel cells and air separation using dense ceramic membranes . Thermochemical equilibrium calculations to guide the design of redox materials, the thermochemical equilibrium of binary bulk metal oxides, o2, and their reduction products was determined at the specified po2 and temperatures from tabulated freeenergy data, with an absolute accuracy of 110 kj mol.13 per convention, negative free energy differences mark exergonic reactions . At the computed conditions, the correlations of g and h red for the metal oxide oxidation and reduction have average relative errors of 12.4% and 17.6%, respectively . These values increase with increasing temperature due to entropic contributions and indicate that the provided volcano plot could be employed for identifying materials active for thermochemical solidstate o2 separation . Electronic structure calculations twelve perovskite surfaces were modeled using dft, performed with the gpaw code.17b, c exchangecorrelation interactions were treated by the revised perdew burke ernzerhof (rpbe) functional.27 atomic configurations were handled in ase.17a a fermi dirac smearing of 0.1 ev was used to achieve convergence, and the structure optimization results were extrapolated to 0 k. the linesearch broyden fletcher shanno (bfgs) algorithm was employed to optimize the atomic geometries until the maximum force was less than 0.05 ev . The utility of dft+u methods for surface calculations is not determined in general and was found unnecessary for many metal oxides.18, 28 here, for all dft calculations the generalized gradient approximation (gga) was used without a hubbard u term as we found previously that the hubbard u correction did not improve the description of surface reactivity with the employed models.18 the cubic bulk structures of abo3 compositions consisted of one metal atom (sr, ba, or la) at the twelvecoordinated asite interstices, one metal atom (mn, co, ni or cu) at the sixcoordinated bsite interstices, and three oxygen atoms that were allowed to optimize their positions (relax). The bulk structures had periodic boundary conditions in all directions and were modeled using a kpoint sampling of 444 . Compositions containing mn, co, or ni were modeled using spinpolarized calculations and, to avoid reminiscent stress in the calculations, the lattice constants were chosen as the dftcalculated bulk lattice constants . Table s1 provides a summary of the lattice constants and magnetic moments along with a discussion of the accuracy of the employed dft methods that predict the lattice constants within 0.363.89% of experimental values . The aoterminated abo3(010) facet was chosen for modeling the perovskite surfaces as this facet was identified as being the thermodynamically most stable surface of cubic perovskites for various compositions.18 the surface models consisted of one upper abo3(010) layer that was allowed to relax and one lower abo3(010) layer constrained to the bulk geometry . The surfaces were periodically repeated in the directions parallel to the surface and were modeled with 10 of vacuum perpendicular to the surface . The partial charge density was determined for all atoms contained in the surface models through bader decomposition.21 to model the perovskite surfaces at different o vacancy concentrations, one third of the stoichiometric lattice oxygen in the upper surface layer was removed while the oxygen concentration in the lower surface layer was maintained . Reduced and oxidized surface models with a2b2o5(010) and a2b2o6(010) stoichiometry, marked with the conventional abo3(010) and abo2.5(010) notation, respectively . The free energy of forming o vacancies (g v[o]) at the surface was computed as follows [eq . (3)]:18, (3) (3)equation image where g v, g s, and go are the free energies of the perovskite surface with the o vacancies, the stoichiometric surface and the reference energy of the liberated lattice oxygen [taken as the energy difference of stable h2o and h2 in the gas phase, see eq . (3) in the supporting information], such that negative free energies indicate exergonic reactions . The formation of o vacancies as computed corresponded to formation of one monolayer o vacancies equivalent to an oxygen nonstoichiometry of =0.5 in abo2.5 (figure 1 c). Details on converting the dftcomputed electronic energy to gibbs free energy at 298.15 k and 1.013 bar, the reference energies, and scaling relations18 to estimate the bulk formation energies are provided in the supporting information . The error of dftcomputed adsorption energies (employed as a descriptor of surface reactivity, comparable to the energy of forming surface o vacancies in this work) was estimated previously to be 0.08 ev.29 perovskite synthesis three perovskites, namely srcoo3, bacoo3, and bamno3, were synthesized using a modified pecchini method, employing stoichiometric amounts of mn(no3)24 h2o (alfa aesar, 98%), sr(no3)2 (alfa aesar, 98%), co(no3)2 (alfa aesar, 97.7%), ba(no3)2 (alfa aesar, 99%), c2h6o (alcosuisse, 96.1%), and c6h8o7 (fluka, 99.5%). The solid products were ground using mortar and pestle, uniaxially pressed into pellets (10 metric tons, 6 and 25 mm in diameter), and sintered in air at 1473 k for 5 h (srcoo3 and bacoo3) or in pure o2 at 1273 k for 48 h (bamno3). To achieve the desired oxidation state, the sintered srcoo3 was ground, fully immersed in naclo (migros, <5% in h2o), washed with deionized water, and subsequently dried for at least 2 h at 473 k. ag2o (merck, 99%) and cu2o (johnson matthey alfa, 99.5%) were used as reference materials . Solidstate analysis xrd and htxrd were performed in the bragg brentano geometry using cuk radiation (2080 2, 0.06 min scan rate, 45 kv/20 ma output, panalytical / xpert mpd / dy636, philips). The original oxygen content of the perovskites was srcoo2.95, bacoo2.58, and bamno2.94 before the redox cycling, as determined using tga (sta 409/c/3, netzsch) of the complete reduction of the metal oxides in 5% h2 in ar at 823 k and 1 bar . To estimate changes in the lattice constants, the perovskites were reduced by heating from 600 to 900 k in 100 k steps at 0.2 bar po2 and thereafter oxidized by cooling from 900 to 600 k in 100 k intervals at 0.035 bar po2 . The morphology of all materials was analyzed using sem (15 kv accelerating voltage, tm1000, hitachi) and is shown in detail in the supporting information . Thermochemical cycling experiments starting materials (0.1 g) were placed in an al2o3 crucible supported with an al2o3 rod on the microbalance of the tga (0.1 g). The materials were thereafter exposed to a gas flow (constant flow rate of 200 ml min at 273 k and 1 bar) with specified po2, which was adjusted by mixing o2 (99.5%, messer) and n2 (99.999%, carbagas) using three electronic mass flow controllers (mfc400, netzsch; accuracy 1%, precision 1 ml min). The mass change of the samples was recorded during two consecutive redox cycles with oxide reduction at 900 k and 20 vol% o2 and oxide oxidation at 600 k and 3.5 vol% o2, respectively (1 k). Heating and cooling was performed at + 10 k min and 10 k min, respectively . To correct for buoyancy, blank runs were performed using the same measurement conditions employed for the experimental runs . The oxygen exchange capacity (dimensionless) was defined as the difference in the oxygen nonstoichiometry of the metal oxides after the oxide reduction (red) and after the oxide oxidation (oxi):(4) (4)equation image where m red and m oxi are the metal oxide mass (in g, determined using tga), after the oxide reduction, and after the oxide oxidation, and mo is the molar mass of oxygen (in g mol).the uncertainties of the oxygen exchange capacities and rates were estimated using error propagation from the accuracies of the experimental analysis.
|
The original method to remove the epithelium before the excimer laser ablation was manual mechanical scraping, which was later enhanced by using an alcohol solution or brush . In 2003, camellin proposed a new alcohol - assisted technique called laser - assisted subepithelial keratectomy (lasek) that enabled the epithelium to be preserved as a flap and reapplying it to the ocular surface after treatment . Epithelial laser in situ keratomileusis (epi - lasik) is another method that uses an epithelial flap, but is performed with a microkeratome with a blunt oscillating blade . In the late 1990s, transepithelial photorefractive keratectomy (prk) was introduced where removal of the epithelium is carried out with laser phototherapeutic ablation followed by a laser refractive ablation of the stroma . This 2-step technique was not widely used due to the prolonged surgery time with the older generation of lasers, increased pain, and a lack of adjusted nomograms . Newer generation of faster lasers and improved ablation algorithms and nomograms have over the years, allowed development of a new (tprk) variant of transepithelial prk . Single - step transepithelial prk allows removing the epithelium and stroma in a single step with 1 ablation profile . This profile is calculated taking into account data from the literature estimating the central epithelial thickness of a normal cornea to be 55 and 65 m at 4 mm from the center, superimposed on the corneal wavefront guided aspheric ablation profiles . Several studies have compared 2-step transepithelial prk to standard prk performed with alcohol or mechanical epithelial removal with variable results . Tprk is a relatively new procedure and a limited number of publications are currently available . Only 3 direct comparisons between a single - step tprk and conventional prk are published so far . Meanwhile thus, there is a need for updated comparative evaluations based on a larger number of eyes . The aim of this study is to compare 3-month refractive results, predictability, safety, and efficacy of single - step transepithelial prk with alcohol - assisted prk (aaprk) when used to correct myopia and compound myopic astigmatism . Control study comprised eyes that underwent either single - step transepithelial prk (tprk) or aaprk between august 2012 and april 2014, at the oftalmika eye hospital, bydgoszcz, poland . Before the procedure, each patient was adequately informed about the study as well as the risks and benefits of the surgery, and provided signed informed consent in accordance with the declaration of helsinki . Inclusion criteria were as follows: age over 21 years, primary myopia or compound myopic astigmatism, preoperative manifest refraction spherical equivalent (mrse) within the range of 1.0 to 9.5 d, a stable refractive error for at least 12 months before the surgery, contact lens discontinuation for at least 3 weeks, estimated corneal stromal bed thickness of more than 300 m at the thinnest point . Exclusion criteria were previous ocular surgery, any diagnosed ocular disease, a history of ocular trauma, irregular astigmatism on corneal topography, systemic disease that could affect corneal wound healing, and pregnancy . One patient developed retrobulbar neuritis of the left optic nerve 6 weeks after the surgery and this eye was excluded from the analysis . The choice of the procedure was based on patients preferences as tprk is a more expansive procedure . There are no significant differences in preoperative variables of patients in the tprk and aaprk groups, except the gender . Patients who attended all visits, thus without any missing data, were included into analysis . Demographics and preoperative variables of patients in the tprk and aaprk groups preoperative information on general and ocular medical history, contact lens wear, and medication use was obtained from each patient . The examination included uncorrected distance visual acuity (udva), corrected distance visual acuity (cdva), manifest and cycloplegic refraction, slit lamp biomicroscopy, tonometry, specular microscopy (em-3000, tomey, erlangen, germany), pupillometry, scheimpflug camera tomography (sirius, schwind eye - tech - solutions gmbh, kleinostheim, germany), ocular aberrometry (irx-3, imagine eyes, paris, france), and fundus examination . All surgeries were performed with 6th - generation amaris excimer laser, version 750 s (schwind eye - tech - solutions). The treatments were mostly aimed at emmetropia baring a few eyes with a target refraction of 0.25 d or 0.5 d (nondominant eye in case of older patients). However, in statistical analysis and standardized graphs presented as results in this study, only eyes targeted plano (plano target) were taken it into account wherever necessary . Before the surgery, proparacaine hydrochloride 0.5% drops (alcaine, alcon, fort worth, tx) were instilled 3 times within a 5-min interval . The cornea was exposed to a 20% ethyl alcohol solution for 30 s with the use of a well . Subsequently, a superficial cut of the epithelium was made with either an 8.5- or 9.5-mm diameter trephine . The epithelium was mechanically debrided with a spatula . In the tprk group, where aspheric aberration - free transprk ablation algorithm was used (schwind eye - tech - solutions), the epithelium was removed during laser ablation only from the area of the total ablation zone, which is the sum of the optical and transition zones . In both groups in all cases, 0.02% mitomycin c (mmc) mmc application was followed by generous irrigation of the eye with room temperature balanced solution . A bandage contact lens was applied (acuvue oasis, j&j, new brunswick, tx) for 7 days . The postoperative regimen included 0.3% tobramycin drops (tobrexan, alcon, new brunswick, tx) for 1 month, 0.1% diclofenac drops (dicloabak, laboratoires thea, clermont - ferrand, france) for 1 month, 0.15% hyaluronic acid drops (biolan, penta arzneimittel, stulln, germany) for 3 months, and 0.1% dexamethasone drops (dexafree, laboratoires thea, stulln, germany) 3 times daily for the first month, twice daily for the second month, and once daily for the third month . Patients were instructed to visit the clinic for postoperative examinations after 1 day, 1 week, 1 month, and 3 months . Examinations at 1 day, 1 week, and 1 month included udva, cdva, manifest refraction, tonometry, and slit lamp biomicroscopy . Corneal haze was evaluated as proposed by fantes at al (0 = no haze; 0.5 = trace haze on oblique illumination; 1 = corneal cloudiness not interfering with the visibility of fine iris details; 2 = mild effacement of fine iris details; 3 and 4 = details of the lens and iris not discernible). At the last visit all ocular aberrations were measured for pupil diameter of 4 mm . Moreover, immediately after the surgery and 1 week after we used a discrete, 10-category verbal rating scale (vrs, 1no pain and 10the worst possible pain) to evaluate pain level . Three months after the surgery patients were asked about overall satisfaction with the surgery and (high, moderate, low, not satisfied), and whether they would decide to have a surgery again (yes, no). Data were analyzed using datagraph - med version 4.20 d (ingenieurbro pieger gmbh, wendelstein, germany), which is a relational database designed for refractive data analysis . Statistical analysis was performed using statistica 10 software (statsoft inc ., when numeric data were compared the z - test was used (for distribution of mean preop mrse, mean preop mrs, mean preop mrc, and respective postoperative values). For the comparison of nominal data the chi - squared test (for sex, follow - up rate, majority of complications, and satisfaction) or fisher exact test (for haze) were used . For all tests, preoperative information on general and ocular medical history, contact lens wear, and medication use was obtained from each patient . The examination included uncorrected distance visual acuity (udva), corrected distance visual acuity (cdva), manifest and cycloplegic refraction, slit lamp biomicroscopy, tonometry, specular microscopy (em-3000, tomey, erlangen, germany), pupillometry, scheimpflug camera tomography (sirius, schwind eye - tech - solutions gmbh, kleinostheim, germany), ocular aberrometry (irx-3, imagine eyes, paris, france), and fundus examination . All surgeries were performed with 6th - generation amaris excimer laser, version 750 s (schwind eye - tech - solutions). The treatments were mostly aimed at emmetropia baring a few eyes with a target refraction of 0.25 d or 0.5 d (nondominant eye in case of older patients). However, in statistical analysis and standardized graphs presented as results in this study, only eyes targeted plano (plano target) were taken it into account wherever necessary . Before the surgery, proparacaine hydrochloride 0.5% drops (alcaine, alcon, fort worth, tx) were instilled 3 times within a 5-min interval ., the cornea was exposed to a 20% ethyl alcohol solution for 30 s with the use of a well . Subsequently, a superficial cut of the epithelium was made with either an 8.5- or 9.5-mm diameter trephine . The epithelium was mechanically debrided with a spatula . In the tprk group, where aspheric aberration - free transprk ablation algorithm was used (schwind eye - tech - solutions), the epithelium was removed during laser ablation only from the area of the total ablation zone, which is the sum of the optical and transition zones . In both groups in all cases, 0.02% mitomycin c (mmc) was applied for 2 min based on the standard protocol . Mmc application was followed by generous irrigation of the eye with room temperature balanced solution . After the surgery, a bandage contact lens was applied (acuvue oasis, j&j, new brunswick, tx) for 7 days . The postoperative regimen included 0.3% tobramycin drops (tobrexan, alcon, new brunswick, tx) for 1 month, 0.1% diclofenac drops (dicloabak, laboratoires thea, clermont - ferrand, france) for 1 month, 0.15% hyaluronic acid drops (biolan, penta arzneimittel, stulln, germany) for 3 months, and 0.1% dexamethasone drops (dexafree, laboratoires thea, stulln, germany) 3 times daily for the first month, twice daily for the second month, and once daily for the third month . Patients were instructed to visit the clinic for postoperative examinations after 1 day, 1 week, 1 month, and 3 months . Examinations at 1 day, 1 week, and 1 month included udva, cdva, manifest refraction, tonometry, and slit lamp biomicroscopy . Corneal haze was evaluated as proposed by fantes at al (0 = no haze; 0.5 = trace haze on oblique illumination; 1 = corneal cloudiness not interfering with the visibility of fine iris details; 2 = mild effacement of fine iris details; 3 and 4 = details of the lens and iris not discernible). At the last visit all ocular aberrations were measured for pupil diameter of 4 mm . Moreover, immediately after the surgery and 1 week after we used a discrete, 10-category verbal rating scale (vrs, 1no pain and 10the worst possible pain) to evaluate pain level . Three months after the surgery patients were asked about overall satisfaction with the surgery and (high, moderate, low, not satisfied), and whether they would decide to have a surgery again (yes, no). Data were analyzed using datagraph - med version 4.20 d (ingenieurbro pieger gmbh, wendelstein, germany), which is a relational database designed for refractive data analysis . Statistical analysis was performed using statistica 10 software (statsoft inc ., tulsa, ok). Smirnov test . When numeric data were compared the z - test was used (for distribution of mean preop mrse, mean preop mrs, mean preop mrc, and respective postoperative values). For the comparison of nominal data the chi - squared test (for sex, follow - up rate, majority of complications, and satisfaction) or fisher exact test (for haze) were used . For all tests, p <0.05 was considered statistically significant . The mean ablation time was 44.35 13.68 s in the tprk group and 16.85 9.58 s in the aaprk group (p <0.001), whereas mean time of the whole procedure, from introduction to removal of the lid speculum, was 165 24.62 s and 254 32.14 s, respectively (p <0.001). In the tprk and aaprk group, respectively, the mean diameter of the optical zone was 6.96 0.45 and 7.11 0.43 mm (p = 0.47), and the transition zone was 1.39 0.50 and 1.29 0.63 mm (p = 0.55). The minimal estimated stromal residual thickness was 306 m among all the analyzed eyes (309 m in tprk group and 306 m in aaprk group). The 3-month follow - up rate was 82.1% in the tprk group (n = 145) and 86.4% in the aaprk group (n = 90), because some of the patients were not able or not willing to attend all of the required visits . Mean postoperative mrse was 0.14 0.26 d in the tprk group and 0.12 0.20 d in the aaprk group (p = 0.9). In the tprk group, the postoperative refractive spherical equivalent in 63% of eyes were within 0.13 d, 12% within + 0.14 to + 0.5 d, 24% within 0.14 to 0.5 d, and 1% within 0.5 and 1.0 d; the respective values in the aaprk group were 70%, 4%, 26%, and 0% . Refractive results, predictability, safety, and efficacy 3 months after the surgery are shown in figures 1 and 2 as standard graphs recommended for reporting refractive surgery outcomes . Udva was 20/20 or better in 97% of eyes in the tprk group and 94% in the aaprk group (p = 0.45). In the tprk group, 13% of eyes lost 1 line of cdva and 30% gained a line or 2 . In the aaprk group, 21% of eyes lost 1 line of cdva and 31% gained a line or 2 (p = 0.48). Comparison of uncorrected distance visual acuity (a), change in corrected distance visual acuity (b), and attempted vs achieved spherical equivalent (c) in single - step transepithelial photorefractive keratectomy (tprk; left panels) and alcohol - assisted photorefractive keratectomy (aaprk; right panels) groups . Comparison of the spherical equivalent refractive accuracy (d), refractive astigmatism (e), and stability of spherical equivalent refraction (f) in single - step transepithelial photorefractive keratectomy (tprk; left panels) and alcohol - assisted photorefractive keratectomy (aaprk; right panels) groups . Mean preoperative higher order rms for 4 mm pupil was 0.15 0.15 m in the tprk group and 0.17 0.21 m in the aaprk group (p = 0.21), and the postoperative values were 0.21 0.23 and 0.19 0.12 m (p = 0.37), respectively . The differences between the preoperative and postoperative higher - order rms were not significant for both groups (p = 0.13 for tprk group and p = 0.27 for the prk group). The mean pain scores after the surgery were 4.78 2.65 in the tprk group and 4.59 2.85 in the aaprk group (p = 0.85). There were also no differences in pain intensity during first days after the surgery (mean scores of 4.46 2.54 and 4.51 2.36 in the tprk and aaprk groups, respectively; p = 0.86). After tprk, 86.25% of patients declared high satisfaction with the surgery compared to 88.24% patients after aaprk (p = 0.46). The ratio for moderate satisfaction was 13.75% for tprk and 11.76% for aaprk, respectively (p = 0.54). The total postoperative complication rate was 19.31% in the tprk group and 14.44% in the aaprk group (p = 0.13). A slightly higher incidence of haze was detected with the slit lamp for the tprk group (13.79%), compared to the aaprk group (8.89%); however, the results of the fisher exact test suggest that the proportions of patients falling in each subcategory within each group did not differ significantly (p = 0.09). The intensity of haze was also not statistically significantly different between groups and was at the 0.5 level in all but 2 eyes after tprk and 1 eye after aaprk in which the incidence of haze was evaluated at level 1 . During the follow up there was no statistically significant difference in the incidence of other postoperative complications, which included elevated iop in 1.38% of eyes after tprk and 2.22% after aaprk; decreased visual acuity at night: 1.38% of eyes after tprk and 1.11% after aaprk; more intensive dry eye symptoms in 2.76% of eyes after tprk and 2.22% after aaprk . No postoperative complications, such as epitheliopathy, delayed re - epithelialization or recurrent corneal erosion, were not reported to a level of clinical significance in our cohort . Aspheric aberration - free ablation profile of single - step transepithelial prk (transprk) used in the study, has many implications over the standard aaprk procedures . The ablation profile is calculated estimating that the central epithelial thickness of a normal cornea is 55 and 65 m at 4 mm from the center . Therefore, the epithelial thickness profile resembles a slight hyperopic treatment (<0.75 d) and proper compensation helps to avoid hyperopic shift . The laser system is tuned to compensate for a difference in photoablative rates of the stroma and the epithelial tissue, which is approximately 20% higher in the epithelium . Since 1 epithelial ablation algorithm is used for all eyes in tprk, regardless of the actual epithelial topometry, more stroma might be ablated than necessary in eyes with a thin epithelium, whereas in eyes with a thick epithelium the refractive part of the ablation might begin where there is still some epithelium left on the surface . In corneas with high toxicity, the epithelial thickness profile along the steepest meridian may differ from the thickness profile along the flattest meridian . Moreover, in light of the studies by reinstein et al and kanellopoulos and asimellis the assumption that the epithelium thickness map is rotationally symmetrical may not be appropriate . By means of very high - frequency digital ultrasonography, reinstein et al found that the mean epithelial thickness at the corneal vertex was 53.4 4.6 m, and the average epithelial thickness map showed that the corneal epithelium was thicker inferiorly than superiorly (5.9 m at the 3-mm radius, p <0.001) and thicker nasally than temporally (1.3 m at the 3-mm radius, p <0.001). The location of the thinnest epithelium was temporally displaced on average 0.33 mm, and 0.90 mm superiorly with reference to the corneal vertex . They used spectral - domain anterior - segment optical coherence tomography and measured a mean epithelial thickness at the pupil center of 53.28 3.34 m, superiorly 51.86 3.78 m, and inferiorly 53.81 3.44 m . Both papers show high inter - individual variability of the central epithelial thickness and 3-dimensional epithelial maps . In theory, the above - mentioned findings may deteriorate the refractive results, predictability, safety, and efficacy of transprk ablations in comparison to the standard aaprk procedures . However, our clinical results analyzing largest material published so far, show the opposite . In our study in which the latest version of the tprk algorithm was used, we did not observe statistically significant differences between the tprk group and the aaprk group in terms of udva, cdva, and mrse, 3 months after the surgery . The correlation between attempted versus achieved mrse was very high in both groups with no statistically significant difference between the 2 groups . Shortly after the procedure was introduced, luger et al, aslanides et al, and fadlallah et al evaluated relatively small cohorts and came to the similar conclusions; in myopia and compound myopic astigmatism correction, the refractive and visual outcomes of single - step transepithelial prk are not different from those of conventional prk . However, luger et al reported that the postoperative mean spherical equivalent in tprk was slightly hyperopic at + 0.07 0.23 d. moreover, our results in both the tprk and aaprk groups were among the best achieved with surface ablation in terms of postoperative udva, postoperative refractive spherical equivalent, and refractive astigmatism . Unequal preoperative epithelial thickness might potentially also be a source of higher - order aberrations, but we did not find statistically significant differences in the preop and postop higher - order rms between the groups . Thus, the natural interindividual variability of epithelial thickness maps did not deteriorate the clinical results in the studied population in a noticeable way . One may expect that the epithelial map would have some similar features before and after the surgery, for example, the epithelium may be thicker inferiorly than superiorly and thicker nasally than temporally . Reinstein et al and kanellopoulos and asimellis confirmed thickening of the epithelium centrally and progressively less thickening centrifugally across the central 6 mm after myopic correction . In both studies, the epithelial thickness was averaged within annular bands centered on the corneal vertex; thus, these studies do not verify the above - mentioned hypothesis . Another potential disadvantage of transepithelial prk is the higher total excimer laser energy load . In our study, mean ablation time was 163% longer in the transprk group; however, the majority of the laser energy was delivered to the epithelium . Excimer laser energy, among other effects, causes increase of the temperature of the stromal tissue, which is the main risk factor for haze formation, an inherent complication of excimer laser refractive surgery . After surface ablation, up to 52% of eyes develop some degree of corneal haze in the first months, with values most often reported are within the range of 5% to 20% . In our study population up to 3 months after the surgery, haze was more often detected in the tprk group; however, the difference did not reach statistical significance (13.79% vs 8.89%, p = 0.09). In all eyes, the intensity of haze was very low, in almost all cases at the 0.5 level, and the difference in haze intensity between groups was not statistically significant . The nonsignificant differences in haze intensity in the 2 groups could be attributed to the use of mmc . It must be accounted here that the use of mmc does not allow us to evaluate haze formation for the 2 techniques in an unbiased way . A weak point of our study, except lack of randomization, is that the haze was evaluated subjectively with the slit lamp by an unmasked examiner . In our opinion, the intensity of haze after transepithelial prk and the impact of mmc on haze formation need to be further studied, preferably with masked examiners and with tools that provide objective measurements, like optical densitometry . There are statistical more females in tprk group, which may be a source of bias especially in pain evaluation, as pain perception may be positively influenced by female gender . High - resolution spectral optical coherence tomography (oct) with speckle contrast reduction also failed to detect differences in the corneal healing processes after tprk and aaprk, except for the shorter time to cover the stroma with epithelium in the tprk group . The main reason explaining this observation is that the diameter of epithelial removal matches the total ablation zone in transepithelial prk treatments, decreasing the wound surface, and shortening the epithelial closure time . Another advantage of tprk is reduced surgery time . In our study, the total surgery time was reduced by 35% in comparison to aaprk . Aslanides et al and fadlallah et al reported decreased postoperative pain after the single - step transepithelial prk; however, our results failed to confirm these findings . Transepithelial approaches allow maximum correspondence between the corneal topography and the ablation profile, which may be especially useful in customized treatments of irregular corneal astigmatism . The topographic map corresponds more closely with the epithelial surface than with the stromal surface since the epithelium acts as a natural mask, thinning over stromal protrusions and thickening over excavations . Several papers confirmed the value of customized, topography - guided transepithelial ablation in correcting irregular corneal astigmatism . However, in current transepithelial customized ablation profiles, a difference in photoablative rates of the stroma and the epithelial tissue cannot be compensated precisely as long as an epithelial thickness map is not taken into account . In the future, the advent of a high - resolution oct technique could allow proper representation of the epithelial layer, potentially leading to improved customized epithelial ablations . In conclusion, single - step transepithelial prk and conventional prk performed on regular corneas produce very similar results 3 months after the surgery . These procedures are predictable, effective, and safe for correction of myopia and compound myopic astigmatism.
|
Clinical and epidemiological studies have identified several factors that increase the risk of coronary heart disease and heart attack . These factors include gender, ageing, heredity, smoking, hypercholesterolemia, hypertension, physical inactivity, obesity and overweight, and diabetes mellitus . Risk factors often occur in clusters and may build on one another, such as obesity leading to diabetes and elevated blood pressure . When grouped together, as in the metabolic syndrome, these factors lead to an even greater risk of coronary artery disease . Special attention has been given to the effect of psychological stress, oral contraceptives, excessive alcohol intake, sleep apnea, elevated c - reactive protein levels, fibrinogen, homocysteine and lipoprotein and, finally the presence of an oxidative stress . Sies has defined oxidative stress as an imbalance between oxidants (e.g., free radical species derived from oxygen) and antioxidants in favour of the oxidants, leading to a disruption of redox signalling and/or molecular damage . A large number of studies have indicated that oxidative damages to proteins, lipids or dna resulting from an increased production of reactive oxygen species (ros) from pathological processes or external origins are involved in the development of cardiovascular diseases and cancer . To regulate ros production and fight against their deleterious effect, the organism responds with a large and complex battery of antioxidants including enzymes, proteins, iron chelators, low molecular weight compounds, trace elements, and antioxidants arising from our diet; among them, vitamins c and e, carotenoids and polyphenols are particularly important . Many epidemiological and clinical studies have also shown that the lower the antioxidant status, the higher the risk of developing cardiovascular diseases and cancer [313]. A few prospective, large - scale, european studies have shown a negative correlation between vitamin c plasma levels and all - cause or cardiovascular mortality . Plasma vitamin c levels below the normal range 48.8 mg / l (or 2350 m) were found to double the risk of developing cardiovascular disease and cancer [1418]. For -carotene, the upper reference limit was estimated to be 0.22 mg / l (or 0.4 m). Factors like male gender, age, race, body mass index (bmi), smoking, alcohol consumption, triacylglycerol concentration, and inadequate dietary antioxidant intakes contribute to lower plasma levels of antioxidants [1928]. To our knowledge, so far no study did investigate how lifestyle behaviours such as smoking, physical activity, and diet alone or in association contribute to reach critical vitamin c (<6 mg / l or 34.2 m) and -carotene (<0.22 mg / l or 0.4 m) levels . Currently, an increasing number of general practitioners strive to assess the antioxidant status of their patients for prevention purposes . In this respect this prompted us to undertake a wide epidemiological study based on a sample of the belgian population . Elan (etude ligeoise sur les antioxydants) is a cross - sectional epidemiological study conducted from march through july 2006 as a joint project between the university of lige, the university hospital of lige, and the public health services of the province of lige (belgium). The province of lige, one of the 10 belgian provinces, has 1.040.297 inhabitants for a geographic area of 3862 km . A stratified random sample of 55 general practitioners working in the province was selected as follows: 21 (38%) in urban environment, 15 (27%) in semiurban, and 19 (35%) in rural living environment . Each physician was asked to recruit in his / her practice 20 presumably healthy volunteers aged 4060 years . Exclusion criteria included intake of antioxidant supplementation and previous history of cardiovascular diseases, diabetesm or cancer . A total of 897 eligible subjects were finally enrolled in the study: 349 (39%) men and 548 (61%) women . The day before the examination visit, subjects fasted for at least 12 h and were not allowed to drink fruit juice and to perform physical activity . The day of the visit, information including age, height, weight, consumption of fruits and vegetable by means of a home - made questionnaire, and intake of alcohol and oral contraceptive pills was collected . The body mass index (bmi) smoking (yes / no) and physical activity (inactive or active 2 - 3 times a week) were also recorded . Social status was classified in 7 categories, as follows: professionals (i), managerial and technical occupations (ii), manual (iiia) and nonmanual skilled workers (iiib), partly skilled workers (iv), retired (va), and unemployed (vb). All contacted volunteers received written information about the goal of the study and signed an informed consent form prior to enrolment . They were immediately centrifuged on site and plasma was frozen as aliquots on ice packs coming from a 80c freezer and placed in a refrigerating box . For the assay of vitamin c, 0.5 ml plasma was immediately transferred to ice - cold tubes containing 0.5 ml of 10% metaphosphoric acid . Analyses were performed on the day of blood collection by a spectrophotometric method using the reduction of 2,6-dichlorophenolindophenol (perkin elmer lambda 40 norwalk, usa, sensitivity: 2 mg / l, inter- and intra - cv: 4 and 6%). Mg / l, inter- and intra - cv: 5.35 and 10.73%) was determined by hplc procedure (alliance waters, usa) coupled with a diode array detector (pda 2996, waters, usa). Both vitamin c and -carotene were analyzed in a routine way . Independently of gender, our reference values, as published earlier on a population of 128 healthy subjects, were 6.218.8 mg / l (35.3107.1 m) for vitamin c and 0.050.62 mg / l (0.091.15 m) for -carotene [31, 32]. Results were expressed as means standard deviation (sd) for quantitative variables, while frequencies and proportions (%) were used for categorical variables . Mean values between groups were compared by one - way analysis of variance or the kruskal - wallis nonparametric method if normality assumptions could not be fulfilled . Correlation coefficients (classical or spearman) were calculated for measuring the association between two quantitative variables . Logistic regression analysis was used to predict vitamin c and -carotene deficiency from risk factors . The association between deficiency and risk factors was measured by the odds ratio (or) and its 95% confidence interval . Calculations were always carried out on the maximum number of data available . Missing data were not replaced . Results were considered to be significant at the 5% critical level (p <.05). Data analysis was carried out using sas (version 9.1 for windows) and s - plus (version 9.0) statistical packages . The gender - specific demographic, biometric, and clinical characteristics of the study population are given in table 1 . In the elan population, respectively 27% of women and 25% of men were smokers . Height, weight, bmi, and both systolic and diastolic blood pressures were significantly higher in men than in women . The dietary intake of vitamin c and -carotene (mg / day) derived from fruits and vegetables consumption generally was significantly lower in men than in women (p <.0001). Table 2 displays vitamin c and -carotene mean levels with respect to subject's characteristics given in table 1 . As expected, vitamin c and -carotene values were lower by, respectively, 15 and 32% in men when compared to women (p <.0001). Smokers had significantly decreased vitamin c and -carotene levels by 19% (p <.0001) and 39% by contrast, regular physical activity was associated with a mean increase of 9% for vitamin c (p <.0001) and 25% for -carotene (p a positive relationship was demonstrated between the amount of daily fruit intake and both vitamin c and -carotene levels . The latter were, respectively, reduced by 27% and 46% (p <.0001) in non consumers when compared to people eating 2 - 3 fruits / day or more . The group apple - pear - grapes - banana, kiwi, citrus fruits, orange, and all kinds of red fruits and strawberry had a positive influence on vitamin c. in contrast, none of the vegetables except endives had a positive effect on vitamin c (data not shown). With respect to -carotene, apricot, the group apple - pear - grapes - banana, kiwi, citrus, mango, and orange contributed to improve the plasma level of -carotene but only asparagus, carrot, and tomato for vegetables (data not shown). Women taking oral contraceptive had significantly lower -carotene levels but vitamin c levels were unchanged . No relevant effect of blood pressure, intestinal disorders, environment, and age (<and> 50 years) has been evidenced on the plasma level of both studied antioxidants . Figure 1 depicts the distribution of plasma vitamin c and -carotene levels in men and women . Only 2.1% of the subjects had higher values than the upper reference value (18.8 mg / l). If a large majority (81.5%) of participants were within the recommended values in vitamin c (6.218.8 mg / l), it should be noted that 16.4% of them were, however, either in a subdeficiency (10.3%) or deficiency (6.1%) status with respect to the cutoff value of 6 mg / l (34.2 m). As far as the -carotene is concerned, a small portion of the study subjects (7.0%) had higher concentration in -carotene than the upper normal value (0.68 mg / l or 1.23 m) and more than 90% of the elan cohort had a plasma -carotene concentration within the conventional and usual values (0.050.68 mg it is worth noting that 46.7% of the studied population had plasma values below the critical point of 0.22 mg / l (0.4 m). By logistic regression analysis applied to vitamin c data (table 3), it was found that male gender (or = 1.70; p = .011), smoking (or = 2.84; p <.0001), lack of physical activity (or = 2.05; p = .0015), and intake of less than 2 fruits / day (or = 2.96; p = .0003) were significant risk factors of vitamin c deficiency . Overweight (or = 1.18; p = .42) and oc use for women (or = 1.24; p = .61) were not significant . When adding the social status, the risk of vitamin c was significantly increased (or = 1.34; p = .0044), when being unemployed compared to the other professional categories . For -carotene deficiency, logistic regression analysis showed that male gender (or = 2.67; p <.0001), smoking (or = 3.03; p <.0001), overweight (or = 2.28; p <.0001), lack of physical activity (or = 1.51; p = .0091), intake of <2 fruits / day (or = 1.41; p = .045), and oc use for women (or = 4.67; p <table 4 examines the probability of vitamin c and -carotene deficiency (i.e., lower than the critical values) with respect to an increasing number of risk factors . Healthy habits consisting in no smoking, practising a regular physical activity, and eating at least two fruits per day resulted in a weak probability (less than 5%) to have plasma vitamin c below 6 by contrast, poor healthy living habits (smoking, no physical activity, nonconsumption of fruits, and overweight) significantly increased this probability up to 46.2% for men against 33.5% for women . When accounting for unemployment, these probabilities raised to 66.3% for men and 44.3% for women, respectively . It should also be noted that men were always associated with higher probabilities of vitamin c levels below 6 mg / l than women (except those of social class iv and va) smoking, practising no physical activity, and eating none fruits regardless of the combination of lifestyle behaviours . For -carotene, healthy habits (nonsmoking, practising sport, and eating two or one fruits per day) resulted in 13.7% and 29.7% of chance to get critical level in -carotene for women and men, respectively . Smoking by itself significantly increased this probability but in a higher extent in men (56.1%) than in women (32.4%). The combination of smoking, absence of regular physical activity, and any intake of fruits contributed to a high probability in men (73.2%) and to a less extent in women (50.5%). The addition of overweight resulted in an increase of about 20% in women (69.9%) and of only 13% in men (86.1%). Finally, the worst situation (91.6%) was observed for women by adding the intake of oral contraceptive pills . It should be noted that for both genders, all probabilities were largely higher than those derived for vitamin c risk of deficiency . The reference values for vitamin c established by our group are comprised between 6.2 mg / l (35.3 m) and 18.8 mg / l (107.1 m). This is in agreement with other studies performed in different european populations [20, 35]. In the work of rutkowski and grzegorczyk, ten ranges of concentrations given by medical handbooks and textbooks have been compared in detail with 15 parallel ranges taken from scientific papers, paying attention to their significant discrepancies . Based on source values and basic statistical calculations, a reliable mean range of vitamin c normal concentrations " in blood plasma has been obtained: 6.314 mg / l (36.179.4 m). According to le grusse and watier, the critical range of accepted marginal vitamin c deficiency was between 3.5 and 6.2 mg / l (20 m35 m). For -carotene, we found the following normal range 0.050.62 mg / l (0.091.15 m) which is in good agreement with the study of olmedilla et al . Performed in five western european populations . With respect to gender, our mean values in antioxidants were in perfect agreement with those found in the reference french suvimax study (vitamin c: men: 8.8 4.0 mg / l; women: 10.6 5.5 mg / l; p <.0001; -carotene: men: 0.22 0.16 mg / l; women: 0.31 0.20 mg / l; p <.0001) [20, 38]. Fruits and to a less extent vegetables are the primary dietary sources of both antioxidants . As confirmed in table 1, it is recognized that women have dietary intakes richer in vitamin c and -carotene than men due to a higher intake of fruit and vegetables . As expected, our data clearly indicate that smoking was associated with a significant decrease of the mean plasma vitamin c (19%) and -carotene (39%) after adjustment for gender and all demographic variables described in table 1 . Our observations were in good agreement with other reports [26, 27] and, more particularly, the suvimax study performed on 3128 french men and women aged 3560 years . Cigarette smoke contains a large number of free radicals species able to induce an oxidative stress on both the respiratory and circulatory systems with as consequence greater antioxidant depletion . After adjustment for all covariates, we also evidenced that a regular physical activity contributes to improve the vitamin c and -carotene levels . A simple explanation could be given by the fact that active people eat more fruits than inactive ones . Southeast showing a significant association between fruit and vegetable consumption and physical activity (p <we also evidenced a positive relationship between the frequency of fruit and the mean plasma level of vitamin c and -carotene . When compared to high consumers, people eating any fruit were characterized by plasma concentrations of both antioxidants which are extremely closed to the normal inferior value . By contrast, we were unable to evidence an association between antioxidant biomarkers and the consumption of vegetables . Moreover, we also evidenced that only the intake of carrot and tomato among vegetables may significantly influence to a higher extent the plasma level of -carotene whilst a larger range of fruits were able to do it . It could be also possible that -carotene is a better predictor than -carotene as suggested in the european prospective investigation into cancer and nutrition (epic study) performed on a stratified random subsample of 3089 men and women . Ideal bmi is the range of 2025 kg / m while a bmi of over 25 kg / m and 30 kg / m is, respectively associated with overweight and obesity . As described earlier [41, 42], we confirmed that a bmi> 25 kg / m resulted in a significant decrease by 31% of the plasma -carotene level . The use of oral contraceptives had a deep negative impact on the plasma level of -carotene . It has been speculated that estrogens induce an activation of the retinol binding protein, hence possibly increasing the conversion of -carotene into retinol . We have also shown that women taking oral contraceptives had higher oxidative damages to lipids than the others . It could be assumed that part of the antioxidant defences were more solicited in women using oral contraception to limit deleterious damages . Neither blood pressure nor intestinal disorders (which could explain a decrease in antioxidants due to possible malabsorption) or environmental parameters had an influence on the mean plasma level of both antioxidants . Based on large - scale epidemiological studies, it is now accepted that an alteration of antioxidant defences was significantly implicated in the development of several pathologies . However, if some variations of the mean plasma values may be evidenced with respect to lifestyle behaviours in all studies, no indication was ever given about the biological interpretation of these variations . Therefore, the establishment of reference or usual values for antioxidants markers such vitamin c and -carotene is needed to detect abnormalities . As explained above, determination of normal ranges for both antioxidants has been achieved on a separate population of 128 healthy persons as earlier published [3133]. Based on our reference values, we were able to detect that 16.4% of the whole elan population had non optimal plasma concentration in vitamin c (<6 mg / l or 34.2 m) against 46.7% for -carotene (<0.22 mg / l or 0.4 m). At the light of the following but not exhaustive studies, the evidence of such abnormalities could therefore be of primordial interest as a preventive tool for health [44, 45]. Recently, langlois et al . Proposed that plasma vitamin c should be considered as a predictor of cardiovascular disease in addition to being a classical nutritional biomarker . Based on a large number of studies including the famous monica study [14, 18] performed on 14 european populations, plasma cutoff levels (4.47.0 mg / l or 2540 m) in vitamin c have been proposed, above which the risk for apparent cardiovascular events should decrease . In haemodialysis patients, the cutoff value of 5.66 mg / l (32 m) was predictive of the appearance of adverse cardiovascular outcomes . In patients with peripheral arterial disease, the cutoff value of 4.9 mg / l (28 m) was associated with increased levels of inflammation parameters . Recently, myint et al . Described in the european prospective investigation into cancer (epic)-norfolk population that the relative risks for risk of stroke diminished inversely to the quartile of plasma vitamin c concentration as follows: 1.0 (<41 m or 7.27 mg / l), 0.83 (4153 m or 7.279.32 mg / l), 0.63 (5465 m or 9.5 or 11.44 mg / l), and 0.57 (> 66 m or 11.6, it was interesting to highlight that there was a continuous relation with mortality through the whole distribution of ascorbic acid concentrations . When compared to 3.66 mg / l, each 3.52 mg / l (20 m) rise in plasma ascorbic acid concentration was associated with about a 20% reduction in risk of all - cause mortality (p <.0001), regardless of age, systolic blood pressure, blood cholesterol, cigarette smoking habit, diabetes, and supplement use . For -carotene, gey established that a plasma value below 0.22 mg / l (0.4 m) was associated with an increased risk of developing cardiovascular diseases and cancer . Among the elan population, 16.4% of the subjects presented a plasma vitamin c below the cutoff value of 6 mg / l (34.2 m) and 46.7% a concentration in -carotene below the critical point of 0.22 mg / l (0.4 m). The availability of a statistical model for predicting the probability of getting a plasma value below the cutoff values of 6 mg / l (34.2 m) for vitamin c and 0.22 mg / l (0.4 m) for -carotene could be of interest for health prevention . Cumulative probabilities were therefore presented instead of odd ratios to stress on the cumulative effect of the risk factors on low levels in both antioxidants . After adjustment for all covariates between them, table 3 clearly indicates that using such values rather than mean plasma value afforded better indications about the relationship between antioxidant biomarkers and lifestyle behaviours . A good base of healthy life could be nonsmoking, regular physical activity and eating more than 3 fruits / day . This resulted in a small probability to have inadequate plasma level of vitamin c. smoking and nonphysical activity significantly but moderately contributed to increase this probability for vitamin c for both genders . In contrast, the nonconsumption of fruits added to the parameters above produced a dramatic increase which was more pronounced in men (42.1%) than in women (30% only for those belonging to social classes i, ii, iiia, and iiib). This suggests that the frequncy of fruit intake appears to be one of the most important regulators of the plasma concentration of vitamin c [50, 51] with a more pronounced effect in men (65.3%) having partial or no working activity . Economical difficulties to buy fruits linked to a precarious social status can explain this last observation . As observed with the mean plasma values, no effect of bmi, intestinal disorders, and environment could be evidenced on the probability to get low plasma level in vitamin c. with respect to -carotene, it was quite interesting to note that despite a healthy way of life there was a significant risk (29.7% in men and 13.7% in women) to get a value below 0.22 mg / l (0.4 m). Malabsorption of this antioxidant could be a rationale explanation although we did not find any influence of intestinal disorders on the plasma level of -carotene . When compared to basal level and according to the different steps described in table, smoking contributes to a mean increase of 27% for men and 18% for women of getting critical plasma value . This is not surprising since the negative impact of smoking on antioxidant is well known . Lack of physical activity was associated with a further but moderate increase of around 9% . This was less pronounced than those observed for vitamin c confirming that the latter is a better biomarker than -carotene of fruits intake . Kg / m and oral contraceptives in women, significantly contributed to finally reach a high probability (86.1% for men and 91.6% for women) to detect nonoptimal plasma value in -carotene . Although representative of the province of lige, the study sample may not be considered as a national probability sample of the belgian population . Moreover, we only focused our attention on people in the age range of 4060 years since we considered that lifestyle behaviours were well anchored in this population . It is clear that ageing (> 60 years) could also contribute to decrease the plasma level in antioxidants so that our observations in the elan population could be modified if taking this parameter in account . We only distinguished nonsmokers from both past and current smokers, this last one category being, however, in a large majority in the elan population . Further, no question has been addressed with respect to environmental tobacco smoker which could possibly have a negative influence on plasma antioxidants . During our study, we also met some difficulties to integrate data about alcohol consumption due to a large underestimation of intake made by participants . As this parameter has been shown to reduce the level of plasma -carotene, it could partially explain the relatively high probability of getting a value below 0.22 mg / l (0.4 m) even when observing optimal lifestyle behaviours (no smoking, physical activity and eating more than 2 days a day). Except for oral contraceptive, the influence of other drugs intake was not taken into consideration . To the best of our knowledge, the present study is the first one to address the relationship between plasma antioxidants and lifestyle behaviours in a belgian population . We have demonstrated that smoking regular physical activity and eating fruits were directly associated with the modulation of the mean plasma concentration of both vitamin c and -carotene . However, such variations, if well described in the literature, always remained within the normal or usual range of concentration . By using cutoff values associated with increased risk of developing cardiovascular diseases and cancer (vitamin c <0.22 mg / l or 0.4 m), we described how lifestyle factors alone or associated contribute to lower plasma concentrations . However, as vitamin c and -carotene are unstable constituents when not protected against air and light, a rigorous preanalytical sample handling and treatment (immediate centrifugation, plasma precipitation and keeping the sample at 80c until analysis) is required to interpret the data correctly . The elan (etude ligeoise sur les antioxydants) study was conducted from march through july 2006 as a joint project between the university of lige, the university hospital of lige, and the local health services of the province of lige (belgium). Sc j pincemail (credec and dept of cardiovascular surgery) were the main coordinators of the elan study . Professor c charlier and professor jp chapelle (laboratories of clinical biology) allowed the analysis of -carotene while vitamin c determination was performed by mr jp cheramy - bien (credec). G collette (dept of general medicine) allowed the recruitment of all general practitioners around the province of lige, belgium . Sc s vanbelle (dpt of medical informatics and biostatistics) were involved in the statistical analysis of all data . All investigators critically revised the manuscript for the intellectual content and gave their final approval of the version to be published.
|
Introduction of ocular response analyzer (ora) provided a simple but reliable method to assess the cornea in clinical settings as well.1 keratoconus is a noninflammatory disease, which affects mainly the central cornea and leads both anatomical and biomechanical changes in corneal tissue.2 corneal hysteresis (ch) and corneal resistance factor (crf) are biomechanical markers that are measured using ora and decline in cornea with keratoconus compared to the healthy corneas.34 the eye with keratoconus, as a result, become more elastic and less rigid than normal eyes.5 the biomechanical properties of the cornea are primarily determined by the collagen fibers within the stroma and degree of interfibrillar linkage.6 the visual acuity (va) due to irregular astigmatism and corneal scarring, the va declines . Transepithelial collagen cross - linkage (cxl) is a widely used method to increase the mechanical stiffness of the cornea . The stability of ch in adult eyes with keratoconus was demonstrated by using biomechanical strain measurements.78 this treatment modality is also introduced for children with keratoconus.910 however, to the best of our knowledge, corneal biomechanical changes and anterior segment changes in eyes of children with keratoconus . To treat children with keratoconus, transepithelial cxl is preferred as it is technically simpler and less invasive than epithelial off cxl and has less postoperative pain and corneal haze.78 we studied the stability of transepithelial cxl treatment over time using changes in ch and crf as indicators for biomechanical changes in the corneal tissue of children with keratoconus . This case series was conducted between may 2012 and october 2013 focusing on children aged <18 years and with progressive keratoconus . The study was approved by the hospital medical and ethical committees . After receiving a detailed description of the nature of the treatment, children with a corneal thickness of at least 400 m at the thinnest point of keratoconus were included . Progressive keratoconus was defined as one or more of the following changes over a period of 24 months: if in 24 months, there was increase of> 1 diopter (d) in the steepest keratometry, an increase in> 1 d in manifest cylinder or an increase> 0.5 d in manifest refractive spherical equivalent, we considered keratoconus to be of progressive nature . Eye with corneal thickness of <400 um at the thinnest point, history of viral keratitis, severe dry eye, concurrent corneal infection, central or paracentral corneal opacities, previous ocular surgery, and contact lens wear for fewer than 4 weeks before baseline examination were excluded from the study . Patients were evaluated before and 1, 3, 6, and 12 months after transepithelial cxl . A complete ophthalmologic evaluation included slit lamp biomicroscopic (name of slit lamp and country) and fundus examination (name of the instrument, company, and country). The corneal and anterior chamber evaluation was also conducted using scheimpflug imaging device (oculus pentacam, optikgerate gmbh, wetzlar, germany). The axial length (al) was measured with an intraocular lens master (carl zeiss meditec, jena, germany) and corneal optical coherence tomography (oct), (visante oct, carl zeiss meditec, jena, germany) and evaluation of the biomechanical properties of the cornea with ora (ora; reichert ophthalmic instruments, buffalo, ny, usa). Pain assessment was done postoperatively with visual analogue scale . As specified by touboul et al.11 using a bidirectional applanation measurement, the ora was able to present four different parameters: ch which is the difference between inward applanation amplitude peak 1 and outward applanation amplitude peak 2 (p1p2), which is related to the viscous dampening property of the corneal tissue which is likely linked to the stromal collagen nature and state of hydration12crf which is indicative of the overall resistance of the cornea and is calculated using a linear combination of peak 1 and peak 2 (p1kp2), and more heavily weighted by the underlying corneal elastic properties13corneal compensated intraocular pressure (iopcc) and goldmann correlated intraocular pressure (iopg) measurement is strongly correlated with goldmann tonometry and is also calculated using a specific linear combination of peak 1 and peak 213amplitude of the peaks (peak 1 and peak 2) is a function of how much light hits the infrared detector during each applanation event and it is corresponding to the first inward applanation event, and the second inward applanation event, respectively.14 ch which is the difference between inward applanation amplitude peak 1 and outward applanation amplitude peak 2 (p1p2), which is related to the viscous dampening property of the corneal tissue which is likely linked to the stromal collagen nature and state of hydration12 crf which is indicative of the overall resistance of the cornea and is calculated using a linear combination of peak 1 and peak 2 (p1kp2), and more heavily weighted by the underlying corneal elastic properties13 corneal compensated intraocular pressure (iopcc) and goldmann correlated intraocular pressure (iopg) measurement is strongly correlated with goldmann tonometry and is also calculated using a specific linear combination of peak 1 and peak 213 amplitude of the peaks (peak 1 and peak 2) is a function of how much light hits the infrared detector during each applanation event and it is corresponding to the first inward applanation event, and the second inward applanation event, respectively.14 in order to ensure accurate results, ora was done 4 times for each eye, by the same operator . Signals that differ significantly in appearance from the other signals from the same eye were deleted . Transepithelial cxl is similar to dresden protocol (epithelium off) in conventional cxl but we used epithelium on technique without removal of the epithelium and with the use of transepithelial riboflavin (ricrolin te, riboflavin 0.1%, sooft, oofta, italia) which is currently available as a formula containing riboflavin 0.1% and enhancers . The presence of the amino alcohol improves bioavailability and, in combination with enhancers such as ethylenediaminetetraacetic acid disodium salt, enables transepithelial penetration through the intact corneal epithelium . Postoperative treatment comprised moxifloxacin 0.5% eye drops, diclofenac 0.1% eyedrops (voltaren), and lubricant eye drops (tears naturale, alcon laboratories, inc ., uk) for 1-month . Primary outcome measures: changes from baseline in ch, crf, and peak 1 . Failure of treatment was considered if there was loss of one or more line of va, progression of k reading> 1 d in the steepest keratometry, an increase in> 1 d in manifest cylinder or an increase> 0.5 d in manifest refractive spherical equivalent after 12 months of follow - up . The student's t - test for paired data was used to compare preoperative data and postoperative data . The results were considered statistically significant at p <0.05 and highly significant at p <0.001 . Biomechanical, pachymetric, va, and refractive values were compared between baseline and postoperative examination and analyzed . To analyze the possible correlation of central corneal thickness (cct), cxl outcomes, oct, and ora measurements, the mean age of the 18 boys and 4 girls was 15.7 2.1 years (range: 1318 years). The mean follow - up was 15.0 3.4 months (range: 1216 months). The differences between baseline and 12 months postoperatively were not statistically significant for all parameters (p> 0.05). They had all significantly increased at 1-month follow - up (p <0.05). Peak 1 and peak 2 were statistically significant changed from 1-month to 12 months of follow - up (p <0.05). Preoperative and postoperative ora and refractive data after transepithelial cxl 12 months after transepithelial cxl, the mean improvement in the uncorrected distance visual acuity (udva) was 0.27 logmar (p <0.05). There was a one - line improvement in udva of 13 eyes (59.1%). There was no statistically significant change from the preoperative cdva (p> 0.05). All eyes achieved a cdva of 20/50 or better . In 4 eyes (18.18%) figure 1 showed the changes in ch and crf versus time in cross - linked keratoconic patients and figure 2 showed the changes in va versus time in cross - linked keratoconic patients . Change in corneal hysteresis and corneal resistant factor versus time in cross - linked keratoconic patients change in visual acuity versus time in cross - linked keratoconic patients the pachymetry map showed statistically significant change in cct after 1-month (p = 0.04), but not after 12 months (p = 0.7) [table 2]. The mean changes in the absolute curvature in maximum k values after 12 months was 2.3 1.4 d (p there was no significant change in the posterior elevation at the thinnest location (p> 0.05 give exact value). Preoperative and postoperative anatomical data after transepithelial cxl no statistically significant changes during 12 months follow - up were observed in al, corneal volume (cv), anterior chamber volume (acv), anterior chamber depth (acd), and endothelial cell count (ecc) (p> 0.05) as shown in table 2 . Ch and crf at baseline and 12 months were significantly correlated with cct at baseline and 12 months, respectively (chbaseline with cctbaseline = 0.72, p <0.001; ch12 with cct12 = 0.53, p <0.001; crfbaseline with cctbaseline = 0.63, p <0.001; and crf12 with cct12 = 0.51, p <0.001) [table 2]. The changes in ch and crf between baseline and 12 months were not correlated with the changes in ucva (rch= 0.06, p = 0.6; rcrf= 0.10, p = 0.4), cdva (rch = 0.03, p = 0.8; rcrf = 0.01, p = 0.9), or kmax (rch= 0.02, p = 0.8; rcrf = 0.02, p = 0.9). There was no statistically significant difference in cct in comparison with pentacam measures in all the follow - up (p> 0.05). The mean depth of the corneal stromal demarcation line measured by the first observer was 202.61 21.07 m (range, 186307 m) centrally . Figure 3 showed the demarcation line in one cross - linked patients . The cxl demarcation line depth and change in cdva (r = 0.16, p = 0.325) and change of the steepest keratometry at 6 months (r = 0.084 corneal optical coherence tomography of one patient 6 months post transepithelial corneal collagen cross - linking with demarcation line at a depth of about 300 um postoperative pain was mild ranging from 0 to 2 which disappeared with a simple analgesic in the first 48 h. transepithelial cxl is a promising new treatment for stabilization and strengthening of the cornea in keratoconus in pediatric age group.910 no previous study evaluated the corneal biomechanical changes and anterior segment changes in keratoconus in pediatric age group . In this study, the in vivo biomechanical measurements, ch and crf remained unchanged 12 months after transepithelial cxl (p> 0.05) although they were both significantly increased at 1-month follow - up (p <0.05). The lack of significant changes in ch and crf after 12 months in our study with epithelium on cxl on keratoconus on pediatric age group was consistent with previously reported ora results in cxl in keratoconus which showed an increase in corneal biomechanical strength that occurred 1-month after epithelium - off cxl in adult.1516 of note, this was concomitant with the statistically significant correlation with corneal thinning that is seen 1-month post cross - linking . Absence of significant changes in ch and crf after 12 months also might be explained by the change in stiffness which might be less than that which can be measured by the sensitivity of the ora, or it might indicate that transepithelial cxl changed both elasticity and viscosity in a manner that was not detected by the viscoelastic parameters, ch, and crf or due to change in collagen fiber orientation which becoming more regular as they are cross - linked.17 it is also possible that the biomechanical changes after transepithelial cxl are inherently different than those measured by ch and crf, and therefore, these metrics may not capture the true biomechanical effect of transepithelial cxl over time . Penetration of the cross - linking is detected by demarcation line in anterior segment oct . Found that the mean demarcation line with epithelium on cxl was located at a depth of 317 um from the surface which is similar to that seen in epithelium off cxl.18 this was comparable with the mean demarcation line depth in our study . The pachymetry map showed a statistically significant reduction in cct at 1-month followed by nonstatistically significant change in the cct after 12 months (p> 0.05). This could correspond to the apoptosis that occurred after the treatment (13 months) followed by repopulation that occurred thereafter (612 months). Wollensak et al.19 found that this apoptotic cell death occurs after exposure to uva light . Peak 1 and peak 2 were statistically significant changed from 1-month to 12 months of follow - up (p <0.05). The peak 1 and peak 2, have been shown to correspond to corneal stiffness which was known to increase significantly after transepithelial cxl.910 this was in agreement with other studies in transepithelial cxl in keratoconus in adult20 and conventional cxl.162122 in our study, we found no correlation between ora, va, and topographic measurements . This might be related to two factors, the first may be a change in collagen fiber orientation with the collagen fibers becoming more regular as they are cross - linked which made stiffness of the superficial corneal layers that could halt the keratoconus progression and improve the regularity of the corneal surface . The second may be the correction of irregular astigmatism in the central area and equal reduction of the flat corneal meridian and steep corneal meridian, which resulted in a significant reduction in the spherical error without a significant change in the cylindrical error . This was in agreement with caporossi et al.23 the mean change in the absolute curvature in maximum k value was 2.3 1.4 d which was statistically significant (p <0.05). This finding was also addressed by caporossi et al.23 who recorded a topographic mean reduction in dioptric power of 2.1 0.13 d in the central 3.0 mm and greenstein et al.24 the observed reduction in k value was probably the result of the increased biomechanical stability of the cornea after cxl.25 no statistically significant changes during 12 months follow - up were observed in al, cv, acv, acd, and ecc (p> 0.05). This was in agreement with other studies of transepithelial cxl in the adult.2021 this stability of al and biomechanical corneal properties confirmed the effectiveness of transepithelial cxl treatment without affecting in a negative way the corneal elasticity . Iopcc and iopg did not change significantly over the 1 postoperative year (p> 0.05), except during the 1 postoperative month which was in agreement with other studies in adult.11121326 this may be due to measurement artifact resulting from corneal changes or true elevation of iop, which return to normal range after 1-month with topical timolol 0.25 mg once daily eye drops . In our study, no case recorded failure according to visual and topographic measures in the 1 year of follow - up . Transepithelial cxl in keratoconus in pediatric age group has a good stability in corneal biomechanical parameters . A multicentre clinical trial with longer follow - up needed to study the persistent of this effect for a longer duration.
|
The first reports of the existence of a factor stimulating blood formation were reported in 1906, when carnot and deflandre discovered the substance in rabbit blood and called it hematopoietin . However, the relationship between erythropoiesis and hypoxia were discovered a just few years earlier in 1893 by meischer . In 1948, bonsdorff and jalavisto introduced the concept of erythropoietin and its effects closely linked to red blood cell synthesis . The humoral nature of erythropoietin was documented in 1953 by allan erslev, who, 2 decades later, thanks to a new northern blot technique, detected erythropoietin mrna . The first human epo was isolated from urine of patients with pernicious anemia in 1977, following successful isolation of the hormone from the serum of anemic sheep in 1962 by goldwasser . Two scholars, lin and jacobs, independently of each other, isolated and cloned the gene encoding erythropoietin in 1985 . For the first time in humans, epo was used in clinical trials in 1986 by winearls and eschbach . Erythropoietin is a glycoprotein that is hydrophobic, heat - stable, and insensitive to ph changes . Epo is synthesized mainly by fibroblast - like cells in the human renal cortex and outer medulla (approximately 8090% of total production) and in the liver (the remaining 1020%). A small amount of epo mrna was demonstrated in lung, testis, spleen, vascular endothelial cells (mostly capillary), placenta, uterus, and brain of experimental animals subjected to hypoxia . Epo is a 193-amino acid glycoprotein, of which 27 n - terminal residues of a signal sequence allow the transport of newly synthesized protein across cell membranes . After proteolysis of the signal peptide, the new pro - peptide is formed with arginine located at the c - terminus . Mature epo -165 amino acids glycoprotein is formed by the action of carboxypeptidase, which hydrolyzes the c - terminal arginine residue . The main factor governing the rate of epo production in the kidney is the concentration of oxygen . The increase in epo synthesis in response to hypoxia is regulated by hypoxia - inducible factors (hifs). The rate of epo secretion depends only on its synthesis rate, because there are no intracellular stores of this hormone . The epo gene is located on chromosome 7 (locus 7q11-q22) and contains 4 key sequences . The kidney - inducible element (kie), responsible for gene expression in the kidney, is located at the end of the 5 sequence of the gene . The negative regulator element (nre) is located closer to the transcription start site sequence (between 400 and 6000 base pair). The nre is responsible for inhibition of epo gene expression in organs that do not have the ability to synthesize epo . Epo is composed of a polypeptide chain and 60% by weight of the molecule consists of 4 carbohydrate chains, which is accompanied by the presence of sialic acid residues (with a maximum number of 14 in the molecule). Greater attached sialic acid - containing carbohydrate content of the molecule is associated with lower affinity for epo - r, but a longer half - life and more effective stimulation of erythropoiesis . There is no difference in sequence of amino acids between recombinant human epo (rhuepo) alpha and natural epo synthesized in the human body . The exception may be darbepoetin alpha, which was engineered to contain 5 n - linked carbohydrate chains (2 more than in rhuepo) and sialic acid residues for a total of 22 . The effect of the changes was to extend operating time and increased biological activity in vivo . Therefore, the newly formed erythropoietin has less affinity for epo - r and has an approximate 3-fold longer serum half - life, with greater in vivo potency . In terms of chemical molecule, . However, to designate the whole group of erythropoietic molecules, the term erythropoiesis - stimulating agents was introduced . Currently, the group of erythropoiesis - stimulating agents include: epoetin alpha (eprex), epoetin beta (neorecormon), epoetin delta (dynepo), darbepoetin alpha (aranesp), and methoxy polyethylene glycol - epoetin beta (mircera). The latter of these compounds is epoetin beta after chemical modification consisting in attaching, via amide bridges, to 30 kda polypeptide chain methoxy polyethylene glycol molecules . Therefore, the newly formed substance is characterized by even longer duration of action than epoetin beta . Due to its properties, current production of the new esas, known as biosimilar medicines, is the result of the expiration of patent protection for drugs produced by biotechnological methods in the pharmaceutical industry . An example is binocrit, which after establishing bioequivalence to the original prototype eprex has been registered by the european medicines agency (ema). During the last decades most of the studies have documented hematopoietic properties, including their safety and only a few non - hematopoietic abilities of epo in a variety of tissue . The main indication of epo in patients remains the same to treat renal anemia and anemia associated with chemotherapy . However, non - hematopoietic properties of epo and the wide - spread distribution of epo - r on renal cells, endothelial, and vascular smooth muscle cells, cardiomyocytes, cardiac fibroblasts, mononuclear cells, gastric cells, retinal and prostate cells, human hair follicles, and auditory hair cells in the inner ear, as well as the central and peripheral nervous system [10,1922], raised the possibility that epo may exert broad protective actions on many targets, including nephroprotection . Nephroprotection is any kind of activity including both non - pharmacological and pharmacological strategy for treatment that minimizes adverse effects, especially due to ischemia or oxidative stress on renal vasculature and renal cells or glomerular and interstitial inflammation with subsequent fibrosis or influence on apoptotic processes, which thereby contributes to progressive renal function loss . Epo - dependent protection may be due to direct impact of epo on the kidney or indirectly through the impact on other organs and tissue by acting on different mechanisms mentioned above, which are jointly responsible for renal injury and progressive renal function loss . The discovery of epo - r in the kidney suggested that epo may act directly in the autocrine - paracrine mechanism within the kidney mediates cytoprotection . Epo - r is expressed by mesangial cells, proximal and distal tubular cells, and the collecting duct cells . The same epo - r was also detected in kidney cancer cells and in cyst epithelia from polycystic kidneys . Scientific reports indicate that in ischemic aki, renal synthesis of epo is significantly decreased, whereas epo - r level stay unchanged; thus, a cytoprotective effect may take place by administration of exogenous epo . Studies performed on animal models revealed a protective effect of epo in the experimental setting of ischemic, septic, hemorrhagic, radio contrast media, and toxic cisplatin mechanisms of acute kidney injury . In another study, the cytoprotective effect was achievable both 30 min and 6 h after ischemic kidney injury compared with the respective control group . In all of the above - mentioned studies, epo had no effect on hb concentration within the time frame of the studies [2326]. Thus the nephroprotection may occur at an early stage, without an increase in hemoglobin levels, which in turn proves that these mechanisms do not strictly depend on the hematopoietic properties of epo - r . However, a study in which investigators performed a double - blind placebo - controlled trial to assess whether early treatment (within 6 h of injury) with high doses of epo (up to 50,000 u) could prevent the development of aki in intensive care unit patients failed to demonstrate effectiveness . High doses of epo did not alter the outcome of aki in patients group receiving epo compared with patients group receiving placebo . Epo did not cause epo - related adverse events and early intervention with high doses of epo was safe . However, this study had a limitations a composite of 2 biomarkers (the proximal tubular brush border enzymes gamma - glutamyl transpeptidase and alkaline phosphatase) was insufficient for risk stratification in a patient population with heterogeneous onset of aki . Therefore, a more precise application of biomarkers in different clinical settings of aki could confirm earlier results obtained in animal models . The nephroprotective effects of epo in ckd patients have been poorly studied, perhaps because the therapeutic efforts in ckd patients were made only to correct anemia and the putative ischemic renal tissue damage as a result of anemia . Some results from recently published large trials in patients with ckd revealed no beneficial effect on progression ckd . However, a study by gouva et al ., in which epo therapy was started in ckd patients with only mild to moderate anemia to correct hemoglobin to subnormal levels over a period of 6 months, revealed a significant reduction of the progression of renal disease and delays the initiation of renal replacement therapy in the group of epo - treated patients . The best example of the indirect nephroprotection achieved by epo is its impact on the cardiovascular system, where epo treatment is associated with improved left ventricular ejection fraction . Strengthening myocardial function, epo increases renal perfusion in patients with chronic heart disease (chd) and anemia . Moreover, epo treatment is responsible for reduction in left ventricular mass index (lvmi), which is associated with the increase in both all - causes and cardiovascular survival rate . Patients with ckd are at increased risk of cardiovascular adverse events, particularly dialysis patients, whose mortality may be up to 100 times greater than for the general population . Furthermore, epo acting on endothelial progenitors, enhances reendothelialization via akt - endothelial nitric oxide synthase activation and prevents neointimal hyperplasia . Erythropoietin also improved skeletal muscle microcirculation through the activation of enos in an animal model . However, epo administration in patients with stemi, treated with pci, was not associated with reduction of the infarct size in contrast to higher rates of adverse cardiovascular events, particularly increased infarct size among older patients . Some studies indicate that long - term administration of epo may have the potential to affect plaque stability . Statins in dialyzed patients demonstrate nephroprotection associated with lower inflammation and erythropoietin responsiveness index [3941]. Chronic inflammatory processes frequently occur in patients with ckd; they are particularly more common in patients with end - stage renal disease [4143]. The presence of immune disorders is the result of uremic toxins and immune cell activation by dialyzer membranes in patients undergoing hemodialysis . Epo therapy in hemodialysis patients restores the ratio of cd4+/cd8 + to the normal level, although at the expense of decrease in cd8 + cells and increase in cd4 + . Increased production of antibodies is also indirectly dependent on increased activity of helper t lymphocytes . Pro - inflammatory cytokines such as interferon- (ifn-), tumor necrosis factor (tnf), interleukin-1, and 6 (il-1 and il-6) are responsible for inhibiting the synthesis of epo, which was revealed in studies both in vitro and in vivo . Tnf exerts its biological activity by signaling via its 2 receptors, tnfr-1 and tnfr-2, and by activating nf - kappab, which is essential for survival of many cell types . There more, the action of tnf has both apoptotic and anti - apoptotic consequences due to altered balance between different cell signaling pathways . Moreover, tnf- and fas are the main activators of extrinsic apoptosis pathway, which occurs through the activation of so - called death receptors, which are cell surface receptors that transmit apoptotic signals after ligation with specific ligands . Death receptors belong to the tnf- receptor gene superfamily, including tnfr-1, fas / cd95, and the tnf - related apoptosis - inducing ligand (trail) receptors dr-4 and dr-5 . Ifn-, tnf-, trail, and il-1 are cytokines responsible for the inhibition of proliferation and differentiation of erythrocytes progenitors . Therefore, anemia is partly due to the induction of apoptosis and inhibition of cell growth, and decreasing the amount of epo - r is the result of the local action of cytokines and iron metabolism . Epo modifies the cellular inflammation process by inhibiting the expression of pro - inflammatory cytokines il-1 and tnf- and decreased pro - inflammatory mediators such as osteopontin and c - reactive protein . One of the mechanism of epo protection against tnf- depends on no derived from endothelial cells . Low - dose darbepoetin alpha treatment significantly ameliorated acute tubular injury and interstitial inflammation through increasing the survival of tubular cells and contributed to preservation of peritubular capillaries and reduction of interstitial fibrosis in a mouse model of aristolochic acid nephropathy . Vascular and tissue protection is associated with persistent stimulation of the pro - survival akt signaling pathway by darbepoetin alpha . Furthermore, epo treatment is responsible for the decreased pro - fibrotic mediators (transforming growth factor - beta1 and transforming growth factor - beta1-inducible gene - h3), which cause fibrosis with subsequent progressive renal function loss . Oxidative stress is the result of the lack of balance between the generation of reactive oxygen species (ros) and the existing antioxidative defense mechanisms . Oxidative stress plays an important role in the pathogenesis of many diseases, including tissue injury . Ros are responsible for destruction of mesangial cells by altering lipid metabolism, as observed in patients with glomerulonephritis and nephritic syndrome . Inactivation of nitric oxide by superoxide anion radical increases vascular resistance in renal arteries and contributes to the development of hypertensive nephropathy . Oxidative stress is well documented as an important factor in the development and progression of diabetic nephropathy, which is one of the main causes of ckd . Pro - inflammatory processes with subsequent activation of free radical processes play important roles in destruction of the kidney structure and in urinary system infections . Oxidative stress may also play a key role in the development and progression of chronic allograft nephropathy (can). Some studies have indicated that epo may prevent the overproduction of reactive oxygen species in diabetes nephropathy . Erythropoietin delta protects human renal tubular epithelial cells against oxidative stress by a dose - dependent inhibition of reactive oxygen species formation . This protective effect is possibly related to the membranous expression of the epo - r . Oxidative stress reduction is associated with the upregulation of renoprotective genes such as heme oxygenase-1 (ho-1), aquaporin-1 (aqp-1), and b - cell cll / lymphoma 2 (bcl-2), carboxypeptidase m (cpm), and dipeptidyl peptidase iv (dppiv). Erythropoietin molecule binding to epo - r causes the homodimerization on epo binding, followed by autophosphorylation of janus tyrosine kinase-2 (jak-2). Jak-2 activation leads to phosphorylation of several downstream signaling pathways, including ras - mitogen - activated protein kinase (mapk) and phosphatidylinositol-3-kinase (pi-3-k). Another important element in signal transduction by the jak-2 is a signal transducer and activator of transcription 5 (stat 5), which affects the activity of the genes bcl-2 and bcl - xl . With the conversion of phosphatidylinositol dependent on pi-3-k and activation of serine / threonine kinase akt, comes the induction of bcl2 family of proteins, which in turn are responsible for the inhibition of apoptosis the cell death program triggered by activation of certain proteases (caspases). Internal damage to the cell causes a protein, bax, to migrate to the surface of the mitochondrion, where it inhibits the protective effect of bcl-2 and inserts itself into the outer mitochondrial membrane, causing cytochrome c to leak out . The released cytochrome c binds to the apoptotic protease - activating factor-1 (apaf-1). Bcl-2 and bcl - xl can bind to the c terminal part of apaf-1, thus inhibiting the association of apaf-1 with caspase-9 . Caspase-9 is one of a family of over a dozen caspases that play a key role in the intrinsic (mitochondrial) pathway of apoptosis . Evaluation of epo renoprotection in renal transplant recipients showed a beneficial effect in preventing chronic renal allograft injury . These protective effects of epo were associated with preservation of intragraft expression of angiogenic factors, upregulation of the anti - apoptotic factor p - akt in tubuli, and increased expression of bcl-2 . Epo plays an important role in the proliferation and differentiation of marrow - derived mesenchymal stem cells (mmscs) under the aki microenvironment . Proliferation ability of mmscs treated with the ischemia / reperfusion (i / r) kidney homogenate supernatant decreased significantly and the apoptosis percentage was significantly higher . Epo decreased the expression of caspase-3 of mmscs under the aki microenvironment in a dose- and time - dependent manner, but increased the bcl-2 expression . 6-ohda decreased phosphorylation of glycogen synthase kinase 3 (gsk3) and increased the level of bax in the mitochondria, which inhibit the protective effect of bcl-2 . Therefore, administration of epo upregulated bcl-2 expression and concurrently diminished expression of bax, resulting in a net decrease in the ratio of bax to bcl-2 protein concentrations . Patients with ckd are a specific group with a high rate of comorbidity, dominated by cardiovascular disease and other diseases associated with dysfunction of the immune system, which leads to prolonged inflammation and abnormal response to infection . The conclusions of the large randomized clinical trials evaluating the effects of epo - treated patients with ckd and concomitant diseases, have certainly contributed to the development of research on the use of epo beyond its non - hematopoietic properties . Nephroprotective effects of epo are achieved by widely related mechanisms of reduction of oxidative stress, apoptosis, and ischemic / reperfusion injury, promotion of vascular repair, or balance of the inflammatory response with subsequent reduction of glomerular and tubular fibrosis . However, the clinical use of epo must be balanced against possible adverse effects, especially as relatively high doses of epo have often been administered to correct anemia of chronic kidney disease . In the light of randomized clinical trials evaluating the safety of epo, the best possible nephroprotective effect is achievable when it used long - acting erythropoietin in small doses to correct anemia gradually and without exceeding the recommended hemoglobin value of 1112 g / dl . Furthermore, it should be emphasized that the nephroprotection induced by epo and its long - acting analogues in aki remains experimental . Clinical trials are needed to assess the efficacy and safety of these drugs in preventing acute kidney injury in humans.
|
Complex fractures of the tibial plateau are difficult to treat and present a high complication rate . The goal of this report is to describe a combined biological and mechanical approach to restore all morphological and functional knee properties . We treated a 50-year - old woman, who was affected by a posttraumatic osteochondral lesion and depression of the lateral tibial plateau with knee valgus deviation . The mechanical axis was corrected with a lateral tibial plateau elevation osteotomy, the damaged joint surface was replaced by a recently developed biomimetic osteochondral scaffold, and a hinged dynamic external fixator was applied to protect the graft and at the same time to allow postoperative joint mobilization . A marked clinical improvement was documented at 12 months and further improved up to 5 years, with pain - free full range of motion and return to previous activities . The mri evaluation at 12 and 24 months showed that the implant remained in site with a hyaline - like signal and restoration of the articular surface . This case report describes a combined surgical approach for complex knee lesions that could represent a treatment option to avoid or at least delay posttraumatic osteoarthritis and more invasive procedures . Complex fractures of the tibial plateau are difficult to treat and represent a challenging problem in orthopedic surgery . Tibial plateau fractures, which are usually a result of high - impact injuries, have a high incidence of severe complications . These injuries are characterized by articular depression, fracture comminution and displacement, and severe associated injury to the soft tissue envelope of the proximal tibia with potentially devastating consequences . In fact, inadequate treatment of these fractures may result in long - term pain, instability, deformity, stiffness, and ultimately posttraumatic osteoarthritis (oa). A significant number of patients, even if operated on, develop oa and require a total knee arthroplasty . To achieve good results, the aims of the treatment should be anatomic reduction and stabilization of the articular surface, restoration and maintenance of the mechanical axis of the leg, preservation of the soft tissue envelope of the proximal tibia, and restoration of a functional range of motion (rom). In the management of complex tibial plateau fractures, therefore, no single treatment modality can be applied; the optimal treatment should be a multiple approach restoring all the morphological and functional characteristics, with prevention of posttraumatic joint deformity, axial misalignment, and possibly oa development . In the present study, we describe the treatment performed on a 50-year - old woman, who was previously treated with a plate and screws for a schatzker type ii tibial plateau fracture, with residual depression, valgus deviation, and a large osteochondral lesion of the external tibial plateau . For the restoration of the correct mechanical axis of the lower limb, something that most authorities consider a critical factor in the long - term function and prevention of knee oa, we performed a tibial plateau open - wedge elevation osteotomy with a homologous bone graft . The synthesis was done through minimal internal fixation to avoid excessive invasiveness, which implies additional trauma caused by operative soft tissue stripping and dissection and, therefore, stiffness, pain, deformity, instability, and soft tissue problems . To restore the joint congruity, we replaced the damaged articular surface with a recently developed composite scaffold, which mimics the biochemical and biophysical properties of the different layers of native osteochondral structures . This scaffold, composed of type i collagen and nanostructured hydroxyapatite (ha), was designed for the treatment of cartilaginous and osteocartilaginous defects and shown to support cartilage and bone tissue formation in our preclinical animal studies and in the clinical practice . Finally, to protect the bone graft and the osteochondral scaffold, we applied a recently developed hinged dynamic external distractor, which avoids the dangerous effects of weightbearing and shear forces on the grafts and at the same time reproduces the normal knee kinematics, allowing postoperative joint mobilization with partial weightbearing and early functional recovery . A 50-year - old woman had a schatzker type ii tibial plateau fracture of the left knee, who was treated with a plate and screws through a lateral approach and cast for 40 days . After the treatment, she complained of pain and instability in the left knee even when performing normal everyday activities and also of frequent episodes of effusion . Walking was possible only with a limp, and her quality of life was reduced . The patient came under our observation after 3 years . At the physical examination, we observed some moderate joint swelling and acute pain in the lateral compartment during palpation . The knee was valgus with a limited rom (20 lower than the contralateral healthy knee), and the patient experienced pain at high flexion degrees . The international knee documentation committee (ikdc) objective evaluation finding was abnormal; the ikdc subjective and euroqol visual analog scale (eq - vas) scores were 40.2 and 49, respectively; and the sport activity level assessed by the tegner score was 0 . Radiographs showed a valgus alignment of the leg in comparison with the other side due to bone loss and extended osteochondral damage of the lateral tibial plateau (fig . 1). (a) preoperative computed tomography scan shows the damaged lateral tibial plateau . (b) x - ray evaluation of the complex knee fracture initially treated with a plate and screws . Due to the complexity of the lesion, we decided to apply an integrated approach, restoring the previous anatomic features with both mechanical and biological treatments . The surgical procedure was performed with the patient under spinal anesthesia and in the supine position . The first step was to remove the previous hardware and to perform a tibial lateral plateau open - wedge elevation osteotomy, implanting a homologous bone graft, wedge shaped from a femoral head and fixed with a minimally invasive synthesis (2 screws) to correct the tibial plateau depression and the misalignment . The dorsolateral fragment, visible on a computed tomography (ct) scan, was not remodeled because it did not interfere with the correct kinematics of the knee joint . Once the normal height of the joint line was recovered, we proceeded by treating the joint surface with a new biomimetic nanostructured osteochondral scaffold (maioregen, fin - ceramica faenza s.p.a ., the defect of the lateral tibial plateau was prepared using a handheld curette: nonviable cartilage tissues were removed to create a stable shoulder for the articular lesion . The lesion was templated, using aluminum foil, to obtain the exact size of the graft needed to cover the entire defect . The template was then used to prepare the graft, which was implanted through a press - fit technique . Because of the intrinsic adhesive properties of this scaffold, additional fixation devices were not necessary . However, after the tourniquet removal, stability was tested with cyclic bending of the knee while visualizing the graft . Finally, we decided to utilize a recently developed hinged dynamic external fixator (ef) to protect the grafts and at the same time allow for early flexion - extension knee movement . The correct placement was checked intraoperatively by repeated flexion - extension movements, positioning the hinge axis nearly parallel to the transepicondylar axis . The ef was then fixed using 2 pins in the tibia and 2 in the femur (fig . Osteochondral biomimetic scaffold: 1) cartilaginous layer, consisting of type i collagen; 2) intermediate layer (tidemark - like), consisting of a combination of type i collagen (60%) and hydroxyapatite (ha) (40%); and 3) subchondral bone layer, consisting of a mineralized blend of type i collagen (30%) and ha (70%)., calderara di reno, italy) that permits the flexion - extension movement of the knee . In the postoperative period, rehabilitation started with continuous passive motion the day after surgery from 0 to 100 for the first week . The control of the knee swelling was performed with icing 20 minutes 4 times daily for 2 weeks and afterward once after every rehabilitation session . For the next 4 weeks, active rom was allowed as possible . Walking with partial weightbearing and isometric exercises the ef was removed 40 days after surgery; subsequently, the patient intensified motion and strengthening exercises, and progressive weightbearing was allowed . Swimming and cycling were allowed at 45 days and 3 months, respectively . Seven months after the surgery, the screws were removed, and at 12 months, after mri evaluation, joint impact activities (jogging, jumping) were allowed . At the 1-year follow - up evaluation, the patient did not complain of knee pain, had full rom, and returned to her previous activities (fig . The ikdc objective score was normal; the ikdc subjective, eq - vas, and tegner scores were respectively 63.2, 83, and 4 . At 24 months of follow - up, the activity level was maintained, whereas a further improvement was observed in the ikdc subjective score and eq - vas evaluations (70.1 and 89, respectively). At the 5-year follow - up, activity level and eq - vas remained stable, and ikdc subjective score further improved to 88.5 . The patient was also evaluated using mri at 12 and 24 months after surgery (fig . The implant remained in site and showed a hyaline - like signal with restoration of the articular surface at both follow - up times . Subchondral edema progressively decreased with time and at 24 months was barely evident in the tibial plateau . The patient recovered and returned to normal daily activities with full knee range of motion at 12 months of follow - up . Mri evaluation at 12 (a, b) and 24 (c, d) months of follow - up . The goals of the treatment firstly consist of restoring the articular surface as much as possible, obtaining a pain - free rom, and the full recovery of the previous activity level . Methods of acute open reduction and internal fixation with plates and screws of complex fractures of the tibial plateau have a high rate of complications, such as posttraumatic deformities and poor outcome despite articular reduction because of stiffness, pain, instability, residual dysfunction, and many others . In our case, the patient came under our observation with a valgus knee and a limp, complaining of stiffness, joint swelling, pain in the lateral compartment, and instability . The complexity of the lesion required an integrated approach to restore the correct mechanical alignment and repair the damaged articular surface . A tibial plateau lateral open - wedge elevation osteotomy was performed to correct the depression and the misalignment . A homologous bone graft was implanted to support the elevated articular surface after reduction, and it was stabilized using minimal internal fixation with 2 screws . After recovering the normal height of the joint line, the second step was to treat the damaged lateral tibial plateau surface . Articular chondral defects are hard to treat, and when the damage involves the subchondral bone, the treatment is even more problematic . For osteochondral defect repair, several authors have highlighted the need for biphasic scaffolds to reproduce the different biological and functional requirements for guiding tissue regrowth . Following this rationale, in 2007, we started a clinical experiment on a recently developed cell - free composite scaffold, which mimics biochemical and biophysical properties of the different layers of native osteochondral structures . Technical notes and early stability evaluations of the first 13 patients of this pilot study more recently, the pilot study on 30 patients was published, confirming the good results at 2 years of follow - up for the treatment of chondral and osteochondral lesions, and the scaffold is becoming available in many countries for clinical application . 2) is an osteochondral nanostructured biomimetic material with a porous 3-dimensional trilayer composite architecture, mimicking the anatomy of the osteochondral unit . The cartilaginous layer has a smooth surface to favor joint flow and consists of type i collagen . The intermediate layer, tidemark - like, is a combination of type i collagen (60%) and ha (40%). The lower layer consists of a mineralized blend of type i collagen (30%) and ha (70%), reproducing the subchondral bone . Each layer is separately synthesized using a standardized process starting from an atelocollagen aqueous solution (1% w / w) in acetic acid, isolated from equine tendon . The upper nonmineralized chondral layer consists of type i collagen, whereas the intermediate and the lower layers are obtained by nucleating bone - like nanostructured nonstoichiometric ha into self - assembling collagen fibers, as occurs in the biological process of neo - ossification . The final product is obtained by physically combining the layers on top of a mylar sheet (dupont, wilmington, de) and freeze - drying and gamma - sterilizing it at 25 kgy . To protect both grafts, we decided to apply an ef, increasing the joint stability and avoiding negative forces on the articular surface . There is little agreement in the literature about which type of ef should be used for the treatment of complex fractures of the tibial plateau . We preferred to utilize an innovative hinged dynamic distractor, which presents, with respect to the other classic efs, the advantage of an immediate and safe joint mobilization, with less stiffness and a faster functional recovery ., calderara di reno, italy), recently developed by our group, and reproduces the 4-bar linkage model of the knee . Due to the design of this model, it allows knee flexion - extension movements and posterior rollback as in the natural knee with the axis rotation, which changes during flexion . The knee is allowed to move only in the sagittal plane with a reduced range (0-100). The normal flexion - extension axis of the knee is nearly parallel to the transepicondylar axis, which passes through the epicondyles and close to the posterior cruciate ligament femoral insertion . Therefore, it is very important to align as much as possible the fixator axis with the knee flexion - extension axis to reproduce the natural knee motion that is performed by the hinge of the ef . The hinge presents a central body made of radiotransparent material, and the shaft and distraction ring nuts are made of light alloy . The use of these materials permits the building of a very strong but light ef, thus protecting the joint but also allowing the patients to easily walk and move the knee . The patient, previously unsuccessfully treated for a complex lateral tibial plateau fracture, was able to achieve good results, as assessed by clinical evaluation and mri, and to return to a satisfactory functional level . We documented an integrated surgical treatment that comprehends both mechanical and biological procedures . In this way, it is possible to restore previous anatomic features and obtain good clinical outcome even in complex fractures with damaged articular surface, bone loss, and residual deformity . This case report describes an interesting surgical approach even for difficult cases that otherwise are doomed to a poor clinical outcome and represents an alternative treatment option to avoid or at least delay posttraumatic oa and more invasive procedures.
|
The reverse shoulder prosthesis is one surgical option for treatment of cuff tear arthropathy and shoulder pseudoparalysis resulting from a massive cuff tear, severe fractures, prosthetic revision, and tumor surgery . Owing to the mechanical advantage of a medialized center of rotation, the reverse shoulder prosthesis offers a potentially valuable surgical option and has become an alternative in situations in which the rotator cuff and/or the proximal humerus are destroyed or absent, with a satisfying reduction of pain after surgery [12, 31]. However, because of the wide variation in published values for active elevation after reverse shoulder replacement (ranging from 88 to 138 [3, 36]), the degree to which this prosthesis restores arm strength is not fully defined . Previously found a better passive than active rom and presumed that the limited glenohumeral motion of the reverse prosthesis resulted from a lack of joint torque generation rather than a structural limitation caused by the prosthetic design . Shoulder strength mostly has been evaluated using subjective methods such as traditional manual muscle testing and handheld dynamometry, which mainly focus on isometric muscle strength . The strength measure in the constant - murley score because most functional activities are dynamic, evaluating isokinetic shoulder strength may be more appropriate when relating strength to functional performance and clinical outcome . However, data for isokinetic strength measurements around the shoulder are available only for normal healthy subjects, patients after open fixation of glenoid rim fractures, open [1, 10] and arthroscopic anterior stabilization [15, 21], rotator cuff surgery [4, 11, 14, 34, 43], with adhesive capsulitis [26, 27, 41], subacromial impingement [16, 24, 30], and pectoralis major muscle rupture, but not for patients with a reverse shoulder prosthesis . Our objective was to perform a pilot study to measure isometric shoulder strength in patients who underwent either a primary or revision reverse shoulder replacement . We asked the following questions: (1) what joint torques can patients with a reverse shoulder prosthesis produce isokinetically, and (2) does this force - generating capacity correlate with functional scores? Between may 2000 and september 2007, we treated 45 patients (49 shoulders) with a reverse shoulder prosthesis (tornier; edina, mn, usa). Of these, 33 patients (19 women and 14 men), volunteered to participate in this study . Ten patients had surgery on the left side, 19 on the right side, and four on both sides (total of 37 shoulders). In 21 patients, the indication for the reverse prosthesis was cuff tear arthropathy, and in 16 patients the indication was revision after a failed primary placed hemiprosthesis or total shoulder prosthesis . The average time between surgery and measurement was 23 14 months (range, 463 months). Mean age of the patients was 72 8 years (range, 5885 years). The minimum clinical followup was 4 months (mean, 23 months; range, 463 months). The institutional ethics committee approved the research protocol and all patients gave their written informed consent before the experiment . All patients underwent surgery under general anesthesia with an interscalene nerve block in the beach - chair position . All glenoid components had been placed inferior on the glenoid surface with no inferior or superior inclination . The humeral components had all been placed in 10 to 20 retroversion, and in 32 patients, the teres minor and subscapularis muscles were still intact . Postoperative management was the same for all patients, consisting of a sling and passive rom exercises for 6 weeks . After 6 weeks, active assisted rom exercises were started and at 3 months, strengthening exercises were added to the rehabilitation program . Shoulder strength was measured with an isokinetic dynamometer, which provides constant velocity with accommodating resistance throughout a joint s rom . This resistance is provided using an electric or hydraulic servo - controlled mechanism at a user - defined constant velocity . Two isokinetic protocols were performed to measure the strength of the subjects shoulder muscles on the surgically treated side using the biodex system 3 pro dynamometer (biodex medical systems, new york, ny, usa). These protocols consisted of an abduction and adduction task and an external and internal rotation task with the arm in 60 abduction in a sitting position with securing bands around the subject s chest and pelvis . For the abduction and adduction task, the chair was rotated 75 around the vertical axis with the dynamometer in neutral position and 10 tilted . For the external and internal rotation task, the chair was in the neutral position with the dynamometer rotated 20 and 50 tilted . After one session of the abduction and adduction or the external and internal rotation task, the subject had a 60-second recovery time after which the same task was repeated . All tasks were repeated five times at 60 per second with a minimum standard threshold of 15 per second to start the measurements defined by the biodex system . For each motion, the average maximal torque (nm) the subjects were instructed and encouraged to reach the highest possible force level during these tasks . Negative axial rotation was defined as external rotation and positive axial rotation as internal rotation . Reported a systematic review of the literature on isokinetic strength of the shoulder until 2005 . We used pubmed to identify other articles providing data for normal shoulder torque values from 2005 and onward [2, 20, 37, 42]. From those studies we took the abduction - adduction and/or external - internal rotation torque values for 60 per second or less and combined those to make comparison possible with our obtained data (table 1).table 1maximum generated force in nm for our data compared with the literature at similar or lower velocitiesstudysubjectmean age (years)dominance or sidevelocityabductionadductionexternal rotationinternal rotationambrosio et al . M = male; f = female; d = dominant; nd = nondominant . Maximum generated force in nm for our data compared with the literature at similar or lower velocities m = male; f = female; d = dominant; nd = nondominant . For clinical evaluation, we obtained preoperative and postoperative (absolute and relative) constant - murley scores [8, 9], postoperative dash score, and the (d)sst [23, 40]. The absolute constant - murley score assesses the overall shoulder function and has a maximum score of 100 points . The relative constant - murley score is corrected for the age- and sex - related decline in force - generating capacity . The dash is a 30-item questionnaire that evaluates functional disability in everyday activities, work, and sports . A dash score of 0 indicates good shoulder function, or no disability, and the maximum score of 100 indicates no function . The (d)sst is a questionnaire consisting of 13 yes or no questions including subjective items and items that require patients to complete a physical exercise . It evaluates shoulder function in daily activities and a maximum score of 13 indicates good shoulder function . We used a t - test to determine the difference in mean maximum generated torque at 60 per second between primary and revision cases . For this same group, the effect size was determined by calculating the cohen s d. the relationship between the clinical outcome scores (constant - murley, dash, and [d]sst) and strength data was evaluated on the basis of a pearson product - moment correlation . Only 23 patients (24 shoulders; 13 primary and 11 revisions) were able to generate sufficient velocity to perform the test, resulting in a mean abduction torque of 15.2 nm 6.6 nm for the whole group with no substantially better value for the primary prostheses compared with the revisions (table 2). For the external and internal rotation torques, these values varied between 13% and 71% . We found similar torque values for adduction also with no major difference between primary and revision cases . The external and internal rotation tasks could be performed by only 13 patients (14 shoulders; nine primaries, five revisions). Mean external rotation torque was 9.3 nm 4.4 nm for the whole group with no major differences between the primary and revision groups . Internal rotation force tended to be higher (p = 0.07) for primary prostheses with a torque of 8.2 nm 2.6 nm for the whole group (table 2). Compared with normal healthy subjects (table 1), patients with a reverse prosthesis who could generate sufficient force to perform the tasks had abduction and adduction torques of 19% to 78% of those of a normal shoulder at a velocity of 60 per second.table 2mean maximum generated force (nm) and sd at 60 per second for the whole groupmaximum torque at 60 per secondall shoulders (n = 24)primary (n = 13)revision (n = 11)p value primary versus revisioncohen s d primary versus revisionabduction15.2 6.616.3 5.613.4 7.60.300.43adduction16.1 = 14)(n = 9)(n = 5)external rotation9.3 4.49.3 4.77.9 4.00.580.32internal rotation8.2 2.69.2 2.16.0 2.50.071.38 mean maximum generated force (nm) and sd at 60 per second for the whole group we found a correlation between the postoperative constant - murley score and the abduction and external rotation torques (fig . 1). Similar correlations were found for the dash score and (d)sst (table 3), with the maximum torque values at 60 per second . An overview of all the clinical outcome scores of the whole group, the primary and the revision cases is presented (table 4).fig . 1pearson s correlation between the maximal abduction and external rotation torque at 60 per second and the postoperative constant - murley score show a correlation between the force - generating capacity of patients with a reverse shoulder prosthesis and their postoperative constant - murley score for abduction and external rotation.table 3pearson s correlation between maximum torque at 60 per second and the postoperative constant - murley score, dash, and (d)sstmaximum torque at 60 per secondconstant - murley scoredash(d)sstabduction0.507p = 0.0140.572p = 0.0040.519p = 0.011adduction0.393p = 0.1830.319p = 0.290.408p = 0.166external rotation0.614p = 0.0260.531p = 0.0620.600p = 0.03internal rotation0.441p = 0.2160.498p = 0.2050.455p = 0.206(d)sst = dutch translation of the simple shoulder test.table 4constant - murley scores, relative constant - murley scores, dash scores, and (d)sstscoresall shoulders sd (range)primary sd (range)revision sd (range)constant - murley preoperative24 11 (547)28 9 (1347)20 12 (547)constant - murley postoperative50 21 (887)59 20 (887)38 18 (1173)relative constant - murley preoperative33% 17% (771)38% 14% (1968)27% 18% (771)relative constant - murley postoperative70% 31% (9124)83% 30% (9124)53% 22% (1492)dash postoperative43.9 25.6 (1.784.2)31.5 24.4 (1.777.5)60.3 17.1 (31.284.2)(d)sst postoperative7 4 (013)8 4 (013)4 3 (110)(d)sst = dutch translation of the simple shoulder test . Pearson s correlation between the maximal abduction and external rotation torque at 60 per second and the postoperative constant - murley score show a correlation between the force - generating capacity of patients with a reverse shoulder prosthesis and their postoperative constant - murley score for abduction and external rotation . Pearson s correlation between maximum torque at 60 per second and the postoperative constant - murley score, dash, and (d)sst (d)sst = dutch translation of the simple shoulder test . Constant - murley scores, relative constant - murley scores, dash scores, and (d)sst (d)sst = dutch translation of the simple shoulder test . The reverse shoulder prosthesis provides a surgical option for conditions such as cuff tear arthropathy, shoulder pseudoparalysis resulting from massive cuff tear, severe fractures, prosthetic revision, and tumor surgery with generally satisfying postoperative results [12, 31]. However, the contribution of this prosthesis to restoration of arm function is less clear . Previous research suggests the limited glenohumeral motion of the reverse prosthesis seems to be the result of a lack of joint torque generation rather than a structural limitation caused by the prosthetic design . Therefore, the evaluation of isokinetic shoulder strength after reverse shoulder replacement may be of interest in modeling dynamic upper extremity function, particularly where comparative data are not currently available for this clinical scenario . We therefore (1) determined joint torques in patients with a reverse shoulder prosthesis and (2) determined whether force - generating capacity correlates with functional scores . We note limitations to our study, one of which is the absence of proper control data . First, ideally a comparison would be made with an age - matched control group without cuff disorders . However, with a prevalence of 31% of asymptomatic (ie, unrecognized) cuff tears in individuals between 70 and 79 years old and a prevalence of 51% in individuals another possibility would be to compare the outcomes with those of the contralateral side in the same patient . However, cuff disorders in the contralateral shoulder are not uncommon, as reported by yamaguchi et al . In their demographic and morphologic study of rotator cuff disease . The average age for patients with a bilateral cuff tear in their group was 67.8 years and logistic regression analysis indicated a 50% likelihood of a bilateral tear after the age of 66 years . Furthermore, patients with a full - thickness symptomatic tear had a 35.5% prevalence of a full - thickness tear on the contralateral side . In our patient population, 12% already had a reverse prosthesis on both sides, showing that our patient group was not suitable to use the contralateral side as a comparison . Second, we had a broad range of followup times for the force measurements and clinical outcome scores . Ideally the measurements should have been performed at the same time postoperatively for every patient with a minimum followup of 1 year . This is also true for the clinical outcome scores, because they require time to stabilize . In the scope of this study, it was not possible to include patients with the same followup period, as this would have required an inclusion period of several years . We therefore chose to include all patients available from our pool of treated patients, which inevitably led to a large range in followup times . It is not certain what effect the followup time will have had, which especially applies for the elderly population for whom recovery might be counteracted by ageing effects . Given the number of available patients, controlling for age and followup will be virtually impossible whereas including larger groups and testing for those factors also do not seem to be realistic options . Isokinetic strength measurements have been performed at different velocities, mostly from 60 per second to 300 per second with some exceptions at 30 per second (table 1). In these measurements, the applied torque needs to increase above a threshold value to successfully perform a certain task at higher speeds . Because the physiologic changes at older age lead to a decline in force - generating capacity and the reverse shoulder prosthesis is implanted mainly in patients with a mean age of 72 years [18, 36], similar to the average age of the participants in our study, we decided to apply a relatively low velocity of 60 per second . Considering our data and the number of patients unable to perform the tests (table 2), it appeared that even 60 per second was too high for most of the patients with a reverse prosthesis . Future research investigating force production of this patient population should incorporate velocities less than 60 per second . Whether a lower velocity would lead to substantially more successful tests however is unknown; in our protocol a standard threshold of 15 per second was used to start measurements, which even proved to be too much for some of our patients . Trying to place our obtained torque values (table 2) in perspective, we compared our data with those of normal healthy subjects (table 1). From this comparison we can conclude that patients with a reverse prosthesis who can generate sufficient force to perform the tasks have abduction and adduction torques of 19% to 78% of those of a normal shoulder at a velocity of 60 per second . For the external and internal rotation torques, these values vary between 13% and 71% . However, those normal values were based on younger subjects than our group of patients and in most series they include groups of athletes . If we compare our data with the only age - related series of verney et al ., our patients have an abduction torque of 33% of that of 10 male elderly volunteers . It is not clear what causes this relatively low abduction torque . From the total of 37 shoulders, only 23 patients (24 shoulders) could generate enough force to perform the abduction and adduction tasks and for the external and internal rotation, the number of patients was even less (table 2). The difference between those two tasks can be explained by the changed biomechanics caused by the reverse shoulder prosthesis . By displacing the center of rotation medially, more fibers of the anterior and posterior parts of the deltoid muscle are recruited for anteflexion or abduction of the arm and therefore fewer fibers are available to internally or externally rotate the arm . Our study group included patients with primary and revision implantations . In revision surgery with a reverse prosthesis, the improvement of function is reportedly only to approximately 70 of active elevation, with a higher complication rate than with primary surgery . Therefore, we expected to find a difference in force - generating capacity between the two groups (table 2) in favor of the primary prosthesis . However, this could not be confirmed for the abduction and adduction tasks because 62% of the primary and 69% of the revision cases were able to generate enough force . For the internal and external rotation tasks, it was 43% and 31% respectively, confirming our expectation and explained by the previously mentioned change of biomechanics after a reverse prosthesis . The correlations we found between clinical outcome scores (constant - murley, dash, and [d]sst) and the abduction and external rotation torque values (table 3) support this contention . Functional outcome probably is not determined by simple rom ranges alone, but also by the actual capacity for material handling in elevated and axially rotated arm positions . For example, it can be expected that patients who have good anteflexion or abduction with limited external rotation strength define their functional outcome as poor . Therefore, it seems logical that greater external rotation torque provides a better functional outcome . Although our findings support this notion, only 13 of a total of 37 shoulders actually were able to generate enough force to perform the tasks at 60 per second . Testing under lighter conditions (30 per second) could have provided more data but probably would not have led to another observation . Patients with a reverse prosthesis were moderately to strongly limited in strength, which was the case for abduction and adduction and even more for external and internal rotation . However, future isokinetic data collection in these patients should be performed at a lower velocity than 60 per second . Results for strength correlated with clinical outcome scores (constant - murley, dash, and [d]sst) indicating moderately strong relationships and a moderate predictive value of the outcome scores . Although it is likely that lower isokinetic shoulder strength in patients with joint arthroplasties is a major factor in reduced rom, the actual causes of loss of strength would need to be identified in future studies . This article is distributed under the terms of the creative commons attribution license which permits any use, distribution, and reproduction in any medium, provided the original author(s) and the source are credited.
|
Major depressive disorder (mdd) is one of the most common psychiatric disorders, with a lifetime prevalence of 17% in the united states and 4% worldwide (eaton et al ., 2008, kessler et al ., 2005). In terms of years lost to disability, mdd is considered one of the most disabling medical conditions and is predicted to become a leading contributor to the worldwide burden of disease (mathers and loncar, 2006). The majority of pharmacotherapies developed for the treatment of mdd target brain monoamine systems, primarily serotonin (5-ht), norepinephrine, and dopamine . The most common of these, the selective serotonin reuptake inhibitors (ssris) and selective norepinephrine reuptake inhibitors (snris), comprise a large proportion of pharmaceutical sales and are considered first line treatments for mdd . Unfortunately, an estimated 40% of patients fail to respond to these therapies (cipriani et al ., 2009, further insight into the neurobiological mechanisms underlying antidepressant response is needed for the development of more efficacious antidepressant regimens . The combination of genetic vulnerabilities and environmental factors, such as stress, are thought to be significant contributors to the onset of depression in humans (charney and manji, 2004). The likelihood of experiencing a depressive episode is greatly increased following a stressful life event or after accumulation of chronic minor stresses (caspi et al ., 2003, harkness and monroe, 2006). Moreover, many patients suffering from depression exhibit signs of dysfunctional hypothalamic - pituitary - adrenal (hpa) axis activity, as demonstrated by elevated basal cortisol levels and resistance to dexamethasone, an exogenous steroid that suppresses cortisol in healthy individuals (gillespie and nemeroff, 2005, pariante and miller, 2001). Interestingly, successful antidepressant treatment is often associated with restored suppression of hpa axis response (schule, 2007). Together, these findings suggest a potential role of stress hormones, such as cortisol (corticosterone (cort) in rodents), in the pathology and treatment of depression . Cort produces its effects in the central nervous system via activation of glucocorticoid (gr) and mineralocorticoid (mr) receptors . Though these receptors are ubiquitous throughout the brain, they are highly abundant in the hippocampus, where they provide crucial inhibitory feedback signals to the hpa axis (jacobson and sapolsky, 1991; sapolsky et al ., 1984). A reduction or absence of these inhibitory signals can promote hyperactivation of the axis and augmented secretion of glucocorticoids (anacker et al ., 2011, mcewen et al ., 2012). In a healthy individual, elevated corticosteroid activity helps facilitate the physiological and behavioral adaptations required to appropriately respond to stressors and reinstate homeostasis . However, prolonged exposure to cort can inhibit the proliferation and survival of adult - born hippocampal neurons, which have been shown to play an important role in the behavioral and neuroendocrine components of stress responses in rodents (gould and tanapat, 1999; snyder et al ., 2011). Conversely, chronic treatment of normal rodents with ssris, such as fluoxetine, increases hippocampal neurogenesis and neurotrophins such as brain derived neurotrophic factor (bdnf) (duman and monteggia, 2006, krishnan and nestler, 2008, schmidt and duman, 2006). Increased hippocampal neurogenesis is associated with behavioral indications of antidepressant efficacy in rodents, such as reduced hyponeophagia in the novelty - induced hypophagia (nih) test and performance in the forced swim test (dranovsky and hen, 2006). Not all strains of mice respond to the behavioral and neurogenic effects of antidepressant treatments . For example, normal c57bl/6 mice are unresponsive to the behavioral effects of chronic fluoxetine treatment, measured in the nih test, and do not exhibit increased hippocampal cell proliferation (balu et al . Although corticosteroids alone do not encompass all aspects of stress exposure (belzung, 2014), previous studies have shown that chronic cort exposure can induce a depressive - like motivational state in rodents that is similar to that produced by a chronic mild stress paradigm (gourley et al ., 2008). Moreover, cort treatment alone is sufficient to alter molecular targets that are implicated in depression and antidepressant efficacy, such as hippocampal neurogenesis (bilsland et al ., 2006, (1997), found that 4-day dexamethasone therapy significantly enhanced antidepressant response to ssris in treatment - resistant patients . Therefore, we hypothesized that activation of stress circuitry might be important to reveal the behavioral and neurogenic effects of the ssri fluoxetine in c57bl/6 mice, a non - responsive mouse strain . In the current study we investigated the effects of exposure to commercial cort pellets for 21 days in augmenting fluoxetine's behavioral and proliferative effects in c57bl/6 mice the results of this study showed that chronic fluoxetine produced behavioral effects in the nih test only in mice exposed to cort . Furthermore, cort administration with fluoxetine co - treatment augmented hippocampal cell proliferation, an effect potentially mediated by alterations in hippocampal corticosteroid receptor expression . Interestingly, analysis of plasma at the end of treatment revealed a paradoxical decrease in cort levels in animals treated with the pellets, suggesting that the cort pellets did not work as advertised . Adrenalectomized animals implanted with cort pellets revealed a sharp drop in cort plasma levels by day 7 of treatment, indicating that this method of cort exposure produced transiently elevated, but not sustained, cort levels . Nevertheless, these experiments revealed the important finding that cort exposure potentiates the behavioral and neurogenic effects of chronic fluoxetine administration in a mouse strain that is otherwise non - responsive to this antidepressant treatment . Intact and adrenalectomized male c57bl/6j, 78 weeks old upon arrival, were purchased from jackson laboratories (bar harbor, me). Mice were housed in groups of 4 (except for those used in the nih test whom were housed in pairs) in polycarbonate cages and maintained on a 12 h light dark cycle (lights on at 0700 h) in a temperature (22 c)- and humidity - controlled environment . All experiments were approved by the institutional animal care and use committee at the university of pennsylvania . Intact animals were implanted with cort pellets (10 mg) or placebo pellets . Beginning on day 7 of cort treatment, animals were dosed with either fluoxetine (5 mg / kg b.i.d ., i.p .) Or saline daily for the remaining 14 days of the experiment . Cohort 1: animals were tested in the nih and home cage test on the last two days of drug treatment (n = 810 per group). Cohort 2: animals received a single injection of brdu on the last day of drug treatment and were sacrificed 24 h later . In these animals trunk blood was collected at time of sacrifice and analyzed for plasma cort levels (n = 1519 per group). Adrenalectomized animals were implanted with cort pellets (10 mg) or placebo pellets and received chronic fluoxetine treatment as described in experiment 1 . All mice received additional cort replacement through the drinking water (25 g / ml in 0.9% saline) to prevent the loss of electrolyte homeostasis (funder, 2006) and eliminate the confounding effects of adrenalectomy alone on neurogenesis (cameron and gould, 1994). Animals received a single injection of brdu on the last day of drug treatment and were sacrificed 24 h later . Hippocampal tissue was dissected and analyzed for brdu positive cells (n = 710 per group). Intact animals were implanted with cort pellets (2.5 mg) or placebo pellets and received chronic fluoxetine treatment as described in experiment 1 . Animals received a single injection of brdu on the last day of drug treatment and were sacrificed 24 h later . Hippocampal tissue was dissected and analyzed for brdu positive cells (n = 910 per group). Adrenalectomized animals were implanted with cort pellets (10 mg) or placebo pellets and then sacrificed 1, 7, 14, or 21 days after implantation . Trunk blood was collected at time of sacrifice and analyzed for plasma cort levels (n = 56 per group). Cort pellets (2.5 mg and 10 mg, 21 day release, innovative research of america, sarasota, fl, usa) were composed of a proprietary matrix of cholesterol, cellulose, lactose, phosphates and stearates designed to facilitate continuous and sustained diffusion of cort over a period of 21 days . Fluoxetine hydrochloride (5 mg / kg; anawa, zurich) was dissolved in distilled water and delivered by intraperitoneal (i.p .) Fluoxetine was administered twice daily because, due to its half - life, this dosing strategy results in relatively stable plasma levels (hodes et al ., 2010) and occupation of brain serotonin transporters (hirano et al ., 2004). 5-bromo - deoxyuridine (brdu; roche applied sciences indianapolis, in) was dissolved in warm saline at a dose of 200 mg / kg and administered i.p . In a volume of 10 ml / kg . Mice were pair housed and trained to eat a palatable food (three peanut butter chips presented in a small, clear petri dish) in a home cage environment . Animals were trained daily in 15-min sessions until they met the criteria of three consecutive days with approach latencies of 30 s or less . Opaque, black, plastic dividers were placed inside each cage to separate the mice during training of home cage training sessions . Mice were allowed to habituate to the dividers for 1 h before the start of the training session . Once all animals had met criteria, training sessions were suspended and drug treatments were initiated . Three days before novel testing all animals were re - exposed to the peanut butter chips through additional training sessions . For novel cage testing, peanut butter chips were presented in the center of an empty, clear polycarbonate cage (25.5 46 20 cm) with bright lighting (60 w light bulb) and scented with lemon (20% lemon joy solution). Mice were placed into the test cage and the latency to approach during the 15-min test session was measured . Flow cytometry is a frequently used method for analyzing newly dividing cells in the hippocampus . This method has been previously validated by our lab and others, and compared to results obtained from immunostaining (balu et al ., 2009b; bilsland et al ., 2006, spoelgen et al ., brdu labeling was measured in cells displaying the nuclear marker 7-aminoactinomycin d (7-aad) by flow cytometry as previously described (balu et al ., 2009b). Briefly, mice were decapitated 24 h following brdu injection, their brains quickly removed, and the hippocampus dissected . Hippocampal tissue was manually minced, digested using an enzymatic mixture (1 mg / ml papain, roche applied science; 0.1 m l - cysteine, sigma louis, mo), and then mechanically triturated to form a single cell suspension . Cells were fixed, permeabilized, and stained using the fluorescein isothiocyanate (fitc) brdu flow kit (bd biosciences, san jose, ca). Data were collected on the same day using a bd facs canto system (bd biosciences) at the university of pennsylvania flow cytometry core facility . Rna was extracted with trizol reagent (gibco brl, life technologies, ny) and purified using the rneasy mini kit (qiagen, valencia, ca) following the manufactures' instructions . Rna concentrations were measured and 300 ng/l rna was used as a template to synthesize c - dna using the superscript vilo c - dna synthesis kit (invitrogen, carlsbad, ca, usa). All reactions were performed with a master mix of sybr green (applied biosystems, austin, tx) and 300 nm primers (final concentration). Quantitative real - time polymerase chain reactions (qrt - pcr) were run using the stratagene mx3000 and mxpro qpcr software . Cycling parameters were as follows: 95 c for 10 min, 40 cycles at 95 c (30 s) and 60 c (1 min), ending with a melting curve analysis to control for amplification . All reactions were performed in triplicate and the mean cycle threshold was used for analysis . The mrna levels of target genes were normalized to the house - keeping gene tata binding protein (tbp) using the 2 method . Trunk blood was collected at time of sacrifice, which occurred between 8 and 10 am for all experiments . Blood was stored in 0.5 ml heparin and centrifuged at 3000 rpm for 20 min . The amount of cort in the plasma from each sample was measured in duplicate by elisa following the manufactures instructions (immunodiagnostic systems, fountain hills, az). Intra - assay variability for the cort kit ranged from 5.9% to 7.0%, inter - assay variability ranged from 8.2 to 8.9%; mean assay sensitivity was 0.17 ng / ml . One - way and two - way anova were performed to examine the significance of differences between treatments . Significant overall main effects (p <0.05) or interactions showing a trend (p <for all follow - up tests, p <0.05 was considered statistically significant . Mice were randomly assigned to either placebo or cort pellet exposure, and then further separated into either saline or fluoxetine treatment groups . As seen in fig . 1a, a two - way repeated measures anova revealed a significant interaction [f(9,102) = 3.761, p <0.001] and main effect [f(3,102) = 12.68, p <0.001] of time on body weight during drug treatment . Placebo - treated animals exhibited significant weight gain by day 14 (p <0.05). Although cort - exposed animals failed to gain weight within the initial 7 days of treatment, animals subsequently treated with fluoxetine showed significant weight gain by day 21 (p <0.001) whereas saline treated animals continued to show inhibited weight gain . The overall change in body weight (from day 1 to day 21) 1b illustrates a significant main effect of treatment with fluoxetine [f(1, 34) = 8.830, p <0.01]. The behavioral effects of cort and fluoxetine treatment were then measured in the nih test . Exposure to a novel environment increased approach latency [f(1,65) = 972.4, p <0.0001] and reduced the amount of food consumed [f(1,68) = 136.0, p <0.0001] compared to home cage in all treatment groups . There was a significant interaction between cort exposure and fluoxetine treatment in approach latencies in the novel environment [f(1,33) = 8.041, p <0.01]. Cort - exposed animals treated with fluoxetine displayed significantly lower approach latencies compared to cort - exposed animals treated with saline . Moreover, fluoxetine treatment had no effect on approach latency in placebo - treated animals in the novel environment (fig . There were no significant differences in food consumption in the novel environment between drug treatment groups (fig . Cort treatment significantly reduced latency to approach [f(1, 33) = 4.772, p <0.05] and increased the amount of food consumed compared to placebo treated animals [f(1, 34) = 4.956, p <0.05] (fig . 2c and d). In a separate cohort, animals received a single injection of brdu on the last day of drug treatment and were sacrificed 24 h later . Additionally, trunk blood was collected at time of sacrifice and analyzed for plasma cort levels . As seen in fig . 3a, flow cytometric analysis of hippocampal tissue revealed that in placebo treated animals, fluoxetine had no effect on hippocampal cell proliferation . Interestingly, cort - exposure significantly increased hippocampal cell proliferation compared to placebo treated animals [f(1,59) = 50.87, p <0.001]. Moreover, there was a significant interaction between cort exposure and fluoxetine treatment on neurogenesis [f(1, 59) = 6.702, p <0.05]. Post - hoc multiple comparisons revealed that cort - exposed animals treated with fluoxetine displayed significantly higher hippocampal cell proliferation compared to cort - exposed animals treated with saline . Analysis of circulating cort levels at the time of sacrifice revealed that exposure to cort pellets significantly reduced cort plasma levels in both saline and fluoxetine treated animals by approximately 50% when measured on day 21 [f(1, 66) = 36.06, p <0.001] (fig . Glucocorticoid (gr) and mineralocorticoid (mr) receptor transcription was examined in the hippocampus as a potential molecular mechanism underlying the cort - induced neurogenic response to fluoxetine in c57bl/6 mice . There was no significant effect of cort or fluoxetine on gr mrna expression (fig . However, exposure to cort significantly reduced hippocampal mr mrna expression in both saline and fluoxetine treated animals [f(1,68) = 4.276, p <0.05] (fig . 3d). To investigate the mechanisms underlying the increase in hippocampal cell proliferation by cort pellets, adrenalectomized animals were used to examine the effects of 10 mg cort pellet exposure and fluoxetine treatment on hippocampal neurogenesis in the absence of adrenal feedback . There was a significant main effect of cort on cell proliferation [f(1, 30) = 5.298, p <0.05] and a trend towards an interaction [f (1, 30) = 3.372 p = 0.08]. As illustrated in fig . 4a, adrenalectomized cort - exposed animals treated with fluoxetine, but not saline, displayed a significant two - fold increase in cell proliferation compared to placebo treated animals (p <0.05). We next examined whether a lower dose of cort pellet exposure combined with fluoxetine treatment would induce an increase in hippocampal neurogenesis in intact animals . There was a significant main effect of cort pellet exposure [f(1, 35) = 6.477, p <0.05] and a significant interaction between cort pellet exposure and fluoxetine treatment [f(1, 35) = 4.705, p <0.05] on hippocampal cell proliferation . As shown in fig . 4b, cort - exposed animals treated with saline exhibited a significant increase in cell proliferation compared to placebo treated animals, as in prior studies . In contrast, the lower dose of cort pellet was incapable of increasing hippocampal cell proliferation when combined with fluoxetine treatment . To determine whether 10 mg cort pellets maintain elevated plasma cort levels for the advertised duration, adrenalectomized animals were implanted with 10 mg cort pellets on day 0 and, cort plasma levels were assessed on day 1, 7, 14, and 21 post - implantation . As shown in fig . 5, plasma cort levels changed dramatically over time (f(3,19) = 16.18, p <0.01), and were no longer in the supraphysiological range by the seventh day of cort pellet exposure (fig . 5). Activation of stress circuitry from implanted cort pellets produced behavioral and neurogenic effects from chronic fluoxetine treatment in a strain of mice that would otherwise have been unresponsive to the effects of the antidepressant . Specifically, co - treatment of cort with fluoxetine significantly reduced the effects of novelty stress measured on approach behavior in the nih test and increased hippocampal cell proliferation . These two effects of antidepressant treatment have been linked together because the behavioral response to fluoxetine is blocked in mice that cannot increase hippocampal cell proliferation (sahay and hen, 2007). Although treatment with cort alone unexpectedly increased cell proliferation to a lesser extent, this effect was absent in adrenalectomized mice while the augmented combination treatment effect was preserved . Measurement of plasma cort levels revealed that the cort pellet did not maintain elevated levels for more than a few days, even though it was expected to be active for 21 days, suggesting that the impact of the cort treatment was likely the after - effect resulting from the supraphysiological levels of acute exposure . Overall, these findings reveal potential neurobiological mechanisms underlying effective antidepressant response in a unique model of treatment resistance . Hyponeophagia, the unconditioned suppression of feeding in a novel environment, is a behavioral measure of stress that may be sensitive to the anxiolytic effects of chronic, but not acute, antidepressant treatment with ssris (bechtholt et al . Fluoxetine's effect of reducing approach latency to food in a novel environment is abolished after focal irradiation of the hippocampus or genetic deletion of hippocampal precursor cells, indicating that hippocampal neurogenesis is a necessary component of this behavioral antidepressant response (david et al . Intriguingly, unlike other mouse strains, c57bl/6 mice did not exhibit reduced hyponeophagia or increased hippocampal neurogenesis following chronic fluoxetine treatment (balu et al ., 2009a). However, in the present study, we showed that cort - exposure via pellet implantation induced a behavioral response to fluoxetine in the nih test in this unresponsive strain . Moreover, cort - exposure in combination with fluoxetine treatment produced a robust increase in hippocampal neurogenesis that was not seen in placebo treated animals . Although correlative, the increased behavioral response to chronic fluoxetine treatment in cort - treated mice could be attributed to heightened hippocampal cell proliferation . Stress is a well - established robust inhibitor of adult neurogenesis (gould and tanapat, 1999, mcewen et al ., 2012). Similarly, cort exposure alone has been shown to be a negative regulator of hippocampal neurogenesis (bilsland et al ., 2006, brummelte and galea, 2010, cameron and gould, 1994, murray et al ., 2008, reduced hippocampal cell proliferation typically coincides with increased plasma cort levels, signifying that circulating cort levels at the time of testing underlie cort - induced changes in proliferation (wong and herbert, 2006). Paradoxically, we observed dramatically reduced plasma cort levels in all cort - exposed animals following the 21-day pellet treatment, while hippocampal cell proliferation was increased . The adrenals operate through an inhibitory feedback system in which increased circulating cort levels serve as a signal for reduced synthesis and secretion from the adrenals (herman and cullinan, 1997, sapolsky et al ., 1984). Cort pellet treatment may have increased internal negative feedback to the point of adrenal inactivation, resulting in reduced endogenous circulating cort levels and disinhibition of cell proliferation . To test for this we examined the effects of cort pellet and chronic fluoxetine co - treatment on hippocampal cell proliferation in adrenalectomized animals . Notably, in the absence of adrenal feedback, cort - exposed animals treated with saline did not demonstrate increased neurogenesis whereas those given fluoxetine still exhibited a proliferative response . Therefore, the mechanisms underlying the augmented neurogenic effect seen in combination treated animals cannot be attributed to artifacts of adrenal feedback . It is important to note, however, that adrenalectomized animals in all treatment groups were supplemented with a low dose cort - treatment (25 g / ml) delivered via drinking water . This mode of delivery produces small rhythmic changes in plasma cort levels, which have been shown to be necessary for fluoxetine - stimulated neurogenesis in rats (huang and herbert, 2006). It is possible, then, that rhythmic fluctuations in cort levels modulate sensitivity to the proliferative effects of fluoxetine . In spite of this, adrenalectomized placebo animals treated with fluoxetine did not exhibit increased proliferation, demonstrating that supplemental cort alone was not sufficient to induce a neurogenic response to fluoxetine . To determine whether a lower dose of cort could elicit a neurogenic response in the presence of fluoxetine without increasing proliferation on its own, we evaluated hippocampal cell proliferation in intact animals treated with 2.5 mg cort pellets . Similar to the 10 mg cort pellet treatment, exposure to 2.5 mg cort pellet treatment produced elevated cell proliferation . However, there was no additional effect in the presence of fluoxetine, suggesting that this dose is sufficient to produce cort - induced increases in neurogenesis, but not sufficient to elicit an augmented proliferative response when combined with fluoxetine . (2009) who showed a low dose of 5 mg / kg / day cort treatment to be effective in reducing hippocampal cell proliferation alone and stimulating proliferation when paired with fluoxetine treatment in c57bl/6 mice . However, whereas the current study utilized a three - week cort pellet treatment, david and colleagues had cort delivered though drinking water and animals were treated for a substantially longer period of time (7 weeks). Therefore, rhythmic low dose cort treatment over a longer period of time may be sufficient to increase neuronal sensitization to fluoxetine in this strain . Altered corticosteroid activity can dysregulate the stress response system and enhance the risk of development of stress - related disorders (groeneweg et al ., 2012). On the other hand, synergistic interactions between hippocampal corticosteroid receptors and serotonergic signaling pathways may mediate the effects of cort exposure on enhancing the neurogenic responses to fluoxetine in c57bl/6 mice . For example, cort treatment has been shown to facilitate fluoxetine - induced enhancement of dopaminergic modulation at the mossy fiber synapse (kobayashi et al ., 2013). Consistent with recent findings, cort treatment reduced hippocampal mr mrna expression while having no effect on gr mrna expression (saenz del burgo et al ., 2013), suggesting that mr mrna expression is more sensitive to the effects of cort exposure . This may be due to the fact that mrs exhibit 10-fold higher affinity for cort compared to grs (joels et al ., 2008). Hippocampal mrs selectively contribute to neuronal stability and excitatory tone and have been shown to mediate behavioral reactivity to a novel environment (berger et al . 1994), hence changes in mr expression and function are likely to impact both hippocampal plasticity and associated behaviors . Interestingly, in the current study, mr expression was similar between cort - exposed animals treated to either saline or fluoxetine treated, indicating that variations in expression alone cannot explain the augmented behavioral and neurogenic responses seen in cort - exposed animals treated with fluoxetine . However, it is important to note that mr and gr expression exhibit a diurnal regulation that is modulated by circulating cort levels (herman et al ., 1993, holmes et al ., 1995). Since exogenous cort treatment has been reported to flatten the natural circadian rhythm of plasma cort (leitch et al ., 2003), cort pellet exposure could potentially alter rhythmic mr and gr occupancy throughout the day thus, the observed neurogenic effects of cort and fluoxetine treatment might be mediated by changes in circadian expression of mr and grs . A major caveat of this study is the lack of sustained cort release from the pellet treatment . Cort pellets have been used to model chronically elevated cort levels, a physiological indicator of dysregulated hpa axis functioning and risk factor for the onset of mdd (goodyer et al ., 2010, owens et al ., 2014). On the contrary, we found that cort plasma levels dropped precipitously between day 1 and day 7 of cort pellet treatment . Rather than a sustained release, the cort pellets produced a rapid, but short - lived, elevation of cort during the initial days of exposure and then became inactive, resulting in cort levels falling to the normal physiological range at the time of the experimental studies . Similar findings were reported in another study evaluating the performance of pellets designed to release cort for 7 days in birds . (2009) found that cort plasma levels peaked 12 days after pellet implantation and reached placebo levels by day 3 . The authors posited that the pellets, being originally designed for rodents, are not as effectively metabolized in other species . However, our data corroborate the findings that the cort pellets do not reliably produce sustained cort release for the indicated length of treatment . In light of this, slow - release cort pellets are not appropriate for modeling prolonged elevated cort levels . Instead, these pellets may more closely model the effects of exposure to a strong acute stressor, as with post - traumatic stress disorder . Interestingly, the initial surge in cort levels during the first few days of treatment was sufficient to induce long lasting molecular and behavioral changes in treated animals, suggesting that alterations in cort levels, not necessarily at a pathological level, can impact the efficacy of fluoxetine . In conclusion, this study found that exposure to exogenous cort increases behavioral and neurogenic sensitivity to chronic fluoxetine treatment in c57bl/6 mice, a typically non - responsive strain of mice . These data recapitulate the general findings that genetic background and environment play a fundamental role in antidepressant response . Although slow - release cort pellets did not model the effects of sustained elevated cort exposure as anticipated, these studies effectively indicate that cort exposure is sufficient to reveal the anxiolytic and neuroplastic effects of chronic fluoxetine treatment in a typically unresponsive strain and could model an augmentation strategy for treatment - resistant patients . These findings implicate corticosteroid receptor activity and modulation as a potential variable in the stratification of antidepressant response in patients with mdd and possibly as a mediator of the effects of environmental stress on the effects of antidepressants.
|
Reliable estimates of population sizes of target species are of central importance to many conservation programs . Density estimates provide baseline data on species abundance and allow the monitoring of population sizes, which is important in assessing the suitability of conservation strategies . However, few studies compare different survey methods and designs for large mammals under the same conditions, for instance, the same time of year and same location (nijman and menken 2005; nomani et al . 2012; viquerat et al . Such a comparison, however, can highlight strengths and weaknesses of the specific methods and thus provide useful information for conservation practitioners when deciding on the most suitable methods to deliver their conservation objectives . One of the most common population assessment methods for diurnal primates is line transect sampling (buckland et al . This method is known to be accurate if a small number of key assumptions are met . Best practice guidelines regarding survey design, field protocol, and analysis are available (buckland et al . 2010) but several primatologists have discussed the possibility that this method is less efficient for some species, among them the members of the gibbon family hylobatidae (nijman and menken 2005; whittaker 2005; and see discussion in waltert et al . 2008). Gibbons are small bodied arboreal apes found across eastern and southeastern asia, northwest india, and bangladesh . In comparison to other primates, gibbons have distinctive behavioural characteristics, including regular vocal displays (bartlett 2007). Morning calls are thought to function as territory defense as well as to strengthen the pair bond (cheyne et al . Owing to their otherwise inconspicuous behavior and their tendency to use the upper canopy (nijman 2001), line transect surveys might fail to record 100% of individuals near the transect line, resulting in underestimation of population densities if no action is taken to accommodate the violation of this key assumption (buckland et al . Triangulation (also known as auditory sampling or fixed point counting) has recently become a commonly applied method to estimate gibbon densities and has proved to be both successful and time efficient (brockelman and ali 1987; brockelman and srikosamatara 1993; buckley et al . Further, triangulation is seen as the most applicable method in hilly terrain (nijman and menken 2005). Besides the obvious advantages, such as the fact that sampling does not affect gibbon behaviour toward the observer, triangulation can be performed within a relatively short time period and it is less destructive, as no transects need to be cut . It may, nevertheless, also introduce some sources of bias, e.g., through the influence of weather conditions on singing behavior or by underestimation of distances to calling groups, the latter of which may result in overestimation of densities (cheyne et al . In addition, calling rates and data on cluster (groups or subgroups of primate social units) size are needed, requiring long - term data or extra survey effort . Triangulation alone does not ensure a sufficient number of sightings to estimate cluster size (cheyne et al . Here we compare line transect sampling with triangulation in estimating densities of hylobates klossii in the peleonan forest, a mixed evergreen rainforest with hilly terrain in the north of siberut island (hadi et al . Hylobates klossii is endemic to the mentawai archipelago and is listed as endangered by iucn (whittaker and geissmann 2008). If the two methods have comparable accuracy then the results for density estimates should not differ significantly . The mentawai archipelago is located 85135 km west of the island of sumatra, indonesia . Siberut is the most northerly and largest island with an area of 4030 km (whittaker 2006; whitten 1982a). Close to the northern coast of siberut lies the peleonan forest, which consists of a 45 km section of primary lowland and swamp forest (quinten et al . The maximum elevation is 190 m above sea level and the area is characterized by hills and ridges that are covered by primary mixed evergreen rain forest (hadi et al . 2009). Pungut field station of the siberut conservation programme (scp) is located (101s and 9850e) in the south of the peleonan forest . We conducted this study in a circular area of 10.7 km around the field station . The transect system around the station consists of 13 systematically placed transects each 13 km in length (waltert et al . We conducted triangulation at four different survey sites covering the study area of the scp during 4 wk from september 8 until october 3, 2010 . At each sample site although distance is not required for triangulation, we used the distance estimates to check that the same cluster was heard by two different listening posts . We checked distance estimates up to 900 m by moving from the listening post to the calling cluster using a global positioning system (garmin gpsmap 60csx). We collected data from three listening posts situated in a triangle formation on elevated terrain . The distances between listening posts were 300500 m. we collected data on four consecutive days at each site at 04:3010:00 h. observers stayed at the listening posts until the gibbons had stopped singing for 30 min . We conducted line transect surveys between 06:3011:30 h and 15:3018:00 h from september 14 and november 26, 2010 . Protocols, season, survey times, surveyed transects, and data analysis followed those of the last survey in the study area in 2005 (waltert et al . 2008). We surveyed each of the 13 transects around the field station between six and eight times (mean 7.23, sd = 0.6), resulting in a total survey effort of 155.5 km . We documented all detections of primates, recording species, cluster size, and the perpendicular distance from the transect line to the estimated center of the cluster using a laser range finder (nikon 550) for distances> 10 m and a tape measure for distances <10 m. we analyzed triangulation data following a triangulation protocol (cheyne et al . The triangulation method usually uses only duet counts for gibbons to ensure that a reproductive gibbon cluster is recorded (brockelman and srikosamatara 1993). However, unlike most gibbon species, male and female hylobates klossii do not duet . Instead males can be heard to sing between 01:00 and 13:00 h, but concentrate mainly on the hours before dawn, whereas females sing after dawn (whitten 1982b). We used only clusters that were recorded after dawn, i.e., those likely to be females, for analysis . We determined cluster size by mapping all sightings of gibbon clusters encountered during the entire study period . We assumed that individuals sighted> 300 m apart belonged to different gibbon clusters . For clusters encountered several times at the same location, we used the maximum number of individuals recorded as the size for that cluster . Owing to time constraints, we could not assess calling rates, so we assumed that females call every 34 d (whitten 1982b). We aimed for 3 d survey at each site, but unfortunately this turned out not to be possible, owing to time constraints and weather conditions in one site where we obtained only 2 survey days . Distance to the cluster is noted to aid data analysis if there are two clusters singing on the same compass bearing . 2010). Where there is no conflict in number of clusters on any given compass bearing, the compass directions only are plotted and intersections used to indicate clusters . Previous research on hylobates klossii estimated their home range to be 2035 ha (whitten 1982a), giving a circle of diameter 250333 m. we, therefore, defined clusters> 300 m apart as different clusters . Those closer than 300 m are likely to represent double counting where gibbons moved between calling bouts . We took the number of clusters heard per day and the total number of clusters heard from each listening post from the maps . We determined effective listening areas the areas where a minimum of two listening posts could have heard gibbon calls, within a radius of 1000 m around each post using arcgis 9.2 . We calculated density estimates using the following formula and correction factors, assuming that singing on successive days is independent (brockelman and ali 1987; cheyne et al . 2008). Density estimate: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$d={n \left/ {{\left [{p(m)\times e} \right]}} \right .} $$\end{document} and correction factor: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$p(m) = 1\text{--} {{\left [{1\text{--}\ p(1)} \right]}^m}, $$\end{document} where n refers to the cumulative total number of clusters heard in the effective listening area e at each site, p(m) denotes the cumulative number of clusters singing in m days, p(1) refers to the mean of the proportion of clusters heard calling at each site (once the data from all study days were combined). We calculated coefficients of variation (cv) using the formula cv = /, where denotes standard deviation and denotes mean . We calculated expected cluster size from a size - biased regression of ln[cluster size] against estimated detection probability g(x). Ideally surveys should be conducted using a systematic random design or a set of equally spaced transects randomly located in the survey region (buckland et al . 2010). At pungut, however, the trail system is oriented in a radial manner around the field station . To account for potential bias arising from over - coverage of the area directly surrounding the station, we stratified data in an inner circle with an area of 1.13 km (radius = 0.6 km) and an outer belt of 9.55 km . Because cluster density estimates did not differ significantly between stratified data and nonstratified data (z = 0.47, p = 0.64) we present estimates from non - stratified data . We compared cluster and individual density estimates between the two survey methods using a two - tailed z - test . Further, we compared cluster sizes including lone males with those excluding lone males, using a two - tailed z - test . Further, we calculated resolution r (minimum detectable change in population density) from both methods by using the formula r = 2.77 * (cv/100) for a significance level of 5% and a statistical power of 50% (plumptre 2000). The mentawai archipelago is located 85135 km west of the island of sumatra, indonesia . Siberut is the most northerly and largest island with an area of 4030 km (whittaker 2006; whitten 1982a). Close to the northern coast of siberut lies the peleonan forest, which consists of a 45 km section of primary lowland and swamp forest (quinten et al . The maximum elevation is 190 m above sea level and the area is characterized by hills and ridges that are covered by primary mixed evergreen rain forest (hadi et al . 2009). Pungut field station of the siberut conservation programme (scp) is located (101s and 9850e) in the south of the peleonan forest . We conducted this study in a circular area of 10.7 km around the field station . The transect system around the station consists of 13 systematically placed transects each 13 km in length (waltert et al . We conducted triangulation at four different survey sites covering the study area of the scp during 4 wk from september 8 until october 3, 2010 . At each sample site although distance is not required for triangulation, we used the distance estimates to check that the same cluster was heard by two different listening posts . We checked distance estimates up to 900 m by moving from the listening post to the calling cluster using a global positioning system (garmin gpsmap 60csx). We collected data from three listening posts situated in a triangle formation on elevated terrain . The distances between listening posts were 300500 m. we collected data on four consecutive days at each site at 04:3010:00 h. observers stayed at the listening posts until the gibbons had stopped singing for 30 min . We conducted line transect surveys between 06:3011:30 h and 15:3018:00 h from september 14 and november 26, 2010 . Protocols, season, survey times, surveyed transects, and data analysis followed those of the last survey in the study area in 2005 (waltert et al . 2008). We surveyed each of the 13 transects around the field station between six and eight times (mean 7.23, sd = 0.6), resulting in a total survey effort of 155.5 km . We documented all detections of primates, recording species, cluster size, and the perpendicular distance from the transect line to the estimated center of the cluster using a laser range finder (nikon 550) for distances> 10 m and a tape measure for distances <10 m. the triangulation method usually uses only duet counts for gibbons to ensure that a reproductive gibbon cluster is recorded (brockelman and srikosamatara 1993). However, unlike most gibbon species, male and female hylobates klossii do not duet . Instead males can be heard to sing between 01:00 and 13:00 h, but concentrate mainly on the hours before dawn, whereas females sing after dawn (whitten 1982b). We used only clusters that were recorded after dawn, i.e., those likely to be females, for analysis . We determined cluster size by mapping all sightings of gibbon clusters encountered during the entire study period . We assumed that individuals sighted> 300 m apart belonged to different gibbon clusters . For clusters encountered several times at the same location, we used the maximum number of individuals recorded as the size for that cluster . Owing to time constraints, we could not assess calling rates, so we assumed that females call every 34 d (whitten 1982b). We aimed for 3 d survey at each site, but unfortunately this turned out not to be possible, owing to time constraints and weather conditions in one site where we obtained only 2 survey days . Distance to the cluster is noted to aid data analysis if there are two clusters singing on the same compass bearing . This is a standard procedure (cheyne et al . 2010). Where there is no conflict in number of clusters on any given compass bearing, the compass directions only are plotted and intersections used to indicate clusters . Previous research on hylobates klossii estimated their home range to be 2035 ha (whitten 1982a), giving a circle of diameter 250333 m. we, therefore, defined clusters> 300 m apart as different clusters . Those closer than 300 m are likely to represent double counting where gibbons moved between calling bouts . We took the number of clusters heard per day and the total number of clusters heard from each listening post from the maps . We determined effective listening areas the areas where a minimum of two listening posts could have heard gibbon calls, within a radius of 1000 m around each post using arcgis 9.2 . We calculated density estimates using the following formula and correction factors, assuming that singing on successive days is independent (brockelman and ali 1987; cheyne et al . 2008). Density estimate: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$d={n \left/ {{\left [{p(m)\times e} \right]}} \right .} $$\end{document} and correction factor: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$p(m) = 1\text{--} {{\left [{1\text{--}\ p(1)} \right]}^m}, $$\end{document} where n refers to the cumulative total number of clusters heard in the effective listening area e at each site, p(m) denotes the cumulative number of clusters singing in m days, p(1) refers to the mean of the proportion of clusters heard calling at each site (once the data from all study days were combined). We calculated coefficients of variation (cv) using the formula cv = /, where denotes standard deviation and denotes mean . We calculated expected cluster size from a size - biased regression of ln[cluster size] against estimated detection probability g(x). Ideally surveys should be conducted using a systematic random design or a set of equally spaced transects randomly located in the survey region (buckland et al . 2010). At pungut, however, the trail system is oriented in a radial manner around the field station . To account for potential bias arising from over - coverage of the area directly surrounding the station, we stratified data in an inner circle with an area of 1.13 km (radius = 0.6 km) and an outer belt of 9.55 km . Because cluster density estimates did not differ significantly between stratified data and nonstratified data (z = 0.47, p = 0.64) we present estimates from non - stratified data . We compared cluster and individual density estimates between the two survey methods using a two - tailed z - test . Further, we compared cluster sizes including lone males with those excluding lone males, using a two - tailed z - test . Further, we calculated resolution r (minimum detectable change in population density) from both methods by using the formula r = 2.77 * (cv/100) for a significance level of 5% and a statistical power of 50% (plumptre 2000). Triangulation resulted in a mean density estimate of 5.01 clusters / km (95% ci: 3.16.9; table i). Mean cluster size was estimated at 3.5 individuals / cluster excluding lone gibbons (n = 27, 95% ci: 2.84.3) and 3.0 individuals / cluster (n = 34, 95% ci: 2.33.7) including lone gibbons . Those cluster sizes did not differ significantly from each other (z = 0.19, p = 0.85). The individual density estimate was 17.5 individuals / km (95% ci: 10.924.2) excluding lone males.table iparameters used to determine gibbon cluster densities at different sampling sites in the peleonan forest, siberut, indonesiasite numberclusters heardp(1) (95% ci, cv)p(m)m (days)e (km)density (clusters / km)1110.5 (0.141.14, 0.14)0.7523.194.62170.34 (0.180.5, 0.29)0.8143.236.53150.51 (0.170.86, 0.27)0.8833.225.274100.47 (0.090.85, 0.33)0.8533.213.67mean (95% ci, cv)13.25 (7.9918.51, 0.25)0.46 (0.330.58, 0.17)0.82 (0.730.91, 0.07)3 (1.704.30, 0.27)3.21 (3.193.24, 0.005)5.01 . (3.126.90, 0.24)p(1) mean of proportion of clusters calling vs. the total number of clusters identified over m days with 95% ci and cv; p(m) the cumulative number of cluster singing in m days; e effective listening area at each site . Mean values for all variables are given with 95% ci and cv parameters used to determine gibbon cluster densities at different sampling sites in the peleonan forest, siberut, indonesia p(1) mean of proportion of clusters calling vs. the total number of clusters identified over m days with 95% ci and cv; p(m) the cumulative number of cluster singing in m days; e effective listening area at each site . Mean values for all variables are given with 95% ci and cv we recorded 101 observations of hylobates klossii during line transect sampling, including auditory and visual records . A subset of 62 observations from truncation distance data at 92 m provided a good model fit, as did truncation to 42 m (fig . 1detection probability plot from line transect data (histograms) conducted for hylobates klossii between september 14 and november 26, 2010 in the peleonan forest, siberut, indonesia, and fitted detection function for truncation widths w = 92 m (a) and w = 42 m (b). Detection probability plot from line transect data (histograms) conducted for hylobates klossii between september 14 and november 26, 2010 in the peleonan forest, siberut, indonesia, and fitted detection function for truncation widths w = 92 m (a) and w = 42 m (b). We estimated cluster size from observed clusters as 2.7 individuals / cluster (95% ci: 2.33.2 individuals / cluster), cluster density as 5.5 clusters / km (95% ci: 3.97.7/km) and individual density as 14.89/km (95% ci: 10.221.7/km; table ii).table iiestimates, after data truncation, of encounter rate, cluster density, and expected cluster size, as well as detection probability (probability of observing a cluster within w [m] from the transect line) with 95% ci for hylobates klossii from line transect sampling in the peleonan forest, siberut, indonesiamean encounter rate of clusters/ km (95% ci, cv)0.40 (0.300.54, 0.15)expected cluster size (95% ci, cv)2.7 (2.33.2, 0.09)mean cluster density / km (95% ci, cv)5.5 (3.97.7, 0.17)detection probability (95% ci, cv)0.39 (0.330.46, 0.08)truncation distance w [m]92number of observations n62mean density, individuals / km (95% ci, cv)14.9 (10.221.7, 0.19)all estimates for truncation distance (w) from number of observations of clusters (n). Mean individual density estimates with 95% ci and coefficient of variation cv estimates, after data truncation, of encounter rate, cluster density, and expected cluster size, as well as detection probability (probability of observing a cluster within w [m] from the transect line) with 95% ci for hylobates klossii from line transect sampling in the peleonan forest, siberut, indonesia all estimates for truncation distance (w) from number of observations of clusters (n). Mean individual density estimates with 95% ci and coefficient of variation cv there were no significant differences in cluster (z = 0.32, p = 0.75) nor in individual density estimates (z = 0.53, p = 0.6) between triangulation and line transect methods . Thus, changes in cluster densities of r <66% at a significance level of 5% with a statistical power of 50% are unlikely to be detected using the triangulation method . For line transect surveys, changes in cluster densities are unlikely to be detected if r <47% at a significance level of 5% with a statistical power of 50% . We found no difference in our estimations of cluster or individual densities using triangulation and line transect sampling and therefore may assume similar accuracy from both methods . The true number of gibbons present in the area, however, is unknown, as is also the proportion of lone gibbons in the area, so we cannot correct individual density estimates gained by triangulation for this potential bias (cheyne et al . 2008). We also do not know the levels of under - recording of lone gibbons and those close to observers . Nevertheless, the detection probability plot showed a prominent shoulder when truncating to 42 m, suggesting no under - recording near the transect line (fig . Gibbon densities assessed by triangulation in our study area in 2003 resulted in density estimates of> 25 individuals / km (whittaker 2005), 50% higher than estimates obtained from line transect surveys in 2005 (waltert et al . 2008). However, this difference is due mainly to an exceptionally high estimate of mean cluster size in the triangulation study (mean cluster size 10 from n = 8 observations; whittaker 2005). Our mean cluster size for all gibbon cluster sightings used for triangulation (3.5 individuals) was similar to the mean cluster sizes in previous studies (3.4 individuals: tenaza 1975; 3.7 individuals: whitten 1982a). This suggests that more than eight sightings are needed to estimate cluster size (perhaps n> 20). If cluster size cannot be estimated accurately, we suggest using cluster density estimates instead of individual density estimates to compare results from different studies or from different survey methods . Although the two methods gave similar estimates of gibbon densities, line transect sampling resulted in more precise cluster density estimates, allowing better detection of changes over time . Even if search effort is optimal, the line transect method is unlikely to detect changes of <2530% (plumptre and cox 2006) whereas indirect methods, such as nest, dung, or cue surveys, are suggested to be unlikely to detect changes of <3050% (buckland et al . 2001; plumptre 2000). We conducted surveys over a relatively long time period (triangulation 4 wk; line transect surveys 10.5 wk); nevertheless we found that only much larger changes in densities than the ones suggested for optimal searching effort could be detected using either method . As time and funding are often limiting factors in small conservation projects, it is important that neither method may detect small changes (<45%) in population densities even if search effort is relatively high . The recommended number of observations to detect population changes over time is 100 (plumptre 2000), which confirms that our line transect sampling effort is not optimal to observe changes . The likelihood of calling over all survey days should be at least 1 to detect all clusters present in the study area during triangulation . For example, a minimum of 5 consecutive days of sampling at each site are suggested for hylobates agilis (obrien et al . Female hylobates klossi sing every 34 d (whitten 1982b), or even less frequently (keith et al . Thus, the 24 d we spent at each site might have led to an underestimation of cluster densities . Overall, we conclude that triangulation can yield density estimates that are not significantly different from those given by line transect sampling in primary lowland rain forests . The method of choice will depend on the objectives of the study and should take into account the terrain . Triangulation was effective in monitoring changes in population densities over time in hylobates albibarbis across kalimantan (s. m. cheyne pers . Comm . ). However, we suggest that line transect sampling is preferable for studies that focus on monitoring relatively small changes in population densities over time, because of its more precise estimates . Line transect sampling should also be chosen if a survey targets more than one species . If the objective of the study is to conduct rapid density estimates within a limited amount of time, in an area that is difficult to access, and/or if resources (human, funding) are limited, then triangulation might be more appropriate.
|
Modified and deformable bioactive substrates can enhance osteoblast adhesion and proliferation . The surface reactivity and interfacial adhesion of such substrates to bone cells can be attributed to the nature / type of surface modifications and functionalized layers attached to the bioactive materials . Bone cells transduce changes in the mechanical environment through adhesion molecules that link them to the extracellular matrix (ecm). The modifications and deformations of substrates are therefore likely to influence the actin cytoskeleton . Very few studies to date, have examined the combined effect of both mechanical stress and materials surface properties on bone cell function . This paper;therefore, investigates the effect of mechanical stimulus and substrate surface characteristics on osteoblasts attachment and proliferation . We hypothesized that the proliferation stage of osteoblastic cells to strain responses in vitro could be determined by the combined effect of applied mechanical strain and surface properties of a substrate . This paper will, thus, serve as a fundamental study in understanding mechanotransduction processes in bone cells seeded on modified bioactive substrates . Bone cells respond to mechanical stimulation and as a result, bone architecture is strongly influenced by mechanical force through a mechanism by which bone cells adapt to mechanical loading . Previous studies that have reported on the responses of bone cells to mechanical stimuli varied widely and therefore lacked consensus on what mechanisms of mechanotransduction were physiologically relevant . Minimal strains have been reported to occur in bone cells as a result of applied mechanical stresses under physiological conditions [3, 4]. Some reported studies have suggested, however that strain rate correlated with bone formation [5, 6]. One study had suggested that mechanical forces were transmitted to cells through the extra cellular matrix and recently published evidence suggested that the ecm - cell surface receptors (the integrins) may act as mechanoreceptors [8, 9]. In one study that focused on the mechanosensitivity of human bone derived cells, the authors demonstrated the frequency and cycle number dependence of the proliferative response of human osteoblast - like cells . That study further surmised that those two effects should not be considered separately since they were interrelated . In a recent study, however, a device was developed that enabled application of sinusoidal micromotions of amplitudes between 550 m and applied loads up to 1000 pa on cells, in vitro, to analyze the bone - implant interface . In another recent and related study, some investigators reported that short periods of applied physiological mechanical stresses induced immediate early gene expression and growth in mc3t3-e1 osteoblasts . Various techniques have been proposed and used in vitro by several investigators to study mechanostimulation of bone cells . Such studies have often used systems that included cell culture with controlled delivery of a mechanical input like hydrostatic pressure, fluid shear stress, and a substrate strain . Apparatuses devised in the laboratory for such studies included a variety of complex systems that featured mechanical inputs of varied degrees of precision and homogeneity although early efforts in cell culture mechanostimulus were of a nonquantitative nature . Glucksmann who pioneered cell mechanostimulus studies utilized several biological - loading models like endosteal cell cultures from embryonic chick tibiae . Quantitation in cell mechanostimulus studies was achieved by the landmark study of rodan and coworkers, which involved preparations of a variety of cells and explants as well as hydrostatic pressurization of suspended bone cells and tensile straining . Techniques for mechanical stimulation of cells that have been employed in the past, included use of hydrostatic pressure, axial compression, longitudinal mechanical straining, out - of - plane systems, and fluid shear stress systems . Special purpose systems were developed to study the combined effect of fluid stress and substrate deformation concurrently [1618]. Among the various mechanostimulus systems used, there was a strong preference for the longitudinal systems that were designed to effectively apply mechanical deformation to bone cells seeded on deformable membranes . In a most recent study, however, the authors confirmed that although mechanical stress was essential for the survival of cells and the maintenance of tissues, the mechanisms of cellular response to mechanical stress were not fully elucidated due to the diversity of mechanical stresses and mechanosensors . In this study, we developed and designed a system that enhanced the attachment and proliferation of bone cells to a deformable membrane . The objectives of this study were to anchor osteoblast cells to a substrate that was chemically functionalized and then modified with protein molecules; and to ascertain whether the combined effect of substrate modifications and applied equibiaxial mechanical strain could cause a change in the cytoskeletal architecture of the adherent bone cells . Prior to anchorage of cells to the substrate with attached protein molecules, the silicone membrane was functionalized by exposure to ultra violet radiation (uvo). The substrates were then characterized using the established surface characterizations tools such as contact angle goniometry, atomic force microscopy (afm), and rutherford backscattering spectroscopy (rbs). Bone cells (mc3t3-e1 osteoblasts) were then seeded onto the biomimetic surface, followed by evaluation of the cell function to determine changes in the cytoskeletal organization of the adherent cells . Silicone membranes of 0.005 inches thickness (silastic q7 - 4840, specialty manufacturing inc ., saginaw, mi) and 2.5 inches cross - sectional diameter were used as substrates for the studies . Membranes were first functionalized, coated with fn, and then cultured in cells prior to application of mechanical strain . The silicone membranes were exposed to 10 to 30 min uvo radiation in order to functionalize and oxidize the surfaces . This treatment resulted in the formation of active hydroxyl (-oh) groups on the surface of the membrane, compared to untreated surfaces, which remained hydrophobic . That is the membrane surfaces were made hydrophilic by exposure to ultraviolet ozone activation / radiation . Contact angle measurements on the substrate were made, on a goniometer, using the sessile drop method . 2 l droplets of water, suspended from the tip of a microliter syringe supported above the sample stage (rame - hart 100 - 00) were allowed to drop on the sample surface . Images of the droplet were captured with a ccd camera (zoom 7000 navitar tv zoom). The contact angles were measured and analyzed using an ati multimedia player and scion image program (microsoft). Roughness analysis of the silicone surfaces were performed using a dimension 3000 atomic force microscope (digital instruments, santa barbara, ca) under ambient conditions, on a 10 m 10 m scan size . The mean ra roughness (nm) of both nontreated and functionalized surfaces was measured . Topographical images were acquired in a tapping mode using silicon tips on integral cantilevers with nominal spring constant of 20100 n / m . Images were obtained from, at least, three different samples prepared on different days and on three microscopically separate areas on each sample . Afm scans were taken on substrates to determine relative changes in surface roughness after the surfaces were modified . Beams of he from the accelerator were utilized with a standard backscattering (bs) setup to obtain bs spectra of silicone membranes containing c, o, and si . The relevant rbs detector parameters were: current = 10 na, fwhm = 20, solid angle subtended by detector = 10, backscattering angle = 10, and the beam energy = 3.44 mev . An incident monoenergetic he beam used as the incident probe was elastically scattered off by target atoms such as si, o and c. to enhance sensitivity to light elements, beam energy of 3.44 mev was chosen since c and o have cross - section resonance near 3.40 mev and 3.1 mev, respectively . Simulations were performed using rump (rbs analysis and simulation package, version 4, 2002, computer graphics service ltd, el passo, tx). Rbs, a commonly applied technique in quantitative surface analysis with the ability to determine, at 13% precision, the elemental composition of samples and depth distributions was used to ascertain the surface modification reaction and to measure the depth profile of the elements si, o, and c. both the functionalized and nontreated silicone membranes were incubated in a 2.5 g / ml concentration of fn (sigma - aldrich, st louis, mo) solution for 1 h at 37c . The non - attached fn molecules were then removed by washing with physiologic buffer, pbs (ph 7.4). Prior to cellular attachment, this concentration of 2.5 g / ml of fn was coated on the different surfaces for 1 hour incubation at 37c in order to attain monolayer surface coverage . Mc3t3-e1 cells were maintained in 22 ml of complete medium consisting of dulbecco's modification eagles medium (dmem) supplemented with 10% fetal bovine serum, 2 mm l - glutamine and 50 g / ml penicillin / streptomycin (psf), ph 7.0 . Cells were passaged once every week and fed every other day with complete dmem supplemented with 10% fbs . The cells were cultured at 37c in a humidified atmosphere containing 5% co2 . The design and characterization of the system to apply mechanical forces to the cell culture consisted of an apparatus capable of deforming a compliant substrate and generating reproducible mechanical strains, mimicking in vivo conditions . This was to ensure the maintenance of cell viability during cell culture, attachment to the membrane and deformations that mimicked in vivo conditions and the possibility of imaging the system for real - time data acquisition . Controlling the cell environment meant providing conditions of 37c, 5% co2 and 100% humidity . Application of mechanical forces to cells seeded on the membranes conformed to techniques reported by banes and coworkers . The cell stretching device that incorporated the four - point bending system was fabricated at the department of anatomy & cell biology, school of dental medicine, the university of pennsylvania . The silicone membranes were attached to polystyrene cylinders with an o - ring, under sterile conditions (figure 1). The cylinder was screwed into a base with a glass window resting on another o - ring to create a chamber . The apparatus designed as a four - point bending system was capable of deforming a compliant substrate in order to generate a reproducible mechanical strain . It provided a sinusoidal waveform and an equibiaxial stress within a frequency range of 0.2 hz2.0 hz for a period of 2 hours under an atmosphere of 100% humidity, comparable to physiological conditions . As a result of applying loads up to 1000 pa, to produce strain rates of up to 4%, the membranes experienced strain regimes of 200 2500 in all four directions . The cells were seeded on the membranes at a concentration of 100,000 cells / cm for 24 hours, after which the membranes were subjected to a uniform equibiaxial strain . A 2% equibiaxial strain was applied at a frequency of 1 hz, in this experiment, because these conditions were postulated to be physiological . The experiments were terminated after 2 h and the cellular responses were evaluated . As a control, the osteoblasts cells were seeded on membranes prepared, as previously described, but not stretched . Actin filaments were visualized by treatment with alexafluor 568 conjugated phalloidin (molecular probes, eugene, or, usa). The medium was removed from each sample and the cell layer was washed twice with pbs . (0.1%) in pbs and 1% bovine serum albumin (bsa) were added to permeabilize the cells . After 20 minutes, the cell layer was washed twice with pbs and then incubated with phalloidin (1: 100) in pbs with 0.1% tween 20% and 1% bsa overnight at 4c . Cells were analyzed with a confocal microscope (the olympus fluoview), inverted, with a long - working distance lens . A specialized cap was used to enable evaluation of the cells through a plastic holder . In order to quantify the cells, a plane of maximum fluorescence was determined . The photomultiplier tube voltage was set at that plane point to serve as the control well the experiments were repeated three times and similar results were obtained with each of the replicates . Data were analyzed using a one - way anova where appropriate, with scheffe's test at a level of 0.05 . The treatment procedures of the silicone membrane surface were optimised in order to maintain its elastic properties . Observations made initially indicated that there were very minimal alterations made to the physical properties of the silicone membranes . In fact, when the membranes were subjected to equibiaxial strain, there was no evidence of deformation of the substrate . Surfaces of the functionalized membrane were characterized by contact angle measurements over time (figure 2(a)). In fact, there was up to 20 reduction in surface wetting after 10 minutes uvo exposure (figure 2(a)). Exposure of the membrane surfaces for longer time periods however, did not reduce the surface hydrophobicity of the si membranes, further . In order to characterize the topography of the silicone membrane, its surface composition was analysed using rutherford backscattering spectrometry (rbs) while surface roughness was evaluated by means of atomic force microscopy (afm). Rbs plot in figure 2(b)showed similarity in the surface profiles of three of the different samples of the membrane after exposure to various uvo times . Afm images (figure 3(a) to 3(d)) showed a steady increase in the surface roughness of the membranes after 10 to 30 min uvo treatment compared to the nonactivated sample . After 10 min uvo treatment, the mean nanoscale surface roughness (rms) was 2.4 nm (table 1). After 30 min uvo exposure however, surface roughness was more than doubled (cf . The surface density of fn molecules evaluated on the functionalized silicone surfaces indicated a nanoscale monolayer protein coverage of up to 150 ng / cm (figure 4). There was generally, a significant decrease in roughness on all the three surfaces after adsorbing 2.5 g / ml fn onto the functionalized surfaces; and more specifically, a mean surface roughness (rms) of 3.7 nm (table 1) was observed on the 30 min functionalized silicone membrane surface (figure 5). The cytoskeletal organization of cells was evaluated by staining actin filaments with phalloidin, after applying 2% dynamic equibiaxial strain exerted cyclically at 1 hz frequency (figures 6(a) to 8(b)). The mc3t3-e1 osteoblast cells that were subjected to strain for 2 h displayed a significant level of actin fluorescence (figures 6(a), 7(a) and 8(a)). Although no preferential orientation was observed, there was however, a significant increase in actin filament fluorescence at the cell periphery . On the nonstretched fn - coated membrane, the fluorescence intensity was generally considerably lower than the level displayed by the stretched cells (figures 7(b) and 8(b)). The frost mechanostatic theory assumed that the application of biophysical forces was supposed to be translated into a cellular response, thereby allowing the cellular organism to adapt to its mechanical environment . These biophysical forces involved a physiological strain range of 200 5000 . A strain regime below 200 resulted in a net bone loss; while between 200 and 2500, the strain regimes were described as physiological . Above 5000 the strain regime was described as pathological . In this and other models that have been developed to mimic the physiological environment, the mechanical stimuli were reported to occur in vivo and included fluid shear, hydrostatic compression, uniaxial stretch and biaxial stretch . In line with the objective of this study which was to engineer a deformable silicone membrane capable of enhancing osteoblast cellular attachment and proliferation; the uvo - activated silicone membranes were first physisorbed with the extracellular matrix protein, fn, which provided ligands for integrin receptors . This functionalized silicone - biomolecule (fn) substrate promoted attachment and proliferation of the bone cells, in conformity with data [2527] reported in previous studies . The data we obtained, after subjecting the osteoblast - like cells to the dynamic equibiaxial strain via the functionalized fn - coated silicone membrane, indicated that there were noticeable changes in the cytoskeletal architecture with minimum cell damage . Our data indicated that the modified silicone surfaces transduced mechanical stimuli directly to the attached cells, in conformation with a recent study that reported a direct effect of mechanical stimuli on osteoblast - like cells, probably through integrin receptors present in fn . The functionalized silicone surfaces created by exposure to uvo radiation, prior to attaching the fn molecules, counteracted the possibility of cell loss due to application of mechanical strain . The silicone substrate was probably bound directly to the attachment domain (rgd) of the fn molecule . Variations in the physical characteristics of the silicone membrane had been linked to the formation of an oxide layer after exposure of membrane to the uvo radiation, causing the formation of an excess of oxygen bridges with the functionalized silicone membrane . The extent of the functionalization time was maintained at 0 to 30 min uvo exposure time, in order to preserve the elastic characteristics of the membranes . Certain factors that might have contributed to promoting the adherence of osteoblast cells to the functionalised fn - coated engineered silicone surfaces included the rgd integrin receptors present in fn molecules, which might have bound to the subunits of the osteoblast - like cells' integrin receptor . In addition, one of the major factors that promoted the adhesion of osteoblasts was the modified surface topography of the silicone membrane . That is, increased surface roughness as evidenced by data obtained in this study, enhanced attachment of the osteoblast cells, as had been reported in other studies [27, 30, 31]. In order to assess the impact of mechanical forces on the attached bone cells, a dynamic equibiaxial tensile strain was imposed on the cellular - attached, fn - coated si surfaces the preliminary data obtained in this study indicated that cellular response in the physiological environment may be due to the applied equibiaxial strain to the membrane . That is, the applied strain caused the transduced forces in the membrane to be transmitted to the attached cells . There was therefore an even distribution of the dynamic equibiaxial strain across the silicone membrane which was ensured by the design of the setup [32, 33]. It was also evident from this study that the strain mechanisms involving a transfer of strain to the osteoblast layer tend to modulate cell function . We observed that the osteoblast cells that were subjected to equibiaxial strain displayed a significant change in morphology evidenced by slight elevation in actin filament staining (indicated by confocal microscopy images). This was in conformity with earlier reports by toma and coworkers, wang and coworkers and meazzini and coworkers and a more recent data which showed that cells responded to the applied force by changing their morphology . The morphological change could probably be linked to remodelling of the cytoskeletal structure of the cells . The attachment and proliferation of cells on the silicone substrate was thus enhanced, confirming the statement that applied forces to the membrane altered osteoblast cellular function . The results also suggested that the applied forces were directly transmitted to the cells via the cytoskeletal system as a result of the linkage between the osteoblast and the membrane through the fn - integrin receptors . The data obtained in this study indicated that we have engineered a system that employed functionalization method to activate surfaces of silicone membranes in order to enable linkage of various biomolecules, proteins, and cells . Furthermore, bone cell adherence and proliferation were more enhanced on strained, functionalized silicone - rgd (fn molecules) surfaces . As a result of the elastic characteristics of the functionalized silicone surfaces, further mechanisms by which bone cell functions could be physiologically influenced through mechanical strains could be explored.
|
It is important to understand the mechanism of the oxidatively generated damage to guanines in dna . The reason is that the damage causes mutations and cancer, and it is an obstacle to use dna as a molecular device. (1) in the case of the damage due to a one - electron oxidant, the reactions occur as follows . It then migrates to a nearby guanine base, because a guanine base has the lowest ionization potential (ip) among the dna bases . The trapped hole escapes to other guanine bases or triggers the chemical reactions which cause the damage to the guanine . It was found that the longer guanine run in a duplex dna is damaged more than the shorter ones . It was also reported that the attachment of a phenyl group to a guanine suppresses the damage not only at the phenylated guanine but also at nearby guanines in the duplex dna. (18) to understand the mechanism underlying these experimental results, we need to know how the hole transfer reactions occur in dna . One of the important parameters determining the charge transfer rate is the free energy difference between the reactant and the product . Thus, in the present work, we theoretically analyzed the ip of duplex dna corresponding to the free energy of the transferring hole on the duplex dna . Since the above experiments were carried out in the presence of a solvent (water), we took into account the solvent; this turned out to be crucial to understanding the above experimental results . One of our goals is to resolve the discrepancy between the theoretical results and the experimental one;(21) these results are about the free energy dependence of the transferring hole on the length of the guanine runs . The ips (corresponding to the free energy of the hole) obtained by the ab initio hartreefock (hf) molecular orbital (mo) calculations are smaller for the longer guanine run . These calculations were performed for the dna oligomers without a backbone in the gas phase . This result of the ip is in qualitative agreement with the experimental results as follows . If the free energy of the hole on the longer guanine run is smaller, then the probability of the hole to be there is larger and thus the longer one is damaged more . However, the calculated ip difference between g and gg (ggg) of 0.47 (0.68) ev is too large compared to the corresponding free energy difference of 0.052 (0.077) ev obtained from the time - resolved data for dna oligomers in water. (21) that is, if the previously calculated value was close to the real value, then the hole transfer from the longer guanine run to the shorter one hardly occurred and thus the distribution of the damage in the dna would become considerably different from the real one . Here, we neglect the entropy difference in the free energy difference between the reactant and the product of the hole transfer reaction by assuming that the potential functions of the reactant and the product are harmonic around the equilibrium structures and their second derivatives are similar . Another question to be answered in the present paper is about the effect of the chemical modifications of dna oligomers on the hole transfer reactions . When a neutral functional group is attached to a guanine in a dna oligomer in water, this removal was found to reduce the free energy of the hole on the guanine. (22) this might sound paradoxical . That is, since a polar solvent usually reduces the free energies of ions, the removal of nearby solvent molecules might be expected to increase the free energy of the hole it will turn out that this mechanism also explains the discrepancy mentioned in the previous paragraph . The free energy reduction of the hole mentioned above was confirmed by the ab initio and the semiempirical hf calculations for various neutral functional groups, i.e., the phenyl, the benzyl, and the tert - butyl groups with the two structures of the typical b - dna structures. (22) this free energy reduction was observed even when the phenyl group attached was replaced by an artificial h2 cluster mimicking the solvent - accessible surface of the phenyl group . Thus, it is considered that this free energy reduction is due to the removal of the solvent molecules. (22) this result agrees with the experimental one(18) that the damage to guanines near the phenylated guanine is suppressed as follows . The phenyl group attachment to a guanine reduces the free energy of the hole on it, and thus, the hole is trapped there; therefore, the guanines near the phenylated guanine are less damaged . We briefly review the relevant works on the electrostatic interaction and the solvent effects on dna, since they turned out to play crucial roles in the present cases . The electrostatic potential in dna has been studied for many years in order to understand its reaction with other molecules . It was pointed out that the effect of the electrostatic interaction on the ip of a guanine doublet is important. (25) as for the solvent effects, the hydration effect on the ip of the small fragments of dna, namely, the watsoncrick (wc) base pairs, nucleotides, and a phosphorylated dinucleotide, was investigated . Recently, the solvent effects on the much - larger - sized dna were investigated . These studies showed the importance of the solvent effects on dna . In the present work, we calculated and analyzed the ip of the duplex dna by taking into account the solvent, where this ip corresponds to the free energy of the hole on the duplex dna . On the basis of the same mechamism, we answer the above two questions as follows . Since the electrostatic interaction between the hole and a nucleotide pair in the duplex dna is attractive, the ip of the longer guanine run is smaller than that of the shorter one . However, this attractive interaction is reduced in water, which results in the small difference of the ip between the longer guanine run and the shorter one in water . This mechanism explains why the theoretical results without taking into account the solvent were too large compared to the experimental one. (21) the effect of the chemical modification is understood as follows . A neutral functional group attached to a guanine in a duplex dna in water expels the nearby water molecules which reduce the electrostatic interaction . Thus, the attractive electrostatic interaction stabilizing the hole on the guanine increases and the hole is stabilized . This is why the free energy of the hole decreases when nearby water molecules are removed . We calculated the ip of the duplex dna oligomers in the gas phase and in water as follows . We used the two structures of the typical b - dna structures, namely, the 55th(37) and the 4th(38) fiber models, to ensure that the result is independent of the structure deviation within the b - dna structure . Their global structures are similar; the helical twists are 36 for both of the two models and the rises are 3.39 and 3.38 for the 55th and 4th fiber models, respectively . These model structures are determined by x - ray diffraction, and thus, the coordinates of the h atoms are missing . Therefore, we added these coordinates and optimized them using the electronic structure calculations described in the next paragraph . We calculated these optimized coordinates for dna oligomers, which are in the neutral state in vacuum and in water, and in the ionic state in water . We calculated the electronic structures using the austin model 1 (am1) hamiltonian(39) implemented in the mopac2002 v1.0 program. (40) (we did not use the linear scaling calculation program mozyme .) We included the solvent as the dielectric continuum, namely, the conductor - like screening model (cosmo) with the dielectric constant of water, 78.4, and the vdw parameters optimized for the density functional theory. (42) these optimized parameters are expected to produce better results than the default ones implemented in the software;(43) this expectation was confirmed in the case of the ip of the nucleosides. (22) we calculated the ip as the difference between the total energies after and before one electron is removed . For these calculations there was no spin contamination in the case of an even number of electrons . In the case of an odd number of electrons, the spin contamination was less than about 3% and thus the error in the energy due to the spin contamination was calculated to be less than a few tenths of an ev . As for the ip in water, we calculated it for dna oligomers in the neutral state and the ionic state; in the latter state, the phosphate backbones are completely ionized . The actual ip in water is considered to be between these ips, since the ionic (neutral) state corresponds to the case when the counterions are far away from (very close to) the dna oligomers. (22) as for the validity of the method, we calculated the relative ips of the nucleosides in water (the relative ops), and compared them to the experimental result. (44) the root - mean - square (rms) deviation between the computational and the experimental result(44) was 0.14 v (table 1), which is similar to the experimental error. (44) in addition, the method described here was successfully used to calculate the ips and the electron affinities of nucleic acid bases in the gas phase, where the rms deviations between the computational results and the experimental ones are 0.12 and 0.20 ev, respectively . The ips calculated by the method include the reorganization energies due to the relaxation of the solvent and h atoms of the solute but not that due to the relaxation of the heavy atoms of the solute . Our conclusions are not affected by this approximation, as will be discussed in section . The solvation energy for the solvent change acetonitrile / h2o is calculated to be 0.02 ev using the born equation,(44) and thus, the correction to the relative op for the solvent change is negligible . In order to interpret the ips obtained by the electronic structure calculations, we used the net charges and dipoles of atoms and the electrostatic interaction calculated from them . The charge distribution of the hole is defined as the difference in the charge distributions between after and before the removal of an electron . We calculated the ip of the dna oligomer d[5-(g)n-3]d[3-(c)n-5] (figure 1a); we found that the ip in the gas phase significantly decreases with the increasing number of base pairs, n, whereas the ip in water (or op) only slightly does (figure 1b). The decrease in the ip in the gas phase from n = 1 to 3 is more than about 1 ev, but that in water is less than 0.2 ev . The latter result is consistent with the experimental result for the dna oligomers in water. (21) the difference between the ip decreases in the gas phase and in water is much larger than the rms deviation (0.14 v) between the computational and the experimental results obtained in section . The values of the ips in the gas phase rapidly decrease for n 3 and converge for n 5 or 6 . About 90% of the charges of the hole is in a certain guanine and 5% is in the sugar covalently bonded to this guanine both in the gas phase and in water . We confirmed the above results using the two structures of the typical b - dna structures . Note that the actual ip in water is between the solid and dashed lines, as described in section . (a) the structure of the duplex dna d[5-(g)6 - 3]d[3-(c)6 - 5]. (b) the ip of the dna oligomer d[5-(g)n-3]d[3-(c)n-5] as a function of the number n of base pairs for the 55th fiber model structure and the 4th fiber model structure, as indicated . Solid line with closed circles: the dna oligomer in the neutral state in water . Dashed line with closed diamonds: the one in the ionic state in water . Dotdashed line with closed squares: the one without a backbone in the gas phase . We calculated the ip of the dna oligomers, d(5-aagaa-3)d(3-ttctt-5) and d(5-aggga-3)d(3-tccct-5), where the lengths of the guanine runs are different but the total number of base pairs is fixed; we again found that the ip difference between the two sequences in water, 0.11 (0.10) ev, is smaller than that in the gas phase, 0.21 (0.15) ev, for the 55th fiber model (the 4th fiber model). As shown in figure 2, the ips calculated above (the closed symbols) are close to the electrostatic energy of the hole both in the gas phase (the open triangles) and in water (the open circles). It is also shown that this energy in the gas phase decreases more strongly when we replace the charge distribution of the dna oligomer in the gas phase by that in the neutral state in water (open inverted triangles). We define the electrostatic energy of the hole as the electrostatic interaction between the hole and all atoms except for the atoms of the guanine where the hole is localized plus a constant; this constant is such that the value of this electrostatic energy coincides with the ip in the gas phase for n = 1 . In the case of the dna oligomer in water, we added the electrostatic interaction between the hole and the water; we obtained this interaction as the dielectric energy,(49) which is considered to be the free energy but not the energy . We neglected the charge distribution of the hole outside the guanine where the hole is localized . We used the charge distribution after the removal of an electron as the charges which interact with the hole . We confirmed the above results using the two structures of the typical b - dna structures . Comparison of the electrostatic energy of the hole (defined in the text) with the ip of the dna oligomer d[5-(g)n-3]d[3-(c)n-5] as a function of the number n of base pairs for the 55th fiber model structure and the 4th fiber model structure, as indicated . The symbols and lines are the same as those in figure 1b except that the open symbols denote the electrostatic energy of the hole . Open inverted triangles: the dna oligomer in the gas phase but with the charge distribution of the dna oligomer in the neutral state in water . To understand the electrostatic interactions in the dna oligomers, we calculated the charge distributions of the dna oligomer d[5-(g)53]d[3-(c)5 - 5] in the neutral state in the gas phase and in water (figure 3); we found that the bases and sugars have negative partial charges and the phosphates have positive partial charges both in the gas phase and in water (figure 4). (the phosphate backbones in the neutral state are not ionized .) About 90% of the charges of the hole is in a certain guanine both in the gas phase and in water, as described earlier . We observed the same features in other sequences of the dna oligomers (not shown). Charge distributions in the dna oligomer d[5-(g)5 - 3]d[3-(c)5 - 5] in the neutral state in the gas phase and in water, as indicated . G, c, s, and p denote guanine, cytosine, sugar, and a part of the phosphate, respectively . Simplified charge distributions in the dna oligomer d[5-(g)5 - 3]d[3-(c)5 - 5] in the neutral state in the gas phase and in water, as indicated . Same as in figure 3 except that the net charges of the fragments are shown . The fragment from which the largest fraction of an electron is removed is shown by the bold fonts and bold lines . The net charge of the fragment after removing an electron is indicated by an arrow . The fragments of sugars and bases are divided at the n9c1 bond for guanines and the n1c1 bond for cytosines . The fragments of the phosphates and sugars are divided at the po5 and po3 bonds . We calculated the ip of the dna oligomers with other sequences, where a guanine is embedded in the center of the contiguous adenines or thymines, and obtained the same result with that of d[5-(g)n-3]d[3-(c)n-5] (figure 5). That is, the ip significantly decreases with the increasing n in the gas phase, whereas it does only slightly in water . The values of the ip decreases are slightly smaller than the corresponding values of the contiguous guanines in figure 1b, both in the gas phase and in water . Ip of the dna oligomers as a function of the number n of base pairs, where a guanine is embedded in the center of the contiguous adenines or thymines . (a) n = 1, 2, 3, 4, 5, and 6 are for d(5-g-3)d(3-c-5), d(5-ag-3)d(3-tc-5), d(5-aga-3)d(3-tct-5), d(5-aaga-3)d(3-ttct-5), d(5-aagaa-3)d(3-ttctt-5), and d(5-aaagaa-3)d(3-tttctt-5), respectively . (b) same as in figure 5a except that a and t are exchanged in the sequences of the dna oligomers . To understand the dependence of the obtained ips on n, we calculated the ip of the system made of two gc base pairs (the inset in figure 6) as a function of the rise r; we found that the ip of this system (the solid line in figure 6) is close to the ip of the single base pair plus the electrostatic interaction between the hole and the base pair where the hole does not reside (the dashed line in the same figure). The values of the ip rapidly increase for r 5 and converge for r 10 . We used the method described in section except that we removed the sugarphosphate backbones (except the c1 atom) from the structure of the dna oligomer d(5-gg-3)d(3-cc-5), capped the dangling bonds with the h atoms, and optimized the coordinates of h atoms for single base pairs . That is, the structure of the system in the cationic (neutral) state is made of the optimized structure of the gc base pair of the 5-side in the cationic (neutral) state and that of the gc base pair of the 3-side in the neutral state . We calculated the electrostatic interaction between the hole and the base pair where the hole does not reside; this interaction is the electrostatic interaction between one base pair in the cationic state and the other in the neutral state, minus that between the two base pairs both in the neutral state . More than 97% of the charges of the hole is in the guanine of the 5-side in the calculated electronic structures of the system . Ip of the two gc base pairs as a function of the rise r. the inset shows the structure of the two gc base pairs . Solid line: ip of the system made of the two gc base pairs . Dashed line: ip of the single gc base pair plus the electrostatic interaction between the hole and the base pair where the hole does not reside (defined in the text). To understand the reduction in the ip decrease with the increasing n due to the solvent, we developed simple models of dna oligomers (figure 7a); we showed that these models reproduce the ips of the dna oligomer d[5-(g)n-3]d[3-(c)n-5] (figure 7b). In this figure, the open symbols are for the simple models and the others are the same as those in figure 1b . A duplex dna oligomer is modeled as a box with the simplified charge distribution of a duplex dna oligomer in the neutral state (the hole is localized on a certain guanine) and the water is replaced by a conductor (figure 7a). The reason is that the dielectric constant of water is large (78.4) and the solvation energies of the dielectric continuum scale as (1)/(+ x) with the dielectric constant, where 0 x 2. (50) (a) charge distributions of the simple models for dna pentamers with and without backbones, as indicated . One electron is removed from the filled circle marked by the outer circle, when the dna is oxidized . The size of the box in the x- and y - directions is 18 . Charge distributions for dna oligomers with different numbers of base pairs are defined in the same way as for the pentamers . (b) comparison of the ips of the simple models with those obtained by the mo calculations in section for the 55th fiber model structure (figure 1b). The symbols and lines are the same as those in figure 1b except that the open symbols are for the simple models of the dna oligomers in the gas phase, those in water in the neutral state, and those without a backbone in the gas phase, as indicated . To discuss the obtained ips, we calculated the vertical ip of the dna oligomer d[5-(g)n-3]d[3-(c)n-5] (figure 8), and obtained a similar result with that of the ip (figure 1b). That is, the vertical ip more significantly decreases with the increasing n in vacuum than in water . Since, by definition, the vertical ip does not include the reorganization energy, we obtained the vertical ip as the energy level of the highest occupied molecular orbital (homo) with the opposite sign using the restricted hf (rhf) method with koopmans theorem . The vertical ip of the dna oligomer d[5-(g)n-3]d[3-(c)n-5] as a function of the number n of base pairs . We calculated the ip of the modified nucleotide - containing dna oligomer, d[5-t1a2g3g4t5a6 - 3]d[3-a12t11c10c9a8t7 - 5], where a phenyl group is attached to g3 (figure 9a); we found that the attachment of a phenyl group reduces the ip in water but not in the gas phase (figure 9b). For the phenylated dna oligomer in water, the hole is always localized on the phenylated guanine g3 . We used the dna sequence of the six base pairs around the phenylated guanine in the experiment. (18) we used the method described in section except that we optimized the coordinates of the phenyl group atoms by the electronic structure calculations . As for a single base, the op of n - phenyldeoxyguanosine g relative to that of deoxyguanosine was 0.03 v in the experiment,(18) and the calculated one is 0.09 v, where the geometries are fully optimized . In the experiment,(18) the solvent was dimethylformamide (dmf); the solvation energy for the solvent change dmf / h2o is calculated to be 0.02 ev using the born equation and thus the correction to the relative op for the solvent change is negligible . (a) structure of the modified nucleotide - containing dna oligomer, d[5-t1a2g3g4t5a6 - 3]d[3-a12t11c10c9a8t7 - 5], where a phenyl group is attached to g3 . The dna sequence is the sequence of the six base pairs around the phenylated guanine in the experiment. (18) (b) the effect of the phenyl group attachment on the ip of the dna oligomer in the gas phase, in the neutral state in water, and in the ionic state in water, for the 55th fiber model structure and the 4th fiber model structure, as indicated . The ips before and after a phenyl group is attached are indicated by g and g, respectively . Figure 1b shows that the large decrease (in the order of 1 ev) of the ip in the gas phase with the increasing dna length is reduced to about a tenth of an ev in water . This reduction in the ip decrease is due to the solvent, since the computational error is less than about a tenth of an ev (section). We can now understand why the calculated ip difference between g and gg (ggg) (in the order of 1 ev) is much larger than the experimental one (in the order of 0.1 ev). (21) this is because the solvent is not included in the calculations . In the present work, we used the two structures of the typical b - dna structures, i.e., the 55th(37) and the 4th(38) fiber models . These models do not include the sequence dependence of the dna structure; namely, the structure parameters of a base are independent of nearby bases . Since figure 1b shows that the general features of the ips are similar for both structures, we consider that the effect of the structure deviation within the b - dna structure on the ip is minor and so is that of the sequence dependence of the dna structure . From figure 2, it is clear that the decrease of the electrostatic energy of the hole causes the ip decrease with the increasing number of base pairs, n. since the electrostatic energy of the hole decreases with the increasing n in figure 2, the electrostatic interaction between the hole and a nucleotide pair is attractive in a duplex dna; this nucleotide pair includes the two phosphates bonded to it . We now understand the obtained dependence of the ips on n as follows . Because of the attractive interaction between the hole and a nucleotide pair, the ip in the gas phase decreases with the increasing n. this attractive interaction is reduced in water, and so is the ip decrease with the increasing n. when we replace the charge distribution of the dna oligomer in the gas phase by that in the neutral state in water, the electrostatic energy of the hole in the gas phase decreases more strongly (figure 2). The reason is that the polarization of the dna oligomer is induced in water (figure 4). From the simplified charge distribution of the dna oligomer in figure 4, we understand why the electrostatic interaction between the hole and a nucleotide pair is attractive in the duplex dna; this nucleotide pair includes the two phosphates bonded to it . The reason is that the hole is on a guanine and thus it is closer to nucleobases and sugars, which have negative partial charges, compared to phosphates, which have positive partial charges . We consider that the simplified charge distribution can be used to understand the above reason because the hole is delocalized over a guanine base and the rough electrostatic potential is smoothed . The ip in the gas phase decreases more strongly than that without a backbone (figure 1b), because the positive partial charges are separated more from the hole for the dna oligomer with backbones compared to that without . In water, the ips of the dna oligomers in the ionic states are smaller than those in the neutral states (figure 1b). This is because the pn s, which have positive partial charges in the neutral state of dna oligomers, become almost neutral in the ionic state of the dna oligomers and the repulsive interaction between pn s and the hole is reduced in the ionic state . The charge distribution of the dna oligomer in figure 4 is in accord with the result that the electrostatic potential around the guanine is lower in the interior than at the end of the sequence. (51) figure 5 shows that the similar dependence of the ip is observed also for the different sequences . We consider that the reason is the same as that for the dna oligomer d[5-(g)n-3]d[3-(c)n-5], since the charge distribution has the same features, as mentioned above . Figure 6 shows that the attractive electrostatic interaction between the hole and a base pair causes the ip dependence of the rise r; this supports that this attractive interaction causes the dependence of the ip on n in figure 1b . The ip in figure 6 rapidly increases for r 5 and converges for r 10 . From this result, we can understand that the ips in the gas phase in figure 1b rapidly decrease for n 3 and converge for n 5 or 6 by considering that the hole is usually in the middle of the dna oligomer and the rise in the duplex dna is 3.4 . The simple models of dna oligomers (figure 7a) illustrate that water molecules around the duplex dna (but not between the base pairs) reduce the electrostatic interaction in the duplex dna (figure 7b). As shown in figure 8, the vertical ip more significantly decreases with the increasing n in vacuum than in water, similarly to the ip in figure 1 . As for the dielectric shielding, when we use koopmans theorem, the hole is not shielded by the solvent, but other charges are shielded, and thus, the attractive electrostatic interaction between them is reduced in water . Thus, this reduction in the attractive electrostatic interaction leads to the result that the vertical ip in water is larger than that in the gas phase . Because of the reorganization energy, the ips in water are more than a few ev smaller than the corresponding vertical ips . The result of the ips include the electronic energy reduction due to the charge redistribution in dna after an electron is removed . However, that of the vertical ip does not . This is because we used koopmans theorem to calculate the vertical ip . We also observed a slightly smaller decrease in the vertical ip in the gas phase with the increasing n and the slightly larger one in water compared to the corresponding ips . The reorganization energy due to the relaxation of the dna atoms and the electronic energy reduction mentioned above increase with the increasing n and these are included in the ips but not in the vertical ips . Thus, the ip in the gas phase decreases slightly more than the corresponding vertical ip . As for dna in water, when n is increased, a part of the dna replaces a part of the solvent, where the dielectric constant of the former is smaller than that of the latter, and thus, the total reorganization energy decreases . Therefore, the ip in water decreases less than the corresponding vertical ip . Since we did not include the reorganization energy due to the relaxation of the heavy atoms of dna, the above decrease in the reorganization energy with the increasing n was overestimated . Thus, the decrease in the exact ip with the increasing n should be between those of the ip and the vertical ip obtained in the present work . As shown in figure 9, when the neutral functional group is attached to the guanine in the duplex dna in water, the free energy of the hole on the guanine is reduced (but not in the gas phase). This result is counterintuitive, since the attached group expels the nearby water molecules, which are usually expected to stabilize ions . Thus, when nearby water molecules are removed, the attractive electrostatic interaction stabilizing the hole increases . As for a single base, guanosine, the calculated op of n - phenyldeoxyguanosine g relative to that of deoxyguanosine is small and positive, i.e., 0.09 v, which is close to the experimental value of 0.03 ev. (18) this means that the free energy of the hole (or op) is not reduced by attaching the phenyl group . The reason is that there is no other bases and sugars which could attractively interact with the hole in the case of a single base . This result of the free energy reduction agrees with the previous one. (22) the difference between the former and the latter is that the former includes the reorganization energy due to the relaxation of the solvent but the latter does not . The stabilization of the guanine radical cation by the attached phenyl group similarly affects its chemical reactions, namely, the hydration and deprotonation processes,(52) as follows . This stabilization makes the possibility that the hole injected is on the phenylated guanine greater and that for guanines nearby less . Thus, the quantum yields of both of the chemical reactions of the nearby guanines decrease . In addition to that, this stabilization reduces the free energy of the initial state for both of the chemical reactions of the phenylated guanine radical cation . This result agrees with the experimental result that the damage to the guanines near the phenylated guanine is suppressed. (18) here, we have to be careful about the chemical yield data in the experiment(18) as follows . In this experiment, thus, the product of the deprotonation was detected, but the products of the hydration processes, namely, 8-oxo-7,8-dihydroguanine (8-oxogua) and 2,6-diamino-4-hydroxy-5-formanido phyrimidine (fapygua) were not . The ratio of these two kinds of damage is sequence dependent,(53) and 8-oxogua, which is the main product of the hydration process, is highly susceptible to secondary one - electron oxidation reactions . However, if the probability of the damage of one kind is larger (or smaller) at a site, then so is that for the other kind,(53) and this feature is not changed by the secondary one - electron oxidation reactions . Thus, if the probability of the damage of one kind is smaller at a site, then so is the other . The miscellaneous points about the stabilization of the guanine radical cation by the attached phenyl group are as follows . According to the above mechanism, the ip of the modified nucleotide - containing dna oligomer in the neutral state in water is supposed to be between the ip of the dna not modified in the neutral state in water and that in the gas phase . However, it is not, as shown in figure 9 . One of the reasons is that when the nearby water molecules are removed, the ip of the modified nucleotide - containing dna oligomer in the neutral state in water approaches not simply the ip of the dna in the gas phase but that when the dna is polarized by water . In water, the ip of the modified nucleotide - containing dna oligomer in the ionic state is smaller than that in the neutral state . The reason is the same as that for the dna oligomers which are not modified . There are the computational results obtained by neglecting the solvent, where the ip dependences on the dna sequence are smaller than those obtained by the ab initio hf mo calculations . For example, the calculated ip differences between the dna oligomers, 5-aga-3 and 5-ggg-3, are 0.10.2 ev, which are closer to the corresponding experimental result, 0.077 ev. (21) however, in the case of the different sequences, 5-tgt-3 and 5-ggg-3, the calculated ip differences are 0.30.5 ev, which are larger than the value(58) (less than 0.1 ev) calculated from the experimental results . In these computations, the semiempirical nddo - g method(56) and the density functional theory(57) were used . In both of them, the backbones of the dna oligomers were neglected; this makes the ip dependence on the dna sequence smaller (figure 1b). In the latter,(57) the charge distribution of the hole was calculated from the homo obtained by diagonalizing the reduced hamiltonian with the elements i|h|j, where h is the kohnsham (ks) hamiltonian, i and j are homos of individual nucleobases, and the total system is made of the stacked three base pairs without a backbone . However, the vertical ionization potential was obtained not as the energy of the homo of the total system but as the diagonal element of the reduced hamiltonian at the middle guanine site in the base pairs . The reason was not described . About 90% of the charges of the hole is always in a certain guanine in our calculations . The inclusion of the neglected reorganization energy due to the relaxation of the heavy atoms of dna will further localize the hole and not change the situation . The damage observed in the experiments is rather localized on a certain guanine in the g run . This fact also supports that the hole is localized . By neglecting the reorganization energy and the solvent effects, more than 95% of the charges of the hole is in a certain guanine for the stacked guanine bases and 70% is in a certain guanine for the stacked gc base pairs. (19) more than 80% is in a middle guanine for the stacked three (n = 3) gc base pairs with backbones, but it is delocalized over two guanines for n = 4. (51) the reason for the difference in the extent of the localization between these results and ours is mainly that the reorganization energy was neglected in these calculations . The calculated ip of the stacked ga is smaller than that of g in the gas phase, and the difference between them is reduced in water. (27) this result is similar to that in figure 1 and is understood in the same way . The calculated vertical ips of the dna tetramers with 65 water molecules are larger than those in the gas phase by a few ev,(34) where the b - dna structure model is different from the ones used here . This result is similar to that in figure 8 and is understood in the same way . Thus, it supports that the effect of the structure deviation within the b - dna structure on the ip is minor and so is that of the sequence dependence of the dna structure . It was discussed that the discrepancy between the theories and the experiment on the ip of the guanine run is reduced by taking into account the solvent effects;(29) in this work, the previously calculated ips(19) were used as the values for the hole fully delocalized over the guanine run and this delocalization was assumed to be the origin of the ip dependence on n in vacuum . However, more than 95% of the hole is localized on a certain guanine in the results(19) used there, and the origin of the ip dependence on n is not the delocalization of the hole, as described above . If the origin of the ip dependence on n was the delocalization of the hole, the average of the homo and homo-1 of the guanine doublet was close to the homo of the single guanine . We examined the ionization potential (ip) corresponding to the free energy of a hole on a duplex dna using the am1 method(39) with cosmo . The electrostatic interaction between the hole and a nucleotide pair in the duplex dna is attractive . Due to this attractive interaction, the ip in the gas phase significantly decreases with the increasing number of base pairs of the dna oligomer . On the other hand, this attractive electrostatic interaction is reduced in water . The guanine runs, this is the reason why this ip dependence calculated by neglecting the solvent(19) was much larger than that obtained from the time - resolved data. (21) including the solvent makes this ip dependence consistent with the experimental result . As for the effect of the chemical modifications of dna, when a neutral functional group is attached to a guanine in a dna oligomer in water, nearby water molecules are removed; this removal was found to reduce the free energy of the hole on the guanine. (22) one might naively have expected the opposite case, since a polar solvent usually stabilizes ions . When some water molecules are removed, the attractive electrostatic interaction stabilizing the hole increases, and thus, the hole is stabilized . In order to design the hole energetics by a chemical modification of dna,
|
The akaki river in ethiopia is purported to be contaminated with multiple toxic agents, including metals . The river runs through residential, commercial, and industrial areas of the capital city of addis ababa (figure 1), where it can be subjected to industrial (e.g., tanneries and battery factories) [13] and human (e.g., domestic wastewater and surface run - off) pollutants . Previous studies describe metal levels in the river itself, as well as nearby fish, soil, and irrigated vegetables [1, 5]. One study found that manganese and iron levels in the akaki river exceeded limits set by the ethiopia environmental protection agency . This study also found measurable amounts of cadmium, chromium, copper, zinc, manganese, iron, and nickel in soil and vegetables irrigated by the akaki river, with all vegetables having chromium levels that exceeded the maximum limit . Another study found that vegetables irrigated by the akaki river had levels of cadmium and lead that exceeded the maximum limit . There is little information in the published literature of what effect, if any, the akaki river might have on residents living downstream from addis ababa, and whether residents living in this area might have increased risk of exposure to metals and other contaminants compared to the general ethiopian population . It is possible that these residents could use the river water for irrigation, animal husbandry, or other uses [1, 2]. Our objectives were to characterize metal exposures in urine, blood, and drinking water samples of a community living near the akaki river and to compare these levels to a community living distant to the akaki river . We chose akaki - kality subcity as our community of interest near the akaki river . Akaki - kality is 25 kilometers south of addis ababa, and the akaki river flows through western akaki - kality after passing through addis ababa . Approximately 200,000 people reside in akaki - kality, which is 125 square kilometers and contains over half of the industries of addis ababa . Approximately 350,000 people reside in yeka subcity, which is 86 square kilometers and situated 10 kilometers east of central addis ababa . We conducted a cross - sectional study of 101 houses in akaki - kality and 50 houses in yeka from june 28 to july 1, 2011 . We first stratified participating subcities into woredas (i.e., districts). In akaki - kality, six of the eight woredas bordering the akaki river agreed to participate; in yeka, two of the thirteen woredas agreed to participate . Field teams sampled households systematically within each participating woreda by randomly selecting a starting point and systematically select every nth housing unit . N separately for each subcity, by taking the total estimated population of the participating area (akaki - kality: 10,548; and yeka: 8,985) and dividing by the target sample size (akaki - kality: 100 and yeka: 50, resp . ). Thus, we selected 1 in every 105 houses in akaki - kality and 1 in every 180 houses in yeka . If a household did not answer the door or refused to participate, then the field team solicited participation from the next closest household . All field teams were trained in the study methods and interviewing techniques immediately prior to the field work . Field teams did the following: obtained informed consent from the head of household; collected a drinking water sample; conducted a household - level questionnaire (e.g., household demographics and sources of food and drinking water); collected urine and blood sample from one volunteer; and conducted an individual - level questionnaire from the same volunteer (e.g., occupation, whether they drank alcohol, and health status). The us centers for disease control and prevention (cdc), division of laboratory sciences in atlanta, georgia, analyzed urine metals (antimony, arsenic, barium, beryllium, cadmium, cesium, chromium, cobalt, iodine, lead, mercury, molybdenum, nickel, platinum, thallium, tungsten, and uranium) and blood metals (cadmium, lead, manganese, mercury, and selenium) using inductively coupled dynamic reaction cell plasma mass spectrometry (icp - drc - ms) and sector field inductively coupled plasma mass spectrometry (sf - icp - ms; table 1). This list of metals was chosen because it is a comprehensive list of the most common metals that persons might be exposed to, and comparison data for these metals exist for the us population . Spot urine samples can vary in dilution between persons; thus, we adjusted all urine samples for creatinine to help account for this dilution and to facilitate comparisons between participants . We present most urine metals in units of g / g creatinine and most blood metals in units of g / l; the exceptions were urinary iodine and blood lead, which are commonly reported as g / l and g / dl, respectively . The environmental science corporation (esc) lab sciences in nashville, tennessee, analyzed drinking water samples for nitrates and metals using the us environmental protection agency's (epa) method 200.7 for chromium, cobalt, copper, manganese, and nickel; epa method 200.8 for arsenic, cadmium, and lead; epa method 245.1 for mercury; and epa method 353.2 for nitrates . We used maximum likelihood estimation to calculate geometric means and to compare metal concentrations by subgroup . This method accounts for the left censoring that results when some metal concentrations are below the limit of detection (lod). We considered p values <0.05 to be statistically significant . At the time of this investigation, there was little information available regarding baseline metal levels in the general ethiopian and other east african populations . Thus, to put our results into perspective, we compared urine and blood metal concentrations among study participants to the us population, as calculated through the us national health and nutrition examination survey (nhanes). We compared drinking water concentrations among study participants to the guideline values established by the world health organization (who). For urine or blood metals in which at least half of the study population had detectable levels, we conducted multivariable linear regression . In these models, the log - transformed metal was the outcome, and characteristics were considered for inclusion as independent variables in the model if they were statistically significant in univariable analyses . This investigation was initiated following a request for cdc epi - aid assistance from the ethiopia federal ministry of health to collect baseline information on exposure to possibly harmful contaminants in water from the akaki river . Overall, 90% of households were at home at the time of the visit, and 76% of households that were at home participated . Households were clustered tightly together in yeka, and in akaki - kality households were located along the akaki river (figure 1). Household members in both subcities ranged in age from 1 to 80 years, with a mean of 28 years in akaki - kality and 26 years in yeka . Body mass index, amount of time living in the subcity, occupation, health behaviors, and drinking water characteristics did not differ substantially between akaki - kality and yeka (table 2). Body mass index ranged from 14 to 38 kg / m, with a median of 22 kg / m . One - third (38%) did not have an occupation, 17% worked in a factory or as a laborer, and 12% worked in business . Few participants reported drinking alcohol (17%), chewing khat (5%), or smoking cigarettes (2%). This tap was usually in the yard, and water was collected in a plastic container (figure 2). In akaki - kality, the municipal supply was drawn from groundwater; in yeka, the municipal supply was drawn from surface water . One - fourth of participants were concerned that their tap water could cause health problems; this was more common in yeka (34%) compared to akaki - kality (18%) (p = 0.02). Some participants felt insecure about their water's cleanliness (34%), or they noted that their water had a bad color (17%), bad taste (9%), or bad smell (5%). Urinary molybdenum (p <0.001), tungsten (p <0.001), lead (p <0.001), uranium (p <0.001), and mercury (p = 0.049) were higher in akaki - kality participants compared to yeka participants; yeka participants had higher concentrations of urinary arsenic (p = 0.009). Compared to the us adult (aged 20 years) population in 2011 - 2012, study participants had mean levels of urinary cobalt that were over four times higher and mean levels of urinary molybdenum that were over two times higher . Conversely, urinary cesium and mercury levels were considerably lower in our participants compared to the us, with mean levels being over two times higher in the us . Median urinary iodine concentrations were relatively low in both subcities (akaki - kality: 53.9 g / l, yeka: 60.1 g / l). As a result, both subcities met the world health organization's (who) guidelines as having moderate iodine deficiency (population median iodine levels from 50 to 99 in akaki - kality, only 2% of households exceeded the reference value (p <0.001). Most drinking water samples contained detectable levels of nitrates (81%); mean nitrate concentrations were higher in akaki - kality (3.5 mg / l) compared to yeka (0.06 one drinking water sample exceeded the who nitrates reference value of 50 mg / l . This sample was from yeka and had a very high nitrates concentration (740 mg the majority of drinking water samples did not contain detectable amounts of lead, copper, cadmium, arsenic, chromium, cobalt, or mercury, and none of these levels exceeded reference values . We examined whether metal exposures varied by occupation, diet, and smoking and alcohol use . Compared to other participants, factory workers had higher concentrations of urinary arsenic (gm = 7.46 versus 5.60 g / g creatinine, p = 0.029) and urinary nickel (gm = 11.5 versus 8.34 g / g creatinine, p = 0.012). Participants who reported drinking alcohol had lower levels of urinary cobalt (gm = 1.13 g / g creatinine) compared to participants who did not report drinking alcohol (gm = 1.67 g / g creatinine, p <0.001). Participants who chewed khat had lower concentrations of urinary cobalt (gm = 1.06 g / g creatinine versus gm = 1.58 g / g creatinine; p = 0.048) and urinary tungsten (gm = 0.19 g / g creatinine versus 0.11 g / g creatinine; p = 0.038) compared to those who did not chew khat . There were no correlations between metal levels in drinking water and urine or blood, and no significant associations were found in multivariable analyses (results not shown). We assessed urinary and blood metals in a subset of the ethiopian population, which provides data that have previously been unavailable . Participants had exposure to a range of metals, some of which were elevated compared to a us reference population . Most of the urine and blood metal levels found during this investigation seem unlikely to cause acute health effects based on known toxic thresholds . However, toxicity data for many of these metals are very limited, and the risk of chronic health effects from possible long - term exposures to these metals is not fully known and would likely depend on other factors such as concurrent exposures and other health risks . Urinary cobalt and molybdenum were substantially higher in our participants compared to the us population . Cobalt is a naturally occurring element that is found in foods such as fish, cocoa, bran, molasses, and some green leafy vegetables . It is also used in alloys (mixtures of metals) and as a drier for paint and porcelain enamel . It is unknown if any of the industries near the akaki river were utilizing cobalt . Cobalt exposure has been associated with allergic contact dermatitis, occupational asthma, interstitial lung disorder, and cardiomyopathy, and animal studies suggest it may be a potential carcinogen . However, there are limited data relating urinary cobalt concentrations to health effects, and no validated, consensus measurement for the minimal level associated with toxic effects in an environmental, nonoccupational setting . Molybdenum is an essential trace element, often consumed through the diet and drinking water . There is limited information concerning adverse health effects, and human toxicity is considered to be low . Chronic exposure to molybdenum levels in the range of 0.140.21 mg / kg per day has been associated with a gout - like illness [15, 16]. This investigation was initiated based on concerns that the akaki river might be causing elevated levels of metals exposures in nearby communities . Even though we found several differences in urine metal concentrations between akaki - kality and yeka participants, we did not find any evidence that exposures were a result of proximity to the akaki river or of domestic use of the river water . Participants were not using the akaki river for drinking, cooking, or bathing, and we did not detect metals in most drinking water samples . It is possible that the differing metal profiles between akaki - kality and yeka participants are a result of other sources of metals exposure, such as differences in the surrounding air quality or differing dietary habits . We found that participants who reported growing their own vegetables had lower lead levels compared to participants who did not grow their own vegetables . This could be a spurious correlation, particularly given that there were no differences in other metals . We do not know the exact source of vegetables that were not homegrown, nor do we know the source of the water that they were irrigated with . However, given that a prior study found lead in vegetables irrigated by the akaki river, it is possible that vegetables that are not homegrown are purchased from one of the nearby markets that are using the akaki river for irrigation . Iodine is an essential nutrient for newborns, particularly from the second trimester of pregnancy through the third year of life . It stimulates the thyroid gland to produce thyroid hormone, which in turn promotes brain development . Iodine deficiency can cause impaired mental function, goiter, and hypothyroidism, and it is considered to be an important cause of preventable brain damage [10, 17]. According to the world health organization, median iodine concentrations ranging from 50 to 99 g / l indicate that a population may have mild iodine deficiency . We found low median urine iodine concentrations in both subcities only 53.9 g / l in akaki - kality and 60.1 g / l in yeka . However, after eritrea seceded from ethiopia, ethiopia's iodized salt consumption dropped to 5% . Our findings suggest that continued work is needed on improving access to iodized salt in ethiopia . Although the motive for study was the akaki river, the study itself only evaluated people and household drinking water, and thus exposures cannot be attributed directly to the river . There are no good data on baseline metal exposures in ethiopia, and thus we cannot compare the metal profiles of our participants to the underlying population . Because this was a one - time, cross - sectional assessment, it is possible we could have missed any seasonal differences or sporadic exposures, particularly because the half - life of some metals in the body can be hours to days . Our sampling was representative of the general akaki - kality population; it is possible that there could be specific segments of akaki - kality or other subcities that might have had greater metals exposures . Continuing to perform biomonitoring investigations in ethiopia and other countries biomonitoring can also help monitor population - level exposures over time in order to determine the impact of changes to the surrounding area.
|
, brescia, italy) is an innovative pre - analytical specimen collection device that is compatible with all diagnostic tests, from culture to molecular amplifications assays . The flocked swab contains short nylon fibre strands attached to molded plastic, with a hydrophilic layer of nylon pile that results in efficient collection and release of particulate matter . Flocked swabs are produced in a variety of sizes and shapes and are used to collect specimens from premature babies to adults and have become the pre - analytical device of choice for the investigation of infectious diseases . In recent publications in the journal of clinical microbiology, endocervical flocked swabs were reported to enhance the analytical sensitivity of antigen detection, culture and nucleic acid amplification assays (chernesky et al ., 2006). In another research study, the nasopharyngeal flocked swab design yielded significantly more total respiratory epithelial cells and more infected respiratory epithelial cells . This two- to three - fold increase in cell yield with the flocked swabs has a greater effect on diagnostic sensitivity compared to traditional fibre swabs (daley et al ., 2006). Flocked swabs are currently used worldwide in italy, europe, canada, us, south america, australia, japan, and china and have been validated with all the state of the art diagnostics and forensic investigations . In food safety, microbiological work surface controls play an important role in the monitoring of contamination from the environment (kusumaningrum et al ., 2003; verran et al ., 2010 there is great interest and continued commitment of all the entities involved, food business operators, laboratories and companies producing laboratory principals, in order to guarantee greater security concerning the aspect of hygiene of work surfaces and its verification (moore and griffith, 2002; ismail et al ., 2013). In this context, the possibility of adopting a new type of collection device for the recovery of bacteria from food surfaces for environmental monitoring has been taken into account (probst et al ., 2010; lahou and uyttendaele, 2014). Clinical data and previous studies have demonstrated flocked swab superiority over traditional collection devices (dalmaso et al ., 2008) in terms of recovery and release . Based on these studies, it was decided to verify the applicability of flocked swabs in the food industry for the recovery of bacteria from surfaces for environmental monitoring and detection of specific pathogens . In the microbiology laboratory of the institute for experimental veterinary medicine of lombardy and emilia romagna a study to compare two different types of swabs a floqswab (copan italia s.pa) and a traditional rayon tipped swab (copan italia s.p.a .) Was conducted . The two type of swabs were evaluated for their capacity to recover and release an analyte (microorganism) in vitro . Suspensions with three different loads equal to 10 colony forming unit (cfu)/ml 10 and 10 cfu / ml were prepared from overnight culture of escherichia coli (reference strain atcc 25922). For each load different tubes containing 100 l of the suspension the two different swabs were put inside the tubes containing the different bacterial load suspensions in order to absorb the inocula within 10 sec . Five replicates for both swabs were analysed for each load according to iso 4833 - 2:2013 cor 1:2014 (iso, 2014) for total mesophilic count at 30c . The gold standard for the three different loads was also verified placing directly the suspensions onto nutrient agar plates and incubating them at the appropriate conditions . After incubation for 72 h, plates were counted and results recorded . In the second experiment (figure 1), the two swabs were evaluated for their capacity to recover a bacterial load from contaminated surfaces . Two different surface materials stainless steel (ss) and polypropylene (pp) were cleaned either by autoclaving (ss) or disinfectant (quaternary ammonium compounds), and let air dry under a laminar flow for 2 h. suspensions with three different bacterial loads equal to 10, 10, and 10 cfu / ml were prepared from overnight culture of e. coli (reference strain atcc 25922). The testing surfaces were contaminated by dispensing 1 ml of different e. coli suspensions distributed on an approximate 1010 cm area using a sterile spreader in order to obtain approximately 10, 10, 10 cfu / cm . The contaminated surfaces were let air dry for 2 h and then sampled in parallel area with the two swabs, according to iso 18593:2004 (iso, 2004; figure 1). Four replicates side by side of both swabs were analysed for each load both for the ss and the pp surface, according to iso 4833 - 2:2013 cor 1:2014 (iso, 2014) for total mesophilic count at 30c . After the incubation time plates were counted and the results were recorded . The difference between means value were detected by the t - test and evaluations were based on a confidence interval of 95% . E. coli counts recorded using the floqswab were expressed as mean of the replicates, and the values resulted as 4.6010 cfu / ml for the lower, 4.1210 cfu / ml for the middle, and 3.1410 cfu / ml for the higher load . Analysis for floqswab results, in comparison with the gold standard values, showed a recovery rate of 128% for the lower, 76% for the middle, and 112% for the higher load of the original concentration of microorganism used in the trial . E. coli counts recorded using a traditional rayon tipped swab were 1.9410 cfu / ml for the lower, 2.8410 cfu / ml for the middle, and 1.1910 cfu / ml for the higher load . Analysis for the traditional rayon tipped swab results, in comparison with the gold standard values, showed a recovery rate of 54% for the lower, 53% for the middle, and 42% for the higher load of the original concentration of microorganism used in the trial (table 1). Differences observed in means of values for the three different loads were statistically significant (p<0.05). E. coli counts recorded using the floqswab to recover the bacterial load from ss surfaces (expressed as mean of the replicates for each bacterial load) were 9.00 cfu / cm for the lower, 8.9510 cfu / cm for the middle, and 3.1810 cfu / cm for the higher load . Using the floqswab and considering the original inoculum concentration used to contaminate the surface, the recovery rates were 9% for the lower, 9% for the middle, and 32% for the higher load (figure 2). On the surface using the traditional rayon tipped swab, e. coli counts expressed as mean of the replicates for each bacterial load were 1.00, 4.0910, and 4.4510 cfu / cm . With the traditional rayon tipped swab and considering the original inoculum concentration, the recovery rates were 1% for the lower, 1% for the middle, and 4% for the higher load . Differences observed in means of value for the three different loads were statistically significant (p<0.05). For the pp surfaces, e. coli counts recorded using the floqswab and expressed as means of the replicates for each bacterial load, were 1.3010 cfu / cm for the lower, 2.1310 cfu / cm for the middle, and 2.0810 cfu / cm for the higher load . The floqswab and the original inoculum concentration considered, the recovery rates were 13% for the lower, 21% for the middle, and 21% for the higher load (figure 3). On the same surface using the traditional rayon tipped swab, e. coli counts (expressed as means of the replicates for each bacterial load) were 7.00, 1.1810, and 8.4510 cfu / cm . In this case, the recovery rates were 7% for the lower, 12% for the middle, and 8% for the higher load . Differences observed in means of value were statistically significant (p<0.05) for lower and higher loads, while for the middle load there was no statistical difference (p>0.05). E. coli counts recorded using the floqswab were expressed as mean of the replicates, and the values resulted as 4.6010 cfu / ml for the lower, 4.1210 cfu / ml for the middle, and 3.1410 cfu / ml for the higher load . Analysis for floqswab results, in comparison with the gold standard values, showed a recovery rate of 128% for the lower, 76% for the middle, and 112% for the higher load of the original concentration of microorganism used in the trial . E. coli counts recorded using a traditional rayon tipped swab were 1.9410 cfu / ml for the lower, 2.8410 cfu / ml for the middle, and 1.1910 cfu / ml for the higher load . Analysis for the traditional rayon tipped swab results, in comparison with the gold standard values, showed a recovery rate of 54% for the lower, 53% for the middle, and 42% for the higher load of the original concentration of microorganism used in the trial (table 1). Differences observed in means of values for the three different loads were statistically significant (p<0.05). E. coli counts recorded using the floqswab to recover the bacterial load from ss surfaces (expressed as mean of the replicates for each bacterial load) were 9.00 cfu / cm for the lower, 8.9510 cfu / cm for the middle, and 3.1810 cfu / cm for the higher load . Using the floqswab and considering the original inoculum concentration used to contaminate the surface, the recovery rates were 9% for the lower, 9% for the middle, and 32% for the higher load (figure 2). On the surface using the traditional rayon tipped swab, e. coli counts expressed as mean of the replicates for each bacterial load were 1.00, 4.0910, and 4.4510 cfu / cm . With the traditional rayon tipped swab and considering the original inoculum concentration, the recovery rates were 1% for the lower, 1% for the middle, and 4% for the higher load . Differences observed in means of value for the three different loads were statistically significant (p<0.05). For the pp surfaces, e. coli counts recorded using the floqswab and expressed as means of the replicates for each bacterial load, were 1.3010 cfu / cm for the lower, 2.1310 cfu / cm for the middle, and 2.0810 cfu / cm for the higher load . The floqswab and the original inoculum concentration considered, the recovery rates were 13% for the lower, 21% for the middle, and 21% for the higher load (figure 3). On the same surface using the traditional rayon tipped swab, e. coli counts (expressed as means of the replicates for each bacterial load) were 7.00, 1.1810, and 8.4510 cfu / cm . In this case, the recovery rates were 7% for the lower, 12% for the middle, and 8% for the higher load . Differences observed in means of value were statistically significant (p<0.05) for lower and higher loads, while for the middle load there was no statistical difference (p>0.05). In the first experiment, floqswab adsorbed the analyte and then released it, applying a routine analytical protocol, in an amount comparable to what recovered in the gold standard analyses for all the three loads considered . Regarding the lower bacterial load result, the fact that the floqswab recovered more than the original concentration has to be addressed to variables and errors that can be produced, and to the uncertainty inherent in microbiological counts . Instead, the traditional rayon tipped swab showed a lower recovery rate . Indeed, only 50% of microorganisms were recovered comparing to gold standards values . In the second experiment, the floqswab showed a better performance also when used as a collection tool as per iso 18593:2004 (iso, 2004) from the two different surface materials tested . In particular, on the ss surface the recovery was more consistent especially at high bacterial load, compared to the traditional rayon tipped swab . In general, 1 log recovery improvement was recorded . On the pp surface the results were always better for the floqswab than the traditional rayon tipped swab, even if the differences in the percentage of recovery were lower . In food safety, microbiological work surface controls play a fundamental role in the prevention of contamination from the environment . The sampling techniques usually applied underrate the level of contamination of different surfaces that are in contact with food during food process . This could give food business operators false information about the level of cleanliness of processing environments . The floqswab was proposed as an improvement in collecting environmental hygiene controls, seem to be encouraging . Indeed, this kind of swab, both in vitro and in experimental surface sampling tests, demonstrated to be more efficient compared to a traditional rayon tipped swab, which has been the state of the art so far and has been also suggested by the iso 18593:2004 (iso, 2004) to be widely used in the food industries . The use of swabs for the environmental sampling was discouraged in the past due to the poor recovery and then for the risk of an erroneous or underestimated result . The introduction of the floqswab allows the operator to reintroduce the use of swab as a sampling tool for all the difficult - to - reach areas to be monitored for hygiene assessment . Based on these preliminary results, it was decided to verify the applicability of the flocked swab, even with other laboratory confirmatory tests, directly in the food industry . Companies should be mainly implicated in dairy and meat - derived production, and the recovery of bacteria should be done from a wider variety of surfaces (wood, ss, pp or other plastic and ceramic surfaces) for the sake of environmental monitoring and research of specific pathogens commonly involved in food poisoning event, like salmonella spp . And listeria monocytogenes.
|
Spinal muscular atrophy (sma) is characterized by motor neuron degeneration with muscular atrophy, paralysis, and an attenuated lifespan . Sma exhibits an autosomal recessive pattern of inheritance with an incidence of 1 in 6,00010,000 newborns and a carrier frequency of about 1: 35 [2, 3]. Based on age of onset and achievement of motor milestones, sma has been subdivided into four clinical types: severe (type i; werdnig - hoffmann disease), intermediate (type ii), mild (type iii; kugelberg - welander disease), and adult forms . Most sma patients harbor deletions, mutations, or conversions of the telomeric copy of the survival motor neuron gene (smn1) [5, 6]. The centromeric smn gene (smn2) is present in all sma patients, but is unable to compensate for the smn1 gene defect as the primary transcript of smn2 gene is defectively spliced [5, 6]. Since there is an inverted correlation between the amount of smn protein and disease severity [7, 8], smn has been the most important therapeutic target for development of sma treatment [9, 10]. However, some smn independent targets and therapeutic strategies have been demonstrated to have the potential to benefit sma [1120]. Although most are still under investigation, these nonclassical therapies might provide an adjunctive method for future sma therapy . Although pathogenesis of sma has been investigated extensively, some of the detailed disease mechanisms are still not fully understood . The smn is a 38-kda protein expressed in both the cytoplasm and nucleus of all cells . Smn serves as a chaperone in the assembly of spliceosome precursors by combining small nuclear rna (snrna) molecules with sm proteins to generate small nuclear ribonucleoproteins (snrnps) [22, 23]. The snrnp assembly activity is dramatically reduced in spinal cord from sma model mice and the degree of snrnp assembly impairment correlates with disease severity . Evidence shows that smn is also involved in the stabilization and maturation of the neuromuscular junction and the transportation of axonal mrnas in motor neurons [2527]. Smn - deficient motor neurons exhibit severe defects in clustering voltage - gated calcium channels in axonal growth cones . An alteration of calcium channel distribution might influence neurotransmitter release, causing dysfunction and immaturation of neuromuscular junction [25, 28]. In addition, the smn protein can form granules that are transported and associated with -actin mrna in neuronal processes . The close relationship of smn and -actin has further demonstrated that motor neurons derived from sma model mice have shortened axons and small growth cones, which are also deficient in -actin mrna and protein . Therefore, smn has a function in maintaining proper neuronal machinery via assistance in splicing process and establishing adequate communication between the muscles and nerves at the motor end plate through stabilization of the neuromuscular junction . The loss of maintenance and communication might thus trigger the cascade of events that probably results in motor neuron death . Sma mouse models have been generated through mouse smn knockout and human smn2 transgenic methods [8, 31]. These mice reveal spinal motor neuron degeneration, muscle atrophy, and impaired motor performances similar to sma patients . The disease severity of these sma mice is also inversely correlated to the copy number of the smn2 transgenes [8, 31]. Neuromuscular junction can form and function normally prior to the postnatal onset of disease . Afterward, abnormal neurofilament accumulation and functional disruption at the neuromuscular junction become evident . Alongside these morphological and functional changes at the neuromuscular junction, studies on the spinal cord of sma mice showed an apparent failure of expression of genes that cluster in postnatal developmental pathways . Subsequently, through still unknown mechanisms, motor neurons degenerate in spinal anterior horn regions probably through cell apoptosis [16, 34], and muscle atrophy and motor dysfunction become apparent . Recently, congenital heart defects have been recognized as additional important phenotypes especially in type i sma patients, including atrial septal defects, dilated right ventricle, and ventricular septal defects . The histological studies in sma model mice also showed that cardiac remodeling starts at the embryonic stage in the severe sma mice while motor neurons are not yet visibly affected at this stage . After birth, there is progressive cardiac fibrosis, which may result from oxidative stress . Sma mice also suffer from severe bradyarrhythmia characterized by progressive heart block and impaired ventricular depolarization, which may be related to defective sympathetic innervation . Notably, systemic restoration of smn expression is able to diminish the cardiac defects accompanied with prolonged lifespan, implying that cardiac abnormalities are playing a critical role on sma pathogenesis [38, 39]. Since smn levels generally correlate with disease severity in sma patients and mouse models [7, 8, 31, 40], smn is the best therapeutic target for development of sma treatment . Various strategies to increase the smn levels have been tested in sma mouse models and some of them have even showed promising beneficial effects [9, 10]. Until now, none of them have been demonstrated to be consistently robust or produce continual benefits in sma patients . These therapeutic strategies are divided into small molecules, antisense oligonucleotides (aso), and viral vector - mediated gene therapy . All sma patients have at least one copy of the smn2 gene, providing an opportunity for manipulation of the smn2 gene expression . The mode - of - action for a potential sma therapy using small molecules mainly includes restoration of the smn2 splicing pattern, activating the smn2 promoter, and extending the half - life of smn mrna or protein . The potential drugs include histone deacetylase (hdac) inhibitors such as sodium butyrate, phenylbutyrate, valproic acid (vpa), trichostatin a, saha, and lbh589, as well as hydroxyuria, sodium vanadate, aclarubicin, indoprofen, bortezomib, and aminoglycosides, such as tobramycin, amikacin, tc007, and g418 . Since there are still no drugs that have shown consistent benefits in clinical trials [55, 56], finding an effective treatment with distinct therapeutic mechanisms, such as smn independent targets, is necessary for future sma therapy . Among these small molecules, vpa is the drug being studied most extensively and has been used in patients with epilepsy and bipolar disorders for decades . Vpa treatment increased levels of smn transcripts and protein in fibroblasts derived from sma patients through upregulation of serine / arginine - rich (sr) proteins, which are involved in regulating smn2 exon 7 recruitment [58, 59]. Autophagy, the degradation of cytosolic components in lysosomes, maintains neuronal homeostasis; its dysfunction has been linked to various neurodegenerative diseases, possibly including sma . Vpa is also an autophagy enhancer, which activated autophagic pathways and attenuated rotenone - induced toxicity in sh - sy5y cells . In addition, vpa upregulates some antiapoptotic factors such as bcl-2 and bcl - xl, perhaps via activation of erk44/42 [43, 62, 63]. Probably through multiple therapeutic effects, vpa reduced motor neuron degeneration, muscle atrophy, and motor dysfunction in sma mice [43, 64], and a small group of sma patients showed obvious improvement in muscle strength after daily vpa treatment [65, 66]. Despite these encouraging results, large clinical trials did not confirm the beneficial effects of vpa in sma patients [6769]. These disappointing outcomes may contribute to different pharmacokinetics and bioavailability between rodents and humans as well as dose - limiting intolerance and drug adverse effects . In addition, the responses of vpa treatment showed intrapatient and interpatient variability in the study using fibroblasts and lymphoblasts from sma patients, probably indicating that tissue and individual factors may affect the vpa effects with unknown reasons . Using aso to inhibit the splicing silencer for smn2 exon 7 leads to restoration of the normal smn2 splicing pattern . The effects of aso were further improved through the incorporation of a binding platform with aso for recruitment of sr protein to the smn2 exon 7 region . These bifunctional asos were able to achieve nearly 100% exon 7 inclusion and enhance smn expression up to 2- to 3-fold in cell - based assays . Injection of aso into cerebroventricles elicited a robust induction of smn protein in the brain and throughout the spinal cord and extended the lifespan of sma mice . A recent study demonstrated that systemic delivery of aso resulted in dramatic prolongation of lifespan in sma mice and the effects were much better than those with intracerebroventricular delivery of aso (median survival, 108 versus 16 days). These findings suggest that aso therapy has great potential in this field and extra - cns targeting is required to rescue the sma phenotype . However, another similar study showed different results that early intracerebroventricular delivery of aso had a better outcome than intravenous aso delivery, which suggests that therapeutic methods for aso treatment still need further investigation and optimization . Direct injection of adeno - associated viral vector serotype 8 (aav8) carrying smn into both cerebroventricles and upper lumbar spinal cord of sma mice showed a robust increase in lifespan by 880% with less motor neuron degeneration and abnormal architectures of neuromuscular junction . However, augmented smn is expressed in thoracolumbar regions, but sparse in the cervical cord, which may suggest poor diffusion of aav in subarachnoid space . In contrast, intravenous aav serotype 9 (aav9) injection has shown success in affecting widespread gene delivery in entire spinal cord . Intravenous injection of aav9 carrying human codon - optimized smn1 at postnatal day 1 recovered most motor function, neuromuscular physiology, and lifespan in sma mice . Notably, postnatal day 1 treatment resulted in the maximal transduction of the motor neurons, while postnatal day 10 treatment led to glia - predominant transduction . This shift in cell type specificity was probably because of the closure of the blood brain barrier that occurs within the first week of life in neonatal mice . When the blood brain barrier is mature and patent, virions are probably not able to penetrate out of vessels smoothly to access motor neurons, but only encounter the endothelial wrappings of astrocyte end feet . Since blood brain barrier likely matures in as early as human neonatal period, the aav9 transduction efficacy should further be tested in nonhuman primates of different ages to identify the optimal temporal window for future therapy . Insulin - like growth factor-1 (igf-1) is a trophic factor mainly secreted by the liver and circulates at high levels in the bloodstream . Igf-1 is a key molecule involved in normal brain growth and function and may have a neuroprotective effect by inhibiting neuronal death in huntington's disease and spinocerebellar ataxia [81, 82]. Igf1-null mice show some phenotypic similarity to sma mice, such as small size and generalized muscle dystrophy, with most of them dying at birth . Notably, serum igf-1 level was decreased in sma mice, and systemic increase of smn expression using the aso strategy in sma mice was accompanied with restoration of serum igf-1 to normal levels . Interestingly, mrna levels of igf - binding protein, acid labile subunit (igfals), but not igf-1, was reduced in sma mice . Igfals binds to igf-1 and igf - binding protein 3 to form a stable ternary complex, extending the half - life of igf-1 from 10 minutes to 12 hours . Therefore, the low serum igf-1 level in sma mice is likely related to downregulation of igfals, and igf-1 may be one of the factors that contribute to the pathogenesis of sma . Igf-1 treatment has been shown to improve disease phenotypes in rodent models of motor neuron diseases such as amyotrophic lateral sclerosis (als) and spinal and bulbar muscular atrophy (sbma). For sma, transgenic expression of igf-1 in skeletal muscle of sma mice resulted in an increase in myofiber size and a modest improvement in median survival . Delivery of a plasmid dna vector encoding igf-1 by intracerebroventricular injection into newborn sma mice also increased body mass and provided a modest improvement in median survival . However, intracerebellar viral delivery of igf-1 reduced motor neuron degeneration, but did not improve motor function in the mildly affected sma mice . Therefore, the effects of igf-1 and igfals - related therapy using different treatment strategies in sma still require further investigation . These cells express ciliary neurotrophic factor (cntf), and lack of cntf expression strongly reduces terminal sprouting and motor unit size . In a mouse model of als, the depletion of synaptic vesicles precedes the loss of synapses; cntf could prevent the depletion of synaptic vesicles and thus maintain function of neuromuscular junctions . Cntf treatment using cntf - secreting stem cells or by local cntf injection into skeletal muscle led to better maintenance of peripheral motor axons in a mouse mutant, progressive motor neuronopathy (pmn) [91, 92]. In a severe type of sma mice, in contrast, the architecture and function of neuromuscular junctions in heterozygous smn (+ /) mice are relatively preserved, despite some loss of spinal motor neurons . However, completed knockout of cntf in heterozygous smn (+ /) mice reduces the sprouting responses of the nerve terminals accompanied with reduced muscle strength . These results imply that cntf may be able to compensate loss of motor neurons by sprouting from remaining motor axon terminals so that neuromuscular endplates remain innervated; cntf may thus guide the way for new therapies for sma . Although systemic cntf treatment elicited severe adverse effects including fever and cachexia in als patients, muscle or cns targeting cntf therapy might offer a chance to reduce these side effects and show benefits in sma . Cntf and cardiotrophin-1 (ct-1) are both members of the il-6 family, which bind a common receptor complex requiring leukemia inhibitory factor receptor (lifr) and gp130 . Ct-1 is essential in normal motor neuron development and is also able to support long - term survival of motor neurons as demonstrated in culture cells and rats with axotomy . In addition, overexpression of ct-1 in pmn and als mice both significantly delayed disease onset, reduced degeneration of motor neurons and axons, and preserved the terminal innervation of skeletal muscles [97, 98]. For sma mice, intramuscular injection of adenoviral vector expressing ct-1, even at very low doses, prolonged survival, delayed motor defects, and diminished motor axonal degeneration and aberrant synaptic terminals . Although most of studies regarding ct-1 are focused on diseases in the cardiovascular system, ct-1 might still be a valuable therapeutic agent for motor neuron diseases through neurotrophic effects . Degeneration of spinal motor neurons in sma is mediated in part through apoptosis [16, 34]. In the bcl-2 family, bcl - xl and bax are important regulators of cell death in the nervous system when cells have matured . Bcl - xl is an antiapoptotic member of the bcl-2 family and acts by inhibiting proapoptotic members of the bcl-2 family through heterodimerization . Bcl - xl was downregulated in sma patients and model mice [17, 100]. Bcl - xl overexpression can protect against motor neuron death in cultured primary motor neurons and embryonic motor neurons with smn knockdown . Interestingly, bcl - xl overexpression in sma mice reduced motor neuron degeneration, preserved motor function, and prolonged lifespan without changes in smn expression levels . Bax knockout sma mice had milder disease severity and longer lifespan with less spinal neuronal degeneration than sma littermates with wild - type bax genes . Therefore, effects of bcl - xl and bax may not be simply through apoptotic pathways, but through unknown mechanisms to salvage neural function in sma . The ratio of bcl - xl / bax is thus another attractive target, where the potential to increase bcl - xl and decrease bax expression may be of benefit to sma patients . Riluzole, a 2-aminobenzothiazole, is the only disease - modifying therapy available for als . Although riluzole is known to modulate excitatory neurotransmission mainly through inhibition of glutamate release, the precise neuroprotective mechanisms remain largely speculative . In sma mice, however, a small phase i clinical trial, enrolling 7 riluzole - treated and 3 placebo - treated type i sma infants, demonstrated no significant differences in survival and the change in motor abilities after riluzole treatment . Nevertheless, further analysis showed that 3 patients in the riluzole group presented an unusual disease course and were still alive at the age of 30 to 64 months . The pharmacokinetics of riluzole in sma patients has recently been investigated, and the long - term benefits of riluzole still warrant large clinical trials for sma patients . Gabapentin is a gaba analogue and has been used clinically for patients with seizures and neuropathic pain for more than 10 years . Gabapentin could also have a neuroprotective action in part by reducing the pool of releasable glutamate in neurons, thereby diminishing the excitotoxicity potential [109, 110]. Although gabapentin treatment showed marginal reduction in disease progression in a phase ii clinical trial for als patients, the following phase iii clinical trial did not reveal significant benefits after gabapentin treatment for 9 months . For sma, there was no difference between the gabapentin and placebo groups in any outcome measure including changes in muscle strength, pulmonary function, or motor functional rating scale after 12 months of treatment . However, another clinical trial which enrolled 120 type ii and iii sma patients showed a significant improvement in muscle strength of legs at both 6 and 12 months after gabapentin treatment . Meta - analysis of these two trials did not successfully demonstrate the beneficial effects of gabapentin in sma . 2-adrenergic agonist, such as salbutamol (albuterol in the united states), enhanced muscle strength in aged rats, human healthy volunteers, and some pathological conditions [117, 118]. In a pilot clinical trial, thirteen type ii or iii sma patients receiving salbutamol for 6 months showed significant increase in myometry, forced vital capacity, and lean body mass . A further larger trial enrolling 23 type ii sma patients consistently got similar results that functional scores were better after daily salbutamol treatment for 6 or 12 months . Notably, the drug did not produce any major side effects [119, 120]. The mechanism of action of 2-adrenergic agonists on human skeletal muscles to enhance muscle strength is not completely understood . Interestingly, salbutamol also promoted exon 7 inclusion in smn2 transcripts and thus increased levels of full - length transcripts of smn2 in sma fibroblasts . In sma patients, daily salbutamol significantly and consistently increased smn2 full - length transcript levels in peripheral leukocytes, and the response was directly proportional to smn2 gene copy number . Considering bifunctional therapeutic effects and safety of salbutamol, large randomized double - blinded placebo - controlled clinical trials are mandatory . Myostatin is a member of the tgf- family and functions as a potent negative regulator of muscle growth . Inhibition of myostatin increases muscle mass and strength in wild - type rodents and improves the pathophysiology of a mouse model for muscular dystrophy [124, 125]. Follistatin is a cystine - rich glycoprotein, which binds to and inhibits several tgf- family members, including myostatin . Follistatin delivered by intramuscular injection of recombinant viral vectors increased muscle mass in mouse models of both als and duchenne muscular dystrophy [127, 128]. Since sma also features diffuse muscle atrophy, inhibition of myostatin may also be a therapeutic strategy . Intraperitoneal injection of recombinant follistatin in sma model mice increased muscle mass, improved motor function, and prolonged lifespan by 30% without changes in smn protein levels in spinal cord and muscles . However, other studies detected no phenotypic alteration in transgenic overexpression of follistatin or ablation of myostatin in sma mice [129, 130]. The reason for this discrepancy is unclear and the effects of follistatin for sma treatment still need further validation . Although sma - affected siblings usually develop similar disease severity in terms of their age at onset and the progression of disease, a small proportion of individuals with homozygous smn1 mutation are fully asymptomatic despite carrying an identical number of smn2 copies as their affected siblings, suggesting the influence of modifier genes [132, 133]. The first potential smn - independent disease modifier, plastin-3, was recently identified from six sma - discordant families with eight fully asymptomatic females who had inherited the same smn1 and smn2 alleles as their affected siblings . Increased levels of plastin-3 were also found to correlate with a mild sma phenotype in female patients, independently of smn protein levels [18, 134]. Plastin-3, an actin binding protein, is a regulator of actin filament organization and is expressed in almost all solid tissues, including the human brain, spinal cord, and muscles . Plastin-3 colocalizes with smn in granules throughout motor neuron axons, and plastin-3 protein levels are reduced in brain and spinal cord of an sma mouse model [18, 135]. In smn - depleted neuronal pc12 cells and primary mouse motor neuron cultures derived from sma mice, notably, overexpression of plastin-3 or its orthologues also led to diminishment of axon defects and disease severity in smn depleted zebrafish embryos, drosophila, and c. elegans [18, 136]. Smn has been shown to moderate and restrict the negative function of profilin iia on actin polymerization . Profilin iia is another actin binding protein, and knockdown of profilin iia results in stimulation of neurite outgrowth, while overexpression of profilin iia reduces neurite number and size . Knockout of profilin iia in sma model mice was able to restore abnormal low plastin-3 levels . However, the phenotype of these sma mice was not ameliorated despite the depletion of profilin iia and restoration of plastin-3 levels, which suggests that other components of actin dynamics are also critically affected in sma . Although some questions need to be answered, such as the mechanisms behind plastin-3 in sma and effects of plastin-3 upregulation in sma mouse models, plastin-3 may become an important smn - independent therapeutic target for sma in the future . The candidate plasticity - related gene 15 (cpg15) is highly expressed in the developing ventral spinal cord and can promote motor axon branching and neuromuscular synapse formation [139, 140]. Cpg15 mrna colocalizes with smn protein in axons and is locally translated in growth cones . Hud is a neuron - specific rna - binding protein and also an interacting partner of smn [141143]. Cpg15 may be an mrna target for the smn - hud complex and smn deficiency reduced cpg15 mrna levels in neurons . Most importantly, cpg15 overexpression partially recovered from motor axonal deficits in zebrafish with smn deficiency . Therefore, cpg15 appears to be a crucial downstream effecter of smn in neurons and may serve as a modifier of sma disease by regulating axon extension and axon terminal differentiation . Rho - kinase signaling is a major regulatory pathway of actin dynamics, and rho - kinase activation is associated with dendritic simplification, and reduced spine length and density . Rho - kinase activity is upregulated in smn - depleted pc12 cells and sma model mice [145, 146]. The migratory capacity of the u87 mg astroglioma cells was attenuated by knockdown of smn through abnormal activation of rho - kinase pathway . Normally, smn binds to profilin iia to form complexes, and rho - kinase may phosphorylate profilin iia . Through competition between smn and rho - kinase for binding to profilin iia, smn deficiency results in a decrease in smn - profilin iia complexes and stronger interaction of profilin iia with rho - kinase . Therefore, rho - kinase inhibition might be able to correct the effect of smn reduction in sma to achieve an adequate ratio of de-/phosphorylated profilin iia . Notably, treatment of sma model mice with rho - kinase inhibitor y-27632 or fasudil led to a significant prolongation in survival, improvement in integrity of neuromuscular junction, and increase in muscle fiber size without altered smn expression or increase in the number of spinal motor neurons [146, 149]. Since fasudil has been successfully applied in many clinical trials for other neurological and vascular diseases based on its neuroprotection, vasodilatation, and immune modulation effects, the results of fasudil therapeutic studies for sma patients are anticipated . A diagnosis of sma is usually made following a patient's initial presentation of muscle weakness, at which there would be substantial spinal motor neuron loss . Both smn dependent and independent treatments described above could only prevent disease progression, but not regain lost motor neurons, while stem cell therapy might provide a possibility for cell replacement . Fetal - derived neural stem cells (nscs) are able to self - renew and are multipotent with the capacity of producing neurons (including motor neurons), astrocytes, and oligodendrocytes . Nscs can be isolated from mouse embryonic spinal cords and differentiated toward a motor neuron cell fate by priming with retinoic acid and sonic hedgehog . Intrathecal injection of these primed nscs in nmd mice, another model of motor neuron disease, resulted in improvement of abnormal phenotypes and extension of survival . In addition, nscs derived from human fetal spinal cord delayed disease onset and prolonged lifespan after being transplanted directly into spinal cord of als mice [153, 154]. In a severe type of sma mouse model, intrathecal injection at postnatal day 1 with primed nscs derived from mouse embryonic spinal cord also promoted motor neuron survival, improved motor function, and prolonged lifespan . Although some grafted cells expressed motor neuron markers, there was no direct evidence suggesting that the beneficial effects resulting from the formation of functional motor units by the transplanted cells . Transplantation of undifferentiating nscs also showed a significant increase in survival of sma mice, although not as efficient as the effects of nscs primed into a motor neuron fate . Therefore, the observed benefits of nscs in sma model mice were likely related to trophic support . Although fetal - derived nsc transplantation in sma mice showed promising effects, their derivation from a spinal cord source impedes further clinical implementation because of ethical and technical issues . On the other hand, embryonic stem cells might be easier to obtain and are also able to differentiate in vitro and in vivo into nscs and a motor neuron fate . Intraspinal grafting of embryonic stem cell - derived motor neurons resulted in a significant improvement in motor behaviors in the als rat . For sma, embryonic stem cell - derived nscs transplanted intrathecally in sma model mice migrated to spinal anterior horn and improved motor function and lifespan . Although the grafted stem cells integrated appropriately into the parenchyma, and expressed both neuron- and motor neuron - specific markers, there was again no evidence of newly generated motor neuron outgrowth to the muscles . In one previous study, a boy with ataxia telangiectasia received intracerebellar and intrathecal injection of human fetal nscs . Four years later, he was diagnosed with a donor - derived multifocal brain glioneuronal neoplasm . To increase the differentiation rate of embryonic stem cells into nscs before transplantation, the above sma study used drug - selectable embryonic stem cell lines that ganciclovir and g418 have been applied for selection against undifferentiated embryonic stem cells and for neuroepithelial cells, respectively . Usage of these drug - selectable stem cells not only promoted transplantation safety, but also produced superior treatment results as compared to using wild - type embryonic stem cells . Since the first report on reprogramming of mouse fibroblasts into so - called induced pluripotent stem (ips) cells by the expression of oct3/4, sox2, c - myc, and klf4 in 2006, reprogramming of human somatic cells to a pluripotent state was achieved using similar approaches [160, 161]. The ips cells can be differentiated into cells of endodermal, mesodermal, or ectodermal origin, and further lineage restriction can obtain specific neural subtypes or astrocytes . Recently, ips cells have been successfully generated from fibroblasts of sma patients [162, 163]. The sma - specific ips cells exhibited a reduced capacity to form motor neurons and an abnormality in neurite outgrowth that ectopic smn expression rescued these abnormal phenotypes . These ips cells provide a novel opportunity in disease modeling for investigating sma pathogenesis and can be used in screening novel compounds for sma treatment . The use of fetal - derived cells or embryonic stem cells for transplantation is hurdled by problems of availability, the possibility of immune rejection, and ethics . In contrast, the source of ips cells is unlimited, and ips cells can be transplanted autologously . Transplantation of normal neurons derived from ips cells reduced abnormal phenotypes in a murine model of parkinson's disease . Notably, when ips cell - derived neural precursor cells from a patient with parkinson's disease were transplanted into the striatum of a parkinson's disease rat model, the donor cells differentiated into dopaminergic neurons, survived in the rodent brain for several months, and reduced the abnormal motor asymmetry . For autologous ips cell transplantation in sma, ips - derived neural precursor cells or motor neurons should be pretreated to express a high level of smn before transplantation . Until now in various neurological disorders, many diseases, such as parkinson's disease, epilepsy, and multiple sclerosis, are treated clinically with multiple drugs in combination to enhance the therapeutic effects . Motor neurons may also require additional support to optimally respond to smn - based treatment . In the past two decades, there has been tremendous progress in sma regarding genetics, pathophysiology, and therapeutics . Some useful strategies to enhance smn expression have been developed, and some novel smn - independent therapeutic targets have been discovered . While smn acts to modulate and correct the neuromuscular junction for functional improvement, smn - independent targets could play a role of extension in the survival of motor neurons and reduce the influence of smn depletion in axonal dynamics . The two currently available stem cell transplantation studies for sma have only demonstrated benefits likely with trophic support without evidence of functional cell replacement [19, 20]. To generate functional motor units, the grafted stem cells should be able to differentiate into motor neurons, appropriately project the axons a long distance toward corresponding muscles, and form functional synapses within neuromuscular junctions . In a virus - induced rat model of motor neuron degeneration, mouse embryonic stem cell - derived motor neurons transplanted into spinal cord could survive, extend axons, form functional motor units, and promote recovery from paralysis [166, 167]. The successful development of motor units in the above studies may result from a combination approach, which includes administration of dibutyryl - camp, rolipram, cyclosporine, and glial cell line - derived neurotrophic factors to promote motor neuron survival, circumvent myelin repulsion, prevent immune rejection, and enhance axonal outgrowth, respectively . Therefore, cell replacement therapy using stem cells for sma is not totally impossible; however, there is still much to be accomplished in cell therapy before being applied clinically to treat motor neuron diseases.
|
In a low - temperature fuel cell, polarization often occurs at the oxygen electrode . In order to reduce the effect of polarization on the electrode, it is necessary to enhance the activity of the electrocatalysts involved in the oxygen reduction reaction . Frequently, spherical pt nanoparticles are used as the electrocatalysts [1 - 3]. On the basis of the catalytic model, increasing the number of active sites on the surface of an electrocatalyst is an option for improving its electrochemical activity . Recently, nonspherical nanoparticles have also been found to be promising catalysts [4 - 8]. These nanoparticles promote catalytic reactions because higher atomic fractions are located at the corners and edges of the nanoparticles . Additionally, hollow metallic nanoparticles have attracted interest in the field of optics and catalysis due to their unique properties . We have recently found that triangular ag / pd nanocatalysts in an electroless copper bath exhibit high activity . The present study investigates the catalytic potential of hexagonal ag / pt nanoshells prepared via the galvanic displacement reaction for the oxygen reduction reaction . Initially, 0.05 ml of 0.05 m agno3aqueous solution was added to 10 ml of 2.5 10 m sodium citrate aqueous solution . Subsequently, 0.025 ml of 0.1 m nabh4solution was gradually added to a stirred mixed solution of sodium citrate and agno3, and a light yellow ag seed solution was obtained . Furthermore, 10 ml of 0.05 m agno3was added to 200 ml of 0.1 m hexadecyltrimethyl ammonium bromide (c16tab) aqueous solution, and 10 ml of 0.1 m ascorbic acid and 0.266 ml of the prepared ag seed solution were slowly dropped into the aqueous solution . Hexagonal ag nanotemplates were obtained on adding 0.8 ml of 2 m naoh aqueous solution to the c16tab aqueous solution . Two hundred milliliters of the solution containing the synthesized ag hexagonal nanoplates was precipitated by centrifugation at 4000 rpm, and the solution was then redispersed using 3 ml of deionized water to reduce the interaction of free c16tab molecules with the synthesized ag / pt nanoshells . In order to prevent the interaction of clions with the synthesized nanoshells, 13.9 mg of k2ptcl4was added and slowly dissolved in a 1-ml aqueous solution of 25 mm agno3; white solid agcl was obtained . The white precipitate was removed by the centrifugation method, and a 1-ml solution was then formed with a ptconcentration of 33.5 mm . An amount of 0.0083 ml of ptsolution was added to 3 ml of the stirred solution of ag nanotemplates at a fixed controlled temperature of 60 c . The solution containing the prepared ag / pt nanoshells was dropped onto a copper grid covered with a carbon film and was dried naturally; the characteristic size, shape, and composition of the nanoshells were obtained by performing observations of the dried material by using a high - resolution transmission electron microscope (hrtem; jeol jem-3000f) and an energy dispersive x - ray spectroscope (edx). X - ray diffraction (xrd) spectroscopy (shimadzu xd-3a, cu anode) was also employed for the analysis of xrd patterns of the nanoshells . First, 0.772 mg of carbon powder (xc-72) was added to a 1-ml aqueous solution and dispersed via ultrasonic vibration . An amount of 30 l of the resulting aqueous solution was dropped onto a 0.07-cmglassy carbon electrode (gce) and heated to 70 c to evaporate the water . Simultaneously, in order to make a comparison with the electrochemical activity of the ag / pt nanoshells, spherical ag / pt nanoparticles and pt nanoparticles with the same pt and ag concentration were prepared . Fifty - microliter solutions concentrated from 1-ml solutions of the prepared ag / pt nanoshells, the ag / pt nanoparticles, and the pt nanoparticles were dropped onto a carbon powder / gce electrode . In order to prevent the catalyst from falling into the electrolyte during the measurement, the gce was rinsed with 3 l of 5 wt% nafion solution and heated at 70 c for 20 min . A three - electrode cell, consisting of a gce working electrode, a pt counter electrode, and an ag / agcl (3 m kcl) reference electrode, was used for the lsv measurement . To measure the oxygen reduction activity, the lsv experiment was performed in 1 m h2so4(aq) solution at a scan rate of 20 mv / s . Figure 1a and b presents hr - tem images of the ag / pt nanoshells prepared by the galvanic displacement reaction . The images clearly reveal that hexagonal ag / pt nanoshells were successfully prepared via the galvanic displacement reaction by adding pt ions to a prepared solution of ag hexagonal nanotemplates, as shown in the inset of fig . 1b), the color of the nanoshell edge was significantly darker than that of the nanoshell center . The edx was utilized to ensure that the hexagonal ag / pt nanoshells were synthesized by this method . Figure 2 shows the line scanned edx spectrum obtained from the edx analysis of a single nanoshell . On the basis of an analysis of the hr - tem image, the lattice spacing of a hexagonal ag / pt nanoshell was measured, and is shown in fig . The plane distance of (111) for the pt and ag nanoparticles was ~2.28 and ~2.33, respectively . This indicates that the distance of ~2.30, which lies between these two values, corresponds to a shell structure formed by the pt and ag atoms . Similar results have been obtained from hr - tem experiments for mixtures of spherical ag / pt nanoparticles . Tem images of ag / pt hexagonal nanoshells: ahigh order;bhr - tem image.inset: hexagonal ag nanotemplates line scanned edx spectrum and xrd pattern of ag / pt hexagonal nanoshells: aline scanned edx spectrum of single nanoshells;bxrd pattern additional information on the nanoshell composition was provided by the xrd pattern shown in fig . The four peaks, located at 38.25, 44.65, 64.85, and 77.55, that were detected for the dry ag / pt nanoshell powders were attributed to the (111), (200), (220), and (311) diffraction planes of the face - centered cubic (fcc) structure, respectively . 089 - 3722) corresponding to the (111), (200), (220), and (311) faces of the fcc structure are located at 38.12, 44.31, 64.46, and 77.41, respectively . The (111), (200), (220), and (311) peaks in the pt standard xrd spectrum (jcpds no . 087 - 0644) are located at 38.69, 44.97, 65.49, and 78.73, respectively . The locations of the peaks of the ag / pt nanoshells were between those of ag and pt . Figure 3 depicts lsv curves that compare the oxygen reduction reactions in which the prepared hexagonal ag / pt nanoshells, ag / pt nanoparticles, and pt nanoparticles were used as electrocatalysts . In contrast to the spherical pt and ag / pt nanocatalysts, the hexagonal ag / pt nanoshells showed excellent activity starting from ~0.68 v in the oxygen - saturated acid solution . In the tem image (fig . 1) of the hexagonal ag / pd nanoshells, pores are observed to form on the nanoshells surface . It is possible that the trapping of the electrolyte species by pores with high - surface areas resulted in the high activity of the nanoshells for oxygen reduction . Recently, pt - based alloy nanoparticles with an optimized electronic structure were reported to show high activity for the electroreduction of oxygen . In the present study, another reason for the high activity of the nanoshells is that pt s electronic structure was modified by ag during the formation of the alloy nanoshells . The comparative lsv curves of the hexagonal ag / pt nanoshells, spherical ag / pt nanoparticles and pt nanoparticles for electroreducing oxygen . The weight of hexagonal ag / pt nanoshells, spherical ag / pt nanocatalysts and spherical pt nanoparticles: 5 10 mg in conclusion, hexagonal ag / pt nanoshells were successfully synthesized using the galvanic displacement reaction; in the reaction, the added ptions slowly reacted with the prepared ag nanoplates that were used as templates . The prepared hexagonal ag / pt nanoshells were successfully used as electrocatalysts in an oxygen reduction process . The authors thank the national science council of the republic of china, taiwan, for financially supporting this research under contract no.
|
The prefrontal cortex (pfc) is implicated in cognitive processes including working memory, temporal processing, decision making, flexibility, and goal - oriented behavior [14]. Alterations in some of these processes are observed in alzheimer's disease (ad) patients [5, 6], and they correlate with amyloid beta (a) peptide accumulation in the pfc and other related brain areas [7, 8]. Similar alterations in pfc function are observed in ad transgenic mice [911], which also correlate with increased a levels in the pfc and other connected brain areas [9, 11]. In fact, alterations in pfc synaptic transmission and plasticity, as well as in cell excitability and in network activity, have been reported in ad transgenic mice . Some data indicate that these deleterious effects might be produced directly by the presence of a in the pfc [1517]. Alterations in pfc - controlled behaviors [1820] and function [18, 19] can also be induced by intrahippocampal application of a, which indicates that altered pfc function can also be induced by dysfunctional connectivity with other brain areas [1820]. The hippocampal connection with the pfc consists of excitatory glutamatergic fibers that synapse on both pfc pyramidal neurons [2123] and interneurons [2325]. This connection allows the synchronization between these two structures, in different frequency patterns, which correlates with animals' behavioral performance in pfc functions mentioned above [18, 19, 2628]. Moreover, ad patients exhibit alterations in pfc coupling with the hippocampus and in the functions that rely on this reciprocal connection [2932]. The possibility that alterations in the synaptic interactions between the hippocampus and the pfc also contribute to a-induced pathology prompted us to test the effects of a on the pfc activity isolated in a brain slice as well as on the pfc activation induced by the stimulation of the hippocampal fibers preserved in a pfc slice preparation developed by parent et al . . We found that a inhibits both pfc spontaneous network activity and pfc activation, both at the population and at the single - cell level, induced by hippocampal fiber - activation . Our data suggest that a contributes to pfc dysfunction by a direct effect on its network activity as well as by a reduction in its synaptic innervation from the hippocampus . Approval of the bioethics committee of the instituto de neurobiologa at universidad nacional autnoma de mxico was granted for all the experimental procedures (protocol number 91.a), which were carried out according to the guidelines of the institutional animal care and use committee guidebook (nih publication 80 - 23, bethesda, md, usa, 1996). Specific pathogen - free wistar rats (812 weeks old) were obtained from our breeding colony located in the facility of the instituto de neurobiologa . All animals were housed in groups of four animals, in transparent acrylic cages located in ventilated racks (12 to 15 complete air changes per hour) at constant temperature (21 1c) and humidity (50 10%) and maintained on a 12-h/12-h light / dark cycle with free access to food (irradiated picolab rodent diet 20, pmi) and water ad libitum . The oligomerization procedure was performed as previously described [33, 34]. Briefly, solid a1 - 42 peptide was dissolved in 1,1,1,3,3,3-hexafluoro-2-propanol (hfip) to a final concentration of 1 mm . This solution was incubated for 60 min at room temperature, the hfip was evaporated overnight, and dmso was added to prepare a 5 mm solution . Then, by adding f12 medium (mf12), a new solution of a42 was obtained with a final concentration of 100 m (100 pmoles/l). This solution was incubated for 24 h at 5c and then centrifuged at 14,000 g at 4c for 10 min . A oligomers found in the supernatant were collected and maintained at 4c until being used for experiments . Previous characterization of our solution indicates that it contains a mixture of a aggregates, with hexamers as the main a oligomeric form present . Animals were anesthetized with sodium pentobarbital (62 mg / kg) and perfused transcardially with cold modified artificial cerebrospinal fluid containing (in mm) 238 sucrose, 3 kcl, 2.5 mgcl2, 25 nahco3, and 30 d - glucose, ph 7.4, and bubbled with carbogen (95% o2 and 5% co2). Then, the brain was removed and dissected in ice - cold artificial cerebrospinal fluid (acsf) containing (in mm) 119 nacl, 3 kcl, 1.5 cacl2, 1 mgcl2, 25 nahco3, and 30 d - glucose, ph 7.4, and bubbled with carbogen . The cerebellum was removed, both hemispheres were mounted onto an agar block with a 1012 inclination, and coronal slices containing both the pfc (400 m thick) and the hippocampal bundle were obtained using a vibratome (microm hm 650 v, thermo scientific, usa). Only one slice was obtained per animal . The slices were left to recover at room temperature for at least 60 min before any further experimental manipulation . For extracellular field population recordings, pfc slices were transferred to a submerged recording chamber continuously perfused at 1517 ml / min with oxygenated acsf maintained at 3032c . The field recordings were obtained using borosilicate electrodes (0.51 m) filled with acsf and positioned on layer 5 - 6 of the prelimbic region of the pfc . Pfc spontaneous activity was recorded for 20 min to obtain the basal network activity . Thereafter, a was added to the bath, and its effects were recorded for 1 h. finally, 1 mm lidocaine was added to the bath to block neural activity, as a control for the viability of the slice . Alternatively, the hippocampal axonal bundle was stimulated electrically with a concentric bipolar microelectrode (fhc inc ., the synaptic potentials were evoked by trains of 5 pulses at different frequencies (5, 10, 20, and 50 hz). Each stimulus in the train had a duration of 100-s and was delivered at 0.04 hz . The stimulus intensity was adjusted in each experiment and for each preparation to evoke a response of 50% maximal amplitude [3638]. After recording control potentials, 30 nm a was added to the bath, and its effects on the synaptic transmission were monitored for 60 min . Then 10 m apv and 10 m cnqx were added to the bath to block all glutamatergic transmission . Finally, 1 mm lidocaine was added to the bath to block any neuronal activity . Pfc slices were incubated at room temperature, in the dark, for 2 h in the presence of 10 m fluo-8 am (invitrogen) and 0.3% pluronic acid in acsf equilibrated with carbogen [37, 3941]. Then, after a recovery period of 2 h, the slices were transferred and immobilized, with a nylon mesh, into a perfusion chamber on a microscope adapted to an epifluorescence system (eclipse e600fn; nikon, melville, ny). Excitation at 488 nm was performed with a lambda ls illuminator (sutter instrument, novato, ca), and images were acquired with a cooled digital camera (coolsnap - es, roper scientific, tucson, az). The imaging software used was rs image (photometrics; roper scientific, tucson, az), and the imaged field was 800 600 m . Short movies (175 s, 40-s exposure, four images per second) were taken . The hippocampal axonal bundle was stimulated electrically as described above in control conditions and in the presence of a. for all electrophysiological experiments, the signal was amplified and filtered (highpass, 0.5 hz; lowpass, 1.5 khz) with a wide - band ac amplifier (grass instruments, quincy, ma, usa). All recordings were digitized at 9 khz and stored on a personal computer with an acquisition system from national instruments (austin, tx, usa) using custom - made software designed for the labview environment . All evoked synaptic responses were measured from the start of the stimulation artifact to the valley of the synaptic response in clampfit (molecular devices). Three 10-sec segments of each condition were analyzed using a fast fourier transform algorithm with a hamming window also in clampfit . The power spectra of all segments were averaged and normalized to the basal spontaneous activity of each individual experiment . For calcium imaging, image processing was carried out with imagej (v.1.36, national institutes of health) and custom - made programs in labview and matlab [40, 41]. All active neurons in a field were semiautomatically identified, and their mean fluorescence was measured as a function of time . Calcium - dependent fluorescence signals were computed as (fi fo)/fo, where fi is the fluorescence intensity at any frame and fo is the resting fluorescence, that is, average fluorescence of the first four frames of the movie . Calcium signals were detected based on a threshold value given by their first time derivative (2.5 times the standard deviation (sd) of the noise value). Thus, we obtained a c f binary matrix, where c represents the number of active cells and f the number of frames for each movie . Recordings were inspected manually to remove artifacts and slow calcium transients which are likely to correspond to glial cells [37, 40]. After defining all neuronal - like calcium transients, we built raster plots and quantified both the number of active neurons per bin (250 ms) and the number of neuronal - like calcium transients per neuron (cell - activation instances). All data are expressed as mean standard error of the mean (sem). In most cases the data distribution was markedly skewed, and hence we used a mann whitney rank sum test or a kruskal - wallis one - way analysis of variance on ranks followed by dunn's method for multiple comparisons . To evaluate the effect of a on the general activity of the prelimbic region of the pfc, we measured its spontaneous population activity in vitro (figure 1). Spontaneous prefrontal network recordings in slices showed low - voltage neuronal activity that includes a broad range of frequency components (figure 1; n = 10; meaning 10 slices obtained from 10 animals, with only one slice per animal). As previously shown for other neuronal networks [3437], this activity is reduced by the application of 30 nm a (figure 1, representative traces and power spectra). Analysis of the integrated power (from 1 to 120 hz) showed a significant reduction of the prefrontal spontaneous network activity 60 min after a application (to 63.2 8.5% of basal activity, p <0.05; n = 10) (figure 1, inset bar graph). To evaluate the effect of a on the hippocampal input into the pfc, we initially measured the field excitatory postsynaptic potentials (fepsps) in the pfc induced by the stimulation of the hippocampal input at different frequencies . The repetitive stimulation of the hippocampal fibers induces fepsps in the pfc that exhibit different degrees of facilitation depending of the stimulation frequency (figure 2(a)). For instance, the amplitude of the fifth fepsp increases to 141.9 12.0% of the first fepsp when the stimulation is applied at 5 hz (figure 2(b)). When the stimulation is applied at 10 hz, the amplitude of the fifth fepsp increases to 162.7 14.8% of the first fepsp (figure 2(b)). When the stimulation is applied at 20 hz, the amplitude of the fifth fepsp increases only to 128.7 15.0% of the first fepsp (figure 2(b)). When the stimulation was applied at 50 hz the individual fepsps get mixed into a compound fepsp that does not allow individual fepsps to be evaluated accurately . Thus, in this case, we quantified the maximal amplitude of the compound fepsp (20.3 6.8 v; (figure 2(c)). Bath application of a reduces the amplitude of the fepsps, as well as that of the compound fepsp (figure 2(a)), regardless of the stimulation frequency or the fepsp number (1 to 5; figure 2(b); p <0.05), except for the third fepsp of the stimulation applied at 20 hz, for which no significant reduction was observed after a application (81.1 13.2% of control, figure 2(c); p = 0.07). In spite of this generalized reduction in synaptic coupling produced by bath application of a, no change in the synaptic facilitation was observed for any of the fepsp trains evoked at 5, 10, or 20 hz (figure 2(b); p <0.05). This can be seen more clearly when the amplitude of each fepsp in the train is normalized to the amplitude of the first fepsp (set as 1; figure 2(b)). In the case of the compound fepsp, a application significantly reduced the maximal amplitude to 78.6 2.8% of control (figure 2(c); p <0.05). Thus, these results indicate that bath application of a produces a generalized reduction in the synaptic neurotransmission provided by the hippocampus into the pfc . To evaluate the effect of a on the hippocampal input into the pfc at the cellular level, we measured the calcium transients induced in single neurons by the stimulation of the hippocampal input . First, we found that the stimulation of the hippocampal fibers recruits pfc neurons, increasing their calcium transients (cell - activation instances) for several seconds (figure 3). Then, we observed that there is a differential recruitment of pfc neurons depending on the stimulation frequency (figure 3). In control conditions, a maximal number of pfc neurons are recruited when hippocampal fibers are stimulated at 5 hz (21.2 5.4 neurons; n = 5 slices; figure 3(b)). This cell recruitment is significantly reduced when stimulation is applied both at 10 hz (17.4 5.44 neurons; p <0.05) and at 20 hz (15.4 3.7 neurons; p <0.05), whereas it tends to be reduced when stimulation is applied at 50 hz (15.7 2.8 neurons; p <0.09). The maximal number of pfc neurons recruited after hippocampal stimulation is reduced in the presence of a, compared to control conditions, when the hippocampal fibers are stimulated at 20 hz (to 66.4 13.7% of control; p <0.05; figure 3(b) right upper part) and 50 hz (to 71.0 13.2% of control; p <0.05; figure 3(b) right lower part). No significant differences versus control conditions were observed in the maximal number of pfc neurons recruited after hippocampal stimulation in the presence of a when the stimulation was applied at 5 and 10 hz (figure 3(b) left upper and lower part). The result was similar when the total number of cell - activation instances in 3 seconds was quantified (figure 3(c)). Compared to control conditions, the total number of cell - activation instances was significantly reduced in the presence of a when the hippocampal fibers were stimulated at 20 hz (to 59.2 8.4% of control; p <0.05; figure 3(c)) and 50 hz (to 68.6 11.1% of control; p <0.05; figure 3(c)), but there were no significant differences when the hippocampal fiber stimulation was applied at 5 and 10 hz (figure 3(c)). Here, we found that a inhibits pfc spontaneous network activity as well as the pfc activation induced by hippocampal fiber - activation both at the population and at the single - cell level, suggesting that a might contribute to pfc dysfunction by a direct effect on this network as well as by a reduction in its synaptic innervation . This finding might constitute the cellular basis of several cognitive deficits that can be produced by pfc dysfunction and/or disrupted pfc - hippocampal coupling and are observed in both ad patients and ad transgenic models . Our finding that a inhibits pfc spontaneous network activity is very similar to observations by our group and others that direct application of a inhibits spontaneous network activity in a variety of networks including the olfactory bulb, the entorhinal cortex, and the hippocampus [37, 45]. In fact, a previous finding already indicated that direct application of a inhibits synchronized activity induced by calcium depletion in pfc slices . In this case, inhibition of a-induced network activity was related to changes in cell excitability . This a-induced inhibition of cell excitability was found to be more prominent in pfc interneurons . This finding correlates with those obtained previously in our laboratory, which show that, despite the lack of effect of a on action potential firing in hippocampal pyramidal cells, the presence of a does induce a reduction in subthreshold membrane potential oscillation . This latter effect might contribute to the a-induced action potential desynchronization in the hippocampus that contributes to the inhibition of its neural network activity . Aside from the changes in cell excitability, the inhibition of neural network activity induced by a has also been related to a reduction in both excitatory [34, 37, 47, 48] and inhibitory [47, 48] synaptic transmission . In fact, these findings are consistent with the observation that a reduced cholinergic modulation of the inhibitory transmission in the pfc . Altogether, the changes in cell excitability and synaptic transmission might contribute to the a-induced inhibition of pfc network activity [1517]. It is important to point out that our finding that a inhibits pfc spontaneous network activity coincides with studies showing changes in pfc network function in ad animal models [14, 18, 19] and ad patients [2931, 49], suggesting that this pathological process can contribute to pfc dysfunction in ad . Ad - associated pfc dysfunction also seems to be the result of reduced pfc coupling to other brain areas [1820, 2931, 49]. One pfc connection that is disturbed in ad is the pfc - hippocampal coupling [2931]. As was already mentioned, alterations in pfc - controlled behaviors [1820] and function [1820] can be induced by intrahippocampal injection of a. it is well known that a affects hippocampal function both in vivo [37, 50] and in vitro [33, 45, 51] and, here, we show that a can affect hippocampal input into the pfc . As this connection is required for the proper synchronization between these two structures and for normal pfc function [18, 19, 26, 27, 32], it is likely that pfc - hippocampal uncoupling could contribute to a-induced pathology and, perhaps, to ad . Considering that pfc - hippocampal coupling occurs at a variety of different oscillatory frequencies [32, 52, 53], we tested whether a affects hippocampal input when it is stimulated at different frequencies . Whereas we observed a generalized reduction in pfc activation at all frequencies tested, the inhibition was more prominent, at least at the unicellular level, when the stimulation was delivered at high frequencies (figure 3). One possible explanation is that this connection is tuned to synchronize the two circuits at low frequencies [26, 35, 42] and, thus, not only is the hippocampal input more efficient in recruiting the pfc at low frequencies [26, 35, 42] but it also renders the connection less vulnerable to a effects when stimulated at low frequencies . It is well known that the synaptic components recruited by different stimulation frequencies vary and that stimulation at higher frequencies favors the recruitment of inhibitory components . Inhibitory neurons and synapses seem to be more sensitive to the effects of a [17, 54], which might explain why a had a major effect on hippocampal input to the pfc when tested at high - frequency stimulation . In fact, this finding is consistent with the observation that fast oscillatory activity, which relies heavily on inhibitory networks [54, 55], is more sensitive to the effects of a [35, 44, 45, 54] compared to slow oscillatory activity . Moreover, fast oscillatory activity is more disrupted both in ad patients [56, 57] and in ad animal models [54, 58, 59]. Thus, understanding the cellular basis of the changes in neural network activity and the alteration in neural network coupling induced by a would help to explain the cellular basis of ad pathophysiology and also would reveal therapeutic strategies to reactivate such networks or reestablish their connections in order to palliate ad symptoms [6062].
|
The past two decades have witnessed major strides in the treatment of several pediatric and adult cancers, particularly with the use of multiagent chemotherapy, radiation therapy, and recently, monoclonal antibodies . Nevertheless, a subset of these patients will develop resistance to these modalities, leaving few treatment options with curative potential . In addition, patients with high risk metastatic disease continue to have dismal treatment outcomes, despite these advances . Therefore, for patients with relapsed, therapy refractory disease and tumors at high risk for recurrence, new treatment strategies are desperately needed . Over the past two decades the success in using adoptive cellular immunotherapy to fight viral infections following allogeneic stem cell transplantation has encouraged some groups to focus their efforts on the infusion of cancer antigen specific, or otherwise activated, t lymphocytes.1,2 there is a long history of clinical investigation with cancer vaccines for a variety of malignant solid tumors . The recognition that dendritic cells (dc) play a key role in antigen presentation led to several groups using dc pulsed with cancer relevant antigens, while other groups have used whole tumor antigens or human leukocyte antigen (hla) restricted epitopes.3,4 several different antigens have been targeted in these strategies, most notably the cancer testis (ct) antigens . These tumor proteins are of interest since they are expressed on several malignant solid tumors, as well as some leukemias, and have a restricted pattern of expression, thereby limiting the possibility of an immune response directed against normal host tissues . These antigens can also be epigenetically upregulated on tumors following exposure to demethylating chemotherapy agents, potentially making tumors more susceptible to killing by antigen - specific t cells that have been stimulated following a ct antigen vaccine . In this review we will summarize past studies which target these antigens and future directions in ct antigen - based immunotherapy . An improved understanding of cellular immunology has helped to facilitate the rational design of cancer immunotherapy strategies . While conventional therapy such as chemotherapy and radiation are useful for the majority of patients, the use of these modalities alone may be insufficient for patients with relapsed cancer or for those who initially present with advanced disease . Chemotherapy often has limited efficacy in patients with relapsed disease, for whom intensification of conventional therapy to overcome drug resistance can lead to significant morbidity . Immunotherapy can specifically target, or in general, modulate cellular immune responses against cancer proteins and has the potential to provide long - lasting responses . Adoptive transfer of autologous in vitro generated and expanded effector t cells is one such effective method . Initial studies in adoptive immunotherapy were performed in the allogeneic stem cell transplant setting to fight serious, potentially life - threatening viral infections, such as cytomegalovirus and epstein barr virus . While adoptive immunotherapy has been largely successful against several viral infections57 this approach has had limited success against cancer . The precursor frequency of cancer antigen - specific cells is very low, and the expansion of these cells requires multiple stimulations . In addition, the low avidity of expanded t cells against cancer antigens and the short life span of adoptively transferred effector t cells are practical limitations of adoptive immunotherapy . Several strategies have been developed to overcome these challenges, such as the use of chimeric antigen receptors,8 t cells genetically engineered to express t cell receptors (tcrs) with high affinity and specificity,9,10 and bispecific antibodies to promote t cell recognition of tumors.11 several immune evasion mechanisms pose major obstacles for the practical application of immunotherapy against cancer . Tumor cells can evade the immune system by (a) downregulating the expression of major histocompatibility complex (mhc) class i and class ii molecules that are required for antigen presentation to t cells; (b) downregulating costimulatory molecules, such as cd80 and cd86, which are required for optimal activation of t cells; (c) upregulating coinhibitory molecules, such as cytotoxic t - lymphocyte antigen 4 (ctla-4) ligands and programmed cell death ligand 1 (pdl-1), on tumor cells;10 and (d) recruiting regulatory t cells (tregs) that produce immunosuppressive cytokines at the tumor site . For example, high expression of ctla-4 has been correlated with increased t cell dysfunction in melanoma patients.12 ctla-4 and programmed cell death 1 (pd-1) are expressed on activated t cells and contribute to t cell exhaustion . The upregulation and ligation of ctla-4/pd-1 (on t cells) with ctla-4 ligands and pdl-1 (on tumor cells) dampens effector t cell activation and negatively attenuates adaptive immune responses.13 researchers have developed strategies to overcome the immunosuppressive tumor microenvironment by blocking the inhibitory pathways.14 therefore antibodies blocking ctla-4 or pd-1 on t cells can prevent the inhibitory signals typically transmitted through these receptors and prevent effector cells from entering into the exhaustion phase, thereby extending the life and function of activated t cells . It seems logical to combine genetically targeted therapies / adoptive immunotherapy with negative regulatory blockade to minimize the chances of tumor resistance and escape . Accordingly, treg depletion followed by pd-1/pdl-1 blockade has shown some efficacy in the treatment of acute myeloid leukemia (aml).15 in a phase i clinical trial of antibody - mediated pd-1 blockade, an objective response (complete response [cr] or partial response [pr]) was observed in those with non - small - cell lung cancer ([nsclc] 18%), melanoma (28%), and renal cell cancer ([rcc] 27%).16 a similar phase i trial using antibody - mediated blockade of pdl-1 induced durable tumor regression and prolonged stabilization of disease in patients with advanced cancers.17 a study has evaluated the contributions of ctla-4 blockade on effector t cells and treg populations in a mouse model of melanoma.18 it revealed that ctla-4 blockade on effector cells significantly improves tumor protection while blockade of tregs completely fails to enhance antitumor responses, and a concomitant blockade of both effector and tregs leads to maximal antitumor activity . Ctla-4 blockade with ipilimumab (an anti - ctla-4 antibody) has resulted in some clinical responses in patients with melanoma, ovarian cancer, prostate cancer, and rcc.19 a phase iii trial showed that ipilimumab, when given with or without a glycoprotein (gp)100 peptide vaccine, improved the overall survival to 10 months when compared to 6.4 months with gp100 alone in patients with metastatic melanoma.20 several phase ii studies suggest that ipilimumab is effective in patients with melanoma and brain metastases.21,22 in a phase ii trial of ipilimumab plus fotemustine in 86 patients with advanced melanoma, of whom 20 patients had asymptomatic brain metastases at baseline . 40 of 86 (46.5%) patients in the study population achieved disease control similar to 10 of 20 patients (50%) with brain metastases.23 furthermore, ipilimumab when combined with decarbazine improved the overall survival to 47% when compared to decarbazine alone (36%).24 these results suggest that blocking the immune checkpoints can improve overall survival in cancer patients . The success of a cancer vaccine is dependent on the ability of a patient to mount a primary or memory immune response against cancer antigens used in the vaccine . Thus far, the majority of cancer vaccine studies have focused on patients with relapsed or therapy refractory disease, but there is a growing interest on the potential to use this approach to prevent relapse in patients who are at high risk for recurrence . Three main types of cancer vaccines that have been used in previous studies, including cellular vaccines, largely consist of dcs pulsed with cancer relevant antigens or tumor cell lysates, protein- or peptide - based vaccines, and vector - based vaccines where plasmid dna and viral / bacterial / yeast vectors are used to deliver tumor - specific antigens.25 potential problems with using whole cell lysates, peptides, or plasmid dna approaches include the immunogenicity of the vaccine, the majority of cancer reactive t cells exist in low numbers and are difficult to expand, and that most tumors have developed multiple means to evade the immune system . Adjuvants can be used to enhance vaccine immunogenicity and thereby increase the likelihood of eliciting a t cell response . Granulocyte - macrophage colony - stimulating factor (gm - csf) has been used as an adjuvant in several types of tumors including melanoma, colorectal carcinoma, rcc, and lymphoma . For example, an idiotypic protein vaccine together with gm - csf resulted in complete molecular remission (by polymerase chain reaction [pcr]) in 8 of 11 lymphoma patients and tumor - specific cytotoxic cd4 + and cd8 + cells were found in 95% of the patients.26 dcs play a central role in initiating antitumor responses by activating innate and adaptive immune cells . Different dc subsets express distinct toll - like receptors (tlrs), such as tlrs 1 to 8, and upon stimulation, upregulate costimulatory molecules, pro - inflammatory cytokines, and chemokines which can assist in priming tumor - specific t cells . Therefore, different types of tlr agonists have been used as adjuvants along with dc - based vaccines in treating glioblastoma, breast cancer, melanoma, rcc, and leukemia.27 a list of clinical trials using dc as therapeutic vaccines has been detailed in a comprehensive review of cancer immunotherapy with these antigen presenting cells.28 an ideal tumor antigen for immunotherapy should be (a) expressed specifically on tumor cells and not on healthy cells, (b) stably and homogenously expressed on all / majority of tumor cells, (c) vital for the existence of cancer cells, and (d) targeted by tumor antigen - specific cytotoxic t lymphocytes.29 identification of such tumor antigens would enhance the success of cancer vaccines . Ct antigens are tumor proteins with a restricted pattern of expression, generally limited to germ cell and trophoblast tissue, but are also expressed in various human cancers . Their stable and specific expression on tumor cells and lack of expression on normal tissues make them an attractive target for cancer immunotherapy . Based on the frequency of ct antigen expression, chen et al30 and caballero and chen31 classified certain types of cancers including melanoma, ovarian cancer, lung cancer, and bladder cancer as ct - rich tumors; rcc, colorectal cancer, and lymphoma / leukemia as ct - poor tumors; and breast cancer, bladder cancer, and prostate cancer as ct - intermediate tumors . Ct antigens are divided into two groups: ct - x (encoded on x chromosome) and non - x ct antigens . An excellent review by simpson et al summarizes the characteristics and functions of these two types of ct antigens.29 until 2004, there were around 40 ct antigens identified,33 but by 2012, the number of ct antigens identified had increased to 110.32 our review will focus mainly on melanoma antigen family (mage)-a1, mage - a3, and new york esophageal squamous cell carcinoma (ny - eso-1), three of the initially identified and most widely studied ct antigens in melanoma . Mage - a1 and mage - a3 are members of the mage gene family that are expressed on male germ line cells and placenta, as well as in melanoma, bladder cancer, breast cancer, prostate cancer, and nsclc.33 ny - eso-1 is another ct antigen found on several tumors, including in ovarian cancer, lung cancer, melanoma, as well as some sarcomas and neuroblastomas.34 expression rates of mage - a1 and mage - a3 were 53.7% and 36.6%, respectively, in ovarian cancer.35 several mage - a1 peptides restricted to individual hla alleles have been reported in healthy donors.3638 the frequency of expression of mage - a1 and ny - eso-1 in bladder cancer versus liver cancer was 22% and 80% versus 80% and 29%, respectively.33 in pharyngeal tumors, mage - a and ny - eso-1 were detectable in 70% and 33.3% of tumors, respectively.39 in nsclc patients, the expression of ny - eso-1 was only 8.3%,40 while its expression in synovial sarcoma was 80%,41 and its expression was 100% in myxoid / round cell liposarcoma patients.42 screening neuroblastoma cell lines for these antigens by reverse transcriptase - pcr (rt - pcr) has revealed that 44% are positive for mage - a1, 21% for mage - a3, and 30%82% for ny - eso-1, and immunohistochemical analysis has shown a good correlation between gene and protein expression.43 in addition, in neuroblastoma, a higher level of ny - eso-1 expression has been reported in patients with later stage disease.44 the frequency of mage - a1 expression increased from 20% (in primary tumors) to 51% with advanced disease (in distant metastases), while ny - eso-1 expression remained at 45%, regardless of stage of disease in melanoma patients.45 in malignant gammopathies, the expression pattern of mage - a1, mage - a3, and ny - eso-1 was heterogeneous, and the expression of these antigens was greater in patients with stage iii extramedullary plasmacytoma or high risk myeloma relative to low risk disease groups.46 this indicates that levels of expression of ct antigens vary depending upon the type of cancer and the stage of a patient s disease, with many tumors having increased expression of ct antigens upon progression / relapse.4547 the expression of ct antigens on tumors has been correlated with the presence of ct antigen - specific b and t cell responses . Studies in adult patients have demonstrated that mage - a1 and mage - a3 specific t cells are present and can be augmented with a vaccine, or by stimulation of these t cells in culture.4851 there is also a correlation between the detection of mage - a3 specific cd8 t cells and regression of tumors in melanoma patients.52 mage - specific cd8 t cell responses have been reported in aml patients.53 in adult t cell leukemia / lymphoma cells, ny - eso-1 and mage - a3 were expressed in 61.4% and 31.6% of cells, respectively . This study detected ny - eso-1 specific antibodies in 11.6%, and ny - eso-1 specific cd8 t cell responses in 55.6%, of adult t cell leukemia / lymphoma patients.54 another study demonstrated cd8 t cell responses in 10 of 11 patients with ny - eso-1 positive melanoma who had ny - eso-1 antibodies, but not in patients with ny - eso-1 negative tumors or those lacking antibodies.55,56 there has also been a report on the detection of interferon- (ifn-) producing ny - eso-1 specific t cells in neuroblastoma patients.45 these studies indicate that mage - a1, mage - a3, and ny - eso-1 are immunogenic and capable of eliciting t and b cell responses . Clinical trials have been reported using dc - based vaccines, whole protein vaccines, or hla restricted epitopes for mage - a1 and mage - a3 positive malignancies . Chianese - bullock et al gave vaccines consisting of mage - a1, mage - a10, and gp100 peptides with gm - csf and incomplete freund s adjuvant to patients with stage iib to iv melanoma.49 there were increases in mage - a1 specific ifn- production postvaccination, and cytotoxic t lymphocyte (ctl) from these patients lysed tumor cells expressing mage - a1 . Mackensen et al reported on the results of a mage - a1 and mage - a3 peptide loaded dc vaccine in 14 melanoma patients.57 clinical and immunologic responses were seen in two patients, and increased melanoma peptide specific immune responses were seen in four patients.57 thurner et al reported the use of mage - a3 peptide pulsed mature dc at doses of 3 10 dc per vaccine, given at 14 day intervals.51 significant expansion of mage - a3 specific cd8 cytotoxic t cells was induced in 8 of 11 patients, with regression of individual metastases in 6 of 11 patients . The ongoing clinical trials with ct antigens, mage - a1, mage - a3, and ny - eso-1 are presented in table 1 . The majority of clinical trials with ny - eso-1 tumor vaccines have used either individual hla restricted epitopes or whole protein, with or without adjuvants . Most of these studies have demonstrated enhancement of t and b cell responses to this antigen postvaccination . Some of the initial clinical trials with ny - eso-1 peptide vaccines used hla - a2 restricted peptides, and demonstrated that cd8 t cell responses can be expanded postvaccination.56,58,59 bender et al used an hla - a2 restricted ny - eso-1 peptide for vaccination, and reported that three of nine seronegative patients developed cd8 t cell responses.60 one study used full length ny - eso-1 protein with the iscomatrix adjuvant in 46 patients with fully resected, ny - eso-1 positive tumors.61 these investigators found high titer antibody responses, as well as cd4 and cd8 t cell responses, against a wide range of ny - eso-1 epitopes postvaccination . There was improved survival, with only two of 19 relapses in the group receiving adjuvant and protein, in comparison with nine of 16 relapses in the group receiving protein alone . Upon further evaluation, persisting anti - ny - eso-1 immunity was detected in ten of 14 recipients who had previously received vaccine with iscomatrix adjuvant, while immunity only persisted in three of 14 recipients who received vaccine alone.62 a major focus of research during the past two decades has been to identify methods to overcome the mechanisms used by tumors to evade the immune system . Different approaches including conventional therapy, molecular - targeted therapy, and immunotherapy have been combined in an attempt to improve clinical outcomes . This includes using chemotherapy and blockade of immune checkpoints,20,63,64 cancer vaccines and radiation therapy,65 cancer vaccines and chemotherapy,66,67 cancer vaccines and molecular - targeted agents,68 and molecular - targeted agents and blockade of immune checkpoints.69 current available combinations of immunotherapy and molecular - targeted therapy for cancer treatment are summarized in a review by vanneman and dranoff.70 depletion of tregs in combination with a cancer vaccine is another approach . Tregs can be depleted by using anti - cd25 monoclonal antibodies71,72 and studies show that chemotherapy agents such as cyclophosphamide can deplete / suppress tregs.73,74 among the different approaches available, we will focus our discussion on combining immunotherapy (using ct antigens) and chemotherapy, especially on the use of decitabine ([dac] 5-aza-2-deoxycytidine), a demethylating chemotherapeutic agent that epigenetically upregulates the expression of ct antigens, and review how ct antigens have been targeted in clinical trials . The success of immunotherapy is largely dependent on the recognition of cancer cells expressing ct antigens by antigen - specific t cells, and this is dependent on antigen expression in the context of mhc class i and class ii molecules . In cancer cells, hypermethylation of promoters leads to the downregulation of expression of ct antigens75 and mhc molecules,76 which are required for antigen presentation and recognition by antigen - specific cytotoxic t cells . Since not all tumors express ct antigens, one way to upregulate the expression of ct antigens and mhc molecules, and enhance tumor cell killing by antigen - specific cytotoxic t lymphocytes, would be to reverse hypermethylation by using demethylating agents . Dac is a potent inhibitor of dna methylation, and the doses associated with the demethylating action of dac are much lower than those required for cytotoxicity.7780 several groups have demonstrated that demethylating agents, such as dac, upregulate the expression of mage - a1, mage - a3, and ny - eso-1 in a number of tumor cell lines,8184 potentially making these tumors more susceptible to mage - a1, mage - a3, and ny - eso-1 mediated killing . There have been several in vitro studies showing the effects of demethylating chemotherapy on the expression of ct antigens . One study demonstrated that the use of dac could result in the restoration of mhc class i and mage antigens on melanoma cells.85 another group demonstrated that the treatment of ovarian cancer cell lines with dac resulted in the upregulation of mage - a1 and mage - a3 expression, as well as mhc class i molecules.81 sigalotti et al treated 33 patients with aml or myelodysplastic syndrome (mds) with dac, and measured the expression of several ct antigens by rt - pcr.86 in 31 of 33 patients who had no ct antigen expression prior to treatment, de novo expression of mage - a1 and ny - eso-1 was observed in all but one patient 15 days after treatment . Weber et al demonstrated that mage - a1 expression was upregulated on several malignant melanoma cell lines following exposure to dac,83 and other studies have demonstrated that dac can increase the expression of ny - eso-1 on malignant glioma cell lines.87,88 our group recently demonstrated that the majority of neuroblastoma cell lines had increased expression of mage - a1, mage - a3, and ny - eso-1, on both a molecular and protein level, after 5 days exposure to dac, and that this effect was associated with enhanced tumor cell killing by ct antigen specific ctl.89 upregulation of ct antigens and enhanced killing of tumor cells following treatment with dac by ct antigen specific t cells suggests that immunotherapy using ct antigens in combination with dac can be a potential strategy to treat relapsed patients . Our ongoing phase i clinical trial combining dac and a dc vaccine targeting mage - a1, mage - a3, and ny - eso-1 for patients with relapsed neuroblastoma demonstrated a complete response in our first patient . The clinical outcome was correlated with a robust increase in the number of mage - a3 specific cd8 and cd4 t cells, and the patient remains disease free 1 year following his vaccination.90 this study indicates that a combination of demethylation - based chemotherapy followed by vaccine formulations containing ct antigens can elicit antigen - specific immune responses, potentially leading to an intensified antitumor effect . Clinical trials are currently underway using genetically engineered ny - eso-1 specific t cells for patients with synovial sarcoma, tcrs specific for magea3/a6/b18 or ny - eso-1/l antigen family member (lage) for patients with ovarian cancer, and tcrs specific for mage - a3 and ny - eso-1 for patients with melanoma . Adoptive transfer of autologous t cells transduced with tcr directed against ny - eso-1 has shown an objective clinical response in 4 of 6 patients with synovial cell sarcoma and in 5 of 11 patients with melanoma.91 this study demonstrated a partial response lasting 18 months in 1 of 6 patients with synovial cell sarcoma and a complete regression, that lasted over 12 months, in 2 of 11 patients with melanoma . Ct antigens are ideal targets for immunotherapy and success of ct antigen based immunotherapy is largely dependent on the recognition of cancer cells expressing ct antigens by antigen - specific t cells . Combination therapy that includes a combination of different immunotherapeutic modalities, or combination of immunotherapy with dac and/or other chemotherapy / irradiation, or both could overcome the obstacles related to effective antitumor immunity . Such a combination therapy should primarily target upregulation of ct antigen expression and pro - apoptotic molecules on tumor cells, enhance the expression of mhc class i and class ii molecules and costimulatory molecules on antigen presenting cells, and downregulate the expression of coinhibitory molecules on the surface of t cells . A combination therapy using agents to target all three types of cells could result in an antitumor immune response, and further studies addressing issues of cell dosage, timing, and necessary sequence of agents used could improve clinical outcomes.
|
A 30-year - old male patient reported to the department of conservative dentistry and endodontics with decayed tooth and associated pain over his left mandibular region . The tooth exhibited no mobility, was mildly tender to percussion, and gave a negative response to heat test and a mild reaction to an electric pulp tester . The preoperative diagnostic radiograph of 37 [figure 1] revealed a deep carious lesion involving the pulp with widening of the apical periodontal ligament space . A provisional diagnosis of necrotic pulp with apical periodontitis was made and endodontic treatment was scheduled . Preoperative radiograph of 37 after administration of local anesthesia and rubber dam isolation, the carious lesion was removed and an adequate endodontic access made . Inspection of the pulp chamber floor showed orifices corresponding to mesiobuccal, mesiolingual, and distal canals [figure 2]. On careful examination of the groove between the mesiobuccal and mesiolingual canal orifices, the middle mesial canal orifice was identified and the canal subsequently negotiated [figure 3]. Intraoral mirror image of 37 with three canals in mesial root intraoral mirror image of 37 with three canals in mesial root the working lengths were established with an electronic apex locator, and size 10 k files of 21 mm length (dentsply, maillefer, ballaigues, switzerland) were used to confirm three canals in the mesial root radiographically [figure 4]. The canals were instrumented with stainless steel hand instruments k files of 21 mm length (dentsply, maillefer) and the orifices were shaped with gates glidden drills . Working length radiograph irrigation was done with copious amounts of 3% sodium hypochlorite (nice chemicals pvt . Ltd ., cochin, india) and 17% ethylenediaminetetraacetic acid (edta; pulpdent corporation, massachusets, usa). The canals after preparation were finally flushed with sterile saline, dried with sterile paper points, and a calcium hydroxide dressing was given . At the subsequent visit after a week, the tooth was asymptomatic and was obturated with gutta percha cones (dentsply, maillefer) using ah - plus sealer (dentsply detrey gmbh, konstanz, germany) [figures 5 and 6]. Post - obturation radiograph of 37 the patient experienced no postoperative sequelae and an appropriate post - endodontic restoration was performed in a subsequent appointment to ensure an adequate coronal seal . There are number of reports that reveal the anatomic variations of root canals in mandibular molars . The presence of a third canal (middle mesial) in the mesial root of the mandibular molars has been reported to have an incidence of 0.9515% . Although many authors have agreed on the presence of three foramina in the mesial root, only a few have reported the presence of three independent canals, which presents itself as a rare anatomic variant . This additional canal may be independent with a separate foramen or the additional canal may have a separate foramen and join apically with either the mesiobuccal or the mesiolingual canal . The clinician should accurately observe the pulp chamber floor to locate possible canal orifices . Pulp chamber floor and wall anatomy provide a guide to determine the root canal morphology . Krasner and rankow[1821] made a rational approach to study the relationship of the pulp chamber to the clinical crown and the pulp chamber floor . Their observations, presented in the form of laws, are valuable aids to the clinician searching for elusive canals . Failure to identify extra canals and to recognize any unusual canal configuration is implicated as one of the most common reasons for the failure of endodontic therapy. [2224] a round bur or an ultrasonic tip can be used for removal of any protuberance from the mesial axial wall, which would prevent direct access to the developmental groove between mesiobuccal and mesiolingual orifices . This developmental groove should be carefully checked with the sharp tip of an endodontic explorer . If depression or orifices are located, the groove can be troughed with ultrasonic tips at its mesial aspect until a small file can negotiate this intermediate canal (vertucci, 2005). Radiographic examination using conventional intraoral periapical views is important for the evaluation of the canal configuration . Computed tomography (ct) imaging has been widely used in medicine since the 1970s and was introduced in the endodontic field in 1990 . Recently, cone beam ct (cbct) imaging has been shown to provide comparable images at reduced dose and costs to be considered as an alternative to multidetector ct imaging in endodontics . La et al . In 2010 suggested clinical detection and management of an independent middle mesial canal in mandibular first molar by using cbct imaging . Cbct imaging prior to initiation of therapy can be done for accurate diagnosis and management of the unusual canal morphology . Various diagnostic aids like dyes, champagne bubble test, ultrasonics, micro openers and trans - illumination aids, irrigators to improve pulp chamber visibility (stropko) and observing the chamber for bleeding spots could be used by the clinician as an effective means to locate additional canal orifices . Newer technologies, such as the dental operating microscope and dental loupes, offer magnification and illumination of the operating field and substantially improve the visualization of root canal orifices (de carvalho). The present report confirms that the third canal in the mesial root of mandibular second molar does occur and must be sought along the line between the two mesial canals after accessing the pulp chamber and any cervical stenosis in this zone that might cover the opening of the canals, using burs or ultrasonic tips. [3033] identification of these extra canals and their instrumentation is one of the key factors in the prevention of unsuccessful treatment outcomes . In addition to the various diagnostic aids, operator experience has also been identified as a key factor in locating these aberrant canals . The clinician should be aware of the incidence of this type of variation in the mandibular second molar tooth and perform a preoperative radiological assessment from different angles, a proper access preparation, and thorough examination of the pulp chamber to locate and debride all the canals . An accurate clinical evaluation of root canal number and morphology in mandibular second should be done using various diagnostic methodologies with magnification and illumination, which would pave the way for long - term success of endodontic therapy.
|
Advances in noninvasive technologies in cardiology are growing and improving both the diagnosis of heart disease and the guidance of therapy . There are currently many emerging technologies, which are being used in the alternative and complementary medicine practice, including computer meridian diagnostics and virtual scanning . Suffice to note that the body is a dynamic system in which reaction kinetics are affected by the reaction conditions . In particular, visual defects are associated with heart condition[35]. Associated with the defects are antioxidant activities[68], which in turn are associated to adenosine triphosphate (atp) metabolism . Changes to the levels of proteins and reactive substrates in the body cause the release of ultra weak light or chemiluminescence . Examples of substrates and/or products of reactions that involve chemiluminescence include antioxidants and atp respectively . The concept of stress is related to the complexity of the interactions between the cells, organs and systems of the body . The constancy, homeostasis or steady - state condition means that any tendency towards change is either automatically resisted by a feedback or feedforward response . Two of the adrenal hormones involved in the neuro - endocrine response to stress are catecholamines and glucocorticoids . The catecholamines decrease insulin production and increase glucagon's release, which culminate in increased glucose level in the blood vis - - vis glucose metabolism . Normal human physiological processes are strongly dependent on glucose metabolism (i.e. The biochemical process) for the generation of energy . Glucose metabolism is a cell level (glycolysis and hexose monophosphate shunt pathways) activity that inherently generates free radicals (oxidants). When a free radical reacts with a molecule, a new radical is always formed . The new radical readily reacts with another molecule to produce yet another radical, and this continues exponentially until the radicals react with a chain breaking molecule (antioxidant), which will result in the formation of a stable product . Typical examples of antioxidants are vitamins c and e. others are glutathione, coenzyme - q10 and carotenoid . There is a paradox that many antioxidants including vitamins c and e are potentially toxic . Recalling the famous chemistry slogan atoms can neither be created nor destroyed, an antioxidant vitamin that has finished a much needed reaction is not destroyed . It is transformed into a reaction product or intermediate, which has pro - oxidant toxic potentials and therefore requires recycling back to its original state . In good health, there are co - antioxidants in a delicately balanced or closed circuit interaction (fig . Closed - circuit nature of co - antioxidants interaction network - vitamin e regeneration system . Keys: aa = ascorbic acid, coq = oxidized coenzyme - q10, coq - h2 = coenzyme - q10, cvd = cardiovascular disease, dha = dehydro - ascorbic acid (free radical), gr = glutathione reductase, gsh = reduced glutathione, gssg = oxidized glutathione, loo = lipid peroxyl radical, looh = lipid peroxide, os = oxidative stress, rc = mitochondrial respiratory chain, toh = tocopherol (vitamin e), to = tocopheroxyl radical . A major part of neuroendocrine system involved in stress adaptation is the hypothalamus - pituitary - adrenalin axis (hpaa). When there is stress, there is release of adrenal hormones and associated with this is increased glucose metabolism . If the stress condition is prolonged (chronic), there will also be chronic increase in glucose metabolism (similar to an undiagnosed diabetic state). This leads to more - than - normal - level production of free radicals and by default, an alteration in the body's biochemical makeup . Among the obvious alterations in biochemical makeup specifically, when oxidative stress involves the red blood cells, the biochemical alterations drive the physiology as in the flow diagram (fig 2). The figure illustrates how stress (such as chronic anxiety) can cause hypertension and increased heart rate en route cardiological diseases . It is known that antioxidant activities involve reactions with proteins with concomitant emission of ultra weak light and are increased in obstructive sleep apnoea states . It is also known that oxidants contribute to the exacerbation of sleep apnoea, particularly including the cardiovascular complications . At this juncture, it is pertinent to note at least the following half - a - dozen points: biochemical changes associated with disease or drug substances influence perception of color.changes to the levels of proteins and reactive substrates in the body cause the release of ultra - weak light albeit chemiluminescence.the emissions are measurable luminescence as index of oxidative stress.oxidative stress as a common event that can lead to emission of chemiluminescence has been indicated in studies on erythrocytes . Further support is provided by studies indicating that emission can be attenuated or increased by addition of antioxidants or reactive oxygen species respectively[2426].atp is the ultimate of glucose metabolism . The associated increase in free radicals is involved in chemiluminescence when a high energy state intermediate changes to a lower energy state . Above all, alteration in atp level is correlated to photon chemiluminescence.photon emission affects color or heat perception and intensity and this property is utilized in ct scan . Therefore, abnormal level of emissions arising from biochemical processes during disease conditions could affect color vision . Changes to the levels of proteins and reactive substrates in the body cause the release of ultra - weak light albeit chemiluminescence . Oxidative stress as a common event that can lead to emission of chemiluminescence has been indicated in studies on erythrocytes . Further support is provided by studies indicating that emission can be attenuated or increased by addition of antioxidants or reactive oxygen species respectively[2426]. The associated increase in free radicals is involved in chemiluminescence when a high energy state intermediate changes to a lower energy state . Above all, alteration in atp level is correlated to photon chemiluminescence . Photon emission affects color or heat perception and intensity and this property is utilized in ct scan . Therefore, abnormal level of emissions arising from biochemical processes during disease conditions could affect color vision . What this article brings to fore is that there is a non - invasive cognitive test procedure, virtual scanning technology, which utilizes the chemiluminescence arising from biochemical processes to assess and manage stress - related cardiological conditions . The biochemical basis of the technology has not been previously explained, except as implied in our papers[2932]. This article furthers explanation that oxidative stress effect of luminescence on cognition and colour perception is possibly the biochemical basis of virtual scanning technology . The concept of stress is related to the complexity of the interactions between the cells, organs and systems of the body . The constancy, homeostasis or steady - state condition means that any tendency towards change is either automatically resisted by a feedback or feedforward response . Two of the adrenal hormones involved in the neuro - endocrine response to stress are catecholamines and glucocorticoids . The catecholamines decrease insulin production and increase glucagon's release, which culminate in increased glucose level in the blood vis - - vis glucose metabolism . Normal human physiological processes are strongly dependent on glucose metabolism (i.e. The biochemical process) for the generation of energy . Glucose metabolism is a cell level (glycolysis and hexose monophosphate shunt pathways) activity that inherently generates free radicals (oxidants). When a free radical reacts with a molecule, a new radical is always formed . The new radical readily reacts with another molecule to produce yet another radical, and this continues exponentially until the radicals react with a chain breaking molecule (antioxidant), which will result in the formation of a stable product . Typical examples of antioxidants are vitamins c and e. others are glutathione, coenzyme - q10 and carotenoid . There is a paradox that many antioxidants including vitamins c and e are potentially toxic . Recalling the famous chemistry slogan atoms can neither be created nor destroyed, an antioxidant vitamin that has finished a much needed reaction is not destroyed . It is transformed into a reaction product or intermediate, which has pro - oxidant toxic potentials and therefore requires recycling back to its original state . In good health, there are co - antioxidants in a delicately balanced or closed circuit interaction (fig . Closed - circuit nature of co - antioxidants interaction network - vitamin e regeneration system . Keys: aa = ascorbic acid, coq = oxidized coenzyme - q10, coq - h2 = coenzyme - q10, cvd = cardiovascular disease, dha = dehydro - ascorbic acid (free radical), gr = glutathione reductase, gsh = reduced glutathione, gssg = oxidized glutathione, loo = lipid peroxyl radical, looh = lipid peroxide, os = oxidative stress, rc = mitochondrial respiratory chain, toh = tocopherol (vitamin e), to = tocopheroxyl radical . A major part of neuroendocrine system involved in stress adaptation is the hypothalamus - pituitary - adrenalin axis (hpaa). When there is stress, there is release of adrenal hormones and associated with this is increased glucose metabolism . If the stress condition is prolonged (chronic), there will also be chronic increase in glucose metabolism (similar to an undiagnosed diabetic state). This leads to more - than - normal - level production of free radicals and by default, an alteration in the body's biochemical makeup . Among the obvious alterations in biochemical makeup specifically, when oxidative stress involves the red blood cells, the biochemical alterations drive the physiology as in the flow diagram (fig 2). The figure illustrates how stress (such as chronic anxiety) can cause hypertension and increased heart rate en route cardiological diseases . It is known that antioxidant activities involve reactions with proteins with concomitant emission of ultra weak light and are increased in obstructive sleep apnoea states . It is also known that oxidants contribute to the exacerbation of sleep apnoea, particularly including the cardiovascular complications . At this juncture, it is pertinent to note at least the following half - a - dozen points: biochemical changes associated with disease or drug substances influence perception of color.changes to the levels of proteins and reactive substrates in the body cause the release of ultra - weak light albeit chemiluminescence.the emissions are measurable luminescence as index of oxidative stress.oxidative stress as a common event that can lead to emission of chemiluminescence has been indicated in studies on erythrocytes . Further support is provided by studies indicating that emission can be attenuated or increased by addition of antioxidants or reactive oxygen species respectively[2426].atp is the ultimate of glucose metabolism . The associated increase in free radicals is involved in chemiluminescence when a high energy state intermediate changes to a lower energy state . Above all, alteration in atp level is correlated to photon chemiluminescence.photon emission affects color or heat perception and intensity and this property is utilized in ct scan . Therefore, abnormal level of emissions arising from biochemical processes during disease conditions could affect color vision . Changes to the levels of proteins and reactive substrates in the body cause the release of ultra - weak light albeit chemiluminescence . Oxidative stress as a common event that can lead to emission of chemiluminescence has been indicated in studies on erythrocytes . Further support is provided by studies indicating that emission can be attenuated or increased by addition of antioxidants or reactive oxygen species respectively[2426]. The associated increase in free radicals is involved in chemiluminescence when a high energy state intermediate changes to a lower energy state . Above all, alteration in atp level is correlated to photon chemiluminescence . Photon emission affects color or heat perception and intensity and this property is utilized in ct scan . Therefore, abnormal level of emissions arising from biochemical processes during disease conditions could affect color vision . What this article brings to fore is that there is a non - invasive cognitive test procedure, virtual scanning technology, which utilizes the chemiluminescence arising from biochemical processes to assess and manage stress - related cardiological conditions . The biochemical basis of the technology has not been previously explained, except as implied in our papers[2932]. This article furthers explanation that oxidative stress effect of luminescence on cognition and colour perception is possibly the biochemical basis of virtual scanning technology . The concept of stress is related to the complexity of the interactions between the cells, organs and systems of the body . The constancy, homeostasis or steady - state condition means that any tendency towards change is either automatically resisted by a feedback or feedforward response . Two of the adrenal hormones involved in the neuro - endocrine response to stress are catecholamines and glucocorticoids . The catecholamines decrease insulin production and increase glucagon's release, which culminate in increased glucose level in the blood vis - - vis glucose metabolism . Normal human physiological processes are strongly dependent on glucose metabolism (i.e. The biochemical process) for the generation of energy . Glucose metabolism is a cell level (glycolysis and hexose monophosphate shunt pathways) activity that inherently generates free radicals (oxidants). When a free radical reacts with a molecule, a new radical is always formed . The new radical readily reacts with another molecule to produce yet another radical, and this continues exponentially until the radicals react with a chain breaking molecule (antioxidant), which will result in the formation of a stable product . Typical examples of antioxidants are vitamins c and e. others are glutathione, coenzyme - q10 and carotenoid . There is a paradox that many antioxidants including vitamins c and e are potentially toxic . Recalling the famous chemistry slogan atoms can neither be created nor destroyed, an antioxidant vitamin that has finished a much needed reaction is not destroyed . It is transformed into a reaction product or intermediate, which has pro - oxidant toxic potentials and therefore requires recycling back to its original state . In good health, there are co - antioxidants in a delicately balanced or closed circuit interaction (fig . Closed - circuit nature of co - antioxidants interaction network - vitamin e regeneration system . Keys: aa = ascorbic acid, coq = oxidized coenzyme - q10, coq - h2 = coenzyme - q10, cvd = cardiovascular disease, dha = dehydro - ascorbic acid (free radical), gr = glutathione reductase, gsh = reduced glutathione, gssg = oxidized glutathione, loo = lipid peroxyl radical, looh = lipid peroxide, os = oxidative stress, rc = mitochondrial respiratory chain, toh = tocopherol (vitamin e), to = tocopheroxyl radical . A major part of neuroendocrine system involved in stress adaptation is the hypothalamus - pituitary - adrenalin axis (hpaa). When there is stress, there is release of adrenal hormones and associated with this is increased glucose metabolism . If the stress condition is prolonged (chronic), there will also be chronic increase in glucose metabolism (similar to an undiagnosed diabetic state). This leads to more - than - normal - level production of free radicals and by default, an alteration in the body's biochemical makeup . Among the obvious alterations in biochemical makeup are increased atp generation and reduction in cellular antioxidant levels . Specifically, when oxidative stress involves the red blood cells, the biochemical alterations drive the physiology as in the flow diagram (fig 2). The figure illustrates how stress (such as chronic anxiety) can cause hypertension and increased heart rate en route cardiological diseases . It is known that antioxidant activities involve reactions with proteins with concomitant emission of ultra weak light and are increased in obstructive sleep apnoea states . It is also known that oxidants contribute to the exacerbation of sleep apnoea, particularly including the cardiovascular complications . At this juncture, it is pertinent to note at least the following half - a - dozen points: biochemical changes associated with disease or drug substances influence perception of color.changes to the levels of proteins and reactive substrates in the body cause the release of ultra - weak light albeit chemiluminescence.the emissions are measurable luminescence as index of oxidative stress.oxidative stress as a common event that can lead to emission of chemiluminescence has been indicated in studies on erythrocytes . Further support is provided by studies indicating that emission can be attenuated or increased by addition of antioxidants or reactive oxygen species respectively[2426].atp is the ultimate of glucose metabolism . The associated increase in free radicals is involved in chemiluminescence when a high energy state intermediate changes to a lower energy state . Above all, alteration in atp level is correlated to photon chemiluminescence.photon emission affects color or heat perception and intensity and this property is utilized in ct scan . Therefore, abnormal level of emissions arising from biochemical processes during disease conditions could affect color vision . Changes to the levels of proteins and reactive substrates in the body cause the release of ultra - weak light albeit chemiluminescence . Oxidative stress as a common event that can lead to emission of chemiluminescence has been indicated in studies on erythrocytes . Further support is provided by studies indicating that emission can be attenuated or increased by addition of antioxidants or reactive oxygen species respectively[2426]. The associated increase in free radicals is involved in chemiluminescence when a high energy state intermediate changes to a lower energy state . Above all, alteration in atp level is correlated to photon chemiluminescence . Photon emission affects color or heat perception and intensity and this property is utilized in ct scan . Therefore, abnormal level of emissions arising from biochemical processes during disease conditions could affect color vision . What this article brings to fore is that there is a non - invasive cognitive test procedure, virtual scanning technology, which utilizes the chemiluminescence arising from biochemical processes to assess and manage stress - related cardiological conditions . The biochemical basis of the technology has not been previously explained, except as implied in our papers[2932]. This article furthers explanation that oxidative stress effect of luminescence on cognition and colour perception is possibly the biochemical basis of virtual scanning technology . It may be likened to other emission - based technologies such as ct scan, magnetic resonance, or ultrasound, but there is a difference . Other technologies involve the body's interaction with, and response to, some exogenous agents being inputted to the system as source of emission . Virtual scanning is based upon the body's inherent biochemical processes as source of light emission and defects in color perception . The cognitive test procedure, which is presented earlier in this volume, the computer then processes the patient's response and shows the results on the screen . The red signals report the extent of the pathology whilst the blue signal reports the extent of the body's natural compensatory response (fig . Signals below 10-units are pre - symptomatic whilst those above 10-units are symptomatic . A typical virtual scanning report indicating cardiological problem . Formatted comments included in the report compensatory signal: 5/0 ischemic heart disease expressed pathological signals (from left to right): 15/31 angina pectoris, 7/17 cardiosclerosis, 7/17 chronic fatigue, 3/31 cardiac insufficiency, 0/24 cardiac myopathy the diagnosis procedure ends with a recommendation of patient treatment strategy and first, the area (organ, system) where correction is necessary and features that are subject to correction are identified . The virtual scanning light therapy involves the presentation of flash lights of uniquely selected colors, shapes and frequencies . The emission is transmitted at delta frequencies to the autonomic nervous system by the computer through his eyes . The third stage of the therapeutic procedure is where healing signals are sensed, as the patient's system (vision) responds, through the monitor . The brain establishes synchronized neural function and hence synchronized function of the autonomic nervous system and physiological systems thereby restoring its normal physiological stability and functions . The principle is referred variously as brain - wave coherence, brain - wave entrainment, or photic stimulation amongst others . One session of treatment takes average of 30 minutes and one module of therapy comprises typically 24 - 36 sessions . Other treatment options of virtual scanning technology (not emphasized in this article) are nutrition, exercise and relaxation . It may be likened to other emission - based technologies such as ct scan, magnetic resonance, or ultrasound, but there is a difference . Other technologies involve the body's interaction with, and response to, some exogenous agents being inputted to the system as source of emission . Virtual scanning is based upon the body's inherent biochemical processes as source of light emission and defects in color perception . The cognitive test procedure, which is presented earlier in this volume, the computer then processes the patient's response and shows the results on the screen . The red signals report the extent of the pathology whilst the blue signal reports the extent of the body's natural compensatory response (fig . Signals below 10-units are pre - symptomatic whilst those above 10-units are symptomatic . A typical virtual scanning report indicating cardiological problem . Formatted comments included in the report compensatory signal: 5/0 ischemic heart disease expressed pathological signals (from left to right): 15/31 angina pectoris, 7/17 cardiosclerosis, 7/17 chronic fatigue, 3/31 cardiac insufficiency, 0/24 cardiac myopathy the diagnosis procedure ends with a recommendation of patient treatment strategy and first, the area (organ, system) where correction is necessary and features that are subject to correction are identified . The virtual scanning light therapy involves the presentation of flash lights of uniquely selected colors, shapes and frequencies . The emission is transmitted at delta frequencies to the autonomic nervous system by the computer through his eyes . The third stage of the therapeutic procedure is where healing signals are sensed, as the patient's system (vision) responds, through the monitor . The brain establishes synchronized neural function and hence synchronized function of the autonomic nervous system and physiological systems thereby restoring its normal physiological stability and functions . The principle is referred variously as brain - wave coherence, brain - wave entrainment, or photic stimulation amongst others . One session of treatment takes average of 30 minutes and one module of therapy comprises typically 24 - 36 sessions . Other treatment options of virtual scanning technology (not emphasized in this article) are nutrition, exercise and relaxation . It may be likened to other emission - based technologies such as ct scan, magnetic resonance, or ultrasound, but there is a difference . Other technologies involve the body's interaction with, and response to, some exogenous agents being inputted to the system as source of emission . Virtual scanning is based upon the body's inherent biochemical processes as source of light emission and defects in color perception . The cognitive test procedure, which is presented earlier in this volume, the computer then processes the patient's response and shows the results on the screen . The red signals report the extent of the pathology whilst the blue signal reports the extent of the body's natural compensatory response (fig . Signals below 10-units are pre - symptomatic whilst those above 10-units are symptomatic . A typical virtual scanning report indicating cardiological problem . Formatted comments included in the report compensatory signal: 5/0 ischemic heart disease expressed pathological signals (from left to right): 15/31 angina pectoris, 7/17 cardiosclerosis, 7/17 chronic fatigue, 3/31 cardiac insufficiency, 0/24 cardiac myopathy the diagnosis procedure ends with a recommendation of patient treatment strategy and the standard therapy involve a basic concept of three stages . First, the area (organ, system) where correction is necessary and features that are subject to correction are identified . The virtual scanning light therapy involves the presentation of flash lights of uniquely selected colors, shapes and frequencies . The emission is transmitted at delta frequencies to the autonomic nervous system by the computer through his eyes . The third stage of the therapeutic procedure is where healing signals are sensed, as the patient's system (vision) responds, through the monitor . The brain establishes synchronized neural function and hence synchronized function of the autonomic nervous system and physiological systems thereby restoring its normal physiological stability and functions . The principle is referred variously as brain - wave coherence, brain - wave entrainment, or photic stimulation amongst others . One session of treatment takes average of 30 minutes and one module of therapy comprises typically 24 - 36 sessions . Other treatment options of virtual scanning technology (not emphasized in this article) are nutrition, exercise and relaxation . We have explained that metabolic and physiological interactions such as glucose metabolism and hpaa, respectively, enable the generation of reactive oxygen species and consequential existence of oxidative stress . The feedback and feedforward responses to oxidative stress reactions form the biochemical basis of pathological processes and systemic instability including cardiological problems (fig . The chemiluminescence arising from oxidative stress are perceived and memorized as characteristic of different disease conditions according to colour perception and intensity and attenuated by flash light using virtual scanning technology . Perhaps, the question would be is this applicable to cardiological diseases? Light is conducted within the body along the acupuncture meridians, and clinical benefits of light therapy have been known . What is yet unknown are the biochemical and/or metabolic basis of the light that is conducted within the body and the basis of therapeutic applicability in cardiology . We had posited that the biochemical basis of signal employed by virtual scanning technology is antioxidant activities . We postulate that oxidative stress induced chemiluminescence and susceptibility to flash light therapy is the basis of virtual scanning technology . Furthermore, we rationalize the applicability to cardiological problems to be based on the attenuating effect of light on oxidative stress . Our postulation is based on the available itemized knowledge on flash light therapy in relation to cardiological problems: the level of blood glucose is a factor in virtual scanning technology . Increased glucose metabolism is implicated in stress and cardiology (fig . 2).light therapy affects cortisol rhythm.low level (infrared) light therapy attenuates hyperglycaemia - induced oxidative stress and enhances the antioxidant protection system.flash light therapy attenuates venous cannulation pain.the concept of selective photothermolysis is applicable in vascular lesions management.atherothrombosis can be cleared, at least in part, by flash light therapy by the principle of laser thrombolysis . 2). Light therapy affects cortisol rhythm . Low level (infrared) light therapy attenuates hyperglycaemia - induced oxidative stress and enhances the antioxidant protection system . Atherothrombosis can be cleared, at least in part, by flash light therapy by the principle of laser thrombolysis . Therefore, given the available knowledge listed above, there is credible evidence that flash light therapy is applicable in the management of cardiological problems . However, validation research would be required to enable incorporation of any new technology such as virtual scanning into conventional clinical practice . This is being incorporated in another closely - related emerging technology, neuropattern, which is based on the argument on neurobehavioral medicine and stress - related disorders that manipulation of the brain by photostimulation technologies can be applied in clinical management . While neuropattern technology acknowledges cortisol rhythm without recourse to light therapy, virtual scanning uses light therapy without recourse to laboratory assessment of cortisol . Therefore, except for reason of availability and cost effectiveness, salivary cortisol test can be employed to monitor and validate therapeutic outcome in virtual scanning . Based on fig . This would include blood glucose level as well as vitamin c, vitamin e and whole blood viscosity . It would be expected that increased blood glucose level, antioxidant imbalance and increased whole blood viscosity will be observed at baseline stress; and normalized after virtual scanning therapy . This hypothesis is in agreement with the implication of oxidative stress and blood flow / shear stress that are involved in several processes of atherogenesis . The association between the triage of (i) biological stress, (ii) cardiology, and (iii) cortisol level is known . This paper articulates that color perception (i) is influenced by biological stress, (ii) is useful for the management of cardiological problems and (iii) can be monitored and validated using cortisol level or the suggested panel of associated biochemical indices, which are centered on oxidative stress . Especially, it is known that oxidative stress is a common mediator of apoptosis and cardiac damage and that antioxidant as adjuvant therapy is effective in improving parameters of cardiac function . What this article contributes is a basis to use blood glucose level, vitamin c, vitamin e and whole blood viscosity as a laboratory panel to validate the technology for possible incorporation, as well as monitor the technology's treatment outcome in clinical practice . It has been argued that virtual scanning technology lacks clear link between plausible mechanism and the theory proposed.
|
In the pediatric population, the reported incidence of pheochromocytoma (pheo) is as high as 0.3 per million per year (1)., 56% of patients with sporadic pheo who are less than 18 yr of age have germline dna mutations (1). Genes thought to be associated with pheos include the ret proto - oncogene, vhl (von hippel - lindau), nf1 (neurofibromin 1), sdhb (succinate dehydrogenase complex subunit b), sdhd (succinate dehydrogenase complex subunit d), sdhaf2 (succinate dehydrogenase complex assembly factor 2), tmem127 (transmembrane protein 127), max (myc - associated factor x), phd2 (prolyl hydroxylase 2), h - ras (harvey rat sarcoma viral oncogene), and hif2a (hypoxia - inducible factor 2) (2, 3). Hypoxia may be a risk factor for pheo along with genetic abnormalities . Because the protein products of vhl and sdh mediate the cellular response to hypoxia by activating the hypoxia - inducible factor (hif) signaling pathway, a pseudohypoxic mechanism may underlie pheo (the pseudohypoxia hypothesis) (2, 4). The mapk (mitogen - activated protein kinase) and mtor (mammalian target of rapamycin) signaling pathways have also been implicated in the development of pheo (2, 4). Although the direct relationship between systemic hypoxia and pheo development is unclear, several cases of pheo in patients with cyanotic congenital heart disease (cchd) have been reported (5,6,7,8,9,10,11,12,13,14,15,16). According to a recent estimate, patients with cchd have a greater risk of developing pheo or paraganglioma (odds ratio: 6.0) than do those with non - cyanotic congenital heart disease (odds ratio: 0.9) (17). In addition, an epidemiologic study reported a relatively high incidence of pheo in people living at high altitudes (18). These findings link cchd and hypoxia with pheo . Here, we present a case of pheo and tricuspid atresia (ta) that was treated by performing the fontan surgery and that supports a relationship between pheo and systemic hypoxia . Cyanosis was noted 8 h after her birth, at which point her percutaneous oxygen saturation (spo2) level was 80% . Palliative surgery (the hemi - fontan surgery and pulmonary artery banding) was performed at osaka university hospital when she was 9 mo of age, but the spo2 level remained around 80% . Functional repair (a modified fontan surgery) was performed at 2 yr of age, and the spo2 level improved to 9094% . At 3 yr of age thereafter, venovenous shunts gradually developed from the hepatic and innominate veins to the pulmonary vein, and the spo2 level was 8090% at 10 yr and 7 mo of age . Coil embolization of the venovenous shunts was performed twice, at 10 yr and 10 mo of age and 12 yr and 10 mo of age, and the spo2 level subsequently improved to 9094% . At 15 yr of age, paroxysmal sweating, dizziness, and transient hypertension (systolic blood pressure: 180 mmhg) were noted . Examinations showed normal thyroid function, normal plasma renin activity, a normal plasma aldosterone level, and a slightly elevated level of total plasma catecholamines (2.1 ng / ml, normal range: 0.150.74 ng / ml). The patient was admitted to osaka university hospital for further evaluation at the age of 15 yr and 11 mo . There was no family history of pheo . On examination, her height was 161 cm, weight was 56 kg, blood pressure was 122/62 mmhg, pulse rate was 84 beats / min, and spo2 level was 90% (room air). Secondary polycythemia was not detected (hemoglobin level: 13.2 g / dl). During cardiac catheterization and contrast angiography, therefore, these procedures were discontinued, and she received continuous infusion of the -blocker phentolamine mesylate (regitine). Laboratory tests performed after cardiac catheterization revealed a highly elevated level of total plasma catecholamines (8.0 ng / ml). Seven days after cardiac catheterization, the catecholamine levels were as follows: fasting total plasma catecholamines, 2.6 ng / ml (normal range: 0.150.74 ng / ml), noradrenaline (na), 2.6 ng / ml (normal range: 0.150.74 ng / ml), urinary noradrenaline, 1092 g / day (normal range: 29120 g / day), and urinary normetanephrine (nm), 3.57 mg / day (normal range: 0.070.26 mg / day). Abdominal computed tomography revealed a tumor 3.8 cm in diameter in the right adrenal gland (fig . (a) abdominal ct: there is a tumor in the right adrenal gland (white arrow). (b) i - mibg scintigraphy: there is marked accumulation of i - mibg in the right adrenal gland (black arrow).). Because scintigraphy showed marked accumulation of i - metaiodobenzylguanidine in the mass (fig . 1), we diagnosed pheo . To reduce systemic vascular resistance and maintain an appropriate circulating blood volume in preparation for surgery, we gradually terminated -blocker therapy (carvedilol) and began -blocker (doxazosin) therapy . Total right adrenalectomy was performed after -blocker pretreatment on the 56th d after admission . Her pulse rate before surgery was 6065 beats / min . After resection of the tumor, her blood pressure decreased to 60 mmhg, and the pulse rate increased transiently to 70 beats / min before returning to 6364 beats / min . After the surgery, catecholamine hypersecretion had ceased, and the blood na and urinary nm levels were 0.13 ng / ml and 0.12 mg / day, respectively . Her pulse rate was 60 beats / min on the 80th d after admission, and she was discharged from the hospital on the 81st d (fig . After diagnosis of pheochromocytoma, -blocker (carvedilol) therpay was discontinued, and an -blocker (doxazosin) therapy was initiated, with gradual increases in the dose until surgery . Unm: urinary normetanephrine (mg / day), sna: serum noradrenaline (ng / ml).). Abdominal computed tomography (ct) and i- metaiodobenzylguanidine (mibg) scintigraphy . (a) abdominal ct: there is a tumor in the right adrenal gland (white arrow). (b) i - mibg scintigraphy: there is marked accumulation of i - mibg in the right adrenal gland (black arrow). After diagnosis of pheochromocytoma, -blocker (carvedilol) therpay was discontinued, and an -blocker (doxazosin) therapy was initiated, with gradual increases in the dose until surgery . Unm: urinary normetanephrine (mg / day), sna: serum noradrenaline (ng / ml). Histological examination of the resected mass showed numerous clear white tumor cells with alveolar structures and abundant blood vessels . The pheochromocytoma of the adrenal gland scaled score is used to distinguish benign versus malignant neoplasms, and the maximum score is 20 (appendix). The tumor may be benign if the score is below 4 (19). The score of our patient s tumor was 0, suggesting that it was benign (fig . 3fig . (a) hematoxylin - eosin (he) staining (low power view). (b) he staining (high power view): there are numerous clear white tumor cells and alveolar structures with abundant blood vessels . (c) immunohistochemistry for chromogranin a: the brown staining indicates expression of chromogranin a in the tumor cells . ). After informed consent was obtained, genetic testing was performed to detect germline mutations in the ret, vhl, sdhb, sdhd, tmem127, and max genes via polymerase chain reaction and direct sequencing . Unfortunately, we did not examine mutations in the dna of the tumor cells . (a) hematoxylin - eosin (he) staining (low power view). (b) he staining (high power view): there are numerous clear white tumor cells and alveolar structures with abundant blood vessels . (c) immunohistochemistry for chromogranin a: the brown staining indicates expression of chromogranin a in the tumor cells . We presented a case of pheo and ta treated by performing the fontan surgery . In patients who undergo this procedure, venovenous shunts develop in response to the elevated systemic venous pressure and carry blood from the systemic veins to the pulmonary veins via remnant fetal vessels . The spo2 level is normally above 90% (20), and the subnormal level in our patient indicated hypoxia due to cchd and the presence of venovenous shunts . Systemic hypoxia has been linked to pheo by data showing a higher frequency of pheo in patients living at high compared with low altitudes (18). Although our patient did not live in a high - altitude area, she had experienced systemic hypoxia since birth owing to cchd . We searched for previous reports of patients with both cchd and pheo and identified 17 such patients (table 1table 1case reports of pheochromocytoma with cyanotic congenital heart disease) (5,6,7,8,9,10,11,12,13,14,15,16). The mean age of these patients at the time of diagnosis of pheo was 24.1 yr, which was younger than the mean age (40 yr) of patients with pheo without other diseases (21). This difference suggests that systemic hypoxia promotes the development of pheo in younger patients . Although the relationship between cchd and pheo remains controversial, our findings suggest a positive association . Various genes, including ret, vhl, nf1, sdhb, sdhd, tmem127, max and hif2a, are thought to be associated with pheo, and most of these genes can be divided into two clusters . The genes in cluster 1 (vhl, sdhb, sdhd, and hif2a) encode proteins that mediate oxygen - independent stabilization of hif, while the genes in cluster 2 (ret, nf1, tmem127, and max) encode proteins associated with receptor tyrosine kinase signaling (22). The hif pathway is a downstream target of proteins encoded by genes in both clusters (22), and the blood level of hif1 is high in patients with cchd (23). Although we did not measure hif1 levels in our patient, it is possible that hypoxia promoted the development of pheo via the hif1 pathway . Diagnosing pheo was difficult for two reasons: 1) pheo was not immediately considered when our patient developed paroxysmal sweating and dizziness because she also had cchd, and 2) paroxysmal hypertension occurs in only 7% of young patients with pheo, and thus, is uncommon (24). Although pheo is rare in children, we need to carefully consider its possible occurrence in patients with cchd . When hypertension is observed in children with cchd, catecholamine levels should be examined before cardiac catheterization . Pheochromocytoma of the adrenal gland scaled scores are based on 12 criteria as follows: large nests or diffuse growth, 2 points; central (middle of the large nests) or confluent tumor necrosis, 2 points; high cellularity, 2 points; cellular monotony, 2 points; tumor cell spindling, 2 points;> 3 mitotic figures/10 high power fields, 2 points; atypical mitotic figure(s), 2 points; extension into adipose tissue, 2 points; vascular invasion, 1 point; capsular invasion, 1 point; profound nuclear pleomorphism, 1 point; and nuclear hyperchromasia, 1 point.
|
Stimulation of enteric motor neuron releases many neurotransmitters and neuropeptides . To evoke post - junctional electrical responses, many ion channels in smooth muscle cells (smcs) or specialized cells (e.g., interstitial cells of cajal [icc] and platelet - derived growth factor receptor -positive [pdgfr] cells) can be activated.1,2 post - junctional responses can be categorized by 2 components: excitatory junction potentials (ejps) and inhibitory junction potentials (ijps). Muscarinic receptors (m2 and m3) are expressed in the gastrointestinal (gi) smooth muscle . Three neurokinins (nks) are substance p, neurokinin a and neurokinin b. these nks are mediated by activation of neurokinin receptors (nk1 - 3). Ijps are mediated by purines, nitric oxide (no), vasoactive intestinal peptide (vip) and pituitary adenylate cyclase - activating peptide (pacap). These g protein coupled receptors have a unique relationship with specific g - proteins and thus activate ion channels in unique ways . Recently the post - junctional responses are focused on the roles of intermediary cells between neurons and smcs . These cells are icc and pdgfr cells.1,2 thus, in this review, we will discuss the ion channel candidates with cell - specific roles which can be modulated by neurotransmitters or neuropeptides . Ach is the major excitatory neurotransmitter3 and plays a primary role in increasing the contractile force in gi motility . Cholinergic excitatory responses are mediated by 2 types of muscarinic receptors (m2 and m3).4 m2 receptors are highly expressed in smc . Icc expresses mainly m3 receptors.5,6 m3 receptors are coupled to gq/11 which activates phospholipase c (plc) and its downstream signaling pathways . Activation of plc hydrolyzes phosphatidylinositol 4,5-bisphosphate (pip2) into diacylglycerol and inositol-1,3,4-triphosphate (ins-1,4,5-ip3).7,8 the plc blocker u-73122 and the anti - gq/11 antibody inhibit muscarinic activation of non - selective cation currents (micat) in murine gastric myocytes.9 the effects of inhibiting plc on micat were found to be independent of triphosphage (ip3), diacylglycerol or ca store depletion in guinea pig ileal myocytes10 and in murine gastric myocytes.11 one interpretation of this finding is that activation of plc is coupled to m2 receptors by dimers released from gi / o proteins.12,13 however, there is no direct evidence of gi / o - mediated regulation of micat in gi smooth muscle to date . In studies of the ip3 mediated pathway, flash photolysis of " caged " ip3 augmented micat in guinea - pig ileal cells suggesting that ip3 receptor - mediated release plays a central role in modulation of micat.14 intracellular ca has been shown to facilitate micat in certain species.15,16 interestingly, the inhibitory effect of ca - dependent pkc on micat suggests that endogenous stimulation of pkc by ach might be responsible for desensitization of micat.17 the rho - kinase (rhok) pathway is a major signaling cascade that controls gi smooth muscle contraction . Recently there have been many reports about the importance of this pathway in gi muscle.18 - 21 the initiating step in this pathway is the small gtpase, rhoa that is activated by receptors coupled to g12/13 . M3 receptors also couple through g12/13 and gq / g11 can also rapidly activate rhoa.22 in the active gtp - bound state, rhoa associates with its main downstream effector, rhok and inhibits myosin light - chain phosphatase (fig . 1), thus increasing the phosphorylation state of myosin and the contractile responses to intracellular ca [ca]i . However, it is important to note the non - specificity of rhok inhibitors . Studies of gi muscle have neglected the fact that rhok may also be coupled to membrane excitability mechanisms . In addition recent studies have indicated that the rhoa signaling modulates a growing number of ion channels.23 - 25 rhok has also been suggested to affect ca influx through inhibition of non - selective cation channels (nscc).26,27 it is worthwhile to note that the pharmacology of native nscc is complicated and there are no specific blockers for these channels . Nscc is important conductance in understanding the fundamental excitatory pathway in gi smc, but evidence to date suggests that cholinergic activation of these channels is unlikely to occur to any great extent in vivo . In w / w murine fundus which iccs were ablated, the ejp was abolished suggesting that cholinergic activation of the gut appears to occur primarily through activation of m3 receptors in icc.28,29 recently, many studies reported that icc uniquely express the ano1 (tmem16a) transcript and protein.30 - 32 ano1 is a molecular candidate for ca - activated cl channels (cacc) which could be another candidate conductance in response to ach (fig . 1). Activation of m3 receptors by ach in icc increases intracellular ca through the plc - downstream pathway . Interestingly, mice which express copgfp constitutively only in icc displayed functional expression of ano1 in small intestinal smooth muscle.31,32 using isolated icc cells from these mice, the characterization of activated currents by muscarinic agonists will be important to interpret the ionic conductance responsible for ejp it is necessary to generate an inducible ano1 ko mouse to elucidate the functional role of cacc in icc in response to ejp . It has been suggested that high frequency stimulation of electrical field stimulation (efs) (> 10 hz) releases neuropeptides . Substance p binds to neurokinin 1 (nk1) receptors, neurokinin a (nka) binds to neurokinin 2 (nk2) receptors and neurokinin b (nkb) binds to neurokinin 3 (nk3) receptors.33 activation of these receptors induces activation of plc and produces ip3 . Thus, we speculate that the functional role of nks is not much different from ach . The nk1 receptor is mainly expressed in icc and nk2 receptors are expressed in smc.34,35 application of nka and substance p in canine colonic smc activates nscc similar to micat.36 in tissue experiments, w / w and ws / ws fundus revealed that substance p - mediated excitation with the marked spontaneous phasic contraction was augmented compared to wild type . These data suggest that the absence of icc would give the musculature unmasked access to substance p since fundic icc are innervated by dominantly inhibitory neurotransmitter (e.g., no). Although there is no report about the effects of nks on icc conductance, it will be worthwhile to characterize the ionic conductance activated by nks in comparison with the ionic conductance in smc . It might be possible to activate cacc through the plc - downstream pathway with an increase in intracellular ca by nks in icc . Efs evoked a ejp followed by a fast hyperpolarization (fast ijp) in gi smooth muscle . The phenomenon resulted from activation of p2y receptors by purines (mainly atp or -nad).37 - 41 there are eight identified human p2y receptors: p2y1,2,4,6,11,12,13,14.42 the p2y1-p2y11 receptors are coupled via gq/11 and p2y12-p2y14 receptors are coupled via gi / o.42 recent evidence showed that p2y1 receptor has the most prominent role in fast ijp . Mrs2500, a specific blocker for the p2y1 receptor, completely abolished fast ijp.37 - 40 furthermore, p2ry1 ko mice showed the absence of fast ijp.39,40 p2y1 receptors are coupled to gq/11 and activate plc downstream signaling . An increase in ip3 production and in turn, release of intracellular ca from ip3 ca store may be the key component . Apamin, a blocker of small - conductance ca - activated k (sk) channels, inhibits partially the fast ijp.41,43,44 thus, activation of sk channels coupled to p2y1 receptor could be one of the main responses to generate fast ijp . Previously, the purinergic inhibitory response was regarded to result from the activation of sk channel in smc.45,46 however, recently the fibroblast - like cells were identified as pdgfr immunoreactive positive cell, confirmed by using transgenic mice which expressed egfp in nuclei (pdgfr cell).47 - 49 pdgfr cell under patch clamp displayed a large outward current which was inhibited by apamin.49 the current density of pdgfr cells is much higher than in smc . Thus, there is strong possibility that fast ijp responses evoked by purines are mediated through p2y1 receptor and sk channels in pdgfr cells (fig . This hypothesis still needs to be confirmed with inducible pdgfr ko mice since conventional pdgfr ko mice are not viable . Enteric nitric oxide synthase (nos) containing inhibitory neurons releases no.50 no induced slow hyperpolarization (slow ijp) and relaxed gi smooth muscle by neural stimulation.51 - 55 no activates soluble guanylate cyclase, produces 3',5'-guanosine cyclic monophosphate (cgmp), and activates protein kinase g (pkg). Nos inhibitors (e.g., l - nna) and soluble guanylate cyclase inhibitors (e.g., odq) abolish slow ijp.56 firstly, slow ijp could be due to activation of k conductance . Functional presence of stretch - dependent k (sdk) channels has been reported in colonic myocytes.57,58 sdk channels are activated by no, a membrane - permeable analogue of cgmp and pkg . L - methionine and its derivatives inhibit sdk channels and decrease the evoked slow ijp.59 trek-1 channel has been found to be a molecular candidate for native sdk channels in murine colonic myocytes.60 trek-1 channel has a similar single channel conductance and regulatory properties including the effects of no and membrane permeable analogue of cgmp . There are reports that slow ijp, particularly in esophageal smooth muscle, is due to inhibition of cacc in tissue experiments.61,62 as is known, cacc blockers are notorious by non - specificity . It is important to note that the no component of ijp (sijp) was abolished in icc ablated mice (w / w and sl / sl) and rat (ws / ws).63 - 65 recently, an icc - specific deletion of pkg decreased the slow ijp66 (fig . These data suggest that the slow ijp may be evoked by pkg activation and may not be due to the activation of ion channels in smc but in icc . We need to consider that phosphodiesterase 3a is highly expressed in icc.6 this enzyme is inhibited by cgmp . Inhibition of phosphodiesterase 3a can increase the concentration of camp and activity of protein kinase a (pka). Pka including pkg might involve the phosphorylation of phospholamban in sarco / endoplasmic reticulum ca - atpase (serca) in icc, and in turn ca influx into the endoplasmic reticulum might be augmented (fig . In addition to activation of k conductance by pkg, it is possible to inhibit ca - activated inward conductance in icc during no release . Thus, it will be very important to investigate ionic conductance(s) evoked by no and its intracellular signaling mechanisms in freshly dispersed icc . Vip and pacap are known to be enteric inhibitory peptides.67 these peptides induce hyperpolarization and relaxation of the gi smooth muscle.68 in rat colonic smooth muscle, the vip antagonist (vip10 - 28) blocked the inhibitory response elicited by efs.69 two vip receptors, vpac1 and vpac2 are activated by both peptides . Vpac2 is predominantly expressed in the gi tract.68,70 this receptor is coupled to gs and increases the production of camp . Vip activates delayed rectifying k currents (kdr) via pka activation in smc.71 however, kdr currents are voltage - dependent and thus have a threshold for activation (~40 mv). The activation of kdr currents cannot undergo further hyperpolarization from the resting membrane potentials . In contrast, pacap induced - hyperpolarization was inhibited by apamin suggesting that activation of sk channel may be mediated through vpac1 receptors which are coupled to gq/11.67,69 however there is no clear study of ion channels regarding how vip and pacap can induce hyperpolarization . Also, no study has shown what types of cells (icc or pdgfr cell) are mediated by peptidergic inhibitory responses . In conclusion, it is not clear what types of receptors, ion channels and cells stimulated by enteric motor neurons are involved in post - junctional responses . Studies with animal models (e.g., w / w, ws / ws and sl / sl etc) suggested that specialized cells are involved in post - junctional responses . Thus it is possible that neurotransmitters and possibly peptides can bind to the receptors in these specialized cells, generate electrical events and conduct these electrical events to the smc . Three types of cells (smc, icc and pdgfr cell) can be candidates in response to neurotransmitters and neuropeptides . Many studies in tissue experiments have relied on pharmacology . Many receptor antagonists and this non - specificity can be solved by direct investigation of functional expression of ion channels in these cell types . Since there was only a limited approaches to isolate and separate the specialized cells (e.g., icc and pdgfr cell), the characterization of ionic conductance(s) in smcs has been studied extensively . Characterization of the ion channels in these cells activated by neurotransmitters and neuropeptides will elucidate new concepts of electrophysiology of gi smooth muscle . Finally we have to consider the difference of electrical responses in the human gi smooth muscle . Although many transgenic animals will be generated and developed for the future, studies on ionic conductance activated by transmitters or peptides using human smooth muscle should be emphasized.
|
One of the main responsibilities of acute pain services (apss) is the provision of effective and safe postoperative pain relief . An unexpected or unintended event under anesthesia care, which causes or has the potential to lead to negative effects on the outcome if left to progress . In our hospital voluntary, anonymous reporting of anesthesia related critical incidents in the operating room was initiated in 1996 . Since then, regular evaluation of the reported incidents is performed . Accordingly, strategies and guidelines have been made for prevention of recurrence of such events, and anesthesia - related critical incident reports have also been published . Reporting of incidents related to acute pain management has not been practiced in a similar manner in our department . Incidents that are detected by aps members during rounds have been dealt with on the spot and feedback provided to the concerned personnel accordingly . However, since the incidents were not formally reported and evaluated, there was no record of how often similar incidents recurred . Furthermore, the frequency of the more serious incidents could not be identified and taken up for making guidelines . To address this issue, we initiated the process of reporting of critical incidents and errors identified by our in - hospital aps . In this article, we present prospectively collected data on the incidents / errors detected and reported by aps . The aps team comprises two consultants, one fellow, one resident (rotational), and three pain nurses . Regular morning, afternoon, and evening rounds are conducted by the rotating resident and pain nurse covered by a consultant . Patients receiving continuous epidural infusions, intravenous (iv) patient controlled analgesia (pca), and continuous iv opioid infusions are followed up by aps . Similar to the definition of critical incidents related to pain management described by chen et al ., we defined an incident related to pain management as an incident that occurs in a patient receiving pain management supervised by aps, and causes or has the potential to cause harm to the patient or affect his safety and well - being . All members of aps were encouraged to report critical incidents related to acute pain management . Data were collected on all incidents picked up and reported from january 1, 2012 to september 30, 2013 . Standardized incident reporting forms were filled out anonymously and were filed in a designated folder, which was kept in a safe locker . The incident was reported in detail with the description of the event, its severity, personnel involved, whether any harm was caused to the patient, and steps taken to rectify the problem . The incidents were evaluated in the pain group meetings to develop improvement strategies for the identified problems ., chicago, il, usa) was used to generate frequencies and percentages for all categorical variables including adjustments made by aps to rectify the identified issues . During the data collection period, 2042 patients received pain management that was supervised by aps and 442 incidents (21.64%) were reported . These incidents were reported in 350 patients, as there were a number of patients in whom more than one incident had been reported at different points in time . However, we analyzed each incident independently and anonymously and grouped and categorized them according to the nature of the incident . The incidents included documentation errors by nursing staff or physicians, noncompliance with protocols for epidural catheter fixation and iv line for pca, wrong combination of drugs, simultaneous administration of two different formulations of same or similar drug group, premature discontinuation of prescribed analgesic modality by the surgical team, prolonged delays in change of syringes for pca or iv infusion, administration of contraindicated drugs, accidental epidural catheter pull - outs, and faulty equipment . Categories of the reported incidents during the study period along with their frequencies are shown in figure 2 . Prescription of contraindicated drugs included nonsteroidal anti - inflammatory drugs prescribed to four patients with deranged renal function and three asthmatic patients and regular paracetamol prescribed to two patients with deranged liver functions . Different pain relief modalities employed in patients followed up by acute pain service during the study period (n = 2042) categories and number of incidents reported by acute pain service during the study period (n = 442) subtypes of the four main categories of incidents reported by acute pain service during the study period the steps taken to rectify the errors included immediate feedback to the concerned team, ensuring correct documentation through audits, discontinuation of wrongly prescribed drugs, and conduct of formal teaching sessions for nurses and trainees . Despite strict adherence to policies and procedures and awareness of safe practices, errors and mishaps can still occur . Aps must be vigilant in detecting and identifying critical incidents and must promote their reporting to ensure continuous quality improvement and safe practices . Review and analysis of the reported incidents should be carried out on a regular basis to rectify the problems and prevent recurrence of similar events . At our institution, the highest number of reported incidents was for documentation errors, mainly by the surgical ward nurses who monitor postoperative patients receiving epidural infusions, iv pca, and continuous opioid infusions by recording hemodynamic variables, and scores for pain, motor block, sedation, nausea, and vomiting according to clearly defined scoring systems and fill out postoperative analgesia forms . The errors in documentation were picked up by aps team during rounds and included either incomplete documentation, with missing pain, nausea or sedation scores, or incorrect documentation, mainly depicting an absence of motor block where it was actually present or under - reporting of sedation scores . It is well - recognized that appropriate documentation can reduce health care errors, and it is recommended that patient care documentation should be timely, accurate, complete, clear, and consistent . Shortage of nursing staff and high workload is an ongoing issue at our hospital, further augmented by inexperience due to high turnover of staff . This highlights the importance of dedicated pain rounds by aps team in the provision of safe and effective pain relief . The aps members conduct regular teaching sessions for surgical ward nurses regarding documentation and monitoring of patients receiving epidural infusions, iv pca, and continuous opioid infusions . Detailed account of epidural analgesia and iv pca is available online including monitoring protocols for nurses . The documentation errors made by physicians involved failure of documentation by residents of the steps taken to treat unrelieved pain or manage side effects . This error could lead to repeat medication of drugs already been administered, especially at the time of changeover of teams . The faculty member - in - charge of quality assurance committee of the department now holds regular sessions on documentation for residents and conducts on - going audits to ensure completeness of documentation . Loss to follow - up occurred in 19 patients due to the failure of entry of patient's name in the aps register by the primary anesthesiologist . These patients were identified by aps team when the ward nurses contacted them regarding inadequate analgesia or side effects . Appropriate record keeping is being ensured through regular reinforcement through e - mail and discussion of the reported incidents in departmental meetings . The hand - over form used by aps at change - over of shifts has also been redesigned . Noncompliance with guidelines regarding epidural catheter fixation and iv line for pca was the next main category of incidents reported . Over the years, after several accidental epidural catheter pull - outs, aps has made clear protocols for fixation of epidural catheters and arranged for a special locking device for this purpose . In the present data, accidental catheter pull - out was seen in 6 patients . Guidelines for catheter fixation had not been followed in all of these 6 cases . Since the introduction of guidelines for catheter fixation and regular teaching of anesthesia trainees and nursing staff regarding catheter care, especially during patient transfer, the frequency of catheter pull - outs has decreased from 3.8% to 1.35% in our institution since the last reported frequency in 2010 . Similarly, after facing iv line related issues, with several complaints of prolonged stoppage of pca, maintenance of dedicated iv lines for pca was made mandatory . Despite this, several incidents were reported on noncompliance with these guidelines . The primary goal of making clinical guidelines is to improve the quality of care, hence adherence to guidelines is important to enhance efficiency, accountability, and professionalism . Since the availability of iv paracetamol at our hospital, aps team has identified and reported several incidents of simultaneous administration of two different formulations of paracetamol, e.g., regular iv paracetamol prescribed along with oral preparations containing paracetamol in combinations with other analgesics, like nuberol . If the incidents had not been identified, the total dose of paracetamol would have exceeded the recommended 24 h dose limit for paracetamol . High doses of paracetamol can lead to hepatic damage even in patients with previously normal liver functions . It was reported by aps that in 74 cases during the study period the surgeons discontinued the prescribed analgesic modality without consulting aps; in 30 cases this was done as early as the morning of the first postoperative day . On inquiry, the main concern of these surgeons was that their plan of early mobilization of the patients would be hindered by epidurals, pca, and opioid infusions and therefore they preferred their patients to be on intermittent boluses of analgesics . The aps team usually discusses the issue with the concerned surgeon and ensures that adequate analgesia is continued until required . Lectures on postoperative pain management by a consultant anesthesiologist have now been incorporated in the core curriculum of all surgical and medical training programs . Prolonged delay in change of syringes in patients receiving pca and continuous infusions was a cause of break - through pain and complaints in 27 patients . Identification of this has led to the development of processes, with the cooperation of the pharmacy department, for online ordering and identification of personnel responsible for prompt delivery of prefilled analgesic syringes . Identification and reporting of prescriptions of contraindicated drugs are highly important in enhancing patient safety and was discovered and reported in nine cases during the study period . Faulty equipment was reported in two cases, pca device in one and an epidural infusion pump in one case . Coordination with the bioengineering department is an essential requirement of aps to ensure timely repair . Effective postoperative pain management requires teamwork and cooperation among anesthesiologists, surgeons, and nurses . The initiation of incident reporting mechanism in acute pain management has helped us in identifying and addressing the weak points in the link . The limitation of this study is that all incidents were identified and reported by aps members . It is hoped that dissemination of our results would raise awareness and initiate voluntary reporting by all staff involved in caring for postoperative patients . Regular incident reporting and analysis guides aps in making standards and guidelines for establishing safer practices by identifying events that may otherwise remain undiscovered and cause harm to patients . We recommend that all apss should implement a system of critical incident reporting in accordance with the available resources.
|
The reported rates range from 4% to 18%, with highest prevalence observed in people with temporal lobe seizures . Antipsychotic - induced seizures appear to be relatively uncommon in patients lacking risk factors, however, they have been found to induce electroencephalographic (eeg) abnormalities resembling seizure activities at rate that far exceeds the frequency of actual antipsychotic induced seizures . The majority of antipsychotics can reduce the seizure threshold and the risk is dose related . Zotepine (2-chloro-11-(2-dimethyl - aminoethoxy) dibenzo [b, f] thiepin) is an atypical antipsychotic with molecular weight of 331.86, structurally similar to the phenothiazines and clozapine . It has been found to be effective in management of both positive and negative symptoms of schizophrenia with beneficial effect on cognitive symptoms and its efficacy has been demonstrated in few open label clinical trials including treatment resistant schizophrenia . The fatal adverse events observed with zotepine were neuroleptic malignant syndrome, abnormal ecg, paralytic ileus, and convulsive seizure (s). Zotepine induced seizure has been only published in few case reports and discrete occasional observational studies and none so far from india . We report myoclonic seizure progressing to generalized tonic - clonic seizures with clear temporal association of dose dependent modulation occurring with zotepine . A 22-year - old, right handed male with premorbid schizoid traits without significant past or family history of mental illness presented with an insidious onset, gradually progressive continuous course of four years duration of disabling symptoms characterized by delusion of control, delusion of persecution, auditory hallucinations (commenting and commanding type), anger outbursts and violent behaviour, mannerism, regressed behaviour, social withdrawal, poor personal care, decreased sleep, and appetite associated with severe socio - occupational dysfunction . There was no history of other schneiderian first rank symptoms, substance use or abuse, suicidal attempt or ideations, affective symptoms, head injury, learning disability, epilepsy or neurodegenerative disorder . He was treated with adequate trial of trifluperazine, chlorpromazine, risperidone, olanzapine and aripiprazole since last three years with electroconvulsive therapy cycles (12 effective ect's). Clozapine could not be built - up because he had persistent history of development of agranulocytosis even with 25 mg initiation (total leukocyte count was 2500/cc mm) and associated anemia (hemoglobin 7.2 gm%). He was prescribed zotepine 50 mg per day, which was gradually increased every week by 50 mg, till 350 mg per day . His liver function tests were monitored for transaminase levels and were found to be within normal limits . He showed moderate improvement in the psychotic symptoms by week 8 (panss score in all three dimensions showed significant change from baseline by week 8). The dose was raised from 300 to 350 mg per day (in view of residual auditory hallucinations and off and on anger outbursts against parents). On 49th day on zotepine he developed paroxysms of sudden, brief and jerky muscle contractions involving right more than left upper extremities followed by tonic contraction of muscles throughout the body that typically continued for 20 - 30 seconds followed by clonic phase which had lasted for about a minute . He was found to be in a state of flaccid, unresponsiveness with stridorous breathing and involuntary passage of urine . The eeg showed paroxysms of repetitive, generalized high amplitude discharges associated with muscle artefact followed by slow spikes [figure 1]. The dose of zotepine was reduced to 300 mg per day . For the next week he remained seizure free and however he began complaining of hearing of third person voices; which were not present with higher dose of zotepine . He was re - hospitalized for a brief duration and the dose of zotepine was again increased to 350 mg / day, four hours later patient again suffered another episode of myoclonic jerks; followed by tonic - clonic convulsions and post - ictal confusion . The eeg concomitantly showed generalized, transient, repetitive paroxysms of high amplitude spikes and polyspikes followed by slow waves . The dose of zotepine was reduced to 300 mg per day and clobazam 20 mg per day was added . Distraction techniques along with cognitive remediation were taught to patient to deal with intractable auditory hallucination . Patient has been seizure free since last four months and clinically better in both positive and negative symptoms . Eeg showing repetitive, generalized paroxysms of high amplitude discharges followed by slow wave pattern associated with muscle artifact suggesting myoclonic type of epileptiform discharges convulsions are a well - known with antipsychotic drugs . The incidence of first unprovoked seizure with antipsychotics is estimated to be 0.073% to 0.086% almost similar to that of the general population 0.037% and as general rule, the more sedating the antipsychotic, the more likely it is to induce seizures . Seizures were reported most commonly with clozapine, followed by chlorpromazine and olanzapine, while quetiapine was least likely to cause convulsion data on zotepine induced seizure is scarce and mostly reported from japan and european countries where it has been in use for almost two decades . In their landmark observational study hori et al ., evaluated 129 schizophrenic patient who were receiving zotepine and found that 22 (17.1% incidence) of them had developed grand mal seizures . Thus the index case is the first to reflect an additional myoclonic type of seizures with zotepine with subsequent progression to generalized tonic - clonic seizures clearly related to escalation of the dose . The seizure in our patient improved when the dose was decreased from 350 mg / day to 300 mg / day and reappeared again within 72 hrs when zotepine was increased to 350 mg/ day suggesting a temporal association . There was no apparent alternate cause other than increase in the dose of zotepine that could have caused the seizure as his repeat liver function tests including serum ammonia level were also normal . Further, the epileptiform activity was confirmed on eeg (as shown in figure 1). On naranjo adverse drug reaction probability scale, the total score was 9 out of 13 [table 1] which reflects the definite causal association naranjo causality scale this is in conformity with the study by hori et al ., who reported that zotepine induced seizure(s) were closely related to the dosage (above 325 mg / day) and the duration of use zotepine (mean duration is 48.1 days). Appropriate investigations ruled out any organic cause of the convulsions and zotepine was successfully continued (300 md / day) together with clobazam (20 mg / day). By the time the treatment was stabilized, these findings suggest that zotepine - induced seizures were phenomenologically identical to those occurring in juvenile myoclonic epilepsy and were classified as generalized epileptic seizures . They can be successfully treated and gradual dose titration can reduce the likelihood of further episodes of seizures . Also concomitant use of a suitable mood stabilizer or anti - epileptic medication can improve the outcome of treatment - resistant schizophrenia.
|
Hypovolemic shock, a condition in which tissue perfusion is disturbed to sustain aerobic metabolism, occurs due to improper low intravascular volume leading to decrease preload, stroke volume, and cardiac output [2, 3]. Hemorrhagic shock (hs) usually happens when trauma is accompanied with intense blood loss, and in such condition the management of the patients is complex and difficult [47]. Hs causes poor tissue oxygenation and accumulation of oxygen debt that can lead to multiorgan failure [8, 9] and increases the morbidity rate . On the other hand the kidney function directly depends on renal perfusion pressure (rpp) and this organ is particularly sensitive to hs . Hs exacerbates renal damage via decreasing oxygen delivery to the kidney induced hypoxia [1214] which induces acute kidney injury (aki). Renin angiotensin system (ras) has a pivotal role in kidney function, and it adjusts the body fluid and blood pressure [18, 19]. This system shows both roles of vasoconstriction and vasodilation in kidney and systematic vascular bed, which depend on angiotensin converting enzymes 1 and 2 (ace1 and ace2) levels [20, 21]. Angiotensin (ang) i is hydrolyzed to ang ii via ace, while hydrolysis of ang ii by ace2 generates ang1 - 7 that subsequently acts upon the mas receptor [22, 23]. Ang1 - 7 stimulates nitric oxide (no) production that may or may not depend on the release of bradykinin [24, 25]. It may also act directly via increasing of prostaglandins to exert the vasodilatory and natriuretic actions . Acute infusion of ang1 - 7 increases the glomerular filtration rate (gfr) and renal blood flow (rbf), and it is reported that, in preconstricted afferent arterioles of the rabbit kidney, ang1 - 7 induces vasodilation depending on no . Due to limited use of hypertonic solution in hs, we hypothesized that ang1 - 7 administration may promote renal hemodynamic parameters after hs . To test this hypothesis, the rbf responses to ang1 - 7, sodium chloride hypertonic solution, or combination of both ang1 - 7 plus hypertonic solution compared with vehicle infusion this study was approved in advance by the ethics committee of the isfahan university of medical sciences . 27 male wistar rats weighting 230 to 270 g from water and electrolyte research center animal house were used . The animals were housed at a room temperature of 24 1c with a 12-hour light / dark cycle and fed with rat chow and water ad libitum and allowed 1 week to acclimatize to these conditions . Animals were placed in lateral position on a surgical table with heating lamp to control body temperature between 36.5 and 37.5c . The left jugular vein was exposed, ligated distally, and cannulated with polyethylene tube to infuse the solutions . The left femoral artery was catheterized and the catheter was driven forward into the abdominal aorta below the renal arteries to measure direct blood pressure . The femoral catheter was attached to a pressure transducer and a bridge amplifier (scientific concepts, vic ., melbourne, australia) to measure mean arterial pressure (map) (in fact, we considered renal perfusion pressure as map). In order to induce hs, the left kidney was exposed and placed in a cup secured to the operating table . The left renal artery was surrounded by a transit - time ultrasound flow probe (type 2sb; transonic systems, ithaca, ny, usa) interfaced with a compatible flowmeter (t108; transonic systems) to measure direct rbf . Throughout the experiment map and rbf were measured continuously and data were recorded as two - second averages via a data acquisition system . After 30-minute stabilization period, rats underwent controlled hs at map 45 mmhg for a period of 45 minutes . Blood withdrawal was carried out in two phases: blood was withdrawn first in 10 min to stabilize map at 45 mmhg and second when map> 45 . The total blood volume withdrawn was measured, and the animals were randomly assigned into the following treatment groups . Group 1 (n = 7) as control was subjected to treatment with vehicle (saline). Groups 2 (n = 6), 3 (n = 9), and 4 (n = 5) as treated groups received ang1 - 7 (300 ngkg in saline), ang1 - 7 in hypertonic sodium chloride 7.5% (5 ml / kg), and hypertonic solution alone . The dose of ang1 - 7 (300 ng / kg) was selected based on previous studies to have at least 10 percent change in renal blood flow [28, 29]. The prepared volume of the each infused fluid was equal to the volume of blood withdrawal during hs . Animals were monitored for another 15 min after infusion, and map and rbf were measured continuously as described above . The data for map, rvr, and rbf were corrected for kidney weight before induction of the hs as basal measurement is tabulated in table 1 . The animal weights were recorded as 223.0 8.4, 243.2 11.9, 232.5 3.6, and 228.4 8.2 g, and the volumes of blood withdrawal to induce hs were 3.0 0.25, 3.3 0.20, 3.5 0.19, and 3.4 0.26 ml in groups 1 to 4, respectively . There is no statistical difference between the groups in weight (p = 0.36) and blood volume withdrawal (p = 0.37). As blood volume was withdrawn, map reduced to about 45 mmhg to induce hs . This pressure was controlled at constant level during 45 min of shock by blood withdrawal . Map and rbf responses to vehicle, ang1 - 7, ang1 - 7 plus hypertonic solution, and hypertonic solution alone infusion are shown in figure 1 . Map and rbf were increased by all the treatment solutions significantly (ptime <0.0001). Rbf response to ang1 - 7, ang1 - 7 plus hypertonic solution, and hypertonic solution alone were statistically different from that in vehicle treated group (p = 0.05). For example at 5 min after infusion, the rbf response to ang1 - 7, ang1 - 7 plus hypertonic solution, and hypertonic solution alone were 1.36 0.25, 1.37 0.23, and 1.37 0.14 ml / min / g tissue while this response to vehicle administration was 0.56 0.12 ml / min / g tissue (p <0.05). Rvr response during 30 min of shock could not be determined due to the lowest rbf . However, postinfusion records indicated that rvr response in vehicle treated group was greater than other groups insignificantly (p = 0.27). During post shock, from starting of infusion until end of experiment the result indicated that the urine responses to ang1 - 7 infusion were statistically greater than saline group (p <0.05) (figure 2). To consider nitrite level, no significant differences were observed between the groups neither before nor after the treatments . Low cardiac output and map are considered as predictors of poor outcome in patients which reduces rbf and disturbs kidney functions [30, 31]. Restoration of the hemodynamic status is pivotal for rbf recovery after hs . In this study, rbf responses to ang1 - 7, ang1 - 7 plus hypertonic solution and hypertonic solution alone were statistically different from that in vehicle treated group while there was a tendency for increasing map in response to hypertonic solution groups more than ang1 - 7 and vehicle treated groups . In addition, coadministration of ang1 - 7 and hypertonic solution did not result in a synergistic effect on rbf compared to administration of ang1 - 7 or hypertonic saline alone . It is expected that both saline and hypertonic solutions produce plasma expansion, blood pressure, and gfr elevation . The suitable map level is pivotal to preserve renal function, and at a specific level of map, rbf decreases and causes aki . However, the exact minimum level of map to prevent the kidney disturbance still remains unknown . It is reported that map above 65 mmhg might be necessary to prevent aki . Patients with low map who also received the highest doses of vasopressors are significantly linked to aki occurrence . The vasodepressor effect of ang1 - 7 mediated by prostaglandins and no [3638], and ang1 - 7 and its signaling pathways may antagonize the actions of angii type 1 receptor [39, 40]. One point is important here; the lower concentrations of ang1 - 7 are required to stimulate no compared to that for ang ii acting via the ang ii type 2 vasodilatory receptor [4143]. Acute administration of ang1 - 7 enhances gfr and rbf that reflects the vasorelaxant properties . Ang1 - 7 also shows the ability to stimulate the formation of no [44, 45], and it stimulates the phosphorylation of enos and the associated kinase akt in endothelial cells . In addition and similar to bradykinin, ang1 - 7 shows a pathway that releases no, and the vasorelaxant actions of ang1 - 7 may be reflected by the release of vasoactive prostaglandins, prostacyclin, and pge2 . It was also reported that the systemically hypotensive effectiveness of ang1 - 7 administration was greater in spontaneously hypertensive and renovascular hypertensive than normotensive animal models [37, 48, 49]. It is reported that ang1 - 7 receptor antagonist (a779) decreased no concentration to restore the risen vasopressin levels during hemorrhagic shock, and it also interacts with the vasopressin v2 receptor . In addition ang-(1 - 7) as a potent antidiuretic peptide [52, 53] also influences water excretion possibly by effect on vasopressin system . Our data from serum nitrite level did not support no formation by ang1 - 7 administration; however it still seems that ang1 - 7 increased rbf via formation of no [44, 45] possibly within the kidney . Our result also did not show the synergistic effect from ang1 - 7 plus hypertonic solution because hypertonic solution is liable for large transcapillary absorptive forces which exert maximum intravascular volume expansion immediately at the end of infusion to increase map, organ flow, and urine output . Map elevation by hypertonic solution may increase vascular resistance as nakamoto et al . Reported that hypertension is accompanied with increase of vascular resistance by no - dependent mechanism created through vascular endothelium, and this phenomenon may limit the production of no by ang1 - 7 . Ang1 - 7 potentially could increase rbf and urine output due to rvr decreasing after hs . However increased map by isotonic normal saline containing ang1 - 7 after hs is not similar to sodium chloride hypertonic solution.
|
Since the advent of nanotechnology, nanoscale particle - based sensors have attracted tremendous attention from scientists, because of their unique optical and electrical properties.14 localized surface plasmon resonance (lspr), which is recognized as one of the special optical properties of noble metallic nanoparticles (eg, silver or gold), is generated when the incident photon frequency is resonant with the collective oscillation of conduction electrons.5 the lspr biosensor, a novel type of optical fiber - based biosensor, uses an optical fiber or optical fiber bundle to transform biological recognition information into analytically useful signals in the lspr spectrum, and has been proven to be an effective platform for detection techniques.5,6 the sensing principle is based on its sensitivity to local refractive index changes near the nanoparticle surface induced by biomolecular interactions.58 the applicability of this nanobiosensor has been studied in many fields, such as drug screening, medical diagnostics, and environmental monitoring, and has become a hot research topic all over the world.913 the detection of biotin - streptavidin and microalbumin in patients urine using the proposed domestic lspr biosensor has been reported previously, without quantitative analysis.14,15 however, to date, this biosensor has not been widely utilized in the field of gynecological oncology . Ovarian cancer is one of the most common malignancies of the female reproductive system . According to the american cancer society, ovarian cancer accounts for about 4% of cancers occurring in women, but ranks fourth among the cancer - related deaths in women, because most cases are unfortunately diagnosed at an advanced stage.16 currently, ca125 is the only biomarker of ovarian cancer that is most widely and routinely used in clinical practice . However, the clinical use of ca125 as a marker for early detection is severely restricted, because it is elevated in only half of early - stage ovarian cancers and is elevated frequently in many benign gynecological diseases, such as endometriosis, ovarian cysts, and pelvic inflammation.17,18 recently, the human epididymis secretory protein 4 (he4), which is a novel biomarker for ovarian cancer, has been widely studied and used in the early diagnosis of ovarian cancer . Reportedly, he4 is highly sensitive to early ovarian cancer and can be used in combination with ca125, offering the best method of differential diagnosis in ovarian cancer and other pelvic masses.1921 currently used approaches for detection of he4 are the enzyme - linked immunosorbent assay (elisa) and the chemiluminescent immunoassay (clia). Although it is one of the most mature methods for protein detection used in the last three decades and is considered the gold standard, elisa still has certain shortcomings in terms of the long assay time required, the indirect detection format, and the need for multiple washing steps.22 clia also has some disadvantages, including the large volume of the analysis instrument, high cost, and special labeling requirements . Thus, a rapid, label - free, simple, low - cost, and portable protocol for detecting he4 is urgently required . In the present work, the lspr biosensor developed was utilized based on silver nanoparticles for the direct detection of the he4 biomarker in blood samples from patients with ovarian cancer . Under the optimum conditions, he4 in both buffer and human serum samples based on current information, this study is the first to investigate the lspr system for the detection of he4 . The study is also the first to discuss and analyze in detail the detection limit, linear range, and regeneration of the proposed homemade lspr sensor . 11-mercaptoundecanoic acid and bovine serum albumin were purchased from sigma - aldrich (st louis, mo). N - hydroxysuccinimide and 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (edc) were purchased from aladdin (shanghai, china). Mouse monoclonal anti - he4 antibody (anti - he4) and standard he4 were obtained from abnova (taiwan, china). An he4 elisa kit was obtained from fujirebio diagnostics inc (malvern, pa). Ultrapure water (18.3 m/cm) used for the preparation of all solutions was obtained from millipore co (boston, ma). The human serum specimens were collected from west china second university hospital (chengdu, china). Written informed consents were not obtained, because these samples were from leftover blood samples in routine blood tests, and this study did not cause any harm to the patients . Sera were isolated through the centrifugation of whole blood samples at 2000 rpm for 20 minutes, and subsequently kept frozen at 80c until analysis . The integrated lspr biosensor used in this work was a custom system built on - site, as previously described in detail.14,23 the silver nanochip was fabricated using the nanosphere lithography method . The peak wavelength of the lspr extinction spectrum (max) excited by the silver nanoparticles was measured and recorded using an ultraviolet - visible spectroscope (sciencetech 9055, sciencetech, ottawa, canada) with a charge - coupled device detector (koan electro - optics co, shanghai, china).14 the entire measurement process could be described as follows . The white light emerging from an optical fiber bundle and the transmitted light coupled into the detection probe of the optical fiber bundle provided the incident light . The nanochip was placed perpendicular to the incident light, which was taken using the ultraviolet - visible spectrometer ranging from 400 nm to 800 nm at room temperature in air.14 all the extinction spectra could be calculated through a software program (ocean optics, dunedin, fl) and directly displayed on the screen of the computer . The shift toward longer wavelengths, defined as a red shift, was indicated as (+), whereas the shift toward shorter wavelengths, defined as a blue shift, was indicated as (). The relative wavelength shift, namely max, was used to monitor the binding of target analytes.13 the experimental setup is illustrated in figure 1 . Functionalization is a multistep process that prepares the lspr nanosensor for biodetection events (figure 2). First, the silver nanochip was incubated in 1 mm 11-mercaptoundecanoic acid solution (in ethanol) for 12 hours to form a self - assembled monolayer on the slice surface, after which the nanochip was washed thoroughly with ethanol and dried at room temperature . The nanochip was then immersed in 75 mm edc/15 mm n - hydroxysuccinimide solution for 2 hours to activate the carboxyl groups of the self - assembled monolayer, which reacts with amino groups of antibodies to form amides . Subsequently, 50 l of anti - he4 solution at 10 g / ml was spotted on the self - assembled monolayer - modified surface and overnight incubation at 4c followed . The anti - he4 immobilized surface was immersed in 1 m ethanolamine solution (ph 8.5) for 30 minutes to deactivate the unreacted esters, after which the surface was washed with phosphate - buffered solution (ph 7.4) and dried . The different concentrations of standard he4 (1 pm to 0.1 m) and the patient samples were incubated on the functionalized lspr chip for 40 minutes, followed by a thorough rinsing with phosphate - buffered solution containing 0.05% tween-20 to dissociate the nonspecific binding . Each value was averaged from three parallel experiments . A statistical evaluation of the correlation of the lspr and elisa methods was performed and computed using a software program (origin 8.0, originlab corporation, northampton, ma). 11-mercaptoundecanoic acid and bovine serum albumin were purchased from sigma - aldrich (st louis, mo). N - hydroxysuccinimide and 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (edc) were purchased from aladdin (shanghai, china). Mouse monoclonal anti - he4 antibody (anti - he4) and standard he4 were obtained from abnova (taiwan, china). An he4 elisa kit was obtained from fujirebio diagnostics inc (malvern, pa). Ultrapure water (18.3 m/cm) used for the preparation of all solutions was obtained from millipore co (boston, ma). The human serum specimens were collected from west china second university hospital (chengdu, china). Written informed consents were not obtained, because these samples were from leftover blood samples in routine blood tests, and this study did not cause any harm to the patients . Sera were isolated through the centrifugation of whole blood samples at 2000 rpm for 20 minutes, and subsequently kept frozen at 80c until analysis . The integrated lspr biosensor used in this work was a custom system built on - site, as previously described in detail.14,23 the silver nanochip was fabricated using the nanosphere lithography method . The peak wavelength of the lspr extinction spectrum (max) excited by the silver nanoparticles was measured and recorded using an ultraviolet - visible spectroscope (sciencetech 9055, sciencetech, ottawa, canada) with a charge - coupled device detector (koan electro - optics co, shanghai, china).14 the entire measurement process could be described as follows . The white light emerging from an optical fiber bundle and the transmitted light coupled into the detection probe of the optical fiber bundle provided the incident light . The nanochip was placed perpendicular to the incident light, which was taken using the ultraviolet - visible spectrometer ranging from 400 nm to 800 nm at room temperature in air.14 all the extinction spectra could be calculated through a software program (ocean optics, dunedin, fl) and directly displayed on the screen of the computer . The shift toward longer wavelengths, defined as a red shift, was indicated as (+), whereas the shift toward shorter wavelengths, defined as a blue shift, was indicated as (). The relative wavelength shift, namely max, was used to monitor the binding of target analytes.13 the experimental setup is illustrated in figure 1 . Functionalization is a multistep process that prepares the lspr nanosensor for biodetection events (figure 2). First, the silver nanochip was incubated in 1 mm 11-mercaptoundecanoic acid solution (in ethanol) for 12 hours to form a self - assembled monolayer on the slice surface, after which the nanochip was washed thoroughly with ethanol and dried at room temperature . The nanochip was then immersed in 75 mm edc/15 mm n - hydroxysuccinimide solution for 2 hours to activate the carboxyl groups of the self - assembled monolayer, which reacts with amino groups of antibodies to form amides . Subsequently, 50 l of anti - he4 solution at 10 g / ml was spotted on the self - assembled monolayer - modified surface and overnight incubation at 4c followed . The anti - he4 immobilized surface was immersed in 1 m ethanolamine solution (ph 8.5) for 30 minutes to deactivate the unreacted esters, after which the surface was washed with phosphate - buffered solution (ph 7.4) and dried . In the detection stage, the different concentrations of standard he4 (1 pm to 0.1 m) and the patient samples were incubated on the functionalized lspr chip for 40 minutes, followed by a thorough rinsing with phosphate - buffered solution containing 0.05% tween-20 to dissociate the nonspecific binding . Each value was averaged from three parallel experiments . A statistical evaluation of the correlation of the lspr and elisa methods was performed and computed using a software program (origin 8.0, originlab corporation, northampton, ma). The lspr spectra of the nanobiosensor in each processing step are shown in figure 3 . Before modification, the lspr max of the bare silver nanochip a representative lspr max of the silver nanochip after modification with 11-mercaptoundecanoic acid was 619.85 nm with a corresponding lspr max of + 27.27 nm (figure 3b). After anti - he4 immobilization, the lspr max shifted to 630.97 nm, with an additional 11.12 nm red shift (figure 3c). After incubation in 500 pm he4, the lspr wavelength shifted to + 14.48 nm, showing a max of 645.45 nm (figure 3d). This experimental evidence clearly showed that he4 in the buffer solution was detected successfully by the lspr biosensor . The optical characteristics of the nanosensor are notably based on the wavelength shift of the absorbance peak, max . According to mie theory, therefore, the change in the local refractive index that accompanies the molecular binding can be sensed by the nanoparticles, and the quantitative detection of targets can be achieved by monitoring the max when the analytes are bound to the nanoparticles.10 figure 4 shows a calibration curve of the nanosensor constructed by measuring the lspr wavelength shifts after exposure of the anti - he4 attachment surface to the he4 standard solutions of concentrations ranging from 1 pm to 0.1 m under optimal conditions . As seen from the data, the lspr max values increased stepwise with increasing he4 concentrations . Like many immunoassays, the curve is sigmoid rather than linear.25 in addition, a good linear relationship between the lspr shifts and the logarithm of the he4 concentration could be fitted to the experimental points from 10 pm to 10,000 pm (inset of figure 4). The linear regression equation was lspr (nm) = 3.72 log [he4] (m) + 47.37, with a linear correlation coefficient (r) of 0.997 . This linear range is broader than that of the commercial he4 elisa kit (15 pm to 900 pm), indicating that it is capable of testing the samples without predilution which could not be confirmed through a routine elisa . Given that the noise level is defined as the standard deviation of the blank (n = 12), the limit of detection, defined as the analyte concentration corresponding to a signal - to - noise ratio of three (about 5 nm), was estimated to be 4 pm . This limit of detection was more than sufficient for analysis of he4 in serum where normal values of he4 are considered to be less than 150 pm.26 this detection limit is a little better than that obtained using the elisa method for he4 (15 pm). Therefore, the lspr biosensor had good analytical performance for the detection of he4, and was comparable with elisa . Several control experiments were designed to ensure that the results of figure 4 were not disturbed by nonspecific adsorption . Squamous cell carcinoma (scc) antigen, another tumor marker and bovine serum albumin, the most abundant protein component in blood serum were chosen as interferences . The functionalized biosensor was incubated with a solution of 500 pm scc or bovine serum albumin . The same concentration of he4 was also introduced to the nanosensor surface in the absence of anti - he4 . Thus, the nonspecific binding of protein molecules on the self - assembled monolayer - covered nanosensor was found to be relatively low . The results indicated that the selectivity of the lspr biosensor based on the highly specific antigen - antibody reaction and surface passivation with ethanolamine was excellent . The precision within and between batches is an important factor in the practical application of the biosensor.25 the intrarun precision was tested at two he4 concentration levels (500 pm and 5000 pm) using the lspr biosensors of the same batch for five continuous measurements within one day . The interrun precision was tested similarly with five biosensors, which were selected randomly from five batches . The results in table 1 suggest that the nanobiosensor showed acceptable precision and reproducibility . Following completion of the antigen - antibody reaction, the nanochips were regenerated via exposure to 8 m urea solution, and then washed with ultrapure water . The reproducibility of responses from the identical biosensor and from different biosensors was evaluated by measuring 500 pm standard he4 solution, and the coefficient of variation for the lspr shift was obtained . After performing the corresponding he4 incubation with the freshly regenerated biosensor four times, a coefficient of variation of 14.7% was obtained, as shown in table 2 . This value indicates that the anti - he4-modified sensor can provide reliable detection of he4 . The biosensor stored in the refrigerator at 4c was regenerated and observed every week for one month . After one, 2, 3, and 4 weeks, the extent of response for 500 pm he4 dropped by 2.30%, 7.21%, 9.66%, and 17.09%, respectively, compared with the initial signal . This drop in response seems to be related to gradual deactivation of the anti - he4 antibody . The silver surface is susceptible to oxidative damage, which could directly affect the stability of the lspr sensor . However, the nanochips were stable in air after chemical modification through to the end of the 4-week study . A series of ten human serum samples, five from the ovarian cancer group and five from the control group, were screened for serum he4 levels using the proposed lspr sensor and an elisa kit . According to the literature, the cutoff value for he4 with 98% specificity is 150 pm.26 therefore, a sample was defined positive when its concentration was more than 150 pm . The five ovarian cancer samples with red shifts ranging from 11 nm to 17 nm were shown to be positive . Meanwhile, red shifts less than 10.5 nm were observed in the negative controls . Thus, consistent results were achieved between the lspr and elisa methods in terms of semiquantitative analysis . Based on a t - test, differences in he4 levels between the ovarian cancer group and the control group detected were statistically significant (p <0.05) using both lspr and elisa . Furthermore, the lspr sensor could specifically distinguish between ovarian cancer and the negative controls without the need for labeling in response to he4 binding in the sera tested . The lspr biosensor clearly has good specificity that cannot be disrupted by other proteins or components in serum . The concentration of the ten samples was found to be within the range of 11.39911.16 pm, which was also within the linear range of the lspr sensor . A comparison between the two methods of analysis was also done using the regression line method.27 the results are shown in figure 5 . The analytical curve was calibrated using the correlation equation, ie, y = 83.88x 677.07, with a correlation coefficient of 0.926 . The results indicate that the lspr biosensor could serve as a good alternative to the laborious and time - consuming elisa method for direct detection of he4 . Moreover, the technological barrier regarding transfer of bench research to clinical application was overcome to a certain extent . In terms of product commercialization, serum he4 can be detected in real time using an antibody - coated lspr sensor within 40 minutes without predilution, thereby reducing the chance of potential procedural errors . The lspr spectra of the nanobiosensor in each processing step are shown in figure 3 . Before modification, the lspr max of the bare silver nanochip a representative lspr max of the silver nanochip after modification with 11-mercaptoundecanoic acid was 619.85 nm with a corresponding lspr max of + 27.27 nm (figure 3b). After anti - he4 immobilization, the lspr max shifted to 630.97 nm, with an additional 11.12 nm red shift (figure 3c). After incubation in 500 pm he4, the lspr wavelength shifted to + 14.48 nm, showing a max of 645.45 nm (figure 3d). This experimental evidence clearly showed that he4 in the buffer solution was detected successfully by the lspr biosensor . The optical characteristics of the nanosensor are notably based on the wavelength shift of the absorbance peak, max . According to mie theory, therefore, the change in the local refractive index that accompanies the molecular binding can be sensed by the nanoparticles, and the quantitative detection of targets can be achieved by monitoring the max when the analytes are bound to the nanoparticles.10 figure 4 shows a calibration curve of the nanosensor constructed by measuring the lspr wavelength shifts after exposure of the anti - he4 attachment surface to the he4 standard solutions of concentrations ranging from 1 pm to 0.1 m under optimal conditions . As seen from the data, the lspr max values increased stepwise with increasing he4 concentrations . Like many immunoassays, the curve is sigmoid rather than linear.25 in addition, a good linear relationship between the lspr shifts and the logarithm of the he4 concentration could be fitted to the experimental points from 10 pm to 10,000 pm (inset of figure 4). The linear regression equation was lspr (nm) = 3.72 log [he4] (m) + 47.37, with a linear correlation coefficient (r) of 0.997 . This linear range is broader than that of the commercial he4 elisa kit (15 pm to 900 pm), indicating that it is capable of testing the samples without predilution which could not be confirmed through a routine elisa . Given that the noise level is defined as the standard deviation of the blank (n = 12), the limit of detection, defined as the analyte concentration corresponding to a signal - to - noise ratio of three (about 5 nm), was estimated to be 4 pm . This limit of detection was more than sufficient for analysis of he4 in serum where normal values of he4 are considered to be less than 150 pm.26 this detection limit is a little better than that obtained using the elisa method for he4 (15 pm). Therefore, the lspr biosensor had good analytical performance for the detection of he4, and was comparable with elisa . Several control experiments were designed to ensure that the results of figure 4 were not disturbed by nonspecific adsorption . All the experiments were implemented in triplicate . Squamous cell carcinoma (scc) antigen, another tumor marker and bovine serum albumin, the most abundant protein component in blood serum were chosen as interferences . The functionalized biosensor was incubated with a solution of 500 pm scc or bovine serum albumin . The same concentration of he4 was also introduced to the nanosensor surface in the absence of anti - he4 . Thus, the nonspecific binding of protein molecules on the self - assembled monolayer - covered nanosensor was found to be relatively low . The results indicated that the selectivity of the lspr biosensor based on the highly specific antigen - antibody reaction and surface passivation with ethanolamine was excellent . The precision within and between batches is an important factor in the practical application of the biosensor.25 the intrarun precision was tested at two he4 concentration levels (500 pm and 5000 pm) using the lspr biosensors of the same batch for five continuous measurements within one day . The interrun precision was tested similarly with five biosensors, which were selected randomly from five batches . The results in table 1 suggest that the nanobiosensor showed acceptable precision and reproducibility . Following completion of the antigen - antibody reaction, the nanochips were regenerated via exposure to 8 m urea solution, and then washed with ultrapure water . The reproducibility of responses from the identical biosensor and from different biosensors was evaluated by measuring 500 pm standard he4 solution, and the coefficient of variation for the lspr shift was obtained . After performing the corresponding he4 incubation with the freshly regenerated biosensor four times, a coefficient of variation of 14.7% was obtained, as shown in table 2 . This value indicates that the anti - he4-modified sensor can provide reliable detection of he4 . The biosensor stored in the refrigerator at 4c was regenerated and observed every week for one month . After one, 2, 3, and 4 weeks, the extent of response for 500 pm he4 dropped by 2.30%, 7.21%, 9.66%, and 17.09%, respectively, compared with the initial signal . This drop in response seems to be related to gradual deactivation of the anti - he4 antibody . The silver surface is susceptible to oxidative damage, which could directly affect the stability of the lspr sensor . However, the nanochips were stable in air after chemical modification through to the end of the 4-week study . A series of ten human serum samples, five from the ovarian cancer group and five from the control group, were screened for serum he4 levels using the proposed lspr sensor and an elisa kit . According to the literature, the cutoff value for he4 with 98% specificity is 150 pm.26 therefore, a sample was defined positive when its concentration was more than 150 pm . The five ovarian cancer samples with red shifts ranging from 11 nm to 17 nm were shown to be positive . Meanwhile, red shifts less than 10.5 nm were observed in the negative controls . Thus, consistent results were achieved between the lspr and elisa methods in terms of semiquantitative analysis . Based on a t - test, differences in he4 levels between the ovarian cancer group and the control group detected were statistically significant (p <0.05) using both lspr and elisa . Furthermore, the lspr sensor could specifically distinguish between ovarian cancer and the negative controls without the need for labeling in response to he4 binding in the sera tested . The lspr biosensor clearly has good specificity that cannot be disrupted by other proteins or components in serum . The concentration of the ten samples was found to be within the range of 11.39911.16 pm, which was also within the linear range of the lspr sensor . A comparison between the two methods of analysis was also done using the regression line method.27 the results are shown in figure 5 . The analytical curve was calibrated using the correlation equation, ie, y = 83.88x 677.07, with a correlation coefficient of 0.926 . The results indicate that the lspr biosensor could serve as a good alternative to the laborious and time - consuming elisa method for direct detection of he4 . Moreover, the technological barrier regarding transfer of bench research to clinical application was overcome to a certain extent . In terms of product commercialization, serum he4 can be detected in real time using an antibody - coated lspr sensor within 40 minutes without predilution, thereby reducing the chance of potential procedural errors . Ideal biosensors should be rapid, sensitive, specific, label - free, stable, reproducible, cheap, portable, and easy to operate . 28 the lspr technique has many of these characteristics, making this method comparable with other immunoassay techniques . The lspr biosensor has significant advantages in terms of label - free biomarker detection, a rapid test time, and in a direct assay format unlike the traditional immunoassay approaches, such as elisa . Compared with chemiluminescence analysis and current commercial surface plasmon resonance sensors, the lspr sensor has outstanding features, including miniaturization, portability, and low cost . A custom - built lspr system was used for the first time in medical diagnostics in the field of gynecological oncology . The experiments described in this study demonstrate that a label - free lspr technique could serve as a very effective alternative to the label - based conventional elisa method . Furthermore, direct detection of protein targets in human serum, which retains the native specific properties of antibodies or proteins without complicated procedures, makes the lspr method a very attractive strategy for cancer biomarker studies . Future studies need to be performed to construct a serum calibration curve . A large, randomized, case - controlled clinical study can be used to evaluate the applicability of this biosensor in medical diagnostics for tumors such as ovarian cancer . The lspr biosensor is anticipated to be a promising platform for point - of - service medical diagnostics and should rival the commercially available instruments.
|
Optical coherence tomography (oct) is a noninvasive technique that provides high - resolution images of the macular layers.1 pars plana vitrectomy (ppv) with silicone oil (sio) tamponade has been used for complicated retinal detachment (rd) with proliferative vitreoretinopathy (pvr) and proliferative diabetic retinopathy (pdr).24 sio is subsequently removed before the occurrence of complications, such as dense complicated cataracts, secondary glaucoma, keratopathy, and emulsification.59 however, other complications such as epiretinal membrane (erm), macular holes, macular edema, sensory detachment, and thinning of the retinal layers can clinically be easily missed . These complications, if present, can affect visual outcome, and some of them require modification of the surgical maneuver during the removal of sio.59 few studies have used oct as a routine tool to assess the macula before the removal of sio . Oct can be used in sio - filled eyes to examine the posterior segments when the media are clear.10 we set out to evaluate the role of preoperative oct in the detection of macular changes when used routinely before the removal of sio . This study was a cross - sectional study performed between july 2011 and september 2014 . The research ethics committee, faculty of medicine, ainshams university (fmaus rec) approved the protocol of this study from the ethical point of view . Different indications including pvr b and c, pdr, penetrating trauma, uveitis, recurrent rd, giant retinal tears (grt), and macular holes . Plan for the removal of sio with or without phacoemulsification to be performed 612 months after primary surgery . An opthalmological examination including indirect ophthalmoscopy, slit lamp biomicroscopy, and preoperative and postoperative visual acuity was carried out on all eyes . Examination using oct (ziess cirrus, software version 4.5; carl zeiss meditec ag, jena, germany) was performed for the macular area by scanning across a series of six radiating cross - sectional b scans of 6 mm with the center of each scan placed at the center of the fovea using a fast macula map including central macular thickness . Macular gube-5 raster lines were used in the eyes with neurosensory rd and erm with traction . Macular edema was defined as increased retinal thickness calculated with an oct algorithm at the central fovea between the inner retinal surface and the retinal pigment epithelium . Patients with significant cataracts underwent microcoaxial phacoemulsification using an infiniti machine (alcon laboratories, inc ., fort worth, tx, usa). All patients had standard three - port sclerotomies in the pars plana, 3.5 mm from the limbus . Endoillumination using the halogen light of a constellation vitrectomy machine (alcon laboratories, inc .) Was used to examine the macular region after the removal of sio . The macular pathology found in the oct examination eyes with macular edema needed pharmacotherapy, and eyes with macular rd needed drainage of subretinal fluid . All eyes were refracted to achieve the best - corrected visual acuity (bcva) after 4 weeks . Statistical analysis was performed to evaluate oct findings in correlation with preoperative fundus appearance, surgical findings, and visual outcome . The following formula was used for sample calculation: 2()27.9(10)2(1) an adequate sample should be at least 40 eyes . Data were collected, coded, revised, and entered into the statistical package for social science (spss) version 20 . Qualitative data were presented as number and percentages and compared using the chi - square test . Quantitative data were presented as means, standard deviations, and ranges and compared using an independent t - test . Confidence intervals were set to 95%, and the margin of error accepted was 5% . Different indications including pvr b and c, pdr, penetrating trauma, uveitis, recurrent rd, giant retinal tears (grt), and macular holes . Plan for the removal of sio with or without phacoemulsification to be performed 612 months after primary surgery . An opthalmological examination including indirect ophthalmoscopy, slit lamp biomicroscopy, and preoperative and postoperative visual acuity was carried out on all eyes . Examination using oct (ziess cirrus, software version 4.5; carl zeiss meditec ag, jena, germany) was performed for the macular area by scanning across a series of six radiating cross - sectional b scans of 6 mm with the center of each scan placed at the center of the fovea using a fast macula map including central macular thickness . Macular gube-5 raster lines were used in the eyes with neurosensory rd and erm with traction . Macular edema was defined as increased retinal thickness calculated with an oct algorithm at the central fovea between the inner retinal surface and the retinal pigment epithelium . Patients with significant cataracts underwent microcoaxial phacoemulsification using an infiniti machine (alcon laboratories, inc ., fort worth, tx, usa). All patients had standard three - port sclerotomies in the pars plana, 3.5 mm from the limbus . Endoillumination using the halogen light of a constellation vitrectomy machine (alcon laboratories, inc .) Was used to examine the macular region after the removal of sio . The macular pathology found in the oct examination eyes with macular edema needed pharmacotherapy, and eyes with macular rd needed drainage of subretinal fluid . All eyes were refracted to achieve the best - corrected visual acuity (bcva) after 4 weeks . Statistical analysis was performed to evaluate oct findings in correlation with preoperative fundus appearance, surgical findings, and visual outcome . The following formula was used for sample calculation: 2()27.9(10)2(1) an adequate sample should be at least 40 eyes . Data were collected, coded, revised, and entered into the statistical package for social science (spss) version 20 . Qualitative data were presented as number and percentages and compared using the chi - square test . Quantitative data were presented as means, standard deviations, and ranges and compared using an independent t - test . Confidence intervals were set to 95%, and the margin of error accepted was 5% . Of those patients, 20 (41.6%) were females and 28 (58.4%) were males . Preoperative oct examination of the macula showed macular edema in 14 eyes (27.5%); this was diabetic macular edema (figure 1) in seven eyes (13.7%) and cystoid macular edema (cme) in seven eyes (13.7%; figure 2). Cme was present in five out of fifteen (33.3%) of pvr eyes, one of grt eyes, and one out of four uveitic eyes (25%). Diabetic macular edema was found seven out of twelve (58.3%) of pdr eyes . Erms were detected by oct in 21 eyes (41.2%); this included fine erm in 13 eyes (25.5%; figure 3) and erm with traction in eight eyes (15.7%; figure 4). Neurosensory rd was found in seven eyes (13.7%; figure 5), macular thinning was found in seven eyes (13.7%; figure 6), and macular holes were found in five eyes (9.8%; figure 7). Emulsification of sio at the macula was detected by oct in two eyes (4%; figure 8), and one eye (2%) had a subretinal band (figure 9). Overall, abnormal oct findings were present in 45 eyes (88.2%) and normal oct findings were found in six eyes (11.8%; figure 7; table 2). Clinically, normal macula were seen in 22 eyes (43%) before the removal of sio . Preoperative oct examination of these eyes with clinically normal macula was normal in only four eyes (18%). Table 3 shows the abnormalities detected by preoperative oct in those eyes with clinically normal macula . The difference in the detection ability was highly significant (p<0.001; table 4; figure 10). Mean logmar after the removal of sio was 0.35 (20/45 snellen s acuity) in eyes with preoperative normal oct . It was 1.22 (20/380 snellen s acuity) in eyes with abnormal oct before the removal of sio . Oct findings were less than expected from clinical examination in three of 51 eyes (5%; figure 12). Surgical findings during the removal of sio corresponded to preoperative oct examination in 37 of 51 eyes (72.5%). Details of the surgical findings corresponding to preoperative oct in each subgroup are described in table 6 . Surgical plans during the removal of sio were changed based on preoperative oct findings in 38 of 51 eyes (74.5%). Details of the changes in surgical plans for pvr and pdr eyes are described in table 7 . In trauma, grt, macular holes, and recurrent detachment, the surgical plan was changed in 100% of eyes with abnormal oct results . Oct operates through a mechanism similar to ultrasonography by replacing ultrasound waves with infrared waves.1 it provides higher resolution images than ultrasonography . This enables oct to assess sio and detailed macular pathology in eyes with clear media.11 we included eyes that needed sio tamponade for 612 months because of their complicated rd . Our concern was the ability of oct to detect macular pathological changes in the presence of sio and its correlation to clinical and surgical findings . They included fewer eyes (n=28), and details of some examples of the cases were described . However, the study concluded that systematic use of oct was useful in recognizing retinal changes . Avitabile et al13 found that the presence of sio does not affect measurements of foveal thickness during oct . They excluded eyes with macular holes and erm and performed oct only 3 months after sio injection . We compared the abnormal findings in the macula detected during clinical examination of the fundus to those detected by preoperative oct . Numbers of pathological macular changes detected by oct were highly significantly greater than those detected by a clinical fundus examination . No previous studies had compared preoperative oct findings to clinical findings . Some of the findings detected by preoperative oct examination could not be detected during surgery for the removal of sio . This included macular edema in 27.5% of all eyes and macular atrophy in 13.5% of all eyes . Macular edema was the most common abnormality in all eyes (27.5%) and in eyes with clinically normal macula under sio removal (22.7%). This means there is difficulty in clinical detection of macular edema in the presence of sio . In pvr eyes theses findings raise the question about the value of pharmacotherapy under sio . In our study we found that oct examination before the removal of sio helped to predict visual outcome . We found a highly significant difference in visual outcome in eyes with normal oct compared with eyes with abnormal oct before the removal of sio (p<0.001). The difference in the visual outcome is explained by the fact that findings detected by oct affect postoperative visual prognoses . Accordingly, oct examination can partially explain visual loss not related to cataractogenesis - associated sio . Avitable et al13 similarly found that postoperative bcva was significantly correlated to increased and decreased foveal thickness as assessed by oct, compared to eyes with normal thickness . However, they measured bcva in the presence of sio, so it could have been affected by cataract or glaucoma . They only correlated bcva to thickness, while we correlated bcva to all oct abnormalities . We noted that intraoperative findings during the removal of sio were identical to preoperative oct examination in 72.5% of all eyes . Surgical plans were changed from simple removal of sio to the addition of other steps in 74.5% of all eyes according to preoperative oct examination . In this study, these included macular edema treated by pharmacotherapy (figure 13) in 13.5% and macular sensory neural detachment in 2% . Accordingly, implementation of oct may help in making earlier decisions for the removal of sio to manage underlying macular pathologies for the prevention of visual loss . This may be induced by affection of macular microcirculation due to sio that was reported by a laser scanning study.14 three eyes (6%) had highly elevated macula by oct . 100% had surgical findings corresponding to oct and the surgical decision was changed in 73% . Findings were related to pvr in 60% of the eyes (erm in 40% and macular this was different from our prevalence because this study was dependent on a fundus examination for detection of erm and used oct only to confirm clinical diagnosis of erm . It also reported only eyes that needed surgical intervention to remove erm; 15% of the eyes in our study required surgical removal . This means that the attachment of the retina and sio injection did not stop the process of pvr . In pdr, 41% of the eyes had surgical findings corresponding to oct, while in 75% of the eyes, there was modification of the surgical plan including pharmacotherapy . Messmer et al16 reported the recurrence of erms as being significantly associated with poor vision following ppv for pdr and sio injection . This study specifically focused on eyes with tractional rd . In eyes with penetrating trauma, 62% had erm and 37% had rd . This was similar to the incidence of rd after ppv (41%) reported in a study for penetrating trauma for intraocular foreign bodies . This is explained by our detection using oct, while the comparative study17 did not use oct . In grt, 66% had surgical findings corresponding to oct and related to the original disease . Another study18 reported postvitrectomy cme in 11% and rd in 7% of the eyes.18 they included a greater number of eyes (n=28). They also included more eyes (n=51) but did not use oct to examine the macula postoperatively . We suggest that performing noncontact oct before the removal of sio is important . It helps to predict visual outcome, which we found was related to cataract density and macular pathologies detected by oct . It helps to change the surgical plan of the removal of sio to manage treatable macular pathologies . It also helps to detect macular edema and thinning that could not be detected intraoperatively . This procedure should be performed routinely before the removal of sio whenever the media allow . We recommend the removal of sio earlier whenever possible before the development of dense cataracts that prevent oct performance as a baseline care . There was a wide spectrum of diagnoses before the use of an sio tamponade, including pvr, pdr, recurrent rd, trauma, uveitis, and grt.
|
Today, clinical research is strongly regulated with the aim of ensuring that clinical trials are well designed and conducted in an ethical manner . In europe, several guidelines, directives and regulations pertaining to clinical trials have been released by the european parliament, council and commission [13]. One in particular, directive 2001/20/ec, establishes specific provisions regarding the conduct of clinical trials of medicinal products on human subjects and recognises the principles of good clinical practice . In line with this, many medicines have been developed based on the results of well - designed, randomised, controlled clinical trials, and these treatments are currently used in a range of patient groups, offering considerable clinical and economic utility in healthcare . That said, however, it is widely acknowledged that not all patients respond in the same way to a given therapy and, as a result, the current methodological approach will require updating in future to take account of individual patient characteristics . For many adult and some childhood conditions, biomarkers that reliably reflect inter - individual variability in disease expression and that also correlate with or predict outcomes have already been discovered among the genes, mrna, proteins and metabolites found in the body . Polymorphisms in the human leukocyte antigen (hla), for example, have been identified as risk factors for severe adverse drug reactions (adrs): these include the association between hla - b*1502 and carbamazepine - induced skin necrolysis and stevens johnson syndrome, as well as the association between hla - b*5701 and hypersensitivity reactions to the hiv drug, abacavir [5, 6]. Screening for both of these alleles is recommended before starting the respective treatment and, in the case of hla - b*5701, screening prior to abacavir initiation has been suggested to produce cost savings [6, 7]. In future, it is expected that such biomarkers will be detected more readily thanks to the new high - throughput technologies and powerful analytical approaches employed within the fields of pharmacogenomics, proteomics, metabolomics and other so - called omics. This type of genetic knowledge may ultimately be included within the drug development process where biomarkers will serve as identifiers of treatment response . As a result, it will become important to include population screening early in the clinical trial development phase in order to establish which subpopulations receiving an experimental drug are most / least likely to benefit from, or to experience adverse reactions associated with, that treatment . Refinement of this approach will lead to more targeted patient recruitment and should reduce the likelihood of new therapies failing at the clinical trial stage . Most importantly, it should reduce the risk of unsuccessful treatments or undesired secondary adverse effects in clinical practice . Whether pharmacodiagnostic (theranostic) applications can simplify the selection of drugs for clinical testing, and help to develop more focused clinical trials that provide enhanced knowledge about the effects of a drug in humans within shorter time frames, are currently being explored by various organisations such as the national institutes of health (nih). The use of biomarkers as indicators of genetic factors affecting drug response is of particular interest for children . Historically, despite the need for treatments for conditions affecting children, for ethical, economic and methodological reasons, there have been few clinical trials in young populations [9, 10]. As a result, off - label drug use in paediatric patients has been relatively common [9, 11, 12]. An example of this is the fact that metabolic capacity is different in children and adults . Hepatic glucoronidation activity of the udp - glucuronosyltransferase (ugt) family of enzymes that are needed for the elimination of certain xenobiotic and endogenous substances, for instance, is lower in children than adults which may have implications for drug detoxification . Ugt activity towards bilirubin at birth, for example, is approximately 1% of the level observed in adults, although activity increases rapidly and reaches levels equivalent to those in adults 14 weeks after birth . Total ugt activity has been reported to develop to adult levels by 20 months of age; however, that age at which enzymes reach adult levels of activity may not be universally indicative of in vivo drug clearance . This study showed that intrinsic hepatic clearance of the antipsychotic drug trifluoperazine did not appear to reach adult levels until 18.9 years of age despite ugt being maximally active well before this time . These types of infancy / childhood - specific developmental changes are clearly complex and likely underlie some of the variability in drug response seen in neonates and children . Failing to take the potential impact of these differences on drug action into account places children at risk of adrs . In recent years there has in fact been a rise in the number of paediatric drug safety and efficacy studies, as well as changes in drug labelling for young patients that show unique paediatric doses are often necessary [17, 18]. Furthermore, some diseases that occur in children either do not develop in adults or have a different effect / prevalence in adults, making it necessary to develop drugs specifically for children . Despite the clear need for individualised medicine for paediatric patient populations, we still know very little about developmental pharmacogenomics and there have been few applications of biomarkers in the management of paediatric disease . Results of a literature search conducted by the task force in europe for drug development for the young (teddy) european network of excellence demonstrated that throughout the world more than 50% of pharmacogenomic / pharmacogenetic research activities in children during the last 10 years were related to predisposition, which means the investigation of the correlation between genetic traits and the probability of or susceptibility for a given pathology or disease . These types of exploratory studies provide little or no insight into mechanisms of disease or drug action, and their results cannot be used to improve medical practice or to support therapeutic solutions . Only a small number of polymorphisms that are linked to therapeutic response have been studied in children and, even when studies demonstrate an impact on treatment response, their use in clinical practice remains limited . This is highlighted by the fact that very few fda drug label amendments for pharmacogenomic testing refer to paediatric populations . A major consideration that has arisen from analyses of publications on pharmacogenetics and pharmacogenomics is that studies often show contradictory or inconsistent results . This is particularly the case for studies in paediatric populations which, by definition, generally have limited patient numbers . A systematic review and field synopsis of pharmacogenetic studies in general that was conducted in 2009 suggested that the limited translation of pharmacogenetic research into practice may be explained by the preponderance of reviews over primary research, small sample sizes, a mainly candidate gene approach, the use of surrogate markers, an excess of nominally positive or truly positive associations and paucity of meta - analyses . The small sample sizes, coupled with the more frequent evaluation of common rather than rare variants, the use of surrogate outcome measures rather than more clinically relevant outcomes, and subgroup analysis with multiple hypothesis testing, suggest that only a proportion of the positive associations reported are in fact genuine . Clear analysis of the situation is further complicated by the use of different research methods across studies, the lack of both standardised outcome measures and study replication, and the low level of consideration given to potential covariates such as co - morbidities . Other investigators have similarly raised concerns about the need to improve the quality of studies and prevent false - positive associations . In conclusion, while the new omics techniques offer great promise for the identification of biomarkers of drug response, these studies are subject to many of the same pitfalls that apply in general to paediatric and other clinical trials . Notwithstanding the limited experience and considerations above, some exciting examples of the usefulness of biomarkers in clinical practice can be derived from recent published literature . Childhood disorders in which pharmacogenetic studies have most commonly been conducted include acute lymphoblastic leukaemia, attention deficit hyperactivity disorder, growth hormone deficiency, juvenile idiopathic arthritis, atopic dermatitis and asthma (see [19, 22, 23] for reviews). A good example of a childhood condition where there will be benefits from the use of pharmacogenetics is acute lymphoblastic leukaemia (all). Current treatment for patients with all results in event - free survival greater than 75% for most patients; however, approximately 25% fail to respond to treatment . One of the reasons for treatment failure is the development of toxicity due to the absence or presence of only low levels of enzymes that metabolise chemotherapies . Thiopurines (azathioprine, mercaptopurine and thioguanine), for example, are often used to treat all and their safety has been shown to be related to thiopurine methyltransferase (tpmt) genotype . Genotypes resulting in reduced tpmt enzyme activity have been shown to be associated with dose - related side effects / toxic events to thiopurines in children with all [2527]. Thus, tpmt genotype may be used to help choose the appropriate dose of thiopurine for an individual child . In the us, the drug labels for azathioprine and 6-mercaptopurine now give the fda recommendation for tpmt testing . Although this biomarker is not yet reliably assessed in children within europe, because tpmt - deficiency can now be easily detected, this knowledge should lead to improvements in the safety of treatment in children receiving thiopurine chemotherapy . The recent publication of clinical pharmacogenetics implementation consortium guidelines for tpmt genotyping and thiopurine dosing may also facilitate the routine incorporation of tpmt genotyping in clinical practice for paediatric patients receiving these compounds . There are several pharmacogenomic / pharmacogenetic networks already in existence that aim to help collect, coordinate or communicate information about genetic determinants of drug response . In europe, for example, there is the european network for pharmacogenetics (http://www.epr-network.org/), in the us there is the nih pharmacogenomics research network (http://www.nigms.nih.gov/initiatives/pgrn), in canada, the canadian pharmacogenomics network for drug safety (cpnds), and there is also the international hapmap project (http://hapmap.ncbi.nlm.nih.gov/) that represents a partnership of researchers and funding agencies from several countries . Each of these networks is distinct; however, the activities of the cpnds illustrate how the establishment of networks may play an important role in the development of personalised medicine . The cpnds is an active surveillance network that collects information on adrs, and operates predominantly within canadian paediatric teaching hospitals [9, 29]. The aim of the network is to improve drug safety by identifying genetic markers that can predict which patients are likely to experience specific serious adrs, as well as those who may experience decreased therapeutic response to a drug . To help determine the role of genetic variations in the development of adrs, the network has created a database of clinical adrs and a bio - bank of dna and other samples . Among other examples, this approach has already proven useful by contributing to the development of a research protocol to validate reports of a potential association between genetic variations in enzymes in the cyp and ugt families in breastfeeding women taking codeine and the development of codeine - induced central nervous system (cns) depression in their babies . The development of databases containing information about genomic positions and bio - banks containing tissue samples from large numbers of individuals also make it possible to conduct genome - wide association studies [19, 31]. Rather than selecting candidate genes, this type of investigation can look at thousands of single nucleotide polymorphisms across the genome in one investigation which may represent an important approach for studying complex, common diseases where multiple genetic variations may contribute to drug response . As mentioned previously, despite the fact that many biomarkers are currently available for use within the clinical research setting, few have been integrated into paediatric clinical practice . In addition, the validation process of such markers in children remains an issue . As a consequence, it is important to encourage the establishment of paediatric bio - banks, as well as the connection of existing bio - banks through intelligent informatics platforms in order to share data, integrate results and promote the use of biomarkers in drug development and clinical trials . Furthermore, the uptake of biomarkers within the drug development process requires investment and research on the part of the pharmaceutical industry . As of 2007, very few pharmaceutical companies indicated ongoing pharmacogenomic or pharmacogenetic - related research in children . However, more recently an investigation performed by tufts suggests a growing interest and investment in this area . Their report shows that 12%50% of current clinical pipelines of the companies interviewed involve personalised medicines . Thus, although at present paediatric drug development and utilisation cannot benefit fully from pharmacogenetic / pharmacogenomic findings there is hope for the future . Particular actions that have to be undertaken in order to reduce the existing gaps include: the identification of the most promising research approaches for use in paediatric populations from among those based on omics sciences; the development of model - based methodologies for clinical trials in children based on the use of omics-derived biomarkers; the initiation and completion of pilot studies designed with the goal of developing paediatric personalised medicines in a specific sector such as oncology, respiratory disease, neurodegenerative disease or infective disease . The identification of the most promising research approaches for use in paediatric populations from among those based on omics sciences; the development of model - based methodologies for clinical trials in children based on the use of omics-derived biomarkers; the initiation and completion of pilot studies designed with the goal of developing paediatric personalised medicines in a specific sector such as oncology, respiratory disease, neurodegenerative disease or infective disease . The development of personalised medicine is of relevance for all paediatric patient groups, and in particular for those populations that are generally deprived of drugs when the traditional clinical trial approach is applied . Examples of populations for whom the personalised medicine approach will be particularly important are neonates and children with rare diseases . In the european union (eu), a rare disease is defined as one that affects fewer than five people per 10,000 . Most of these conditions are genetically inherited and, importantly, many develop during childhood . Although individually uncommon, collectively there are thousands of rare diseases, making them an important group of disorders that affect a large number of patients throughout europe . In the context that we have so far identified somewhere in the region of 5,0008,000 distinct rare diseases, between 27 and 36 million people in the eu could be affected (6%8% of the population), making the management of these conditions an important issue . For these reasons, the eu takes the position that rare diseases are a serious public health concern and should be a priority in eu health and research programmes . Although neurodegenerative diseases are most prevalent in the elderly, in rare cases they also affect individuals early in life . In children, neurodegeneration leads to severe mental retardation and premature death with devastating consequences on their immediate environment . These conditions also have relatively high costs for society . In total, there are thought to be about 600 different genetically inherited metabolic diseases, approximately 400 of which involve the cns with differing degrees of severity and rates of degeneration . Lysosomal storage diseases (lsds) are a subgroup of approximately 40 of these metabolic disorders that affect about one in 7,500 newborns [34, 35], although more recently a combined incidence as high as one in 5,000 newborns has been suggested . The proportion of patients diagnosed with different lsds in australia between 1980 and 1996 is shown in fig . 1 . These conditions are caused by the lack of certain (lysosomal) enzymes or lysosome components, thus preventing the complete degradation of macromolecules and the recycling of their components . As a result of the failure to degrade these molecules, intermediate degradation products begin to accumulate within the cells, affecting the function of lysosomes and other cellular organelles . The accumulation of these proteins starts immediately after birth and continues throughout life, often altering the structure and impairing the function of several organs, including the cns (fig . 2). Cns pathology causes mental retardation and progressive neurodegeneration that ultimately ends in early death of these young patients [3741]. Fig . 1proportion of patients diagnosed with different lysosomal storage diseases (lsds) in australia between 1980 and 1996 . More than ten patients were identified for 18 of the 27 lsds diagnosed during this period . Based on data from meikle et al . . Images include brain scans showing: a atrophy with enlarged virchow robin spaces and ventricles, b communicating hydrocephalus, and c spinal cord compression at the cervical junctions . Other images show d corneal clouding, e larynx thickening, f valvular alterations due to the accumulation of undegraded substrates, and g i dysostosis multiplex of back bone, hand and long bones proportion of patients diagnosed with different lysosomal storage diseases (lsds) in australia between 1980 and 1996 . More than ten patients were identified for 18 of the 27 lsds diagnosed during this period . Based on data from meikle et al . . Mps i, mucopolysaccharidosis type i impact of the accumulation of undegraded proteins in lysosomal storage diseases . Images include brain scans showing: a atrophy with enlarged virchow robin spaces and ventricles, other images show d corneal clouding, e larynx thickening, f valvular alterations due to the accumulation of undegraded substrates, and g i dysostosis multiplex of back bone, hand and long bones our understanding of the pathogenesis of the lsds has grown dramatically over the last 1020 years and there is already a strong community supporting research and scientific developments in this area, which includes physicians, researchers, patient advocates and industry . Thanks largely to advances in cellular and molecular biology, and the incentives for drug development provided by the introduction of the orphan drug regulation in europe, we are now moving closer to being able to provide therapies for neurological signs and symptoms in patients with these conditions . The advanced state of knowledge of the mechanisms of action of lsds, in particular, is allowing the elucidation of features of neurodegenerative diseases that will most likely also prove to be useful in the study of more prevalent neurodegenerative diseases that predominantly affect the elderly (e.g. Alzheimer s and parkinson s diseases). Furthermore, secondary events that lead to neurodegeneration (e.g. Brain inflammation, alteration of intracellular trafficking, impairment of autophagy, or oxidative stress) are common to both paediatric and adult neurodegenerative diseases (for a review see) therefore, at least some of the observations relative to loss and recovery of brain plasticity in paediatric neurodegeneration can be extrapolated to adult disorders, and findings will provide unique insights into the pathophysiology and restorative capacities of neurodegenerative diseases in general . In fact, suppressing the primary cause of neurodegeneration (e.g. By supplementing the missing enzyme) in a young brain has the potential to maximise benefit as the brain retains considerable plasticity at this stage of development . There are several factors that make the lsds good candidates for pharmacogenetic studies and personalised medicine . The first is that the genetic basis of most of these conditions is well defined; they are monogenic disorders and many disease - causing mutations have already been characterised . Although these mutations are often private, they all result in reduced enzyme levels and storage to varying degrees . Despite a current general lack of awareness of these conditions among physicians which can lead to delayed diagnosis, there is the potential for pre - symptomatic diagnosis and, in many cases, prenatal diagnosis [4244]. This means that once biomarkers that predict therapeutic response have been identified, it will be possible to initiate the appropriate treatment at an early stage of disease . Furthermore, for many of the lsds there is some overlap in the pathways that are involved in the degradation of the proteins that accumulate, making it likely that any biomarkers discovered may apply in more than one condition . Another factor is that patients show considerable phenotypic variability (even those with the same underlying genetic mutation) and there is similarly variation between individuals in terms of response to therapy . At present, many different therapeutic approaches have been proposed including replacement of the missing enzyme (enzyme replacement therapy, ert), reduction of levels of the enzyme substrate (substrate reduction therapy, srt), the use of chemical chaperones to stabilise existing but unstable enzyme (chaperone therapy), bone marrow transplantation, and gene therapies [4547] (fig . 3). Based on current knowledge, predicting which patients will respond to which treatment remains a challenge . 3routes of intervention for the treatment of patients with lysosomal storage diseases routes of intervention for the treatment of patients with lysosomal storage diseases in order to make personalised medicine for children with rare neurological disorders a reality it is necessary to refine the techniques used to ensure that therapy gains access to the cns . Although it is known which enzyme deficiency causes each of the lsds, supplying a correct version of the affected lysosomal enzyme intravenously only allows for modification of the natural history of these diseases in the peripheral organs (e.g. Liver, spleen, joints, etc . ). The reason for this is that the therapeutic enzyme molecules used in ert are too large to cross the blood brain - barrier which protects the brain by allowing only those molecules required naturally by the cns to pass into the brain from the peripheral circulation . Proposed methods to circumvent the blood brain - barrier in patients with lsds include the direct injection into the brain of either the recombinant enzyme itself or of gene transfer vehicles able to induce the synthesis of the enzyme in genetically deficient brain cells . Another approach is to inhibit enzymes early in the biosynthetic pathway of the accumulating protein(s) to reduce the number of molecules that require degradation in the lysosome . Small pharmaceutical molecules that are capable of crossing the blood brain barrier are used to achieve this . In cases where the affected lysosomal enzyme is present but does not function because it is unstable, small pharmaceutical molecules known as chemical chaperones that can cross the blood brain - barrier may be used to stabilise the enzyme, thus at least partially restoring its function . As the process of neurodegeneration observed in lsds is characterised by secondary events such as neuroinflammation, glutamatergic activation and oxidative stress, the use of small molecules with anti - inflammatory and/or neuroprotective properties may also be a useful adjunctive approach to treat lsds . To date, the utility of most of these approaches has already been demonstrated in animal models . Looking to the future, there is also a need to establish and validate biomarkers that will allow us to understand both disease pathophysiology and which patients are most likely to respond to the different therapies that are available . Although we are currently able to quantify the stored protein material and to assess changes in storage in response to treatment, in general, these variables have not proved to be reliable biomarkers for the lsds . Other candidate biomarkers are already under investigation . In the future, the availability of biomarkers other than the stored material, will allow the choice of the most appropriate therapy (ert, chaperone therapy or srt) when taking into account patient phenotype and expected disease severity and course of progression . Once a therapy is developed that can slow or prevent the progression of neurodegeneration, it will become extremely important to facilitate early detection of the genetic defect by newborn screening to enable early intervention . The development of new tools / technologies to diagnose patients and to predict disease severity and progression, as well as to assess new therapies, can be achieved only through collaboration between existing stakeholders . The first steps towards establishing a community to focus efforts on developing therapies for rare neurological diseases of childhood were taken in december 2010 at a meeting held at the european parliament in brussels . This meeting, which was organised by the brains for brain foundation [b4b (www.brains4brain.eu)], the european brain council (ebc), the lysosomal storage disease (lsd) patient collaborative and the veneto region, and sponsored by member of the european parliament, mrs amalia sartori (veneto, italy), brought together stakeholders from 13 eu countries, as well as the usa and brazil . Those registered for the meeting included 22 political representatives and members of 17 scientific organisations, 14 european family organisations, 10 biotechnology companies and over 40 european universities . The organisers called for a new initiative to coordinate the efforts of all existing groups in europe with the shared goal of improving the treatment and care of patients with rare neurological disorders . As commented in a recent editorial, there is a need for harmonised interaction between all stakeholders to enable the further development of personalised medicine . In line with this, the present project will unite all interested parties, who are working to increase the visibility, recognition and awareness of rare neurological disorders in order to facilitate early diagnosis of these conditions; to promote and facilitate partnership and collaboration between physicians, researchers, patient advocates, carers, policy- and decision - makers and industry; to encourage and support research and the translation of scientific breakthroughs into clinical practice; to contribute to the establishment of a standard of care for patients with rare neurological disorders which is agreed across europe; and to ensure equity of access to diagnosis, treatment and care . Achieving better and more predictable treatment outcomes offers benefits in terms of reducing unnecessary treatment and side effects and may ultimately lead to more cost effective healthcare . In order to progress the development of personalised medicine it is necessary for these benefits to be clearly demonstrated and for there to be buy - in and investment from all stakeholders, including the pharmaceutical industry, regulatory authorities and payers . The increasing incorporation of biomarkers within product pipelines is a sign of the growing interest of the pharmaceutical industry in this area . Nevertheless, there is still work to do in order to realise the potential of this approach and there remains a need for more examples that demonstrate proof of concept in clinical practice.
|
It is well known that early diagnosis and management of neonatal infection is mandatory for outcome . Clinical difficulties in identifying early the infection in neonates and also in discriminating between bacterial and viral aetiology have led to the evaluation of several biomarkers including hematologic parameters, acute phase proteins, chemokines, cytokines, and cell - surface antigens [1, 2]. However, none of the biomarkers of neonatal infection or sepsis assessed up to date has been shown to be ideal . The urokinase - type plasminogen activator receptor (upar), a membrane - linked receptor with extracellular protease activity that transduces intracellular signaling pathways, is expressed on the surface of several inflammatory cells, including neutrophils, lymphocytes, and monocytes, as well as on endothelial cells . It is the cognate receptor for urokinase - type plasminogen activator which is activated upon binding and involved in the conversion of plasminogen to the active fibrinolytic enzyme plasmin . After cleavage and release from the cell membrane, increased supar levels have been reported in several biological fluids including blood, urine, and saliva, as well as in cerebrospinal, pleural, pericardial, and peritoneal fluid [35], in response to a variety of infections in adults [68], and they correlate positively with the activation level of the immune system . In neonates, the properties of supar as a biomarker of infection are not known; to the best of our knowledge, the only information regarding supar in neonatal infections derives from one study aimed to identify by multiplexed immunoassay arrays differentially expressed serum proteins in clinically infected and noninfected preterm infants . The objective of the present study was to evaluate the clinical value of supar in the detection of neonatal infection or sepsis, discrimination between bacterial and viral infections, and monitoring the responsiveness to treatment . Criteria for eligibility in the study included: (1) term infant, (2) postnatal age between 4 and 28 days of life, (3) bacterial (confirmed by positive blood, urine, and/or csf culture) or viral infection (confirmed by detection of virus in biological fluids or highly probable viral infection suggested by accompanying symptoms, well - appearing, negative bacterial cultures, normal for age total leukocyte count / differentiation, and serum c - reactive protein [crp] values less than 10 mg / l). Exclusion criteria were as follows: (1) perinatal asphyxia, (2) antibiotic treatment in the last 10 days before admission, (3) surgery, and (4) positive culture(s) for staphylococcus epidermidis . On admission to our special care unit, all infected neonates underwent blood, csf, and suprapubic urine sampling for analyses and cultures; a small quantity of plasma (0.2 ml) was isolated within 30 min and stored at 80c for measurement of supar levels . Additional biological specimens including synovial fluid, stools, throat swabs, or nasopharyngeal secretions were also obtained if required according to the presenting symptoms . Following admission, blood samples were drawn from all infected infants at 24 hours, 48 hours, 35 days, and 710 days for routine blood tests (full blood count, renal and liver function, and serum crp levels), as well as for 0.2 ml plasma isolation and storing at 80c for supar levels determination . Plasma supar concentrations were finally measured in 47 infected neonates of mean sd gestational age 39.0 1.0 weeks, birth weight 3, 135 351 g, postnatal age 18 6 days, and male / female ratio 29/18, and in 18 healthy term infants who had similar gestational age (38.6 1.0 weeks), birth weight (3, 216 406 g), postnatal age (17 6 days), and gender distribution (11 males, 7 females) to those of infected infants, as controls . Five serial supar measurements were performed in each patient during the course of the disease, whereas supar plasma levels were determined only once in the control group along with full blood count, renal and liver function tests, and serum crp levels . In all infants studied, associations of supar concentrations on admission with clinical and laboratory parameters (leukocyte count and differentiation, platelet count, serum crp levels, renal and liver function) were assessed . Nineteen out of 47 infected neonates suffered from bacterial infections confirmed only by blood (n = 4), urine (n = 8), or csf (n = 1) cultures, or by both blood / urine (n = 4), blood / csf (n = 1), and blood / synovial the remaining 28 neonates had definite (n = 12) or probable (n = 16) viral infections (table 1) with no evidence of bacterial super - infection . The definite diagnosis of viral infections was performed by polymerase chain reaction (enterovirus, adenovirus), immunochromatographic tests (adenovirus or rotavirus in faeces) or direct immunofluorence in nasopharyngeal secretions (respiratory syncytial virus). Sepsis was defined according to the criteria established by the international pediatric sepsis consensus conference; evidence of systemic inflammatory response syndrome (sirs) in the presence of or as a result of suspected or proven infection was required . The children's hospital ethics committee approved the study and informed parental consent was also obtained . Hematologic parameters were measured using a siemens - advia 120 whole blood autoanalyzer (siemens healthcare diagnostics, tarrytown, ny, usa). Blood chemistry for renal and liver function was performed using the siemens advia 1800 clinical chemistry system (siemens healthcare diagnostics, tarrytown, ny, usa), whereas crp concentrations were determined with immunonephelometry using a beckman coulter immage immunochemistry system (beckman coulter, inc ., the intra- and interassay coefficients of variation (cvs) were 3.5% and 7.0%, respectively . For supar determination, plasma was isolated from edta - k3 anticoagulated blood samples of neonates following centrifugation at 3000 g for 10 minutes and stored at 80c until analysis . Plasma supar levels were determined using a commercial enzyme - linked immunosorbent assay (elisa) (suparnostic standard kit; virogates a / s, birkerd, denmark). This assay utilizes a double monoclonal antibody that measures all circulating supar, including full - length and cleaved forms of the receptor . According to the standards provided by the manufacturer in ng / ml, a curve was constructed by us and the results were expressed as ng / ml, in a range between 0.6 and 20.0 ng / ml . The intra- and interassay cvs ranged from 1.3% to 4.7% and 1.7% to 5.1%, respectively, whereas the sensitivity limit was 0.1 ng / ml . The sample size of the study was calculated using our preliminary results of plasma supar concentrations in infected and healthy neonates . Assuming an alpha risk of 0.05, a power of 0.80, and a bilateral test, it was estimated that 15 neonates was the minimum number of infants needed in each group to detect a significant difference of one sd in mean supar levels between infected and healthy infants . Values of supar were not normally distributed overall (kolmogorov - smirnov test), but the distribution was normal for neonates with infections (bacterial or viral) and controls separately . Comparisons of quantitative variables between more than two groups were conducted by anova with bonferroni post hoc analysis or by kruskal - wallis and mann - whitney u test, as appropriate . A one - way repeated measures anova was used to compare the values of supar with baseline (on admission) within the infected group, in bacterial and viral infections separately . Correlation (pearson's or spearman's correlation test, as appropriate) and regression analyses were used to examine relations among the variables of interest . The diagnostic properties of supar concentrations on admission were assessed by receiver operating characteristic (roc) analysis . All statistical analyses were performed using the spss statistical package (spss, version 19.0, chicago, il). Demographic, clinical characteristics, and laboratory findings including white blood cells (wbc), absolute neutrophil count (anc), immature neutrophil and platelet count, liver and renal biochemistry, serum crp, and plasma supar levels in infants with bacterial and viral infections, separately, on admission to the unit, as well as in controls, are shown in table 2 . Infants with bacterial infections did not differ significantly than infants with viral infections in gestational and postnatal age, birth weight, gender, duration of fever before admission, and maximum body temperature (table 2). The time for fever recession following admission was less than 36 hours in equal percentage (approximately 75%) of infants in the bacterial and viral infection group, but it was more than 72 hours in 3 out of 28 infants with viral infections (10.7%) and in none infants with bacterial infection; however, the difference between groups was not statistically significant (table 2). As expected, the wbc, anc, and serum crp values were significantly higher in neonates with bacterial infections than those with viral infections and controls; immature neutrophil count was also higher, whereas platelet count was lower in neonates with bacterial infections but the difference between groups was not significant (table 2). Plasma supar levels were significantly higher (p <0.001) in the entire group of infected neonates (5.01 1.52 ng / ml), as well as in neonates with bacterial or viral infections separately (p <0.001 and p = 0.02, resp .) In comparison with controls (3.61 0.74 ng / ml). No difference was recorded in supar levels between neonates with bacterial infections and those with viral infections (table 2). Furthermore, in the group of neonates with viral infections, supar levels did not differ significantly between neonates with confirmed and those with probable infections . In the 13 out of 47 infected neonates who fulfilled the criteria for sepsis (11 with bacterial and 2 with viral infections), baseline mean s.d . Plasma supar levels (6.05 1.96 ng / ml) were significantly higher than levels in the remaining 34 nonseptic neonates (4.58 1.08 ng / ml; p = 0.002) and controls (p <0.001). The difference in supar levels between nonseptic neonates and controls was also significant (p = 0.02) (figure 1). In the entire study population, supar levels on admission correlated positively with postnatal age (rs = 0.29, p = 0.01), wbc (rs = 0.26, p = 0.03), serum urea (rs = 0.28, p = 0.03), and crp levels (rs = 0.42, p = 0.001). The positive correlation between supar and crp concentrations was driven by the group of neonates with bacterial infections (rs = 0.52, p = 0.02) (figure 2). Moreover, supar levels correlated negatively with platelet number in neonates with bacterial infections (r = 0.55, p = 0.01), whereas a positive influence of male gender on supar levels was recorded in controls (regression coefficient = 0.516, p = 0.02). Receiver operating characteristic (roc) analysis of supar values on admission to the unit resulted in significant areas under the curve (auc) for detecting either infected (auc = 0.801 (95% ci: 0.6870.916), p <0.001) or septic neonates (auc = 0.788 (95% ci: 0.6530.923), p = 0.001) (figures 3(a) and 3(b), resp . ). However, the diagnostic performance of supar was not superior compared to crp either for detecting infection (auc = 0.905 (95% ci: 0.8340.976), p <0.001) or sepsis (auc = 0.858 (95% ci: 0.7141.000), p <0.001), whereas it was almost equal compared to wbc and anc for detecting infection (auc = 0.787 (95% ci: 0.6340.940), p = 0.001, and auc = 0.820 (95% ci: 0.6760.963), p <0.001, resp . ), but better than wbc and anc for detecting sepsis (auc = 0.633 (95% ci: 0.4130.853), p = 0.14, and auc = 0.675 (95% ci: 0.4610.888), p = 0.05, resp ., figure 3). In our study population, supar values higher than 4.07 ng / ml on admission could detect infection with sensitivity 74.5% and specificity 78%, whereas values greater than 4.79 ng / ml could detect sepsis with sensitivity 61.5% but specificity 89% . However, supar values on admission could not discriminate between bacterial and viral cause of infection (auc = 0.515 (95% ci: 0.3310.699), p = 0.86). Within the entire group of infected neonates, the time points at which repeat blood samples were obtained had a significant effect on plasma supar levels (f = 10.5, p <0.001) by one - way repeated measures anova, whereas the effect of the infection type (bacterial or viral) was not significant . In comparison with values on admission (baseline), supar concentrations decreased significantly (p <0.001) in the entire population of infants with bacterial and viral infections (figure 4(a)); however, at 710 days following admission, supar levels were still significantly higher in comparison with controls (p = 0.01) (figure 4(a)). Plasma supar levels also declined significantly during the course of the disease in the group of neonates with bacterial (p = 0.004) and viral infections (p <0.001), separately (figure 4(b)), whereas no difference was recorded between the two groups . In neonates with bacterial infections, supar concentrations decreased significantly from baseline to 24 hours (p = 0.01), as well as from 24 to 48 hours (p = 0.04), whereas the alteration in supar levels from 48 hours to 35 days or from 35 days to 710 days following admission was not statistically significant . In neonates with viral infections, a significant decrease in supar levels was firstly observed between 24 and 48 hours (p = 0.007); supar levels also decreased from 48 hours to 35 days (p = 0.05), but they did not alter significantly from 35 days to 710 days following admission (figure 4(b)). In the septic group of infants, separately, supar concentrations decreased significantly from 24 hours onwards in comparison with baseline (p <0.001) (figure 4(c)), but remained higher than in controls at 710 days following admission (p = 0.05). According to the results of this study, circulating supar levels are increased in term neonates with acute infections in comparison with healthy controls . Moreover, supar levels in septic neonates are higher than levels in infected neonates who do not fulfill sepsis criteria . Increased systemic supar levels were previously reported in critically ill adults with or without sirs, or sepsis; a gradual increase in levels of supar was shown from adults who did not fulfill sirs criteria to patients with sirs and patients with sepsis [8, 9]. Supar levels were almost two times higher in septic adults than levels in our septic neonates, whereas levels in healthy adults were similar to those in our control group . The difference in supar levels between septic neonates and septic adults can possibly be attributed to the less severity of sepsis in our neonates; all studied infants were hospitalized in a special, but not intensive, care unit and in none of them the course of disease was complicated or fulminant . Supar levels in our study population were similar to those in older children with acute malaria infection, community - acquired pneumonia, and urinary tract infection . There is only one published study of supar levels in neonates (10); supar has been recognized as one among eight proteins increased in clinically infected preterm infants, but neither its association with bacterial or viral cause of infection, or with the course of disease, was studied . Despite the increased circulating supar levels, the diagnostic value of supar for identifying infection or sepsis in adults is questioned as there are reports showing that it is good, uncertain, or poor [7, 8, 15, 16]. It was previously shown that in comparison with other, frequently used in clinical practice, biomarkers of sepsis including crp and procalcitonin, supar was not a better diagnostic marker [7, 15]. In our study, the diagnostic value of supar for neonatal infection was good, whereas it was much better for neonatal sepsis . However, similarly to studies in adults [7, 16], supar was less accurate than crp as diagnostic biomarker and also did not have any value in discriminating bacterial from viral infections . Furthermore, in neonates with bacterial infections, supar levels did not seem to correlate with bacteria species (data not shown). Whereas the diagnostic utility of supar is controversial, several studies have shown that supar is a valuable prognostic biomarker [6, 1619]. Circulating supar levels, but not crp levels [20, 21], were reported to be higher on admission in nonsurvivor adults compared to patients who survived sepsis [6, 1618]. The prognostic value of supar for mortality could not be evaluated in our study as all septic neonates survived . However, the higher supar levels on admission in septic neonates compared to infected, but nonseptic, ones and the negative correlation between supar levels and platelet number in the bacterial infant group indicate that supar is indeed associated with the severity of infection . The positive correlation between supar and crp levels in our study population is in accordance with the fact that circulating supar levels reflect the degree of immune activation and systemic inflammation . There is also some evidence that individual factors, such as age and possibly female gender, are positively associated with systemic supar levels [9, 13, 22, 23]. In our study, supar levels correlated positively with postnatal age, whereas a positive influence of male, but not female, gender was observed in controls . We wonder whether supar could be used as a biomarker of clinical recovery or response to treatment in patients with infection or sepsis . Changes in supar levels after initiation of antimicrobial therapy have been studied only in adults [8, 16, 19, 24]; it was shown that supar may remain elevated for days (even for weeks) after initiation of treatment . In our study, supar levels declined significantly in infected neonates; however, 7 to 10 days following admission, although all infected neonates had fully recovered, supar levels were higher than in healthy controls . Given that supar levels were not halved even at 7 to 10 days following recovery, we assume that either the half - life of supar, being unknown so far, is long or the production / release of supar is continued for a period of time following clinical improvement . Supar participates in a number of immunological functions, including cell adhesion, migration, chemotaxis, proteolysis, immune activation, tissue remodeling, invasion, and signal transduction . However, its precise role in infection and sepsis is still not clear . Knockout mice lacking upar have shown impaired host defense against sepsis, including reduced neutrophil migration towards the primary site of infection and markedly impaired phagocytosis in comparison with wild - type mice [25, 26]. On the other hand, upar and circulating supar have been implicated in the promotion of disease progression [25, 27]. Further studies are needed to elucidate whether supar is merely an epiphenomenon of the increased activation level of the immune system, or either this receptor possesses a protective role in neonatal sepsis or promotes inflammation / tissue damage and should, therefore, become a potential therapeutic agent or target in the future.
|
The importance of epidemiological monitoring of yeasts involved in pathogenic processes is unquestionable due to the increase of these infections over the last decade; so are the changes observed in species causing candidiasis and empirical antifungal treatment . Although c. albicans is the organism most often associated with serious fungal infection, other candida species also have emerged as clinically important opportunistic pathogens . Most pathogens, including candida species, havedeveloped an effective battery of putative virulence factorsand specific strategies to assist in colonization, invasion, and pathogenesis . Thevirulence factors expressed by candida species, to cause infections may vary depending on the type of infection, the site and stage of infection, and the nature of the host response . The main virulence factors are biofilm formation, production of acid proteinase, phospholipase, etc . Once the contact is made, enzymes facilitate adherence by damaging or degrading cell membranes and extracellular proteins thus permitting the yeast to enter the host, whereas phenotypic switching or coating with platelets may be used to evade the immune system . Biofilms are the structured microbial communities that are attached and encased in a matrix of exopolymeric material, and are important for the development of clinical infection . The most external layers of candida cells are essential for the adherence to host surface, thereby playing a pivotal role in the pathophysiology of candidiasis . The advantages of forming a biofilm include protection from the environment, nutrient availability, metabolic cooperation, and acquisition of new genetic traits . Theenzymes are secreted in vitro when the organism is cultured inthe presence of exogenous protein (usually bovine serum albumin)as the nitrogen source . Proteinase production is believed to enhance the ability of the organism to colonize and penetrate host tissues and to evadethe host immune system . Phospholipase enzymes are associated with membrane damage of the host cells, adherence, and penetration . Invasion of host cells by microbes entails penetration and damage of the outer cell envelope . Early data suggestthat direct host cell damage and lysis are the main mechanismscontributing to fungal virulence . A total of 250 different clinical samples were collected from patients being treated in hospitals and nursing homes in and around bangalore . The samples collected include 102 from respiratory tract (sputum, bronchial wash, tracheal secretion) and saliva, 120 from blood, 12 from urine, 2 from middle ear discharge, 1 from vitreous fluid, 1 from corneal ulcer, and 9 samples from plastic devices (endotracheal tube, catheter tip, suction tip). The samples were inoculated on to sabouraud's dextrose agar as the main isolation medium . For blood samples, the identification of the species was conducted by assessing the germ tube formation, pellicle formation, assimilation, fermentation of sugars . Biofilm formation was determined for all the isolates and the standard strains by using a method proposed by branchini et al . A loopful of organisms from the sda plate was inoculated into a tube containing 10 ml sabouraud's liquid medium supplemented with glucose (final concentration of 8%). The tubes were incubated at 37c for 24 h after which the broth was aspirated out and the walls of the tubes were stained with safranin . Biofilm formation was scored as negative (0 +), weak positive (1 +), moderate positive (2 +), or strong positive (3 +). The candida proteinase was detected by the slightly modified staib et al, method using bovine serum albumin medium (dextrose 2%, kh2 po4 0.1%, mgso4 0.05%, agar 2% mixed after cooling to 50c with 1% bovine serum albumin solution). Proteinase activity was detected by inoculating 10 l aliquots of the yeast suspension (approximately 10 yeast cells /ml) into the wells punched onto the surface ofthe medium . Opaqueness of the agar, corresponding to a zone of proteolysis around the wells that could not be stained with amidoblack indicated degradation of the protein . The diameter of unstained zones around the well was considered as a measure of proteinase production . The proteinase activity (pz) was determined in terms of the ratio of the diameter of the well to the diameter of the proteolytic unstained zone . Slightly modified method of samaranayake et al, was used to estimate phospholipase.the egg yolk medium used consisted of 13.0 g sabouraud dextrose agar (sda), 11.7 g nacl, 0.111 g cacl2, and 10% sterile egg yolk.the egg yolk was centrifuged at 500 g for 10 min at room temperature, and 20 ml of the supernatant was added to the sterilized medium.extracellular phospholipase activity was detected by inoculating 10 l aliquots of the yeast suspension (approximately 10 yeast cells /ml) into the wells punched onto the surface ofthe egg yolk medium . The diameter of the precipitation zone around the well was measured after incubation at 37c for 48 h. phospholipase activity(pz value) was determined . Biofilm formation was determined for all the isolates and the standard strains by using a method proposed by branchini et al . A loopful of organisms from the sda plate was inoculated into a tube containing 10 ml sabouraud's liquid medium supplemented with glucose (final concentration of 8%). The tubes were incubated at 37c for 24 h after which the broth was aspirated out and the walls of the tubes were stained with safranin . Biofilm formation was scored as negative (0 +), weak positive (1 +), moderate positive (2 +), or strong positive (3 +). The candida proteinase was detected by the slightly modified staib et al, method using bovine serum albumin medium (dextrose 2%, kh2 po4 0.1%, mgso4 0.05%, agar 2% mixed after cooling to 50c with 1% bovine serum albumin solution). Proteinase activity was detected by inoculating 10 l aliquots of the yeast suspension (approximately 10 yeast cells /ml) into the wells punched onto the surface ofthe medium . After incubation, the plates were fixed with 20% trichloracetic acid and stained with 1.25% amidoblack . Opaqueness of the agar, corresponding to a zone of proteolysis around the wells that could not be stained with amidoblack indicated degradation of the protein . The diameter of unstained zones around the well was considered as a measure of proteinase production . The proteinase activity (pz) was determined in terms of the ratio of the diameter of the well to the diameter of the proteolytic unstained zone . Slightly modified method of samaranayake et al, was used to estimate phospholipase.the egg yolk medium used consisted of 13.0 g sabouraud dextrose agar (sda), 11.7 g nacl, 0.111 g cacl2, and 10% sterile egg yolk.the egg yolk was centrifuged at 500 g for 10 min at room temperature, and 20 ml of the supernatant was added to the sterilized medium.extracellular phospholipase activity was detected by inoculating 10 l aliquots of the yeast suspension (approximately 10 yeast cells /ml) into the wells punched onto the surface ofthe egg yolk medium . The diameter of the precipitation zone around the well was measured after incubation at 37c for 48 h. phospholipase activity(pz value) was determined . The species spectrum of the isolate was as follows, of the 111 isolates 49 were c. albicans, 7 c. glabrata, 4 c. guilliermondi, 2 c. kefyr, 35 c. krusei, 5 c. parapsilosis, and 9 c. tropicalis . Candida species isolated from different clinical samples a total of 81 (73%) out of 111 candida species isolates obtainedfrom the clinical isolates produced biofilm . Only 51% (25 of 49) of c. albicans isolates produced biofilm, which was significantly lower than the percentageof all non albicans candida species isolates producing slime (90.32%, 56 of 62; p<0.0001). Highest proteinase producers were c. kefyr (pz 0.16), c. guilliermondii (pz 0.17), followed by c. albicans (pz 0.18), whereas the least producer in the group was c. glabrata (pz 0.29). Highest phospholipase producer is c. guilliermondii (pz 0.07), followed by c. parapsilosis (pz 0.08). Biofilm, proteinase, and phospholipase production by candida species isolated from clinical specimen are shown in the figure 1 . Candida is an asexual, diploid, dimorphic fungus that is present on humans and in their environment these organisms are capable of causing a variety of superficial and deep - seated mycoses such as cutaneous, mucocutaneous, subcutaneous, or systemic candidiasis . Candida organisms are commensals; and to act as pathogens, interruptionof normal host defenses is necessary . Therefore, general riskfactors for candida infections include immunocompromised states, diabetes mellitus, and iatrogenic factors like antibiotic use, indwelling devices, intravenous drug use, and hyperalimentationfluids . Candidiasis has emerged as an alarming opportunistic disease as there is an increase in number of patients who are immunocompromised, aged, receiving prolonged antibacterial and aggressive cancer chemotherapy or undergoing invasive surgical procedures and organ transplantation . The present study showed the distribution of candida species in different clinical samples and the predominance of non - candida albicans, as was also shown by mujika et al . The most common isolate from all samples was c. krusei . C. albicans (41.37%) was the predominant species recovered from respiratory tract samples . The patients aged above 60 years of age and had productive cough; they probably had secondary infection due to candida . Most catheter - related septicemias are caused by microorganisms that invade the intracutaneous wound during catheter insertion or thereafter. [911] the proportion of such infection due to non - candida albicans species is persistently rising. [1214] the saliva samples were collected from 84 diabetic individuals aged above 60 years . Saliva samples from 31 patients yielded c. albicans 23 (74.19%) and non - candida albicans 8 (25.8%). Urine samples yielded c. krusei 6 (50.0%); followed by c. albicans 3 (25.0%) and these patients had symptoms of urinary tract infection . The isolates from pus, middle ear discharge, and eye were predominantly non candida albicans species . Plastic devices like endotracheal tube, suction tip, and catheter tip were collected from patients . A biofilm is a community of microorganisms and their extra cellular polymers that are attached to a surface . The ability to form biofilms is associated with the pathogenecity and as such should be considered as an important virulence determinant during candidiasis . Biofilms may help maintain the role of fungi as commensal and pathogen, by evading host immune mechanisms, resisting antifungal treatment, and withstanding the competitive pressure from other organisms . The biofilm production is also associated with high level of antimicrobial resistance of the associated organisms . Biofilm positivity occurred most frequently in isolates of c. krusei followed by c. tropicalis, c. kefyr, c. guilliermondii, c. parapsilosis, c. glabrata, and c. albicans . In contrast, hawser and douglas reported thatisolates of c. parapsilosis and c. glabrata were significantlyless likely to produce biofilms than the more pathogenic c. albicans . Biofilm production in this study was more related to the species of candida than to the site of infection . There were no significant differences in biofilm production when grouping the strains according to the patients age, and site of infection . . Secreted aspartic proteinases (saps) are responsible for the adhesion, tissue damage, and invasion of host immune responses . Proteinases fulfill a number of specialized functionsduring the infective process, they include digesting molecules for nutrient acquisition, digesting ordistorting host cell membranes to facilitate adhesion and tissueinvasion, and digesting cells and molecules of the host immunesystem to avoid or resist antimicrobial attack by the host . The proteinase - producing capacity of candida non albicans 56 (50.45%) was less than that of c. albicans 33 (67.34%) in this study . The term phospholipases refers to a heterogeneous group of enzymes that share the ability to hydrolyze one or more esterlinkage in glycerophospholipids . Since phospholipase targets membrane phospholipids and digests these components, leading to cell lysis; direct hostcell damage and lysis has been proposed as a major mechanism contributingto microbial virulence . A total of 23 (46.93%) of c. albicans isolates and 26 (42%) of non - candida albicans isolates produced phospholipase . The result in this study agrees with the reports of ibrahim et al, in proving that c. albicans isolated from the blood samples showed greater extracellular phospholipase activity . The number of non candida albicans producing proteinase, phospholipase and biofilm are more than the number of c. albicans producing these virulence factors . This result suggests that the biofilm production is more important for non - candida albicans strains and candida albicans possess mechanisms other than biofilm production to establish infections . Our study showed that the percentage of non - candida albicans producing proteinase is higher than c. albicans, whereas c. albicans are higher producers of phospholipase than non- candida albicans.
|
Metal organic frameworks (mofs) are materials formed via the coordination of metal centers and organic linkers in three dimensions . The varied chemical compositions and structural topologies of mofs make them suitable for a broad range of applications including gas storage and separation, solar energy conversion, and heterogeneous catalysis . One mof that has attracted particular attention is uio-66 (figure 1), which was first synthesized by cavka et al . This material features a high coordination of 12 benzene-1,4-dicarboxylate (bdc) ligands around each zr node and is thermally stable up to 813 k. the internal surface area (800 m g) is large with the structure containing both tetrahedral and octahedral cages . Each octahedral cage is edge - sharing with eight tetrahedral cages and face - sharing with eight octahedral cages . The inner - sphere coordination of zr in uio-66 is 6, but additional face - sharing oxide and hydroxide ligands lead to an outer - sphere coordination of 12 . Crystal structure of uio-66 (left) and locations on the metal node where charge compensating or neutral molecules can bind following bdc linker removal (right). The locations of charge compensating molecules are highlighted in maroon and neutral molecule locations are highlighted in black . Top right shows the bdc linker connection between zr - metal nodes prior to removal . Centre and bottom right shows the locations considered for charge compensating molecules following linker removal . Wu et al . And vermoortele et al . Reported a significant internal surface area increase for uio-66 synthesized with an acidic modulator such as acetic or hydrochloric acid . This phenomenon, leading to increased gas storage capabilities with little stability loss, has been attributed to a missing bdc linker from the unit - cell, with a subsequent reduction in coordination of the zr metal . Recent reports have focused on the charge - capping mechanism following the removal of the linker . Experimental evidence, such as quantum tunnelling peaks in inelastic neutron scattering, associated with terminating methyl groups, suggest acetic acid becomes incorporated into the framework . The incorporation of cl ions when using hcl has also been suggested . Considering that an excess of zrcl4 is often used during synthesis and that experimental conditions do not completely exclude water nu-1000 is a structurally similar zr - containing mof, which is often compared to uio-66 . The zr node in nu-1000 has the formula [zr6(3-o)4(3- oh)4(oh)4(h2o)4] and in uio-66 has the formula [zr6(3-o)4(3oh)4]. The additional incorporation of four hydroxide and four water molecules in nu-1000 is due to the use of zrocl2 as the zr precursor source, as opposed to the zrcl4 precursor used to synthesize uio-66 . Reports vary from 14 vacancies per metal node depending on synthesis conditions; however, all measurements are indirect (e.g., thermogravimetric analysis) and usually yield an average over a large sample volume . Regardless of the method employed, it is clear that the defect concentrations are high and beyond those typically found in crystalline materials . In this paper, we investigate the free energy of formation of missing ligand defects in uio-66 using a combination of first - principles and molecular mechanics computational techniques . The results validate recent experimental observations of high defect concentrations and reveal a thermodynamic driving force for defect aggregation in the uio-66 system ., we combine empirical and first - principle methods . The analytical force field calculations allow us to probe large and complex defect structures including vibrations and hence calculate the gibbs free energy of ligand removal . The higher - level density functional theory calculations provide a means of validation, while also giving an estimation of solvation and cluster energies for reaction products that are challenging to compute using empirical interatomic potentials . We have considered the cubic unit cell of uio-66, which contains 24 linkers and 4 metal nodes . Parametrisation of the interatomic potential was conducted to recreate the structural and material properties of nondefective uio-66, including bond lengths, bond angles, phonon frequencies, bulk modulus, and elastic constants . The details of the force field and a comparison of the predicted structure of uio-66 against experimental data is given in the supporting information (si). The bulk and defective structures were first optimized with respect to the internal energy, and then the free energy of the final structure was calculated including the vibrational entropy . For all defect reactions considered, reactants and products were optimized at constant external pressure, thus providing the gibbs free energy (g) of reaction . Reference solid - state density functional theory (dft) calculations on the pristine and defective structures of uio-66 were performed using vasp . These periodic dft calculations were to provide high - quality fitting data for the force field and to validate the defect structures . The pbesol functional was used with a plane - wave cutoff of 600 ev and wave functions were calculated at the -point of the brillouin zone . Projector augmented wave potentials were used to model the interaction between valence and core of all atoms with 4d5s as the valence configuration of zr . The optimized unit - cell parameters from pbesol / dft (a = 20.80 and = 90.0) reproduce the experimental structure (a = 20.98 and = 90.0) of uio-66 to within 1% . Comparisons of the crystal structures produced by dft and force field methods are given in the si . Free energies of solvation for molecular fragments in dmf (dimethylformamide) were calculated with the continuum solvation model, cosmo, in nwchem (cc - pvtz basis set). The self - consistent field energy convergence was set to 10 ha and the m06 - 2x functional, which is known to produce accurate thermodynamic properties, was used to obtain geometries . In the solvation model, we used the temperature - dependent experimental dielectric constant of dmf, as reported by bass et al . Other thermodynamic quantities, such as the energy of protonation of bdc, were taken from the nist database . This approach gives a good description of hydrogen bonding interactions at low computational cost . The dielectric constant of dmf at 300 k was used . A single point counterpoise correction for the basis set superposition error (bsse) was calculated on the converged cluster geometries . For a balanced defect reaction, conservation of charge and mass is required . Acetic acid (ch3cooh) and/or hcl in addition, the commonly used solvent, dmf, and also h2o can be incorporated . The removal of one bdc linker results in a system with an overall + 2 charge and reduces the coordination sphere of 4 zr centers from 12 to 11 . We consider seven capping mechanisms for charge compensation and stabilizing the structure by saturating the coordination of each metal center with a neutral molecule (table 1). Given are the charge compensating molecules coordinated onto the two zr centers, the precursors, and the neutral molecules included in some models to saturate the zr coordination spheres . There are two choices for adding the charge - capping and neutral molecules into the structure, labeled as trans and cis in figure 1 . We find the lowest energy arrangement for trans substitution, which can be understood from simple electrostatics, as it maximizes the distance between the charge - capping species, and also steric effects . The defect free energies as a function of temperature, calculated using mass and charged balanced chemical reactions, are given in figure 2 . The charge compensating models are detailed in table 1 and full reactions are listed in the si . The higher calculated defect energy associated with oh is due to the energy required to split its precursor (water) in dmf as a solvent . Free energy of defect formation for (a) a single vacancy with a range of capping models (labeled 17 corresponding to table 1). (b, c) two vacancies with acetate and cl / h2o capping models . Highlighted are the two lowest and highest energy configurations, all other configurations are shown as black lines . (d, e) three vacancies with acetate and cl / h2o capping models . (f, g) removal of 18 ligands for the ch3coo and cl / h2o charge - capping models toward the formation of the ordered vacancy nu-1000 type configuration . All energies are presented per defect and include contributions from the vibrational internal energy and entropy . The charge - capping mechanisms that had the lowest associated formation free energy were with acetic acid and cl / h2o . The acetic acid cap was optimized from multiple initial configurations . In each case, the ch3coo ligand converged to a structure with bidentate coordination and identical bond lengths . Little structural distortion or loss of symmetry occurs to the framework of uio-66 with the incorporation of acetic acid due to it possessing an identical headgroup to bdc . Slight losses of symmetry calculated when using ch3coo as the charge - capping ion are due to the loss of a mirror plane from the introduction of the methyl group . It is therefore the similarity between the chemical structure and solvation energies of the bdc and acetate head groups that makes acetic acid the lowest energy charge - capping mechanism in uio-66 . Interestingly, we found that binding a cl ion with a neutral molecule had a much lower energy than binding only cl ions . Following the insertion of a monodentate charge - capping ion alone we observed it bridging between two neighboring zr centers . When water / dmf were introduced, such that the zr centers remained fully coordinated, the defect energy was lowered . This confirms, as expected, that an undercoordinated metal center is energetically unfavorable . Our findings also suggest that a small concentration of water during synthesis may increase the number of linker vacancies within the material . We found the effect of coordinating dmf as a neutral molecule to have little influence on the defect energy . It can be seen that when comparing the energies for single cl and cl / dmf substitution, dmf, as a neutral coordinating molecule, lowers the defect energy of removing one bdc linker . Note that between 350400 k, the energies of the respective charge - capping mechanisms cross and the single cl model becomes more favorable than the cl / dmf model, suggesting dmf coordination to be unfavorable at high temperatures . Taking the lowest energy charge - capping mechanisms (ch3coo and cl / h2o), as identified in figure 2a, we further investigated the defect energies associated with the removal of additional bdc ligands . We present the defect energies for each of the symmetry unique locations of 2 bdc removals in figure 2b, c . The lowest energy configurations are identified to occur when removing linkers from the faces of the same tetrahedral cage, which also form the vertices of the central octahedral cage . The most favorable position renders one metal node as 10 coordinate and two other metal nodes as 11 coordinate . For the removal of three bdc linkers, we have calculated the defect formation energy of all configurations for the lowest energy charge - capping mechanisms (ch3coo and cl / h2o), figure 2d, e . Each configuration is numbered in order of increasing magnitude of the defect energy, (i.e., configuration 1 has the lowest energy and configuration 32 has the highest). We find a broader distribution of defect energies for the acetate capping than for cl / h2o . We observe the short - range structural disorder in the acetate configurations, where the acetate molecule points into the pore and does not stay in planar alignment, to be larger with clustered defects due to local interactions and a loss of symmetry . Configuration 1 has the lowest defect energy by 23.8 and 26.5 kjmol for the acetate and cl / h2o capping, respectively, when compared to configuration 2 . This configuration corresponds to three bdc linkers being removed from the same tetrahedral cage within the structure with strong local interactions between the defects . In contrast, the highest energy configurations feature parallel vacancies that create a long - range structural instability . Beyond three ligands, there is a combinatorial explosion and we become limited by our simulation cell size . However, we have considered some representative configurations . For acetic acid, removing four ligands equating to two bdc linkers per metal node has no significant energy penalty (figure 2f). This result agrees, at least qualitatively, with experiment in that a large increase in surface area can be obtained by using acetic acid as a modulator to remove linkers from the structure . The removal of five and six linkers from the unit cell results in a small increase in defect energy per linker removal before phonon stability and therefore structural integrity is lost with the removal of 78 linkers for acetic acid compensation . For cl / h2o (figure 2 g), there is a reduction in energy per defect when removing 7 and 8 bdc linkers (i.e., 3.54 linkers per metal node), together with a phase change from cubic to monoclinic symmetry, which occurs in a similar manner to the breathing motion of winerack mofs . There is also an increased structural flexibility due to the high number of vacant ligand sites . The predicted phase change occurs at a very high concentration of defects and so may not be experimentally observable . The symmetry reduction to monoclinic does not happen in the case of the acetic acid charge cap, because this is a bidentate ligand and the structural integrity of the cubic phase is maintained . A boltzmann distribution for two and three linker vacancies shows that 99% of defects will be clustered at 300 k for the acetate and cl / h2o, respectively . Under equilibrium conditions, a distribution of isolated vacancies is unlikely and a dominant preference for clustered vacancy motifs would be expected, which is consistent with recent x - ray scattering analysis . Furthermore, the dynamic nature of charge capping, including rapid proton transfer has been suggested from very recent simulation studies . A further simulation was performed for the oh / h2o charge - capping system with 8 linkers missing from the cubic unit cell . This corresponds to the node structure of nu-1000, a mof synthesized from a different zr precursor . As an analysis of the energy required to form this structure, we repeat the removal of 18 linkers in the same manner as previously performed but instead for the oh / h2o charge capping . The final structure is equivalent to nu-1000 and was constructed along the highest symmetry path (the same path as was followed for the acetate and cl / h2o charge capping). Interestingly, we do not see the same phase change as was observed with the cl / h2o capping; instead hydrogen bonding between the hydroxyl groups and water maintains the cubic symmetry with only small structural distortions . The defect energy associated with the formation of this structure (8 vacant linkers from the cubic unit cell) is similar to the cost of a single defect (see si), highlighting the unusual tolerance of uio-66 for high defect concentrations . We note that the defect energy for this charge capping considers the oh capping source to be from the splitting of water . Synthesis methods for nu-1000 involve the use of a zr oh precursor, which offers an alternative oh source . We therefore highlight the observed trend as being of interest rather than the specific energetics of ligand removal for making a nu-1000 type structure . Because of the high concentration of defects predicted for uio-66, we should consider processes beyond the typical dilute limit of noninteracting defects . Cluster formation following the removal and subsequent protonation of bdc may occur both in the framework but also between the removed species in the solvent . Possible clusters that may form in solution are depicted in figure 3 . A strong binding energy of 104.7 kjmol between two acetic acid molecules and one bdc - h2 linker has been calculated (figure 3f). Equilibrium geometries of molecular clusters for which binding energies are given in table 2 . Formation of molecular clusters in solution may provide an additional driving force for bdc linker to leave the uio-66 framework when this acid is used as a modulator . Other clusters considered are shown to have a weaker binding energy between components (table 2). Experimental evidence has been reported that even when synthesized without an acidic modulator uio-66 can possess the missing linker defect at a low concentration . A contributing factor may be the strong calculated binding energy (75.3 kjmol) between dmf and bdc - h2 (figure 3d). The formation of this cluster can provide a thermodynamic driving force for a reduced number of linkers to be incorporated into the framework during the formation of uio-66 . The values reported are qualitative because hydrogen bonding between the solvent and molecule is not described in a continuum model . An explicit solvent model could provide a more accurate description of aggregate formation in future studies . The volume of the crystal lattice is found to increase and bulk modulus to decrease for the majority of capping models (see table 3). The single anion capping (cl and oh) is an exception as the anion effectively bridges between two metal centers, taking less physical space than bdc, and the lattice volume decreases . The bulk moduli are all lower for the defect structures but remain within 5 gpa of pristine uio-66 . A key question is whether the missing ligands have an observable spectroscopic signature . The simulated infrared (ir) spectra of 14 missing linkers for the two lowest energy charge - capping mechanisms (acetate and cl / h2o) are presented in figure 4 . First, for the acetate capping acetate peaks are evident at 1463 cm and between 15831586 cm due to the asymmetric and symmetric stretching of the c o carboxylate bonds, respectively, which can be distinguished from the c o carboxylate stretch of bdc, occurring between 1617 and 1650 cm . The c h bond stretch of acetate occurs at 2900 cm, and the bdc c h stretch at 2947 cm . Additional peaks between 720994 cm are associated with bending and twisting of the zr node . Shoulder peaks are associated with the loss of symmetry at the zr node, but are difficult to distinguish . For the cl / h2o charge cap, additional peaks between 500900 cm are present due to the reduction in symmetry of the zr node (as evident for eight missing linkers in figure 4). The zr cl stretch is difficult to assign to one specific mode but occurs in the same frequency range as the zr o stretches between 582612 cm . H bond stretch of water at 3378 cm (see si for the full spectral range and associated raman spectra). The results suggest that high - resolution vibrational spectroscopy may provide the means to assign the local charge - capping mechanism and give insights into defect concentrations . Simulated ir spectra for pristine and defective uio-66 with acetate (14 missing bdc linkers) (top) and cl / h2o (1, 2, 4, 6, and 8 missing bdc linkers) (bottom) as the charge - capping mechanism . Ir spectra are plotted between 2001800 cm . A broadening factor of 10 cm was applied . From an analysis of the defect chemistry of linker removal in uio-66, we conclude that the lowest energy processes are for acetate and cl / h2o charge - capping mechanisms . We show that h2o capping at high concentrations results in an ordered - defect structure consistent with the nu-1000 framework . A cluster between two acetic acid molecules and a protonated bdc linker is found to have a strong binding affinity and is a candidate product of ligand loss . The results are expected to be transferable to other uio frameworks with relevance to a wider range of hybrid organic inorganic solids.
|
Studies concerning the epidemiology in dentistry have showed that dental caries and periodontal diseases are the most prevalent pathologies that affect the oral cavity . Previous studies performed by american researchers had suggested that dental caries was the main reason for teeth extraction, and other studies accomplished in new zealand, sweden, and even in brazil confirmed that caries may lead to tooth mortality [15]. On the other hand, some studies suggested that periodontal disease was the most prevalent reason that leads to tooth loss . Thus, controversial findings could be explained by differences in the characteristics of the study population, immunological and genetic factors, cultural beliefs, and socioeconomic characteristics, among others . Immunological and genetic reasons are some of the contributory factors that may explain why some populations exposed to the same bacterial etiologic factors did not develop similar pathological conditions [6, 7]. Populations with poorer socioeconomic conditions have shown higher prevalence and extent of teeth mortality, which increases with aging [810]. The prevalence, extent, and risk indicators for tooth loss were studied in a representative brazilian population, showing that 94% of the subjects had experienced tooth loss . The authors verified a tooth mortality mean of 11.2, ranging from 5.5 to 20.2 teeth in subjects from 30 to 39 years old and 60 + years age groups, respectively; gender, socioeconomic status, cigarette smoking, caries experience, and attachment loss were important risk indicators . On the other hand, a decline in the tooth loss can be verified in developed countries in the last years [7, 11, 12], which can be explained by preventive programs and higher accessibility to the oral health care that have been decreasing the extractions [13, 14]. Brazil is a country in development progress (underdeveloped), and some studies verified the prevalence of tooth extractions in brazilians [4, 810, 15, 16], but few of them have verified the reasons for the tooth mortality in this population . Thus, the aim of this study was to describe the epidemiological data of the prevalence and reasons for teeth extractions in a convenience sample of brazilians . This study was approved by the ethics committee in human of araraquara dental school (unesp process number 45/99). A review of 800 clinical records was performed to select 439 patients with tooth loss from 1999 up to 2002 in dental clinics at state university of so paulo (unesp), araraquara city, brazil (sudeste region). From the 800 clinical records, 361 subjects were excluded by x - ray absence or absence of specifications of the reasons for tooth mortality, and 439 patients were enrolled in this study . From these 439 patients, 800 teeth with x - ray and specifications of reasons for tooth loss the clinical records were evaluated considering the gender and the age groups . Additionally, the prevalence of tooth loss was evaluated by reasons of extractions and type of teeth (molars, premolars, incisors and canines). The reasons for teeth mortality were adapted based on cahen et al . As follows: (1) caries: it is properly caries; (2) endodontic problems, such as pulp inflammation, necrosis, or even tooth fracture; (3) periodontal diseases: tooth extraction by periodontal attachment loss; (4) eruption problems: tooth loss by dental impacation; (5) prosthetics: indication for extraction by prosthetic reasons; (6) trauma: extractions by external trauma; (7) orthodontics: tooth extraction by orthodontic indications; (8) occlusal problems: extractions by occlusal dysfunction, such as extrusion; (9) other reasons: any other determined reasons, such as iatrogenic factors . A single examiner accomplished the clinical records assessment, and data was described in a proper form . Chi - square statistics () were applied, considering p <0.05 as a statistical significant difference . Adjusted residual chi - square () was calculated, considering 1.96 (= 0.05) and 2.573 (= 0.01). Table 1 shows the data collected from 1999 to 2002, the number of subjects, and teeth included in this study . The number of subjects according to age groups and gender ratio can be verified in table 2, that shows a similar prevalence of tooth loss between gender in all age groups (p = 0.67). Table 3 shows that the groups with range from 35 to 44 years, 45 to 54 years, and 55 to 64 years revealed significantly greater number of teeth extractions than other age groups (p <0.0001). The anterior teeth loss increased with aging and the extractions of premolars and molars decreased with aging, while the tooth mortality of premolar and molar were higher in younger people (table 4). The results showed that caries and periodontal diseases were statistically significant reasons for tooth loss when compared to the other factors (p <0.0001; table 5). Table 6 shows that caries was the most prevalent reason for tooth mortality among young and adults up to 44 years old, while the periodontal disease was the main reason for extractions from 45 years old until range of 81 years . Other reasons for teeth extractions can be verified as follows: iatrogenic factors (9.9), eruption problems (6.4), orthodontics (5.7), prosthetic indication (3.6), trauma (2.6), and occlusion problems (1.1). It can be seen in table 6 that tooth mortality for some reasons such as orthodontic, occlusal problems, and other reasons was significantly higher (p <0.0001) among younger, and by prosthetic reasons was significantly higher in older people (p <0.0001). Our data showed that the number of male and female subjects with tooth loss was similar among all age groups . Conversely, the study by barbato et al . Verified higher prevalence of tooth mortality in women than in men . Other studies assessed the tooth mortality among the urban and rural adult population of dharwad district (india) in 1223 subjects (685 urban and 538 rural) and found that females compared to males had higher tooth loss . Moreover, our findings showed that the age group between 35 to 44 years old presented a mean tooth loss of 2.3, which was lower than the mean of 11 verified in the other study . This difference could be explained by the sample size of the studies, which was of 439 brazilians in our sample and a major population of 13.431 brazilians in the study by barbato et al . . Our findings showed that among adolescents aged from 15 to 19 years, the prevalence of tooth extraction was 8.0%, while in a greater population of 16.833 brazilian adolescents it was 38.9% . Probably this difference could also be related to the sample size of the studies that is too discrepant . The results in the present study demonstrated higher missing teeth for premolars (43.1 to 51.6%) and molars (48.4 to 51.0%) among the youngest subjects (15 to 24 years), and the dental caries was the main reason for teeth extractions (67.2%). Our findings are in agreement with previous studies that have demonstrated that the first molars were the most prevalent missing teeth in brazilian younger people [9, 15, 19]. Barbato and peres found more than 55% of missing first molars, and dental caries experiences were found in 92.71% of all teeth lost . Other studies also suggested that the first molars were the most frequently missing teeth in subjects aged from 14 to 29 and from 13 to 16 years . The caries (38.4%) and periodontal disease (32.3%) were the most prevalent conditions for tooth mortality in the present study with similar prevalence . Conversely, other study on brazilians suggested that the main reason for tooth extraction was the caries (70.3%) and not the periodontal disease (15.1%), but this study showed findings of a small sample with 404 teeth extracted . In a caribbean population antigua, viagnarajah also suggested that caries was the main reason for tooth extraction (61.6%), and the periodontal disease was the next more frequent reason for tooth loss (29.9%). Our results showed that periodontal disease was more prevalent among older subjects over 40 years of age . Some studies are in agreement with our findings, showing that periodontitis became the most prevalent reason for tooth mortality in people near 40 years old [10, 2026]. In addition, other reasons for teeth extractions were found in the present study as follows: iatrogenic factors (9.9%), eruption problems (6.4%), orthodontics (5.7%), prosthetic indication (3.6%), trauma (2.6%), and occlusal problems (1.1%). Caldas also evaluated other reasons for extractions in 404 teeth, such as prosthetic reasons (6.4%), third molar - eruption disorders (3.7%), orthodontic reasons (2.5%), and trauma or patients request (1%), which showed lower prevalence than the caries and periodontal disease . Considering that few studies evaluated reasons for teeth losses in brazilians, our retrospective study may be useful in clinical dentistry and used as baseline data regarding prevalence and reasons for teeth extractions in other populations; moreover, other prospective studies might be performed . Within the limits of this study, it can be suggested that some reasons for tooth loss were age dependent, but the caries and the periodontal diseases were the main reasons for tooth mortality in this brazilian sample.
|
Spinal cord injuries (scis) cause substantial social, economic, and health burdens . In the majority of cases, the spinal cord is not completely severed and thus some fiber tracts and segmental spinal cord circuits remain intact, which determine the preserved functions and provide the basis for functional restoration . In incomplete sci persons, recovery of sensorimotor function increases progressively during the first year, with reorganization of sensory and motor cortices to lead to recovery of function and maladaptive behavior . In para- and tetraplegic patients, the cortical hand area was expanded towards the cortical leg area and was different based on the lesion level . Further, in paraplegic patients the representation of the nonimpaired upper limb muscles was modified showing an increased activation in the corresponding primary motor cortex (m1), in the parietal cortex, supplementary motor area, and cerebellum . An fmri study in rats showed that after midthoracic spinal cord transection, deafferented hindlimb territories in s1 exhibited responses to electrical stimulation of the unaffected forepaw, presumably mediated by both spinothalamic and dorsal column nuclei pathways . Evidence suggests that functional plasticity of motor cortical representations is mediated by an anatomical framework of preexisting projections that transverse representation borders . In addition to spontaneous reorganization of the brain after sci, spinal cord circuitries have the capacity to alter their structure and function with motor training, as supported by the physiological leg muscle activation patterns observed after locomotor training in spinalized animals [914]. Body weight - supported treadmill training (bwstt) is a therapeutic approach in which a person with sci steps on a motorized treadmill while some body weight is removed through an upper body harness and repetitive rhythmic leg movement patterns are promoted either through manual assistance provided by therapists or through a robotic exoskeleton system . Evidence that supports this intervention has been derived largely from studies conducted in spinalized animals [1619]. Specifically, treadmill training increases axonal regrowth and collateral sprouting proximal to the lesion site in mice, phosphorylation of erk1/2 in the motor cortex as well as the spinal cord injury area, expression of brain - derived neurotrophic factor (bdnf) in the spinal cord, ameliorates muscle atrophy in moderate contused sci rats, and alters properties of spinal motor neurons . These changes are only a small representation of activity - dependent plasticity located at the synaptic terminals of a variety of systems, that involves physiological, structural, and biochemical changes (see more in [25, 26]). In humans, bwstt improves lower extremity motor scores, increases the amplitude of muscle activity in the ankle extensors during the stance phase of walking, and improves walking ability and clinical outcome measures [2731]. A recent single - blind, randomized clinical trial involving bwstt with manual assistance, stimulation, over - ground training with stimulation and treadmill training with robotic assistance showed improvements in walking speed and distance . Walking speed was not significantly different between groups, but distance gains were greatest with overground walking training . Further, lower extremity motor scores increased in all groups, regardless the type of intervention . Based on the aforementioned findings, it is apparent that bwstt contributes to restoration of locomotion . Because remodeling of neuronal circuits as a result of plasticity occurs at multiple sites of the central nervous system [8, 32] restoration of movement after training is anticipated to be the result of neural reorganization that occurs simultaneously in supraspinal and spinal cord circuits . The aim of this paper is to focus on the corticospinal neural plasticity after locomotor training in sci . The corticospinal tract is the most direct pathway between the cerebral cortex and spinal cord with corticospinal axons monosynaptically synapsing onto spinal motor neurons . Even though neurons of the motor cortex are not required for simple locomotion, they exhibit a profound step - related frequency modulation in the cat [3335]. This modulation is driven by a combination of signals from the spinal central pattern generators and sensory afferent feedback reflex mechanisms that support interlimb coordination . The modulation of motor cortex neurons is necessary for accurate stepping on uneven terrain when adjustments of the limb trajectory are required to overstep an obstacle or to place the foot on a definite spot on the ground [3739]. However, pyramidal tract stimulation evokes disynaptic excitatory postsynaptic potentials (epsps) in flexor motor neurons that are much bigger in the locomotor state than in the resting state, which are rhythmically modulated so that the facilitation occurs in the flexor - active phase . While the spinal cord of vertebrates possesses the neural structures for genesis of the locomotor rhythm [4143] and the spinal pattern generator plays a decisive role in the recovery of locomotion after incomplete sci, lesions of the dorsolateral funiculi at thoracic t13 level in the cat induced long - term deficits on the locomotor pattern, supporting that the corticospinal tract plays a prominent role in the neural control of locomotion . The involvement of supraspinal neural control in human walking can be assessed by a variety of techniques utilized in isolation or in combination, including electroencephalography (eeg), electromyography (emg), transcranial magnetic and electric stimulation (tms and tes), and neuroimaging [45, 46]. Single - photon emission tomography and near - infrared spectroscopic topography have shown that the sensorimotor and supplementary motor cortices are activated during real and imagined locomotion [47, 48], while the prefrontal and premotor cortices were involved in adapting the locomotor speed on the treadmill . A recent study postulated a significant coupling between eeg recordings over the leg motor area and emg from the tibialis anterior (ta) muscle in the frequency band of 2440 hz prior to heel strike during the swing phase of walking, supporting a cortical involvement in human gait function . (time (cross - correlation) and frequency (coherence) domain techniques for the detection of coupling between signals provide an analytical framework from which functional coupling between localized cortical activity (measured by meg or eeg) and motor output (emg) can be identified in human subjects .) A single stimulus of tms produces a synchronized discharge of cortical interneurons and pyramidal neurons that travel down the corticospinal tract . Epidural electrodes in the spinal cord detect several waves following tms, termed direct (d) and indirect (i) waves . I waves originate in the motor cortex most likely through activation of corticocortical projections onto corticospinal neurons, while d waves are thought to result from direct depolarization of the initial axon segment of the corticospinal neuron . Recordings from the peripheral muscles demonstrate compound muscle action potentials known as motor evoked potentials (meps), which are a summation of multiple motor units depolarizing in response to d and i waves arriving onto the spinal motor neurons . However, the mep amplitude is not a reliable measure of corticospinal excitability . This is because tms - induced action potentials in cortical axons spread transynaptically to many other neurons that activate different descending pathways which are differently regulated during human movement . Further, in order to support cortical excitability changes based on alterations of mep amplitude due to motor plasticity, both need to be mediated by the same motor neurons and caused exclusively by direct monosynaptic projections from the motor cortex without any contamination through indirect interneuronal relays . The peaks in the peristimulus time histogram of the discharge probability of motor units induced by tms have the same duration as those induced by ia stimulation, and thus there is ample time for nonmonosynaptic effects to influence the mep amplitude as is the case for the h - reflex [57, 58]. Lastly, because meps are facilitated on average 12 ms before the reaction time to contraction during which antagonists are concomitantly facilitated by subcortical circuits [59, 60], it is apparent that they are sensitive to the excitability state of spinal -motor neurons and interneurons . The aforementioned limitations can be counteracted by reducing the tms intensity below the mep threshold . Direct recordings in awake human subjects have shown that tms at subthreshold mep intensities, which does not evoke any descending corticospinal volleys, depresses the mep evoked by a subsequent suprathreshold tms and the emg activity of ankle extensor muscles during the stance phase of walking, while the ta ongoing emg activity is facilitated at a short - latency at early swing phase . At subthreshold tms intensities the excitability of spinal motor neurons at short latencies is influenced by intracortical inhibitory circuits and mechanisms [62, 64], including but not limited to intracortical and interhemispheric inhibition [6570], that in turn influence soleus or ta coupled corticomotoneuronal cells . These findings support that cortical excitability changes can be assessed in awake humans and that cortical cells with direct motoneuronal connections change their excitability during human walking . Corticospinal drive of human locomotion is further addressed in sections 3 and 4, whereas the cortical control of spinal reflex and interneuronal circuits is discussed . Various training protocols in uninjured subjects induce reorganization of corticospinal actions on lumbosacral motor neurons . For example, balance training decreased the ta and soleus mep amplitudes, while 32 min voluntary ankle dorsi- and plantar - flexion training increased the ta mep amplitude regardless of the stimulation intensity level . Repeated visuomotor skill training increased the maximal mep and decreased the stimulation intensity needed to evoke an mep, while opposite results were obtained after strength training, suggesting that reorganization of corticospinal actions on lumbosacral motor neurons depends on the type of training . In motor incomplete sci subjects at rest, meps are either absent or very small in amplitude with prolonged latencies, which are considered signs of impaired transmission of the fastest conducting corticospinal neurons [7477]. Further, the absent or small ta meps prevail in sci persons with increased foot drop . Further, the peak coherence in the 10 to 20 hz frequency band and synchronization within a narrow time band between paired ta emg recordings taken during the swing phase were absent during the swing phase and were positively correlated to the degree of foot drop . Because coherence in the frequency and time domain reflects the common synaptic drive, which may be corticospinal in origin, behavioral deficits in ambulatory sci persons are driven by impaired corticospinal excitability . Reorganization of corticospinal actions with training in neurological disorders has been shown in few studies . In 4 male sci subjects with tetraparesis, fmri showed a greater activation in sensorimotor cortical and cerebellar regions following 36 bwstt sessions consistent with the changes observed in the activation patterns of both hemispheres in poststroke subjects after 4 weeks of bwstt . Three - to-5 month bwstt enhanced the mep amplitude in 9 out of 13 muscles tested, increased the maximal mep, and changed the slope of the mep input - output curve in the majority of sci subjects tested while seated . Furthermore, in incomplete sci participants whom their locomotor function improved following treadmill training, the coherence (2440 hz) of emg activity, which is thought to indicate a common drive from corticospinal inputs, between antagonist muscles acting at the knee joint was increased and remained unaltered in participants that the locomotor ability was not improved . The lower - frequency coherence (518 hz), which is thought to contain common synaptic drive from spinal inputs, remained unchanged in both groups . One person (49 yo female, 5 years after - injury) with an american spinal injury association (asia) impairment scale (ais) d at thoracic 57 received 60 bwstt sessions (1 h / day; 5 days / week) with a robotic exoskeleton device (lokomat). Before training, the patient stepped at 0.5 m / s with 50% body weight support (bws), and after training the patient stepped at 0.89 m / s with 20% bws . Electrophysiological tests, illustrated as a schema in figure 1, were conducted before and after training in the same patient while seated as well as during bws assisted stepping . Data presented in this paper are original, have not been published elsewhere, and are from the same patient . All experimental procedures were approved by the institutional review board of the northwestern university irb committee and were conducted in compliance with the 1964 declaration of helsinki . The ta meps evoked at 1.3 ta mep threshold during assisted stepping before and after training are shown in figure 2 . (the ta mep threshold was established with the subject standing at equivalent bws levels to that utilized during stepping . During stepping, ta meps were evoked randomly at different phases of the step cycle every 3 to 5 steps based on the signal from the ipsilateral foot switch . The step cycle of the right leg was divided into 16 equal time windows or bins .) Before training, the ta mep amplitude was increased during early swing (bins 1013) when compared to that observed at midstance (bins 35), but an mep was not evocable from mid stance (bin 6) until swing phase initiation (bin 9). After training, the ta mep amplitude increased significantly compared to that observed before training and was modulated in a phase - dependent pattern; that is, it was progressively depressed during the stance phase (bins 17) and was facilitated during the swing phase (bins 914) (figure 2). This ta mep modulation pattern during assisted stepping is consistent with that reported in uninjured subjects, which is generally increased when the muscle from which it is recorded is active and small when the antagonist muscle is active [8284]. Although the findings reported in figure 2 are from a single case, the altered mep modulation pattern supports the notion that locomotor training alters the efficacy of corticospinal descending motor volleys synapsing with ta spinal motor neurons in a manner that supports a physiologic gait pattern . It is apparent that more studies are needed on the neuronal mechanisms mediating improvement of locomotor function after training in spinal lesions of different segmental levels and types, in order that currently available rehabilitation strategies are optimized . The spinal cord constitutes the final common pathway for segmental and supraspinal pathways underlying motor behavior . Electrical stimulation of a mixed peripheral nerve at low intensities activates primary (ia) afferent axons which synapse in the spinal cord . Alpha motor neurons activated monosynaptically by ia afferent volleys induce a synchronized reflex response known as the hoffmann-(h-) reflex, which is the electrical analogue of the monosynaptic stretch reflex . When the h - reflex is used as a test reflex, the effects of conditioning volleys from other afferents or descending tracts on the motoneuron pool and synaptic actions from different sources in health and disease can be assessed [85, 86]. Cortical control of spinal reflex circuits has been extensively investigated in awake humans by means of tms . Subthreshold tms produces a short - latency inhibition on the soleus h - reflex followed by a period of facilitation [56, 8789] with subjects at rest . In contrast, the ta h - reflex is facilitated at an early conditioning - test (c - t) interval . Superficial peroneal or sural nerve stimulation potentiates the presumably monosynaptic facilitation of the ta h - reflex evoked by brain stimulation . The cortical modulation of the soleus h - reflex depends largely on the position of the ankle joint, with subthreshold tms to induce an early long - lasting facilitation or depression of the soleus h - reflex during tonic plantar flexion and dorsiflexion, respectively [87, 91]. Similar findings have been reported for pyramidal monkeys, cats, and baboons during which cortical inhibition predominated on the soleus and gastrocnemius monosynaptic reflex, while cortical facilitation influenced largely flexor motor neurons [92, 93]. It should be noted, however, that a single cortical d wave could produce changes in segmental motor neurons in the primates but not in the cat that required d and i waves or multiple d - waves . In addition to the h - reflex, the ta long - latency (or m3) ankle stretch reflex was facilitated when the mep arrived in the spinal cord at the same time . However, subthreshold tms intensities delivered 5585 ms prior to the m3 depressed the long - latency ta stretch reflex . Because the long - latency response was reduced in size following subthreshold tms while the short - latency response remained unchanged [95, 96], it provides evidence that the long - latency stretch reflex is mediated in part by a transcortical path that can be affected by subthreshold tms . During human walking, subthreshold tms induces a short - latency, presumably monosynaptic, facilitation of the soleus h - reflex followed by a long - lasting inhibition . Because potentiation of ta meps was synchronized with the peak ta ankle stretch reflex, corticospinal pathways are partly involved in the generation of spinal stretch reflexes during human walking [97, 98]. In human sci, the conditioned h - reflex profile by subthreshold tms varied significantly based on the ais scores [99, 100]. In patients with severe paralysis (ais a - b) an early or late soleus h - reflex facilitation by tms was absent, suggesting for a nonphysiological interaction between descending inputs and spinal reflex excitability in patients with spastic paraparesis . Persistent changes in h- or stretch reflex amplitudes may be regarded as signs of learning and plasticity as a result of training, which have been shown after various training protocols . For example, 30 min ankle cocontraction training decreased the ratio of maximal h - reflex versus maximal m wave (hmax / mmax) and improved motor performance defined as the difference between the maximum and minimum torque displacements within 1 min . The soleus h - reflex amplitude was enhanced after 3 week isometric maximal plantar flexion training when measured at 20% and 60% of maximal voluntary contraction (mvc), with similar results to be reported after 14 week of resistance training that involved heavy weight - lifting exercises for the leg muscles with reflexes measured during maximal isometric ramp contractions . In contrast, 18 sessions eccentric strength training of the plantar flexor muscles for a 7 week period increased the hmax / mmax ratio during eccentric mvc but not during isometric or concentric contractions, suggesting that spinal reflex excitability is adjusted based on the type of exercise training protocol . Nonetheless, the aforementioned changes in h - reflex amplitude can result from modifications of interneuronal circuits interposed in the spinal pathway or by changes on the strength of descending pathways, since the latter is potent regulator of spinal reflex circuits behavior [105107]. This is supported by the failed operant conditioning of the h - reflex in rats when the corticospinal tract was transected at the spinal cord level [108, 109]. Limited evidence exists on plastic changes of the cortical control of spinal reflexes after locomotor training in neurological disorders . Forty bwstt sessions in 29 patients with incomplete sci reestablished the tms - induced long - latency soleus h - reflex facilitation with subjects at rest . It should be noted that bws improves the efficacy of the sensorimotor cortex function, decreases the ta mep threshold, and increases the map size for the ta in both hemispheres of stroke patients . Nonetheless, when tms effects on spinal reflexes are assessed with patients at a resting state, it cannot be assumed that corticospinal changes due to training are transferrable at a locomotor state and thus be functional relevant . This is largely based on that (1) short - latency ankle or quadriceps extensor reflexes (h- or stretch reflexes) are modulated in a phase - dependent pattern in uninjured subjects [113115], (2) the phase - dependent modulation of these reflexes is affected substantially in individuals with an sci [115117], and (3) cortical control constitutes one of the sources for the phasic patterned reflex excitability during human walking . In figure 3(a), the soleus h - reflex recorded during bws assisted stepping according to methods described in detail [115, 118, 119], before and after 60 bwstt sessions, is indicated for the same patient whose ta mep modulation pattern was described in figure 2 . After 60 bwstt sessions, the maximal reflex excitability shifted, with respect to the step cycle phase, from mid- to early stance (bins 13), while a maintained h - reflex excitability commonly observed throughout the stance phase in uninjured subjects was absent before and after training (figure 3(a)). However, after 60 bwstt sessions the soleus h - reflex amplitude increased during the late swing phase (bins 1216), consistent to a reflex behavior observed in some control subjects . The effects of subthreshold tms on the soleus h - reflex at a c - t interval of 1-ms during bws assisted stepping are indicated as a function of the step cycle before and after 60 bwstt sessions in figure 3(b). It is clear that, after 60 bwstt sessions, subthreshold tms affected substantially the soleus h - reflex during the stance phase resulting in a progressive increase of the soleus h - reflex amplitude . The soleus h - reflex amplitude was maintained throughout the stance phase (compare bins 18 in figures 3(a) and 3(b)). Modifications in synaptic actions of cortical inhibitory circuits exerted on soleus motor neurons might be the source of these changes since the phasic soleus h - reflex excitability during bws assisted stepping with or without leg assistance by a robotic exoskeleton remains unaltered [115, 118]. One of the spinal interneuronal circuits with paramount contribution to the neural control of movement is that of disynaptic reciprocal ia inhibition . Reciprocal inhibition refers to an automatic antagonist motor neuron inhibition when an agonist muscle contracts . Following an sci, the reciprocal inhibition is either reduced or replaced by reciprocal facilitation [121124] leading to coactivation of antagonist ankle muscles, spasticity, and poor movement performance . Regulation of locomotion by reflexly mediated spinal circuits that integrate sensory inputs is well established . The contribution of muscle afferents mediating information about the amplitude and rate of muscle stretch is easily recognized by the phase - dependent modulation of short - latency spinal reflexes during walking . The short - latency soleus and quadriceps extensor reflexes (stretch, tendon, or h - reflex) in humans are modulated in a way that promotes bipedal gait . The ankle stretch and soleus h - reflexes increase progressively from mid- to late stance in parallel with the soleus emg activity and are significantly depressed or abolished during the swing phase of gait [113115, 125]. A phase - dependent modulation has been demonstrated for the ankle stretch reflex in the high decerebrate mesencephalic cat . The soleus h - reflex depression during the swing phase in humans has been partly ascribed to reciprocal ia inhibition exerted from common peroneal nerve group i afferents on soleus motor neurons, which is regulated in a similar manner to that reported in animals and corresponds largely to absent reciprocal inhibition in the stance phase and maximal in the swing phase [127, 128]. During fictive locomotion in cats without brainstem connections, simultaneous extracellular recordings from ia inhibitory interneurons and intracellular recordings from lumbar motor neurons revealed that hyperpolarization of soleus motor neurons coincided with activity of ia inhibitory interneurons [129, 130]. Ia inhibitory interneurons were rhythmically active due to periodic excitation and not due to periodic inhibition by other spinal inhibitory interneurons . Recent evidence obtained from spinalized animals verified that reciprocal ia inhibition contributes to hyperpolarization of motor neurons during the inactive (flexion) phase of locomotion . Animal studies through intracellular recordings provided a detailed knowledge of the pathway and integration of segmental and supraspinal convergence at the interneuronal level [132135] with volleys in the corticospinal tract to exert an excitatory effect over ia inhibitory interneurons . In monkeys, intracortical stimulation revealed that the same interneurons mediate the disynaptic inhibition of motor neurons evoked by corticospinal fibers and the disynaptic inhibition of motor neurons evoked by group ia afferents of antagonist muscles . Further, motor neurons and ia inhibitory interneurons were activated in parallel by supraspinal centers in order to secure a coordinated contraction of agonists and relaxation of antagonists [138, 139]. Descending control of reciprocal inhibition in particular, the reciprocal inhibition exerted from common peroneal nerve group i afferents on soleus motor neurons was observed 50 ms before the onset of ta emg activity . Further, when subjects attempted to dorsiflex the ankle after the common peroneal nerve was blocked with a local anesthetic a strong soleus h - reflex depression was still evident . The test h - reflex facilitation, induced by tes applied to the scalp below the intensity needed to produce a motor response, was quickly terminated by subsequent arrivals of ipsps at the motor neurons . These ipsps might be produced by activity in ia inhibitory interneurons, which in monkeys receive monosynaptic tract projections . Single subthreshold tes reduced the inhibition of the flexor carpi radialis h - reflex evoked by radial nerve stimulation at a latency compatible with a monosynaptic or disynaptic corticospinal projection to ia inhibitory interneurons . Descending facilitation of ia inhibitory interneurons has also been documented for the human leg [87, 89]. Findings on the reorganization of reciprocal inhibition as a result of motor training in health and disease are limited . Stimulation of the common peroneal nerve with a train of 10 pulses at 100 hz with and without motor cortex stimulation potentiated reciprocal inhibition in control subjects . Reciprocal inhibition was potentiated after 12 sessions of ankle dorsiflexion strength training when measured at the onset of ankle dorsiflexion but remained unchanged when measured with subjects at rest . In figure 4, the mean amplitude of the soleus h - reflex conditioned by stimulation of common peroneal nerve group i afferents at a c - t interval of 3 ms and established according to methods outlined in detail, which represents the amount of reciprocal inhibition (rci), before and after 60 bwstt sessions with subject seated (same patient for data previously described in figures 2 and 3 is indicated as a percentage of the control h - reflex). Further, the soleus h - reflex conditioned by subthreshold tms at a c - t interval of 1 ms and the reciprocal inhibition conditioned by subthreshold tms (c - t intervals: 3 and 1 ms, resp .) As a percentage of the control h - reflex is indicated . It is apparent that locomotor training reestablished the reciprocal inhibition exerted from flexor group i afferents on soleus motor neurons, potentiated the soleus h - reflex depression following subthreshold tms, and potentiated the reciprocal inhibition conditioned by subthreshold tms, consistent with findings reported in uninjured subjects (see figure 4 in). The net effects of subthreshold tms on the reciprocal inhibition during bws - assisted stepping before and after 60 bwstt sessions are indicated in figure 5 for the same patient . The net effects (or net modulation) were estimated at each bin of the step cycle based on the equation (d - c)-(b - a) whereas a is the test soleus h - reflex (baseline soleus h - reflex modulation pattern during stepping), b is the soleus h - reflex conditioned by subthreshold tms, c is the soleus h - reflex conditioned by common peroneal nerve stimulation (i.e., reciprocal inhibition), and d is the reciprocal inhibition conditioned by subthreshold tms . Positive values indicate potentiation of reciprocal inhibition and negative values indicate attenuation of reciprocal inhibition . Locomotor training contributed significantly to attenuation of reciprocal inhibition exerted from ankle flexor afferents to extensor motor neurons during the stance phase . Most importantly, potentiation of reciprocal inhibition at swing phase initiation (i.e., bin 9 in figure 5) was evident . Adaptation of cortical control of reciprocal inhibition after locomotor training supports that changes of corticospinal neuronal pathways interacting with ia interneurons are possible in people with a chronic sci, although altered corticospinal interactions with other spinal inhibitory interneurons, such as renshaw cells and presynaptic inhibitory interneurons, cannot be excluded [85, 148, 149]. Sci changes the human body homeostasis leading to myriad changes of multiple systems . In most cases, the spinal cord is not completely severed and thus some fiber tracts and segmental spinal cord circuits remain intact . Based on the plastic capabilities of the central nervous system, it is apparent that the adult lesioned motor system reorganization occurs spontaneously after an injury and after training . Electrophysiological studies have shown that bwstt increases the mep amplitude, changes the common drive of antagonist muscles from corticospinal inputs with subjects seated, and alters the ta mep modulation pattern during bws assisted stepping . Further, bwstt reestablished the tms - induced long - latency soleus h - reflex facilitation and potentiated the short - latency soleus h - reflex depression following subthreshold tms with subjects at rest, while cortical modulation of the soleus h - reflex during stepping changed significantly . Lastly, bwstt changed the cortical control of reciprocal inhibition during bws assisted stepping in a manner that promotes bipedal gait . These findings support the notion that improvements in locomotor function from treadmill training are mediated, in part, by changes in the corticospinal drive of spinal reflex circuits, spinal interneuronal circuits, and output of leg muscles during walking . Plasticity in the brain and spinal cord underlying restoration of lost function can be driven by appropriately designed interventions [150, 151]. Development of such interventions depends largely on gaining a detailed understanding of the underlying neural mechanisms that support restoration of motor function . Based on this brief paper it is clear that there is a need for translational neuroscience research in order that the neural mechanisms underlying restoration of lost voluntary motor function are outlined based on specific clinical cases . This body of knowledge will contribute significantly to the development of new rehabilitation strategies and/or optimization of the currently available strategies, and to patient - orientated rehabilitation protocols promoting evidence - based rehabilitation.
|
Posterior reversible encephalopathy syndrome (pres) is a clinico - radiological entity characterized by a varying combination of symptoms and signs that include impaired consciousness, seizure activity, headache, visual abnormalities, nausea / vomiting, and focal neurological deficits.16)27) this syndrome was first reported by hinchey and colleagues in 1996.16) the syndrome is characterized by a primarily vasogenic edema of the subcortical white matter with a predilection for the parenchyma supplied by the posterior circulation, and is potentially reversible.4) however, recognition of atypical imaging findings, such as varied distribution patterns, cytotoxic edema, infarction, hemorrhage, and contrast enhancement has recently increased.15)32) however, many patients are still not diagnosed during the initial stage . Studies have reported on precipitants of pres, such as hypertension, acute renal failure, eclampsia, blood transfusion, infection, sepsis, radio - contrast, and immunosuppressive agents, and certain cytotoxic medications . Pres must be taken into consideration; radiological studies, particularly magnetic resonance imaging (mri), should be performed . Without immediate diagnosis and administration of appropriate treatment, which have the greatest effect on prognosis, progression to ischemia, infarction, and death might occur . The aim of this study is to identify the clinical and radiological findings of all patients who were admitted to our institution with a diagnosis of pres, and to review the current literature on this syndrome . The radiological report data bases, involving the neurosurgery, neurology, cardiovascular, oncology, rheumatology, and obstetrics departments of the author's affiliated hospitals were searched for the following items cited on brain mri reports from january 2006 to december 2012: pres, posterior reversible encephalopathy, posterior reversible leukoencephalopathy, preeclampsia and eclampsia, toxemia of pregnancy, hypertensive encephalopathy, and hypertensive crisis . Patients included in this study had a clinical presentations and specific radiological abnormalities consistent with pres . The following criteria were used in final diagnosis of pres: typical clinical presentation of pres, including headaches, visual disturbance, altered mental functioning, and seizures with an underlying etiology such as hypertension, drug toxicity . Also included were other common causes, like renal involvement with renal insufficiency and infection supported by imaging of brain parenchyma that demonstrated signal changes on t2 weighted images and fluid - attenuated inversion recovery (flair) images as well as apparent diffusion coefficient (adc) values . We collected data on demographics, predisposing conditions, presenting symptoms, co - morbidities, blood pressure measurements at the initial stage and time to clinical recovery . All neuroimages (including brain computed tomographs [ct] and mris) were reviewed by study neuroradiologists for identification of various anatomical regions and atypical features of pres (fig . We identified 16 patients (10 females and 6 males). Mean age at presentation was 47 21.6 years (range, 12 - 83). The most common clinical presentation was seizure, observed in 12 patients (75%) including 10 patients (83.3%) with generalized tonic - clonic seizures, and 2 patients (16.7%) with partial seizures . Other clinical presentations included decreased consciousness in 3 patients (18.8%), severe headache in 4 (25%), and visual disturbances in 2 (12.5%). Comorbid conditions included hypertension (n = 4, 25%), cytotoxic medications (n = 3, 18.8%), sepsis (n = 4, 25%), malignancy (n = 4, 25%), subarachnoid hemorrhage (n = 1, 6.3%), autoimmune disorders (n = 1, 6.3%), and eclampsia (n = 1, 6.3%). Mean peak systolic blood pressure at symptom onset was 159.7 (range, 120 - 200) and diastolic was 94.6 mmhg (range, 80 - 130). Malignancy was present in 4 (25%) patients and included invasive ductal carcinoma, metastatic carcinoma, urethral adenocarcinoma, and cecal adenocarcinoma . One of these 2 patients had urethral adenocarcinoma treated with cisplatin; the other had cecal adenocarcinoma treated with 5-fluoruracil / oxaliplatin . All patients underwent initial neuroimaging with either brain ct scan (n = 5) or mri (n = 11). Parietal lobe involvement was observed in 13 (81.3%) patients, occipital in 13 (81.3%), frontal in 7 (43.8%), and temporal in 2 (12.5%). The cerebellum was involved in 2 (12.5%) patients, brain stem in 3 (18.8%), thalamus in 3 (18.8%), and basal ganglia in 4 (25%). Eleven patients (68.8%) underwent diffusion - weighted imaging (dwi) and adc mapping . Among them, 9 patients (81.8%) had hypo- or isointensity on dwi . On the adc map, 10 patients (90.9%) had hyperintensity, and the other had normal values . The radiological spectrum of lesion distribution of 16 patients with pres was described in table 2 . Corrections of severe hypertension, treatment of seizure, and removal or reduction of causative medications are mandatory . Hypertension was treated with intravenous antihypertensive drug, usually nicardipine or labetalol . In patients with presenting seizure or we usually prefer to use intravenous antiepileptic drugs (benzodiazepines, valproate or levetiracetam). Following administration of antiepileptic and antihypertensive drugs, her neurologic symptoms recovered fully 3 days later . After dose reduction of cisplatin, she tolerated the remaining cycles of chemotherapy . In the patient with behcet disease and pemphigus vulgaris, cyclosporine - her symptoms improved 1 week after the control of hypertension and discontinuation of cyclosporine - a (case 16). Clinical recovery occurred within a mean duration of 5.7 4.6 days (range, 2 - 15). We identified 16 patients (10 females and 6 males). Mean age at presentation was 47 21.6 years (range, 12 - 83). The most common clinical presentation was seizure, observed in 12 patients (75%) including 10 patients (83.3%) with generalized tonic - clonic seizures, and 2 patients (16.7%) with partial seizures . Other clinical presentations included decreased consciousness in 3 patients (18.8%), severe headache in 4 (25%), and visual disturbances in 2 (12.5%). Comorbid conditions included hypertension (n = 4, 25%), cytotoxic medications (n = 3, 18.8%), sepsis (n = 4, 25%), malignancy (n = 4, 25%), subarachnoid hemorrhage (n = 1, 6.3%), autoimmune disorders (n = 1, 6.3%), and eclampsia (n = 1, 6.3%). Mean peak systolic blood pressure at symptom onset was 159.7 (range, 120 - 200) and diastolic was 94.6 mmhg (range, 80 - 130). Malignancy was present in 4 (25%) patients and included invasive ductal carcinoma, metastatic carcinoma, urethral adenocarcinoma, and cecal adenocarcinoma . One of these 2 patients had urethral adenocarcinoma treated with cisplatin; the other had cecal adenocarcinoma treated with 5-fluoruracil / oxaliplatin . All patients underwent initial neuroimaging with either brain ct scan (n = 5) or mri (n = 11). Several topographic mr imaging patterns of pres have been described (fig . Parietal lobe involvement was observed in 13 (81.3%) patients, occipital in 13 (81.3%), frontal in 7 (43.8%), and temporal in 2 (12.5%). The cerebellum was involved in 2 (12.5%) patients, brain stem in 3 (18.8%), thalamus in 3 (18.8%), and basal ganglia in 4 (25%). Eleven patients (68.8%) underwent diffusion - weighted imaging (dwi) and adc mapping . Among them, 9 patients (81.8%) had hypo- or isointensity on dwi . On the adc map, 10 patients (90.9%) had hyperintensity, and the other had normal values . The radiological spectrum of lesion distribution of 16 patients with pres was described in table 2 . Corrections of severe hypertension, treatment of seizure, and removal or reduction of causative medications are mandatory . Hypertension was treated with intravenous antihypertensive drug, usually nicardipine or labetalol . In patients with presenting seizure or decreased consciousness were treated antiepileptic drugs . We usually prefer to use intravenous antiepileptic drugs (benzodiazepines, valproate or levetiracetam). Following administration of antiepileptic and antihypertensive drugs, her neurologic symptoms recovered fully 3 days later . After dose reduction of cisplatin, she tolerated the remaining cycles of chemotherapy . In the patient with behcet disease and pemphigus vulgaris, cyclosporine - her symptoms improved 1 week after the control of hypertension and discontinuation of cyclosporine - a (case 16). Clinical recovery occurred within a mean duration of 5.7 4.6 days (range, 2 - 15). A unique pattern of brain vasogenic edema seen in the setting of neurotoxicity has been recognized as pres associated with eclampsia, cyclosporine after organ transplantation, and severe hypertension.35) however, the mechanism involved in development of pres is uncertain . Although several theories are proposed, the one having the widest acceptance suggests that rapid development of hypertension results in malfunction of cerebral autoregulation, with the posterior head region being particularly affected (where fewer sympathetic innervations occur), followed by hyperperfusion with extravasation of protein and fluid, resulting in development of focal vasogenic edema.16)26)30) an alternative theory, associated primarily with preeclampsia, eclampsia, and sepsis, suggests involvement of endothelial dysfunction.2)10) another theory implicates vasospasm with subsequent ischemia.23)33) pres without hypertension is reported in 20 - 40% of patients.4 - 6) in the majority of cases, although hypertension (moderate to severe) is present, reported blood pressure at neurotoxicity does not reach the limit of autoregulation.3)4) in addition, several recent studies report that patients with severe hypertension showed less vasogenic edema than normotensive patients . This result would be unexpected if the mechanism of pres was severe hypertension with failed autoregulation.3)5) the majority of our patients (82.3%) showed acute elevation of blood pressure . Considering the common major conditions associated with development of pres, such as transplantation, autoimmune disease, preeclampsia / eclampsia, cancer chemotherapy, infection and sepsis, some degree of endothelial injury appears to be a consistent finding.4)10) in our study, pres was observed in association with a wide range of disorders and predisposing conditions, ranging from hypertension, eclampsia to sepsis, subarachnoid hemorrhage, and exposure to cytotoxic drugs as well as behcet diseases . Association of high - dose multidrug cytotoxic chemotherapy with pres, particularly in children with leukemia, has also been reported.9) in additionally, pres has been reported in association with the following chemotherapeutic drugs: cytarabine, cisplatin, gemcitabine, and bevacizumab.14)17) symptoms may occur over a period of several days although may only be observed in an acute setting . In our series, 2 patients received chemotherapy for malignancy . One of these patients had urethral adenocarcinoma treated with cisplatin . After dose reduction of cisplatin, she tolerated the remaining cycles of chemotherapy . Her symptoms improved 1 week after the control of hypertension and discontinuation of cyclosporine - a (case 16) (fig . Cyclosporine - a can affect vascular endothelium, cause disruption of the blood - brain barrier, and increase arterial blood pressure.21)29) when such complications occur, the offending drug should be withdrawn immediately . Generalized seizure is a common occurrence in patients with pres (80 - 90%).16)20) seizure is related to the location of the focal brain abnormality that provokes an epileptic focus, because locations associated with pres occur most often in parieto - occipital lobes . On radiological finding, pres typically presents as vasogenic edema, most often involving the posterior white matter of the cerebral hemispheres, particularly the bilateral parieto - occipital lobes, usually without involvement of the calcarine and paramedian occipital - lobe.16) dwi can be helpful in identification of cytotoxic or vasogenic edema and evaluation of the potential for occurrence of complications such as ischemia or infarction.1)13)18)28) vasogenic edema typically shows iso or hypointensity in dwi and hyperintensity on the adc map, and cytotoxic edema shows hyperintensity on dwi and hypointensity on the adc map.24)29) in our series, 11 patients (68.8%) underwent dwi and adc mapping . Among them, 9 patients (81.8%) had hypo- or isointensity on dwi . On the adc map, 10 patients (90.9%) had hyperintensity, and the other had normal values . Although the parietal and occipital lobes are primarily involved, other cerebral structures are often affected . Atypical manifestations include brainstem variant or involvement of the frontal lobes, basal ganglia, brainstem, and deep cerebral white matter, with minimal high signal intensity on the parieto - occipital lobes (fig . 1).1)19) however, frequent frontal lobe involvement, rather than atypical localization, has recently been described . Therefore, the hypothesis of less sympathetic innervation of arterioles supplied by the vertebrobasilary system, compared with the anterior circulation, which presumably protects the brain from sudden significant increases in intravascular pressure, is not completely accurate.12) we frequently observed these atypical imaging presentations in our patients, especially in those with frontal lobe involvement, observed in 43.8% of patients . Treatment of elevated blood pressure is regarded as being essential in management of pres . The general goal of treatment is to decrease the mean blood pressure to that of premorbid levels . A neurocritical care unit, which allows for close consultation with other specialties according to the underlying systemic condition, is considered the best setting for management of pres . In treatment of pres, there are several important considerations: (1) elimination or reduction of the causative drug, (2) aggressive management of blood pressure in patients with hypertension, (3) treatment of seizures and status epilepticus, and (4) possible delivery by cesarean section for pregnant women who exhibit refractory symptoms.31) prompt administration of adequate treatment will usually result in complete reversal of pres within several days to several weeks.16)20) in our studies, the mean clinical recovery period was 5.7 4.6 days (range, 2 - 15). Of particular importance, reversal of pres in addition, delayed diagnosis and treatment may result in permanent damage to affected areas of the brain.8) ischemia is a major complication of pres, and characteristically occurs in the posterior border zone between the territories of the middle and posterior cerebral arteries.8) delay of diagnosis and treatment can result in permanent damage to affected brain tissues . Several limitations of our study should be considered, most of which are inherent to retrospective studies in general . Patient enrollment was initially based on a search of radiology reports; therefore, some cases may have been missed . Although it is a well - known condition among neuroradiologists, many physicians working in critical areas are still not familiar with pres . Physicians should be aware of atypical radiological findings to avoid a delayed diagnosis of pres, as delayed diagnosis and treatment can result in permanent neurological sequlae.
|
Otitis media with effusion (ome) is a disease that's characterized by the presence of fluid in the middle ear . Despite the substantial investigation that has been done on ome, several cytokines, including interleukin-1beta (il-1), il-8 and tumor necrosis factor - alpha (tnf-), and complement c3 are considered to play key roles in the initiation and maintenance of the inflammatory response in ome (1 - 3). The th-2-driven cytokines il-4, il-6, and tnf- may contribute to the allergy - related persistence of ome (4). More knowledge concerning the pathomechanisms of ome and the contributing cytokines is needed to develop truly efficacious treatment and prevention strategies . Heat shock proteins (hsps) are essential for the survival of cells that are undergoing environmental stress . Various families of hsps, including hsp90, hsp70, hsp60, and hsp27, have been categorized based on their molecular weights and functional attributes (5). Their synthesis is enhanced by exposure to a variety of detrimental conditions such as heat, toxins, oxidative stress and glucose deprivation (6). Hsp70 is expressed in the middle ear mucosa of experimentally induced acute otitis media (aom) (7, 8). Even though it has been considered that hsps mainly function as molecular chaperones, they also appear to be involved in diverse biological activities such as apoptosis, carcinogenesis and cytoprotection from cytotoxic damage . The cytoprotective role of hsp 70 and the relationship between hsp70 and inducible nitric oxide synthase (inos) has recently been studied in gastritis induced by the pathogenic bacterium helicobacter pylori (9). The latter study is intriguingly germane to otolaryngology because of the similar pathomechanisms that are involved in the inos pathway . In another study, the proteomic analysis of murine skin demonstrated that hsp70 is an important mediator of allergic contact hypersensitivity, which indicates that inhibiting its activity may be beneficial for preventing autoimmune and immunological hypersensitivity diseases (10). Considering its confounding effect on various inflammatory processes, hsp70 may well be important in the pathoetiology of diseases that affect different organs, or at different stages of a disease . To the best of our knowledge, there have been no published reports concerning the expression and the possible role of hsp70 in the middle ear effusion (mee) of humans during the disease process of ome . Here we report for the first time on the expression of hsp70 in human mee and its possible role in the chronicity of ome as an inflammatory mediator or indicator . A total of 30 ears from children aged 9 months to 15 yr (mean age, 4.13.6 yr) and who had chronic ome for more than 2 months (range, 2 to 10 months) and 38 ears from adults who were medically treated and observed for their ome for at least 1 month and who were undergoing myringotomy or tympanotomy tube placement at seoul st . The study has been approved by the institutional review board of the catholic medical center (seoul st . The adults were subgrouped according to their previous history of head and neck region radiation therapy (received or not received) as their concomitant cancer treatment to observe the difference in the cytokine and hsp70 expressions in the mee between the two groups . To collect the various types of the mee without any loss, we designed a mee sampling system that consisted of a 1 cc tuberculin syringe, a long and thin intravenous (i.v .) Catheter and different sizes of blunt spinal needles (17 - 23 g), as shown in fig . The nature of the fluid (serous, mucous or seromucous) was determined by the attending surgeon . Serum - like yellowish clear fluid without any viscosity was considered as serous, and thick viscous fluid that was hard to collect was considered as mucous . The clinical data concerning ome was obtained from the participants by using a specially designed questionnaire . The information obtained included the frequency of tympanostomy tube insertion, the duration of ome and the allergy history of each patient . An audiology test measuring the pure tone averages of the air and bone conduction hearing levels at the speech frequency was performed preoperatively for most of the patients . The total protein was assayed using a bradford - based commercial kit (biorad, hercules, ca, usa) with bovine serum albumin as a standard . The tnf-, il-1 and hsp70 levels in the mee were determined using a specific enzyme - linked immunosorbant assay (elisa) kit for human tnf- (biosource, camarillo, ca, usa), human il-1 (r&d systems, minneapolis, mn, usa) and hsp70 (stressgen biotechnologies, victoria, bc, canada) according to the instructions of the particular manufacturer . One - way anova, chi - square tests and standard pearson correlation tests were used to compare the clinical data, the hearing levels, the nature of the fluid, the total protein and the tnf-, il-1 and hsp70 levels in the different groups . A total of 30 ears from children aged 9 months to 15 yr (mean age, 4.13.6 yr) and who had chronic ome for more than 2 months (range, 2 to 10 months) and 38 ears from adults who were medically treated and observed for their ome for at least 1 month and who were undergoing myringotomy or tympanotomy tube placement at seoul st . The study has been approved by the institutional review board of the catholic medical center (seoul st . The adults were subgrouped according to their previous history of head and neck region radiation therapy (received or not received) as their concomitant cancer treatment to observe the difference in the cytokine and hsp70 expressions in the mee between the two groups . To collect the various types of the mee without any loss, we designed a mee sampling system that consisted of a 1 cc tuberculin syringe, a long and thin intravenous (i.v .) Catheter and different sizes of blunt spinal needles (17 - 23 g), as shown in fig . The nature of the fluid (serous, mucous or seromucous) was determined by the attending surgeon . Serum - like yellowish clear fluid without any viscosity was considered as serous, and thick viscous fluid that was hard to collect was considered as mucous . The clinical data concerning ome was obtained from the participants by using a specially designed questionnaire . The information obtained included the frequency of tympanostomy tube insertion, the duration of ome and the allergy history of each patient . An audiology test measuring the pure tone averages of the air and bone conduction hearing levels at the speech frequency was performed preoperatively for most of the patients . The total protein was assayed using a bradford - based commercial kit (biorad, hercules, ca, usa) with bovine serum albumin as a standard . The tnf-, il-1 and hsp70 levels in the mee were determined using a specific enzyme - linked immunosorbant assay (elisa) kit for human tnf- (biosource, camarillo, ca, usa), human il-1 (r&d systems, minneapolis, mn, usa) and hsp70 (stressgen biotechnologies, victoria, bc, canada) according to the instructions of the particular manufacturer . One - way anova, chi - square tests and standard pearson correlation tests were used to compare the clinical data, the hearing levels, the nature of the fluid, the total protein and the tnf-, il-1 and hsp70 levels in the different groups . The patients were 30 children (mean age, 4.1 yr), 27 adults who had not received radiation therapy (mean age, 62.5 yr) and 11 adults who had received radiation therapy (mean age, 58 yr). The gender distribution, the duration of ome and the hearing levels among the three different groups were not significantly different . The number of previous tympanostomy tube insertions was higher for the adults who had not received radiation therapy . Almost all the effusions in the children were mucous or seromucous in nature, whereas most of the adult effusions were serous . These observations are consistent with those previously reported for adult ome (11, 12). Hsp70 was detected in all the mees in the three study groups, but the level varied quantitatively (6444 ng / ml for the children, 4832 ng / ml for the adults who had not received radiation therapy and 4133 ng / ml for the adults who had received radiation therapy). The average concentration of tnf- in the mee was 232453 pg / ml for the children, 4484 pg / ml for the adults who had not received radiation therapy and 4247 pg / ml for the adults who had received radiation therapy (fig . The il-1 mee level was highest in the children (743931 pg / ml), followed by that in the adults who had received radiation therapy (114248 pg / ml) and that in the adults who had not received radiation therapy (3888 pg / ml). The latter's il-1 mee level was significantly different from that of the children (p<0.05). No other statistically significant differences between the groups were evident for il-1 (fig . 2c) the levels of hsp70 in the mucous and seromucous effusions were significantly higher than that of the serous effusion (p<0.05). A similar phenomenon was observed for the levels of tnf- in the mee (p<0.05). However, the il-1 levels did not show any meaningful differences in the different types of effusion (table 2). The hsp70 level was correlated with the levels of tnf- (r=0.48) and il-1 (r=0.31) in the effusions . The positive correlations between hsp70, tnf- and il-1 were statistically significant (p<0.05). There was no correlation evident between the level of hsp70 and age, but negative correlations were evident between tnf-/il-1 and age . The levels of all three cytokines were not significantly correlated with the amount of mee (table 3). The patients were 30 children (mean age, 4.1 yr), 27 adults who had not received radiation therapy (mean age, 62.5 yr) and 11 adults who had received radiation therapy (mean age, 58 yr). The gender distribution, the duration of ome and the hearing levels among the three different groups were not significantly different . The number of previous tympanostomy tube insertions was higher for the adults who had not received radiation therapy . Almost all the effusions in the children were mucous or seromucous in nature, whereas most of the adult effusions were serous . These observations are consistent with those previously reported for adult ome (11, 12). Hsp70 was detected in all the mees in the three study groups, but the level varied quantitatively (6444 ng / ml for the children, 4832 ng / ml for the adults who had not received radiation therapy and 4133 ng / ml for the adults who had received radiation therapy). The quantitative differences were not statistically significant (fig . The average concentration of tnf- in the mee was 232453 pg / ml for the children, 4484 pg / ml for the adults who had not received radiation therapy and 4247 pg / ml for the adults who had received radiation therapy (fig . The il-1 mee level was highest in the children (743931 pg / ml), followed by that in the adults who had received radiation therapy (114248 pg / ml) and that in the adults who had not received radiation therapy (3888 pg / ml). The latter's il-1 mee level was significantly different from that of the children (p<0.05). No other statistically significant differences between the groups were evident for il-1 (fig . 2c). The levels of hsp70 in the mucous and seromucous effusions were significantly higher than that of the serous effusion (p<0.05). A similar phenomenon was observed for the levels of tnf- in the mee (p<0.05). However, the il-1 levels did not show any meaningful differences in the different types of effusion (table 2). The hsp70 level was correlated with the levels of tnf- (r=0.48) and il-1 (r=0.31) in the effusions . The positive correlations between hsp70, tnf- and il-1 were statistically significant (p<0.05). There was no correlation evident between the level of hsp70 and age, but negative correlations were evident between tnf-/il-1 and age . The levels of all three cytokines were not significantly correlated with the amount of mee (table 3). Hsps are crucial for the maintenance of cell integrity during both normal cell growth and pathophysiological conditions (13). Their expressions are induced by various conditions such as heat, oxidative stress and drug exposure; the type of hsp induced and its level of expression are responsible for the fate of a cell in response to stress or stimulus (14). Hsp70 is expressed during the inflammatory process of experimentally induced mee by bacterial inoculation (7). However, there has been no report regarding the hsp70 expression or its quantification in human ome . Yet given that this protein has been detected in the middle ear mucosa of an experimental model of aom (7), we hypothesized that hsp70 could be expressed in the mucosa of the middle ear during the disease process of human ome, and it could be secreted from the inflamed mucosa to the mee . The mee hsp70 levels in the current study were measured using elisa and the level of this protein was compared to other well - known early onset cytokines such as tnf- and il-1 in the mees . The levels of hsp70 in human mee and their correlations with the nature of the effusion and the other clinical characteristics have not been previously reported on . For the proper collection of mee, we developed the collection system (park's mee collection system) shown in fig . Moreover, its long, thin i.v . Catheter connected to the back side of a 1 ml tuberculin syringe enabled controlling the suction power, which prevents loss of the mee . A third advantage is the various sized blunt spinal needles that are directly connected to the tuberculin syringe, which eases the collection of different types of mee, including the fluid that is thick and mucous in nature . The direct collection of mee using the graded tuberculin syringe provides an easy, accurate means of measuring the volume of the recovered mee . Finally, the collected mee can be directly stored in the syringe, which lessens the possibility of contamination or the loss of the mee . Indeed, hsp70 was detected in the mucous, seromucous and serous mees . The higher level detected in the mucous and seromucous effusions, as compared to the serous effusion, suggests that hsp70 should be considered as another cytokine that may be related with the chronicity of ome . Hsps are crucial for the maintenance of cell integrity during both normal cell growth and pathophysiological conditions (13). For example, those guinea pig gastric mucosal cells in which hsps have been induced by heat shock treatment can show considerable resistance to injury induced by ethanol (15). The cytoprotective mechanism of hsps in various stressful conditions has been revealed by modulating the expression of an enzyme that causes tissue damage . In rat pulmonary artery smooth muscle cells, the expression of il-1-induced inos can be inhibited by a preinduced hsp70 expression (16). After challenge with endotoxin, the induced hsp 70 expression in the mesenteric artery, lung and liver can significantly attenuate hypotension and it can up - regulate the inos m rna expression in rats (17). Inos is expressed in the middle ear mucosa when the inflammatory reaction is initiated by various types of insults (18, 19), and inos is also induced by early onset cytokines, including il-1 and tnf-, in a mee . The latter inductions might be related to the cytoprotective role of hsp70 in ome, as was shown in other tissues . From the beginning of this study, we hypothesized that the mee in different age groups (adults and children) and in the groups with a definitive causal factor such as estachian tube dysfunction after radiation therapy (adults with rt) or without a definitive causal factor (adults without rt) might show different cytokine levels and hsp70 levels . We found the difference of the early cytokine expressions in the different age groups, but we could not find any difference of the early cytokine expressions in the two different adult groups . We could conclude that the disease process of mee in adults and children seemed to be different, whereas the mee in adults with or without rt did not seem to have a different inflammatory process . Since there is well known longevity of the disease process from the serous effusion to the seromucous infusion to the mucous effusion in ome, we can postulate that the nature of the fluid might represent the chronicity of the disease here in our study . The result of our study showed that hsp70 and tnf- were highly expressed in the mucous mee, and that the hsp70 level was positively correlated with the levels of tnf- and il-1. In the previous study by nell and grote (20), early cytokines such as tnf- and il-1 were expressed at a higher level in the mucous effusion than that in the in serous effusion, which was the same result as ours . We could not find any significant difference in the hsp70 level according to the age group . These results support the contention that the hsp70 in mee could be a cytokine that is secreted from the middle ear mucosa and it is a good indicator of disease chronicity . Considering the positive correlation between hsp70 and tnf-/il-1 we can also postulate a possible representative role for hsp70 as a cytoprotectant of the middle ear mucosa during ome . We can suggest the possible pathomechanism of the hsp70 expression in the mee during the disease process of ome and its relationship with the other early cytokines . During the early stage of ome that is evident as serous effusion, generation and secretion of inflammatory mediators, including tnf- and il-1 might be low and so this would not lead to a high expression of hsp70 in the middle ear mucosa . As the disease progresses, the higher generation of the inflammatory mediators in the middle ear mucosa would lead to the higher expression of hsp70 in the middle ear epithelial cells and its secretion into the mee . Future experiments designed to investigate the inos expression in mee, which might be related to the expression of hsp70, could be helpful for understanding the disease process of ome . Further studies to investigate the more precise functional role of hsp70 in ome will be necessary to provide clues regarding other perspectives on the pathomechanism and treatment of ome . We performed this study to investigate the possibility of an hsp 70 expression in human mee and to examine its potential role as a cytokine during the disease process of ome . The study results show that hsp70 is expressed in the various types of human mee and the hsp70 level is positively correlated with the levels of other cytokines in mee . As far as we can determine the highly elevated level of hsp70 in the seromucous and mucous effusions indicates that this protein might be related with the chronicity of this disease . The specially designed mee collection system (park's mee collection system) that was successfully used during this study should prove to be valuable when conducting future studies on human mee.
|
The traditional approach to wound care was that it was delivered by individual specialists and disciplines . Gottrup proposed to gather these specialists and disciplines together in a single team to deliver standardized protocol based treatment with optimal resource allocation . The centres would deliver a broad spectrum of wound care and through exposure to multiple cases develop expertise and credibility in advanced wound management . An important element of the treatment would be to demonstrate the cost - effective nature of interventions . He estimates the prevalence of chronic wounds to be about 1% of the population; that is to say roughly 50,000 - 60,000 people in denmark have chronic wounds and these can be managed in two wound healing centres . Gottrup is talking about are those most often associated with degenerative or acquired diseases such as diabetes, venous hypertension or ischaemia . Well yes they can and do and one of the most devastating inherited skin conditions affecting children is epidermolysis bullosa, particularly recessive dystrophic epidermolysis bullosa (rdeb). This is a rare condition and the prevalence is difficult to determine but has been calculated to be of the order of 1 in a million population . The contrast then, between chronic wounds in children and chronic wounds in adults is conspicuous when it come to numbers . It is the number factor which is very relevant if considering whether the concept of an advanced wound care centre exclusively for children is economically viable . There can be few, if any, places in the world where such a model, as exemplified by the adult advanced wound care centre, has been directly transferable to children . And yet there are conditions that severely affect the quality of life of children which could be treated in a similar setting of advanced specialist care . When such cases are grouped together they can reach a critical mass that renders such a concept cost - effective and economically viable . This then is the background to the concept of an advanced skin, scar and wound care centre specifically for children . A logo had to be quickly designed for invitation to a fund raising event [figure 1]. And what is important here is that the team is evenly balanced between clinical and laboratory based scientists delivering individualized, specialized care to children with rare or debilitating, physically or psychologically, skin conditions that severely impair the child's quality of life . The logo depicting a father, mother and baby in simple brush strokes the organizational structure of the centre the conceptual simplicity, i.e. A two layer structure comprising epidermis and dermis belies the unfathomable biological complexity of the largest organ in the body . The ectodermally derived epithelial layer can be identified early in foetal development and the integrity of this layer, the epidermis, is essential for survival . It is obvious that as skin covers our bodies throughout intrauterine and post - natal life that it must be continually adapting and changing in response to growth, the environment and age . Skin is a multi - functional organ and key elements of protection are served by the stratum corneum, the layer of dead cells that sustain human life . The structural arrangement of the epidermis represents a gradient of metabolic activity with intracytoplasmic changes in the terminally differentiating keratinocyte arising from the transit amplifying cells lying on the basement membrane [figure 3]. The epidermis is mechanically weak and the major contribution of the structural integrity and remarkable biomechanical properties of the skin are provided by the dermis . The dermis is comprised mainly of the fibrillar protein, collagen and elastin together with a non - fibrillar extracellualr matrix of proteo - glycans and glycosamino - glycans . The morphological structure of the dermis allows for stretching and recoil which gives the skin remarkable elastic properties that can be appreciated by observing the skin on the hands as a fist is clenched and unclenched . There are cells within the dermis, mainly fibroblasts but in addition there are blood vessels and sensory endorgans . The epidermis also invades the dermis with ectodermally derived structures that contribute to the structure and function of the skin . Sweat glands play a role, albeit minor, in thermoregulation and also play some part in excretion and water and electrolyte balance . Sebaceous glands produce sebum, a predominantly triacylglycerol secretion that has lubricating and antibacterial actions . Hair follicles occur in skin from all parts of the body apart from the glaberous areas; palms, soles, lips and labia minora and glaun penis . Hair is a highly diverse biological feature again with multiple biological, functions and diverse cultural significance . The conceptual simplicity of the skin belies a biological complexity and then we have this incredible molecular assembly that joins the epidermis to the dermis forming the dermal epidermal junction (dej). When looking at the discipline of paediatric dermatology it is evident that a vast array of congenital and acquired anomalies arise which can seriously affect a child and indeed their families, quality of life . In the context of the centre proposed the majority of paediatric skin problems can be very effectively managed with creams, lotions, emollients and other non - surgical strategies . It is also evident that many surgically related congenital anomalies or pathology affecting the skin can be most adequately treated by paediatric and/or plastic surgeons . Figure 4 shows four children with extensive areas of darkly pigmented skin . In two of the children the skin only is involved and the diagnosis in each case is a giant hairy naevus . In the other two cases deeper tissues and structures are also abnormal and the diagnosis is hamartoma . This technique has been used in clinical plastic surgery for over a quarter of a century and yet the fundamental biology of tissue expansion remains a mystery . This is just one example of where clinical plastic surgery is operating far in advance of scientific understanding . The two children on the left have grant hairy naevae; the two on the right have hamartomas another example is in the clinical application of tissue engineered products . Excision is performed using a needle tipped unipolar diathermy set on coagulation mode . Using a slow and meticulous technique that uses electrical arcing rather than physical contact a large bloodless field can be created with minimal deposits of charred tissue . The periphery has been infiltrated with lignocaine and adrenaline solution and the margin of the lesion incised with a knife down to the deep dermal layer . The diathermy has been described previously in the indian journal of plastic surgery and incorporates suction to remove the carcinogenic smoke [figure 6]. A giant hairy naevus involving 18% body surface area is excised needle point, hand held, cantery with suction tube attached (ref 2) again plastic surgery leads the surgical specialties in the clinical application of tissue engineered products . This patient is having the defect reconstructed with a dermal regeneration template, integra figure 7 . This is a stage process with the application of the tissue engineered material, the biodegradation of the engineered matrix and its replacement with autologous collagen which is covered with a very thin autologous skin graft . Figure 9shows another patient who had a giant hairy naevus of the right lower leg removed one year before . The appearance of the reconstructed leg is very acceptable although there is still room for improvement . The new skin, for example does not contain appendageal structures and this again is a focus of laboratory research . There are great prospects for combing tissue engineering a stem cell product in the future . Of interest the first case where integra was used in reconstructive plastic surgery rather than acute or reconstructive burns surgery involved a child with a suspicious pigmented naevus on her right lower leg . It is evident that there will be new and exciting developments in the field of cell and tissue engineering in the future . The stages of integra application early appearance of reconstructed skin late appearance of reconstructed skin a six year follow up of the world's first case where integra was used for a non - burn related application a scar is the result of natures attempt to repair a disruption in the extracellular matrix in an organ or tissue . Scarring is very evident in the skin and can cause significant functional disability as well as distressing deformity [figure 11]. Reconstructive plastic surgery can do a great deal to help in restoring form and function [figures 12 and 13]. However to achieve what we describe as metamorphosis for children whose lives are seriously affected, being prisoners within their walls of scar tissue, the route to freedom can be long and complex . The girl depicted in figure 14 needed long term planning to create new tissue for reconstructive surgery and illustrates the long term view of reconstruction and scar wars. Other forms of scarring do occur and we have previously postulated that one day the approach to keloid scarring will be to undertake a biomolecular characterization of the scar and individualize the treatment . Our experience of using stem cell rich cell culture to treat keloids have been previously reported and figure 15 shows the eight year follow up of our original case . Bilateral pedicled ld flaps deformity and disability standing tall and happy metamorphosis combines surgery, tissue engineering tissue expansion and stem cell applications keloid scar post burn but why focus on scarring? On april 26 1981 the first open human fetal surgical procedure was performed in san francisco . An amazing observation from those early procedures was that human fetal surgical wounds heal without scarring . This opened up a whole new emphasis in biomedical research the pursuit of scarless healing or regeneration . The third category of patient we would aim to treat in this centre are children who do have chronic, recurring and disabling wounds . There is no condition that illustrates the devastation to the quality of life as much as recessive dystrophic epidermolysis bullosa . The key problem is the lack of normal collagen type vii which is an integral part of the dermo - epidermal junction [figure 16]. Without this functioning component, the epidermis is not attached to the dermis in a robust manner and can easily be dislodged by shearing forces . Repeated blistering and wounds occur [figure 17]. We treated one child with an aggressive squamous cell carcinoma complicating his disease [figure 18]. In the course of this treatment we used integra [figure 19] and a combination of meshed autograft and a spray of cultured allograft grown from the patient's younger brother . We need to find ways to manipulate the patients cells which will ultimately involve genetic engineering [figure 20]. One year later we used the same strategy for an axillary recurrence and noted rapid and robust healing in the area treated with the allogenic cells . Type vii collagen - essential for healthy skin a medical student illustrates the clinical problems in rdeb squamous cell carcinoma excise and reconstruct with integra allogenic cells and autogenous meshed skin produce disable new skin of note there is currently no cure for recessive dystrophic epidermolysis bullosa and all that can be done is to manage the condition with advanced wound dressings, nutritional support and life style adaptation . There are experimental strategies to replace the abnormal collagen vii but these remain in the trial stages in various centres [figure 21]. Strategies to treat rdeb another observation we can report is the use of allogenic bone marrow to aid the healing in an rdeb patient [figure 22]. We have previously reviewed stem cell strategies in burn and wounds [figure 23] and looking at allogenic sources we are most attracted to the intra - uterine life support system the amoniotic membranes, the placenta and the umbilical cord and cord blood . These are abundant in supply, ethically acceptable and safe (after appropriate screening) and can provide both allogenic and autogenic cells . We have been looking at the stem cells derived from the human umbilical cord and the potential for epithelial reconstitution . So the proposed advanced skin scar and wound care centre for children will be an example of the future trend in clinical medicine translational medicine [figure 24]. Using the father's bone marrow to aid healing of a wound in a patient with rdeb a strategy for stem cells translational clinical and research teams work together to achieve solutions our hope is that by delving deeply into the fundamental biology of a relatively small number of children we can learn for more about conditions that affect all age groups . So our immediate goal is to improve the quality of life of severely distressed children but ultimately we hope to make a significant contribution to improving the quality of life of the many millions of people (adults) who suffer particularly from chronic wounds . If dr.
|
Lower gastrointestinal (gi) bleed due to hemangioma in rectum is an uncommon problem . A hemangioma generally has a feeding and draining vessel and the collection of contrast in hemangioma helps in its identification during computed tomography (ct) scan or magnetic resonance imaging (mri). A 19-year - old female patient presented with history of recurrent episodes of lower gi bleeding 1 - 2 times / month for last 3 years . At the time of hospitalization colonoscopy showed bluish reddish elevated nodular lesions limited to distal rectum [figure 1 and video 1]. Mri of rectum showed hyper intense signals in the anterior wall [figure 2]. The radial ultrasound was able to demonstrate vascular signal in the submucosa of anterior wall of rectum [figure 3]. Real time eus imaging was able to trace an outflowing vessel through the left lateral wall of rectum for a distance of about 3 cm [video 2]. Application of pulse doppler confirmed the venous nature of the outflowing vessel [figure 4]. Linear eus showed a submucosal vascular lesion in the anterior wall of rectum supplied by an inflowing artery [figure 5 and video 3]. A biopsy of the lesion showed numerous dilated vascular spaces within lamina propria and submucosa [figure 6]. The lesion was seen in anterior wall magnetic resonance imaging of rectum showed hyper intense signals in the anterior wall (green arrow) the radial ultrasound of rectum showed vascular signal in the submucosa of anterior wall of rectum application of pulse doppler confirmed the venous nature of the outflowing vessel in the anterior wall of rectum linear endoscopic ultrasound showed a submucosal vascular lesion in the anterior wall of rectum supplied by an inflowing artery a biopsy of the lesion showed numerous dilated vascular spaces within lamina propria and submucosa cavernous hemangioma is an uncommon entity responsible for <1% of lower gi bleed . Diagnosis is best established by endoscopic visualization of a blood filled hemangioma that has appearance of plum red nodules or vascular congestion . Ct scan and mri can also be used for diagnosis and evaluation of the extent . In this case the diagnosis was suspected by endoscopic appearance and mri and continuous color doppler eus of the lesion provided additional information of presence of a vascular lesion [figures 35, videos 2 and 3].
|
The new zealand census - mortality study is a population - wide cohort study, in which the cohort consists of the entire 1996 resident population (n=3 732 000) and the outcome of interest is mortality . For this analysis, records from the 1996 census were anonymously linked to 3 years of subsequent mortality data, creating a cohort study of the new zealand population followed up for 3 years.19 20 in new zealand, urban areas are defined as cities having a population of at least 30 000 people; about half of the approximately 2000 census areas are classified as urban . Because the definition of urban areas in new zealand includes small towns and suburbs, many urban census areas have low levels of air pollution . The method of record linkage has been described in detail elsewhere.19 briefly, probabilistic record linkage is a process used to link two files of records, in which records in one file have a corresponding record in the other file . Records from the first file are compared with records from the second file in order to find matching record pairs (ie, two records belonging to the same individual). Census and mortality records were linked using date of birth (day, month and year as separate matching variables), country of birth, sex, ethnicity and address of usual residence . Linkage was restricted to individuals aged 74 years or below at the time of the census . The proportion of mortality records linked overall was 78%,20 and varied by sex, age, ethnicity and the deprivation index.19 weights were therefore applied to adjust for linkage bias, by strata of sex, age, ethnicity, deprivation, rurality and cause of death.21 for example, if 20 of 30 maori men who died aged 4564 years and living in moderately deprived (see below) rural areas of new zealand were linked to a census record, each of the 20 linked records received a weight of 1.5 (30/20). Air pollution monitoring data are typically only available for a few sites and may not be representative of exposure in other areas . Detailed atmospheric dispersion modelling can be used to provide estimates of air pollution exposure for small areas, but these models are difficult to apply to large areas due to data and computer processing limitations . The method of air pollution exposure assessment has been described in detail elsewhere.22 briefly, the approach to modelling long - term average pm10 was as follows . Atmospheric dispersion modelling results were available for one city (christchurch, population 300 000). These data were assumed to be representative of the spatial pattern of annual average pm10 exposures for small areas (census area units) in christchurch.23 data on meteorological variables and indicators of air pollutant emissions for these areas were used as predictors of pm10 exposure in christchurch, using regression models . The predictors for the regression models were: census data on domestic heating; estimates of industrial emissions; and vehicle kilometres travelled within small areas . Because data for these predictor variables were available for all of new zealand, we were able to extrapolate the empirical results for the christchurch regression model to urban census area units throughout the country . The resulting exposure estimates agreed well with multiyear averages of pm10 based on routine monitoring data for urban centres (19952001) (n=43; r=0.87). While we acknowledge that there may be considerable exposure misclassification, we assume that the pm10 estimates are representative of long - term average spatial patterns of exposure during the 1990s . Ideally, for analyses with the new zealand census mortality study data we would have used the continuous pm10 estimates for individual census areas . However, because the new zealand census mortality study data contain census information at unit record level, access to the data is restricted and additional data can only be added if confidentiality is not compromised as a result . Assigning continuous pm10 estimates at census area level would have permitted many census areas to be uniquely identified . In order to maintain confidentiality, it was necessary to aggregate the pm10 estimates into quintiles before they could be merged with the census data . Quintiles of exposure were calculated based on the estimates for individual census areas . For this purpose, we assigned a pm10 estimate of 0 g / m to rural census areas where pm10 estimates were unavailable . The average pm10 level for all new zealand census areas was 8.3 g / m (sd 8.4 g / m) and the cut - off values between pm10 quintiles were 0.0, 0.5, 12.5 and 15.4 g / m . Individuals were assigned to quintiles of pm10 exposure depending on their census area of residence on census night . In order to avoid bias affecting analyses in smaller rural areas due to migration to cities following the development of disease, we restricted the analyses to the urban population . Following restriction to the urban population, the lowest two quintiles of exposure had relatively few observations (table 1). For this reason, and given the small variation in pm levels between quintiles 1 and 2, we combined the two lowest quintiles of pm10 to produce four categories in total . The estimated mean pm10 levels for these categories were 0.1, 7, 14 and 19 g / m (long - term averages). Weighted counts, for deaths occurring among the census respondents with complete data . Ethnicity and socioeconomic position are strong predictors of mortality in new zealand, and potential confounders of the association of air pollution with mortality . We assigned each respondent to a mutually exclusive ethnic group using a prioritisation system commonly used in new zealand: maori, if any one of the responses was maori; pacific, if any one response was pacific but not maori; and the remainder non - maori non - pacific (mostly new zealand european). Smoking status was reported in the census using the categories: never smoker, ex - smoker, or current smoker.24 socioeconomic position was characterised as: total household income, with adjustment for the number of children and adults in the household to allow for economies of scale, log - transformed having first set all values of less than nz$1000 to equal nz$1000;20 highest educational qualification (higher than school, school, or none); and neighbourhood deprivation measured by the nzdep index (in quintiles).25 this index of deprivation within small geographical areas was calculated using census data on socioeconomic characteristics (eg, car access, tenure and receipt of benefits) at aggregations of approximately 100 people, and assigned to mortality data by use of address . As climate is correlated with pm10, and associated with mortality (independently of pm10), temperature has the potential to confound air pollution effects . Therefore, we also included estimates of long - term average minimum temperature (in addition to the above sociodemographic factors) in the models, also in quintiles based on place of residence . These data were derived from an interpolated temperature surface.26 mean values for the minimum temperature quintiles were 0.2, 2, 4, 5 and 7c . Logistic regression analyses were conducted to investigate associations between all - cause and cause - specific mortality rates and average exposure to pm10, with control for confounding by age, sex, ethnicity, social deprivation, income, education, smoking history and average minimum temperature . As death is a rare outcome over 3 years for the age groups included in the analysis, logistic regression results differ very little from those from either poisson or cox proportional hazards modelling . Initial models incorporated pm10 categories as dummy variables, and given a reasonably linear dose response, final models used the estimated mean pm10 for these four categories (see above). In order to facilitate comparison with overseas findings,, age was included as a linear plus a squared term, and the income variable was natural - log transformed . Logistic regression model including all variables listed as independent variables (all deaths, all ethnicities: n= 1 065 645) * rounded; for logit form of model, constant 6.528 (7.036 to 6.020). Any association of air pollution with mortality might be modified by social and environmental factors, due to different vulnerability or intensity of exposure to air pollution . Finally, we conducted a sensitivity analysis by restricting the dataset for analysis to those people who had lived in the same geographical unit at the 1991 census as they did at the time of exposure assignment (1996) in this cohort study . This restriction should reduce exposure misclassification by excluding those people who have not been exposed to the same level of pm10 for at least 5 years . The method of record linkage has been described in detail elsewhere.19 briefly, probabilistic record linkage is a process used to link two files of records, in which records in one file have a corresponding record in the other file . Records from the first file are compared with records from the second file in order to find matching record pairs (ie, two records belonging to the same individual). Census and mortality records were linked using date of birth (day, month and year as separate matching variables), country of birth, sex, ethnicity and address of usual residence . Linkage was restricted to individuals aged 74 years or below at the time of the census . The proportion of mortality records linked overall was 78%,20 and varied by sex, age, ethnicity and the deprivation index.19 weights were therefore applied to adjust for linkage bias, by strata of sex, age, ethnicity, deprivation, rurality and cause of death.21 for example, if 20 of 30 maori men who died aged 4564 years and living in moderately deprived (see below) rural areas of new zealand were linked to a census record, each of the 20 linked records received a weight of 1.5 (30/20). Air pollution monitoring data are typically only available for a few sites and may not be representative of exposure in other areas . Detailed atmospheric dispersion modelling can be used to provide estimates of air pollution exposure for small areas, but these models are difficult to apply to large areas due to data and computer processing limitations . The method of air pollution exposure assessment has been described in detail elsewhere.22 briefly, the approach to modelling long - term average pm10 was as follows . Atmospheric dispersion modelling results were available for one city (christchurch, population 300 000). These data were assumed to be representative of the spatial pattern of annual average pm10 exposures for small areas (census area units) in christchurch.23 data on meteorological variables and indicators of air pollutant emissions for these areas were used as predictors of pm10 exposure in christchurch, using regression models . The predictors for the regression models were: census data on domestic heating; estimates of industrial emissions; and vehicle kilometres travelled within small areas . Because data for these predictor variables were available for all of new zealand, we were able to extrapolate the empirical results for the christchurch regression model to urban census area units throughout the country . The resulting exposure estimates agreed well with multiyear averages of pm10 based on routine monitoring data for urban centres (19952001) (n=43; r=0.87). While we acknowledge that there may be considerable exposure misclassification, we assume that the pm10 estimates are representative of long - term average spatial patterns of exposure during the 1990s . Ideally, for analyses with the new zealand census mortality study data we would have used the continuous pm10 estimates for individual census areas . However, because the new zealand census mortality study data contain census information at unit record level, access to the data is restricted and additional data can only be added if confidentiality is not compromised as a result . Assigning continuous pm10 estimates at census area level would have permitted many census areas to be uniquely identified . In order to maintain confidentiality, it was necessary to aggregate the pm10 estimates into quintiles before they could be merged with the census data . Quintiles of exposure were calculated based on the estimates for individual census areas . For this purpose, we assigned a pm10 estimate of 0 g / m to rural census areas where pm10 estimates were unavailable . The average pm10 level for all new zealand census areas was 8.3 g / m (sd 8.4 g / m) and the cut - off values between pm10 quintiles were 0.0, 0.5, 12.5 and 15.4 g / m . Individuals were assigned to quintiles of pm10 exposure depending on their census area of residence on census night . In order to avoid bias affecting analyses in smaller rural areas due to migration to cities following the development of disease following restriction to the urban population, the lowest two quintiles of exposure had relatively few observations (table 1). For this reason, and given the small variation in pm levels between quintiles 1 and 2, we combined the two lowest quintiles of pm10 to produce four categories in total . The estimated mean pm10 levels for these categories were 0.1, 7, 14 and 19 g / m (long - term averages). Weighted counts, for deaths occurring among the census respondents with complete data . Ethnicity and socioeconomic position are strong predictors of mortality in new zealand, and potential confounders of the association of air pollution with mortality . We assigned each respondent to a mutually exclusive ethnic group using a prioritisation system commonly used in new zealand: maori, if any one of the responses was maori; pacific, if any one response was pacific but not maori; and the remainder non - maori non - pacific (mostly new zealand european). Smoking status was reported in the census using the categories: never smoker, ex - smoker, or current smoker.24 socioeconomic position was characterised as: total household income, with adjustment for the number of children and adults in the household to allow for economies of scale, log - transformed having first set all values of less than nz$1000 to equal nz$1000;20 highest educational qualification (higher than school, school, or none); and neighbourhood deprivation measured by the nzdep index (in quintiles).25 this index of deprivation within small geographical areas was calculated using census data on socioeconomic characteristics (eg, car access, tenure and receipt of benefits) at aggregations of approximately 100 people, and assigned to mortality data by use of address . As climate is correlated with pm10, and associated with mortality (independently of pm10), temperature has the potential to confound air pollution effects . Therefore, we also included estimates of long - term average minimum temperature (in addition to the above sociodemographic factors) in the models, also in quintiles based on place of residence . These data were derived from an interpolated temperature surface.26 mean values for the minimum temperature quintiles were 0.2, 2, 4, 5 and 7c . Logistic regression analyses were conducted to investigate associations between all - cause and cause - specific mortality rates and average exposure to pm10, with control for confounding by age, sex, ethnicity, social deprivation, income, education, smoking history and average minimum temperature . As death is a rare outcome over 3 years for the age groups included in the analysis, logistic regression results differ very little from those from either poisson or cox proportional hazards modelling . Initial models incorporated pm10 categories as dummy variables, and given a reasonably linear dose response, final models used the estimated mean pm10 for these four categories (see above). In order to facilitate comparison with overseas findings, we report results for adults aged 3074 years . In final models, age was included as a linear plus a squared term, and the income variable was natural - log transformed . All other covariates logistic regression model including all variables listed as independent variables (all deaths, all ethnicities: n= 1 065 645) * rounded; for logit form of model, constant 6.528 (7.036 to 6.020). Any association of air pollution with mortality might be modified by social and environmental factors, due to different vulnerability or intensity of exposure to air pollution . Finally, we conducted a sensitivity analysis by restricting the dataset for analysis to those people who had lived in the same geographical unit at the 1991 census as they did at the time of exposure assignment (1996) in this cohort study . This restriction should reduce exposure misclassification by excluding those people who have not been exposed to the same level of pm10 for at least 5 years . When pm10 was modelled using dummy variables, there was an approximately linear increase in mortality with increasing average pm10 exposure (figure 1). Three models are shown: (1) adjusting for sex, age and ethnicity on all observations (n=1 364 454); (2) the same model, but restricted to observations with non - missing data on other covariates (n=1 065 645; a test of any selection bias compared with model 1); (3) fully adjusted model (n=1 065 645; a test of possible confounding compared with model 2). There is no meaningful difference between models 1 and 2, suggesting no selection bias when restricting analyses to those with full data on covariates . Adjusting for potential confounders in model 3 attenuated the or for all non - referent groups, although the relative differences between quintiles 3, 4 and 5 were not much reduced . That is, adjusting for confounders mostly closed the gap between the referent group and quintile 3 . Or and 95% ci of all - cause mortality for people living in the three non - referent pm10 categories, compared with quintiles 1 and 2 combined . Model is for sexes combined, restricted to adults aged 3074 years on census night, urban population, with covariates as follows: model 1: age, sex, ethnicity, all data, n=1 364 454; model 2: age, sex, ethnicity, data with non - missing values for covariates in model 3, n=1 065 645; model 3: age, sex, ethnicity, deprivation, income, education, smoking, temperature, n=1 065 645 . Considering the preferred model 3, the or increased monotonically and linearly with increasing pm10 level, and the 95% ci for the two highest quintiles excluded 1.0 . Given the approximately linear association of pm10 with mortality described above, subsequent models incorporated pm10 as a linear term, using the average pm10 for each category) (tables 2 and 3). Table 2 shows the same model as in figure 1, except for the continuous treatment of pm10 . The or of 1.007 corresponds to a 1 unit increase in pm10, which equates to an increase of 7% (95% ci 3% to 10%) in the odds of all - cause mortality in adults (aged between age 30 and 74 years at census) per 10 g / m increase in long - term average pm10 exposure . Findings by subgroups of ethnicity and cause of death (model 3, fully adjusted) note: models included persons dying from the specified causes (coded 1) and people presumed alive at the end of follow - up (coded 0), but excluded persons dying from other causes . Other deaths are all those deaths (including unspecified) that are not included among lung cancer, respiratory, cardiovascular disease or accidents . We found stronger effects of pm10 among people who lived in the same census area in 1991 (at the time of the previous census), 8% (4% to 12%) per 10 g / m increase in pm10 . By cause of death, the association was similar for all natural causes, 7% (3% to 10%), but substantially stronger for respiratory deaths (including lung cancers), 14% (5% to 23%) and for lung cancers, 16% (4% to 29%). For cardiovascular disease, 6% (1% to 12%) and for other and unspecified causes of death, 5% (1% to 10%), the association was marginally significant; while for accidental deaths and injuries, the association was non - significant, 4% (9% to 20%) (table 3). Considering interaction with social variables, there was an apparently stronger association of pm10 with all - cause mortality among maori, 20% (7% to 33%). However, the 95% ci for europeans overlapped that for maori, 7% (3% to 10%). A wald test for interaction between ethnicity and pm10 was not significant (p=0.12). There were no statistically significant interactions with age, sex, income, deprivation, educational status or average temperature . Mortality was lower among people living in warmer census areas, and the difference between the lowest and the highest quintile of annual average temperature was statistically significant . Using linked mortality and census data, we report a significant positive association between estimated long - term exposure to air pollution (pm10) and mortality in new zealand urban areas . This setting includes approximately 75% of the new zealand population, who are exposed to relatively low levels of pm10 compared with other countries . The results persist after controlling for plausible confounders, including multiple measures of socioeconomic position and smoking . Most of this misclassification was probably non - differential by mortality risk (meaning we have probably significantly underestimated the true strength of association). There is potential differential misclassification of pm10 by mortality risk in our study, because our assessment was based on modelling in one city using proxies, including domestic heating, estimates of industrial emissions and vehicle kilometres travelled within small areas . If these proxies are not such reliable predictors of pm10 in other cities, and are (say) correlated with socioeconomic position, then it may be that our pm10 estimates are also capturing aspects of socioeconomic exposure . However, the fact that an association remained after extensive control of socioeconomic factors, including individual level income and education, makes this an unlikely explanation of the results . The use of modelled estimates of pm10 exposure will tend to smooth the data and reduce the resulting ci it is possible that less healthy people might migrate towards health services (or other service amenities) that happen to be in more polluted areas a form of reverse causation or endogeneity . However, we think this is unlikely to be an important factor as new zealand cities are relatively small (maximum 1.4 million), and most suburbs in new zealand's main cities have relatively good access to hospitals . The odds of all - cause mortality in adults (aged between 30 and 74 years at census) increased by 7% (95% ci 3% to 10%) per 10 g / m increase in average pm10 exposure . Our observations are consistent with an increasing number of studies of long - term exposure to particulate matter and mortality.310 1318 the original us six cities study reported an adjusted mortality rate ratio of 1.27 (95% ci 1.08 to 1.48) for the most polluted compared with the least polluted city, corresponding to 18.2 and 46.5 g / m pm10, respectively3equivalent to an increase in mortality of approximately 10% per 10 g / m pm10 . In the us nurses health study, there was a 16% (5% to 28%) increase in all - cause mortality per 10 g / m pm10.14 it is not yet clear to what extent the heterogeneity in reported dose response in those studies is related to differences in the accuracy of exposure measurement, to differences in the toxicity of complex mixtures of pollutants at differing levels of exposure, and/or differences in the sensitivity of exposed populations . Recent studies use the more specific measure pm2.5 (particulate matter with an aerodynamic diameter less than 2.5 m) rather than pm10, whereas several european studies use black smoke or total suspended particulates as the exposure measure . The association between particulate air pollution exposure and mortality is usually found to be strongest for finer fractions, such that the dose response for pm2.5 is greater than for pm10, which in turn is greater than for total suspended particulates . An extended follow - up of the us six cities study reported a 14% (6% to 22%) increase in mortality per 10 g / m pm2.5,9 whereas the american cancer society study reported 6% (2% to 11%) and the nurses health study 26% (2% to 54%), while coarse particulate matter exposure (pm102.5) was not associated with an increase in mortality in that study.27 an analysis based on electoral wards in the uk found a 1.3% (1% to 1.6%) increase in all - cause mortality per 10 g / m increase in black smoke.10 in 18 regions in france, the paarc study reported a 7% (3% to 10%) increase per 10 g / m increase in black smoke and a 5% (2% to 8%) increase for total suspended particulates.7 in the netherlands, there was a 5% (0% to 10%) increase in mortality per 10 g / m increase in black smoke . Our study assessed the association of pm10 and mortality over 3 years . In the us nurses health study, mortality was most strongly associated with average pm10 exposures in the 24 months before death . In the uk, the association, although weak, was stronger for exposure in the 4 years before death . However, a re - analysis of the american cancer society study found no clear effect of exposure period.17 a priori, we hypothesised that the association of pm10 with mortality in our study would be stronger for a cohort restricted to those census respondents who lived in the same census area at the time of the 1991 census . We also hypothesised that the association of pm10 with mortality would be stronger for cardiorespiratory deaths . Our results were consistent with these a priori hypotheses, strengthening the ability to make causal inference . There is some evidence, most consistently in studies with individual measurements of social factors, that more deprived populations are particularly sensitive to air pollution effects.5 11 12 28 29 our ability to detect a true difference by ethnicity in sensitivity to air pollution was limited by the relatively small maori population . Although not significant, the difference in our central effect estimates for european and maori was substantial: 7% versus 20% . This might reflect a higher prevalence of pre - existing cardiorespiratory disease among maori, or a difference in the toxicity of air pollution to which different ethnic groups are typically exposed . We found no other suggestion of interaction of social factors with pm10 in the association with mortality . In this longitudinal study we report an association of pm10 with mortality, consistent with that reported elsewhere, in a country with low levels of air pollution . The major limitation of our study is the probable misclassification of the pm10 exposure . On balance, this means we have probably underestimated the strength of association . The study design has several strengths, including national population coverage and good control of confounding . We found that the association was, as hypothesised a priori, stronger for cardiorespiratory deaths and people with less residential mobility . Relatively few cohort studies of the health effects of urban air pollution have been published, particularly outside north america and europe . We report here findings from a longitudinal study in new zealand, based on the national census . There is evidence, most consistently in studies with individual measurement of social factors, that more deprived populations are particularly sensitive to air pollution effects . We found an association of pm10 with mortality in a country with relatively low levels of air pollution . There was some evidence that maori may have greater susceptibility to life - shortening effects of air pollution.
|
A five - month - old male infant (weight, 6 kg; height, 64 cm) underwent elective repair of a large perimembranous - type ventricular septal defect (vsd). He had no discernible anomaly other than vsd; his preoperative routine laboratory values were all within normal limits, and he had no family history of genetic disease including malignant hyperthermia (mh)-susceptible trait (which was inquired later). Upon anesthetic induction, fentanyl sodium and ketamine were administered intravenously, followed by rocuronium bromide for intubation . Anesthesia was maintained with nitrous oxide and sevoflurane, along with incremental doses of fentanyl and ketamine . End - tidal pco2 (etco2) and oxygen saturation were monitored continuously with an intermittent analysis of the arterial blood gases . The patient's body temperature was normal (36.8) before the induction of anesthesia, but it increased to 38.7 just before the bypass; no specific measures were taken as he was going to be on hypothermic cpb soon . Systemic cooling was applied shortly after the initiation of the bypass, and the temperature was maintained around 26 throughout the intracardiac procedure . The flow rate was appropriately controlled according to the body temperature, and there was no episode of a significant fall in the mean blood pressure during the entire course of cpb . The blood gas profiles were also in the normal range . Upon rewarming, although the standard rewarming protocol was applied, a very rapid and excessive elevation of the temperature was noted; it took only 17 minutes for the temperature to reach 36.6/36.2 (esophageal / rectal), and then, the temperature continued to rise and peaked at 38.2/39.1 12 minutes later . Cooling measures were applied, and the temperature fell gradually to the normal level 35 minutes after peaking . The first sign of metabolic acidosis, along with hypoxia and hypercapnia, was noted in the blood gas sample drawn 44 minutes after the cpb weaning . Hypoxia and hypercapnia were corrected by the manipulation of the ventilator; however, a mild degree of metabolic acidosis persisted (fig . Nevertheless, the hemodynamic parameters were quite stable . The chest was closed, and the patient was transferred to the intensive care unit (icu) in a stable condition . Initially, in the icu, the only sign against normal recovery was metabolic acidosis, which continued until postoperative day 2 . The initial profile of the cardiac enzyme (creatine kinase [ck]/ck - myocardial band [mb]/troponin - i: 1,100/190/98.7) was unusually elevated, showing results that did not match the clinical findings at that time . Nonetheless, he was sedated again overnight mainly because of the unexpected metabolic acidosis . The next day, the computed tomogram of the brain taken on postoperative day 2 revealed a diffuse brain injury pattern . 2). Nonetheless, the urine output was well maintained, without any noticeable color change and without a significant elevation of the serum blood urea nitrogen or creatinine . Echocardiography showed good postoperative results; the vsd was closed well without a residual shunt, and cardiac contractility was preserved . The isoenzyme study of ck from a blood sample taken on postoperative day 5 revealed a significant elevation of the mm fraction (fig . Thereafter, the patient followed a gradual downhill course and eventually died on postoperative day 33 . At first, upon reviewing this complicated and unhappy case, malperfusion came to our mind first as a culprit for the diffuse brain injury and massive rhabdomyolysis leading to death . However, according to the perfusionist's record, the pump speed and the flow rate were maintained within the acceptable range throughout the run of the bypass, and the blood gas profiles were absolutely within the normal limits . Moreover, the extent of rhabdomyolysis as represented by the ck elevation was too severe to be simply attributed to malperfusion . It would be logical to conclude that the initial excessive elevation of serum ck - mb was only a reflection of the elevation of the total ck amount . As for mh, we were not aware of it until we were reminded by a text that mh was supposed to be the number - one disease to be ruled out in the differential diagnosis of rhabdomyolysis . Mh is a genetic disorder of the skeletal muscle that presents a high fever, usually after operation, as a result of the hypermetabolic state to the volatile anesthetic agents, such as halothane, sevoflurane, desflurane, and the depolarizing muscle relaxant succinylcholine, and rarely to stresses such as vigorous exercise and heat . This disorder is characterized by massive rhabdomyolysis and is likely to be fatal unless recognized early and treated appropriately . The classic signs of mh include hyperthermia to a marked degree, tachycardia, tachypnea, increased carbon dioxide production, increased oxygen consumption, acidosis, and muscle rigidity . . However, the presentation of the symptoms is highly variable: the fever can be a mild one and even totally omitted, and the interval from the exposure to the symptom onset can be highly variable . Thus, mh is a disease of exclusion; a variety of conditions may resemble mh during anesthesia . Similarly, when severe rhabdomyolysis is encountered postoperatively, mh should be considered in the first line . In this context, we scrutinized the case again and came up with the notion that the earlier abnormal pattern of rewarming, which was once thought to be insignificant, might be an early sign of mh . The ensuing events such as acidosis and rhabdomyolysis corresponded well to the clinical features of mh as described earlier . It might be argued that careless and very rapid rewarming was the principle cause of death . We insisted that the temperature had increased abruptly although we had followed the general guideline of rewarming . In addition, we believed that if mh had developed in the setting of cpb, one could hardly have detected the early signs largely because of the symptoms obscuring hypothermia . Thus, we systematically searched the literature focusing on mh and cpb and found some relevant articles . Recently, metterlein et al ., in their review article, have described 14 patients experiencing an episode of mh associated with cardiopulmonary bypass in 12 reports over nearly three decades . In general, when mh develops in patients undergoing cardiac surgery under cardiopulmonary bypass, the situation becomes more complicated . Classical clinical features are obscured by the effect of hypothermia, rendering the early recognition and timely management of mh extremely difficult . They also pointed out that putting aside volatile anesthetics, rewarming per se can be a triggering factor or at least have a modulating effect on the development of a crisis . The definite diagnosis of mh is currently made by an in vitro contracture test, which unfortunately was not carried out in this patient because of the rapidly declining clinical course . Dantrolene, which is currently accepted as an effective treatment regimen, was also not administered in time because clinical suspicion was lacking at that time . All potent inhalation agents and muscle relaxants should be stopped immediately, and minute ventilation should be increased to lower etco2 . Cooling measures such as ice pack application and/or nasogastric lavage with an iced solution should be carried out . Measures to maintain the urine output should be encouraged, and the treatment of hyperkalemia, arrhythmia, and potential disseminated intravascular coagulation should be undertaken as needed . In summary, although we could not explain the cause of the brain injury, the occurrence of mh was very probable in this case; the abnormal pattern of temperature rise upon rewarming, which was transient and did not draw much attention at that time, might have been an early sign of mh . The ensuing metabolic acidosis that was hard to correct and massive rhabdomyolysis also tied in very closely with the clinical situation in the case of mh . We might have missed the first sign of mh - the increase in etco2 by a simple manipulation of the ventilator, as pointed out by others . One should be aware of the possibility of mh, although it rarely occurs, when unexplained metabolic acidosis and rhabdomyolysis develop and continue in association with cpb and rewarming.
|
Human cutaneous malignant melanoma (cmm) basically corresponds to an uncontrolled overgrowth of neoplastic melanocytes . However, the extracellular matrix (ecm) and the connective tissue cells adjacent to the neoplasm probably represent more than passive bystanders in cmm . The biology and prognostic significance of some tumoral components are increasingly established [1, 2], but the relationship between cmm cells and the nonimmune aspects of the peritumoral stroma remains poorly understood . The cmm - stroma cross - talk is regulated by soluble factors and by direct cell - cell contact . It is a commonplace to suggest that cmms with little fibroblasts are quite aggressive, but this assumption is not firmly rooted in evidence - based observations . The aim of this paper is to summarize the evidence on the changes in the nature of stromal cells and their products in the peri - cmm stroma during tumor invasion and metastatic dissemination . At a key point in tumor progression, cmm starts to express a high metastatic potential before causing mortality . In order to form distant metastases, in particular, some interactions exist between cmm cells and various biologic systems including environmental factors, immune cells, vascularity, contiguous stromal cells, and molecular components of the dermal ecm [57]. Some aspects of the cmm - stroma interactions including the release of growth factors and matrix metalloproteinases (mmp) are likely associated with the disease progression and prognosis [711]. Cell functions required in the cmm metastatic cascade are not limited to intrinsic properties of the neoplastic cells . Many properties are regulated or influenced by the close microenvironment [12, 13]. In addition, neoplastic cells are able to induce changes in the surrounding tissues [14, 15]. Thus, cmm cells and their surrounding stroma jointly form a specific and complex microecosystem [10, 16]. Cross - talk between cmm and stromal cells is likely mediated through a combination of direct heterotypic cell - cell contacts, adhesion molecules, signaling factors, as well as other secreted molecules including growth factors, cytokines, chemokines, ecm proteins, mmps, proteinase inhibitors, and lipids [3, 17]. Conceptually, the cmm microecosystem is crucial for the maintenance of both the cell functions and tissue integrity suggesting that any cmm - induced change in the stroma contributes to the neoplastic progression and invasiveness . Any alteration in the cmm stroma is likely related to various imbalances in the cytokine profile, resulting from the oncogenic changes in the neoplastic cells . In particular, experimental animal models demonstrated that cancer invasion was stimulated by the wound - healing stroma . Both stromal cells and ecm components located beneath primary cmm are therefore involved in both the neoplastic invasive process and the early dissemination of micrometastases associated or not with neoangiogenesis [2, 2023]. These characteristics are expected to be related to phenotypic changes in the stromal cells in the cmm vicinity . The three - dimensional relationship between neoplastic cells and stroma varies among tumors . In benign tumors, a clear cut separation exists between neoplastic cells and the connective tissue . By contrast, especially in malignancies, areas of tumoral cells and stroma are merging, since the former ones often invade the latter structures . This neoplasm exhibits a clinical behavior distinct from regular cmm, including frequent local recurrences . They consist of invasive neoplastic spindle - shaped melanocytes encased in a striking desmoplastic stroma . They exhibit either a single - cell dispersal pattern within the sclerotic dermis or are disposed in long fascicles . Desmoplasia is commonly related to a variety of cell lines including numerous factor xiiia+ dermal dendrocytes (dds) and rare -actin+ myofibroblasts (mfs). In addition, cd45 + lymphocytes and mac 387 + monocytes / macrophages are clustered inside desmoplastic melanoma . Primary cmms less than 1 mm thick are associated with high cure rate and unaffected survival . The apparent breakpoint beyond about 1 mm thickness is a dramatic aspect for the disease outcome . One possible reason appears to be linked to the cmm vascularization patterns [2528]. Such microanatomic feature is persuasive, but it is by no means the single one . The concept of dormant cmm metastases was offered to explain (a) why some cmms develop metastases after disease - free intervals as long as 1040 years following excision of the primary cmm, (b) the therapeutic failure of wide surgical resection margins, and (c) the vain hope placed in elective lymph node dissection to influence prognosis . Once cmm metastases have developed, the subsequent prognosis is fairly predictable, irrespective of the preceding disease - free interval . These observations suggest that microscopic cmm foci likely remain quiescent in their own microenvironment for variable periods of time before some event(s) trigger(s) the development of detectable / progressive metastases . The metastatic potential is expressed by variant subpopulations of metastatically competent cmm cells present in the primary neoplasms . These subpopulations typically exhibit over time a growth advantage at the primary site leading to a dominant proliferating population . At this stage, most thin primary cmms only contain few, if any, metastatically competent cells, whereas thicker cmms contain increased proportions of such cells . The stromal microecosystem is in part involved in such a shift in the biologic profile . The presence of cmm stem cells is in part involved in the process of cmm micrometastases and in their relationship with the peritumoral stroma [20, 3136]. Cmm stem cells are capable of indefinite self - renewal, a function linked to cmm growth [2, 34, 37]. Although conventional anticancer treatments aim at eradicating malignant cells, they are potentially ineffective against chemoresistant cancer stem cells, which are ultimately responsible for neoplastic recurrence, progression, and metastasis [2, 20, 31]. Cmm typically exhibits cell heterogeneity, undifferentiated molecular signatures, and increased tumorigenicity restricted to specific cmm subsets with embryonic - like differentiation plasticity . These features strongly suggest the involvement of cmm stem cells in the initiation and spreading of this malignancy [3133, 35, 3841]. Both the structure and biologic specificity of the ecm are potentially involved in the invasiveness and propagation of cmm stem cells . The generation of cmm metastases at distant sites relies on adequate genotypic and phenotypic characteristics acquired in an orderly sequence referred to as the cmm metastatic cascade . Such a process encompasses boosted cmm cell proliferation, detachment from the primary neoplasm, interaction with and invasion into the peritumoral stroma, penetration into blood and lymphatic vessels, survival in the circulation, adhesion to a vessel wall at the final metastatic site, extravasation, survival in the new ecm, and proliferation to form overt metastasis [2, 5]. Thus, basically, the specific functions involved in the metastatic cascade combine intrinsic characteristics of some cmm cells and the regulatory influences from the microenvironment . Indeed, cmm cells and their surrounding stroma jointly form a microecosystem receptive to early inconspicuous metastatic spread . By contrast, most of them are disclosed under the microscope, particularly with the help of immunohistochemistry [2, 10, 22, 42]. They are found in four main distinct locations, namely, (a) inside lymph vessels, (b) inside blood vessels, (c) in a perivascular location just abutted to the outer aspect of the endothelial lining, and (d) dispersed inside the stroma [20, 21, 23]. The latter eventuality is frequently associated with neoangiogenesis, and a boosted neoplastic germinative pool is commonly found [20, 28]. The active migration of metastatic cmm cells in the peritumoral stroma is probably a complex process . It involves both the active migration of cmm cells and changes in the cmm cell adherence systems with ecm components . Interstitial unicellular or paucicellular cmm micrometastases are occasionally found and confined to the perineoplastic stroma . Their presence is statistically correlated with the risk of invasion of the sentinel lymph node . Overexpression of some homeobox (hox) genes is typically present in cmm cells susceptible to generate metastases . This facet of cmm pathobiology conveniently revealed using immunohistochemistry shows correlation with specific changes in the peritumoral stroma as described hereafter . The role of homeobox (hox) gene overexpression has been highlighted in the evolving process of cmm metastasis [4447]. Although mmps are typically degradative enzymes with the ability to cleave ecm proteins such as collagen and fibronectin, their dominant role is actually a signal - altering effector . These nonmatrix - degrading functions of mmps vastly expand the ways in which they contribute to various pathologies, including cmm progression . At the regular histopathology examination, stromal cells look normal underneath primary cmm when partial regression is not obvious . However, their differentiation as revealed by immunohistochemistry appeared altered when compared to the surrounding skin . In particular, phenotypic changes were found in the expression of the transglutaminase factor xiiia, cd34, the (iv) collagen chains, the - and -actins, as well as elafin and versican . It is possible although not yet proven that transforming growth factor-1 (tgf-) and platelet - derived growth factor (pdgf) play a role in changing the stromal host compartment in cmm . It has a hetero - tetrameric structure which consists of two globular a units and two strandlike b subunits . The a subunit is a proenzyme circulating in the blood and present intracellularly in platelets and monocyte - macrophages . Factor xiiia - enriched stromal cells of the skin are commonly identified as dds type i. the intracytoplasmic subunit a is a specific transglutaminase . The cells belong to the monocyte - macrophage lineages preferentially abutted to the superficial microvasculature [5052]. Increased numbers of factor xiiia+ dd are often found in the vicinity of most invasive cutaneous neoplasms . By contrast, they are fewer or even absent in thick primary cmm and their metastases [5255]. Circumstantial evidence correlated the density of factor xiiia+ dd and a low proliferative rate of cmm cells . Thus, factor xiiia+ dd are probably not passive bystanders in cmm [29, 48, 49]. Their function possibly differs based on whether they are located in the stroma or inside the neoplasm . Intratumoral dd appeared associated with a growth - restricting role . In contrast, stromal dds contribute to the invasiveness and metastatic spread of cmm cells . This role in cmm invasiveness is putative but it unambiguously opens new lines of inquiry about the biologic functions of factor xiiia . Invasive cmms are frequently associated with a decrease in these cells . In malignant neoplasms, basement membranes (bms) are composite structures synthesized by tumoral cells, stromal cells, by one of these two cell types, but depending on interactions between them, or are a mixture from both origins . These tumor - associated bms are often abnormal in their composition and ultrastructure [57, 58]. Bm material seems rather accompanying malignant cells rather than preventing invasion as a physical barrier . Nevertheless, active interactions between neoplastic cells and stroma, in particular the ecm, play a key role in the neoplastic progression leading to invasion and metastasis . Several bm components were identified around cmm cells including collagen iv [57, 6062]. In the skin, collagen iv represents an assembly of 1 (iv) and 5 (iv) collagen chains . In cmm, some neoplastic cells and stromal cells exhibit intracytoplasmic immunolabeling for 1 (iv) chains . The pattern is heterogeneous, and bm components including type iv collagen gradually disappear during the dermal ingrowth of cmm cells . Of note, a minority of cmm without any identifiable micrometastasis and a majority of cmms with cutaneous micrometastasis show discrete cytoplasmic positivity for the 5 (iv) collagen chain . The distribution of 1 (iv) collagen chain in cmm highlights the heterogeneity in both cell differentiation and stroma - cmm interactions . Thus, cmm cells appear to have their own individual potential to be wrapped by a bm and to interact with the stroma . This biologic aspect is likely related to the neoplastic progression and it influences the inconspicuous metastatic potential . The molecule belongs to the chondroitin sulfate family of the hyalectan group, named from its ability to bind to hyaluronan . In mammals little is known about the differential regulation of the isoforms and about their respective roles in the ecm either normal or peritumoral . The versican production is deregulated in several human cancers . As it is largely expressed in fast - growing neoplastic cells, it has been suggested to play a direct role in cell proliferation and other cell functions . It appeared to be particularly abundant in the stromal cell population underneath cmm [6471]. The overexpression was sharply circumscribed to a cup - shape structure cuffing the bottom of cmm . In addition, some nests of cmm cells were strongly labeled with the antiversican antibody . Such finding contrasts with another study having reported the absence of versican immunoreactivity in neoplastic melanocytes . The peritumoral stroma of some cmms contains both mf and their precursors, the protomyofibroblasts . Any mf resembles a peculiar fibroblast - like cell, exhibiting features of a smooth muscle (sm) cell, including microfilament bundles, with interspersed dense bodies, and intercellular gap junctions . The mf structure is characterized by stress fibres formed by contractile proteins, particularly -sm actin (-sma). The switch from the protomyofibroblast to mature mf probably results from the production and release of transforming growth factor-1 (tgf-1) by inflammatory and fibroblast - like cells . The tgf-1 action is mediated by the cellular fibronectin splice variant ed - a . Thus, mf differentiation is regulated by both specific cell components and some ecm molecules . Endothelin-1, thrombin, and mechanobiology promote mf induction [73, 74]. Contrasting with melanocytic nevi and desmoplastic melanomas, the stroma of most regular cmm appears to be devoid in mf exhibiting -sma immunoreactivity [56, 75]. Elastic fibres are coated by distinct molecules following chronic ultraviolet light exposures [7678]. The serine antileukoprotease elafin, and versican and lysozyme as well bind to elastin preventing elastolytic degradation by elastases on sun - exposed areas exhibiting solar elastosis [7779]. In addition, elafin was reported to elicit p53-dependent apoptosis in cultured cmm cells transfected by a plasmid producing elafin under doxycycline boosting . Contrasting with such in vitro experiments, immunohistochemistry did not disclose intratumoral cell presence of elafin in human cmm . Of note, western blot and reverse transcription analyses indicated transcriptional elafin repression in cmm cells . About 25 years ago, the comparison of tumors and wounds led to an intriguing concept considering the resemblance between cancers and wounds . The comparison was based on molecular and biologic features occurring in wound healing on the one hand and in neoplasms on the other hand . If most observations indicate that many neoplastic cells induce stroma formation, the reverse question explored the possible induction of tumor cell development by a scar . The involvement of fibroblasts in cmm stromagenesis occurs through different stages involving their recruitment, activation, and conversion to mf, or differentiation to fibrocytes . Such involvement is topographically linked to different areas inside and around cmm, and stromal activation, as seen in tumor ulceration and immunologically - driven regression of cmm stimulating neoplastic progression . In general, the peritumoral stroma creates a kind of scaffolding for the neoplasm . In particular, a singular ecm structure is abutted to the deep part of primary cmm . Some of these metastatic cells survive singly and are possibly in their way of migration to other organs . They possibly correspond to cmm stem cells or to mature cmm cells with hox gene dysfunctions . The intimate relationship between neoplastic cells and their stroma is a fascinating topic orienting the translational research in therapy . Beyond the importance of cmm vascularity for the tumoral growth, invasiveness, and metastatic spread [2026, 83, 84], such a structure is involved in a constant remodelling following degradation and repair of the ecm . In addition, some environmental influences including ultraviolet light exposures are involved in the cmm initiation . In addition, they support the neoplastic progression through the intervention of diverse autocrine and paracrine factors . Of note, immunohistochemistry highlights the direct implication of cmm cells in the synthesis and/or storage of some ecm molecular components . The immunohistochemistry characterization of cmm cells is informative [8, 34, 8691], but it should probably be extended to its peritumoral stroma including the microvasculature [20, 25, 26, 83], the stromal cells, and ecm components as well . A comprehensive mapping of cmm genotypic and phenotypic characteristics identifies relevant targeted therapies [89, 9199]. Inflammatory cells and immunocytes represent another class of host cells that are regulated by cytokine balances . They perform countercurrent invasion, from the circulation into the neoplasm, and provide roads for cmm cell invasion . The global host involvement in the cancer microecosystem basically relies on the microvasculature, the stromal cells and the specific immune reactions [10, 20, 100]. It appears crucial for cancer progression, as blood vessels deliver nutrients and oxygen to the neoplastic cells . The relative contribution of both compartments is likely to be influenced by the cmm type and site and is balanced by other factors as well [25, 26]. The multiple interactions between cmm and its stroma are beyond doubt, in particular during the invasive and metastatic phases of evolution . Stromal cells are recognized to secrete metalloproteinases and their inhibitors, growth factors, and other soluble mediators as well participating in the growth and mobility of the cmm cells . In addition, some other molecules are synthesized and overexpressed by stromal cells and/or cmm cells . Immunohistochemistry conveniently identifies factor xiii - a, 1 and 5 (iv) collagen chains, versican, elafin, and lysozyme . While cmm cell motility cannot be directly assessed, there is circumstantial evidence that mobility is operative in cmm progression and possibly indicative for prognostic purposes . In addition to the secretion and activation of enzymes modeling the ecm, a variety of stromal changes occur following overexpression of diverse ecm components . Molecular morphology yields evidence suggesting that the cmm stroma plays an integral role in the neoplastic evolution . Although much remains to be learned, the presently summarized changes have diagnostic and prognostic significance that merit to be scrutinized in future works.
|
The role of bacteria in initiating and perpetuating pulp and periapical disease is well established . Therefore, the purpose of endodontic treatment is to eliminate microorganisms from the root canal system, and to prevent recontamination by creating a fluid - tight seal between the canal and the obturating material . For this purpose, a material which can completely seal the infected root canal system would be ideal for clinical practice . However, previous studies showed that current root canal obturation materials such as gutta - percha and/or polymer - based materials cannot provide a bacteria - tight seal . Mineral trioxide aggregate (mta) has been successfully used as a biomaterial in both surgical and nonsurgical endodontics . Mta has been shown to provide superior sealing and biomineralization ability, despite concerns about the macro- or microporous structure of the material caused by inadequate water - to - powder ratio, insufficient packing or water evaporation . Indeed, it has been reported that the porosity caused by dissolution of calcium hydroxide within mta could be self - repaired' by mineral precipitates such as calcium silicate hydrate gel that is formed by the hydration reaction of the material, and the tag - like structures formed at the mta / dentin interface . These characteristic structures appear to be important in sealing dentinal tubules and biomineralization of the material . For biomineralization, the interaction of mta and phosphate - buffered saline (pbs) triggers the initial precipitation of calcium - deficient carbonated apatites via an amorphous calcium phosphate phase, which further promotes the process . Furthermore, it has been reported that these carbonated apatites promote the formation of an interfacial layer with tag - like structures at the mta / dentin interface . Consequently, mta - induced biomineralization may be enhanced if pbs is used as the mixing vehicle for hydration . However, there have not been any studies on the effectiveness of mta pbs paste as an obturation material, and little is known about the capacity for mta - induced biomineralization to entomb bacteria in infected root canals . Orthomta (biomta, seoul, korea) is a newly developed mta cement for orthograde root canal obturation, that is mainly composed of tricalcium silicate and contains less heavy metal than the original proroot mta (dentsply, tulsa, ok, usa). Therefore, the aim of this study was to examine the effects of mta - induced biomineralization with regard to bacterial entombment in dentinal tubules, by using orthomta the null hypothesis was that the orthomta pbs obturation can effectively entomb bacteria by intratubular mineralization in enterococcus faecalis - infected root canals . This study was carried out under the approval of the institutional review board of seoul national university dental hospital, seoul, korea . Sixty human single - rooted premolars with fully formed apices that were without root cracks or defects when viewed under a microscope (opmi pico, carl zeiss, germany) were collected from patients undergoing extractions for orthodontic reasons in the department of oral and maxillofacial surgery . All of the teeth were decoronated with a minitom saw (struers, rodovre, denmark), and apical patency was obtained with a size #10 stainless steel k - file (dentsply, tulsa, ok, usa). The working length was determined to be 1 mm short of the apical foramen when visually inspected with a size #10 stainless steel k - file (dentsply, tulsa, ok, usa). The coronal third of the canals were flared with gates glidden burs #24 (komet, rock hill, sc, usa). The canals were then instrumented to an apical size #50/.06 with a crown - down technique using profile 0.04 and 0.06 ni ti rotary instruments (dentsply maillefer, ballaigues, switzerland), and copiously irrigated with 5.25% sodium hypochlorite and 17% ethylenediaminetetraacetic acid (edta) between instruments . The smear layer was removed from the canal walls by immersing the specimens for 5 min each in 17% edta (ph 7.2) followed by 5.25% sodium hypochlorite within an ultrasonic bath (elmasonic 1 ultrasonic cleaner; camlab, cambridge, uk). Finally they were autoclaved at 121 c for 15 min to ensure that there was no bacterial contamination, and then incubated in brain heart infusion (bhi) broth at 37 c for 24 h. the roots were stored at 37 c in 100% humidity until use . Roots were randomly assigned to four groups that determined whether or not they would receive an inoculation and/or an mta obturation . Group 1: 10 sterile roots were filled with pbs; group 2: 10 inoculated roots were filled with pbs; group 3: 20 sterile roots were orthograde filled with orthomta pbs; group 4: 20 inoculated roots were orthograde filled with orthomta pbs paste . Each group was further subdivided into five subgroups for the observation periods 1, 2, 4, 8 and 16 weeks . Enterococcus faecalis was grown overnight in bhi broth, adjusted to a turbidity of 0.5 on the mcfarland scale (1.510 cfuml) and inoculated into all root canal lumens in groups 2 and 4 . All of the roots were then placed into conical tubes containing fresh bhi (20 ml) that was replaced every second day, and incubated for 3 weeks at 37 c in a humidified incubator with 5% co2 (bbd 6220 co2 incubator; thermo fisher scientific, waltham, ma, usa). The purity of the cultures was confirmed by gram staining, catalase production and colony morphology on bhi blood agar . Following this incubation, then, all of the canals in groups 3 and 4 were filled to their working length with orthomta cement (biomta, seoul, korea). The orthomta powder was mixed with pbs (liquid / powder=0.3) with a sterile plastic stick, and an mta carrier (biomta, seoul, korea) was used to insert mta incrementally into each canal . Ti compactor and hand pluggers (biomta, seoul, korea) were used alternatively to condense the mta increments and prevent voids . The orthomta compactor was applied with a continuous, slight pecking movement using a reduction handpiece (1281; w & h dentalwerk burmoos gmbh, burmoos, austria) and electric motor (tcm 3000; nouvag ag, goldach, switzerland) at 60 rmin . All of the obturations were performed by a single endodontist, and radiographs were taken to ensure that the canals were adequately filled and without voids . Then, the cervical 3 mm of all root canals were packed with pbs - soaked sterile cotton and sealed with intermediate restorative material (irm; dentsply caulk, milford, de, usa). Finally, the roots were stored in sterile plastic vials containing 20 ml of pbs that was replaced weekly for 1, 2, 4, 8 or 16 weeks at 37 c . At the end of each incubation period (1, 2, 4, 8 and 16 weeks), each root was aseptically transferred from its vial to a teflon beaker that was covered with sterile foil (nalgene labware, rochester, ny, usa). The roots were then split in half by creating two parallel longitudinal grooves on their outer surfaces with slow - speed carborundum disks (henan meijiasheng trading, zhengzhou, china), and using sterile long - handled end cutting pliers (channellock, meadville, pa, usa). To prevent contamination, each sample was prefixed with a pbs solution of 2.5% glutaraldehyde and 2% paraformaldehyde (ph 7.2) at 4 c overnight and washed 3 times with pbs solution (ph 7.2). For post fixation, each sample was treated with 1% osmium tetroxide for 1.5 h then washed three times with distilled water and dehydrated in graded ethyl alcohol (70%80%90%95%100% each for 15 min and 100% for 15 min). The samples were dried with hexamethyldisilazane in air overnight before coating with ion - beam sputtering . The split roots were then mounted on aluminum stubs, sputter coated with a 30 nm layer of gold and examined both longitudinally and cross - sectionally along the mta - dentin interfaces of the canals by scanning electron microscopy (sem, model s4700; hitachi, tokyo, japan). The voltage was set to 15 kv, the type of signal used was secondary electrons, the working distance was 12 mm and the scan speed was 16 frames per 20 s. the central areas of each sample were photographed . This study was carried out under the approval of the institutional review board of seoul national university dental hospital, seoul, korea . Sixty human single - rooted premolars with fully formed apices that were without root cracks or defects when viewed under a microscope (opmi pico, carl zeiss, germany) were collected from patients undergoing extractions for orthodontic reasons in the department of oral and maxillofacial surgery . All of the teeth were decoronated with a minitom saw (struers, rodovre, denmark), and apical patency was obtained with a size #10 stainless steel k - file (dentsply, tulsa, ok, usa). The working length was determined to be 1 mm short of the apical foramen when visually inspected with a size #10 stainless steel k - file (dentsply, tulsa, ok, usa). The coronal third of the canals were flared with gates glidden burs #24 (komet, rock hill, sc, usa). The canals were then instrumented to an apical size #50/.06 with a crown - down technique using profile 0.04 and 0.06 ni ti rotary instruments (dentsply maillefer, ballaigues, switzerland), and copiously irrigated with 5.25% sodium hypochlorite and 17% ethylenediaminetetraacetic acid (edta) between instruments . The smear layer was removed from the canal walls by immersing the specimens for 5 min each in 17% edta (ph 7.2) followed by 5.25% sodium hypochlorite within an ultrasonic bath (elmasonic 1 ultrasonic cleaner; camlab, cambridge, uk). Finally they were autoclaved at 121 c for 15 min to ensure that there was no bacterial contamination, and then incubated in brain heart infusion (bhi) broth at 37 c for 24 h. the roots were stored at 37 c in 100% humidity until use . Roots were randomly assigned to four groups that determined whether or not they would receive an inoculation and/or an mta obturation . Group 1: 10 sterile roots were filled with pbs; group 2: 10 inoculated roots were filled with pbs; group 3: 20 sterile roots were orthograde filled with orthomta pbs; group 4: 20 inoculated roots were orthograde filled with orthomta pbs paste . Each group was further subdivided into five subgroups for the observation periods 1, 2, 4, 8 and 16 weeks . Enterococcus faecalis was grown overnight in bhi broth, adjusted to a turbidity of 0.5 on the mcfarland scale (1.510 cfuml) and inoculated into all root canal lumens in groups 2 and 4 . All of the roots were then placed into conical tubes containing fresh bhi (20 ml) that was replaced every second day, and incubated for 3 weeks at 37 c in a humidified incubator with 5% co2 (bbd 6220 co2 incubator; thermo fisher scientific, waltham, ma, usa). The purity of the cultures was confirmed by gram staining, catalase production and colony morphology on bhi blood agar . Following this incubation, then, all of the canals in groups 3 and 4 were filled to their working length with orthomta cement (biomta, seoul, korea). The orthomta powder was mixed with pbs (liquid / powder=0.3) with a sterile plastic stick, and an mta carrier (biomta, seoul, korea) was used to insert mta incrementally into each canal . An orthomta ni ti compactor and hand pluggers (biomta, seoul, korea) were used alternatively to condense the mta increments and prevent voids . The orthomta compactor was applied with a continuous, slight pecking movement using a reduction handpiece (1281; w & h dentalwerk burmoos gmbh, burmoos, austria) and electric motor (tcm 3000; nouvag ag, goldach, switzerland) at 60 rmin . All of the obturations were performed by a single endodontist, and radiographs were taken to ensure that the canals were adequately filled and without voids . Then, the cervical 3 mm of all root canals were packed with pbs - soaked sterile cotton and sealed with intermediate restorative material (irm; dentsply caulk, milford, de, usa). Finally, the roots were stored in sterile plastic vials containing 20 ml of pbs that was replaced weekly for 1, 2, 4, 8 or 16 weeks at 37 c . At the end of each incubation period (1, 2, 4, 8 and 16 weeks), each root was aseptically transferred from its vial to a teflon beaker that was covered with sterile foil (nalgene labware, rochester, ny, usa). The roots were then split in half by creating two parallel longitudinal grooves on their outer surfaces with slow - speed carborundum disks (henan meijiasheng trading, zhengzhou, china), and using sterile long - handled end cutting pliers (channellock, meadville, pa, usa). To prevent contamination, each sample was prefixed with a pbs solution of 2.5% glutaraldehyde and 2% paraformaldehyde (ph 7.2) at 4 c overnight and washed 3 times with pbs solution (ph 7.2). For post fixation, each sample was treated with 1% osmium tetroxide for 1.5 h then washed three times with distilled water and dehydrated in graded ethyl alcohol (70%80%90%95%100% each for 15 min and 100% for 15 min). The samples were dried with hexamethyldisilazane in air overnight before coating with ion - beam sputtering . The split roots were then mounted on aluminum stubs, sputter coated with a 30 nm layer of gold and examined both longitudinally and cross - sectionally along the mta - dentin interfaces of the canals by scanning electron microscopy (sem, model s4700; hitachi, tokyo, japan). The voltage was set to 15 kv, the type of signal used was secondary electrons, the working distance was 12 mm and the scan speed was 16 frames per 20 s. the central areas of each sample were photographed . There were no mineral precipitates in dentinal tubules of all the non - mta filled root in groups 1 and 2 until 16-weeks' observation period (figure 2a and 2b), whereas the formation of uniform tag - like structures was generally found over entire surface at coronal (figure 2c and 2d), middle (figure 2e and 2f) and apical (figure 2 g and 2h) parts of all the mta - filled root in groups 3 and 4 . In group 3, the formation of tiny leaflet - like crystalline structures indicated a biomineralization process on the dentinal tubular surface in a 1-week specimen (white arrows, figure 3a and 3b). In a 2-week sample, it was observed that the tag - like structures obstructed the entrance of dentinal tubule and the crystalline structures were formed inside the dentinal tubules (figure 3c). The 4-week sample showed crystalline structures forming simultaneously on the entire surface of the dentinal tubules observed (white arrow, figure 3d). After 8 weeks, the specimen showed obstruction of the dentinal tubules by newly formed crystalline structures (white arrow, figure 3e). A cross - sectional sem view of a 16-week specimen showed almost complete obstruction of the dentinal tubule lumens by growth of newly formed crystalline structures (figure 3f). Not only dentinal tubules but also the apical foramen was shown to be obliterated with newly formed crystalline apatite structures in 4-week specimens in group 3 (figure 3 g and 3h). In group 4, the dentinal tubules harbored e. faecalis, and the distinctive crystalline structures had not yet formed in 1-week sample (white arrow, figure 4a). In the 2-week sample, the needle - like crystalline structures grew along the entire wall of the dentinal tubules (white arrows, figure 4b), indicating that bacterial entombment had begun in this period . A 4-week specimen showed e. faecalis entombment resulting from narrowing of the infected dentinal tubules by the formation of leaflet - like crystals (figure 4c). A magnified view of the yellow rectangular area in figure 4c showed that each e. faecalis bacterium is being entombed by a growing crystalline structure (figure 4c). An 8-week sample showed the almost complete obstruction of the lumen of the infected dentinal tubule by leaflet - like crystalline structures and entombed bacteria (white arrow). The yellow arrows showed the sites that e. faecalis had been entombed and detached in the process of preparing the samples for sem (figure 4e). The 16-week sample showed that newly formed crystalline structures appeared in tiny needle - like structures (yellow arrow) or as an agglomerate of leaflet - like structures (white arrow) in almost the whole dentinal tubule (figure 4f). The crystalline structures were formed in the apical foramen area of a 12-week sample (figure 4 g), which showed a small amount of needle - like crystals among the plate - like ones (figure 4h). This is the first study to have shown bacterial entombment by intratubular mineralization over time following orthograde obturation with mta . The entombment of intracanal bacteria was suggested by sundqvist and figdor to be one of the main objectives of root canal obturation . However, the entombment of bacteria within the root canal space has not been achieved by with either gutta percha or resilon obturation materials . Although the resin - based sealers in resilon could effectively penetrate the dentinal tubules in moist dentin, they are still susceptible to the effects of matrix metalloproteinase in the dentin matrix . In contrast, mta has been shown to resist leakage at a higher rate when placed in a moist environment such as the root canal system . Furthermore, recent studies have suggested that mta - induced mineralization could be enhanced by the use of pbs . It was reported that the addition of phosphate to portland cement that has a similar composition to mta, accelerated the hydration reaction which improved the flexural strength and reduced the solubility of the set material . Calcium and phosphate ions in pbs could precipitate amorphous calcium phosphate, which is a precursor of hydroxyapatite, and thereby promote carbonated apatite deposition and strengthen the mta / dentin interface . However, until now, there have not been any reports on the use of pbs as the mixing vehicle for mta, and on its capacity to stimulate intratubular mineralization . In every orthomta pbs paste - filled specimens, short tag - like structures obliterated the entrance of the dentinal tubules and long tag - like precipitates filling the dentinal tubule lumens were routinely observed . These characteristic features might decrease the nutritional supply to the intratubular bacteria, and their further growth into dentinal tubule might reduce the available space for bacterial survival and growth . The phosphorus required in intratubular crystalline growth process seems to have been supplemented from the dentinal fluid, as was reported by by camilleri et al . The depletion of intratubular phosphorus might result in the inhibition of e. faecalis because the phosphorus ion is essential to the survival of e. faecalis . This bacterial entombing mechanism under moisture condition is a unique feature of mta not previously reported in any of the other root canal filling materials . Considering the superior sealing ability and physiochemical and bioactive properties of the material as well, mta appears to be a potential benefit as a root canal obturation biomaterial . The chemical profile of the crystalline precipitates formed in this study was not fully confirmed yet . A recent study speculated that intratubular crystalline precipitation induced by mta is partly related to the transformation of metastable amorphous calcium phosphate phase into an apatite phase . Moreover, the plate - like crystals and needle - like crystals observed at the apical foramen (figure 4h), as reported in the study of teng et al ., might possibly are octacalcium phosphates and hydroxyapatites, respectively . Although its intratubular biomineralization ability, mta has some drawbacks such as irretrievability, tooth discoloration, and slow setting time as a canal obturation material . Also, there are concerns regarding the possibility of bacterial ingress by the formation of voids or porosities within mta and at the mta / dentin interface after obturation or hydration . Therefore, orthograde mta obturation should be carefully performed to minimize the possible formation of voids / porosities and limited in selected clinical cases until its long - term benefits and prognosis is further confirmed . Under the limitation of the present study, orthograde canal obturation with orthomta pbs paste could induce amorphous tag - like structure formation and intratubular crystalline growth over time which effectively entombs the intratubular bacteria . The present study suggests the potential antibacterial effect of orthograde obturation with orthomta pbs paste in infected root canals.
|
The oregon health authority conducts active, laboratory - based surveillance for all cases of nts infection . Physicians and laboratories are required by law to report laboratory - confirmed and clinically suspected cases of salmonellosis to the patient s local health department; reports should contain the patient s date of birth, sex, diagnosis, date of symptom onset, date of specimen collection, and laboratory test results . All salmonella isolates are forwarded to the oregon state public health laboratory (osphl), where they are serotyped . Local health department officials interview patients about hospitalization, clinical outcomes, additional demographic information, and exposure history for the 7 days before illness onset . Risk - factor questions ask about specific travel, human, animal, and high - risk food exposures . International travel was considered a risk factor only if it had taken place in the 30 days before illness onset . Patients with recurrent infection or multiple salmonella isolates (of same serotype within a plausible time frame for the original infection) are interviewed only once, at the time of initial illness onset . During 20042009, the population of oregon was 3.63.8 million persons, which is 1.2% of the us population (21,22). The surveillance system in oregon is estimated to capture> 99% of laboratory - confirmed cases of salmonellosis; however, for every 1 case confirmed, an estimated 25 additional cases are not detected (2). For 2004 and 2005, all confirmed isolates were forwarded to the oregon state university veterinary diagnostic laboratory for susceptibility testing . From 2006 through 2009, susceptibility testing was performed by osphl . All isolates were tested by using broth microdilution to determine mics for the following 10 antimicrobial agents: ampicillin, ceftriaxone, chloramphenicol, ciprofloxacin, gentamicin, nalidixic acid, nitrofurantoin, sulfamethoxazole, tetracycline, and trimethoprim / sulfamethoxazole . Susceptibilities were determined according to clinical and laboratory standards institute interpretative criteria (23). To ascertain cephalosporin resistance, osphl tested isolates for ceftriaxone susceptibility; and the oregon state university veterinary diagnostic laboratory tested for susceptibility to cefuroxime and cephalothin by using analogous broth microdilution methods . Isolates were included in analyses only if they were cultured from specific specimens, such as feces, urine, or blood or other normally sterile tissues (i.e., cerebrospinal fluid). Cir was defined as resistance to at least 1 of the following: ampicillin, ceftriaxone, ciprofloxacin, gentamicin, or trimethoprim / sulfamethoxazole (13). We used the cochran - armitage test for trend to analyze nts case data for 20042009 to determine whether the proportion of salmonella isolates with cir increased significantly . Demographic and exposure risk factors, specifically international travel, were evaluated as risk factors for acquisition of a resistant isolate . The 9 most common salmonella serotypes were fixed (included in all models regardless whether they met the p<0.05 level of significance) in all analyses, and remaining serotypes were grouped as all other . Serotype enterditis is the most frequently isolated serotype in oregon and was therefore used as the referent for all comparisons . We sought to evaluate whether resistance was associated with increased disease severity, including hospitalization and invasive infection . Invasive infection was defined as isolation of salmonella from a normally sterile body site or tissue, such as blood (13). Multiple logistic regression models were constructed with variables that were significant at the p<0.25 level in unadjusted analyses . Salmonella serotype and patient race, age, and year of illness onset were fixed in all models . Other variables were given further consideration according to disease severity or relevance for external validity . Predictor variables significant at p<0.05 were retained in the final model, and adjusted log odds ratios (aors) were calculated . Model fit was assessed by using the hosmer lemeshow goodness - of - fit test . All analyses were performed by using sas version 9.2 (sas institute inc ., cary, nc, usa). Because this study involved more extensive analysis only of data collected routinely as part of public health surveillance, it was not considered human subjects research . The oregon health authority conducts active, laboratory - based surveillance for all cases of nts infection . Physicians and laboratories are required by law to report laboratory - confirmed and clinically suspected cases of salmonellosis to the patient s local health department; reports should contain the patient s date of birth, sex, diagnosis, date of symptom onset, date of specimen collection, and laboratory test results . All salmonella isolates are forwarded to the oregon state public health laboratory (osphl), where they are serotyped . Local health department officials interview patients about hospitalization, clinical outcomes, additional demographic information, and exposure history for the 7 days before illness onset . Risk - factor questions ask about specific travel, human, animal, and high - risk food exposures . International travel was considered a risk factor only if it had taken place in the 30 days before illness onset . Patients with recurrent infection or multiple salmonella isolates (of same serotype within a plausible time frame for the original infection) are interviewed only once, at the time of initial illness onset . During 20042009, the population of oregon was 3.63.8 million persons, which is 1.2% of the us population (21,22). The surveillance system in oregon is estimated to capture> 99% of laboratory - confirmed cases of salmonellosis; however, for every 1 case confirmed, an estimated 25 additional cases are not detected (2). For 2004 and 2005, all confirmed isolates were forwarded to the oregon state university veterinary diagnostic laboratory for susceptibility testing . From 2006 through 2009, all isolates were tested by using broth microdilution to determine mics for the following 10 antimicrobial agents: ampicillin, ceftriaxone, chloramphenicol, ciprofloxacin, gentamicin, nalidixic acid, nitrofurantoin, sulfamethoxazole, tetracycline, and trimethoprim / sulfamethoxazole . Susceptibilities were determined according to clinical and laboratory standards institute interpretative criteria (23). To ascertain cephalosporin resistance, osphl tested isolates for ceftriaxone susceptibility; and the oregon state university veterinary diagnostic laboratory tested for susceptibility to cefuroxime and cephalothin by using analogous broth microdilution methods . Isolates were included in analyses only if they were cultured from specific specimens, such as feces, urine, or blood or other normally sterile tissues (i.e., cerebrospinal fluid). Cir was defined as resistance to at least 1 of the following: ampicillin, ceftriaxone, ciprofloxacin, gentamicin, or trimethoprim / sulfamethoxazole (13). We used the cochran - armitage test for trend to analyze nts case data for 20042009 to determine whether the proportion of salmonella isolates with cir increased significantly . Demographic and exposure risk factors, specifically international travel, were evaluated as risk factors for acquisition of a resistant isolate . The 9 most common salmonella serotypes were fixed (included in all models regardless whether they met the p<0.05 level of significance) in all analyses, and remaining serotypes were grouped as all other . Serotype enterditis is the most frequently isolated serotype in oregon and was therefore used as the referent for all comparisons . We sought to evaluate whether resistance was associated with increased disease severity, including hospitalization and invasive infection . Invasive infection was defined as isolation of salmonella from a normally sterile body site or tissue, such as blood (13). Multiple logistic regression models were constructed with variables that were significant at the p<0.25 level in unadjusted analyses . Salmonella serotype and patient race, age, and year of illness onset were fixed in all models . Other variables were given further consideration according to disease severity or relevance for external validity . Predictor variables significant at p<0.05 were retained in the final model, and adjusted log odds ratios (aors) were calculated . Model fit was assessed by using the hosmer lemeshow goodness - of - fit test . All analyses were performed by using sas version 9.2 (sas institute inc ., cary, nc, usa). Because this study involved more extensive analysis only of data collected routinely as part of public health surveillance, it was not considered human subjects research . From 2004 through 2009, a total of 2,255 laboratory - confirmed cases of nontyphoidal salmonellosis were reported in oregon . In accordance with oregon law, 2,153 isolates were forwarded to osphl, and 2,127 (98.8% of all nts isolates) were cultured from a specific source and had antimicrobial drug susceptibility testing information (figure). Of these isolates, 26 (1.2%) were obtained through a nonspecific source, such as lesions or sputum, and were excluded from analysis . Culture - confirmed salmonellosis cases ascertained by statewide active surveillance and included in analyses, oregon, usa, 20042009 . The most common salmonella serotypes detected were enteritidis (18.4%), typhimurium (14.3%), heidelberg (8.2%), typhimurium var . Cases that were part of identified outbreaks represented 24.1% of the cohort; the remaining 75.9% were considered sporadic cases . The median age of patients was 29 years (interquartile range 951 years), and 53.1% of patients were female . Information about race was not available for 9%; of patients for whom race was known, 91.8% were white and 9.2% were not white . Similarly, information about ethnicity was not available for 10.5% of patients . Among patients for whom isolates from 1,213 (57%) patients were susceptible to all antimicrobial drugs screened (pansusceptible), and isolates from 347 (16.3%) had cir (table 1). Of the 2,127 patients, 412 (19.4%) were hospitalized and 110 (5.2%) had invasive disease . * cir, clinically important resistance to> 1 of the following: ampicillin, ceftriaxone, ciprofloxacin, gentamicin, or trimethoprim / sulfamethoxazole . The proportion of isolates that were pansusceptible significantly decreased from 69.5% in 2004 to 53.6% in 2009 (p<0.01). Stratification by serotype revealed that cir increased among the 3 most common serotypes: enteritidis (3% to 8%, p = 0.02), typhimurium (19% to 34%, p = 0.03), and heidelberg (6% to 30%, p<0.01). Significant increases were identified for resistance to ciprofloxacin (p<0.05), nalidixic acid (p<0.01), sulfamethoxazole (p<0.01), tetracycline (p<0.01), and trimethoprim / sulfamethoxazole (p<0.01). We suspected that these findings were confounded by serotype and therefore used logistic regression to model the odds of acquiring a resistant infection for each of the clinically important antimicrobial drugs (ampicillin, ceftriaxone, ciprofloxacin, gentamicin, or trimethoprim / sulfamethoxazole) as well as cir . Serotype - adjusted log odds ratios were generated with year of infection entered as a discrete continuous variable . After adjusting for serotype, we found that with each subsequent year, patients were 30% more likely to acquire an infection that was resistant to quinolones (nalidixic acid or ciprofloxacin) and trimethoprim / sulfamethoxazole (table 2). We also found that with each year, odds of acquiring an infection with cir increased by 13% . * multiple logistic regression analysis of 2,127 isolates . Cir was associated with hospitalization (odds ratio [or] 1.5, 95% ci 1.12.0). This association was preserved after adjustment for serotype, patient age, patient race, and year (aor 1.7, 95% ci 1.22.1). For patients with cir infections, odds of invasive infection were increased, although not significantly, according to unadjusted or adjusted analyses (or 1.4, 95% ci 0.92.2 and aor 1.5, 95% ci 0.92.5, respectively). Of the 2,127 patients included in the previous analyses, 1,813 (84.2% of all oregon patients with nts) were interviewed . For 305 (16.8%) of these patients, isolates had cir, and for the remaining 1,508 (83.2%), isolates were susceptible to all clinically important antimicrobial drugs (figure). Of the 1,508 isolates susceptible to clinically important drugs, 1,002 (55.3%) were susceptible to all drugs screened and 506 (27.9%) were resistant to at least 1 non - cir drug . According to the unadjusted analysis, several serotypes were more likely than the referent serotype, enteritidis, to be resistant to> 1 clinically important antimicrobial drug (table 3). Patient sex, race, age, and ethnicity were not significantly associated with resistance . * multiple logistic regression analysis of 1,813 patients; cir, clinically important resistance to> 1 of the following: ampicillin, ceftriaxone, ciprofloxacin, gentamicin, or trimethoprim / sulfamethoxazole . Cir was not associated with any other demographic risk factors or high - risk food or animal exposures . However when international travel was examined by individual countries or applicable united nations region, cir was significantly associated with travel to southeast asia (24). Associations of resistance with travel to mexico and eastern asia also approached significance (table 4). The most common travel destinations in asia where resistant infections were acquired were thailand, china, and malaysia / indonesia . On the basis of these findings, we analyzed international travel by 3 destinations: central america, including mexico (135 patients), eastern and southeast asia (46 patients), and all other international travel destinations (77 patients). * cir, clinically important resistance to> 1 of the following: ampicillin, ceftriaxone, ciprofloxacin, gentamicin, or trimethoprim / sulfamethoxazole . Patients who were part of identified outbreak clusters were significantly less likely than patients with sporadic infections to have a resistant infection (or 0.5, 95% ci 0.40.8). During our study period, 131 outbreaks (406 cases) occurred, and for 25 of these outbreaks a causative vehicle was successfully identified . To assess whether oversampling of cases from outbreak clusters could explain this association, we first restricted cases to 1 isolate per outbreak where a causative vehicle was implicated while retaining all cases from outbreaks for which a vehicle was not implicated (302 cases). Second, we further restricted cases to 1 isolate per outbreak, regardless whether a vehicle was identified (131 cases). In each of these analyses the magnitude, direction, and significance of the association was preserved (or 0.6, 95% ci 0.40.8 and or 0.5, 95% ci 0.30.9, respectively), suggesting that oversampling could not have explained this association . Furthermore, 53.6% of outbreaks had intra - outbreak cases for which the antimicrobial drug susceptibility profiles of the isolates differed . The resultant main - effects model included the fixed variables of serotype, patient age, year of onset, and patient race, along with travel to eastern or southeast asia, and outbreak association (table 3). We hypothesized that effect modification occurred between the variables of outbreak cases and travel to eastern or southeast asia, as well as between travel to eastern or southeast asia, serotypes, and outbreaks . The association between resistance and travel to eastern or southeast asia was preserved after exclusion of all outbreak - associated cases (aor 4.6, 95% ci 2.39.4; table 5). Similarly, the association between resistance and outbreak - associated cases was preserved after exclusion of patients with a history of international travel (aor 0.5, 95% ci 0.40.8; table 6). Therefore, these results suggest that inclusion of patients with a history of travel to asia, as well as patients with outbreak - associated infections for the main analysis, was appropriate . * multiple logistic regression analysis . Cir, clinically important resistance to> 1 of the following: ampicillin, ceftriaxone, ciprofloxacin, gentamicin, or trimethoprim / sulfamethoxazole . Cir, clinically important resistance to> 1 of the following: ampicillin, ceftriaxone, ciprofloxacin, gentamicin, or trimethoprim / sulfamethoxazole.clinically important resistance . Patients with a history of recent travel to eastern or southeast asia were> 5 times more likely to acquire a cir infection than were patients with no history of recent international travel . The most common serotypes acquired among persons with a history of travel to asia were enteriditis (n = 13, 54% cir), typhimurium (n = 5, 60% cir), newport (n = 4, 25% cir), i 4, 5, 12:i:- (n = 4, 50% cir), stanley (n = 3, 33% cir), and typhimurium var . Copenhagen (n = 2, 100% cir). Patients with outbreak - associated infections were half as likely as those with sporadic infections to have cir (table 3). To identify risk factors for resistance to individual antimicrobial drugs, we constructed models with each of the clinically important antimicrobial drugs . Travel to eastern or southeast asia was significantly associated with resistance to ampicillin, quinolones (nalidixic acid or ciprofloxacin), and trimethoprim / sulfamethoxazole (table 7). Only individual serotypes were associated with resistance to cephalosporins or gentamicin, and no other risk factors were significantly associated with resistance to ampicillin, quinolones, or trimethoprim / sulfamethoxazole . * multiple logistic regression analysis for 1,813 patients, comparing odds of resistance for those with a history of travel to asia with those with no history of international travel . Adjusted by serotype, year, patient age, patient race, and outbreak status . From 2004 through 2009, a total of 2,255 laboratory - confirmed cases of nontyphoidal salmonellosis were reported in oregon . In accordance with oregon law, 2,153 isolates were forwarded to osphl, and 2,127 (98.8% of all nts isolates) were cultured from a specific source and had antimicrobial drug susceptibility testing information (figure). Of these isolates, 26 (1.2%) were obtained through a nonspecific source, such as lesions or sputum, and were excluded from analysis . Culture - confirmed salmonellosis cases ascertained by statewide active surveillance and included in analyses, oregon, usa, 20042009 . The most common salmonella serotypes detected were enteritidis (18.4%), typhimurium (14.3%), heidelberg (8.2%), typhimurium var . Cases that were part of identified outbreaks represented 24.1% of the cohort; the remaining 75.9% were considered sporadic cases . The median age of patients was 29 years (interquartile range 951 years), and 53.1% of patients were female . Information about race was not available for 9%; of patients for whom race was known, 91.8% were white and 9.2% were not white . Similarly, information about ethnicity was not available for 10.5% of patients . Among patients for whom isolates from 1,213 (57%) patients were susceptible to all antimicrobial drugs screened (pansusceptible), and isolates from 347 (16.3%) had cir (table 1). Of the 2,127 patients, 412 (19.4%) were hospitalized and 110 (5.2%) had invasive disease . * cir, clinically important resistance to> 1 of the following: ampicillin, ceftriaxone, ciprofloxacin, gentamicin, or trimethoprim / sulfamethoxazole . The proportion of isolates that were pansusceptible significantly decreased from 69.5% in 2004 to 53.6% in 2009 (p<0.01). Stratification by serotype revealed that cir increased among the 3 most common serotypes: enteritidis (3% to 8%, p = 0.02), typhimurium (19% to 34%, p = 0.03), and heidelberg (6% to 30%, p<0.01). Significant increases were identified for resistance to ciprofloxacin (p<0.05), nalidixic acid (p<0.01), sulfamethoxazole (p<0.01), tetracycline (p<0.01), and trimethoprim / sulfamethoxazole (p<0.01). We suspected that these findings were confounded by serotype and therefore used logistic regression to model the odds of acquiring a resistant infection for each of the clinically important antimicrobial drugs (ampicillin, ceftriaxone, ciprofloxacin, gentamicin, or trimethoprim / sulfamethoxazole) as well as cir . Serotype - adjusted log odds ratios were generated with year of infection entered as a discrete continuous variable . After adjusting for serotype, we found that with each subsequent year, patients were 30% more likely to acquire an infection that was resistant to quinolones (nalidixic acid or ciprofloxacin) and trimethoprim / sulfamethoxazole (table 2). We also found that with each year, odds of acquiring an infection with cir increased by 13% . * multiple logistic regression analysis of 2,127 isolates . Cir was associated with hospitalization (odds ratio [or] 1.5, 95% ci 1.12.0). This association was preserved after adjustment for serotype, patient age, patient race, and year (aor 1.7, 95% ci 1.22.1). For patients with cir infections, odds of invasive infection were increased, although not significantly, according to unadjusted or adjusted analyses (or 1.4, 95% ci 0.92.2 and aor 1.5, 95% ci 0.92.5, respectively). Of the 2,127 patients included in the previous analyses, 1,813 (84.2% of all oregon patients with nts) were interviewed . For 305 (16.8%) of these patients, isolates had cir, and for the remaining 1,508 (83.2%), isolates were susceptible to all clinically important antimicrobial drugs (figure). Of the 1,508 isolates susceptible to clinically important drugs, 1,002 (55.3%) were susceptible to all drugs screened and 506 (27.9%) were resistant to at least 1 non - cir drug . According to the unadjusted analysis, several serotypes were more likely than the referent serotype, enteritidis, to be resistant to> 1 clinically important antimicrobial drug (table 3). Patient sex, race, age, and ethnicity were not significantly associated with resistance . * multiple logistic regression analysis of 1,813 patients; cir, clinically important resistance to> 1 of the following: ampicillin, ceftriaxone, ciprofloxacin, gentamicin, or trimethoprim / sulfamethoxazole . Cir was not associated with any other demographic risk factors or high - risk food or animal exposures . However when international travel was examined by individual countries or applicable united nations region, cir was significantly associated with travel to southeast asia (24). Associations of resistance with travel to mexico and eastern asia also approached significance (table 4). The most common travel destinations in asia where resistant infections were acquired were thailand, china, and malaysia / indonesia . On the basis of these findings, we analyzed international travel by 3 destinations: central america, including mexico (135 patients), eastern and southeast asia (46 patients), and all other international travel destinations (77 patients). * cir, clinically important resistance to> 1 of the following: ampicillin, ceftriaxone, ciprofloxacin, gentamicin, or trimethoprim / sulfamethoxazole . Patients who were part of identified outbreak clusters were significantly less likely than patients with sporadic infections to have a resistant infection (or 0.5, 95% ci 0.40.8). During our study period, 131 outbreaks (406 cases) occurred, and for 25 of these outbreaks a causative vehicle was successfully identified . To assess whether oversampling of cases from outbreak clusters could explain this association, we first restricted cases to 1 isolate per outbreak where a causative vehicle was implicated while retaining all cases from outbreaks for which a vehicle was not implicated (302 cases). Second, we further restricted cases to 1 isolate per outbreak, regardless whether a vehicle was identified (131 cases). In each of these analyses the magnitude, direction, and significance of the association was preserved (or 0.6, 95% ci 0.40.8 and or 0.5, 95% ci 0.30.9, respectively), suggesting that oversampling could not have explained this association . Furthermore, 53.6% of outbreaks had intra - outbreak cases for which the antimicrobial drug susceptibility profiles of the isolates differed . The resultant main - effects model included the fixed variables of serotype, patient age, year of onset, and patient race, along with travel to eastern or southeast asia, and outbreak association (table 3). We hypothesized that effect modification occurred between the variables of outbreak cases and travel to eastern or southeast asia, as well as between travel to eastern or southeast asia, serotypes, and outbreaks . The association between resistance and travel to eastern or southeast asia was preserved after exclusion of all outbreak - associated cases (aor 4.6, 95% ci 2.39.4; table 5). Similarly, the association between resistance and outbreak - associated cases was preserved after exclusion of patients with a history of international travel (aor 0.5, 95% ci 0.40.8; table 6). Therefore, these results suggest that inclusion of patients with a history of travel to asia, as well as patients with outbreak - associated infections for the main analysis, was appropriate . * cir, clinically important resistance to> 1 of the following: ampicillin, ceftriaxone, ciprofloxacin, gentamicin, or trimethoprim / sulfamethoxazole . Cir, clinically important resistance to> 1 of the following: ampicillin, ceftriaxone, ciprofloxacin, gentamicin, or trimethoprim / sulfamethoxazole.clinically important resistance . Patients with a history of recent travel to eastern or southeast asia were> 5 times more likely to acquire a cir infection than were patients with no history of recent international travel . The most common serotypes acquired among persons with a history of travel to asia were enteriditis (n = 13, 54% cir), typhimurium (n = 5, 60% cir), newport (n = 4, 25% cir), i 4, 5, 12:i:- (n = 4, 50% cir), stanley (n = 3, 33% cir), and typhimurium var . Patients with outbreak - associated infections were half as likely as those with sporadic infections to have cir (table 3). To identify risk factors for resistance to individual antimicrobial drugs, we constructed models with each of the clinically important antimicrobial drugs . Travel to eastern or southeast asia was significantly associated with resistance to ampicillin, quinolones (nalidixic acid or ciprofloxacin), and trimethoprim / sulfamethoxazole (table 7). Only individual serotypes were associated with resistance to cephalosporins or gentamicin, and no other risk factors were significantly associated with resistance to ampicillin, quinolones, or trimethoprim / sulfamethoxazole . * multiple logistic regression analysis for 1,813 patients, comparing odds of resistance for those with a history of travel to asia with those with no history of international travel . Adjusted by serotype, year, patient age, patient race, and outbreak status . We found that nts infections were more likely to have cir with each subsequent year of our study . In oregon during 20042009, the proportion of isolates susceptible to all antimicrobial drugs significantly decreased . Such travel was specifically associated with resistance to ampicillin, quinolones, and trimethoprim / sulfamethoxazole . Isolates from patients who were part of identified outbreak clusters were significantly less likely to be resistant, suggesting that resistance estimates based on outbreak cases alone may underestimate the true level of resistance . Our analysis was performed by using salmonella susceptibility data from a surveillance system that captures 100% of confirmed infections, has antimicrobial drug susceptibility information for> 95% of confirmed cases, and includes exposure histories for> 84% of patients . This study is strengthened by having collected data on several known and potential confounders before the drug - susceptibility profiles were known . Our study design complements a previous national antimicrobial resistance monitoring system / foodnet study that analyzed antimicrobial drug resistance and increased disease severity (13). However, we determined where resistant infections were acquired (exposures) and patient outcomes associated with resistant infections by using an entire population . The ability to integrate resistance and serotype data with case - specific demographic and risk - factor data improves the generalizability and plausibility of our study and provides population - level risk estimates (1420). Widespread quinolone resistance in southeast asia has been reported (26); a better understanding of global use of antimicrobial drugs might suggest where resistant salmonellae are prevalent . Examination of serotype profiles among patients who had traveled to eastern or southeast asia and multivariate analyses adjusted for serotype provided strong evidence that the increased resistance in this region is widespread and not specifically attributable to a single serotype or regional serotype differences . We confirm the results of varma et al . And lee et al ., who found antimicrobial drug resistance to be associated with increased likelihood of hospitalization (13,25). More severe infections can lead to treatment failure, sepsis, meningitis, and even death . If resistance to clinically important antimicrobial drugs continues to increase by 13% per year, as our data suggest, we can expect more severe illnesses, hospitalizations, and deaths, along with the accompanying higher economic costs . The association between resistance and outbreak cases persisted after restricting the data in unadjusted and adjusted analyses . The lack of effect modification between outbreak cases and a history of travel to asia in the multiple logistic regression modeling suggests that this finding is independent of travel . Resistant isolates might be less infectious and therefore less likely to cause recognizable outbreaks . Alternatively, however, this exposure would be expected to confound the observed associations nondifferentially, thereby resulting in lower point estimates . Reporting lags could have delayed risk - factor interviews, resulting in nondifferential recall bias . This bias would not be expected to explain the association between resistance and international travel and would ultimately lead to underestimation of the true effect size . Case ascertainment among persons with a history of travel to eastern or southeast asia could have been biased . This bias could have affected our analyses if more severe illness developed in travelers with resistant infections, who were more likely to seek health care or be reported than were travelers without resistant infections . However, according to a subanalysis, not presented here, we found that patients who traveled to eastern or southeast asia were less likely to be hospitalized than were those who had not recently traveled internationally (or 0.4, 95% ci 0.21.2). This finding might be explained by a healthy traveler effect; thus, the association between resistance and travel to eastern and southeast asia cannot be explained by biased case ascertainment (29). Both laboratories were licensed and were using clinical and laboratory standards institute standardized methods, suggesting that this bias, if present, would be minimal and could not explain the observed associations . This study demonstrates that antimicrobial drug resistance among nts is increasing and has clinical and public health implications . When considering antimicrobial drug therapy, providers should evaluate patient travel history and salmonella serotype . Our results highlight the need for enhanced domestic surveillance for antimicrobial drug resistance and suggest a need for increased prudence regarding the use of antimicrobial drugs.
|
Food allergy, the adverse immune response to foods, currently affects approximately 8% of children and 4% of adults . Its prevalence is rapidly increasing due to unknown reasons causing it to become a major public health concern in westernized and developed countries (12). Although hundreds of foods can trigger an allergic reaction, the big 8 foods, including milk, egg, peanut, soy, wheat, tree - nut, fish and shellfish, are responsible for most significant allergic reactions (3). Acute allergic reactions to food antigen range from mild to severe or life - threatening . Nearly 40% of food allergy patients visit emergency rooms at some point with severe or life - threatening food allergy responses characterized by hypotension, vascular collapse, and cardiac dysrhythmias, and over 30% have allergic response to multiple foods . Currently, the accepted standard of care for food allergy patients is strict avoidance of the diagnosed food allergen and injection of anti - histamines or epinephrine in case of accidental ingestion . However, these approaches negatively affect patient quality of life and adversely affect families who worry about accidental exposure and thus, limit their participation in social activities (45). Therefore, it is imperative that understanding of the immune responses to food allergens be expanded . Although food allergy is roughly divided into immediate ige - mediated or delayed non - ige - mediated allergic reactions, ige - mediated food allergy is the most common and well defined of the two . This review will focus on the immune mechanisms responsible for ige - mediated food allergy in the gastro - intestinal (gi) tract . In addition, the recently reported il-9 producing mucosal mast cells (mmc9) and type 2 innate lymphoid cells (ilc2) will be introduced and discussed in detail (67). The gastrointestinal (gi) tract is the largest interface between the body and the external environment . Although the main function of gi tract is to process ingested food into a form that can be absorbed, the gi tract also prevents microbes from invading . Because the intestinal mucosa is exposed to a huge quantity and diversity of foods and microbiota, it has the added challenge of distinguishing between harmful pathogens and beneficial commensal organisms (89). The gi tract has a large, well - organized mucosal immune system comprised of a three - layer defense . The first layer is a physical barrier comprised of epithelial cells including enteroendocrine cells, goblet cells, and paneth cells . Goblet cells and paneth cells establish major physical barrier by tight junction that is important for regulating intestinal permeability . Goblet cells and paneth cells also can establish biochemical barrier by secreting mucus like mucin, anti - microbial peptide (amp) and -defensins . This mucus cover epithelial surface and block micro - organisms from reaching epithelial cells (101112). A third defense layer is densely populated immune cells that constitute either inductive sites such as peyer's patch (pp), mesenteric lymph nodes (mln) and isolated lymphoid follicles or effector sites like lamina propria (lp). Antigen specific immune responses are induced in inductive sites and the migration of immune cells from inductive to effector sites is basis for cellular immune response in the gi tract . Lamina propria which lies below the epithelium is rich populated by many kinds of cells including fibro - blasts, cd4 t cells, cd8 t cells, regulatory t cells, plasma cells, dendritic cells, eosinophils, macrophages and mast cells . As the effector sites of the mucosal immune system, lamina propria recognize or combat invading pathogens thus, the epithelial cells, mucus layer and immune cells constitute the intestinal mucosal immune system and the interconnection or communication among 3 defense layer enables the mucosal immune system physically and immunologically to protection of the vast gi tract from invading microbes while maintaining commensal microbiota (13). Even though foods are non - self antigens, the immune system must somehow become non - responsive to food dietary antigens . The suppression of immune responses to previously orally - administered dietary antigens is known as " oral tolerance " (1415). Oral antigen administration in humans and mice has been shown to generate tolerance and induce a number of regulatory t cells . However, the breakdown or failure of oral tolerance to food antigens induces an adverse immune response known as " food allergy " or " food hypersensitivity " (16). Diverse, experimental food allergy mouse models have been developed in order to investigate the immune mechanisms underlying food allergy (17). In mice, food allergy can be developed by sensitizing with alum (18), by administration of oral antigen with a strong adjuvant like cholera toxin or staphylococcal enterotoxin (19), or by disruption of regulatory t cell function . These experimental food allergy models have generally shown that the immunological mechanisms involved in the development of food allergy consists of two phases 1) allergic sensitization, which is breakdown of oral tolerance, and 2) the effector phase, which is driven by effector cells reacting to the food allergen with results ranging from mild symptoms to severe anaphylaxis . Ige - mediated food allergy is the most common and classical immune mechanism in food allergy and is mediated by the ige / fcr / mast cells axis in a two - step process consisting of sensitization and hypersensitivity reactions (fig . Food proteins cross the epithelial barrier, make contact with the immune system of the gi tract, and are processed and presented by antigen - presenting cells . In the presence of il-4, nave cd4 t cells differentiate into th2 cells and produce other type-2 cytokines like il-5, il-13, and il-9 with il-4 (20). These type-2 cytokines promote b cells differentiation into ige - producing plasma cells (21) as well as intestinal mast cell proliferation and accumulation known as mastocytosis (22). Finally, allergen - specific ige is distributed systemically and binds to the fcr on mast cells and basophils (23). Together these processes constitute sensitization, poising the body to be reactive to food allergen . After sensitization, cross - linking of re - exposed food allergens to allergen - specific ige that binds to fcr on mast cells induces degranulation of mast cells (24) and release of several kinds of mediators such as histamine, platelet - activating factor (paf), prostaglandin, and cytokines . This, in turn, causes hypersensitivity reactions ranging from a mild response to severe anaphylaxis (1825). Of note, the anaphylactic responses produced during the effector phase are induced quickly / immediately after ingestion of allergen - containing foods and are potentially life threatening (2627). Although th2 cells, mast cells, and allergen - specific ige all play major roles in classical ige - mediated food allergy, the mechanisms that promote uncontrolled type 2 immune responses to dietary allergens in the gi tract and the underlying cause of the susceptibility to food allergy remain unclear . Multiple factors such as antigen availability, antigen uptake / presentation by dendritic cells (282930), costimulation (3132), function of regulatory t cells (3334), and the immune environment have been shown to contribute to the breakdown of oral tolerance and result in the induction of an allergic reaction to ingested food . Recently, emerging data have shown the importance of maintaining the intestinal epithelial barrier for prevention of gi allergic inflammation . As the primary barrier of the gut, the intestinal epithelium contains tight junctions that limit access of intact antigens and prevent them from encountering the immune system . For the induction of allergic responses, food proteins have to cross this intestinal epithelial barrier . Alteration of the intestinal epithelium by environment factors or stimuli such as inflammation or helminth infections are known to disrupt the integrity of the intestinal epithelium leading to increased intestine permeability and paracellular transport . In addition to this physical and physiological role, the intestinal epithelium also produces cytokines such as thymic stromal lymphopoietin (tslp), il-33, and il-25 in response to barrier disruption by certain stimuli . These epithelial - derived cytokines have been shown to promote production of type 2 cytokines such as il-5 and il-13 from type 2 innate lymphoid cells (ilc2s) (353637) resulting in the initiation and amplification of type 2 immune responses in both allergic asthma and against parasitic infections (383940414243). A cutaneous sensitization model of food allergy showed that tslp enhances allergic sensitization and il-33 is essential for inducing ige - dependent anaphylaxis (44). In addition, il-25 is also involved in the dysregulated type 2 immune responses to ingested food antigens and contributes to ige - mediated food allergy susceptibility (6). In a food allergy mouse model that uses ovalbumin (ova)/alum sensitization, repeated oral antigen challenge was shown to induce il25 gene expression by the intestinal epithelium before onset of the anaphylactic response (18). Moreover, intestinal il-25 transgenic mice (iil-25tg), which constitutively overexpress murine il-25 in the epithelium of the small intestine, are more prone to ige - mediated food allergy than their wild - type counterparts . Further, il17rb mice, which are deficient for the il-17rb subunit of the il-25 receptor, are more resistant to ige - mediated food allergy . Together, these findings suggest that intestinal il-25 signaling regulates susceptibility to ige - mediated food allergy . Two dominant il-17rb - expressing cells, cd4th2 cells and ilc2s, have been identified in the lamina propria of the small intestine during development of experimental food allergy . Between cd4th2 cell and ilc2s, only intestinal ilc2s produce high amounts of il-5 and il-13 in response to il-25 administered with il-2 or il-7 . The direct contributions of ilc2s in promoting ige - mediated food allergy have been demonstrated in rora or il17rb - deficient bone marrow reconstituted mice that are defective in ilc2 development or function, respectively . Moreover, il-13-deficient bone marrow reconstituted mice are also resistance to food allergy, suggesting il-13 production by ilc2s might also play a key role in promoting susceptibility to food allergy . This may be due to the induction of goblet cell hyperplasia, increase of intestinal permeability, or alteration of gut barrier function by il-13 (4546). Furthermore, nave or sensitized iil-25tg mice that have excess amounts of il-25 signal and ilc2s do not drive allergic responses in mouse models . The capability of ilc2s to produce il-5 and il-13 in response to il-25 and to promote experimental food allergy is enhanced in these mice due to the induction of increased numbers of il-17rbcd4th2 cells after repeated intragastric antigen challenge . Thus, il-25 and il-17rbcd4th2 cells induced by ingested antigens enhance ilc2-derived il-13 production, which may be a key step in amplifying the allergic reaction cascade to ingested antigens during the effector phase of ige - mediated food allergy . The measurement of food allergen - specific ige in serum is used as a diagnostic for food allergy as elevated allergen - specific ige is indicative of sensitization . However, this is not a good parameter for prediction of symptoms or clinical reaction in food allergy patients . Indeed, among those with high levels of food allergen - specific serum ige, only some individuals experience allergic responses following exposure . Thus, food allergen - specific ige is required for the pathology of food allergy, but is not sufficient to induce disease . Therefore, there are additional, unidentified regulatory or signaling steps potentiating the susceptibility to food allergy . The experimental food allergy mouse model using ovalbumin (ova)/alum sensitization and repeated oral ova challenge (18) has been reported to induce expansion of mucosal mast cells derived from bone marrow progenitors in the small intestine (47). As mentioned earlier, mast cells are well known effectors of allergic responses, releasing many mediators such as histamine and paf and producing pro - inflammatory cytokines . Moreover, depletion of mucosal mast cells, inhibition of mast cell activation, and use of fcri - deficient mice all result in significant reduction of the development of allergic diarrhea following oral antigen challenge (18). Thus, mast cell activation is likely important for the elicitation of clinical reactions to oral food antigens . Recent studies have shown that il-9 plays a role in promoting intestinal mastocytosis, characterized by the accumulation of mast cells in the intestine (2248). In the same ovalbumin (ova)/alum sensitization model, sensitized il-9- or il-9r - deficient mice were found to be resistant to food allergy, exhibited failed mucosal mast cell expansion and mast cell degranulation, and reduced allergic diarrhea following oral ova challenge, even though they produced ova - specific ige normally . On the other hand, intestinal - specific il-9 overexpressing mice are more susceptible to food allergy (224849) and systemic il-9 overexpression in mice also results in increased mast cell numbers (50). In humans, microarray analysis identified il-9 as the gene with the greatest difference in expression (among 12,257 differentially expressed genes) between children with peanut allergy and controls (51). Thus, il-9 may also be required for clinical reaction to oral food antigens . Although it has been reported that th9 cells (52), bone marrow (bm) - derived mast cells (53), eosinophils (54), neutrophils (55) and type-2 innate lymphoid cells (56) all produce il-9, the major il-9 producer in the intestine during food allergy is il-9 producing mucosal mast cells (mmc9) (7). Recently, lineage - negative (lin) il-9-producing cells, named mmc9 after characterization, were identified in the lamina propria of sensitized and challenged mice . Mmc9s expressing lin c - kit fcrist2 7 integrin are multifunctional and possess the unique characteristics of mucosal mast cells . In addition, mmc9s highly express mucosal mast cell - related chymase transcripts, mcpt1 and mcpt4, and the connective tissue mast cell - related tryptase transcripts, mcpt6 and gata1 and gata2 with il9 . Moreover, these cells produce large amounts of il-13 and il-9 when stimulated with il-33/scf / il-3 and release comparable amounts of histamine and mcp-1 as bone marrow - derived mast cells on ex - vivo ige cross - linking . When cultured with scf and il-3, mmc9s rapidly develop into granular mast cells and acquire -hexoaminidase activity while lost the capacity for il-9 production . Interestingly, depletion of cd4 and use of genetically - modified mice such as il-4-, il-4r-, stat6- or t cell - deficient mice significantly reduces mmc9s and mucosal mast cells and results in the failure to develop allergic diarrhea in response to oral antigen . Therefore, these finding suggest mmc9s are hypogranular mast cell lineage intermediates developed during type-2-cell - mediated intestinal inflammation . The presence of mmc9s is positively correlated the degree of intestinal mastocytosis, mast cell activation, and allergic diarrhea further, in the absence of mmc9s, mice do not develop intestinal mastocytosis or food allergy symptoms . Interestingly, both il-9 and il9r - deficient mice develop mmc9s normally, but exhibit reduced numbers of mature mucosal mast cells and decreased mast cell activation after oral antigen challenge, indicating that the il-9 is an important mediator of the differentiation of mmc9s into fully - mature mucosal mast cells . In addition, transfer of wt bone marrow, but not il-9-deficient bone marrow, into irradiated il-9-deficient mice restores the induction of intestinal mastocytosis and mast cell reactivity, indicating mmc9s generate il-9 to facilitate their own maturation into mucosal mast cells . Moreover, mmc9s appear to regulate mast cell immunopathology in food allergy in that they can produce high amounts of il-9 resulting in mastocytosis while they lose il-9 production upon mucosal mast cell maturation . Thus, expansion of intestinal mmc9s might be a second signal required for clinical reactions associated with food allergy . Therefore, it has been speculated that mmc9s are responsible for the susceptibility to food allergy in effector phase . Here, we reviewed the immune mechanisms responsible for ige - mediated food allergy in the gastrointestinal (gi) tract and in particular, the roles of il-25 and ilc2s and of il-9 and mmc9s (67). In addition to the role of allergen - specific th2 cells in regulating food allergy, it has recently been described that il-25, ilc2 cells and mmc9 cells also have key roles in amplifying the allergic reaction cascade in response to ingested antigens during the effector phase of ige - mediated food allergy . Susceptibility to food allergic responses appears to be determined not by one parameter, but by a collaboration of several parameters that result in synergic responses . Indeed, the function of ilc2s and mmc9s in developing food allergies appears to also require cd4th2 cells . Moreover, the il-25 mediated collaboration between ilc2s and cd4th2 cells potentiates the type 2 cytokine environment and physically changes intestinal permeability through il-13 production by ilc2s . Moreover, the induction of mastocytosis by mmc9 cell expressed il-9 and the interplay between mmc9 and cd4th2 cells appear to govern the susceptibility to and severity of food allergies (fig ., understanding the factors required to initiate these events in response to dietary antigens might provide novel therapeutic strategies for the care of ige - mediated food allergy patients.
|
This study was approved by the institutional review board of the duke university health system, and all subjects participated with full informed consent . A group of 14 ophthalmic surgeons - in - training were recruited from duke university ophthalmology residents . The subjects were randomized into two groups balanced by level of training and surgical experience: with one group assigned to work with the ability to view the mi - oct (mi - oct+) and the other without (mi - oct) such guidance (fig . A total of three first - year, two second - year, and two third - year residents were randomized to each group (n = 14 total). All residents within the same year had equivalent wet laboratory experience prior to the commencement of the study . Fourteen ophthalmology residents were stratified according to the year of training and randomized to either the mi - oct or mi - oct+ group (a). They were asked to perform four surgical maneuvers, including simple corneal pass at 50% and 90% depth, repair corneal laceration at 90% depth, and create triplanar clear - cornea wound on porcine eyes . The mi - oct residents initially operated without mi - oct guidance, whereas the mi - oct+ residents operated under mi - oct feedback (trial 1). The same maneuvers were repeated by both groups of residents without mi - oct feedback (trial 2). Finally, the mi - oct group crossed over and repeated all the maneuvers with mi - oct guidance (trial 3) (a, b). (c) wet laboratory setup, which included operating microscope with custom - designed, ss the subjects were shown a standardized powerpoint slide set to introduce the wet laboratory, surgical maneuvers, instrumentation, the operating microscope, and mi - oct . Freshly enucleated porcine eyes obtained from a local slaughterhouse and stored at 4c were used for the wet laboratory within 18 hours to minimize corneal edema . The residents were asked to perform a corneal suture pass at 50% thickness, a corneal suture pass at 90% thickness, repair a linear full - thickness corneal laceration with suture at 90% thickness, and construct a triplanar clear - corneal cataract - type incision on the porcine eye (fig . 1). The corneal suture passes and laceration repair were with 10 - 0 nylon suture on a spatulated needle (ethicon, somerville, nj, usa), whereas the clear - corneal wound was constructed using a standard 2.75-mm disposable keratome for cataract surgery (alcon, fort worth, tx, usa). In the trials involving mi - oct feedback, the residents could ask for oct at any point during the surgical maneuver . The oct feedback entailed obtaining scans in any orientation anywhere within surgical field as directed by the surgeon . At that point, based on the feedback, the resident could rectify the maneuver (i.e., back out the needle pass and go deeper or shallower) based on the mi - oct finding for up to three trial attempts . In the trials not involving mi - oct feedback, the entire procedure was performed using only the operating microscope . For both, however, intraoperative oct was used to obtain images used for grading the maneuver at the end of the procedure . For depth - based maneuvers, an intraoperative oct image perpendicular to the needle and when visible along the suture tract was obtained after each completed pass to allow subsequent grading of the depth of the pass (figs . 1, 2). The depth scores of the individual attempts were averaged and analyzed for statistically significant differences between the mi - oct+ and mi - oct groups . For the clear - corneal incision, a b - scan oriented along the radial axis of the wound was acquired at the conclusion of the maneuver and used for grading . Close - up view of the mi - oct display options is demonstrated in a resident surgeons had a choice to view oct display data of the surgical field during each maneuver in (a) a 3d view demonstrating the cornea (white arrow) and anterior chamber (red arrow), (b) cross - sectional b - scan view, or (c) as a surface volume projection . Three consecutive trials were performed: trial 1, each resident performed the above surgical maneuvers with (mi - oct+ group) or without (mi - oct group) mi - oct feedback based on the randomized assignment; trial 2, the same maneuvers were repeated by each surgeon using only the microscope for viewing (no mi - oct guidance for either group) to test the persistence of effect in the mi - oct+ group compared with the mi - oct group; and trial 3, the same maneuvers were repeated by each surgeon in the mi - oct group with intraoperative oct feedback . This crossover was designed as an internal control to ensure that any observed differences between the group performance in trials 1 and 2 were not due to confounding variables such as innate surgical ability . The mi - oct scanner used was previously published and utilized an external display for image viewing . Briefly, a customized mechanical enclosure allowed integration of the mi - oct into an ophthalmic surgical microscope (leica microsystems, inc ., buffalo grove, il, usa). A dichroic mirror folded the oct beam path onto the surgical microscope path to allow unobstructed surgical viewing with simultaneous (ss - oct) imaging . The final surgical microscope objective lens was shared between the two systems and ensured that both systems were parfocal . The ss mi - oct system used a (ss - oct) engine utilizing a swept - frequency source centered at 1040 nm with a sweep bandwidth of 100 nm and a sweep rate of 100 khz (axsun, billerca, ma, usa). This resulted in a measured system signal - to - noise ratio (snr) of 99 db, and axial and lateral resolutions of 7.8 and 15 m, respectively . The imaging protocol consisted of 500 a - lines / b - scan and 100 b - scans / volume with an average of 510 volumes per second . Custom gpu - accelerated software enabled real - time acquisition, processing, and simultaneous display during surgery of a continuously updated and optimized oct b - scan, top - down retinal view, and volumetric rendering on a computer screen adjacent to the operating microscope . The site of user - specified b - scan of interest in the volume was selected by an assistant using a mouse; at that site, b - scans were averaged 5 times to enhance visualization . To grade the suture placement, custom software was created using matlab (mathworks, natick, ma, usa). On averaged b - scans at the point of maximal depth of the needle and suture passes, the surface of the corneal endothelium and epithelium were marked by a masked trained grader . Two - dimensional correction of the selected b - scan was performed to correct for image distortions due to refraction as previously described . The corneal thickness at the suture pass was defined as the shortest distance between the epithelial and endothelial layers that included the position of the surgical needle or suture . The percent depth was calculated as the ratio between the distance from the epithelium to the needle / suture and the distance between the epithelium and endothelium (corneal thickness). In some corneal laceration cases, jagged edges and protrusions occurred in the epithelium at the edge of the laceration . In these b - scans, the epithelial segmentation was fit to a higher - order polynomial to accurately follow these high frequency features . Refraction correction was performed as described previously, except where a significant portion of the corneal tissue was missing in the laceration . In those cases, the best - approximated orthogonal path through the cornea was segmented manually in these instances, and the shortest linear path was found between the endothelium and epithelium . For clear - corneal incision geometry assessment, volume and averaged b - scans parallel to the direction of the keratome path were deidentified, shuffled, and reviewed by two masked expert graders . Graders determined the geometry of the clear corneal incisions on a categorical scale (3 = triplanar wound, 2 = biplanar wound, 1 = monoplanar wound, 0 = unable to determine geometry of the wound) by comparison with standard images for each grade . The scores of the individual graders were averaged for each scan, and the agreement (statistic) between the graders was computed . All subjects were given an anonymous survey to determine their subjective experience (supplementary tables). The mi - oct+ group was asked to rank their agreement with statements evaluating their comfort in performing simple corneal passes, repairing the corneal laceration, and constructing the clear corneal incision under direct mi - oct guidance . The mi - oct group was asked to rank their agreement with statements evaluating their comfort in performing simple corneal passes, repair of corneal laceration, and construction of clear corneal wound without direct mi - oct feedback on a 1 to 5 numerical scale . They were then asked to rerank their performance of the same maneuvers with direct mi - oct feedback at the completion of trial 3 when they were finally provided with mi - oct guidance . Both groups were asked to rank their overall experience of using mi - oct, as well as their likelihood of using mi - oct in their future practice on a 1 to 5 numerical scale . In both groups, the subjective score of 1 represented the lowest confidence score, whereas a score of 5 represented the highest confidence score . The composite scores of the depth - based maneuvers were computed and expressed as box - plots using graphpad prism software (graphpad, la jolla, ca, usa). The statistical comparisons conducted across the mi - oct+ and mi - oct groups were performed unpaired, using a wilcoxon rank sum test . Thus, comparisons between mi - oct and mi - oct+ group scores for trial 1 (mi - oct+ versus mi - oct), trial 2 (both groups without mi - oct), and trial 3 (mi - oct group repeating maneuvers using mi - oct) were performed using the wilcoxon rank sum test of differences between medians . The statistical comparisons within a group (either mi - oct or mi - oct+) were performed using the wilcoxon signed rank test of median differences . The wilcoxon signed rank test was used to ascertain, in a paired fashion, whether there was a statistically significant difference in scores within the mi - oct group when they only had the microscope alone (trials 1 and 2) and when they had guidance from mi - oct (trial 3). Similarly, the wilcoxon signed rank test was used to compare, in a paired fashion, within the mi - oct+ group whether there was a statistically significant difference in scores when they had the mi - oct guidance first compared with their performance without the mi - oct afterward . All comparisons of the medians using the wilcoxon signed rank test and wilcoxon rank sum test with a p value of <0.05 were deemed statistically significant . A group of 14 ophthalmic surgeons - in - training were recruited from duke university ophthalmology residents . The subjects were randomized into two groups balanced by level of training and surgical experience: with one group assigned to work with the ability to view the mi - oct (mi - oct+) and the other without (mi - oct) such guidance (fig . A total of three first - year, two second - year, and two third - year residents were randomized to each group (n = 14 total). All residents within the same year had equivalent wet laboratory experience prior to the commencement of the study . Fourteen ophthalmology residents were stratified according to the year of training and randomized to either the mi - oct or mi - oct+ group (a). They were asked to perform four surgical maneuvers, including simple corneal pass at 50% and 90% depth, repair corneal laceration at 90% depth, and create triplanar clear - cornea wound on porcine eyes . The mi - oct residents initially operated without mi - oct guidance, whereas the mi - oct+ residents operated under mi - oct feedback (trial 1). The same maneuvers were repeated by both groups of residents without mi - oct feedback (trial 2). Finally, the mi - oct group crossed over and repeated all the maneuvers with mi - oct guidance (trial 3) (a, b). (c) wet laboratory setup, which included operating microscope with custom - designed, ss the subjects were shown a standardized powerpoint slide set to introduce the wet laboratory, surgical maneuvers, instrumentation, the operating microscope, and mi - oct . Freshly enucleated porcine eyes obtained from a local slaughterhouse and stored at 4c were used for the wet laboratory within 18 hours to minimize corneal edema . The residents were asked to perform a corneal suture pass at 50% thickness, a corneal suture pass at 90% thickness, repair a linear full - thickness corneal laceration with suture at 90% thickness, and construct a triplanar clear - corneal cataract - type 1). The corneal suture passes and laceration repair were with 10 - 0 nylon suture on a spatulated needle (ethicon, somerville, nj, usa), whereas the clear - corneal wound was constructed using a standard 2.75-mm disposable keratome for cataract surgery (alcon, fort worth, tx, usa). In the trials involving mi - oct feedback, the residents could ask for oct at any point during the surgical maneuver . The oct feedback entailed obtaining scans in any orientation anywhere within surgical field as directed by the surgeon . At that point, based on the feedback, the resident could rectify the maneuver (i.e., back out the needle pass and go deeper or shallower) based on the mi - oct finding for up to three trial attempts . In the trials not involving mi - oct feedback, the entire procedure was performed using only the operating microscope . For both, however, intraoperative oct was used to obtain images used for grading the maneuver at the end of the procedure . For depth - based maneuvers, an intraoperative oct image perpendicular to the needle and when visible along the suture tract was obtained after each completed pass to allow subsequent grading of the depth of the pass (figs . 1, 2). The depth scores of the individual attempts were averaged and analyzed for statistically significant differences between the mi - oct+ and mi - oct groups . For the clear - corneal incision, a b - scan oriented along the radial axis of the wound was acquired at the conclusion of the maneuver and used for grading . Close - up view of the mi - oct display options is demonstrated in a resident surgeons had a choice to view oct display data of the surgical field during each maneuver in (a) a 3d view demonstrating the cornea (white arrow) and anterior chamber (red arrow), (b) cross - sectional b - scan view, or (c) as a surface volume projection . Three consecutive trials were performed: trial 1, each resident performed the above surgical maneuvers with (mi - oct+ group) or without (mi - oct group) mi - oct feedback based on the randomized assignment; trial 2, the same maneuvers were repeated by each surgeon using only the microscope for viewing (no mi - oct guidance for either group) to test the persistence of effect in the mi - oct+ group compared with the mi - oct group; and trial 3, the same maneuvers were repeated by each surgeon in the mi - oct group with intraoperative oct feedback . This crossover was designed as an internal control to ensure that any observed differences between the group performance in trials 1 and 2 were not due to confounding variables such as innate surgical ability . The mi - oct scanner used was previously published and utilized an external display for image viewing . Briefly, a customized mechanical enclosure allowed integration of the mi - oct into an ophthalmic surgical microscope (leica microsystems, inc ., buffalo grove, il, usa). A dichroic mirror folded the oct beam path onto the surgical microscope path to allow unobstructed surgical viewing with simultaneous (ss - oct) imaging . The final surgical microscope objective lens was shared between the two systems and ensured that both systems were parfocal . The ss mi - oct system used a (ss - oct) engine utilizing a swept - frequency source centered at 1040 nm with a sweep bandwidth of 100 nm and a sweep rate of 100 khz (axsun, billerca, ma, usa). This resulted in a measured system signal - to - noise ratio (snr) of 99 db, and axial and lateral resolutions of 7.8 and 15 m, respectively . The imaging protocol consisted of 500 a - lines / b - scan and 100 b - scans / volume with an average of 510 volumes per second . Custom gpu - accelerated software enabled real - time acquisition, processing, and simultaneous display during surgery of a continuously updated and optimized oct b - scan, top - down retinal view, and volumetric rendering on a computer screen adjacent to the operating microscope . The site of user - specified b - scan of interest in the volume was selected by an assistant using a mouse; at that site, b - scans were averaged 5 times to enhance visualization . To grade the suture placement, custom software was created using matlab (mathworks, natick, ma, usa). On averaged b - scans at the point of maximal depth of the needle and suture passes, the surface of the corneal endothelium and epithelium were marked by a masked trained grader . Two - dimensional correction of the selected b - scan was performed to correct for image distortions due to refraction as previously described . The corneal thickness at the suture pass was defined as the shortest distance between the epithelial and endothelial layers that included the position of the surgical needle or suture . The percent depth was calculated as the ratio between the distance from the epithelium to the needle / suture and the distance between the epithelium and endothelium (corneal thickness). In some corneal laceration cases, jagged edges and protrusions occurred in the epithelium at the edge of the laceration . In these b - scans, the epithelial segmentation was fit to a higher - order polynomial to accurately follow these high frequency features . Refraction correction was performed as described previously, except where a significant portion of the corneal tissue was missing in the laceration . In those cases, the best - approximated orthogonal path through the cornea was segmented manually in these instances, and the shortest linear path was found between the endothelium and epithelium . For clear - corneal incision geometry assessment, volume and averaged b - scans parallel to the direction of the keratome path were deidentified, shuffled, and reviewed by two masked expert graders . Graders determined the geometry of the clear corneal incisions on a categorical scale (3 = triplanar wound, 2 = biplanar wound, 1 = monoplanar wound, 0 = unable to determine geometry of the wound) by comparison with standard images for each grade . The scores of the individual graders were averaged for each scan, and the agreement (statistic) between the graders was computed . All subjects were given an anonymous survey to determine their subjective experience (supplementary tables). The mi - oct+ group was asked to rank their agreement with statements evaluating their comfort in performing simple corneal passes, repairing the corneal laceration, and constructing the clear corneal incision under direct mi - oct guidance . The mi - oct group was asked to rank their agreement with statements evaluating their comfort in performing simple corneal passes, repair of corneal laceration, and construction of clear corneal wound without direct mi - oct feedback on a 1 to 5 numerical scale . They were then asked to rerank their performance of the same maneuvers with direct mi - oct feedback at the completion of trial 3 when they were finally provided with mi - oct guidance . Both groups were asked to rank their overall experience of using mi - oct, as well as their likelihood of using mi - oct in their future practice on a 1 to 5 numerical scale . In both groups, the subjective score of 1 represented the lowest confidence score, whereas a score of 5 represented the highest confidence score . The composite scores of the depth - based maneuvers were computed and expressed as box - plots using graphpad prism software (graphpad, la jolla, ca, usa). The statistical comparisons conducted across the mi - oct+ and mi - oct groups were performed unpaired, using a wilcoxon rank sum test . Thus, comparisons between mi - oct and mi - oct+ group scores for trial 1 (mi - oct+ versus mi - oct), trial 2 (both groups without mi - oct), and trial 3 (mi - oct group repeating maneuvers using mi - oct) were performed using the wilcoxon rank sum test of differences between medians . The statistical comparisons within a group (either mi - oct or mi - oct+) were performed using the wilcoxon signed rank test of median differences . The wilcoxon signed rank test was used to ascertain, in a paired fashion, whether there was a statistically significant difference in scores within the mi - oct group when they only had the microscope alone (trials 1 and 2) and when they had guidance from mi - oct (trial 3). Similarly, the wilcoxon signed rank test was used to compare, in a paired fashion, within the mi - oct+ group whether there was a statistically significant difference in scores when they had the mi - oct guidance first compared with their performance without the mi - oct afterward . All comparisons of the medians using the wilcoxon signed rank test and wilcoxon rank sum test with a p value of <0.05 were deemed statistically significant . Figure 3a demonstrates a representative orthogonal b - scan of a corneal needle pass at 50% depth (arrow). When asked to perform corneal passes at 50% depth in trial 1, residents operating without mi - oct feedback (mi - oct group) on average placed the pass at 39.4% depth (sd = 13%, median = 35%), whereas residents operating with direct mi - oct feedback (mi - oct+ group) on average placed the pass at 54.6% depth (sd = 5%, median = 56%). 3b). When both groups were asked to repeat this corneal pass without mi - oct in trial 2, the mi - oct group on average placed the pass at 37.6% depth (sd = 7%, median = 38%), whereas mi - oct+ on average placed the pass at 51.0% depth (sd = 7%, median = 51%), which was also significantly different (p = 0.009; fig . 3b). To ensure that the observed difference was not due to inferior surgical ability in the mi - oct group, these subjects were asked to perform the same maneuver with mi - oct feedback . With mi - oct feedback, there was a significant difference (p = 0.016) in the performance of the mi - oct residents with an average of 53% depth (sd = 5%, median = 55%) compared with their earlier performance without mi - oct in trial 2 with an average of 37.6% (sd = 7%, median = 38%). Corneal passes with the goal depth of 50% corneal thickness were performed by mi - oct and mi - oct+ group residents . A representative cross - sectional b - scan orthogonal to the direction of corneal needle pass is shown, and the hyperreflective dot (circle) represents an attempted pass at 50% corneal depth (a). The average score of the residents in each group and the median depth scores are compared within the individual groups using paired analysis with the wilcoxon signed rank test, with relevant comparisons demonstrating statistical significance indicated at p <0.05 (b). For the corneal pass at 90% depth, a representative b - scan of this maneuver is shown in figure 4a . When asked to perform this maneuver in trial 1, residents operating without mi - oct feedback (mi - oct) on average placed the pass at 49.1% depth (sd = 14%, median = 43.0), in contrast to 85.5% depth (sd = 5%, median = 87%) for the mi - oct+ group . When both groups were asked to repeat this corneal pass without mi - oct in trial 2, the average was 46.4% depth (sd = 12%, median = 41%) for the mi - oct group and 81.5% depth (sd = 9%, median = 79%) for the mi - oct+ group, which was also a statistically significant difference between the mi - oct+ and mi - oct groups without the use of the microscope (p = 0.002; fig . The mi - oct+ group had no significant difference in depth performance between trials 1 and 2 with and without mi - oct (median difference = 0.03, p = 0.812). In trial 3, the mi - oct group repeated the surgical maneuver with mi - oct feedback, with the average corneal pass at 84.1% depth (sd = 9%, median = 85%); using the wilcoxon signed rank test, nonparametric testing for paired data, the mi - oct group's performance with and without mi - oct was compared, and noted to be significantly different (median difference = 0.34, p = 0.016). Corneal passes with goal depth of 90% corneal thicknesses were performed by mi - oct and mi - oct+ group residents . A representative cross - sectional b - scan obtained orthogonal to the direction of needle pass demonstrates a hyperreflective dot (circle) at the goal of 90% corneal depth (a). The average score of each resident was plotted, and the median depth scores were compared within individual groups using the wilcoxon signed rank test, with relevant comparisons demonstrating statistical significance indicated at p <0.05 (b). Figure 5a demonstrates a representative orthogonal b - scan of a corneal needle pass at 90% depth (arrow) through the laceration . While performing this maneuver in trial 1, residents operating without mi - oct feedback (mi - oct) on average placed the pass at 55.5% depth (sd = 14%, median = 53%), whereas residents operating with direct mi - oct feedback (mi - oct+) on average placed the laceration pass at 81.5% depth (sd = 3%, median = 82%). When both groups were asked to repeat this corneal pass without mi - oct in trial 2, the mi - oct group on average placed the pass at 50.6% depth (sd = 15%, median = 49%), whereas the mi - oct+ group on average placed the pass at 73.3% depth (sd = 12%, median = 74%), which was also statistically significant (p = 0.025; fig . Notably, the mi - oct+ group, which first operated with direct mi - oct guidance, continued to perform well in the second trial once mi - oct guidance was removed . There was no significant difference in their performance (median difference = 0.07, p = 0.11). In trial 3, the mi - oct group repeated the surgical maneuvers with mi - oct feedback, resulting in an average 83.8% suture pass depth (sd = 5%, median = 83%), which was significant compared with their earlier performance without mi - oct in trial 2 with paired analysis through the wilcoxon signed ranks test (p = 0.016). Fresh porcine corneas were used to construct vertical linear corneal laceration using a 15-blade scalpel . The corneal laceration repair with 10 - 0 nylon suture was performed by mi - oct and mi - oct+ group residents . A representative cross - sectional b - scan was obtained orthogonal to the direction of needle pass and demonstrates a jagged break in corneal integrity consistent with corneal laceration (arrow) and a hyperreflective dot (circle) at goal depth of 90% corneal thickness (a). The average score of each resident was plotted, and the median depth scores compared across the groups using the wilcoxon signed rank test, with relevant comparisons demonstrating statistical significance indicated at p <0.05 (b). The agreement between the expert graders in scoring corneal incision geometry on a scale of 0 to 3 was determined to not be significantly different (weighted = 0.6381). Figures 6a and 6b demonstrate two representative b - scans of the constructed wounds . When asked to create a triplanar incision in trial 1, residents operating without mi - oct feedback (mi - oct group) on average constructed a corneal wound with a mean score of 1.82 planes (sd = 0.67, median = 1.75), whereas residents operating with direct mi - oct feedback (mi - oct+ group) had a mean score of 2.14 planes (sd = 0.46, median = 2.00). When both groups were asked to repeat this maneuver without mi - oct in trial 2, the mi - oct group on average constructed wounds with a mean score of 2.41 planes (sd = 0.65, median = 2.75), whereas the mi - oct+ group had a mean score of 2.38 planes (sd = 0.53, median = 2.50), which was also not statistically significant (p = 0.521). In trial 3, the mi - oct group was given an opportunity to repeat the surgical maneuver with mi - oct feedback and on average received a mean score of 2.21 (sd = 0.86, median = 2.64), which was not significantly different than this group's performance in trial 2 (p = 0.437). Clear corneal incisions were created in porcine eyes by mi - oct and mi - oct+ group residents using 2.75-mm surgical keratomes . Although the mi - oct+ resident could view the mi - oct throughout and at the completion of the maneuver, a representative cross - sectional b - scan longitudinal to the length of the wound was obtained at the completion of each maneuver (a, b) for postmaneuver grading of the wound profile visible from two separate representative trials (arrows). All incisions viewed on such b - scans were assigned a grade of 0 to 3 by two expert graders masked to study group . Last, qualitative and quantitative surgeon's subjective feedback was obtained from the residents following completion of the study maneuvers via an administered survey (fig . Only the mi - oct+ group had the direct use of mi - oct; the mi - oct+ group reported higher levels of comfort compared with the mi - oct group, in performing simple cornea suture passes (p = 0.007) and cornea laceration repair (p = 0.028), but this trend was not observed for creation of triplanar corneal wound . At the end of the training, when both mi - oct and mi - oct+ groups had experienced the direct use of mi - oct, there was no statistically significant difference between the groups' subjective experience of mi - oct impact on their ability to perform those same procedures . In total, both mi - oct and mi - oct+ residents on average rated the overall experience of using mi - oct feedback for anterior segment surgical maneuvers as helpful (score of 4) or very helpful (score of 5), reporting a mean score 4.57 (sd = 0.53) for the mi - oct group and 4.86 (sd = 0.38), and a median of 5 for both groups on a 1 to 5 scale . (score 4 on 15 scale) to use mi - oct in their future practice as a result of mi - oct experience in this study . The survey administered to each resident surgeon at the conclusion of initial training and end of the study ranked their subjective experience on a 1 to 5 numerical scale . The mean subjective score with sd and minimum, maximum, and median responses to the survey questions the comparison between the mi - oct group and the mi - oct+ groups was done using the wilcoxon rank sum test of difference between medians . Figure 3a demonstrates a representative orthogonal b - scan of a corneal needle pass at 50% depth (arrow). When asked to perform corneal passes at 50% depth in trial 1, residents operating without mi - oct feedback (mi - oct group) on average placed the pass at 39.4% depth (sd = 13%, median = 35%), whereas residents operating with direct mi - oct feedback (mi - oct+ group) on average placed the pass at 54.6% depth (sd = 5%, median = 56%). 3b). When both groups were asked to repeat this corneal pass without mi - oct in trial 2, the mi - oct group on average placed the pass at 37.6% depth (sd = 7%, median = 38%), whereas mi - oct+ on average placed the pass at 51.0% depth (sd = 7%, median = 51%), which was also significantly different (p = 0.009; fig . 3b). To ensure that the observed difference was not due to inferior surgical ability in the mi - oct group, these subjects were asked to perform the same maneuver with mi - oct feedback . With mi - oct feedback, there was a significant difference (p = 0.016) in the performance of the mi - oct residents with an average of 53% depth (sd = 5%, median = 55%) compared with their earlier performance without mi - oct in trial 2 with an average of 37.6% (sd = 7%, median = 38%). Corneal passes with the goal depth of 50% corneal thickness were performed by mi - oct and mi - oct+ group residents . A representative cross - sectional b - scan orthogonal to the direction of corneal needle pass is shown, and the hyperreflective dot (circle) represents an attempted pass at 50% corneal depth (a). The average score of the residents in each group and the median depth scores are compared within the individual groups using paired analysis with the wilcoxon signed rank test, with relevant comparisons demonstrating statistical significance indicated at p <0.05 (b). For the corneal pass at 90% depth, a representative b - scan of this maneuver is shown in figure 4a . When asked to perform this maneuver in trial 1, residents operating without mi - oct feedback (mi - oct) on average placed the pass at 49.1% depth (sd = 14%, median = 43.0), in contrast to 85.5% depth (sd = 5%, median = 87%) for the mi - oct+ group . When both groups were asked to repeat this corneal pass without mi - oct in trial 2, the average was 46.4% depth (sd = 12%, median = 41%) for the mi - oct group and 81.5% depth (sd = 9%, median = 79%) for the mi - oct+ group, which was also a statistically significant difference between the mi - oct+ and mi - oct groups without the use of the microscope (p = 0.002; fig . The mi - oct+ group had no significant difference in depth performance between trials 1 and 2 with and without mi - oct (median difference = 0.03, p = 0.812). In trial 3, the mi - oct group repeated the surgical maneuver with mi - oct feedback, with the average corneal pass at 84.1% depth (sd = 9%, median = 85%); using the wilcoxon signed rank test, nonparametric testing for paired data, the mi - oct group's performance with and without mi - oct was compared, and noted to be significantly different (median difference = 0.34, p = 0.016). Corneal passes with goal depth of 90% corneal thicknesses were performed by mi - oct and mi - oct+ group residents . A representative cross - sectional b - scan obtained orthogonal to the direction of needle pass demonstrates a hyperreflective dot (circle) at the goal of 90% corneal depth (a). The average score of each resident was plotted, and the median depth scores were compared within individual groups using the wilcoxon signed rank test, with relevant comparisons demonstrating statistical significance indicated at p <0.05 (b). Figure 5a demonstrates a representative orthogonal b - scan of a corneal needle pass at 90% depth (arrow) through the laceration . While performing this maneuver in trial 1, residents operating without mi - oct feedback (mi - oct) on average placed the pass at 55.5% depth (sd = 14%, median = 53%), whereas residents operating with direct mi - oct feedback (mi - oct+) on average placed the laceration pass at 81.5% depth (sd = 3%, median = 82%). When both groups were asked to repeat this corneal pass without mi - oct in trial 2, the mi - oct group on average placed the pass at 50.6% depth (sd = 15%, median = 49%), whereas the mi - oct+ group on average placed the pass at 73.3% depth (sd = 12%, median = 74%), which was also statistically significant (p = 0.025; fig . Notably, the mi - oct+ group, which first operated with direct mi - oct guidance, continued to perform well in the second trial once mi - oct guidance was removed . There was no significant difference in their performance (median difference = 0.07, p = 0.11). In trial 3, the mi - oct group repeated the surgical maneuvers with mi - oct feedback, resulting in an average 83.8% suture pass depth (sd = 5%, median = 83%), which was significant compared with their earlier performance without mi - oct in trial 2 with paired analysis through the wilcoxon signed ranks test (p = 0.016). Fresh porcine corneas were used to construct vertical linear corneal laceration using a 15-blade scalpel . The corneal laceration repair with 10 - 0 nylon suture was performed by mi - oct and mi - oct+ group residents . A representative cross - sectional b - scan was obtained orthogonal to the direction of needle pass and demonstrates a jagged break in corneal integrity consistent with corneal laceration (arrow) and a hyperreflective dot (circle) at goal depth of 90% corneal thickness (a). The average score of each resident was plotted, and the median depth scores compared across the groups using the wilcoxon signed rank test, with relevant comparisons demonstrating statistical significance indicated at p <0.05 (b). Figure 3a demonstrates a representative orthogonal b - scan of a corneal needle pass at 50% depth (arrow). When asked to perform corneal passes at 50% depth in trial 1, residents operating without mi - oct feedback (mi - oct group) on average placed the pass at 39.4% depth (sd = 13%, median = 35%), whereas residents operating with direct mi - oct feedback (mi - oct+ group) on average placed the pass at 54.6% depth (sd = 5%, median = 56%). 3b). When both groups were asked to repeat this corneal pass without mi - oct in trial 2, the mi - oct group on average placed the pass at 37.6% depth (sd = 7%, median = 38%), whereas mi - oct+ on average placed the pass at 51.0% depth (sd = 7%, median = 51%), which was also significantly different (p = 0.009; fig . 3b). To ensure that the observed difference was not due to inferior surgical ability in the mi - oct group, these subjects were asked to perform the same maneuver with mi - oct feedback . With mi - oct feedback, there was a significant difference (p = 0.016) in the performance of the mi - oct residents with an average of 53% depth (sd = 5%, median = 55%) compared with their earlier performance without mi - oct in trial 2 with an average of 37.6% (sd = 7%, median = 38%). Corneal passes with the goal depth of 50% corneal thickness were performed by mi - oct and mi - oct+ group residents . A representative cross - sectional b - scan orthogonal to the direction of corneal needle pass is shown, and the hyperreflective dot (circle) represents an attempted pass at 50% corneal depth (a). The average score of the residents in each group and the median depth scores are compared within the individual groups using paired analysis with the wilcoxon signed rank test, with relevant comparisons demonstrating statistical significance indicated at p <0.05 (b). For the corneal pass at 90% depth, a representative b - scan of this maneuver is shown in figure 4a . When asked to perform this maneuver in trial 1, residents operating without mi - oct feedback (mi - oct) on average placed the pass at 49.1% depth (sd = 14%, median = 43.0), in contrast to 85.5% depth (sd = 5%, median = 87%) for the mi - oct+ group . When both groups were asked to repeat this corneal pass without mi - oct in trial 2, the average was 46.4% depth (sd = 12%, median = 41%) for the mi - oct group and 81.5% depth (sd = 9%, median = 79%) for the mi - oct+ group, which was also a statistically significant difference between the mi - oct+ and mi - oct groups without the use of the microscope (p = 0.002; fig . The mi - oct+ group had no significant difference in depth performance between trials 1 and 2 with and without mi - oct (median difference = 0.03, p = 0.812). In trial 3, the mi - oct group repeated the surgical maneuver with mi - oct feedback, with the average corneal pass at 84.1% depth (sd = 9%, median = 85%); using the wilcoxon signed rank test, nonparametric testing for paired data, the mi - oct group's performance with and without mi - oct was compared, and noted to be significantly different (median difference = 0.34, p = 0.016). Corneal passes with goal depth of 90% corneal thicknesses were performed by mi - oct and mi - oct+ group residents . A representative cross - sectional b - scan obtained orthogonal to the direction of needle pass demonstrates a hyperreflective dot (circle) at the goal of 90% corneal depth (a). The average score of each resident was plotted, and the median depth scores were compared within individual groups using the wilcoxon signed rank test, with relevant comparisons demonstrating statistical significance indicated at p <0.05 (b). Figure 5a demonstrates a representative orthogonal b - scan of a corneal needle pass at 90% depth (arrow) through the laceration . While performing this maneuver in trial 1, residents operating without mi - oct feedback (mi - oct) on average placed the pass at 55.5% depth (sd = 14%, median = 53%), whereas residents operating with direct mi - oct feedback (mi - oct+) on average placed the laceration 5b). When both groups were asked to repeat this corneal pass without mi - oct in trial 2, the mi - oct group on average placed the pass at 50.6% depth (sd = 15%, median = 49%), whereas the mi - oct+ group on average placed the pass at 73.3% depth (sd = 12%, median = 74%), which was also statistically significant (p = 0.025; fig . Notably, the mi - oct+ group, which first operated with direct mi - oct guidance, continued to perform well in the second trial once mi - oct guidance was removed . There was no significant difference in their performance (median difference = 0.07, p = 0.11). In trial 3, the mi - oct group repeated the surgical maneuvers with mi - oct feedback, resulting in an average 83.8% suture pass depth (sd = 5%, median = 83%), which was significant compared with their earlier performance without mi - oct in trial 2 with paired analysis through the wilcoxon signed ranks test (p = 0.016). Fresh porcine corneas were used to construct vertical linear corneal laceration using a 15-blade scalpel . The corneal laceration repair with 10 - 0 nylon suture was performed by mi - oct and mi - oct+ group residents . A representative cross - sectional b - scan was obtained orthogonal to the direction of needle pass and demonstrates a jagged break in corneal integrity consistent with corneal laceration (arrow) and a hyperreflective dot (circle) at goal depth of 90% corneal thickness (a). The average score of each resident was plotted, and the median depth scores compared across the groups using the wilcoxon signed rank test, with relevant comparisons demonstrating statistical significance indicated at p <0.05 (b). The agreement between the expert graders in scoring corneal incision geometry on a scale of 0 to 3 was determined to not be significantly different (weighted = 0.6381). Figures 6a and 6b demonstrate two representative b - scans of the constructed wounds . When asked to create a triplanar incision in trial 1, residents operating without mi - oct feedback (mi - oct group) on average constructed a corneal wound with a mean score of 1.82 planes (sd = 0.67, median = 1.75), whereas residents operating with direct mi - oct feedback (mi - oct+ group) had a mean score of 2.14 planes (sd = 0.46, median = 2.00). This difference was not statistically significant (p = 0.244). When both groups were asked to repeat this maneuver without mi - oct in trial 2, the mi - oct group on average constructed wounds with a mean score of 2.41 planes (sd = 0.65, median = 2.75), whereas the mi - oct+ group had a mean score of 2.38 planes (sd = 0.53, median = 2.50), which was also not statistically significant (p = 0.521). In trial 3, the mi - oct group was given an opportunity to repeat the surgical maneuver with mi - oct feedback and on average received a mean score of 2.21 (sd = 0.86, median = 2.64), which was not significantly different than this group's performance in trial 2 (p = 0.437). Clear corneal incisions were created in porcine eyes by mi - oct and mi - oct+ group residents using 2.75-mm surgical keratomes . Although the mi - oct+ resident could view the mi - oct throughout and at the completion of the maneuver, a representative cross - sectional b - scan longitudinal to the length of the wound was obtained at the completion of each maneuver (a, b) for postmaneuver grading of the wound profile visible from two separate representative trials (arrows). All incisions viewed on such b - scans were assigned a grade of 0 to 3 by two expert graders masked to study group . Last, qualitative and quantitative surgeon's subjective feedback was obtained from the residents following completion of the study maneuvers via an administered survey (fig . 7). After completing the first portion of the study, only the mi - oct+ group had the direct use of mi - oct; the mi - oct+ group reported higher levels of comfort compared with the mi - oct group, in performing simple cornea suture passes (p = 0.007) and cornea laceration repair (p = 0.028), but this trend was not observed for creation of triplanar corneal wound . At the end of the training, when both mi - oct and mi - oct+ groups had experienced the direct use of mi - oct, there was no statistically significant difference between the groups' subjective experience of mi - oct impact on their ability to perform those same procedures . In total, both mi - oct and mi - oct+ residents on average rated the overall experience of using mi - oct feedback for anterior segment surgical maneuvers as helpful (score of 4) or very helpful (score of 5), reporting a mean score 4.57 (sd = 0.53) for the mi - oct group and 4.86 (sd = 0.38), and a median of 5 for both groups on a 1 to 5 scale . (score 4 on 15 scale) to use mi - oct in their future practice as a result of mi - oct experience in this study . The survey administered to each resident surgeon at the conclusion of initial training and end of the study ranked their subjective experience on a 1 to 5 numerical scale . The mean subjective score with sd and minimum, maximum, and median responses to the survey questions are summarized below . The comparison between the mi - oct group and the mi - oct+ groups was done using the wilcoxon rank sum test of difference between medians . In this randomized prospective study, we demonstrated that mi - oct feedback results in enhanced surgical performance of ophthalmology residents and improved anatomic outcomes in select anterior segment surgical maneuvers in model eyes . The residents performing depth - based maneuvers (simple corneal passes at 50% and 90% depth, and repair of corneal laceration at 90% depth) with direct mi - oct feedback outperformed their counterparts who were operating with only the microscope alone . Interestingly, the enhanced performance persisted even when direct mi - oct assistance was removed, which suggests that mi - oct can allow for sustained learning of surgical skill even when mi - oct feedback is not subsequently available . We also demonstrated a favorable subjective experience of the trainee surgeons in using mi - oct through a surgeon - administered survey . On average, most residents' reported that their comfort in performing study maneuvers increased as a result of using mi - oct, and residents ranked the mi - oct experience as either very helpful or helpful, while reporting on average being more likely to use mi - oct in their future practice . Overall, the results of this study suggest that mi - oct feedback can directly impact surgical outcomes, and for the first time, demonstrates its potential utility in surgical training of ophthalmic residents . Not all surgical maneuvers were amenable to effective mi - oct feedback under the current study methodology . In our study, we found no effect of mi - oct feedback on corneal incision geometry . We attributed this to the metal keratome shadowing large portions of the oct image, which limited feedback while the incision was being created, and the use of an external display of the oct images, which was adjacent to, but not within the oculars . Both of these limited the surgeon to assessing the wound geometry after, but not readily during the performance of the surgical maneuver . Development of oct heads - up display through the operating microscope eyepieces and an oct - compatible keratome may aid in the utility of direct mi - oct guidance for construction of cataract incisions and other similar maneuvers in the future . The survey questions were used to obtain general feedback and were not provided before and after testing . A more standard validated questionnaire would be useful in future assessment of imaging as a training tool . Other limitations of our study include the small sample size and a single study site . Validation of the utility of mi - oct with a larger number of ophthalmology residents and fellows at other programs, and expanding the range of surgical maneuvers for which mi - oct may be useful in ophthalmic surgical training, such as posterior segment surgery, would be important future steps . Such feedback may also be useful in ophthalmic surgeon self - assessment using a similar wet laboratory setup or with comparable model eye materials (e.g., kitaro kit; fci ophthalmics, pembroke, ma, usa). In addition, a natural future evolution from our study would be for potential integration of mi - oct feedback for future training of residents and fellows in patient surgical treatment, such as during early experience in repair of corneal lacerations, open globes, and corneal suturing (e.g., penetrating keratoplasty). Determining whether improved anatomic outcomes with mi - oct feedback in resident - performed and early career surgery will translate into improved visual outcomes, shorter operative time, and faster visual rehabilitation in patients would be important to justify significant cost of acquiring this technology for training or for use during routine surgery . Clinical assessment from oct imaging of the eye has revolutionized diagnosis and management of many ophthalmic conditions and is now an indispensable part of practice of almost all ophthalmic subspecialties . Although relatively recently introduced in the operating room, the histology - level feedback that intraoperative imaging provides during ophthalmic surgery holds the potential of a similar disruptive change in the surgical practice of ophthalmology . Multiple studies to date have reported the use of intraoperative oct in anterior and posterior segment surgery . Recent us food and drug administration approval of microscope - integrated sd - oct rescan 700 (carl zeiss meditec, dublin, ca, usa) will allow for access to microscope integrated, heads - up display oct viewing during live surgery in the united states . Recently published 2-year results of a prospective evaluation of microscope - mounted sd - oct used at pauses in 275 anterior segment and 256 posterior segment ophthalmic surgeries . In this single center study, the use of mm - oct (which required moving the microscope to the side) resulted in a mean delay of 4.9 minutes while altering intraoperative surgeon's decision making in more than 40% of surgical cases . The current study demonstrates that mi - oct feedback cannot only guide a surgeon's intraoperative decision making, but also has the potential to improve surgical performance, enhance anatomic outcomes, and be used as a training tool that is directly translatable to the operating room for use in live human surgery . As intraoperative oct technology continues to evolve, so will our understanding of its potential, which will allow for its increasing creative applications in many aspects of ophthalmic surgery.
|
Periodontal disease is an infection of the tooth supporting structure and is divided into two main groups of gingivitis and periodontitis . Chronic periodontitis is the most common form of periodontitis that affects up to 30% of adults . In 713% of patients periodontal disease is initiated by the accumulation of bacterial plaque in the gingival sulcus triggering immune response . The first step in prevention and treatment of periodontal disease is mechanical plaque removal and proper oral hygiene instructions . If not treated, progression of the disease leads to increased pocket depth (pd), bleeding, bone loss, tooth mobility, and eventual tooth loss . Destruction of tooth supporting structure and alveolar bone occurs as the result of host immune response to bacteria and their products . Although oral microbial flora and environmental factors affect the pathogenesis of periodontal disease, evidence shows that genetics can also be a risk factor . Cytokines namely interleukin (il) -6, il-1 and tumor necrosis factor- play important role in the immunopathology of periodontal disease . Different types of cells secrete il-6 and its level of secretion are influenced by the type of cell, type of stimulant, and the underlying genetic mechanism . Il-6 is an important inflammatory mediator and has both pro- and anti - inflammatory properties . Single - nucleotide gene polymorphisms of -572 g / c and -174 g / c which are common polymorphisms in the il-6 gene promoter affect the expression of il-6 and increase its serum level causing its higher transcription and consequently greater induced response . Increased il-6 serum level is correlated with inflammatory diseases like periodontitis . Only a few researchers have attempted to assess the relationship of il-6 and periodontitis worldwide and number of studies conducted in this respect in iran is scarce . Costa et al . In brazil concluded that il-6 - 174 g / c gene polymorphism may play a role in chronic periodontitis however, sanchooli et al . In their study in iran rejected this association . Concluded that il-6 - 174 g / c gene polymorphism had the greatest impact on the development of periodontal disease . Jingjin et al . In their study on the chinese population concluded that il-6 - 572 g / c polymorphism increased the susceptibility of patients to periodontitis . Considering the existing controversy regarding the correlation of il-6 with periodontitis, this study aimed to assess the correlation of il-6 - 572 g / c and -174 g / c gene polymorphisms with periodontal disease in an iranian population of patients presenting to taleghani hospital in 2012 . This analytical case control study assessed the relationship of il-6 - 572 g / c and -174 g / c gene polymorphisms with periodontal disease in an iranian population . A total of 129 patients presenting to the laboratory of taleghani hospital with a mean age of 34.14 11.81 years were randomly selected including 48 males with a mean age of 35.23 12.46 years and 81 females with a mean age of 33.49 11.48 years . Considering the multifactorial nature of periodontal disease and the effect of underlying diseases and systemic and environmental conditions on development and progression of periodontitis, the following inclusion and exclusion criteria were set for patients: all understudy subjects had to be nonsmoker with no systemic disease or predisposing conditions for periodontitis such as diabetes . Patients had to be hiv negative with no history of hepatitis, chemotherapy, radiotherapy, immunosuppression, immune diseases, leukemia, immunosuppressive infections, and malnutrition . Having orthodontic appliances, removable denture, acute necrotizing ulcerative gingivitis, mouth opening limitation, gingival surgery, oral hard or soft tissue diseases excluding caries and periodontitis, and taking cyclosporine, nifedipine, nonsteroidal anti - inflammatory drugs or antibiotics in the past 2 weeks prior to the study were also among the exclusion criteria . Periodontal health of patients was evaluated by clinical examination and assessment of pd, and clinical attachment level (cal) in 6 points around each tooth using williams probe and a dental mirror . Bleeding on probing (bop), gingival color, and presence of calculus were also assessed by a dentist under the supervision of a specialist for each individual in the laboratory of taleghani hospital according to the criteria for periodontal parameters described in periodontology reference textbooks . After consultation with a statistician and based on the inclusion and exclusion criteria, patients were divided into five groups: healthy group: these patients included 15 males and 28 females and did not have any sign of periodontal disease (cal = 0, pd <3 mm)gingivitis group: these patients included one male and four females, had cal = 0 but had periodontal pocket . Gingival color in these patients had turned dark pink or reddish from coral pink in> 30% of the areas . The factor of changing color from light pink to dark pink and red in> 30% of the regions was used for diagnosing gingivitis or gum tissue inflammation . It is clear that it is possible for teeth to have cal (nevertheless the color of gum is normal) and suffer from periodontitis . Therefore, the criteria for measurement of pd and cal are used for making a diagnosis of periodontitis . The change in color in the absence of pd and cal is used for making a diagnosis of gingivitismild periodontitis group: this group included 9 males and 12 females . Healthy group: these patients included 15 males and 28 females and did not have any sign of periodontal disease (cal = 0, pd <3 mm) gingivitis group: these patients included one male and four females, had cal = 0 but had periodontal pocket . Gingival color in these patients had turned dark pink or reddish from coral pink in> 30% of the areas . The factor of changing color from light pink to dark pink and red in> 30% of the regions was used for diagnosing gingivitis or gum tissue inflammation . It is clear that it is possible for teeth to have cal (nevertheless the color of gum is normal) and suffer from periodontitis . Therefore, the criteria for measurement of pd and cal are used for making a diagnosis of periodontitis . The change in color in the absence of pd and cal is used for making a diagnosis of gingivitis mild periodontitis group: this group included 9 males and 12 females . 2<cal<4 severe periodontitis group: this group included 11 males and 12 females . Cal>5 . Blood samples were taken by a laboratory technician using 5 cc vacuum syringes and were transferred to test tubes containing ethylene diamine tetra acetic acid . Patients were thoroughly informed about the study, written informed consent was obtained and ethical committee of shahid beheshti school of dentistry, tehran, iran confirmed the study . Two milliliters of heparinized peripheral blood were obtained from each patient according to miller et al . Il-6 sequence amplification was done using polymerase chain reaction (pcr) with 3 thermal protocols of 94c for 30 s, 56c for 30 s and 72c for 30 s. this cycle was repeated 35 times . Il-6 - 174 g / c and -572 g / c polymorphic sites were treated with (5-tgacttcagctttactctttgt-3 (f)) and (5-ctgattggaaaccttattaag-3(r)) and (5-agattccaagggtcacttg-3 (f)) and (5-agaagcagaaccactcttc-3 (r)) primers to generate and amplify 198 and 519 base - pair fragments [figures 1 and 2]. These fragments were then digested overnight at 37c using sfani and bsrbi enzymes (new england biolabs, beverly, ma, usa). The digested products were analyzed by electrophoresis through 2% agarose gel and visualized by gel red staining . After digestion by sfani, for cc, we have no break in the polymerase chain reaction product, but for gg we have two bands (140 and 58 base - pair) and finally for gc we have three bands (198, 140, and 58 base - pair). Percent gel electrophoresis red c572 g e. all phases of dna extraction and pcr were carried out by a laboratory technician under the supervision of a specialist in the cellular and molecular research center of zanjan university of medical sciences . After collection, the specimens were frozen at 20c and transferred to a box containing dry ice 1-month later . Two milliliters of heparinized peripheral blood were obtained from each patient according to miller et al . Technique . The quality and the quantity of dna were confirmed by agarose gel electrophoresis and spectrophotometry, respectively . Il-6 sequence amplification was done using polymerase chain reaction (pcr) with 3 thermal protocols of 94c for 30 s, 56c for 30 s and 72c for 30 s. this cycle was repeated 35 times . Il-6 - 174 g / c and -572 g / c polymorphic sites were treated with (5-tgacttcagctttactctttgt-3 (f)) and (5-ctgattggaaaccttattaag-3(r)) and (5-agattccaagggtcacttg-3 (f)) and (5-agaagcagaaccactcttc-3 (r)) primers to generate and amplify 198 and 519 base - pair fragments [figures 1 and 2]. These fragments were then digested overnight at 37c using sfani and bsrbi enzymes (new england biolabs, beverly, ma, usa). The digested products were analyzed by electrophoresis through 2% agarose gel and visualized by gel red staining . After digestion by sfani, for cc, we have no break in the polymerase chain reaction product, but for gg we have two bands (140 and 58 base - pair) and finally for gc we have three bands (198, 140, and 58 base - pair). Percent gel electrophoresis red c572 g e. all phases of dna extraction and pcr were carried out by a laboratory technician under the supervision of a specialist in the cellular and molecular research center of zanjan university of medical sciences . After collection, the specimens were frozen at 20c and transferred to a box containing dry ice 1-month later . This cross - sectional study was conducted on 129 patients from hospitals in north of tehran, iran with a mean age of 34.14 11.81 years including 81 females with a mean age of 33.49 11.48 years and 48 males with a mean age of 35.23e12.46 years . The mean and maximum cal and pd, as well as the percentage of bop, were calculated for each patient to diagnose gingivitis or periodontitis . The collected information regarding the clinical periodontal parameters of patients is shown in table 1 . The mean and maximum cal and pd and the percentage of bop in males and females for each patient, the polymorphism status of the il-6 - 174 and il-6 - 572 regions was determined as c / c, g / c or g / g . The results showed that only one patient had il-6 - 174 c / c polymorphism, and one other patient had polymorphism c / c polymorphisms at the respective regions, the cc group was eliminated, and all statistical analyses were done on the remaining 129 patients had il-6 - 174-gg polymorphism, and 93 patients (71.3%) had il-6 - 572-el-6 - 572-gg polymorphism was significantly higher than that of il-6 - 572-gc polymorphism (p <0.001). Furthermore, the mean cal and pd, max cal, maximum pd and bop% were compared between males and females and the two polymorphism groups [table 2a]. The cal and pd data had a normal distribution in males and females and also in both polymorphism groups . A significant difference was found in terms of cal between males and females and males had a significantly higher mean cal . However, the mean pd was not significantly different between males and females . The mean cal and pd in males and females the frequency distribution of gc and gg polymorphisms at position 174 and -572 of il-6 gene the mean cal and pd in subjects with gg and gc polymorphisms at position 174 of il-6 the mean cal and pd in subjects with il-6 - 572 g / g and il-6 - 572 g / c polymorphisms regarding the occurrence of polymorphisms and the relationship between the two types of polymorphisms [table 2b], it was concluded that regardless of the type of polymorphism at position -174 of il-6 gene, about 1/3 of patients had gc and 2/3 had gg polymorphism . In other words, if the polymorphism at position-174 of il-6 gene is of gg type, about 2/3 of patients (72%) have gc polymorphism at position-572 of il-6 gene . Furthermore, if the polymorphism at position-174 of iee6 e/3 (72%) of patients have gg polymorphism at position-572 of il-6 gene . No significant difference existed between the frequencies of gg and gc polymorphisms at position-174 of il-6 gene [table 2c]. No significant difference existed between the frequencies of gg and gc polymorphisms at position -572 of il-6 gene [table 2d]. Comparison of the mean cal and pd among the five groups in terms of disease status revealed significant differences . Maximum cal, maximum pd, and bop% were significantly different among the five groups [table 3]. Comparison of the mean (sd) pd, cal, maximum cal, maximum pd and bop% among the five groups in terms of periodontal disease status comparison of the intensity of periodontal disease between subjects with the two polymorphisms revealed that in each group, gg and gc polymorphisms had almost similar frequency percentages . Thus, a significant difference in the incidence of disease between the two groups of polymorphisms seems unlikely . This finding was confirmed by chi - square test [table 4]. As seen in table 4, except for subjects with mild periodontitis who had equal percentage of both types of polymorphisms, in the remaining groups a higher percentage of subjects had gg polymorphism and the difference in this regard was close to significant (p = 0.065). The frequency percentage of gc and gg genotypes in il-6 - 174 and il-6 - 572 polymorphisms in different groups in terms of disease status considering the fact that different degrees of periodontal disease (mild, moderate, and severe) are not distinct, the frequencies of il-6 - 174 and il-6 - 572 polymorphisms were not significantly different when the healthy group was compared with other groups . This study showed that most subjects had gg polymorphism at position -174 and -572 of il-6 gene . In other words, the frequency of gg polymorphism at position -174 and -572 of il-6 gene was higher than that of gc polymorphism . However, our results revealed that no correlation existed between the il-6 - 174 and il-6 - 572 polymorphisms and various degrees of periodontal disease . In other words, the presence of il-6 gene polymorphism at the mentioned positions is not a predisposing factor for periodontitis among the iranian population ., trevilatto et al ., franch - chillida et al ., moreira et al . And they evaluated the correlation of il-6 - 174 polymorphism and susceptibility to chronic periodontitis in a brazilian population . They analyzed samples for polymorphism using pcr - restriction fragment length polymorphism . In their study, the difference between our results and those of trevilatto et al . May be due to the difference in the understudy population and the molecular genetic technique applied . The age range of subjects in the two groups of chronic periodontitis and controls in their study was 2565 years; different age range of subjects and ethnicities may explain the difference between the results of these studies . They clinically evaluated 251 systemically healthy indians and divided them into two groups of healthy controls and periodontitis patients according to the criteria set by the european workshop on periodontitis . They evaluated patients' age and cal and genomic dna was extracted from oral mucosal cells . They evaluated subjects in terms of the severity of periodontal disease and divided them into several groups based on the mean cal . They reported + g genotype in nonsmoker patients with severe periodontitis; while the frequency of g genotype was 8.59.6% in control subjects and those with moderate periodontitis . They used pcr with pfu and screened chronic periodontitis patients with pd> 5 mm and cal> 3 mm in> 20 teeth . Ethnic differences, environmental factors, and different sample size may explain the variable results . Furthermore, the frequency of g allele was not significantly different between the two groups, and they concluded that this gene probably plays no role in the development of periodontitis . Similar ethnicity of patients and almost similar sample size may be responsible for this agreement . Our results were also in accordance with those of a meta - analysis by shao et al . They evaluated the results of studies on 1093 periodontitis patients and 574 healthy controls and reported that the g allele of il-6 - 174 gene polymorphism cannot change the risk of developing chronic periodontitisee6 - 572 g> c polymorphism was correlated with periodontitis (both chronic and aggressive types). Our study was different from that of robati et al . Which has been performed in iran . They evaluated the results of the study on 50 patients including 25 patients with generalized aggressive periodontitis and 25 with healthy periodontium . Their results confirmed the association between generalized aggressive periodontitis and high level of il-6 as a proinflammatory cytokine; however, they had a limited sample size . Histologic sections stained by hematoxylin - eosin were used for histopathological evaluation . For pcr, they used restriction endonuclease digestion (hsp ii). They deduced the high expression of il-6 is an important factor related to chronic periodontitis, but were not associated with methylation status or the -174 (g / c) genetic polymorphism . Ethnic differences and different kind of sampling may be responsible for different results . Considering the lack of scientific evidence in this respect, this study aimed to assess the relationship of il-6 - 174 and il-6 - 572 gene polymorphisms with periodontal disease in an iranian population . It should be noted that our study investigated the correlation of different levels of periodontal disease with two il-6 gene polymorphisms based on gender and age and, number of similar studies is scarce . In order to assess the correlation of il-6 gene polymorphism and periodontal status, we evaluated the periodontal status of patients using different periodontal parameters including plaque indexbop, cal and pd around each tooth . More favorable results could have been obtained if this study had been done in several provinces of iran on a larger sample size or if understudy subjects had been examined under standard conditions (optimal for dental examination) and their plaque index had been evaluated as well . Recruiting subjects was difficult considering the need for obtaining blood samples and requiring patient cooperation . Obtaining the required pcr kit was also difficult . Thus, other alleles are recommended to be evaluated in future studies since they may play a role in increasing patient susceptibility to periodontal disease . Future studies should be preferably conducted on a mixed sample size from different provinces of iran . This study found no association between il-6 - 174 and il - gene polymorphisms in an iranian population or between il-6 gene polymorphisms and periodontal health or disease states . Future studies with a larger sample size are required to be performed in different geographical locations and on different ethnic populations to assess the correlation of il-6 gene polymorphism and that of other genes . The authors of this manuscript declare that they have no conflicts of interest, real or perceived, financial or non - financial in this article . The authors of this manuscript declare that they have no conflicts of interest, real or perceived, financial or non - financial in this article.
|
Sphingosine-1-phosphate (s1p), a highly active lipid mediator, exhibits a broad range of cellular activities including proliferation, survival, adhesion, and migration [1, 2]. S1p is critical for mammalian cardiac development and for maturation of the systemic circulatory system . These biological actions are carried out by predominantly intracellularly produced s1p via sphingosine kinase (sphk), of which two isoforms sphk1 and sphk2 exist [4, 5]. Moreover, s1p has emerged as an intracellular second messenger involved in regulation of cell proliferation and in mobilization of internal calcium stores by a protein kinase c independent pathway . Further reports suggest that s1p found within the extracellular space is not merely derived from intracellular generation but biosynthetic enzymes of the s1p metabolism appear to subsist in the extracellular space . This outside the cell s1p acts in an autocrine or paracrine manner as an agonist for a unique family of g - protein - coupled receptors which to date comprises the five s1p receptors (s1prs) s1pr1s1pr5 [8, 9]. Extracellular s1p regulates proliferation and migration of vascular endothelial cells (ecs) and smooth muscle cells (vsmcs) and critically determines lymphocyte egress and angiogenesis . Both s1p and s1prs regulate vascular tone either by directly modulating the smooth muscle layer or by stimulating ecs to release bioactive molecules which regulate vsmcs responses in a paracrine manner . The levels of s1p in plasma and tissues are tightly regulated by the balance between its synthesis by sphingosine kinases and degradation [2, 14]. The role of s1p and the processes involved in its biosynthesis, that is, regulation of the metabolizing enzymes, for controlling vascular integrity has been studied thoroughly in vitro and in vivo . Vascular proliferative disorders such as atherosclerosis and persistent proinflammatory challenges of the vessel wall are characterized by the activation of the coagulation cascade and platelet activation, both processes which elevate local s1p concentrations . This may play an important role in directing immune cells to sites of local injury and directly links the coagulation system to s1p - mediated inflammatory responses in vivo . After vascular injury, the coagulation cascade is initiated by activating the clotting factors x (fxa) and ultimately thrombin, which are both key regulators of subsequent tissue repair and remodeling [18, 19]. Fxa - mediated thrombin generation initiates and is itself amplified by subsequent platelet activation, finally leading to cleavage of fibrinogen and eventually the formation of the mural thrombus [20, 21]. In addition to their physiological function in hemostasis, the clotting proteases thrombin and fxa are also accountable for clinically relevant pathological responses such as postphlebitic inflammatory and tissue repair reactions [16, 22]. The biological effects of fxa and thrombin are mediated via a family of g - protein - coupled receptors, protease - activated receptors 1, 2, 3, and 4 (par-1par-4) [23, 24]. Thrombin initiates signaling through par-1, par-3, and par-4, while fxa acts via par-1 and par-2 . Previous reports, including studies from our group, have reported that pars stimulate vsmcs proliferation and migration, modify the composition of the extracellular matrix of blood vessels, and mediate proinflammatory responses in the vessel wall [2528]. Because proliferation and migration of vsmcs are considered key events in the development of atherosclerosis and vascular remodeling, these cellular effects of thrombin and fxa may directly contribute to the pathogenesis of vascular diseases such as progression of atherosclerosis and restenosis after vascular injury . In addition, recent studies highlight numerous interactions between blood coagulation and the s1p signaling system [17, 29]. This review discusses the recent findings concerning the role of s1p and its receptors in vascular and blood cells which are interlinked with the coagulation system . Particularly, hemostasis - related mechanisms which increase local s1p availability and the regulation of par receptor expression by s1p are highlighted . Elucidating the complex interactions between blood coagulation and the s1p signaling network further may bear the potential to discover and develop novel targets for the therapy of inflammation - prone vascular diseases . Ceramide is formed either de novo from serine, palmitoyl coa, and fatty acid or from breakdown of membrane - resident sphingomyelin [30, 31]. Maintaining a balance between s1p generation and degradation is critical for regulation of cell growth and plays a key role in pathological processes such as carcinogenesis . S1p degradation is achieved via reversible dephosphorylation by two s1p - specific phosphatases (spp1 and spp2) or irreversible hydrolysis by s1p lyase . S1p exerts actions either by binding to its intracellular targets or through its specific receptor in autocrine, paracrine, and/or endocrine manner . S1p is secreted, stored, and exported by the cells of the vessel wall, vsmcs, and ecs, respectively . Recent observations highlight the critical role of the putative s1p transporter spinster homolog 2 (spns2) in endothelial s1p release and in lymphocyte trafficking [33, 34]. In other cell types, that is, breast cancer and mast cell, the abc (atp - binding cassette) transporter family members abcc1 and abcg2, known regulators of inflammatory processes, facilitate export of s1p across the cell membrane [35, 36]. S1p regulates a diverse range of cellular processes that are important in immunity, inflammation, and inflammatory disorders [37, 38] whether this carrier - bound serum s1p or rather locally produced s1p is important for the diverse cellular functions is a matter of current debate . Endothelial cells synthesize and secrete large amounts of s1p and contribute substantially to generating the high s1p level present in the blood [40, 41]. Of the five s1prs, s1p modulates diverse endothelial activities including proliferation, survival, migration, and regulation of proinflammatory responses and controls the endothelial barrier function [4649]. S1pr1 is highly expressed in endothelial cells and regulates cytoskeletal structure, migration, and vessel maturation [51, 52]. In s1pr1 receptor deficient embryos, blood vessels were incompletely covered by vsmcs, indicating that s1pr1 also regulates vascular maturation . Thus, s1pr1 appears to mediate predominantly physiological functions while particularly s1pr2 regulates inflammatory endothelial responses and is upregulated during inflammatory conditions such as atherosclerosis [45, 54]. These assumptions are in agreement with recent observations of varying s1p concentrations resulting in differential receptor activation and the differential regulation of s1pr1 and s1pr2 expression during conditions of hyperglycemia - induced endothelial cell dysfunction . A key regulator of endothelial function is the coagulation system with factors such as thrombin known to affect its permeability as well as endothelial inflammation . Thrombin causes induction of endothelial cell contraction and disruption of endothelial barrier integrity via the par-1 receptor . This involves signaling through the endothelial protein c receptor and includes cross talk with the s1pr system . S1p / s1pr signaling can counteract this detrimental effect of thrombin and appears to protect from vascular leakage and tissue damage such as edema formation . Thus, thrombin may enhance endothelial s1p generation and signaling within the endothelium to limit its own actions of inducing vascular leakage via mutual par-1 mediated s1p / s1pr1 actions (figure 2). In certain systemic diseases such as sepsis, signaling through par-1 exerts multiple and partly opposing functions . This has been attributed to either promoting dendritic cell - dependent coagulation and inflammation or reducing sepsis lethality due to protein c activation and involves regulation of the balance between differential vascular s1pr (s1pr1/s1pr3) signaling pathways . Thus, not only par signaling but also s1p actions in endothelial cells appear to involve opposing mechanisms and cellular effects . On the one hand, s1p enhances barrier integrity to counteract thrombin - mediated disturbance of permeability to restore vascular homeostasis after injury; on the other hand, it synergizes with thrombin in upregulating the expression of tf in endothelial cells . Thereby, s1p may enhance generation of thrombin under proinflammatory conditions such as atherosclerosis . In this context, a recent study from campos et al . Is of interest, which showed that the functional s1p receptor antagonist fingolimod reduces infarct size and enhances blood - brain barrier integrity in rodent models of stroke . To determine whether this observation, besides an effect on barrier function, involves direct thrombotic or antithrombotic mechanisms of s1p signaling requires further investigations . The mechanistic studies which directly link s1p and its receptors to the thrombin or fxa receptors, their (patho)physiological actions, and associated signaling pathways are summarized in table 1 . Proliferation and migration of vascular vsmcs are fundamental features in physiological processes such as maturation of blood vessel as well as during vascular lesion formation . Numerous growth factors and inflammatory molecules like cytokines regulate vsmcs proliferation and migration . Early studies also suggested a function of s1p for dna synthesis and migration in vsmcs . Since then, s1p has rapidly been gaining attention as a key regulator of vsmcs functions and vascular development as well as a critical factor for vascular damage . Like endothelial cells, vsmcs obtained from different vascular beds express s1pr1, s1pr2, and s1pr3 receptors [6771]. Kluk and hla reported that s1p via activation of s1pr1 significantly stimulates both proliferative and migratory responses for vsmcs . This is in agreement with the observation that s1p induces vsmcs migration through a gi - linked, ras- and pi3-k - coupled, erk1/2-dependent process . A further role of s1pr2 receptor in vascular physiology and pathology has been established through regulation of intracellular signaling pathways, such as rho gtpase, the phosphatase pten, and ve - cadherin pathways . They suggest that predominantly s1pr3 stimulates expression of cox-2 through mechanisms involving calcium - dependent pkc and src - family tyrosine kinase . The relevance of s1p in the regulation of vascular permeability, lymphocyte trafficking, and vascular development is well documented in vivo . S1pr1 deficiency resulted in impaired vascular maturation whereas sphk1 and sphk2 null mice have shown disturbed angiogenesis resulting in embryonic lethality . Furthermore, kono et al . Reported that s1pr1, s1pr2, and s1rp3 function coordinately during embryonic angiogenesis . Taken together, these studies suggest s1p governs physiological vascular homeostasis and is also an important mediator during pathophysiological conditions such as inflammation . An interaction between thrombin - induced par-1 signaling and the s1p system via enhanced expression of sphk1 and elevated s1p synthesis has first been observed in epithelial and in endothelial cells . In addition, the s1p system has been suggested as a downstream component of thrombin signaling also in other cell types . Work from niessen et al . Revealed a critical role of cross talk between par-1 and the s1pr3 receptor in dendritic cells in the amplification of inflammation during sepsis . Further studies indicate direct involvement of thrombin in regulating key processes of cellular proinflammatory responses in vsmcs . This involves activation of classical inflammatory transcription factors such as nf-b, but also immune regulators that have more recently become of interest, that is, the forkhead - box - o transcription factor family . Recent work from our laboratory has shown that fxa regulates transcription of sphk1 and elevates s1p biosynthesis in human vascular smooth muscle cells (figure 3). This stimulatory effect, observed in cultured cells, was seen at fxa concentrations (3 to 30 nm) which have been shown to occur during thrombus formation ex vivo . Expression of sphk1 by fxa was attenuated by inhibitors of the rho - associated kinase and of classical pkc isoforms . In addition, fxa caused activation of the small gtpase rhoa in human smooth muscle cells . This is particularly interesting, because small gtpases are known to play key roles in mediating signaling responses of the s1p receptor, suggesting a mutual interaction of s1p receptor - initiated signaling and regulation of s1p synthesis . Interestingly, fx / fxa appears to be already present within human carotid artery plaques (plaque material is well known to be highly thrombotic) and colocalizes with sphk1 expression . The presence of active coagulation factors in atherosclerotic tissue has also been shown by others . This observation suggests a close relation between coagulation factor signaling and progression of the atherothrombotic disease . Whether possible antiproliferative or antiatherogenic actions of the novel oral coagulation inhibitors involve affecting sphk1 expression and possibly modification of s1p - mediated signaling in patients the biological effects of s1p released from activated platelets in the vasculature include inhibition of platelet aggregation, angiogenesis, vascular development, and thrombosis - related vascular diseases such as the acute coronary syndrome [47, 85, 86]. Platelets were originally suggested to be the prime source of plasma s1p, because they exhibit high sphk activity . In human platelets, sphk2 is the predominant isoform . Surprisingly, however, although platelets do express s1p receptors during in vitro platelet function testing such as light transmission aggregometry, s1p does not appear to function as a potent direct platelet agonist . However, s1p plasma levels in thrombocytopenic mice were found to remain largely unchanged, suggesting that resting platelets may not substantially contribute to circulating s1p concentrations in plasma . Platelets release huge amounts of s1p during blood clotting or upon direct activation with agonists of pkc signaling like thrombin [92, 93]. Work from our laboratory suggests a critical role of thromboxane in regulating the release of s1p from human platelets . Secretion of s1p was induced after activation of platelets with potent agonists such as thrombin or selective par - activating peptides (par - aps) or with a high concentration of collagen . This effect was largely prevented after inhibition of thromboxane formation by classical inhibitors of cyclooxygenase-1 (cox-1), such as aspirin, diclofenac, or ibuprofen (figure 4 and). Thus, one pathway mediating release of platelet - derived s1p after platelet activation depends on cox-1-derived thromboxane . Since s1p represents an amphiphilic anion, its translocation across the plasma membrane supposedly does require active transport proteins . As mentioned above, several studies in various cell types point to the involvement of a transporter of the abc family [94, 95]. However, the biological functions of these proteins are by far not completely understood . In activated platelets, s1p secretion was affected by several compounds that are known to inhibit members of the multidrug resistance protein (mrp / abcc) subfamily of abc transporters . A variety of transporters including mrps are expressed in platelets that exert important functions for translocation and storage of signaling molecules [9698]. Further studies are required to identify the proteins involved in the export of s1p out of the cells . The elucidation of the mechanisms of s1p release would also provide the opportunity of pharmacological modulation of the transport process . During vascular inflammation, monocytes secrete several proinflammatory cytokines and adhesion molecules, a response mechanism which facilitates recruitment and adherence to the inflamed and activated endothelium . Thrombin is one of the key factors controlling the migratory and secretory behavior of monocytes . Interestingly, during differentiation into macrophages, that is, by colony - stimulating factors, the expression levels of par-1, par-2, and par-3 are highly elevated indicating dynamic adaptation mechanisms of the system . A recent report indicates that monocytes from patients with antiphospholipid syndrome expressed par-1 to par-3 but not par-4 . Other authors have described a role for par-4 in the release of inflammatory markers from monocytes, such as il-6 . Thus, different pars may be differentially regulated in response to various stimuli during vascular pathogenesis . S1p is a recently recognized novel regulator also of monocyte functions [104, 105]. Human monocytes express all five s1prs at the mrna and protein levels, possibly mediating the regulation of monocyte apoptosis and chemotaxis . In leukocytes, s1p contributes to p - selectin - dependent rolling through endothelial s1pr3 . In dendritic and endothelial cells, involvement of s1p in the signaling pathways of the prototypic thrombin receptor par-1 has been suggested . However, little information is to date available about a possible cross talk between s1p and pars in monocytes . Recent data from our laboratory provide evidence that (i) s1p directly enhances expression of the thrombin receptors par-1 and par-4 in human monocytes and that (ii) this results in enhanced par-4-mediated chemotaxis and elevated generation of cox-2 in response to thrombin . S1p induced par-1 and par-4 mrna and total protein expression in human monocytes and u937 cells in a concentration- and time - dependent manner, respectively . However, only par-4 cell - surface expression was increased significantly by s1p, whereas cell - surface par-1 remained unaffected . This response was associated with activation of the akt, erk1/2, and p38 pathway and induction of cox-2 but not cox-1 . Par-4-mediated induction of cox-2 was prevented by pharmacological inhibition of the pi3 kinase pathway and incubation of human monocytes with s1p resulted in an enhanced par-4-dependent chemotaxis response to thrombin . Thus, s1p enhances monocyte responses to thrombin via upregulation of par-4 protein and cell - surface expression, which promotes migration and cox-2 abundance . These studies establish a direct link between s1p receptor activation and regulation of thrombin receptor expression in human monocyte and the subsequent cellular responses to thrombin . This mechanism may facilitate monocyte recruitment to sites of vessel injury and inflammation (figure 5). Taken together, complex (patho)physiological interactions between blood coagulation factors and s1p and their respective signaling receptors are being increasingly recognized (see table 1). This involves regulation of endothelial, smooth muscle, and immune cell functions . Of particular interest for the clinic is the use of new selective modulators of the s1p - s1pr signaling system such as fingolimod as therapeutic agents . In the cardiovascular system, the role of s1p as therapeutic target or as a potential biomarker in cardiovascular diseases is still unclear . For example, the role of s1p levels and release, that is, from thrombin - activated platelets during myocardial infarction, is not finally defined to date . Recent studies indicate that s1p levels substantially vary during cardiovascular disease entities [110, 111]. An important future issue is the definition of circulating s1p levels in defined study populations as well as in clinical cohorts such as patients with acute coronary syndrome . The clinical relevance and therapeutic potential of altering s1p levels or receptor activity in atherothrombosis associated diseases is to date unclear and warrants future studies.
|
Total knee arthroplasty (tka), involving the replacement of both sides of the knee joint, is an effective surgical treatment for patients with end - stage degenerative arthritis of the knee . The goal of tka is to relieve the pain and to improve the knee function and range of motion (rom) for activities of daily living . A knee flexion angle greater than 90 was required for many daily activities, such that flexion angle of 110 to 130 was essential for cross - legged sitting and squatting and 90 to 120 for stair climbing and sitting on a chair . However, the average maximal flexion angle was reported to range from 100 to 110 . A substantial number of patients (approximately 20%) remain uncertain or not satisfied with their tka, mainly due to the knee pain and poor range of motion . The rom after tka depends on the individual patient, surgical technique, implants, and many other factors [811]. To achieve deep flexion, high - flexion prostheses were designed with the features of improved posterior condylar offset, improved articular contact area, increased patellar tendon recess, and increased posterior femoral translation . Indeed, several studies have evaluated the effect of high - flexion implants and found they were better than the conventional implants . However, several studies did not confirm the differences between these 2 types of prostheses [1618]. Despite 2 meta - analyses that estimated the outcomes of high - flexion and conventional knee implants, contradictory evidence in favor of the high - flexion design in addition, 6 new comparative studies [2126] on those prostheses in tka have been published in the last 3 years . Therefore, we performed a meta - analysis comparing the clinical outcomes of high - flexion prostheses and conventional prostheses for primary tka based on all eligible studies to obtain a comprehensive result . We systematically searched pubmed and embase databases for articles published up to december 20, 2013 . The following key phrases combined with boolean operators were used: total knee arthroplasty or total knee replacement and flexion or high - flexion or high flexion . The reference lists of the relevant reviews and the included articles, as well as the references of paper editions, were also checked manually to obtain more available studies . Studies were included in our meta - analysis if they met the following criteria: (1) prospective or retrospective control study or random control study; (2) compared high - flexion prostheses with conventional prostheses in total knee arthroplasty; (3) indexes including range of motion (rom), knee society scores (kss), and hospital for special surgery (hss) scores were provided; (4) the experimental and control groups were comparable for age, sex, and other preoperative indicators . Studies were excluded if they met the following criteria: (1) non - english; (2) review, letter or comment; (3) the mean value was available but lacked the standard deviation; (4) duplicate publication; (5) studies applied the same population data except the 1 with the longest follow - up time and the most comprehensive research information . Two reviewers independently examined and confirmed the eligible studies according to the inclusion and exclusion criteria defined above . Data extracted from the studies included the first author, year of publication, region where the study was conducted, sample size, age and sex of the cases, and follow - up time . The rom, kss, ks function scores, and hss scores were selected as the evaluation index in the current study . If there was some evidence for heterogeneity (p<0.05 or i>50%), a random - effects model was used . If p0.05 and i50%, we utilized the fixed - effects model . We systematically searched pubmed and embase databases for articles published up to december 20, 2013 . The following key phrases combined with boolean operators were used: total knee arthroplasty or total knee replacement and flexion or high - flexion or high flexion . The reference lists of the relevant reviews and the included articles, as well as the references of paper editions, were also checked manually to obtain more available studies . Studies were included in our meta - analysis if they met the following criteria: (1) prospective or retrospective control study or random control study; (2) compared high - flexion prostheses with conventional prostheses in total knee arthroplasty; (3) indexes including range of motion (rom), knee society scores (kss), and hospital for special surgery (hss) scores were provided; (4) the experimental and control groups were comparable for age, sex, and other preoperative indicators . Studies were excluded if they met the following criteria: (1) non - english; (2) review, letter or comment; (3) the mean value was available but lacked the standard deviation; (4) duplicate publication; (5) studies applied the same population data except the 1 with the longest follow - up time and the most comprehensive research information . Two reviewers independently examined and confirmed the eligible studies according to the inclusion and exclusion criteria defined above . Data extracted from the studies included the first author, year of publication, region where the study was conducted, sample size, age and sex of the cases, and follow - up time . The rom, kss, ks function scores, and hss scores were selected as the evaluation index in the current study . If there was some evidence for heterogeneity (p<0.05 or i>50%), a random - effects model was used . If p0.05 and i50%, we utilized the fixed - effects model . Initially, the search strategy yielded a total of 3970 studies, comprising 2215 from embase and 1755 from pubmed . Among them, 2448 were eliminated due to duplication . Fifteen studies were excluded through examining their full text because they lacked controls (n=10), lacked values of standard deviation (n=3), were non - english publications (n=1), or reviews (n=1). Consequently, only 16 eligible articles [1418,2131] were included in the present meta - analysis . A total of 2848 knees were enrolled in the included papers published from 2007 to 2013 . In the study of mccalden et al ., tka with cruciate retaining (cr), posterior stabilized (ps), and high - flex posterior stabilized implants was conducted for 160, 1177, and 197 knees, respectively . We eliminated the data of the 160 knees using cruciate retaining implant on the basis of comparability of data . Finally, we evaluated the outcomes of a total of 2643 knees in the current meta - analysis, among which 747 knees had high - flexion prostheses and 1896 knees had conventional prostheses . The mean age of patients in these studies was more than 60 years (range 62.872 years). There were 4 prospective cohort trials, 6 retrospective cohort trials, and 6 random control trails [1618,23,24,29]. Five papers compared ps design implants, 5 compared cr design implants [16,26,2830], and the others compared lps (legacy posterior stabilized) design implants [15,16,2124]. All papers evaluated the range of motion (rom) after tak . There were 1159 and 2067 knees which were treated with tka using high - flexion and conventional implants, respectively . There was evidence of statistical heterogeneity across the 16 trials [14 - 18,21 - 31] (i=51%, p=0.01; figure 2). The random - effects model was applied and the overall weighted mean difference (wmd) in rom was 2.92 (95% ci, 1.634.22; p<0.0001; figure 2). Patients using high - flexion implants achieved more improvement in rom compared to the ones using conventional implants . Then the 16 trials were divided into 2 subgroups to reduce the heterogeneity based on the type of implants compared . Eleven trials [1417,2125,27,31] with high - flexion ps tka (ps - flex) vs. standard ps tka were defined as subgroup 1 and other 5 trials [18,26,2830] with high - flexion cr tka (cr - flex) vs. cr tka were defined as subgroup 2 . In the subgroup 1, a total of 872 knees were treated with ps - flex tka and 1780 were treated with ps tka . Evidence showed heterogeneity across the 11 studies in subgroup 1 (i=49%, p=0.03), thus the random - effects model was used . The pooled wmd in rom was 2.73 (95% ci, 1.274.20; p=0.0003; figure 2). A clear advantage of high - flex ps implants was found in the improvement of rom when compared to ps implants . In subgroup 2, heterogeneity was also tested across the 5 trials (i=60%, p=0.04; figure 2) and consequently the random - effects model was applied to evaluate the overall effect . The pooled wmd was 3.24 (95% ci, 0.286.20; p=0.003) and high - flexion cr implants used in tka were superior to conventional cr implants in the improvement of rom . The funnel plot displayed graphic symmetry across studies, which indicated no publication bias (figure 3). No heterogeneity was detected across these trials (i=0%, p=0.55; figure 4) and the pooled wmd was 0.42 (95% ci, 0.601.43; p=0.42), indicating that there was no statistical significance between the high - flexion and conventional groups in kss . The knee society function data were available in 7 trials [16,21,2325,28,30] (750 knees). The p value of heterogeneity test was 0.34 and i was 12%, indicating that there was no statistical heterogeneity across these studies, so the fixed - effect model was used . The pooled wmd was 0.37 (95% ci, 1.482.22; p=0.70), indicating that there was no statistically significant difference between the high - flexion and conventional groups in knee society function (figure 5). The hospital for special surgery score was tested in 6 trials [15,2123,25,29] (933 knees) and no statistical heterogeneity was found across these studies (i=19%, p=0.29; figure 6). The pooled wmd was 0.26 point and no significant difference was detected between these 2 groups (95% ci, 0.47 to 1.00 points; p=0.48; figure 6). Initially, the search strategy yielded a total of 3970 studies, comprising 2215 from embase and 1755 from pubmed . Among them, 2448 were eliminated due to duplication . Fifteen studies were excluded through examining their full text because they lacked controls (n=10), lacked values of standard deviation (n=3), were non - english publications (n=1), or reviews (n=1). Consequently, only 16 eligible articles [1418,2131] were included in the present meta - analysis . A total of 2848 knees were enrolled in the included papers published from 2007 to 2013 . In the study of mccalden et al ., tka with cruciate retaining (cr), posterior stabilized (ps), and high - flex posterior stabilized implants was conducted for 160, 1177, and 197 knees, respectively . We eliminated the data of the 160 knees using cruciate retaining implant on the basis of comparability of data . Finally, we evaluated the outcomes of a total of 2643 knees in the current meta - analysis, among which 747 knees had high - flexion prostheses and 1896 knees had conventional prostheses . The mean age of patients in these studies was more than 60 years (range 62.872 years). There were 4 prospective cohort trials, 6 retrospective cohort trials, and 6 random control trails [1618,23,24,29]. Five papers compared ps design implants, 5 compared cr design implants [16,26,2830], and the others compared lps (legacy posterior stabilized) design implants [15,16,2124]. There were 1159 and 2067 knees which were treated with tka using high - flexion and conventional implants, respectively . There was evidence of statistical heterogeneity across the 16 trials [14 - 18,21 - 31] (i=51%, p=0.01; figure 2). The random - effects model was applied and the overall weighted mean difference (wmd) in rom was 2.92 (95% ci, 1.634.22; p<0.0001; figure 2). Patients using high - flexion implants achieved more improvement in rom compared to the ones using conventional implants . Then the 16 trials were divided into 2 subgroups to reduce the heterogeneity based on the type of implants compared . (ps - flex) vs. standard ps tka were defined as subgroup 1 and other 5 trials [18,26,2830] with high - flexion cr tka (cr - flex) vs. cr tka were defined as subgroup 2 . In the subgroup 1, a total of 872 knees were treated with ps - flex tka and 1780 were treated with ps tka . Evidence showed heterogeneity across the 11 studies in subgroup 1 (i=49%, p=0.03), thus the random - effects model was used . The pooled wmd in rom was 2.73 (95% ci, 1.274.20; p=0.0003; figure 2). A clear advantage of high - flex ps implants was found in the improvement of rom when compared to ps implants . In subgroup 2, heterogeneity was also tested across the 5 trials (i=60%, p=0.04; figure 2) and consequently the random - effects model was applied to evaluate the overall effect . The pooled wmd was 3.24 (95% ci, 0.286.20; p=0.003) and high - flexion cr implants used in tka were superior to conventional cr implants in the improvement of rom . The funnel plot displayed graphic symmetry across studies, which indicated no publication bias (figure 3). No heterogeneity was detected across these trials (i=0%, p=0.55; figure 4) and the pooled wmd was 0.42 (95% ci, 0.601.43; p=0.42), indicating that there was no statistical significance between the high - flexion and conventional groups in kss . The knee society function data were available in 7 trials [16,21,2325,28,30] (750 knees). The p value of heterogeneity test was 0.34 and i was 12%, indicating that there was no statistical heterogeneity across these studies, so the fixed - effect model was used . The pooled wmd was 0.37 (95% ci, 1.482.22; p=0.70), indicating that there was no statistically significant difference between the high - flexion and conventional groups in knee society function (figure 5). The hospital for special surgery score was tested in 6 trials [15,2123,25,29] (933 knees) and no statistical heterogeneity was found across these studies (i=19%, p=0.29; figure 6). The pooled wmd was 0.26 point and no significant difference was detected between these 2 groups (95% ci, 0.47 to 1.00 points; p=0.48; figure 6). In this meta - analysis, we evaluated the results of 16 trials with 747 knees in the high - flexion prostheses group and 1896 knees in the conventional prostheses group . The results revealed that high - flexion implants were superior to conventional implants in the improvement of rom, but each type of prosthesis achieved an average postoperative rom of more than 105. however, no difference was found in knee society scores, knee society function, and hospital for special surgery scores between these 2 groups . Rom after tka is one of the most important indexes in determining clinical outcomes, since many daily activates require a knee with a flexion of greater than 90 and some special activates, such as squatting for certain religious activities (need> 120) and kneeling during prayer (need> 135), require much greater knee joint flexion . However, patients usually do not achieve satisfactorily high degrees of flexion after tka, although the clinical outcomes achieved by the majority of modern tka designs are satisfactory for walking ability . Moreover, even patients who had good preoperative rom often lose deep flexion (defined as flexion>. Therefore, high - flexion implants were designed with the expectation of achieving greater knee flexion . The findings in the present meta - analysis indeed demonstrated the greater rom in the high - flexion group than in the conventional group . Even in the subgroups high - flexion ps vs. standard ps and high - flexion cr vs. standard cr, the advantage of high - flexion implants was still significant . In the meta - analysis conducted by luo et al . In 2011, evidence did not support that high - flexion prostheses (either ps or cr) were superior to conventional prostheses in rom after tka . Two previous studies have demonstrated that no difference in rom was observed between high - flexion and conventional groups with at least 1-year follow - up . In contrast, our meta - analysis favored the use of high - flexion implants rather than conventional implants in rom after tka . Moreover, in the subgroup analysis of high - flexion (cr tka vs. standard cr tka), we also confirmed that patients in the high - flexion group achieved more favorable flexion than in the conventional group (112.0 vs. 119.3, p<0.001). Although the high - flexion implants were superior to conventional implants in the improvement of rom, no difference was found in knee functional scores between these 2 groups . It has been reported that knee flexion was not the best predictor for functional outcome after tka . More importantly, the majority of arthroplasty surgeons and physical therapists suggested that a difference of knee rom less than 5 was not clinically relevant . In addition to implants, some other factors, including surgical technique and postoperative care could influence clinical functional outcomes after tka . Therefore, it is understandable that similar knee functional scores were found between high - flexion and conventional groups even though significantly greater knee flexion was achieved by high - flexion implants . First, we included cohort trials in our study to obtain comprehensive information when considering the few randomized controlled trials . Therefore, the potential confounding bias of the nonrandomized studies may exaggerate estimates of intervention effects . Second, not all the studies provided every clinical result, so we cannot estimate other indexes associated with the outcomes of postoperative tka . Third, the follow - up times were varied across the included studies (15.4 years), thus different outcomes were generated . Our meta - analysis indicated the improved rom using high - flexion implants in tka over conventional implants . No difference was found in knee society scores, knee society function, and hospital for special surgery scores between these 2 groups
|
Considerable effort has been devoted to the study of gold nanoparticles with variable size and shape due to their unique geometry - dependent optical, electronic, and catalytic properties in electronics and optics [1 - 5], particularly in the fields of biotechnology and nanotechnology [6 - 8]. Recently, gold nanorods (gnrs) have attracted interest due to their unusual properties in electronics and optics and especially in bionanotechnology fields involving bioimaging, biosensing [13 - 16], dna expression, cancer therapy, etc . For gnrs, two distinct plasmon bands, a transverse mode (~520 nm) and a longitudinal mode (usually> 600 nm), can be observed . This unique optical property of gnrs opens up fascinating applications as biologic and chemical sensors . A versatile layer - by - layer approach to the preparation of polyelectrolyte - coated gnrs films has been reported, indicating that polyelectrolytes are effective coating reagents for the modification of gnrs . The immobilization of an enzyme is one of the crucial factors in a range of biologic techniques . Proteins have traditionally been immobilized on to solid surfaces by a variety of techniques including physical adsorption, solvent casting, covalent binding, and electropolymerization . Although enzymes have been immobilized on to the surface of polystyrene latex, gold nanoparticles (gnps), or silica nanoparticles [23 - 25], there are few reports in which anisotropic nanoparticles have been used to conjugate the enzyme . In this work, gnrs were used to prepare a bioconjugate with an enzyme, using god as a model enzyme . The thermostability of the gnr / god bioconjugates was dramatically enhanced, and even at 90 c, its relative activity still remained at about 39.3% . Materials and reagents . God (ec 1.1.3.4, 211 u mgfromaspergillus niger) and peroxidase from horseradish (hrp, 969.65 u mg) were purchased from fluka.d-(+)-glucose (99%), chloroauric acid (haucl43h2o, 99.9%),l-(+)-ascorbic acid (aa, 99+%), silver nitrate (agno3, 99.9%), and cetyltrimethylammonium bromide (ctab, 98%) were purchased from alfa - aesar.o - dianisidine and sodium borohydride (nabh4, 98+%) were obtained from sigma (usa). The polyelectrolytes, poly (sodium-4-styrenesulfonate) (pss, mw ~70,000 g / mol), and poly(diallyldimethylammoniumchloride) (pdadmac, mw ca . 200,000350,000 g / mol) were obtained from aldrich and used without further purification . Briefly, a seed solution was prepared by mixing 5 ml of ctab (0.2 m) and 5 ml of haucl4(0.5 mm) with 0.6 ml freshly prepared 10 mm ice - cold nabh4solution . The color of the solution changed from dark yellow to brownish yellow under vigorous stirring, indicating the formation of the seed solution . After 5 h, this seed solution was used for the synthesis of the gnrs . In a flask, 75 ml of 0.2 m ctab was mixed with 1.5 ml of 4 mm silver nitrate aqueous solution and 75 ml of 1 mm haucl4 . While continuously stirring this mixture, 180 l of the seed solution was added to initiate the growth of the gnrs . About 10 ml of as - prepared gnrs was centrifuged twice at 8,000 rpm for 10 min, the supernatant was discarded, and the precipitate was redispersed in 5 ml 1 mm ctab . Subsequently, it was added dropwise to 5 ml of pss (2 g l, 1 mm nacl) aqueous solution . After 1 h adsorption time, it was centrifuged twice at 8,000 rpm to remove excess polyelectrolyte and dispersed in 5 ml deionized water . Finally, the pss - coated gnrs were added dropwise to 5 ml of pdadmac (2 g l, 1 mm nacl) aqueous solution . After 1 h, it was centrifuged twice at 8,000 rpm to remove excess polyelectrolyte and dispersed in 5 ml of phosphate buffer solution (10 mm, ph 7.0). The combination of god and gnrs was achieved using electrostatic interaction . In detail, the above 1.5 ml cationic pdadmac - coated gnrs was centrifuged at 8,000 rpm for 10 min, the supernatant was discarded, and the precipitate was incubated with 1.5 ml god (1 mg ml) dissolved in phosphate buffer (10 mm, ph 7.0) for about 1 h at 30 c . The resultant mixture was centrifuged to discard free god and washed by phosphate buffer containing tween 20 . The target god / gnr bioconjugates were finally dispersed under ultrasonication in 1.5 ml phosphate buffer solution (10 mm, ph 7.0) and stored at 4 c . The activities of free god at different temperatures were monitored using uv vis spectroscopy at = 460 nm based on the change in solution color, which results from the oxidation ofo - dianisidine by the reaction product hydrogen peroxide from glucose in the presence of hrp . Typically, 2.5 ml of a 0.33 mmo - dianisidine solution in 0.1 m buffer, 0.3 ml 5 g lglucose solution, and 0.1 ml 0.02% hrp were mixed as substrate . Then, 10 l of the free god solution (1 mg ml) was added into the mixture, and the absorption of the mixture was recorded immediately and for the next 4 min . For the god / gnr system, the measuring procedures were the same as those for free god in solution except for the use of 10 l gnrs@pss@pdadmac@god (god / gnrs bioconjugates) and 10 l gnrs@pss@pdadmac instead of 10 l of free god, respectively . 1 ml pdadmac (2 g l, 1 mm nacl) aqueous solution was mixed with 1 ml god (2 mg ml) in a phosphate buffer (10 mm, ph 7.0) for about 1 h at 30 c . The resulting concentration of god in the pdadmac / god bioconjugates is 1 mg ml . Vis absorption spectra were obtained using a uv-2550 spectrophotometer with temperature controller (s-1700, shimadzu, japan). Zeta potentials and size distributions were measured on a zetasizer nano 90 and zetasizer 3000hsa (malvern, england), respectively . Tem was performed with a jeol - jem-1011 electron microscope under 100 kv accelerating voltage . Formvar - coated copper grids (200 meshes) were used as the support carrier . It is well known that a protein can be regarded as an anionic or cationic polyelectrolyte by simply adjusting the ph value of the protein solution to be higher or lower than its isoelectric point (pi). The formation of a protein polyelectrolyte complex at ph> pi with polycations and at ph <pi with polyanions can be easily achieved . The bioconjugates of god and gnrs were fabricated using the electrostatic interaction between god and cationic polyelectrolyte - coated gnrs, as shown in scheme 1 . The gnrs used in this study were prepared by the seed - mediated growth method in cetyltrimethylammonium bromide (ctab) surfactant solution and were positively charged due to the coating of the ctab bilayer . Because the free ctab and the fixed ctab on the substrate possess high cytotoxicity and cause denaturation of proteins, the as - prepared ctab - coated gnrs were treated with anionic poly(sodium-4-styrenesulfonate) (pss), resulting in negatively charged pss coatings on the gnrs . Subsequently, positively charged poly(diallyldimethylammoniumchloride) (pdadmac) was absorbed on to them . In this case, anionic god in the phosphate buffer solution (10 mm, ph 7.0), in which the pi of god is 4.2, can easily be attached electrostatically on to the pdadmac - coated gnrs, resulting in the formation of bioconjugates of god and gnrs . The resultant god / gnr bioconjugates display dramatically enhanced thermostability, much better than that of the free enzyme and even better than the reported results for god immobilized on planar substrates, polystyrene nanoparticles, and spherical gold nanoparticles . Schematic illustration of the fabrication of the god / gnr bioconjugates gold nanorods exhibit transverse surface plasmon resonance (tspr) as well as longitudinal surface plasmon resonance (lspr) bands . The uv vis spectra of the gnrs with different coatings are shown in fig ., there is a tspr peak at about 520 nm and a lspr peak at 691 nm (fig . Compared with the lspr peak of the as - prepared gnrs, there are red shifts for the gnrs with a pss coating (697 nm, curve b) and with a pdadmac coating (703 nm, curve c), showing that the polyelectrolytes are successfully adsorbed on to the gnrs via electrostatic interactions . After god (ph 7.0) solutions were added to the pdadma - coated gnr suspension, the lspr peak located at 723 nm was observed, as shown in fig . 1a curve d. compared with that of pdadmac - coated gnrs, there is a red shift of about 20 nm indicating that the god has been electrostatically absorbed on to the gnrs . Auv vis spectra of ctab - stabilized gnrs (curve a), gnrs / pss (curve b), gnrs@pss@pdadmac (curve c), and gnrs@pss@pdadmac@god (curve d).bzeta potentials of gnrs coated with multilayers, ctab (first layer), and those sequentially coated with pss (second layer), pdadmac (third layer), and god (fourth layer), respectively zeta potentials () were measured to follow the formation of the god / gnr bioconjugates . The -potential of the coated gnrs was measured after deposition of each layer, as shown in fig . The -potential of the as - synthesized gnrs is about + 33.2 mv due to the presence of a bilayer of cationic ctab on the surface of the gnrs . When the negatively charged pss and the positively charged pdadmac formed the outermost layer, negative and positive -potentials can be observed at 50.8 mv and + 50.6 mv, respectively . When anionic god is adsorbed on to gnrs@pss@pdadmac, the -potential is about 15.4 mv . This is the qualitative evidence for the stepwise deposition of polyelectrolyte and god . Besides -potentials measurements, size distributions of gnrs, gnrs@pss@pdadmac, and gnrs@pss@pdadmac@god were also performed, which is consistent with -potential values (as shown in the supplementary material). The aspect ratio of the used gnrs is about 2.7 0.4, and the thickness of the coating layer is about 5 nm, as shown in fig . Tem images of the gnrs (a) and god / gnr bioconjugates after stained by uranyl acetate (b) the practical application of immobilized enzymes depends on their stability under various conditions, e.g., temperature . In this case, the activity and thermostability of god was examined for the god / gnrs . The optimum catalytic activity for free god was observed at ph 7.0, and the isoelectric point of god is 4.2 . Cationic pdadmac - coated gnrs were, therefore, incubated with god in phosphate buffer (10 mm, ph 7.0), in which the god was negatively charged . In order to address the influence of gnrs on the thermostability of god, the free god in solution and god immobilized on to the gnrs were exposed to a defined temperature for 15 min, and for the same concentration of glucose, the uv vis absorbance of god / gnrs bioconjugates or free god at 460 nm, after the reaction with glucose, are represented at different temperatures as ai,460, except amax at 40 c, which was regarded as 100% activity . The relative activities of god at different temperatures were obtained from the ratio ai,460/amax . In order to eliminate the influence of the absorbance of gnrs on the values of ai,460, the relative activities of the god immobilized on gnrs were obtained from (ai,460 aai,0,460)/(amax ai,0,460), where ai,0,460 represents the absorbance of gnrs@pss@pdadmac at 460 nm . In order to make the relative activities of free god and the god immobilized on gnrs comparable, the amount of god used to prepare the god / gnrs was the same as that of the free god used to measure the enzyme assays . Each set of experiments was carried out in triplicate to confirm the reproducibility of the system . Figure 3shows the relative activities versus temperature for the god immobilized on gnrs (god / gnrs), free god, and the god immobilized on pdadmac (god / pdadmac). A sharp reduction in activity with temperature is observed for all of them at temperatures over 40 c . Surprisingly, when the temperature reached 90 c, the relative activity of god / gnrs remained at about 39.3% . The relative activities of the free god and pdadmac / god bioconjugates were only 22.0 and 15.4%, respectively, as shown in fig . This suggested that it is the structure of enzyme assembly that has great effects on enzyme activity . Enzyme thermostability of (a) immobilized god (b) free god, and (c) pdadmac - blended god in summary, we have demonstrated that god can be successfully adsorbed on to polyelectrolyte - coated gnrs via electrostatic interactions . According to enzymatic catalysis examination, the god / gnrs bioconjugates have extraordinary stability at high temperature in contrast not only with the free enzyme in solution but therefore, gnrs can be expected to be a promising matrix for the immobilization of other kinds of enzymes and proteins with greatly enhanced stability for biosensor applications . The present results will be of significance for the biologic enhancement effects using other kinds of anisotropic nanostructures . Although the mechanism by which gnrs dramatically enhance the enzyme thermostability of god is still an open question, with further experiments to understand the detailed effect of gnrs on god being pursued, the present work has already suggested a new way of enhancing enzyme stability and will be of significance in designing new kinds of enzyme - based nanoreactors for biosensors and biocatalytic reactors using other kinds of anisotropic nanostructures . This study was supported by development program of science and technology of beijing municipal education commission (km200810028010) and capital normal university.
|
The diagnosis of cardiac disorders becomes more and more important with the incidence of acute myocardial infarction (ami) commanding one of the highest mortality rates in the us and around the world . Each year, approximately 635,000 people suffer from ami, among whom it is estimated that 50% will die within the first hour of symptoms . For this reason, many studies have been conducted to shorten the time required to diagnose ami [25]. Given the complex pathophysiology of heart disease, interests have intensified in plasma biochemical markers to predict susceptibility and aid in patient management . After an ami has occurred, cardiac biomarkers, such as myoglobin, troponin i (ctni), troponin t (ctnt), and creatine kinase (ck - mb), are released into the bloodstream [3, 4, 6]. In 2000, the world health organization set a standard allowing physicians to use the troponins and ck - mb levels, in addition to ecg and the patients' history, to diagnose ami . Although the serum detection of these biomarkers aids in an accurate diagnosis, it is usually time consuming due to the laborious lab techniques and logistics of sample transportation to a central lab . Both the turnaround time for laboratory diagnosis and the elapsed time for ctni or ck - mb biomarkers to be released into the body (up to 3 hours for ctni and 6 hours for ck - mb after an ami) may lead to a delay in prime - time treatment or hospitalization of a patient with ami . Myoglobin, however, is one of the earliest biomolecules released into the bloodstream (~1 hour) after the ami, reaches peak levels after 2 hours, and has been shown to be an early indicator of ami [3, 6, 9]. Demonstrated that an increase of 20 ng / ml of myoglobin in 90 minutes provided a highly accurate diagnosis of ami in patients with normal levels of ctni . Given that these cardiac markers have different characteristics, including clinical sensitivity and specificity, release time after symptom onset, clinical cutoff level (myoglobin 70200 ng / ml; ck - mb 3.510 ng / ml; ctni 0.061.5 ng / ml) [10, 11], and capability to remain elevated for a reasonable length of time, a rapid, accurate, and simultaneous measurement of the cardiac markers is important in reducing detection time, decreasing cost of patient treatment, and saving patient lives . This has led many researchers to study the use of label - free biosensors to detect myoglobin levels . Since the first discovery of cardiac biomarkers, many detection methods have been developed such as fluorescence immunoassay, surface plasmon resonance (spr) sensor, resonant waveguide grating or quartz crystal microbalance, electrical signals from nanowire - based biosensors, microresonator based such as microcantilever biosensors [16, 17], and two - dimensional photonic - crystal biosensors [1821]. For the fluorescence - based detection methods, despite its high sensitivity, the process of fluorescence labeling can be complicated and time consuming . The nanowire - based biosensors may offer label - free detection with high sensitivity, but measurement results are to be easily affected by ph values of solutions and charges of molecules, because the detection mechanism is based on the measurement of conductance change of a nanowire . For the cantilever - based resonator sensor, the out - of - plane vibration experiences a high viscous damping in liquid environment, thus lowering the q - factor and mass resolution . Although the spr - based sensor has been successfully commercialized, it is expensive and has limited use for small molecular binding assays . In this paper, we report label - free bioassays of myoglobin with a novel photonic - crystal - based sensor having a unique open microcavity structure . The optical biosensor is designed based on a photonic crystal structure used in a total - internal - reflection configuration [2428]. Briefly, the sensor is composed of a bk7 glass substrate, five alternating layers of two different dielectric materials (titania and silica), and a cavity layer at the surface . Each of the titania layer and the silica layer is 89.8 nm and 307.2 nm thick, respectively, and is fabricated on the substrate using a vacuum vapor deposition method, which is a well - established fabrication method and relatively inexpensive . The cavity layer of the sensor is formed with 382 nm of silica and 10 nm of silicon . The silicon layer is used to introduce an appropriate amount of absorption that produces a resonant dip in the reflectance spectrum of the sensor . A broadband light is introduced into the sensor substrate at an incidence angle of 64 through a prism . This pc - tir sensor functions as a high - finesse fabry - prot resonator, which enables it to yield a sharper resonance mode than spr - based sensors and thus higher detection sensitivity, and yet the sensor surface available for analyte binding is open to free space and allows real - time binding measurements, bypassing the problems of porous structure - based biosensors . Our sensor is unique in the fact that it utilizes an open optical microcavity as opposed to a conventional closed optical microcavity . A traditional closed optical microcavity has a cavity layer sandwiched between two high - reflection surfaces . We create the open cavity by dividing the cavity layer of a traditional closed cavity in half, placing only one half into a tir configuration . A microcavity is still created as the incident light is confined between the photonic crystal structure and its mirror image due to tir . The open sensing surface is allows easy immobilization of analyte - recognition molecules on the surface and direct exposure of analyte molecules for real - time bioassays . When molecular bindings occur on the cavity layer surface, the wavelength of the resonant dip in the reflectance spectrum of the sensor shifts in a manner highly sensitive to analyte binding . Through monitoring the shift in the resonant dip, a real - time detection of the molecular binding can be performed . Similar to the surface treatment protocol described in other papers [2931], the sensor surface is cleaned and oxidized via immersion in a piranha solution a mixture of sulfuric acid and hydrogen peroxide (98%-h2so4: 30%-h2o2 = 3: 1) in a parafilm sealed beaker on a heated plate (80c) for 1 hour followed by rinsing with a copious amount of deionized water for 2 minutes under sonication and then immersed in deionized water for overnight to completely remove the residue of acid . The sensor surface is further etched with trifluoroacetic acid (thf) for 90 minutes at room temperature . The thf residue is evaporated by putting the sensor in a vacuum chamber pumped overnight . The silanization of the sensor surface is finished by placing it in a freshly prepared 5% (v / v) 3-aminopropyltriethoxysilane (aptes) solution in 95% acetone for 10 minutes, followed by removing excess reaction reagents with acetone on a shaker for twelve times at 5 minute intervals . Finally, the curing of the silane linkage is carried out by drying the substrates on a hot plate at 110c for 90 minutes . After the above process, the sensor surface is enriched with amine groups suitable for further conjugation with carboxyl - terminated biomolecules . Before the immobilization of cardiac myoglobin antibodies, the carboxyl methylated (cm) dextran (150 kda) is covalently conjugated onto the sensor surface via edc / nhs chemistry to maximize the binding sites of cardiac myoglobin antibodies . The cm - dextran (125 mg) is prepared in a hepes (n-2-hydroxyethylpiperazine - n-2-ethane sulfonic acid) buffer solution (2 ml, ph = 5.5). The carboxyl groups on the cm - dextran are activated with the aid of 1-ethyl-3(3-dimethyl aminopropyl) carbodiimide (edc) and n - hydroxysuccinimide (nhs) molecules for 10 minutes, with the molar ratios of cooh: edc: nhs = 1: 10: 2.5 . The cm - dextran solution with activated carboxyl groups is adjusted to a ph value of 7.3 from 5.5 by adding an appropriate amount of naoh solution . The activated cm - dextran then reacts with the amine groups on the sensor surface for 4 hours at room temperature . The cm - dextran immobilized on the surface is about 2.5 nm, confirmed by the sensor via the method described in section 2.5 . Finally, the immobilized cm - dextran on the sensor surface is activated with a similar edc / nhs chemistry and reacts with 200 l cardiac myoglobin antibodies (fitzgerald industrial, 10-m50c) to functionalize the sensor for specific detection of myoglobin (fitzgerald industrial, 30c - cp1030u). To load samples for analysis with the sensor, two microchannels having a width of 500 m, height of 380 m, and length of 5 mm pdms base and curing agents (sylgard184, dow corning) are mixed at a ratio of 10: 1 . The mixture is degassed in a vacuum chamber for about 10 minutes and then cast on a mold and cured at room temperature . Finally, the two microchannels are sealed on the surface of the functionalized sensor . In order to inject the target sample solution or phosphate buffered saline (pbs) solution, teflon tubings are used to connect the outlets of the microfluidic channels to a multichannel syringe pump . The inlets of the microfluidic channels are connected to two vials containing the target myoglobin samples and pbs solutions, respectively . The flow of cardiac myoglobin samples or buffer solutions onto the sensing areas is precisely controlled with the syringe pump . A white light source is coupled into a single - mode optical fiber using an objective lens to obtain a good spatial mode . An aspherical lens is used to collimate the output light from the fiber as it passes through a linear polarizer to select s - polarization . The light is split into two parts and is delivered to the pc - tir sensor substrate at an incident angle of 64 through a coupling prism . The two beams are carefully aligned to the center of the two microchannels on the sensor surface . The reflected light from the two microchannels on the sensor is collected using a high - resolution spectrometer (hr4000, ocean optics) where the resonant wavelength shifts are recorded in real time . One channel is used for flowing cardiac myoglobin samples, while the other is used as a reference channel to compensate for changes in the resonant wavelength due to mechanical drift or temperature fluctuations . The myoglobin at various concentrations from 70 to 1000 ng / ml in pbs is measured using our pc - tir sensor . Firstly, a pbs solution (ph = 7.4) is injected into both microchannels on the sensor surface . The resonant dip wavelengths in the reflectance spectra corresponding to the two channels are recorded as the detection baselines . Next, 200 l of cardiac myoglobin antibody solution (in pbs) is injected into one of the microchannels, replacing the pbs solution at a speed of 5 l / min . With the binding of the myoglobin antibody on the sensor surface, the resonant dip of the sensor shifts accordingly, which is a direct recording of the dynamic binding process . The sensor is then washed by making pbs flow through the both microchannels for 10 minutes at the same flow rate . The net shift of the resonant wavelength before and after the flow of cardiac myoglobin antibody solution reflects the amount of antibody molecules immobilized on the sensor surface . The binding thickness of the antibodies is confirmed by this method to be ~1 nm . The sensor is prepared for myoglobin assays due to the immobilization of the cardiac myoglobin antibodies on the sensor surface . A 200 l cardiac myoglobin solution in pbs is injected through one microchannel on the newly prepared sensor, while the other microchannel continuously maks pbs as a reference . Different concentrations of cardiac myoglobin samples are measured and the amount of cardiac myoglobin binding to the sensor surface is quantified by analysis of the corresponding resonant dip shift in the reflectance spectra . A series of the typical reflectance spectra of the sensor when making 200 l myoglobin solution (in pbs, 70 ng / ml) flow through a microchannel is shown in figure 2 . The full width at half maximum of the resonant dip is only 2.5 nm . The sharp resonant condition allows precise quantification of the center wavelength of the resonant dip . When the binding of myoglobin molecules to the immobilized antibodies occurs on the sensor surface, the resonant condition of the sensor changes due to an increase of the effective thickness of the cavity layer, thus producing a shift of the resonant wavelength . Although at the low concentration of myoglobin at 70 ng / ml the shift is minimal, it is still clearly measureable (figure 2). The curves can be fitted with a lorentzian function, which provides quantitative results of the shift of the center wavelength . At a constant concentration the shift increases with time, indicating that more myoglobin molecules are bound to the antibodies on the sensor surface . When the concentration of myoglobin increases, the shift of the resonant wavelength also increases and can become much bigger than that shown in figure 2 . The time - dependent wavelength shift of the sensor resonant dip is caused by the interaction events between myoglobin and the antibodies immobilized on the sensor surface . The time - dependent response is close to linear for the first concentration of 70 ng / ml . The linear relationship is because the binding sites available on the sensor surface are much larger than the number of myoglobin molecules . Over the time, the available interaction sites decrease until all of the binding sites are occupied, resulting in a saturation of the binding curve for the high concentration (1000 ng / ml). After binding of myoglobin at each concentration, the sensor surface is washed with pbs and a drop of the resonant wavelength is observed, which can be attributed to partial removal of loosely bound molecules . The end point of the resonant wavelength shift after pbs wash is plotted as a function of myoglobin concentrations in figure 3(b). Saturation of binding has been observed at higher myoglobin concentrations . Based on our transfer matrix simulation of multilayer interference in our sensor, the final resonant wavelength shift of 0.25 nm for 1000 ng / ml of myoglobin corresponds to a binding thickness of myoglobin of 0.30 nm . Our experimental result indicates that a pc - tir can be functionalized for sensitive detection of myoglobin with a concentration ranging from 70 to 1000 ng / ml . This sensing range of myoglobin meets the present clinical diagnostic requirement for myocardial damage that results in an elevation of myoglobin to more than 110 ng / ml [32, 33]. In order to confirm that the resonant wavelength shift is caused by specific interactions between the antibodies and myoglobin for that, myoglobin solutions with the highest (1000 ng / ml) and lowest (70 ng / ml) concentrations used in the binding assay experiment were selected to be injected into a microchannel on a sensor surface without immobilized antibodies . As demonstrated in figure 4, after pbs wash the average resonant wavelength shift is only ~0.050 (figure 4(a)) and 0.018 nm (figure 4(b)), respectively . This result indicates that there is minimal nonspecific binding for a sensor without the immobilization of antibodies, while the resonant wavelength shift for a sensor functionalized with antibodies is caused by specific binding between myoglobin and the antibodies . To further test the specificity of the sensor to myoglobin, we carried out another control experiment by checking the binding of unrelated protein molecules with the sensor having immobilized myoglobin antibodies . For that, cardiac troponin i (ctni) was chosen as a random protein molecule . A solution of 200 l ctni with a concentration of 200 ng / ml in pbs was flowed across the sensor surface immobilized with myoglobin antibodies . Although we observed a jump of the resonant wavelength when starting injection of ctni onto the sensor surface, the wavelength shift returned to the baseline level after the sensor was washed with pbs (figure 5). The initial jump of the resonant wavelength can be attributed to the change of the bulk refractive index caused by replacing pbs with the ctni solution . Except for the initial jump, the flat sensor response during this period indicated that no real binding occurred when ctni was flowing on the sensor surface . The fact that the final wavelength shift returned to the baseline after the sensor was rinsed with water further proved that there was no binding of ctni to the sensor functionalized for myoglobin assays . Therefore, this experimental result confirms the specificity of our sensor for detecting the myoglobin cardiac biomarker . Besides quantifying myoglobin with different concentrations, the pc - tir sensor can also be used to obtain the dissociation constant kd at equilibrium, which is an important parameter in evaluating the biochemical binding activities . Assuming a simple biomolecular binding model where two binding components a and b form a binding complex as ab, [a] + [b] [ab], the kinetic rate constants are described as follows: (1)drdt = konc(rmaxrt)koffrt, where r is the response of the sensor, while rt and rmax are the response at time t and the maximum binding response, respectively . Kon and koff are the binding and dissociation rate constants, respectively . At equilibrium, one obtains (2)kdreq = c(rmaxrt), where kd is the equilibrium dissociation constant, kd = koff / kon . Req is the sensor response at equilibrium corresponding to a concentration of c. by measuring the resonance shifts at equilibrium for two different concentrations, one can calculate kd by solving (2). To ensure binding equilibrium for calculating the equilibrium dissociation constant kd, we used myoglobin samples at two high concentrations, 8000 ng / ml and 2600 ng / ml, for the binding assays with our pc - tir sensor . The binding curves are plotted in figure 6, which shows that equilibrium has been reached at two levels corresponding to the two concentrations used . From the sensor responses at the equilibrium levels and based on (2), the kd of myoglobin bound with antibodies on the pc - tir sensor surface was calculated to be 1.2 nm, which is in good agreement with the value of 1.3 nm reported previously in . It should be noted that myoglobin is not specifically indicative of acute myocardial infarction, because it is also present in skeletal muscle; however, it may still provide the earliest indication of myocardial injury and other valuable prognostic information when it is used in combination with other biomarkers . Ctni is the most widely used biomarker, due to its nearly complete cardiac tissue specificity and sensitivity . They remain elevated for 410 days after the onset of ami, indicating their capability to remain elevated for a reasonable length of time to allow a suitable diagnostic window . However, since it takes approximately 4 hrs for cardiac troponins to reach detectable concentrations in blood, they cannot be considered as early markers . On the other hand, however, myoglobin is rapidly cleared out from blood compared to other cardiac biomarkers, limiting its diagnostic usefulness in patients after 812 hours of presenting symptoms . A combination blood test of ctni and myoglobin may allow the achievement of high diagnostic sensitivity and specificity . A sensitive biosensor is needed for rapid detection right after the onset of the elevation of myoglobin concentrations . A pc - tir sensor may potentially address this unmet demand, since it can offer sensitive and rapid detection of myoglobin in the clinically significant concentration range as demonstrated in this study . A photonic crystal structure used in a tir configuration can form a sensitive biosensor with a unique open microcavity as its sensing surface . Such a sensor is successfully fabricated at low cost and applied for the label - free binding assay of myoglobin for potential early diagnosis of myocardial infarction . The sensor detection limit is as low as 70 ng / ml, which falls in the clinical diagnostic level of ami patients . The experimental results reported here serve as a stepping stone towards potential applications of the pc - tir sensor for earliest diagnosis and identification of ami patients . In the future, more experiments with the pc - tir sensor will include the use of other cardiac biomarkers along with actual blood samples.
|
Chemotherapy - induced nausea and vomiting (cinv) associated with highly emetogenic chemotherapy (hec) adversely affects the quality of life of patients; it is especially challenging to manage in the delayed phase (24120 hours after chemotherapy)1 and affects chemotherapy compliance.2,3 hec includes chemotherapeutic agents with the potential to cause emesis in> 90% of patients in the absence of prophylaxis.4 for patients receiving hec, antiemesis guidelines from the american society of clinical oncology (asco), the national comprehensive cancer network (nccn), the european society of medical oncology (esmo), and multinational association of supportive care in cancer (mascc) recommend the use of a three - drug regimen consisting of a 5-hydroxytryptamine type 3 (5-ht3) receptor antagonist (ra), a neurokinin 1 (nk-1) ra, and a corticosteroid.3,5,6 despite these comprehensive treatment guidelines, there is still an unmet clinical need for improved prevention of delayed cinv in patients receiving hec regimens.7,8 anthracycline and cyclophosphamide (ac)based regimens represent a distinct class of emetogenic chemotherapy . Previously classified as moderately emetogenic chemotherapy (mec) according to the hesketh emetogenicity criteria, developed in 1997,4 ac - based regimens were subsequently reclassified as hec in the asco 2011 emetogenicity guidelines to recognize their high emetogenic risk.9 updated mascc and esmo guidelines have also recommended classification of ac - based regimens as hec and recommend the above - mentioned three - drug regimen for cinv prevention in this setting.5 ac - based regimens are most commonly administered to women with breast cancer, a population at higher risk for cinv, based on both female gender and typically younger age.1015 therefore, cinv in this population is influenced by both chemotherapy- and patient - related risk factors . Cinv prevention in patients receiving ac - based hec6 is challenging and remains an urgent therapeutic need . Granisetron, a first - generation serotonin (5-ht3) ra, is commonly used to treat cinv but has a short half - life (9 hours).16 apf530 is a new formulation of 2% granisetron in a viscous bioerodible biochronomer tri(ethylene glycol) poly(orthoester) (teg - poe) polymer.17 following subcutaneous (sc) administration of apf530 in the upper arm or abdomen, the polymer undergoes slow, controlled hydrolysis, maintaining therapeutic concentrations of granisetron for 5 days.18,19 a single dose of apf530 (granisetron 10 mg) provides extended release of granisetron for the prevention of both acute (024 hours) and delayed (24120 hours) cinv.17 in a phase iii noninferiority trial, apf530 (500 mg sc) was noninferior to palonosetron (0.25 mg iv) in the control of acute cinv in patients receiving mec or hec and in the prevention of delayed cinv in patients receiving mec.17,20 apf530 is approved by the us food and drug administration (fda) for use in conjunction with other antiemetics to prevent acute or delayed cinv following initial or repeat courses of mec or ac combination regimens.21 the phase iii modified absorption of granisetron in the prevention of cinv (magic) trial compared delayed - phase complete response (cr; no emesis [vomit or retch] and no rescue medication use) achieved by using apf530 with that using ondansetron, each in a three - drug regimen with an nk-1 ra and dexamethasone . Ondansetron, the active comparator, has been used in large - scale cinv studies as the positive comparator for other 5-ht3 ras22,23 and is indicated for the prevention of nausea and vomiting associated with initial and repeat courses of emetogenic cancer chemotherapy, including high - dose cisplatin.24 in magic, the apf530 arm demonstrated superior cr versus ondansetron in delayed cinv following hec (64.7% vs 56.6%; p=0.014; 8% absolute improvement).25 apf530 is the first and only 5-ht3 ra to demonstrate superiority over another 5-ht3 ra in a three - drug versus three - drug pivotal phase iii efficacy trial . This exploratory post hoc analysis evaluated the efficacy and safety of an apf530 regimen versus an ondansetron regimen in magic trial patients who received ac - based chemotherapy regimens . Details of the magic trial design and methodology have been presented previously,25 whereas a brief overview is presented in this report . This prospective, multicenter, randomized, double - blind, double - dummy, parallel - group phase iii trial was conducted at 77 sites (see table s1 for the list of study investigators list) in the united states (clinicaltrials.gov identifier: nct02106494). The protocol was approved by the institutional review board at all sites and conducted according to the international conference on harmonisation e6 good clinical practice guidelines and the declaration of helsinki . Access to the data for this post hoc analysis was provided by heron therapeutics, inc . Adult patients who had histologically or cytologically confirmed malignancy and were scheduled to receive their first cycle of single - day hec, according to asco 2011 emetogenicity criteria,9 were enrolled . Eligible patients had an eastern cooperative oncology group (ecog) performance status of 0 or 1 . Patients with current or prior significant cardiac disease, including qt interval prolongation, were excluded . Patients were randomly assigned 1:1 to receive either apf530 500 mg sc (granisetron 10 mg) and ondansetron placebo iv or ondansetron 0.15 mg / kg iv (to a maximum of 16 mg) and apf530 placebo sc (containing the biochronomer teg - poe vehicle); stratification was by planned cisplatin 50 mg / m (yes / no). In addition, all patients received fosaprepitant 150 mg iv and dexamethasone 12 mg iv on day 1 and were scheduled to receive dexamethasone 8 mg orally once daily on day 2 and twice daily on days 3 and 4 . The primary objective was to demonstrate the superiority of apf530 500 mg sc in achieving delayed - phase cr, compared with ondansetron 0.15 mg / kg iv, in patients receiving hec in cycle 1 . Secondary end points included cr in the overall (0120 hours) phase and two, more stringent end points that measure additional effects on nausea: complete control (cc; cr and no more than mild nausea) in delayed and overall phases . Other end points included cr and cc in the acute phase and total response (tr; cr and no nausea) in acute, delayed, and overall phases; the number of nausea episodes and rescue medication use, results for which were based on observed data without imputation for missing data, were also included . Patients recorded daily, up to 120 hours following chemotherapy, the number of nausea, retching and/or vomiting episodes, and instances of rescue medication use; these data were used to evaluate the above - mentioned efficacy measures . Response rates were compared using 95% confidence intervals for treatment differences using a modified intent - to - treat (mitt) population (all patients who received hec and the study drug and had postbaseline efficacy measures); p - values between treatment arms were based on the chi - square test . This post hoc analysis was conducted on the subgroup of patients who received an ac - containing hec regimen; however, the study was not powered to detect statistically significant treatment differences between the arms with this subgroup . Safety was assessed by adverse events, physical examinations, vital signs, and clinical laboratory values in the safety population, comprising all patients who received the study drug . The type of treatment - emergent adverse event (teae) and its duration, severity, and relationship to the study drug were evaluated . Teaes, serious adverse events (saes), treatment - related teaes, and treatment - related saes were assessed . Teaes were defined as adverse events that either began within 8 days of study drug administration or prior to and increased in severity within 8 days of study drug administration . Treatment - related teaes included teaes with possible, probable, or definite relationship to study drug treatment or events with unknown or missing causality . Severity of teaes was graded by the national cancer institute common terminology criteria for adverse events version 4.03 . All injection site reactions (isrs) were collected by patient diary entries in addition to investigators evaluation . The severity of most isrs was based on prespecified criteria of size and appearance only, rather than functional impairment . Of the 942 patients randomized in the entire study between march 31, 2014, and may 15, 2015, 600 patients received ac - based hec (apf530 arm, 296; ondansetron arm, 304) (figure 1). Of the 296 randomized patients in the apf530 arm, 3 discontinued prior to treatment (1 due to a protocol violation, 1 due to withdrawn consent, and 1 due to other reason); of the 304 randomized patients in the ondansetron arm, 1 discontinued prior to treatment because of an adverse event . The safety population consisted of 293 patients in the apf530 arm and 303 patients in the ondansetron arm . Of the 293 patients in the apf530 arm safety population, 2 discontinued the study prior to day 6 (1 due to an adverse event and 1 due to other reason). Among the 303 patients in the ondansetron arm safety population, 5 were excluded from the mitt population: 2 discontinued the study without postbaseline efficacy data (1 due to protocol violation and 1 due to an adverse event) and 3 completed the study, but 2 had no postbaseline efficacy data and 1 had improper study medication (figure 1). All patients in the apf530 arm mitt population completed the study; among the ondansetron arm mitt population, 2 patients discontinued the study because of a protocol violation (figure 1). Of the 902 patients in the mitt population of the entire study, 589 (65%) received ac - based hec (apf530 arm, n=291; ondansetron arm, n=298). Baseline demographics were generally balanced between the treatment arms in the ac subgroup (table 1). Most patients in the ac subgroup were female (apf530, 99.3%; ondansetron, 98.3%), white (apf530, 80.1%; ondansetron, 77.9%), and had an ecog performance status of 0 (apf530, 83.8%; ondansetron, 79.9%). The mean age of patients in the apf530 arm was 54.1 years and that in the ondansetron arm was 53.8 years . The most common ac - based chemotherapy regimen in both treatment arms was cyclophosphamide <1500 mg / m and doxorubicin (apf530 arm, 87.3%; ondansetron arm, 89.3%) (table 2). In the ac subgroup, delayed - phase cr was numerically higher in the apf530 arm versus the ondansetron arm, approaching statistical significance (63.6% vs 56.0%; p=0.062) (table 3). Similarly, in the overall phase, a trend favoring the apf530 arm versus the ondansetron arm was observed, although it was not statistically significant . No appreciable efficacy difference was observed in the acute phase in the apf530 arm compared with the ondansetron arm (table 3). For cc and tr, numerically higher rates were observed in the apf530 arm versus the ondansetron arm in the delayed and overall phases, although the treatment differences were not statistically significant . Minor differences were observed in cc and tr rates in the acute phase (table 3). A numerically higher proportion of patients in the apf530 arm versus the ondansetron arm reported no rescue medication use in the delayed (68.9% vs 61.7%; p=0.069) and overall phases (63.3% vs 56.9%; p=0.116) (table 4). The proportion of patients with no rescue medication use was numerically higher in the apf530 arm compared with the ondansetron arm across all phases (figure s1). Clinical results also favored the apf530 arm versus the ondansetron arm in the proportion of patients reporting no nausea in the delayed and overall phases (table 5). The apf530 regimen was generally well tolerated in this ac subgroup; no new safety signals were identified (table 6). Most patients experienced at least one teae (apf530 arm, 93.5%; ondansetron arm, 91.1%). Excluding isrs, the most frequently reported teaes were fatigue, constipation, nausea, and headache, occurring with a similar frequency in each treatment arm . Serious teaes were experienced by 4.1% of the patients in the apf530 arm and 2.0% of the patients in the ondansetron arm; no teaes led to death . Excluding isrs, the most common treatment - related teaes in the apf530 and ondansetron arms were constipation (8.2% vs 5.9%, respectively) and headache (7.2% vs 5.9%, respectively). A treatment - related sae occurred in one patient in the apf530 arm (0.3%, injection - site infection) 14 days after apf530 administration and recovered within 9 days with antibiotic use . A treatment - related sae occurred in one patient in the ondansetron arm (0.3%, dehydration) and subsequently resolved . The most frequently reported teaes were isrs (table 6), which occurred in 66.9% of patients in the apf530 arm and 60.7% in the ondansetron arm . The severity of most isrs was based on prespecified criteria of size and appearance only, rather than functional impairment . These were generally mild or moderate, most resolved by the end of the study, and no isr led to death or study discontinuation . Of the 942 patients randomized in the entire study between march 31, 2014, and may 15, 2015, 600 patients received ac - based hec (apf530 arm, 296; ondansetron arm, 304) (figure 1). Of the 296 randomized patients in the apf530 arm, 3 discontinued prior to treatment (1 due to a protocol violation, 1 due to withdrawn consent, and 1 due to other reason); of the 304 randomized patients in the ondansetron arm, 1 discontinued prior to treatment because of an adverse event . The safety population consisted of 293 patients in the apf530 arm and 303 patients in the ondansetron arm . Of the 293 patients in the apf530 arm safety population, 2 discontinued the study prior to day 6 (1 due to an adverse event and 1 due to other reason). Among the 303 patients in the ondansetron arm safety population, 5 were excluded from the mitt population: 2 discontinued the study without postbaseline efficacy data (1 due to protocol violation and 1 due to an adverse event) and 3 completed the study, but 2 had no postbaseline efficacy data and 1 had improper study medication (figure 1). All patients in the apf530 arm mitt population completed the study; among the ondansetron arm mitt population, 2 patients discontinued the study because of a protocol violation (figure 1). Of the 902 patients in the mitt population of the entire study, 589 (65%) received ac - based hec (apf530 arm, n=291; ondansetron arm, n=298). Baseline demographics were generally balanced between the treatment arms in the ac subgroup (table 1). Most patients in the ac subgroup were female (apf530, 99.3%; ondansetron, 98.3%), white (apf530, 80.1%; ondansetron, 77.9%), and had an ecog performance status of 0 (apf530, 83.8%; ondansetron, 79.9%). The mean age of patients in the apf530 arm was 54.1 years and that in the ondansetron arm was 53.8 years . The most common ac - based chemotherapy regimen in both treatment arms was cyclophosphamide <1500 mg / m and doxorubicin (apf530 arm, 87.3%; ondansetron arm, 89.3%) (table 2). In the ac subgroup, delayed - phase cr was numerically higher in the apf530 arm versus the ondansetron arm, approaching statistical significance (63.6% vs 56.0%; p=0.062) (table 3). Similarly, in the overall phase, a trend favoring the apf530 arm versus the ondansetron arm was observed, although it was not statistically significant . No appreciable efficacy difference was observed in the acute phase in the apf530 arm compared with the ondansetron arm (table 3). For cc and tr, numerically higher rates were observed in the apf530 arm versus the ondansetron arm in the delayed and overall phases, although the treatment differences were not statistically significant . Minor differences were observed in cc and tr rates in the acute phase (table 3). A numerically higher proportion of patients in the apf530 arm versus the ondansetron arm reported no rescue medication use in the delayed (68.9% vs 61.7%; p=0.069) and overall phases (63.3% vs 56.9%; p=0.116) (table 4). The proportion of patients with no rescue medication use was numerically higher in the apf530 arm compared with the ondansetron arm across all phases (figure s1). Clinical results also favored the apf530 arm versus the ondansetron arm in the proportion of patients reporting no nausea in the delayed and overall phases (table 5). The apf530 regimen was generally well tolerated in this ac subgroup; no new safety signals were identified (table 6). Most patients experienced at least one teae (apf530 arm, 93.5%; ondansetron arm, 91.1%). Excluding isrs, the most frequently reported teaes were fatigue, constipation, nausea, and headache, occurring with a similar frequency in each treatment arm . Serious teaes were experienced by 4.1% of the patients in the apf530 arm and 2.0% of the patients in the ondansetron arm; no teaes led to death . Excluding isrs, the most common treatment - related teaes in the apf530 and ondansetron arms were constipation (8.2% vs 5.9%, respectively) and headache (7.2% vs 5.9%, respectively). A treatment - related sae occurred in one patient in the apf530 arm (0.3%, injection - site infection) 14 days after apf530 administration and recovered within 9 days with antibiotic use . A treatment - related sae occurred in one patient in the ondansetron arm (0.3%, dehydration) and subsequently resolved . The most frequently reported teaes were isrs (table 6), which occurred in 66.9% of patients in the apf530 arm and 60.7% in the ondansetron arm . The severity of most isrs was based on prespecified criteria of size and appearance only, rather than functional impairment . These were generally mild or moderate, most resolved by the end of the study, and no isr led to death or study discontinuation . The use of ac - based chemotherapy remains highly prevalent because of its effectiveness in patients with breast cancer and the relatively high breast cancer incidence.2629 placebo - controlled studies have shown that this combination induces emesis in a sufficient number of patients to warrant its reclassification, in 2011, from mec to hec . The magic trial compared apf530 versus ondansetron in the context of a guideline - recommended three - drug regimen in cinv prevention following hec regimens, including ac . The use of ondansetron was appropriate because it has been used in pivotal cinv studies as the active comparator for other 5-ht3 ras22,23 and is indicated for the prevention of nausea and vomiting associated with initial and repeat courses of emetogenic cancer chemotherapy, including high - dose cisplatin.24 no previous pivotal efficacy trial involving patients receiving ac - based regimens has compared two 5-ht3 ras within a three - drug regimen . The magic trial design was consistent with current antiemesis guideline recommendations and was conducted in us community practices, so the results are likely to be representative of this clinical practice setting . In contrast to other hec, ac - based regimens are administered mostly to younger female patients; both female sex and young age constitute patient - related cinv risk factors.30,31 accordingly, in the magic trial, most patients receiving ac - based regimens were female and aged <55 years, and so at higher risk for cinv.31,32 the interaction of high emetogenicity of ac - based regimens with patient - related risk factors highlights the distinct cinv prevention needs in this patient group . In two large phase iii trials, cr rates were lower in patients receiving ac - based than in those receiving non ac - based regimens across all phases, suggesting greater cinv prevention challenges associated with ac - based regimens.13,33 furthermore, patients receiving hec or mec regimens continue to experience delayed - phase cinv, highlighting the need for new therapies.34 although this exploratory post hoc ac subgroup analysis was not powered for statistical significance, trends favoring the apf530 versus the ondansetron arm in delayed and overall phases were observed in multiple measures of cinv control: cr, cc, tr, rescue medication use, and proportion of patients with no nausea . The biochronomer technology underlying apf530 provides sustained therapeutic granisetron concentrations across 5 days following a single apf530 injection and was expected to provide better delayed - phase cinv control than ondansetron in the magic trial . The lack of any appreciable differences in efficacy in the acute phase is consistent with the trial design . Acknowledging the limits of cross - trial comparisons, the control arm of the magic ac subgroup showed results consistent with those from a previous study in patients with breast cancer who received ac - based regimens.15 similar to findings in the entire study population, apf530 was generally well tolerated in this patient subgroup receiving ac - based hec, and no new safety signals were observed.25 the incidences of isrs were similar in both the arms, and most resolved by the end of the study . Consistent with the treatment - related teaes observed with other 5-ht3 ras,35 constipation and headache were the most commonly reported teaes with apf530 . Trial results suggest that apf530 is a safe and effective cinv management option in this particularly challenging clinical setting . Consequently, the fda approved apf530 for the prevention of both acute and delayed cinv following initial and repeat courses of mec or ac combination regimens.21 the findings of the present study from the ac subgroup are concordant with the superior delayed - phase cr rate observed in the entire magic study population.25 the superiority of apf530 versus ondansetron, in the presence of an nk-1 ra and dexamethasone, in achieving delayed - phase cr in the magic trial patients suggests that apf530 provided benefit in addition to that of the nk-1 ra . Overall, these results demonstrate the benefit of the extended - release design of the apf530 formulation, whereby a single sc dose provides therapeutic granisetron concentrations for 5 days.18 limitations of this analysis include being an exploratory post hoc analysis with a relatively small number of patients in each arm . In addition, use of the double - dummy design resulted in an increased incidence of isrs in the ondansetron arm due to the presence of the viscous teg - poe vehicle in the apf530 placebo injection . In a recently published randomized, double - blind phase iii trial, olanzapine was compared with placebo, when added to a three - drug regimen of 5-ht3 ra, nk-1 ra, and dexamethasone in patients receiving cisplatin or ac - based hec.36 in that study, the addition of olanzapine resulted in a significant improvement in nausea control . It will therefore be of interest to determine whether the addition of olanzapine to a three - drug regimen of apf530 may similarly further improve cinv control in patients receiving ac - based regimens . The magic trial demonstrated the superiority of apf530 versus ondansetron, each in a guideline - recommended three - drug regimen with fosaprepitant and dexamethasone, in the prevention of delayed - phase cinv following hec . The findings of this post hoc subgroup analysis in patients receiving ac - based hec and at a high risk of experiencing cinv are consistent with the results from the entire study population, particularly in control of delayed cinv . The apf530 regimen was generally well tolerated in the ac subgroup, as in the entire population . Apf530, in conjunction with other anti - emetics, is approved for preventing cinv in both acute and delayed phases in patients receiving initial or repeat courses of mec or ac - based regimens.21 thus, apf530 may be a convenient antiemetic option for female patients with breast cancer receiving ac - based chemotherapy, a population in which preventing nausea and vomiting is particularly difficult.
|
Dry socket is a common complication following a tooth extraction, with a peak incidence in the 4045 year - old age group . It has an incidence of 1%4% for all routine dental extractions and is more frequent in female patients [1, 2]. It is a self - limiting disease that often will take 510 days to disappear, even without treatment . The treatment of this disease has commonly been divided into two groups: the nondressing and dressing interventions . The use of dressing interventions is controversial because no scientific studies have been carried out that specifically to investigate the incidence of potential side effects and tissue damage arising from the placement of them . These dressings according to their active principle can be classified into antimicrobial dressings, soothing dressings, or dressings with local anesthetics . One of the most common dressings reported in the literature is zinc oxide and eugenol, often mixed into a semisolid consistency [1, 5]. Local complications have been described after the placement of intra - alveolar dressings; some of them are neuritis, foreign body reactions [7, 8], and myospherulosis [9, 10]. This paper presents a case of a late complication related to a dry socket dressing that mimicked a trigeminal neuralgia during 3 years and caused a chronic osteomyelitis with foreign body reaction . A 45-year - old female was referred to the oral and maxillofacial department of zacamil's national hospital; the chief complaint was a right trigeminal neuralgia that could not be managed by conservative treatment . Four days after the extraction her dentist diagnosed a dry socket, which was treated with an intra - alveolar dressing consisting of zinc - oxide eugenol paste; this medication was placed directly into the alveolus without any other transport vehicle . The patient experienced relief of pain and never went back with her dentist so paste remained inside the alveolus (this information was obtained directly from the medical files of the dentist that treated the patient). She visited different dentists to find the cure to her pain, and during a period of two years third molar, second molar, first premolar, and second premolar of the right maxillary side were extracted . Hemifacial pain persisted, and the patient was referred to the neurologist who confused by the symptoms treated the patient as a trigeminal neuralgia . Carbamazepine was prescribed for about a year without pain relief; after this the neurologist sent the patient to our department . The chief complaint was an intermittent right hemifacial pain, which was described as an ache with periods of intense shooting pain . A visual analog scale was used to measure it during the intermittent periods finding a severe pain . Physical examination revealed no trigger zones and clinical absence of teeth 1, 2, 3, 4, and 5 . A right maxillary foreign body was found in the position of a nonhealed alveolar bone of the maxillary first molar; the image was in close proximity to maxillary sinus (figures 1 and 2). Due to the signs and symptoms of the patient, the foreign body was removed and curettage of the affected area was done; the findings during surgery were: a nonhealed alveolus, granulation tissue, free bone fragments, and a white solid foreign body that was in direct contact with maxillary sinus (figure 3). All tissues were sent to the pathologist who reported a well - vascularized fibrous connective tissue, chronic inflammatory infiltrate, multinucleated giant cells and necrotic bone surrounded by bacterial forms . The rest of the postoperative care was managed in a conventional manner without any further complications . Postoperative x - rays showed adequate healing and complete removal of the foreign body (figures 4 and 5). Visual analog scale was used during several months revealing no pain after foreign body was removed . Patient has been followed up for six months without any facial pain during this time . The number of secondary complications to the placement of dressings in the treatment of an established dry socket is ignored; most of the complications previously reported, myospherulosis, neuritis, and foreign body reaction, are related to intra - alveolar medication as a preventive methods and not as a treatment . Bright et al . Described myospherulosis related to tetracycline in a petrolatum base, used as a preventive measure to avoid dry socket . Now is known that petroleum - based carriers interfere with wound healing by action of lipids on extravasated erythrocytes, producing myospherulosis . Because of this, nowadays the usage of petroleum - based carriers has been discouraged . Zuniga and leist in 1995 reported a topical tetracycline induced neuritis six months after routine removal of an unerupted mandibular third molar . Moore and brekke in 1990 reported a foreign - body giant cell reaction related to placement of tetracycline - treated polylactic acid . Mainous in 1974 reported foreign body reaction after zinc oxide - eugenol packing in localized osteitis . Bloomer in 2000 did an investigation of the prevention of alveolar osteitis by immediate placement of medicated packing but they used the medication for one week only and then they removed it, so they did not report complications in a long - term evaluation . Oil of cloves is eugenol in its unrefined form, and it has been used for centuries as a toothache remedy . Chisholm described its mixture with zinc oxide in 1873 to form a plastic mass for therapeutic uses . This mixture of eugenol with zinc oxide relies on a setting reaction between them which produces zinc eugenolato . Eugenolato is not stable in the presence of water, and readily undergoes hydrolysis with the release of free eugenol . The type and extent of oral tissues reactions to eugenol vary but eugenol is generally cytotoxic at high concentrations and has an adverse effect on fibroblasts and osteoblast - like cells . This effect is dose related and will potentially affect all patients [5, 12]. Kozam noted that eugenol at certain concentrations can extinguish impulse transmission of a nerve within 3 hours . Also transient paresthesias have been reported after the use of eugenol as an endodontic medication [13, 14]. Other treatment using a packing has been reported for the effective relief of alveolar osteitis pain which includes using iodoform gauze (nu gauze, johnson & johnson wound management) coated with a mixture of three to five drops of obtundant, eugenol, with or without other ingredients, and packed into the anesthetized socket . This treatment should not be used if the patient is allergic to iodine . In our case, the intra - alveolar zinc - oxide eugenol medication, caused bone necrosis, foreign body reaction, delayed alveolar healing, and hemifacial pain that was confused with a trigeminal neuralgia . Symptoms of the patient confused dentists and neurologist, misleading them to the wrong diagnosis of a trigeminal neuralgia . This case reveals the need to do more long - term scientific investigations about the usage of intra - alveolar dressings as treatment for dry socket and not as prevention of it, in order to determine the safety of them and their potential side effects to our patients in long - term studies . It also reveals the importance of a thorough clinical and radiographic evaluation in patients with a suspected diagnosis of trigeminal neuralgia to discard local jaws affections that could confuse or mislead to a wrong diagnosis and treatment . Finally, providing patients with written postoperative instructions stating what was placed in the socket, how long it should stay in the socket, and when or if it should be removed, should not be overlooked by treating physician.
|
Few countries have traditionally regarded alcohol as a public health issue to the same extent as the nordic countries . As a result, the alcohol policies of particularly sweden, finland and norway have been very restrictive, the goal being to limit not only alcohol consumption among problem drinkers but also the overall level of drinking . The most important tools for keeping alcohol consumption (total volume consumed) at a low level have been extensive restrictions on physical availability and high alcohol prices . To make these tools efficient, sweden has also applied strict restrictions on the amount of alcohol that can be brought back privately from abroad, but these restrictions have been repealed since sweden joined the european union (eu) in 1995 (table 1). Table 1changes in swedish alcohol quotas from other eu countries since membership in the eutime periodspritsfortified winetable winestrong beer1 january 1995 - 1 l spirits or 3 l fortified wine5 l15 l1 july 2000 - 1 l3 l20 l24 l1 january 2001 - 1 l6 l26 l32 l1 january 2002 - 2 l6 l26 l32 l1 january 2003 - 5 l6 l52 l64 l1 january 2004- (eu - quota)free import for personal use (indicative level: 10 l)free import for personal use (indicative level: 20 l)free import for personal use (indicative level: 90 l)free import for personal use (indicative level: 110 l)source: commissions of the board 2000/44/eg, ministry of finance and the website of swedish customs (http://www.tullverket.se). Table was first published in leifman and gustafsson.quotas refer to the amount (in litres) that can be brought into sweden by travellers aged 20 years without any swedish alcohol tax being paid . Changes in swedish alcohol quotas from other eu countries since membership in the eu source: commissions of the board 2000/44/eg, ministry of finance and the website of swedish customs (http://www.tullverket.se). Quotas refer to the amount (in litres) that can be brought into sweden by travellers aged 20 years without any swedish alcohol tax being paid . With higher import quotas, raising alcohol taxes was no longer regarded as efficient owing to the risk of substitution effects, i.e. More alcohol would be purchased abroad instead . Furthermore, availability was increasing in practice, especially among residents in southern sweden who live close to low - tax countries like germany and denmark, from which most of the privately imported alcohol comes . Earlier studies have also shown that especially southern sweden has a high rate of private imports and that such imports account for almost half of all alcohol consumed in this part of sweden . Therefore, it was assumed that the amount of alcohol consumed in this region would increase when denmark, on 1 october 2003, decreased its tax on spirits by 45%which was equivalent to a 25% decrease in the price of the cheaper brands of spirits and when sweden shortly thereafter, on 1 january 2004, increased its alcohol import quotas to the levels required by the eu (i.e. Indicative levels of when import can be considered to be for one s own use). Thus, although the decrease in price did not actually take place in sweden, the already high market share for privately imported alcohol in southern sweden and the short distance to denmark suggested that the changes were equivalent to a price reduction in southern sweden . A recent study based on large repeated cross - sectional surveys was able to establish that travellers imports did increase substantially in southern sweden in 2004 . However, surveys measuring actual drinking did not find any increase in alcohol consumption or alcohol - related social problems . For instance, a comparison between 2003 and 2004 did not show any increase in volume of alcohol consumed in any region in sweden, neither in the repeated cross - sectional samples for the total population nor in the longitudinal data . A study using a longer follow - up period did not change this conclusion, and no change was found in southern sweden when data up until 2006 were analysed . In accordance with the results on consumption, alcohol - related social problems in southern sweden did not increase as expected . Thus, the results from population surveys did not verify that alcohol consumption increased following these changes in alcohol policy . As these unexpected results are based on survey data, with their limitations (i.e. In reaching heavy drinkers), further analyses on data less affected by such problems (i.e. Various forms of register data) are warranted . In the present study, the number of hospital admissions for acute alcohol poisonings and the number of police - reported violent assaults and drunk - driving incidents were used to assess the impact of lower taxes in denmark and higher swedish import quotas . Analyses from other nordic countries suggest that an analysis of this kind of register data can give new insights compared with studies based on survey data . In finland, the raised quotas for private alcohol import were shown to have a great effect on heavier drinkers, among whom there was a striking increase in alcohol - related deaths between 2003 and 2004 . Herttua, mkel and martikainen studied the effect of the reduction in price following the tax decrease in finland in 2004 and also found an increase in alcohol - related mortality (mainly for chronic causes and particularly for liver diseases) after the change . In a study using interrupted time - series analysis, koski et al . Found an increase in alcohol - positive sudden deaths related to the tax cut on alcohol . Other sources of information in finland have supported these findings as well, stating that substance abusers have been shown to be in poorer health after the changes and that intoxicated persons have been taken into custody more often . As for denmark, time - series analysis performed on violent assaults and hospitalizations for acute alcohol intoxication from january 2000 through december 2005 showed an increase in hospitalizations due to acute alcohol intoxication after the danish tax reduction in 2003 among individuals 15 years of age, but did not find such an increase in the total population or for violent assaults . For sweden, no study using register data has yet been carried out to examine the effects on alcohol - related harm of the changes in private import quotas or the reduction in the danish alcohol tax in 2003 . According to a study of the relatively modest increase in travellers allowances of wine and beer in 1995, no increases in alcohol - related mortality, traffic accidents or reported criminal violence were found . The aim of this article is thus to study whether the abolishment of alcohol import quotas in 2004 and the danish reduction in spirits tax 3 months earlier had any effect on alcohol - related harm in southern sweden, using register data on alcohol poisonings, drunk driving and assaults as indicators of alcohol - related harm (more details are presented in the methods section). As the hospitalization data on alcohol poisonings are available by age, we will also test the possibility of age - specific effects in order to replicate a similar study based on danish data . Our starting point is that the effect may be stronger in age groups, mainly middle - aged people, known to travel and import most of the alcohol . Furthermore, a recent analysis of the impact of the increasing allowances and tax reduction in finland suggested that the increase in alcohol - related mortality was basically seen in the age group 5069 years . The selection of alcohol poisoning, drunk driving and assault as indicators of increasing harm in the analysis was justified by the following arguments . Alcohol poisonings and drunk driving are by definition alcohol - related, and it is well established that a high proportion of perpetrators as well as victims of violent assaults are intoxicated . In addition, all three indicators have been found to have a positive association with sales at systembolaget [the swedish alcohol retail monopoly stores] as well as with estimates of travellers alcohol imports in southern sweden . Furthermore, data are available on a monthly basis, thus providing a sufficient number of data points for a meaningful time - series analysis as well as allowing us to come as close as possible in time to the specific changes . It was also considered important to have indicators that respond rapidly to an increase in drinking, thus ensuring that the problem of lagged effects will play a minor role . Alcohol poisonings were measured as hospitalizations in which alcohol poisoning was the main or secondary diagnosis . These data are recorded in the swedish hospital discharge records and cover all public in - patient care in sweden (for more information on this register, see http://www.sos.se/epc/english/pareng.htm). The validity of the data is considered to be high, and the quality is continuously being evaluated . The selection of icd codes (10th revision) that represent a case of alcohol poisoning was guided by the criteria set up by the swedish board of health and welfare and includes statistics on alcohol - related crimes were collected from the swedish national council for crime prevention (br). Police - reported assaults include deadly violence, attempted murder, assaults and rape including aggravated cases . Data on police - reported drunk driving offences do not include driving while under the influence of drugs . It should be noted that some of these crimes do not lead to a sentence; this share accounts for only a few percentage points each year . As noted in the descriptive figure for violence (figure 2), there was a peak in june to july 2001 in southern sweden that was caused by riots in gothenburg (southern sweden) in relation to an eu meeting at this time . The series was therefore corrected using the linear interpolation command in statistical package for social sciences, version 16.0, for these months . Monthly data covering the period january 2000 until december 2007 were analysed using interrupted time - series analysis, more specifically the technique developed by box and jenkins, often referred to as arima models, in this case arima impact analyses . Intervention components (dummy variables) were constructed to test whether there was any impact of the two interventions that could not be accounted for by normal fluctuations and long - term trends within the harm series . The first dummy took the value 0 before the tax change and 1 afterwards, and similarly the second dummy took the value 0 before the quota change and 1 afterwards . The final model controlled for changes in harm in northern sweden as well as for two earlier changes in private import quotas of alcohol on 1 january 2002 and 2003 (table 1) using dummies computed as for the other quota dummy in arima modelling, data need to be stationary, which was assessed using the dickey fuller test . Most series showed seasonal peaking (every 12th lag) with gradual attenuation, which indicates that the series requires seasonal differencing for stationarity . With a seasonal differencing of yt, defined as yt yt12, the relationship between the changes in the same month but during the following years are analysed rather than the relationship between the raw series yt and yt + 1, one month compared with the following month during the same year . Furthermore, the method requires that the noise term (including other etiological factors) be allowed to have a temporal structure . The structure of the noise term (n) was modelled and estimated in terms of the autoregressive parameters (ars) or moving average parameters (mas). The model and noise specification are specified by the expression (p, d, q) (p, d, q), the first parenthesis referring to the regular noise modelling and the second to the seasonality component . The order of the ars and mas is indicated by p and q, respectively, and the order of differencing is indicated by d. the corresponding symbols for the seasonal parameters are p, d and q. the residuals of the estimated model should be white noise, which means that there is no structure of autocorrelation in the noise term . Other factors, in addition to the danish tax cut and the increasing import quotas, are likely to affect both alcohol consumption and harm rates in southern sweden, i.e. General trends in purchasing power and travelling habits in sweden . There may also exist national trends in police enforcement and health policies that affected the selected harm indicators . Therefore, we used corresponding harm rates in northern sweden as controls in our analysis, the assumption being that the long distance to the danish and german borders would mean little effect of the reforms and that we would still capture the impact of other relevant factors . This idea was supported in separate analyses by site (without using a control site), where no effects of the interventions were found for northern sweden (results not shown). It should be noted, however, that the findings for southern sweden were little affected by the inclusion of northern sweden as a control in the analysis and that the main results remained without this control variable (analysis not reported here). The following specification was used in the final model: where ht symbolizes the harm indicator in the southern site at time t, i.e. By month . This means that the estimates of b1 b5 can be expressed as change in percentage by applying the formula: 100[exp(b) 1]. T is the dummy variable for the danish tax change in 2003, and q1q3 represents the swedish quota change in 2004 and the two previous quota changes in sweden in 2002 and 2003 . The graphs (figures 13) reveal an increase in alcohol poisonings as well as in the number of reported violent crimes in both northern and southern sweden, but no obvious increase in the number of drunk - driving cases for the period january 2000 until december 2007 . With respect to alcohol poisonings, the development during the pre - intervention period was similar in both regions, but between 2003 and 2006, the rates increased more in southern sweden than in the northern regions . In 2007, however, the rates were once again more similar . Figure 1descriptive figure over the trends in number of alcohol poisonings in southern and northern sweden . Figure covers the period january 2000 to december 2007 figure 2descriptive figure over the trends in number of reported violent assaults in southern and northern sweden (for south, this original series was corrected with linear interpolation). Figure covers the period january 2000 to december 2007 figure 3descriptive figure over the trends in number of reported drunk driving in southern and northern sweden . Figure covers the period january 2000 to december 2007 descriptive figure over the trends in number of alcohol poisonings in southern and northern sweden . Figure covers the period january 2000 to december 2007 descriptive figure over the trends in number of reported violent assaults in southern and northern sweden (for south, this original series was corrected with linear interpolation). Figure covers the period january 2000 to december 2007 descriptive figure over the trends in number of reported drunk driving in southern and northern sweden . Figure covers the period january 2000 to december 2007 to test whether the two interventions had any effect on these kinds of harm, a series of interrupted time - series analyses were performed . The findings from the final model controlling for harm in northern sweden and earlier quota changes are presented in table 2 . Table 2estimated effects of danish tax - cut in october 2003 and increased alcohol quotas in january 2004 on alcohol poisonings, violent crimes and drunk drivingoutputestimatesep - value95% cibox - youngp - valuealcohol poisoning(1,0,0) (1,1,0,12)6.150.91tax change 030.0310.0440.4800.0550.118quota change 040.100**0.0390.0090.0250.176violent crime(0,0,0) (1,1,0,12)14.290.28tax change 030.0370.0310.2370.0980.024quota change 040.0250.0260.3470.0270.076drunk driving(0,0,0) (0,1,1,12)10.800.55tax change 030.0090.0490.8560.1060.088quota change 040.0310.0490.5290.0650.126alcohol poisoning 1019 years(0,0,0) (0,1,1,12)7.920.79 tax change 030.0000.1450.9980.2850.284 quota change 040.1380.1440.3380.1440.421 2029 years(0,0,0)14.080.30 tax change 030.0760.1820.6750.4340.281 quota change 040.1210.1770.4930.2260.469 3049 years(0,0,1) (1,1,0,12)17.230.14 tax change 030.1060.0920.2490.0740.285 quota change 040.0500.0850.5560.1170.218 5069 years(0,0,0) (1,1,0,12)11.170.51 tax change 030.0130.0620.8390.1100.135 quota change 040.122 * 0.0580.0370.0080.236 70 years(1,0,0)13.450.34 tax change 030.2860.3550.4210.4110.982 quota change 040.0110.3490.9750.6720.694ci: confidence interval; se: standard error . Semi - logarithmic arima models estimated on monthly data january 2000 to december 2007 for southern sweden, controlling for changes in the harm rates in northern sweden and quota changes of 2002 and 2003.for alcohol poisonings, trends are also estimated by age. *p <0.05. **p <0.01 . Estimated effects of danish tax - cut in october 2003 and increased alcohol quotas in january 2004 on alcohol poisonings, violent crimes and drunk driving ci: confidence interval; se: standard error . Semi - logarithmic arima models estimated on monthly data january 2000 to december 2007 for southern sweden, controlling for changes in the harm rates in northern sweden and quota changes of 2002 and 2003 . For alcohol poisonings, the only effect revealed in all these arima models was the effect of the traveller s allowance change in 2004 on alcohol poisonings in southern sweden . After applying the conversion formula to the estimate of 0.10 in the final model, we note that the intervention effect of the increased import quotas was followed by a 10.5% increase in the number of hospitalizations due to alcohol poisoning . However, the tax decrease in denmark was not shown to have affected the different kinds of harm, and none of the interventions had any impact on violent crime or drunk driving . A further analysis showed that there was a strong correlation (rxy = 0.76) between the estimates of the quota change and the tax decrease in southern sweden, which produced uncertain results when both variables were estimated in the same model . Thus, we cannot rule out that the tax decrease, too, was part of the effect found for the increase in private import quotas of alcohol . An increase in alcohol poisonings due to the change in the traveller s allowance in 2004 was not observed among all age groups (table 2), but was in fact only observed among those aged 5069 years . The changes in quotas implied a 13% increase in alcohol poisonings in southern sweden in this group . All models were satisfactory with respect to the residual autocorrelation; thus the auto correlations were close to zero, indicating that the time series are random (white noise). It should be noted that the semi - logarithmic model specification applied here assumes multiplicative effects of the two policy changes . As this may not necessarily be the case, the analyses were also performed using linear models, which, however, did not change the outcome . The danish decrease in spirits tax in 2003 and the abolishment of swedish alcohol import quotas on alcohol in 2004 suggested that alcohol consumption and alcohol - related harm would increase, especially in the southern parts of sweden . This expectation has not been verified in previous studies using survey data, and the aim of the present study was to investigate the same issue by analysing various register data using an interrupted time - series approach . Hospitalization for acute alcohol poisoning and police - reported cases of drunk driving and violent assaults were used as indicators of alcohol - related harm . Overall, the results of the present analyses did not allow for any definite conclusion as to whether alcohol - related harm increased in southern sweden . On the one hand, an increase in acute alcohol poisonings was found after the increase in import quotas, particularly among those aged 5069 years, but on the other hand, no increase was found in violent assaults or in drunk driving . Thus, the findings with respect to assaults and drunk driving supported previous findings based on survey data and the conclusion that problems had not increased, whereas the increase in alcohol - related harm (alcohol poisonings) in southern sweden suggests that some problems may have worsened, at least among middle - aged people in southern sweden . One interpretation of the results is simply that some problems increased whereas some did not and that these harm indicators measure specific problems rather than alcohol - related harm in general . Thus, drunk driving and alcohol - related violence were not affected by the increase in travellers imports allowances, because these crimes are primarily committed by younger people who are less affected by lower import quotas . Only about 10 and 20% of the perpetrators of assault and drunk drivers are> 50 years of age, whereas the corresponding figure for those hospitalized for alcohol poisoning is 50% (according to data from the swedish council for crime prevention). Thus, the finding that the travellers imports of alcohol are most common among people> 50 years of age could explain some part of the difference, although further studies are needed to test this idea . It is also worth noting that there are some similarities with finnish experiences related to their abolishment of import quotas and reduction of alcohol taxes in 2004 . An analysis by herttua found no impact on assaults after the changes, but an increase in alcohol - related hospitalizations, which was largest in the age group 5069 years . Thus the increases in both countries can be linked to older heavy drinkers, who are known to be less well represented in surveys . Our findings also have some similarities with a study from denmark using the same time - series approach . This study examined changes in alcohol - related harm in denmark between 2003 and 2005 after changes in alcohol policies were introduced and found no increase in violent assaults . On the other hand, an increase in alcohol poisonings was revealed but only among those aged 15 years . Although the overall findings from these countries indicate an increase in harms, the results vary by subgroup, suggesting that the effects of this kind of increase in availability may be influenced by cultural differences and that findings for one country should not automatically be generalized to other countries . In this specific case, it is also important to consider that the danish and finnish changes were domestic, whereas in sweden a trip abroad was required to take advantage of the new possibilities to buy cheaper alcohol . Naturally, one major limitation of this kind of study, which uses a quasi - experimental design, is that the intervention and control groups have not been randomly selected . Thus, there may have been large systematic initial differences between southern and northern sweden, meaning that the latter was a poor control site . The higher level of drinking and harm in the southern site are two possible examples . However, in the present study, we had to identify a region affected to a lesser degree by the major interventions of interest: the danish tax decrease and the abolishment of import quotas . Although certainly not a perfect control area, the northern parts of sweden were the best choice available for fulfilling these criteria and, as previously mentioned, no effect on harm in northern sweden could be established in relation to these reforms . In conclusion, because previous survey analyses have not revealed any increase in alcohol - related problems in southern sweden, the present findings highlight the importance of using various data sources when studying policy changes and their potential impacts on alcohol - related harm . It also stresses the fact that various data sources are able to cover different segments of the population and that choosing one over the other may result in missing an existing effect . Additionally, the results presented here raise important questions about the association between changes in availability and alcohol - related harms in sweden today . Us national institute on alcohol abuse and alcoholism [r01 aa014879], as part of the study effects of major changes in alcohol availability . Conflict of interest: none declared . Key messageswhen denmark decreased their tax on spirits and sweden shortly thereafter abolished its private import quotas on alcohol to unlimited levels if it was for private consumption, it was assumed that people in the southern parts of sweden would increase their imports of alcohol . Because private imports already corresponded to 50% of the total alcohol consumption among swedes in the south, it was expected that per capita alcohol consumption in this region would increase, and thus also the alcohol - related harms.the present results in this study did not allow for any definite conclusion regarding whether alcohol - related harm increased in southern sweden . Using an interrupted time - series analysis, an increase in alcohol poisonings was found in relation to the repeal of the alcohol import quotas, but not in relation to the danish tax decrease . Similarly, no increase was found in violent assaults or drunk driving.it is concluded that the results raise important questions about the association between changes in availability and alcohol - related harms in sweden today . When denmark decreased their tax on spirits and sweden shortly thereafter abolished its private import quotas on alcohol to unlimited levels if it was for private consumption, it was assumed that people in the southern parts of sweden would increase their imports of alcohol . Because private imports already corresponded to 50% of the total alcohol consumption among swedes in the south, it was expected that per capita alcohol consumption in this region would increase, and thus also the alcohol - related harms.the present results in this study did not allow for any definite conclusion regarding whether alcohol - related harm increased in southern sweden . Using an interrupted time - series analysis, an increase in alcohol poisonings was found in relation to the repeal of the alcohol import quotas, but not in relation to the danish tax decrease . Similarly, no increase was found in violent assaults or drunk driving.it is concluded that the results raise important questions about the association between changes in availability and alcohol - related harms in sweden today . When denmark decreased their tax on spirits and sweden shortly thereafter abolished its private import quotas on alcohol to unlimited levels if it was for private consumption, it was assumed that people in the southern parts of sweden would increase their imports of alcohol . Because private imports already corresponded to 50% of the total alcohol consumption among swedes in the south, it was expected that per capita alcohol consumption in this region would increase, and thus also the alcohol - related harms . The present results in this study did not allow for any definite conclusion regarding whether alcohol - related harm increased in southern sweden . Using an interrupted time - series analysis, an increase in alcohol poisonings was found in relation to the repeal of the alcohol import quotas, but not in relation to the danish tax decrease . It is concluded that the results raise important questions about the association between changes in availability and alcohol - related harms in sweden today.
|
A total of 204 patients were diagnosed with subarachnoid hemorrhage caused by a ruptured intracranial aneurysm in a single medical center between november 2011 and october 2013 . Among these, 109 cases underwent clipping by the same neurosurgeon . The conventional supraorbital keyhole approach were allocated to group 1, and those who underwent the modified supraorbital approach were allocated to group 2 . We set the inclusion criteria for subarachnoid hemorrhage patients to select those with hunt and hess and fisher grades 2 or lower in order to create similar preoperative clinical conditions . The clinical results evaluated included total operative time, extent of intraoperative hemorrhage, early ambulation time, duration of hospital stay, and discharge glasgow outcome scale (gos) score . Total operative time was defined as the time from the start to end of general anesthesia . To assess the extent of intraoperative hemorrhage, we used the following values: estimated blood loss (ebl), pre and post - operative hematocrit (hct) change, and transfusion volume . In group 1 (supraorbital keyhole approach), the skin incision was started medial to the supraorbital notch and beyond the tail of the eyebrow . A small keyhole was made at the frontozygomatic suture, and an approximate 2 2-cm craniotomy was performed (fig . (modified supraorbital keyhole approach), with a conventional pterional skin incision and inter - fascial dissection, the superolateral orbital rim was exposed . A minimal dissection of the temporalis muscle was performed from the anterior aspect of the supratemporal ridge . An approximate 3 3-cm frontotemporal craniotomy was made, including a part of the superior orbital wall (fig . After the craniotomy was completed, the operative technique did not differ between the groups . If the brain was tight despite mannitol, cerebrospinal fluid was removed by intraoperative ventriculostomy at paine's point or a modified paine's point.12)14) arachnoid fissure dissection was generally performed laterally to medially, but occasionally medially to laterally . Whenever possible, veins of the sylvian fissure and sphenoparietal sinus were preserved to minimize venous congestion . We performed complete proximal artery control to enable a prompt response to intraoperative aneurysm rupture, and carefully dissected arterioles around the neck of the ruptured aneurysm . When there was atherosclerotic change of the neck of the aneurysm, we slightly adjusted the location of the clip . All analyses were performed using spss ver . 19.0 for windows (spss inc ., student's t - test or the chi - square test was used to identify differences between the groups a total of 204 patients were diagnosed with subarachnoid hemorrhage caused by a ruptured intracranial aneurysm in a single medical center between november 2011 and october 2013 . Among these, 109 cases underwent clipping by the same neurosurgeon . The conventional supraorbital keyhole approach were allocated to group 1, and those who underwent the modified supraorbital approach were allocated to group 2 . We set the inclusion criteria for subarachnoid hemorrhage patients to select those with hunt and hess and fisher grades 2 or lower in order to create similar preoperative clinical conditions . The clinical results evaluated included total operative time, extent of intraoperative hemorrhage, early ambulation time, duration of hospital stay, and discharge glasgow outcome scale (gos) score . Total operative time was defined as the time from the start to end of general anesthesia . To assess the extent of intraoperative hemorrhage, we used the following values: estimated blood loss (ebl), pre and post - operative hematocrit (hct) change, and transfusion volume . In group 1 (supraorbital keyhole approach), the skin incision was started medial to the supraorbital notch and beyond the tail of the eyebrow . A small keyhole was made at the frontozygomatic suture, and an approximate 2 2-cm craniotomy was performed (fig . (modified supraorbital keyhole approach), with a conventional pterional skin incision and inter - fascial dissection, the superolateral orbital rim was exposed . A minimal dissection of the temporalis muscle was performed from the anterior aspect of the supratemporal ridge . An approximate 3 3-cm frontotemporal craniotomy was made, including a part of the superior orbital wall (fig . After the craniotomy was completed, the operative technique did not differ between the groups . The dura was opened in semicircular fashion over the sylvian fissure . If the brain was tight despite mannitol, cerebrospinal fluid was removed by intraoperative ventriculostomy at paine's point or a modified paine's point.12)14) arachnoid fissure dissection was generally performed laterally to medially, but occasionally medially to laterally . Whenever possible, veins of the sylvian fissure and sphenoparietal sinus were preserved to minimize venous congestion . We performed complete proximal artery control to enable a prompt response to intraoperative aneurysm rupture, and carefully dissected arterioles around the neck of the ruptured aneurysm . When there was atherosclerotic change of the neck of the aneurysm, we slightly adjusted the location of the clip . All analyses were performed using spss ver . 19.0 for windows (spss inc ., chicago, il, usa). Student's t - test or the chi - square test was used to identify differences between the groups the mean age of the study subjects was 57.35, and there were 10 males and 10 females in each group . There were no statistically significant differences in sex and age between the two groups (table 1). The hunter hess grade (1.50 0.61 vs. 1.50 0.61, p = 0.780) and fisher grade (1.65 0.49 vs. 1.40 0.50, p = 0.119) also did not show statistically significant differences between the two groups . The mean operative time was 5.34 1.11 h in group 1, and 5.75 1.02 h in group 2 (p = 0.226). Ebl, hct change, and total amount of blood transfused showed statistically significant differences between groups (p <0.05). In particular, the values were lower in the supraorbital group than in the modified supraorbital approach (table 2). Ebl was 192.00 33.02 ml in group 1 and 632.50 86.26 ml in group 2 (p <0.05). Pre- and postoperative hct change was 4.15 1.73 in group 1 and 8.70 1.38 in group 2 (p <0.05). The total amount of blood transfused was 125.00 151.74 ml in group 1 and 500.00 114.71 ml in group 2 (p <0.05). Early ambulation time was 9.30 2.87 days in group 1 and 9.00 3.16 days in group 2 (p = 0.755), and total hospital stay was 18.20 7.05 days in group 1 and 17.65 5.45 days in group 2 (p = 0.784). No statistical differences were observed in admission glasgow coma scale (gcs) score (p = 0.752) and discharge gos (p = 0.427). In group 1, postoperative complications included death (due to acute respiratory distress syndrome caused by postoperative pneumonia in 1), symptomatic vasospasm (1 patient), and cerebral artery infarction (1 patient). In group 2, 2 patients had symptomatic vasospasm, and 1 had a frontal sinus opening . Patients of group 1 were satisfied with their appearance, and were happy to have avoided a head shave . However, 2 patients had postoperative frontal muscle weakness and numbness . Both groups had no complications for surgical wounds, including orbital swelling, depression of the operated site . The pterional approach for aneurysm clipping, which was first described by yasargil and fox,21) is a familiar surgical method that is widely used because of its primary advantage of better surgical view, clear anatomic exposure of most of the arteries (including the posterior communicating artery), and many other benefits . However, the pterional approach also has some disadvantages, such as possible muscle atrophy or pain after the exfoliation of the temporal region, and cosmetic dissatisfaction due to surgical scarring.7)15) hence, the need for a surgical method that provides the same clear anatomic exposure led many neurosurgeons to design various successful and minimally - invasive surgical approaches . In 1971, wilson and colleagues were able to operate on intracranial lesions through a minimal craniotomy site.19) studies revealed that these less invasive surgical methods resulted in less tissue damage and decreased cerebral edema compared with existing surgical methods . In 1978, brock used the method of frontotemporal craniotomy for anterior circulation aneurysm clipping, in which the resulting surgical wound was only 3 - 5 cm in diameter.3) in 1982, jane described the supraorbital craniotomy, which opened the anterior orbital roof, thus minimizing traction and exposure of the cranial structures, and decreasing complications that would have arisen with a different approach.10) paladino and colleagues introduced the concept of the keyhole approach, and opened a new chapter in the field of minimally - invasive neurosurgery; however, those authors were faced with the shortcomings of the technique, including the limitation of surgical view.13) in 1998, van lindert and colleagues introduced the supraorbital keyhole approach,18) while paladino announced the transciliary keyhole approach.13) many other studies described surgical methods with more advantages than those with the pterional approach, including less invasiveness, shorter operative time, and the ability to control the size of the craniotomy . However, these minimally - invasive surgical methods could not be applied to all patients . First, the supraorbital keyhole approach itself does not actually decrease the danger of the operation, which demands a skilled surgeon who can operate in a narrow space.20) in addition, the exposure of the frontal sinus in cases of supraorbital craniotomy performed on patients with a large sinus increases the possibility of an infection, causing surgical limitations . The average craniotomy size was 2 - 3.5 cm in width and 1.5 - 2 cm in height . They reported no frontal sinus exposure and emphasized the importance of measurement of the frontal sinus by imaging of the lesions prior to the operation.18) in our research, aneurysm clipping using the transciliary supraorbital keyhole approach led to frontal sinus exposure in 1 of 10 patients . This patient's frontal sinus was approximately 4.5 cm wide, measured from the center of the face . Moreover, surgeons must avoid damaging the supraorbital nerve during the transciliary supraorbital keyhole approach . In 2010, trivedi and colleagues carried out a study of the cranial supraorbital notch and supraorbital foramen in 249 patients.17) their results showed that the supraorbital notch was on average 24.30 mm from the center of the cranium, whereas the left side showed a mean distance of 23.73 mm and did not exceed 31.68 mm . Therefore, it was concluded that neurological damage might occur if the craniotomy is performed 4 cm away from the center of the cranium (considering the size of the frontal sinus) during the transciliary supraorbital keyhole approach . The supraorbital keyhole approach provided an unfamiliar view to the surgeon compared to the conventional pterional approach . The sylvian fissure presents in the lateral side of surgical window in the supraorbital keyhole approach . It is difficult to approach the sylvian fissure and the viewing angle along with the microscopic lighting is limited . Therefore, much more skill and thorough knowledge of the surgical anatomy is required for the keyhole approach . The narrow intraoperative viewing angle and limitation of microscope lighting could be overcome by the application of endoscopes to obtain details in close - up fields.5) we did not apply the use an endoscope in any of our cases . Although the size of bone flap was not different between the two groups, modified supraorbital keyhole approach the modified supraorbital keyhole approach allowed for a convenient to approach to the sylvian fissure and required less brain traction in dissection of the aneurysm (fig ., use of two suction tubes is challenging in surgery on a ruptured aneurysm due to the narrow view, and proximal control can be difficult . Some researchers advocated additional osteotomy because of the operational limitations of a prominent orbital rim limiting access to the skull base.1)8)11)16) in order to overcome this limitation of the supraorbital keyhole approach, this study modified the traditional approach and performed a posterior hairline incision, immediately removing a part of the superior orbital rim in the craniotomy . As the incision enlarged, the amount of intraoperative hemorrhage and the need for postoperative transfusion increased . However, there was no significant change in hospital stay and prognosis of patients due to the increased hemorrhage in our two subgroups . Better surgical view and space could be obtained, and conversion to expanded craniectomy could be performed in cases where intracranial pressure suddenly increased during the operation, with accompanying cerebral edema . In our study, the subjects were compared to patients with hunt and hess or fisher grade 2 or lower, with little brain damage, or low intracranial pressure (icp). However, there are more patients with high icp due to cerebral edema and hematoma in clinical practice settings, and there are many cases with increased icp for various reasons after surgery . Gresir and colleagues stressed the importance of deciding on and implementing primary or secondary decompressive craniectomy to the treatment and prognosis of a patient with subarachnoid hemorrhage with a serious increase in icp, regardless of the patient's pathological physiology (hemorrhage, infarction, or cerebral edema) and condition.9) as shown in the current study, when there is need of postoperative secondary craniectomy and an easy means of managing a sudden increase in icp while performing a posterior hairline incision, rapid surgical treatment can be performed through wound revision rather than through a new incision . The supraorbital keyhole approach has many merits but also drawbacks compared to the traditional approach . In order to overcome this, the modified supraorbital keyhole approach had more hemorrhage compared to the supraorbital keyhole approach, but there was no difference in clinical results . In addition, the modified supraorbital keyhole approach allows additional treatment to be more readily performed in cases where secondary decompressive craniectomy is needed because of increased icp.
|
Over the past two decades, the principles underlying nucleic acid structure and the polymeric characteristics of oligonucleotides have been exploited for creation of special ligand sequences that bind specific target molecules with high affinity and specificity [1, 2]. These special sequences or aptamers are discovered from combinatorial oligonucleotide libraries by iterative selection and amplification processes . The rationale for an iterative selection process is explained by the principles of systematic evolution of ligands by exponential enrichment (selex). Selex has allowed the discovery of aptamers for a plethora of molecular targets including small molecules and proteins . By virtue of their high affinity and specificity aptamers have emerged as a class of molecules that rival antibodies especially in diagnostic and biosensing applications . In particular, aptamers address several shortcomings of antibodies such as the ability to function in nonphysiological buffers and temperatures and the ability to identify reporter molecules such as fluorescein at precise locations . In this regard, aptamer - based optical sensors are extremely attractive and have been the object of extensive research [58]. Molecular beacon - inspired optical assays require functionalization of the 5- and/or 3-termini of an aptamer with a fluorophore and a quencher . In the presence of or upon binding to the target, conformational changes in the aptamer manifest themselves as changes in fluorescence . Single - or dual - labeled aptamers can be used to detect target binding by monitoring the target - induced fret or anisotropy changes . These methods provide real - time information on aptamer - ligand interactions compared to techniques such as autoradiography and electrophoresis . While the experimental design in such an approach may appear straight forward, it presupposes adequate knowledge of the structure and various conformations accessible to the aptamer in the presence and absence of target molecules . Labeling of aptamers with reporter molecules usually requires extensive optimization as small changes in the aptamer sequence and/or conformation may lead to unwanted changes in affinity and specificity [11, 12]. A general method that allows direct transduction of the recognition event into a change in optical spectra in particular, the association of dna - binding chromophores with nucleic acid aptamers could be affected in varying degrees by the formation of aptamer - analyte complexes . Previous approaches in this realm have generally been in a dye - displacement format where an rna or dna aptamer binds to a chromophore, resulting in a fluorescent complex [7, 14]. Presence of the target in solution results in the displacement of dye from the complex and reduction in fluorescence . While a number of chromophores have been tested in this format also, previous reports have primarily focused on only single chromophores for monitoring specific aptamer - target interactions without any comparison of different chromophores across a range of aptamers that significantly differ in secondary structures . In this work, we use a number of commercially available nucleic - acid - binding dyes for monitoring aptamer - target interactions [15, 16]. We monitor the formation of the fluorescent complex by nucleic acid and chromophore in the presence and absence of cognate target . Our study reveals that the chromophores sybr green and thiazole orange (to) can be used across rna and dna aptamers, albeit with different efficiencies in each specific case . We demonstrate the potential of rationally designed aptamer - chromophore pairs for sensitive and selective detection of a wide variety of targets . The structures of the aptamers employed for our current work have been previously published [17, 18]. Both the thrombin and atp dna aptamers are guanine - rich and fold into quadruplex helical structures, forming a pocket which allows for the binding of their target molecules, while the theophylline aptamer is an rna oligonucleotide that folds into a complex stem - loop structure . Five different dyes that are known for binding nucleic acids were utilized for our fluorescence studies . Stock solution of ethidium bromide was obtained from fisher bioreagents (fair lawn, nj), diluted with double deionized water to different standards to ascertain the optimum concentration needed for fluorescence studies . Hoechst dye 33258 was purchased from fischer scientific (pittsburgh, pa) and a 1 mm solution prepared in methanol . Yoyo-1 was purchased from invitrogen (eugene, or) and diluted to a 40 m solution in dmso . (san jose, ca), dissolved in dmso and a 1 mm solution prepared . Stock solution of sybr green was purchased from invitrogen (eugene, or) and diluted with dmso to obtain a 10x concentrated solution . Oligonucleotides were either purchased from integrated dna technologies (coralville, ia) or synthesized on an applied biosystems 392 dna / rna synthesizer using standard phosphoramidite chemistry, and reagents from glen research (sterling, va). Oligonucleotides were ammonia deprotected at 55c overnight and purified using low - melting gel electrophoresis or by using reverse - phase cartridges on oligonucleotides synthesized with the hydrophobic dimethoxytrityl (dmt) group . Absorbance values of purified sequences were obtained at 25c and ph 7.0 phosphate buffer and used to calculate the working concentrations of our dna / rna sequences . Atp was obtained from fisher bioreagents (fair lawn, nj) and thrombin was purchased from fischer scientific (pittsburgh, pa). 100 m solutions of these were prepared in sterile water except for human -thrombin which was prepared in a 50 mm sodium citrate/0.2 m nacl/0.1% peg-8000/ph 6.5 solution according to the vendor's instructions . Appropriate final concentrations of the target molecules were obtained by dilution of the above stock solutions . The current study explores the use of nucleic - acid - binding chromophores in a staining rather than a dye - displacement format . 100 nm atp and thrombin aptamers were prepared in 20 mm tris - cl buffer ph 7.5 with 300 mm nacl, 5 mm mgcl2, and 10 mm kcl whereas 100 nm theophylline aptamer was prepared in a 20 mm tris - cl buffer ph 7.5, 140 mm nacl, 5 mm kcl, and 5 mm mgcl2 with the addition of sterile water to make a 1 ml solution . These were annealed at 8590c for at least 5 minutes followed by gradual cooling to room temperature . The volume of addition in each case was designed not to exceed 10 l, thereby contributing to almost insignificant changes in total concentrations of aptamer and target . Aptamers were allowed to incubate with their target for 30 minutes in an incubator at 25c . Chromophore concentrations were found to be optimal at 250 nm (for probe and target concentrations of 100 nm each). Emission spectra were recorded at 25c on a shimadzu rf-5301 pc spectrophotometer by exciting dyes at their respective excitation wavelengths . The following excitation wavelengths were used: ethidium bromide, 340 nm; hoechst dye 33258, 320 nm; thiazole orange, 510 nm; sybr green, 497 nm; yoyo-1, 488 nm . Emission intensities at characteristic emission maxima for each chromophore were used for calculating the percentage decrease in fluorescence upon an aptamer - binding cognate target using the following formula: (1)%decrease in fluorescence = fofifo100, where fo is fluorescence of dye + aptamer, and fi is fluorescence of dye + aptamer - target . Experiments that are performed to measure fo and fi have the same amounts of dye, aptamer, and target . Based on the percentage decreases observed throughout this study, a drop in fluorescence of 10% is considered to be within the range of experimental error mainly due to variations in the amounts of dye added . Experiments were performed in triplicate and the errors shown are standard deviation from the mean . Briefly, the chromophores being used in this assay are almost nonfluorescent when free in solution but exhibit a strong increase in fluorescence quantum yield when bound to single or double - stranded dna . Structural perturbations in the nucleic acid aptamers upon binding cognate targets are expected to generate measurable changes in the fluorescence binding behavior of chromophores . The success of the signaling strategy thus not only depends on the degree to which aptamers undergo conformational changes upon target binding but also on the identity of the chromophore used that may or may not be sensitive to those changes . Structures of the chromophores used in the current work are shown in figure 2 . In order to explore the general applicability of the strategy shown in figure 1, we also chose to study a number of different aptamer - target pairs (shown in table 1) to account for differences in type of nucleic acid (rna or dna), binding affinities for targets (shown in table 1), type of secondary structures (hairpins, quadruplexes, or both), and binding motifs applicable to the chromophore (intercalation, minor groove binding). The behavior of yoyo as per the signaling strategy described above is shown in figure 3 . Binding of thrombin by tba leads to a significant drop in fluorescence emission of yoyo thereby indicating sensitivity of the dye to conformational changes in the aptamer . The specificity of tba and of our approach is evident from the lack of significant decrease in fluorescence of yoyo for the tba - lysozyme and atp aptamer - thrombin controls . In fact the fluorescence of yoyo in presence of atp aptamer is very similar in absence of target atp (data not shown). The larger absolute fluorescence observed is possibly due to the availability of larger number of binding sites in the atp aptamer compared to tba . The atp aptamer chosen for this work possesses an atat tract which is known to assist in hoechst 33258 binding . Notably, comparing the decrease in fluorescence across chromophores (see figure 4(a) and table s1 in supplementary material available online at doi:10.1155/2012/247280), the change in the hoechst 33258 fluorescence is the greatest . The percentage changes in figure 4 were calculated by comparing the fluorescence of each chromophore complexed to atp aptamer with and without the target . Experiments using a range of chromophore concentrations within an order of magnitude were found to yield very similar results . A small percentage change (10%) is possibly indicative of an aptamer - chromophore complex that is not significantly perturbed in presence of the target . While both the atp aptamer and the thrombin - binding aptamer (tba) possess quadruplex structural elements, the latter does not have a duplex tract . Comparing the decrease in fluorescence across chromophores, it is thus not surprising that the hoechst 33258 dye displays negligible change (see figure 4(c)). The intercalating dyes, thiazole orange (to) and sybr green, exhibit weak - to - moderate fluorescence decreases for tba in the presence of thrombin target . The relatively short sequence of tba and corresponding compact structure offer fewer sites for chromophore binding compared to the atp aptamer . As shown in figure 5, there is little variation in the fluorescence change of yoyo even when the chromophore concentration is varied over an order of magnitude . Interestingly ethidium bromide only exhibits poor fluorescence changes in the presence versus absence of thrombin, even though its binding mode is similar to that of yoyo and to . This is possibly an indication of the weaker binding affinity of ethidium bromide for nucleic acids compared to the other staining reagents . The substantial drop in fluorescence of yoyo (~60%) for tba in the presence of thrombin may be due to the g - quartet motif of tba providing a secure binding pocket for yoyo, which is then perturbed upon target (thrombin) binding . Finally, we tested the intercalating dyes, to, sybr green, and yoyo, on an rna theophylline aptamer (see figure 4(b)). Both sybr green and to display a significant decrease in fluorescence for the aptamer in presence of theophylline target the magnitude of fluorescence changes is greater for the theophylline aptamer (~68%) compared to atp and thrombin aptamer possibly due to higher binding affinity of the dyes for rna molecules and greater conformational changes in aptamer upon target binding . We tested the sensitivity of our approach by varying the amount of cognate target for each of the three aptamers . Not surprisingly the aptamer - dye pairs that provided the best fluorescence response were also the most sensitive towards target concentration . Notably, the thrombin aptamer in conjunction with yoyo was able to detect 0.1 nm of thrombin, albeit with only ~20% decrease in fluorescence of the chromophore (see figure 6). Similarly, 1 nm of theophylline and 2 nm of atp induced a measurable change in fluorescence intensity of to and hoechst 33258, respectively . These detection limits (~0.12 nm) are somewhat comparable with the use of chromophores that are covalently coupled to aptamer probes [9, 24]. Finally we tested our approach for selectivity of an aptamer towards its cognate target . In this regard, the theophylline aptamer has been shown to be selective for theophylline over caffeine notwithstanding structural similarity between the two molecules . As shown in figure 7, the theophylline aptamer in conjunction with to is insensitive to caffeine concentration with even a huge excess of caffeine failing to elicit a fluorescence change of less than 5% . Similarly, the atp aptamer in conjunction with hoechst 33258 when tested against the structurally analogous gtp target elicits substantially smaller fluorescence changes (~5%). Finally, the selectivity of tba is evident from the lack of change in fluorescence of yoyo in presence of lysozyme as compared to thrombin . These results demonstrate the selectivity of our approach using nucleic acid staining dyes for detecting aptamer - target interactions . From our study of both dna and rna aptamers using numerous commercially available staining agents some factors have been identified as being key to the success of exploiting the signaling strategy . First, the presence of distinctive binding sites for chromophores within the aptamers would likely help the signaling strategy . While this feature may be difficult to incorporate for intercalating chromophores, it is possible to develop aptamers that possess specific tracts for groove - binding dyes . Second, chromophores that exhibit stronger binding affinity for a specific nucleic acid aptamer are more likely to succeed at this signaling strategy . Relatively weaker binding chromophores would be less perturbed by aptamer - target interactions and would thus be less sensitive to analyte concentrations . Finally, the success of the strategy depends in large part on the affinity and specificity of the aptamer for its cognate target . The better performance of the thrombin- and theophylline - binding aptamers compared to the atp aptamer can be attributed to the higher binding affinity of those aptamers for their corresponding targets . More efficient formation of aptamer - target complexes (as a fraction of total amount of aptamer and target present) by the higher binding affinity aptamers would also allow for better signalling by chromophores . An aptamer - based method for detection of analytes has been developed which successfully avoids the more common chemical labeling and modification procedures . Covalent labeling of aptamers with reporter molecules including fluorophores usually lead to higher cost and unpredictable affinity of the aptamer for its target . The reported method is thus a simple economical alternative to selective and sensitive detection of analytes . We have performed a comprehensive analysis of numerous chromophores across several aptamer - target pairs unlike previous reports that focused on single candidates of each [2628]. One drawback of unlabeled nucleic acid aptamers for detecting physiological analytes is possible interference from residual nucleic acids from such samples.
|
With the rising incidence of differentiated thyroid cancer (dtc), particularly in younger women, dtc is the second most common cancer diagnosed around the time of pregnancy with a prevalence of 14 per 100,000 . Normal physiological changes occurring during pregnancy and concerns regarding fetal well - being pose distinct challenges to all aspects of dtc management . This paper reviews various facets of dtc management during pregnancy based on the published evidence and extensive clinical experience of the authors . Since dtc has a threefold higher incidence in women of reproductive age, an association between estrogen, human chorionic gonadotropin (hcg), and dtc has long been speculated . Several studies have suggested an association between the risk of dtc and high parity [3, 4], and there is also evidence that use of fertility agent, clomiphene, in parous women is associated with a higher risk of dtc . The data regarding an association between estrogen and dtc, however, are inconsistent, with some studies reporting a pro - proliferative effect of estrogen on thyroid cancer cell lines, while others showing a stimulatory effect of estrogen on normal and adenomatous thyroid only, but not on thyroid cancer . The clinical data are also conflicting; one study reported a higher risk of dtc in women exposed to estrogen - containing oral contraceptive and postmenopausal hormone replacement therapy, while another study reported no association between the use of exogenous estrogens and dtc . Similar discordance exists in data regarding the outcome of dtc diagnosed during pregnancy; for instance, one study suggests that dtc diagnosed during pregnancy is associated with poorer prognosis and is more likely to have positive er expression as compared to tumours diagnosed in nongravidic period, while another retrospective study comparing the outcome of dtc diagnosed in pregnant women with age - matched controls showed no significant difference in cancer recurrence or cancer - related death . Although rising hcg during pregnancy has a stimulatory effect on thyroid hormone production, there is no evidence to date linking hcg with dtc . In a large cohort of women treated with fertility drugs, the use of hcg was not associated with a higher risk of dtc . In summary, therefore, epidemiologic data suggest an association between high parity and risk of dtc; but there is lingering unclarity regarding the outcome of dtc that is diagnosed during pregnancy . One includes those women who are diagnosed de novo with dtc during pregnancy, while the other includes women with previous history of dtc who have either become pregnant or are planning pregnancy . Both groups present distinct therapeutic challenges requiring specific clinical approach based on disease stage, patient preference, and stage of pregnancy . For most women with newly diagnosed dtc or those with resectable macroscopic recurrence, a decision about whether or not to perform surgery during pregnancy has to be made . So far there has been no prospective study comparing the outcome of dtc in women undergoing surgery during pregnancy versus those where surgery was delayed until after delivery . A retrospective, cross - sectional study comparing 201 pregnant women undergoing thyroid and parathyroid surgery with age - matched nonpregnant controls reported that pregnant women had significantly longer hospital stay, higher hospital costs, and higher rates of general and endocrine complications . Another large survey of almost thirteen thousand pregnant women reported a significantly higher risk of spontaneous abortion in women who underwent surgery during gestation compared with those who did not have surgery . However, the risk of surgery during pregnancy must be balanced against patients' anxiety and perceived concern of tumour growth in case surgery is delayed for several months . This question was addressed through a retrospective study that compared outcomes of dtc in 61 pregnant women with 528 age - matched nonpregnant controls . Of pregnant women with dtc, one underwent surgery in the first trimester, twelve in the second, and one in the third trimester, while most of the patients underwent surgery after delivery . After a median followup of 22.4 years, no significant differences in recurrence were observed between women who underwent surgery during or after pregnancy . Currently there is no consensus about the optimum timing of surgery for dtc in pregnancy, and individualized decisions are generally based on patients' wishes and other risk factors, though most would agree that, in the absence of aggressive disease, it is reasonable to delay surgery until after delivery . On the other hand, if surgery is to be considered, for example, in case of large tumour, compressive symptoms, aggressive pathological or clinical features, rapid enlargement of tumor, or patients' concern, it should be performed in the second trimester before 24-week gestation primarily due to an increased risk of spontaneous abortion when surgery is performed in the first trimester . In our interdisciplinary clinic setting (attended by an endocrinologist, surgeon, and a radiation oncologist), we stratify individual patient - risk based on several factors such as cytological features (in case of newly identified dtc), pathological aggressiveness and previous tumor behavior (in case of recurrence), rapidity of growth, compressive symptoms, and ultrasound features while also taking into account patient's wishes and concerns and the obstetrician's opinion before reaching a consensus . In the absence of any high - risk features, we would normally prefer to delay surgery until after delivery but we closely monitor patients throughout pregnancy by performing neck ultrasound scans during each trimester . Radioiodine (i) administration during pregnancy is contraindicated due to the sequelae of exposing the embryo or fetus to high doses of radiation which include fetal hypothyroidism, attention deficit disorders, memory impairment, mental retardation, malformations, growth changes, induction of malignancies including leukemia, and lethal changes . I should not be given to nursing women due to the significant accumulation of i in the lactating breast and its excretion in breast milk . As most thyroid cancers are slow growing, delaying i therapy to allow breastfeeding for a short duration may be considered through discussions between the patient and the treating physician . Postpartum i therapy should be deferred for at least 68 weeks after lactating women have stopped breastfeeding . There is a paucity of reliable data on the kinetics of i excretion in breast milk . Therefore, after i therapy, it is recommended that breastfeeding should only be resumed with the birth of another child [17, 18]. In order to avoid stagnation of i in the lactating breast and minimize the risk of breast radiation exposure, suppression of lactation through dopaminergic agents has been utilized but this should only be used very cautiously after discussion with the patient . Although one large study suggested a possible increase in miscarriage rate if conception occurred within 6 months of i therapy, subsequent studies failed to confirm adverse outcomes for pregnancies or offspring related to previous i therapy . A conservative recommendation is that women receiving radioiodine therapy should avoid pregnancy for 612 months to prevent any increase in risk of infertility, miscarriage, or fetal malformation . Adequate thyroid hormone levels are crucial for maternal and fetal well - being, and several studies have reported that even mild hypothyroidism during pregnancy is associated with both adverse maternal and fetal outcomes . For instance, one study showed that children of women with undiagnosed hypothyroidism during pregnancy had lower iq score than their age - matched controls . In another study of women without overt thyroid dysfunction, the risk of miscarriage, fetal or neonatal death the data regarding low tsh in pregnancy is relatively reassuring, and, in a large survey of 25,765 women of which 433 had subclinical hyperthyroidism, low tsh was not associated with adverse outcomes . The two major challenges in assessing and replacing thyroid hormones during pregnancy are emulating various physiological changes occurring in the thyroid gland during pregnancy and limitations of the commonly utilized laboratory tests for testing thyroid function . A rising hcg in early pregnancy, due to its similarity to thyroid - stimulating hormone (tsh), promotes the release of thyroid hormones which consequently leads to a transient drop in serum tsh values . At the same time, an increasing estrogen level causes two- to threefold rise in thyroid - binding globulin which alters the measured levels of total thyroxine (t4) and triiodothyronine (t3) and to some extent free thyroid hormones as well, thus limiting the usefulness of thyroid hormone measurement . This is further complicated by the fact that there can be a wide interassay variability in measured thyroid hormones during pregnancy . Several other factors such as gestational age and singleton versus multiple - birth pregnancy can also alter thyroid hormone levels, in particular serum tsh values [27, 28]. A large survey of over thirteen thousand pregnant women reported a much tighter reference range for tsh especially in early pregnancy (2.5th and 95th percentiles of 0.1 miu / l and 2.5 miu / l, resp . ), as compared with general population . Based on these physiological variations, it is ideal to use gestational age - specific reference ranges expressed as multiples of the median, instead of reference values based on general population; however, most commercial assays do not quote pregnancy - specific reference values . Recently more elaborate techniques such as liquid chromatography - tandem mass spectrometry and equilibrium dialysis have been utilized to assess serum t4 in pregnancy [29, 30], but, apart from being much more expensive and time consuming, the correlation between free t4 measured through these techniques and serum tsh in pregnancy remains poor . Furthermore, the requirement for thyroid hormone replacement increases by as much as 2040% during pregnancy starting as early as the first few weeks of gestation [31, 32]. Due to its long half - life, t4 administration can take as much as 46 weeks before reaching a steady state in plasma . With these multiple factors, pursuing a narrow therapeutic tsh target during pregnancy one study looked at the effect of empirically increasing the dose of thyroxin replacement immediately upon confirmation of pregnancy and concluded that giving an extra two tablets of thyroxin each week significantly reduces the risk of maternal hypothyroidism during the first trimester and mimics the normal physiology . One caveat with this study was that patients who were athyreotic, those requiring a prepregnancy thyroxin dose of at least 100 g / d, and those with prepregnancy serum tsh concentrations below 1.5 miu / liter had the highest risk for developing tsh suppression and required subsequent dose modifications after the initial intervention . In our centre, whenever possible, we typically begin the management of these patients with proper prepregnancy counseling by informing our patients about the rationale for more frequent tsh testing and the need for dose adjustment . In addition, we make patients aware of the possibility of reduced thyroxin absorption with commonly used prepregnancy supplements such as iron and calcium and advise to take them separately from their thyroxin . Those who are already taking suppressive tsh therapy and are planning to get pregnant are typically advised to reduce the dose of thyroxin aiming for a tsh in the range of 0.52.5 miu / l . Upon confirmation of pregnancy, the dose is increased by an additional two tablets each week if tsh is 1.5 miu / l and by one tablet if tsh is <1.5 miu / l . Serum tsh levels are checked every 46 weeks and the dose adjusted to achieve and maintain tsh in the range of 0.52.5 most pregnant women with low - risk dtc require little more than routine tsh monitoring and periodic clinical examination during pregnancy . Radioactive iodine scan or stimulated thyroglobulin (tg) estimation through either thyroid hormone withdrawal or recombinant tsh (thyrogen) is not justifiable in pregnancy . Several studies have reported that although serum tg levels can vary significantly during each trimester, the overall values remain well within the normal nonpregnant range [3436]. In our centre pregnant women with low - risk dtc who were regarded free of disease prior to pregnancy, aside from their thyroxin dose adjustment, are followed on a three monthly (once in each trimester) basis with an unstimulated tg, and a thorough neck examination is conducted at each visit . Those women who have high - risk dtc or had documented recurrence of dtc prior to pregnancy are followed more rigorously on a three monthly basis with unstimulated tg and neck ultrasonography . Normal reference ranges for serum tg are irrelevant for followup of such patients, and decision regarding cancer progress is based on their prepregnancy tg levels as well as ultrasonography findings . Outside specialist centers, dtc patients have traditionally been managed by a variety of specialties which leads to an inconsistent and fragmented care, borne out by several studies from various centers [3739]. Patient surveys have also confirmed poor and inconsistent coordination of thyroid cancer care among different caregivers . Over the past decade, several centers of excellence have developed models of multidisciplinary teams comprising surgeons, radiologists, pathologists, endocrinologists, and allied specialists to deliver coordinated care within hospitals which ensures that each individual patient gets appropriate treatment decision made by a team of experts . In our centre, all dtc patients (including pregnant females) are assessed and followed by a team of specialists including a surgeon, an endocrinologist, a radiation oncologist, a dietitian, specialist nurses and, in case of pregnant women, the team works closely with an obstetrician and gynecologist . In our opinion, pregnant women with dtc should ideally be referred to a specialist centre but, in the absence of such facility, management decisions should be made through close cooperation of all caregivers and the patient.
|
She presented with a 5-day history of behavioral change, in the form of incomprehensive talking visual and auditory hallucinations, and short attention span . She had sleep disturbance, labile mood, and decreased appetite with loss of sphincter control . One month prior to this episode, she had one attack of unprovoked generalized tonic - clonic brief seizure . Her father had hypothyroidism that was, well controlled on treatment . On physical examination, she was agitated, hemodynamically stable, and afebrile . She had hallucinations and abnormal facial movements, but otherwise there was no neurological deficit . A full work - up including metabolic screening, toxicology screening, brain mri, cerebrospinal fluid (csf) analysis, and septic screening were all negative . Her thyroxine (t4) and thyroid stimulating hormone (tsh) were normal, but thyroid antibodies were elevated: thyroglobulin=383 (normal range <115 iu / ml), and thyroid peroxidase= 195 (normal range <34 iu / ml). The working diagnosis was hashimoto thyroiditis, and she was treated with intravenous immunoglobulin (400 mg / kg / day for 5 days). She showed a quick improvement in her condition, and returned to her baseline within 2 weeks . Electroencephalography showing diffuse slow background activity without epileptiform discharges . A 9-year - old boy presented with a history of behavioral changes associated with aggressiveness and excessive crying for one week . He then started to develop a series of seizures and status epilepticus . On examination, he was encephalopathic, with a glasgow coma scale of 9/15, hemodynamically stable, and afebrile . Results of brain mri were normal, and csf showed 24 cells / mm normal range <5, mainly mononuclear . The anti - nmdar antibodies were high in the csf (1:30; normal range<1:1) and serum (1:160; normal range<1:10). Other work - up including septic work - up, toxicology, and metabolic screening, he was considered to have anti - nmdar encephalitis, and treated with intravenous immunoglobulin, steroids, rituximab, and anti - epileptics . The outcome was good, and he returned to normal within 9 months of treatment . A 7-year - old girl was referred because of acute psycho - behavioral changes, 2 weeks after febrile illness . Her vital signs were within normal limits . A systemic examination including neurological examination was normal . She was diagnosed with lgi1 antibodies encephalitis and started on intravenous immunoglobulins and pulse methylprednisolone with a good outcome . She presented with a 5-day history of behavioral change, in the form of incomprehensive talking visual and auditory hallucinations, and short attention span . She had sleep disturbance, labile mood, and decreased appetite with loss of sphincter control . One month prior to this episode, she had one attack of unprovoked generalized tonic - clonic brief seizure . Her father had hypothyroidism that was, well controlled on treatment . On physical examination, she was agitated, hemodynamically stable, and afebrile . She had hallucinations and abnormal facial movements, but otherwise there was no neurological deficit . A full work - up including metabolic screening, toxicology screening, brain mri, cerebrospinal fluid (csf) analysis, and septic screening were all negative . Her thyroxine (t4) and thyroid stimulating hormone (tsh) were normal, but thyroid antibodies were elevated: thyroglobulin=383 (normal range <115 iu / ml), and thyroid peroxidase= 195 (normal range <34 iu / ml). The working diagnosis was hashimoto thyroiditis, and she was treated with intravenous immunoglobulin (400 mg / kg / day for 5 days). She showed a quick improvement in her condition, and returned to her baseline within 2 weeks . A 9-year - old boy presented with a history of behavioral changes associated with aggressiveness and excessive crying for one week . He then started to develop a series of seizures and status epilepticus . On examination, he was encephalopathic, with a glasgow coma scale of 9/15, hemodynamically stable, and afebrile . Results of brain mri were normal, and csf showed 24 cells / mm normal range <5, mainly mononuclear . The anti - nmdar antibodies were high in the csf (1:30; normal range<1:1) and serum (1:160; normal range<1:10). Other work - up including septic work - up, toxicology, and metabolic screening, he was considered to have anti - nmdar encephalitis, and treated with intravenous immunoglobulin, steroids, rituximab, and anti - epileptics . The outcome was good, and he returned to normal within 9 months of treatment . A 7-year - old girl was referred because of acute psycho - behavioral changes, 2 weeks after febrile illness . Peri - oral movements were also observed . There was no history of headache, vomiting or drug ingestion . Her vital signs were within normal limits . A systemic examination including neurological examination was normal . She was diagnosed with lgi1 antibodies encephalitis and started on intravenous immunoglobulins and pulse methylprednisolone with a good outcome . We describe 3 patients with immune - mediated encephalopathy / encephalitis who presented in the initial phase with predominant psychiatric symptoms . The presenting symptoms included mainly psycho - behavior changes, aggressivity and hallucinations . Immune - mediated encephalopathies / encephalitis are increasingly being recognized in children with antibodies, mainly to nmdar, but also to lgi1, caspr2 (previously attributed to voltage- gated potassium channel antibodies complex) or other cns antigens.5,7 most of the patients present with a combination of recurrent seizures / status epilepticus, decreased level of consciousness, and motor neurological deficits . A recent large cohort - based study of patients with immune - mediated encephalitis revealed that 4% of patients presented with isolated psychiatric episodes.8 support for this paradigm comes from another study involving 43 children with a first episode of acute psychosis . Antibodies to the dopamine d2 receptor were identified in 3 children, and to the nr1 subunit of the nmdar in 6 children, whereas no such antibodies were found in a group of 43 healthy control children.9 the mechanisms of psychiatric manifestations in antibodies mediated encephalitis are still not clear . The nmda - receptor blockade in vivo produces schizophrenia - like symptoms in healthy individuals . Ion channel disturbance and hyponatremia have also been described as features of schizophrenia, previously attributed to medication - induced or psychogenic polydipsia.8,9 the findings from this study have several practical implications . There is growing evidence that a proportion of psychosis / psychiatric manifestations in children may be immune - mediated, and psychiatrists should consider this etiology in each presentation of first - episode psychosis . If positive, these patients should be considered for treatment with immunotherapy . On the other hand, several antipsychotic drugs, such as haloperidol, must be used with caution in these conditions, as they have been observed to exacerbate motor symptoms in patients with anti - nmdar encephalitis . We therefore recommend that all patients with a new - onset psychosis, or neuropsychiatric manifestations including seizures, autonomic dysfunction, movement disorders, or rapid deterioration of the level of consciousness should be evaluated for a possible antibody - associated encephalitis . This assessment should include, as a minimum, a neurological examination and early testing for antibodies against the nmdar, lgi1, caspr2, ampa, gad, gabab antibodies, and thyroid antibodies . The eeg can be useful: and encephalopathic pattern or extreme delta brushes pattern should prompt early referral . Mri of the brain may be normal (although the finding of temporal lobe or limbic system signal changes is very suggestive of an immune - mediated encephalopathy). The aim of these recommendations is the early identification and improved treatment for patients with this disorder . In conclusion, autoimmune mechanisms have been recently implicated in a number of neuropsychiatric disorders, classically linked to a pure psychiatric disease . Delay in diagnosis and treatment with immunomodulatory drugs can lead to permanent sequelae . In cases of acute psychosis in children,
|
Study design: the study was performed from july 2011 to september 2011 at a commercial pig farm located in jitian village, shuangliu county, chengdu, sichuan province, china . There had been no mass outbreaks of disease and less antimicrobial use at the farm in the past year . A total of 26 finishing pigs were selected and divided into the following 2 groups: the experimental (ep) group and the control (cp) group . Each group of pigs was placed in different pens, and the 2 groups were managed by a single stockman . Landrace, duroc and yorkshire crossbred pigs (mixed males and females), 2 . Same ages (90 days old) with an average weight of 30 kg, 3 . Antimicrobial administration and sampling: pigs were fed a control diet for 2 weeks before sampling . Pigs in the ep group were orally fed ciprofloxacin (150 mg per pig) once per day at noon for 30 days . We performed the feeding procedure in 2 steps: 1) half the fodder (by weight) was taken out, and an antimicrobial solution was sprayed onto it by mixing; the mixture was then added into the corresponding feeder . 2) after the pigs ate all the mixture, the other half of the fodder without the antimicrobial was added in so that all the antimicrobials were eaten by pigs . No antimicrobials were used for the pigs in the cp group . The feeder would clean the floor of each pen after feeding the pigs . Fresh feces (> 5 g) were picked from 5 different locations in each pen and mixed immediately . Fecal samples were collected at noon on each sampling day within 1 hr post feeding . They were collected on days 0, 1, 2, 4, 6, 11, 16, 21, 26, 31, 36, 41, 46, 51, 56 and 61 . The fecal samples were placed into an ice box and transported to laboratory within 2 hr . Counting of drug - resistant e. coli and total e. coli in fecal samples: one gram of each fecal sample was suspended in 10 ml pbs buffer (0.05 m), and the supernatant was collected after the sample was mixed fully . The supernatant was serially diluted 10-fold by using pbs buffer (0.05 m), and then 0.1 ml of each dilution, including the original dilution, was spread onto 2 types of culture medium: emb agar (becton, dickinson and co., sparks, md, u.s.a .) Containing no ciprofloxacin and ciprofloxacin - plus emb (cip+emb) agar containing 4 g / ml ciprofloxacin . After 24 hr of incubation at 37c, the numbers of qrec and total e. coli in feces were calculated according to the countable isolates on agar plates, and 10 e. coli clones were randomly picked from emb agar for further analysis . Bacterial isolates and susceptibility testing: all the e. coli clones were identified by classical biochemical methods and confirmed with an api 20e system (biomrieux, france). The susceptibility to quinolones of the e. coli clones was tested by determining the minimal inhibitory concentration (mic, 0.0078125256 g / ml). The agar dilution method described by the clinical and laboratory standards institute (clsi) was used to test the mic of the antimicrobials, ciprofloxacin, nalidixic acid, norfloxacin and levofloxacin . E. coli clones were considered resistant or susceptible according to a standard introduced by the clsi . The reference e. coli strain atcc 25922 was used as an internal control in this study . Statistical analysis for the mics of e. coli clones in the ep and cp groups: after the mics of e. coli clones from both the ep and cp groups were determined, we used the t - test in spss (statistical product and service solutions) 13.0 software to analyze the salient differences in the mics of e. coli clones between different points of time in the ep group and between the ep and cp groups . The e. coli clones were from the fecal samples collected on day 0, 1, 4, 6, 11, 31, 41, 51 and 61 . Dna sequence analysis and genotypic comparison of e. coli clones: by using the boiling method, dna of e. coli clones was extracted and reserved at 80c until use . The quinolone resistance - determining region (qrdr) genes (gyra, parc) were found to have point mutations with primers described previously [13, 23]. Four plasmid - mediated quinolone resistance (pmqr) genes (qnrb, qnrs, aac (6)-ib - cr, and oqxab) were detected by pcr with the primers shown in table 1table 1.primers used in this studytarget geneprimerssequence (5-3)size (bp)annealing temperature (c)accession no.qnrbqnrb -fcgacctgagcggcactgaat51557.5dq351241qnrb -rtgagcaacgatgcctggtagqnrsqnrs -fcatacatatcggcaccacaac63756ef683584qnrs -rcaggataaacaacaatacccagtaac (6) ib - craac -fttgcgatgctctatgagtggcta48255ef465463aac -rctcgaatgcctggcgtgtttoqxaboqxab -fgatcagtcagtgggatagttt62755hq674771oqxab -rtactcggcgttaactgatta . All the reactions were carried out in a final volume of 25 l containing 2.5 l of 10ex taq buffer, 2 l of mgcl2 (25 mm), 2 l of dntp (2.5 mm), 0.25 l of takara ex taq (5 u/l), 0.5 l of each primer (25 m) and 1 l of dna samples . Homologous analysis of e. coli clones was performed through enterobacterial repetitive intergenic consensus (eric) pcr amplication as described previously . The quantity one 4.6.2 software was used to analyze genetic relationships among different isolates . Cluster analysis was performed using the unweighted pair - group method with average linkages . Monitoring of bacterial growth: the growth rates of e. coli clones from 3 stages (before ciprofloxacin administration, after ciprofloxacin administration and after ciprofloxacin withdrawal) were determined by the method described previously . For each of the 3 stages, 5 e. coli clones were selected to measure the optical density at 600 nm (od600) in luria - bertani (lb) medium . All the clones were initially cultured in lb medium at 37c for 16 hr, and then, the bacterial suspension was diluted to a determined density (10 cfu); finally, 0.1 ml of the diluted culture was transferred into 3 ml lb medium for measuring the od600 . The number of qrec and total e. coli isolates: fecal samples contained a certain amount (10 cfu per gram of feces) of qrec isolates before ciprofloxacin administration, and the amount of total e. coli isolates was 10 cfu per gram of feces . After ciprofloxacin administration, the number of qrec isolates increased from 10 cfu to 10 cfu, and on day 6, the amount was stable (10 cfu). The number of total e. coli isolates decreased obviously from 10 cfu to 10 cfu after ciprofloxacin administration, but returned to a stable level on day 6 (10 cfu). After withdrawal, the numbers of qrec isolates and total e. coli isolates gradually decreased, and on day 56, they finally decreased to the initial level seen before ciprofloxacin administration (fig . 1.the number of qrec and total e. coli strains in fecal samples collected from experimentally treated pigs at 16 time points . ). The number of qrec and total e. coli strains in fecal samples collected from experimentally treated pigs at 16 time points . Antimicrobial resistance testing and statistical analysis: a total of 240 e. coli clones (160 clones from the ep group and 80 clones from the cp group) were examined with the api 20e system . The results concerning the dynamics of the mics for the 240 e. coli clones are shown in fig . 2.the average mic of e. coli clones (n=10) from fecal samples at 16 time points in the experimental group of pigs and at 8 time points in the control group of pigs . After 3 days of ciprofloxacin administration, the mic for ciprofloxacin increased from 0.5 to 8 g / ml (16-fold); after 26 days of ciprofloxacin withdrawal, the mic decreased from 128 to 0.5 g / ml in the ep group . The mics for the 80 e. coli clones in the cp group maintained a stable value (<1 g / ml). According to the statistical analysis, the mics for the e. coli clones showed no significant difference between the ep and cp groups, in which the fecal samples were collected on days 0, 51 and 61 (p>0.05), but there were significant differences between the 2 groups in which the fecal samples were collected on days 1, 6, 11, 31 and 41 (p<0.05). In the ep group, after 3 days of ciprofloxacin administration, the mics for the e. coli clones showed significant differences compared with the e. coli clones from before ciprofloxacin administration (day 0). The average mic of e. coli clones (n=10) from fecal samples at 16 time points in the experimental group of pigs and at 8 time points in the control group of pigs . Detection of pmqr genes and mutations in qrdr genes: the pmqr genes (qnrb, qnrs, aac (6)-ib - cr and oqxab) were not detected in both the ep and cp groups . Only the position 83 mutation of gyra was detected in some of the e. coli clones in the cp group during the whole study . In the ep group, after ciprofloxacin administration, the position 83 and 87 mutations of gyra and the position 80 mutation of parc were detected in e. coli clones with an mic 8 g / ml . After 26 days of ciprofloxacin withdrawal, only the position 83 mutation of gyra was detected (table 2table 2.characteristics of e. coli isolates isolated from the fecal samples of pigs fed ciprofloxacin from days 1 to 30cip useday of fecescollectionmax mic (g / ml)gyraparccipnalnorlvxmut 83 (n)mut 87 (n)mut 80 (n)before ciprofloxacin administration016411s83l (4)...... after cip administration1165121616s83l (6)d87n (4)s80i (4)2165121616s83l (6)d87n (4)s80i (6)4165121632s83l (10)d87n (10)s80i (10)632>10243232s83l (10)d87n (10)s80i (10)1132>10243232s83l (10)d87n (4)s80i (6)16128>10243232s83l (10)d87n (4) d87y (6)s80i (10)21128>10243232s83l (10)d87n (10)s80i (10)26128>10243232s83l (10)d87n (10)s80i (10)after cip withdrawal31128>10243232s83l (10)d87n (10)s80i (10)3632>10243232s83l (10)d87n (2) d87y (8)s80i (10)4164>10241616s83l (10)d87n (10)s80i (10)46325121632s83l (10)d87n (10)s80i (10)5185121616s83l (10)d87n (4)s80i (4)560.56422s83l (10)...... 6116422s83l (10)...... cip: ciprofloxacin, nal: nalidixic acid, nor: norfloxacin, lvx: levofloxacin, mic: minimal inhibitory concentration, n: number of e. coli with a point mutation . ). Cip: ciprofloxacin, nal: nalidixic acid, nor: norfloxacin, lvx: levofloxacin, mic: minimal inhibitory concentration, n: number of e. coli with a point mutation . Homology of e. coli clones: cluster analysis of eric - pcr profiles of the e. coli clones from the 3 stages (before ciprofloxacin administration, after ciprofloxacin administration and after ciprofloxacin withdrawal) revealed a low level of similarity among the strains (6179%). Growth rates of e. coli clones: the e. coli clones we used to measure growth rates were quinolones susceptible e. coli (qsec) from feces before ciprofloxacin administration (day 0) and after ciprofloxacin withdrawal (day 61); and the e. coli clones after ciprofloxacin administration (day 26) were qrec clones . 3.growth profiles of e. coli clones (n=5) from before ciprofloxacin administration (bs - e . Growth profiles of e. coli clones (n=5) from before ciprofloxacin administration (bs - e . This study was specifically designed to analyze the time - effect relationship between ciprofloxacin administration and quinolones resistance in fecal e. coli of finishing pigs and to test the hypothesis that the emergence of resistance in pigs requires drug accumulation for 7 days or more . A certain amount of qrec isolates was present in the intestine of pigs before ciprofloxacin administration, suggesting that resistant isolates could colonize the swine intestine, which is consistent with previous research . The use of antimicrobials can influence the number of intestinal microbiota in swine immediately, but the influence becomes smaller as time goes on, as the swine intestinal ecosystem was previously shown to remain stable with or without antimicrobial pressure . The dynamic changes in the number of qrec and total e. coli isolates suggest this . We found that a low - level dose (5 mg / kg) of ciprofloxacin alone could alter the number of qrec isolates, but not the total number of e. coli isolates from feces of pigs . A recent study also showed that chlortetracycline alone at a low - level dose (50 g / ton) had little effect on the microbial population of swine feces . But, in another study that investigated the intestinal microbiota after feeding a performance - enhancing mixture of 3 antimicrobials (chlortetracycline 100 g / ton, sulfamethazine 100 g / ton and penicillin 50 g / ton) to pigs, an increase was found in the e. coli population . The correlation between emergence of ciprofloxacin - resistant bacteria and ciprofloxacin treatment in humans or swine has been well characterized in recent years [11, 22]. However, how medication time influences the emergence of resistance has not been revealed . According to the dynamics of the mic, we found that just 3 days were needed to develop quinolone resistance to fecal e. coli of pigs, which proves that our hypothesis that the emergence of resistance in pigs requires drug accumulation for 7 days or more is invalid . Removing antimicrobial pressure can reduce the number of resistant bacteria, but the seeds of resistance could colonize in the animal farm environment for a long time ., quinolones have been used as therapy or feed additives in animals for many years, which has resulted in high quinolone resistance in bacteria [6, 18, 33]. The mechanism of quinolone resistance is mainly mediated by the mutation of gyra and parc genes . In this study, when the max mic of qsec to cip was 1 g / ml or less, only the gyra mutation was detected; but, when the max mic was 16 g / ml or more, mutations of gyra and parc were both detected . These results suggest that mutations of the gyra gene could not mediate high - level quinolone resistance, but are necessary for high - level resistance, which is in agreement with previous reports [25, 29]. Low - level quinolone resistance can also be mediated by pmqr genes . However, we detected none of the described pmqr genes, suggesting that the emergency of qrec has little relation to the pmqr genes in this study . There was no similarity between e. coli clones that were separated from feces before ciprofloxacin administration, during ciprofloxacin administration and after ciprofloxacin withdrawal, illustrating that de novo selection of resistance mutants from the initial microbiota was not the cause of emergence of qrec . Moreover, no plasmid - mediated resistance genes were detected in qsec and qrec clones . Thus, the emergence of qrec may be caused by 2 possibilities: (1) enrichment of qrec in the initial gut microbiota and (2) exogenously acquired resistant bacteria . In both the ep and cp groups, we found a certain number of qrec isolates (10 cfu) in feces from pigs before ciprofloxacin administration . Therefore, we are inclined to believe that the more likely cause of qrec emergence was the enrichment of qrec in the initial gut microbiota ., we found that the qrec had a selective advantage from day 31 to day 56, suggesting that the antimicrobial pressure did not disappear immediately after ciprofloxacin withdrawal, which is in agreement with a previous report . Qrec with mutations in gyra and parc may have a fitness cost without antimicrobial pressure [1, 26]. However, our findings indicate that without antimicrobial pressure, qrec lost its selective advantage after 26 days of ciprofloxacin treatment first, fecal samples were picked from just 5 different locations in the pens, but there were 13 pigs in each pen . Second, qrec isolates, which were present in feces at a low concentration before ciprofloxacin administration, may have been missed when we selected only 10 clones for further research . This may have led to a lack of information about the relationship between e. coli resistance and antimicrobial residues . It has been shown that exogenous acquisition of resistant isolates is the cause for the emergence of qrec from an individual s feces . However, our results suggest that the enrichment of qrec in the initial gut microbiota is the more probable cause for the emergence of fecal qrec after feeding ciprofloxacin to pigs.
|
Sodium - ion batteries (nibs) are of great interest as a complementary technology to lithium - ion batteries in applications such as grid - storage, where cost and sustainability are of greater importance than high energy density . However, graphite, the anode of choice for lithium - ion batteries, shows almost no capacity for sodium, meaning that the identification of suitable alternative anode materials is a major technological challenge . Alloying anodes consisting of metals or metalloids that form alloys with sodium are of great interest due to their low operating voltage and high gravimetric capacities, reversible capacities of 480, 350, 500, and 580 mahg having been reported for pb, ge, sn and sb, respectively . The performance of antimony at high rates sets it apart from other alloying materials; micrometric antimony can retain a capacity of 580 mahg at a rate of c/6 and 520 mahg at a rate of 3/4 c, something that has not been reported for lead, germanium or tin elemental anodes in nibs . Despite the advantages of alloying anodes, there are still major issues that need to be addressed if these systems are going to be used in real applications . For example, the large volume expansions that take place on sodiation can lead to harmful mechanical processes and side - reactions that cause capacity fade with cycling . This can be somewhat mediated by careful electrode formulation or nanocompositing the material with carbon . More fundamental, however, is a lack of understanding of the phases that are formed within the battery and the transformation between them, which stems from the formation of highly reactive and often amorphous intermediate phases . Structural elucidation of these amorphous phases is challenging for conventional crystallographic methods, especially in complex systems where there is coexistence of amorphous and crystalline phases; the latter can overwhelm the analysis and obscure information about the relatively weakly scattering amorphous phases . Therefore, in order to obtain a full understanding of the electrochemical mechanism it is necessary to develop analyses that are able to extract the structure of these amorphous phases . In the case of antimony, numerous details of the (de)sodiation processes remain a mystery; the first sodiation is dominated by a single process at 500 mv, but subsequent (de)sodiations have strikingly different electrochemical profiles, suggesting that the structural transformations on the first and second sodiation are significantly different . This raises questions about the origin of this effect as well as what the structure of the electrode at the top of charge is, as this effectively becomes the active the intermediate phases that are formed during cycling are also unknown; x - ray diffraction (xrd) studies confirm that crystalline na3sb (c - na3sb) is formed at the end of both the first and second sodiation, but other than the formation of this crystalline phase, the electrode is amorphous for large sections of the first sodiation and all of the subsequent (de)sodiation processes, meaning xrd is unable to probe their structure . There is no clear evidence from xrd that nasb, the only other sodium antimonide in the known na sb phase diagram is formed at any stage in the (de)sodiation process . Probed thin film electrodes in the first sodiation and first desodiation using sb mossbauer spectroscopy and proposed that sb environments similar to those found in nasb are formed during both processes . However, the close similarity between the isomeric shifts of the nasb structure and those arising from a combination of sb and na3sb do not allow for an unequivocal conclusion about the nature of this intermediate phase . Given these complexities, it is clear that further structural elucidation is required in the intermediate regions of the (de)sodiation of antimony, with a focus on techniques that are able to isolate and characterize any amorphous or disordered intermediates and track their interconversion, especially in the presence of additional crystalline phases . Pair distribution function (pdf) analysis uses bragg scattering and diffuse scattering in parallel, meaning that while any long - range order that is present in the material is taken into account, it is also possible to characterize structures with deviations from long - range order, or phases that lack long - range order altogether . The method has recently found application in characterization of battery electrodes both ex situ and during operation . Operando measurements, where scattering data is collected during battery operation, have particular advantages over post - mortem analysis as they increase the consistency between data sets and circumvent issues of air contamination, which can complicate analysis; this is particularly relevant to the very air sensitive alloy samples considered here . In addition to these factors, operando measurements can capture the formation of metastable species that may form in the battery but may relax before post - mortem analysis is carried out . Visual examination of the pdf can give direct structural information, but additional quantitative information can be extracted by using atomistic modeling approaches, such as real - space rietveld, reverse monte carlo methods and empirical potential structure refinements . However, one of the challenges of modeling the pdf of battery systems is the separation of amorphous and crystalline phases when present simultaneously . To obtain unambiguous interpretation, it is necessary to add additional chemical information about the number and nature of phases . Furthermore, while x - ray pdf is highly sensitive to the components of the electrode that are strongly scattering in this case meaning that changes to the antimony connectivity during sodium insertion are very distinct, we present a pair distribution function and high - resolution na magic - angle spinning solid - state nuclear magnetic resonance spectroscopy (mas ssnmr) study of antimony anodes for sodium - ion batteries . We focus on using in - depth analysis of pdf data, constrained by chemical information from na ssnmr experiments referenced to synthesized model compounds of the two known sodium - antimonide compounds nasb and na3sb, in order to isolate amorphous and crystalline phases present in the electrode, and understand their transformations during the (de)sodiation process . Through this approach, we are able to propose structural origins for each of the distinct electrochemical signatures, and rationalize the different electrochemical profile observed on the second sodiation process . Stoichiometric ratios of sb powder (sigma - aldrich, 99.99%) and sodium metal (sigma - aldrich,> 99%) were ball milled using a hardened stainless steel ball - mill jar in a planetary ball mill pm 100 under ar atmosphere . An active - milling time of 60 min was sufficient to obtain a complete reaction of sb and na . The formation of nasb and na3sb was confirmed using xrd (see section 5, supporting information, figure s10). Antimony powder (200 mesh, 99.99%, sigma - aldrich) was ball milled under argon for 30 min using a spex 8000 m high - energy ball mill . Electrodes were formulated by forming an aqueous slurry using a 70:18:12 ratio of sb, carboxymethylcellulose (cmc) (ds = 0.7, mw = 250 000, sigma - aldrich), superp carbon (timcal). The slurry was ball - milled in a retsch pm100 plenary ball - mill for 1 h, before being cast on a glass slide using a 150 m doctor blade . The film was dried for 16 h in air, and dried at 110 c under a vacuum for 2 h. ex situ pdf samples were packed into 0.0485 in . Diameter kapton capillaries (cole - parmer), and sealed with epoxy in an argon atmosphere . Cells were assembled using na - metal (sigma,> 99%) as the counter electrode, 1 m napf6 (99.5 +, sigma) in pc (anhydrous, sigma - aldrich) as the electrolyte and a glass - fiber separator (whatman, gf / a) in an argon atmosphere glovebox . Cells were cycled galvanostatically at a rate of c/20 (based on mass of antimony) in the range of 2.5 to 0 v, where c/20 corresponds to the insertion of 3 na per sb in 20 h. x - ray total scattering data were collected using 45 min intervals, corresponding to the insertion of 0.1125 na, with an exposure time of 180 s. data were collected for the first sodiation, first desodiation, and second sodiation . The cycling rate and number of discharge x - ray scattering data were collected at 11-id - b at the advanced photon source, argonne national laboratory using an x - ray energy of 86.7 kev (= 0.1430) and an amorphous silicon area detector (perkinelmer) to obtain data to large momentum transfer values . Data were integrated using the program fit2d, standard corrections (background, compton scattering, detector effects) were applied, and the data fourier transformed (qmax = 18) to obtain g(r) using the software pdfgetx2 . Structural models were refined against pdf data using pdfgui, using previously published structures from the icsd database . For the refinement of any crystalline phases present within the electrode, starting values for the structural models were taken from the refinement of model compounds for sb and na3sb . If the r - factor (rw) for the refinement was unsatisfactory, an additional minor phase was added and the relative scale parameters were refined . When the minor phase was present in small quantities (when the scale factor was less than 10% of the scale factor of the phase when present as a single - phase electrode, i.e., at the start of sodiation for c - sb or the end of sodiation for c - na3sb) thermal parameters were fixed to values representative of those in regions where the phase was the major constituent of the electrode . A spherical particle envelope was used to model the particle size and/or length scale of ordering in areas where phases were present with limited correlations . Rw values from the final refinements are quoted to give an idea of the attainable fit and to allow the competing models to be compared . Rw for pdf refinements is generally higher than those typically found an xrd rietveld refinement, which reflects the fact that the functions being fit are different, with g(r) being more sensitive to the local atomic structure . Rw remains, however, useful as a measure of goodness - of - fit when comparing models fit to pdf data . To extract information about additional phases with limited correlation lengths, a refinement for the crystalline phases present was performed at high - r (2050) using the values for low - r peak sharpening fixed to values determined from refinements where each the crystalline phase was dominant . The refinement was extended to the full r - range (250) keeping all parameters fixed to examine the contribution of the crystalline phase to the whole pdf . The contribution of amorphous components was assessed from the residual (g(r)experiment g(r)model) of this refinement . From the onset of desodiation, the pdfs obtained have a small contribution from sodium metal, due to additional texture on the counter electrode that could not be accounted for during background subtraction . This was modeled as an additional phase with fixed unit cell parameters and thermal parameters . The contribution of this phase to the pdf as a function of sodiation (figure s15) was found to be small in all data sets compared to the contribution from naxsb phases . Additional amorphous phases were added to the refinements for the first sodiation process using a model that was refined against data from the second sodiation (at the end of the d2-c process), where the amorphous phase is assumed to be phase - pure . In these multiphase refinements, the sodiation level, defined here as the number of sodium atoms per antimony was calculated from structural data by considering the distribution of antimony between the phases present (as output from refinements in pdfgui) and the number of sodiums per antimony in each phase (e.g., 0 for c - sb, 3 for na3sb, 2.5 for a - na3xsb). For the electrochemical measurements, the number of na per sb was calculated from the current that was passed; 0.1125 na per sb were added between each data set at the current used . Details of the calculations for the sodiation level of naxsb phases are shown in the supporting information . Sb / c / cmc films (612 mg) were assembled in 2032 coin cells using a fiber - glass separator (whatman) and sodium metal (sigma - aldrich,> 99%) as the counter electrode . 1 m napf6 (sigma - aldrich,> 99.5%) in pc (sigma - aldrich, anhydrous) was used as the electrolyte . Cells were cycled at a rate of c/20 using an arbin instruments electrochemical cycler, to points of interest in the electrochemical curve . The batteries were dissembled inside an argon glovebox, and the active material washed with dimethylcarbonate (sigma - aldrich, anhydrous,> 99%) in order to remove excess electrolyte from the sample . Samples were dried under a vacuum, before being packed into kel - f inserts placed in 4 mm zirconia rotors and closed with kel - f caps inside an argon glovebox . Though the formation of decomposition products of naxsb phases (e.g., naoh) was minimized by the careful handling of materials in an argon atmosphere, it is possible that small quantities remain . Na solid - state nmr data were collected on a bruker aviii-700 spectrometer working at a na larmor frequency of 185.2 mhz . Rotors were spun at magic - angle spinning (mas) rates between 5 khz and 10 khz . Spectra were acquired using a pulse - acquire sequence, with a 90 pulse duration of 2.75 s and a recycle interval of 5 s. between 2000 and 10 000 transients were coadded for each spectrum, depending on the mass of the sample in the rotor, and level of sodiation . Spectra in the plots are normalized with respect to the sample weight and the number of scans used in the experiment . Na chemical shifts prior to the study of sb battery anodes, structural characterization was carried out for crystalline nasb and na3sb reference materials . Na3sb (space group 194, p63/mmc) is formed of hexagonal layers of alternating na and sb atoms with additional sodium ions residing between the layers (figure 1, top left). There are two sodium environments in a 1:2 ratio; sodium within the hexagonal layers sits in a trigonal environment, and sodium between the layers is in a tetrahedral environment . Nasb (space group 14, p21/c) is formed of interlinked helical chains of sb and na running parallel to the b - axis (figure 1, bottom left). (a) left: unit cell of na3sb (top) and 1 2 1 unit cells of nasb showing the helical chains of antimony (bottom). (b) middle: na nmr spectra of synthesized na3sb at 268 k (top), na3sb at 298 k (middle) and nasb (bottom), all recorded at 10 khz mas with an external field of 16.4 t. chemical shifts of major isotropic resonances are marked . * = spinning sidebands . (c) right: least - squared refinement of na3sb (top) and nasb (bottom) structures against ex situ pdf data . The difference between the experimental and model pdfs is shown by the black line, offset for clarity . A 7% sb impurity (by mass) na nmr spectra for the two model compounds are shown in figure 1 (middle). For na3sb, the spectrum recorded at 298 k shows a sharp feature with a poorly resolved shoulder . In a second spectrum recorded at 268 k, the observed features are resolved into a sharp resonance at 52 ppm together with a clearly defined quadrupolar line shape centered around 65 ppm . Fitting of the two resonances yields nmr parameters iso = 52 ppm, cq = 0 mhz, q = 0.15, (ascribed to the tetrahedral na1 site between the layers) and iso = 83 ppm, cq = 4.6 mhz, q = 0.06 (ascribed to the trigonal na2 site within the layers). The fit of simulated peaks to the experimental spectrum for na3sb is shown in figure s12 and table s5 . The large temperature dependence observed in the spectra (figure s13) indicates that there is significant exchange between the two sodium sites in the structure, occurring even at room temperature; simulations of the na nmr spectra allow the exchange frequency between sodium sites to be estimated as around 12 khz at room temperature . The na nmr spectrum of nasb exhibits two partially resolved features at 18 and 22 ppm . A multiple - quantum mas (mqmas) spectrum (figure s14) confirms that these correspond to two sites, consistent with the two crystallographic sites present in the nasb structure, both with very small quadrupolar parameters . The na nmr results demonstrate that the sb - connectivity has a clear effect on the na shift, something that has been observed in lithium - alloy electrodes . In the case of na sb, a change from sb sb chains (as in nasb) to units of isolated sb ions (as in na3sb) moves the resonances to higher chemical shift . The opposite trend is observed in lithium - alloys (li si, li ge, li sb), highlighting potential differences in the electronic structure of sodium phases . The shifts observed for these reference compounds will be used to help interpret the spectra for electrochemically sodiated naxsb phases . Real - space least - squared refinements using the na3sb and nasb structures reported by brauer et al . And cromer et al . Show a good match to the experimental pdf data for these compounds indicating that there is a good agreement of the local and long - range structure . Of note, is the large value of the u33 thermal displacement parameter obtained from the refinement for the na2 (table s4), the sodium - ions within the hexagonal layers of na3sb, corresponding to displacements in the c - direction, normal to the hexagonal layers of the material . This implies that there is some disorder in the height / position of the in plane sodium ions, which may come about through the significant site exchange observed by na nmr . In order to assess the contribution of sodium within the cmc binder and conductive carbon to the na nmr spectra for the battery samples, na nmr experiments for the pristine electrode and for sample of super p and cmc in the ratio 40:60 discharged to 0 v with the same effective current as the antimony samples were performed (figure s16). The cmc binder in the pristine electrode gives a broad resonance between 40 and 20 ppm . The spectra for the discharged super p carbon / cmc sample is dominated by this resonance and by resonances between 0 and 20 ppm from sodium contained in the solid - electrolyte interphase (sei), on the surface of the electrode, and that reacts with the conductive carbon additive, as well as from any residual electrolyte that was not removed by washing . The galvanostatic (constant current) electrochemical profile and the differential capacity (dq / dv) for antimony, shown in figure 2, are similar to those reported previously . The first sodiation process is dominated by a flat plateau at around 500 mv (s1-a) before a voltage drop to 0 v (s1-b), corresponding to the addition of slightly more than 3 na per sb . During desodiation, approximately 2.5 na per sb are removed from the electrode, corresponding to 82% of the theoretical capacity . The desodiation processes shows a significant voltage hysteresis and features three processes: a distinct plateau at 800 mv (d1-a) followed by a sloping process at 850950 mv (d1-b) and a sharp rise to 2 v (d1-c). Subsequent sodiations show three processes; a short plateau at 750650 mv (s2-a), a sloping process to 450 mv (s2-b) and at least one additional plateau at 450 mv (s2-c), before dropping to 0 v (s2-d). The relatively large sb - particle size means that no significant capacity from the reaction of surface antimony oxides, which is expected to occur primarily above 500 mv, is observed . Clean model system for studying only the antimony phase transformations, but is also highly relevant to nanostructured antimony (e.g., nanoparticles or sb / c composites) where similar electrochemical processes are observed beyond the first sodiation . Note that the chief difference between nanostructured antimony and bulk antimony in the first (de)sodiation cycle is the additional irreversible capacity, which can be attributed to increased sei formation on the higher surface area electrodes, and the increased quantities of surface antimony oxides . Electrochemical data for subsequent cycles for bulk antimony is similar and has been reported previously . Top: (de)sodiation curves obtained for antimony vs sodium metal cycled at a rate of c/20 in the voltage range of 2.5 to 0 v. the different electrochemical processes are labeled and these labels referred to subsequently in the text . The different electrochemical processes are marked with a notation that is used throughout the subsequent text . Ex situ na mas ssnmr provides insight into the sodium local environments as a function of (de)sodiation (figure 3, left). At a low sodiation level of 0.6 na per sb the na nmr spectra are dominated by resonances between 40 and 20 ppm from sodium within the binder, the conductive carbon and the sei as discussed in section 3.1 . On further sodiation (> 1 na per sb), an additional broad peak is observed in the na nmr, centered around 37 ppm . It is clear that this shift is different to those observed for both nasb and na3sb, and indicates that the sodium exists in environments where the antimony connectivity is intermediate between nasb and na3sb . During the second half of s1-a, the resonance at 37 ppm grows and shifts gradually on increasing sodiation to 42 ppm . Additional weak resonances between 50 and 80 ppm are observed, corresponding to the two sites of na3sb, clearly indicating the coexistence of multiple naxsb phases in this region . During s1-b, the additional phase is converted to c - na3sb; the 3742 ppm resonance becomes weaker and the c - na3sb resonances dominate the na nmr spectra . The peaks from c - na3sb show a similar broadening to the model na3sb compound indicating that similar na exchange processes are present within the electrode . The final nominal composition of the sample at the end of sodiation (eos) is na3.375sb, indicating that 0.375 na has been consumed in side reactions to form the sei . (a) ex situ na nmr spectra (normalized) of cycled sb electrodes at the states of charge . Spectra were recorded at 10 khz mas with an external field of 16.4 t. chemical shifts of major isotropic resonances are marked . The shaded region marks where resonances from sodium within the cmc binder, the sei and the conductive carbon are dominant . * mark spinning sidebands . Number (#) of sodiums per antimony is labeled next to each spectra, based on the calculations outlined in the supporting information, eos = end of sodiation, eod = end of desodiation . (b) discharge charge curves obtained for sb during the in situ pdf measurements . (c) selected pdfs obtained during the first discharge, first charge and second discharge cycles by fourier transforming the total scattering x - ray data . The colors of the curves correspond to the colors of the points on the electrochemical curve in (b) where the samples were extracted for nmr / pdf analyses . On desodiation, na nmr resonances from c - na3sb lose intensity during d1-a . The resonance at 37 ppm from a - na3xsb does not reappear, confirming that a different reaction pathway is taken on desodiation . Instead, a very broad resonance centered at 27 ppm appears, indicative of sodium being within a phase with a higher sb sb connectivity than na3sb, and ruling out the formation of nasb . At the end of desodiation, the only strong peaks in the na nmr spectra originate from sodium with the conductive carbon, the sei and the cmc binder . Approximately 1 sodium per antimony remains in the electrode at the end of desodiation (eod), at least some of which are likely present in the sei (approximately 0.375 na per sb based on the additional capacity observed on sodiation). However, based on the consistency of capacity measurements between electrode formulations and experimental setups in this study and previous studies (table s1), it is likely that at least some of the sodium remains within the connected naxsb phases of the electrode, but in concentrations too low to give rise to distinct resonances in the region dominated by sodium contained in the sei and the cmc binder . Certainly, the na nmr spectra indicate that very little c - na3sb remains in the electrode at the end of desodiation, indicating that significant loss of electrical contact does not take place during the d-1a / b processes, suggesting that if any sodium antimonide remains, it does so within the naxsb phases . During the second sodiation, both intermediate species and c - na3sb are reformed; the resonance at 27 ppm is the dominant naxsb phase at the end of s2-a, and grows in intensity during s2-b . During s2-c resonances at both 37 ppm and from c - na3sb appear, and at the end of the second sodiation, these results demonstrate that sodium environments consistent with c - nasb are not formed during (de)sodiation; instead two other naxsb intermediates species, characterized by broad na resonances at 37 ppm and 27 ppm are formed . In the following sections, the structure and interconversion of these phases is analyzed in the context of operando pdf measurements, constrained by the information from these na nmr spectra . Pdfs obtained as a function of sodiation are shown in figure 3 (right), alongside the electrochemical profile for the galvanostatic (constant current) measurement during the in situ pdf measurements (figure 3, middle). Least - squares refinement of the structure of crystalline hexagonal antimony (c - sb) against pdf data for the pristine electrode shows a good fit (figure s17, table s3). Sb bonds within the puckered hexagonal layers; a longer correlation at 3.3 is a signature of the weaker between - layer correlations . No attempt was made to add contributions from the cmc binder or conductive carbon to the refinement, because these are weak x - ray scatterers with limited correlations lengths, so are unlikely to contribute strongly to the pdf . No significant peaks are observed in the residual from the one - phase pdf refinement for the pristine material, confirming that the contribution of other electrode components is minimal . Early in s1-a, up to a sodiation level of 0.5 na per sb, the pdf shows relatively little change, confirming the utilization of sodium inserted in this region in the formation of light species in the sei or reaction with surface species and the conductive carbon to which the pdf is relatively insensitive . Upon further sodiation, the large observed changes to the pdf are an indication that the structure of the electrode undergoes drastic changes, as is expected for an alloying mechanism . The high - r peaks lose intensity as the long - range structure of crystalline sb is broken down but strong peaks remain at low - r indicating that some degree of local - order remains . While the amount of crystalline material present in the material decreases during s1-a, those present can be modeled well through a two - phase refinement using the c - sb and c - na3sb structure against pdf data in the distance range of 2050, i.e., the distance where the crystalline phases will dominate; good fits are obtained in this distance range for all data sets with no significant peaks remaining in the residual, indicating no further crystalline phases are formed, in agreement with previous studies . During s1-a, c - sb is the dominant crystalline phase present up to a na: sb ratio of approximately 1.7:1, albeit with a steady decrease in the scale factor for this phase (figure s18); no significant quantity of c - na3sb is present (table s7). The absence of sodium - containing crystalline phases results in a large discrepancy between the level of sodiation determined from electrochemical measurements and that calculated from the phase fractions of the crystalline phases present (figure 4, top) meaning additional amorphous phases must account for a significant amount of the sodium present in the electrode . (a) comparison of the sodiation calculated from electrochemical measurements and from the phase fractions determined from least - squares refinements of pdf data . Blue triangles show the sodiation calculated from a two - phase fit using c - sb and c - na3sb in the distance range (2050); green crosses show the sodiation calculated from a two - phase fit using c - sb and c - na3sb in the distance range (250); red circles show the sodiation calculated from a three - phase refinement using c - sb, c - na3sb and a - na3xsb . Bottom: real - space least - squares refinements against pdf data at an electrode stoichiometry of na2.36sb during the first sodiation . (b) a two phase refinement in the range 250 . (c) a constrained refinement where the values obtained during a refinement in the distance range 2050 were fixed for the refinement in the full distance range . (d) three phase refinement using c - sb, c - na3sb and a - na3xsb (x = 0.5). For all refinements, experimental data is shown in gray circles, the fit to the data in orange, and the residual in gray (raw) or black (r - averaged over termination ripples). Details of the calculations used to estimate error bars on the sodiation levels are shown in the supporting information . When two - phase refinements are extended to the full distance range (250), the fit is unsatisfactory (figure 4(b)); at low - r there is significant mismatch between the model and the pdf data, and the fit at high - r is worse compared to the refinements against high - r pdf data (table s6), providing further evidence for the presence of additional phases in the system . In order to extract the pdf for these amorphous phases, the structural parameters for refinements at high - r (2050) were fixed and used to constrain a full r - range (250) refinement against the pdf data . The residual (g(r)experiment g(r)model) from these constrained refinements were then extracted as a function of sodiation level and represent the pdf of the amorphous phase . The differential pdf for the amorphous phase was calculated by subtracting the residual for the pristine electrode from subsequent residuals . Peaks in this residual pdf correspond to the additional interactions within the amorphous phase(s) in the system when sodium is added to the electrode . Strong peaks are observed at 3.1 and 5.4, along with broader peaks out to 20, but no high - r peaks are seen (figure 5, figure 6a). The positions of the low - r peaks are close to the na sb and sb sb nearest correlations in c - na3sb (the pdf for both of these phases is shown in figure 6a), suggesting local environments similar to c - na3sb are formed during s1-a, but without the long - range correlations present in a crystalline material . This is consistent with large peak width of the na nmr spectra in this region, indicating a highly disordered structure in which the sodium is likely to have a range of coordination numbers and geometries . Pdfs for the a - na3xsb intermediate formed during s1-a as a function of sodiation . Phase fractions for the crystalline phases are obtained from a two phase (c - sb and c - na3sb) refinements against data at high - r (2050). These phase fractions were then fixed for refinements against data over the full r - range . The residual of these refinements represents the additional amorphous phases present in the electrode . The electrochemical profile of the first sodiation is shown below; the color of the curve corresponds to the point on the electrochemical curve designated by the dot of that color . (a) pdfs for the amorphous phases formed during (de)sodiation of antimony extracted from experimental data: a - na1.0sb extracted from the amorphous component of the pdf at the end of d1-b; a - na1.7sb extracted from the amorphous component of the pdf at the end of d1-a; a - na3xsb is the pdf extracted from the end of s2-c . Distinguishing distances for each of the phases are marked on the pdfs and calculated pdfs for c - sb and c - na3sb (scaled by 0.5) are shown for comparison . (b) an sb sb offset dumbbell arrangement giving rise to peaks in the same positions as the pdf for a - na1.7sb . (c) comparison the arrangement of sb in c - na3sb (left) and c - sb (right) looking down the c - axis; sodium is shown in orange, antimony is in blue . Light blue atoms lie in one plane, dark blue lie offset in another plane . A comparison between the sb and na3sb structure (figure 6c) shows that the puckered hexagonal arrangement of sb atoms is retained in na3sb, with the insertion of additional sodium both between the sb atoms within layers and between the layers, representing a kinetically facile pathway for sodiation . Therefore, we propose that the amorphous structure formed initially on sodiation is related to these other structures, with the sb - interlayer distances reduced compared to c - na3sb, probably due to vacancies between the layers . On the basis of the na nmr shift, we propose that this phase referred to herein as a - na3xsb is undersodiated compared to c - na3sb . Using data collected at a total electrode stoichiometry of na2.7sb where the pdf indicates that a - na3xsb is the major phase in the electrode (figure s19), we estimate the stoichiometry of a - na3xsb as x = 0.4 by subtracting the contribution of sodium in the c - na3sb and within the sei, estimated to be 0.78 and 0.375 na per sb, respectively, from the sodiation level calculated from the electrochemistry . Some deviation from this value is likely due to the difficulty in determining when in the electrochemical process the sodium consumed in side reactions (sei, carbon surface reactions, etc . ). However, further evidence of this under - sodiation comes from the second sodiation, where this amorphous a - na3xsb phase is reformed in isolation at the end of s2-c (see section 3.2.3), at an electrode stoichiometry of na2.5sb (calculated from electrochemical measurements), making x = 0.5 (figure s20 compares the pdfs of these phases). Alloy phases are known to accommodate some degree of over- or under - stoichiometry, there is likely to be some stoichiometric flexibility in this highly amorphous phase . Above a sodiation level of 2.9 na per sb no further crystalline sb is observed in the electrode; all the sb the crystallization of c - na3sb is observed; sharp high - r peaks corresponding to c - na3sb phase appear in the pdf, and at the end of discharge, pdf data can be modeled well by using the crystalline na3sb structure, reported by brauer and zintl (figure s21, table s4) in agreement with other studies that report this as the final sodiation product . No crystalline cubic na3sb was observed in contrast to a previous study that reported a minor amount of this high - pressure metastable phase alongside hexagonal na3sb prior to the full crystallization of hexagonal na3sb . The same large u33 values observed for the na2 site of the model compounds are also observed here . When linked with the na ssnmr, these results imply that na3sb has some degree of local disorder resulting in exchange of sodium between sites, which is not captured in the average structures of the previous reports . C - na3sb is broken down during d1-a, the high - r peaks disappearing while an additional interaction at 2.85 starts to appear . The additional interactions, again extracted from the residual of a constrained refinements against c - na3sb, are shown in figure 6(a) (middle) for the end of d1-a at an electrode stoichiometry of na1.875sb . It is immediately obvious that no antimony connectivity similar to a - na3xsb is present, confirming that a different reaction pathway is taken on desodiation . Instead, an additional phase is formed during d1-a, of approximate stoichiometry na1.7sb (full details of these calculations are shown in the supporting information). The structure is highly amorphous, with no peaks observed above 10, consistent with the broad peak observed in the na nmr for this phase, which indicates highly disordered sodium environments . There is a single, sharp, intense peak at 2.85, a signature of sb sb bonding, along with weak, broad peaks centered at 4.6, 6.6, and 9.3 . The weak x - ray scattering power of na in comparison to sb, makes the presence of significant nasb or nana correlations in the pdf unlikely and therefore all peaks observed in the pdf are likely to come from sb sb correlations . The sharpness of the first peak compared to the other peaks in the pdf indicate that the local sb units are well - defined, probably as sb sb dumbbells . Any more extended sb sb connectivity (e.g., chains) would results in additional sharp peaks in the pdf at higher - r that are not observed here . Dumbbells are known to be stable structural motifs in other alkali alloy phases such as li ge, li sn . Certainly, the pdf in this region rules out the formation of nasb that is postulated by baggetto et al . Because the weak peaks between 4 and 10 are not consistent with the structure (figure s22) and the na nmr spectra a structure containing nasb - like helical chains disordered in relation to one another is also ruled out as the peak positions do not match those observed experimentally (a calculated pdf is shown in figure s22). In contrast, a simple geometrical argument suggests that dumbbells, offset with respect to each other to form a parallelogram of sb - atoms (figure 6(b)) would give peak positions at the correct distances and approximately the correct intensities . It should be noted, however, that the structure has a very high degree of disorder beyond the well - defined first nearest - neighbor distance, and the atomic arrangement presented here is only a representation of the local structural motifs present; no order on the long - range exists . The pdfs during d1-a can be reproduced well using a linear combination of the pdfs of c - na3sb and a - na1.7sb (see supporting information, figure s25), and the extracted phase fractions indicate a two - phase reaction between c - na3sb and a - na1.7sb during d1-a . At the end of d1-a, the pdf is a mixture of a - na1.7sb and c - na3sb, where approximately 14% of the c - na3sb phase remains, based on the relative scale factor obtained by least - squares refinement against pdf data . During d1-b, the remaining c - na3sb is broken down and there is a growth in intensity and change to the positions of low - r peaks, indicating both a growth of the amount of amorphous phase, and structural rearrangements within the amorphous phase . Figure 6 (top) shows the pdf for the phase formed in this region, the na - content at this point corresponding to a stoichiometry of na1.0sb (for the calculations of the sodiation level of this phase, see supporting information). The peak at 2.9 remains, a signature of the prevalence of sb sb bonding, while the intensity of the 6.6 peak increases relative to that observed for a - na1.7sb and shows no change in position . Larger changes occur between these distances; the peak at 4.6 is no longer evident, but two new peaks at 3.7 and 4.3 can be deconvoluted from the pdf (figure s23). These additional strong peaks at low - r indicate that a more highly connected antimony network results from the removal of sodium . The pdf for this structure shows a striking resemblance to a pdf reported for amorphous explosive, who propose a structural model based on a three - connected random network of antimony, where all antimony are bonded to three other antimony atoms . A large range of dihedral angles result in the broadening of peaks beyond the first nearest neighbor and no long - range order to atom atom correlations . No peak is observed at 3.3, where the correlation between the puckered layers in c - sb is observed . This disordered antimony phase is believed to have heteroatoms terminating sb - fragments in the case of the sample of krebs, this is likely to be residual chloride . Within the electrode, residual sodium or organic components from the decomposition of the organic electrolyte are likely to remain . We postulate that the lower density resulting from the lack of layering in the material compared to c - sb could accommodate the residual sodium present at this composition . The residual sodium is likely to be highly disordered, broadening out the already weak contribution to the pdf, meaning that no clear na na or na peaks at high - r appear; these are modeled well by c - sb (figure s26, table s8) indicating that removal of further sodium from na1.0sb results in the crystallization of some areas of the electrode, consistent with previous xrd report by darwiche et al . The correlation length of this c - sb at the end of charge is limited to 20 nm . It is clear, however, that a significant amount of the a - na1.0sb remains in the electrode; a comparison of the scale factors for the c - sb at the end of d1-c and for the pristine electrode estimates that 40% of the sb is present as c - sb, 60% of the antimony is present as the a - na1.0sb network . The ratio of the first peaks in the pdf assumed to be as a result of each sb bonding to 3 other sb atoms for the amorphous component (extracted from the residual of pdf refinements carried out the r - range of 2050) and the crystalline component is 7:3, again estimating that 70% of the antimony remains as a - na1.0sb (figure s1). At the end of desodiation, approximately 0.64 na per sb have not been removed in addition to the 0.375 na per sb that have been assigned to sei formation during the first sodiation, either because of the loss of connection of areas of the electrode or because of sodium trapped in the electrode . We propose that loss of connection is unlikely, given the reproducibility of the effect in multiple electrodes and also in reports by other authors (table s1) and, because the na nmr results indicate that very little na3sb / a - na1.7sb remains in the electrode at full desodiation . Reason that the isomeric shift observed for antimony at the end of charge is shifted from crystalline antimony due to residual sodium present in the material . The increase to the c - lattice parameter of the desodiated c - sb phase compared to the pristine electrode (11.38(4) vs 11.27(1), table s3), seems too small for the c - sb to contain any significant amount of sodium . It is more likely that sodium is trapped in the sei and within the amorphous component of the electrode that remains in a stoichiometry of na1.0sb, the latter in turn preventing the crystallization of this part of the electrode . A total capacity of 544 mahg is observed in four distinct voltage processes indicating that several sequential sodiation reactions take place . Careful analysis of the pdf data allows the structural changes associated with each electrochemical signature to be isolated: the crystalline and amorphous electrode components were again separated by refining the crystalline structures using high - r (2050) data and the information from these refinements then used to constrain the refinements using the full data set and extract the amorphous component . The changes in the pdfs for the two components are shown in figure s8 . During s2-a, there is little change to the pdf at high - r (figure s8, right), indicating that crystalline sb does not take part in sodiation reactions at this voltage . However, the pdf for the amorphous component of the electrode shows considerable change at this voltage (figure s8, left); the peaks at distances between 2.85 and 9 lower in intensity signifying breakdown of the amorphous antimony network . The pdf of the amorphous component at the end of s2-a contains features that are similar to that of a - na1.7sb, formed during d1-a (figure s27 compares these two pdfs), consistent with na nmr spectra that show the reappearance of the broad resonance at 27 ppm, ascribed in the previous section to sodium within a - na1.7sb . Therefore, we propose that the s2-a process is characteristic of the breakup of the amorphous antimony network (a - na1.0sb) to reform a - na1.7sb . High - r peaks in the pdf disappear in this region as the nanocrystalline sb component of the electrode is broken down (figure s8, right) to form amorphous phases; the reaction does not result in any additional crystalline phases . The 2.85 sb sb correlation remains almost constant, but a defined shoulder develops on the high - r side of this peak 3.44, accompanied by the appearance of an additional peak at around 5.5 . Both peaks are characteristic of a - na3xsb indicating that this phase begins to form during s1-b . Linear combinations of the pdfs of a - na1.7sb (taken from the pdf for this phase extracted at the end of d1-a) and a - na3xsb (taken from the pdf at the end of s2-c), (figure 7), indicate that c - sb does not form the dumbbell phase na1.7sb: the scale factor for the na1.7sb remains constant during s2-b, while that for the a - na3xsb increases linearly . This would indicate that the c - sb reacts straight to form a na3sb - like phase, probably due to the structural similarity between the two phases discussed earlier . At the end of s2-b, the pdf can be modeled as a linear combination of the pdfs of a - na1.7sb and a - na3xsb with phase fractions of 0.53 and 0.47, respectively (figure 7). At this stage, a - na1.7sb is still the dominant phase in the na nmr spectra, and the weaker resonance from a - na3xsb at 37 ppm must be buried under that of the a - na1.7sb resonance . We note that the relative amounts of a - na3xsb are likely to be closely related to the exact amount of c - sb that is reformed at the height of charge and may explain why very little is produced in some samples, and subtle differences between in situ and ex situ samples may also result in differences to the phase fractions obtained in regions where metastable phases are dominant . Results of linear combination fitting of the pdfs extracted during processes s2-b and s2-c with pdfs for a - na1.7sb (obtained from d1-a) and a - na3xsb (from the end of d2-c). Top: example of the fit of the linear combination (orange line) with experimental data (gray circles). The difference between the experimental data and the fit is shown offset in gray . The contribution of a - na1.7sb (blue solid line) and a - na3xsb (green dashed line) is shown offset below . Bottom: variation of the scale factors for a - na1.7sb (blue circles) and a - na3xsb (orange squares) with sodiation level . The plateau at 450 mv, s2-c, is reminiscent of the s1-a process that dominates the first sodiation . 0.45 na per sb are inserted into the electrode and peaks are observed in the pdf to higher - r (20), indicating that a more ordered structure is formed . The 2.85 peak in the pdf disappears during this process, and the peak at 3.1 becomes the dominant low - r peak, signifying that sb sb bonds are broken during this region to form a - na3xsb . A single - phase a - na3xsb electrode, where x 0.5 based on the stoichiometry calculated from electrochemical measurements, is formed at the end of s2-c . A starting model based on c - na3sb structure was refined against the pdf data obtained at the end of s2-c, using very large thermal parameters to capture the disorder in the material and a spherical particle envelope to capture the limited correlation length in the material . Sodium occupancies were constrained to be 0.83, based on the sodiation level calculated from the electrochemical measurements . The refinement is shown in figure s28 and structural parameters are found in table s9 . The structure that is obtained from this refinement comprises of hexagonal layers of alternating na and sb, similar on a local scale to c - na3sb, but with more closely spaced layer evidenced by the decrease in c - lattice parameter from 9.49(1) to 9.19(1), presumably due to sodium vacancies between the layers . This is consistent with na nmr results that indicate a more sb - rich sodium environment in this phase compared to c - na3sb . Thermal parameters for both the antimony and sodium atoms in the interplanar direction are very large, which indicates significant turbostratic disorder of sodium within the structure; a large number of sodium environments are likely to exist within a - na3xsb, a result that is consistent with the broad peak observed in the na nmr spectra for this species . This approach captures most of the features in the pdf and allows us to propose that the local structure of the a - na3xsb is very similar to the c - na3sb structure, and the similarity of both c - na3sb and a - na3xsb to c - sb discussed above is likely to make this reaction pathway kinetically facile . The pdf results indicate that a - na3xsb exists in isolation at the end of s2-c, but despite several attempts to obtain an ex situ sample containing pure a - na3xsb, none were successful . The presence of small amounts of c - na3sb in all ex situ spectra where a - na3xsb is present is ascribed to the metastability of the a - na3xsb; once removed from the battery, some of the material may react to form c - na3sb and other reaction products appearing overlapped in the sei region . The exact proportion of the two phases is likely to depend on the exact sodiation at the point where the cell is stopped . During s2-d, the correlation length of the electrode increases as c - na3sb is formed from a - na3xsb . The structural parameters after refinement against pdf data are not significantly different from the end of the first sodiation (table s4). The na nmr spectra at the end of the second sodiation confirm c - na3sb as the final product . The model for a - na3xsb obtained from refinement against data at the end of s2-c was used to model the a - na3xsb formed during the first sodiation . Using the structural parameters for c - na3sb and c - sb obtained from two - phase least - squares refinements against the pdf data at high - r, refinements were performed using the full r - range (250), using a - na3xsb as an additional phase, refining only the scale factors for the three phases . This approach improves the fit to data in the intermediate region between 0.62.8 na per sb (figure 4, bottom); rw improve in all cases, but particularly in the intermediate region where the sodiation level is between 1.8 and 3 (table s6). The approach also improves the fit of the sodiation level expected from structural data with that obtained from the electrochemical measurements (figure 4, top). Some deviation is still observed at low sodiation levels, because of surface processes (reaction with the carbon) and sei formation that take place early on in the sodiation process and to which the pdf is not sensitive . Density - functional theory calculations were performed on structures generated by our species - swapping method (see section si.4 for details of the method). The only stable structures found on a zero temperature convex hull (figure s9) were nasb and na3sb having p21/c and p63/mmc symmetries, respectively . At low sodiation, only 0.009 ev / formula unit (f.u .) Above the hull tie - line is a nasb2c2/m phase . Sb bonds must be broken even at low na content, producing structures that are not simply na intercalated sb; thus c - sb is not easy to sodiate, consistent with the experimental results . A 6 formula unit per cell na3sb phase with p63 cm symmetry was found only 0.018 ev / f.u . Above the ground state this indicates that for the na3sb stoichiometry at room temperature the system will easily explore lower symmetry and larger repeat - length structures; i.e., there are many low - energy amorphous structures . The conversion of c - sb to c - na3sb is predicted to be at 0.57 v in good agreement with experiment . There are no other obvious thermally accessible phases in the species - swapped convex hull diagram, indicating that any additional phases are likely to be metastable phases, in agreement with the results of saubanre et al . The first sodiation of antimony is dominated by the breakdown of the crystalline antimony electrode . The overpotential required to breakdown the crystalline lattice results a single pseudo - plateau at approximately 500 mv . Both nmr and pdf data indicate that amorphous na3xsb is the major product during s1-a, though some c - na3sb is formed concurrently as a result of the overpotential . However, significant formation of c - na3sb only occurs once the majority of the crystalline antimony has been broken down into na3xsb, indicating there are kinetic difficulties associated with nucleating crystalline na3sb (c - na3sb) while sb si and li ge, where amorphous phases are formed during the breakage of dumbbell phases, and crystalline li15si4 and li15ge4 only form when the si si or ge dft calculations indicate that lower symmetry c - na3sb - like structures with more disordered sodium sites can easily be formed, indicating a propensity of this structure to disorder, and therefore to accommodate some under / over stoichiometry . We observe no evidence that environments similar to nasb are formed, in contrast to the results of baggetto et al . However, we do note that the overpotential on the first sodiation is likely to be highly dependent on the particle size and formulation (film thickness, additives, etc .) And therefore the mechanism for very thin films on the first sodiation may differ from what is presented here . Na nmr spectra for c - na3sb indicate high sodium mobility in this structure, and structural refinements against pdf data indicate some inherent disorder in the material . Potentiostatic intermittent titration technique (pitt) measurements reported previously indicate the sodium diffusion coefficient is high (34 times larger than the lithium diffusion coefficient in cubic li3sb) close to 0 v. on the basis of the nmr and pdf experiments reported here, we suggest that a different pathway is taken on desodiation . A 0.2 v difference between sodiation and desodiation curves determined from galvanostatic intermittent titration technique (gitt) experiments the formation of sb sb bonding immediately on desodiation is apparent from the peak at 2.85, which appears in the pdf during d1-a; no resonance corresponding to a - na3xsb is observed in the nmr, ruling out the reformation of a - na3xsb . Instead, the good fit of a linear combination of c - na3sb and a - na1.7sb to the pdfs collected during d1-a indicates that a two - phase reaction between c - na3sb and a - na1.7sb, the latter a highly amorphous phase containing sb - dumbbell units and no significant ordering of sodium, takes place . These results are in contrast to those reported by baggetto et al ., who proposed the reformation of the same intermediate formed on sodiation of thin films . We ascribe the different pathway taken on desodiation to poor kinetics in the electrode; variable temperature nmr experiments have indicated that the sodium mobility in c - na3sb is high, and therefore its removal on initial desodiation is should be facile . Presumably the limited antimony mobility prevents crystallization of the thermodynamically stable nasb phase, and sb - dimers, instead of more extended sb sb phase diagram, indicating that the pathway must occur via a kinetically - favored structural motif . The formation of dimers when the na: sb ratio is close to 2:1 is unsurprising since zintl counting rules predict that the antimony should be present with a formal charge of sb; this results in the same connectivity found in halogen molecules, i.e., x2, and dimers are to be expected . Future experiments to probe the effect of temperature on the phases formed are planned, but it is clear from both nmr and pdf results that in room - temperature batteries, the nasb phase is not formed on either sodiation or desodiation . As more sodium is removed, the antimony connectivity increases to form a network, similar to that reported for amorphous antimony . In areas where additional sodium can be removed the electrode forms crystalline antimony, but with a significantly reduced correlation length indicating it may be present as nanoparticles . It is not clear whether complete na removal (from the amorphous phase) is prevented due to difficulties in na transport through the amorphous phase, or whether the (kinetic) formation of the amorphous phase hinders further crystallization of the sb phase again due to the difficulty of breaking and reforming sb bonds . On the basis of pdf results, the different electrochemical profile observed on the second sodiation can be attributed to two key factors both intimately connected to the complex structure of the electrode formed on desodiation . First, the amorphous and crystalline phases sodiate at different voltages, something that is clearly observed in the pdf data . Antimony contained as amorphous a - na1.0sb reacts during s2-a to reform a - na1.7sb . Crystalline antimony does not react until lower voltages (s2-b) and, significantly, it appears that it reacts straight to the a - na3xsb phase without forming the na1.7sb phase, similar to the behavior observed on the first sodiation . Second, the correlation length / particle size and crystallinity of the c - sb that is present at the start of the second sodiation is reduced compared to the pristine starting material . As a result of this, the overpotential required to break down the crystalline lattice that is responsible for the single plateau observed in the first sodiation, is reduced or removed entirely on the second sodiation, and as a result of this additional plateaus (s2-b / c) can be resolved in the electrochemistry . On the basis of the structural studies outlined here, we can propose that several structural factors are responsible for the excellent cycling and rate performance of antimony, in addition to those factors discussed by previous authors i.e ., the good electrical conductivity and the low packing density of the antimony structure that promotes ion movement through the structure . First, we show that the two intermediates, a - na3xsb and a - na1.7sb are highly amorphous structures; this reduces the strain associated with multiple phase transitions . Second, pdf measurements show the formation of a complex electrode containing both amorphous and crystalline antimony networks at full desodiation . The different reaction voltages of these components lead to a more sequential reaction profile, where an inactive component can, to some extent, accommodate the strain resulting from reactions in other phases of the electrode, thus preventing harmful side processes that lead to capacity fade . Lastly, the high sodium mobility within the final c - na3sb structure is likely to contribute to the good rate performance of antimony by increasing sodium movement in and out of the phase leading to facile structural transformations . Finally, we note that examination of the second sodiation process is vital, not only for understanding the structure of the active electrode material - which in this case differs considerably from the single - phase pristine electrode and, therefore, the (de)sodiation mechanism of antimony in real systems, but also for understanding the complex processes going on in the electrode that can be masked by the presence of an overpotential in the first sodiation . Using in - depth analysis of the pdf data, constrained by structural and chemical information from known model naxsb phases and na ssnmr, we are able to demonstrate, for the first time, the separation of amorphous and crystalline phases formed in a sodium - ion battery and link structural information to all electrochemical signatures observed, allowing a comprehensive mechanism of (de)sodiation to be assembled (figure 8). Operando pdf analysis of sodium - ion batteries, when constrained by chemical information from na nmr spectroscopy, referenced to known model compounds nasb and na3sb, was used to separate the amorphous and crystalline structures formed in antimony anodes during (de)sodiation . This approach has led to the identification of previously unknown amorphous intermediate phases a - na3xsb and a - na1.7sb and tracking of their interconversion within a sodium - ion battery . We propose that a - na3xsb (0.4 <x <0.5) is locally similar to crystalline na3sb, with hexagonal layers of antimony interspersed with sodium, but with a reduced interlayer spacing resulting from significant numbers of na - vacancies between the sb - layers . The pdf for a - na1.7sb has a single sharp peak at 2.85 indicative of a sb - dumbbell motif present within the highly amorphous structure . Inclusion of amorphous phases into real - space least - squares refinements results in a better match of the sodium level calculated from structural refinements with that obtained from electrochemical measurements, far extending previously known mechanistic details . Pdf and nmr - derived mechanism of (de)sodiation of antimony from the first desodiation during galvanostatic cycling at a rate of c/20 . The structural origins of the different electrochemical profiles observed on the first and second sodiations are explored; (de)sodiation processes during the first cycle result in a change to the active electrode from crystalline antimony to a composite electrode containing both amorphous and crystalline antimony networks at full desodiation . The different reaction voltages of the amorphous and crystalline components of the electrode are responsible for the additional processes observed in subsequent cycles . Na nmr spectroscopy highlights the anomalously high sodium mobility within the na3sb final sodiation product, a likely contributing factor to the exceptional rate performance of antimony compared to other alloying anodes . We show that the sodiation of antimony is controlled to a large degree by the kinetics of the system . Dft calculations show no additional thermodynamically stable phases exist on the zero temperature convex hull . Formation of undersodiated na3sb (a - na3xsb) takes place due to difficulties in nucleating c - na3sb in regions where sb the absence of nasb in both sodiation and desodiation is also ascribed to the lack of mobility of sb within the naxsb phases, particularly after the initial sb sb bonds (in the dumbbells) have already formed, instead forming amorphous structure containing first sb - dumbbells and later extended, but disordered, networks of antimony . The electrode formed after desodiation is a composite of amorphous and crystalline antimony networks . We show that these connectivities react at distinct voltages via different sodiation pathways; the sequential manner of these transformations enhances the cyclability of the electrode by having an inactive component capable of buffering of strain associated with multiple phase transitions . We highlight the role that connectivity plays in determining the sodiation pathway in kinetically controlled systems; here, amorphous and crystalline antimony networks react through different intermediate phases that are structurally related to the starting connectivity . This result could have wider implications for understanding other kinetically limited alloying systems where the starting connectivity is likely to have a large effect on the pathway taken and the capacities observed . For example, germanium nanowire anodes for sodium - ion batteries show little capacity in their crystalline form, but high capacity and good rate performance when prelithiated and amorphised . Our results have additional implications for understanding high - rate nanostructured antimony anodes, because the electrochemical processes observed in bulk antimony are also observed in nanostructured systems beyond the first sodiation, indicating that the same antimony - based phase transitions take place . Study of bulk antimony as a model system helps to decouple the processes associated with surface oxide groups with those associated with naxsb phase transitions in such nanostructured electrodes.
|
The prevalence of childhood overweight and obesity gradually increases, even in preschool - age children . Globally, more than 20 million children who are below the age of 5 are overweight . The finding that overweight in preschool children is an indicator of five times more overweight in adolescence and four times more overweight in adulthood is compared with normal - weight counterparts . Since chronic conditions such as diabetes, cardiovascular disorders, hypertension, stroke, asthma, and certain neoplastic disorders may occur in late adulthood, prevention and early interventions for overweight or obesity are a real concern . Although the body mass index (bmi) is used as a marker of obesity, it may be a less sensitive indicator in early childhood . A few studies on preschool children showed a weak correlation between bmi and metabolic risk factors [19, 36]. Thus, it may be considered that bmi is an unreliable marker in this age group since central adiposity which is associated with metabolic risk factors is not adequately reflected by bmi . Therefore, early identification of children s central adiposity is important [40, 41]. The waist circumference (wc), one of the anthropometric techniques, is strongly correlated with metabolic risk factors and now becomes widely used . In addition, wc is an essential diagnostic criterion for metabolic syndrome according to the national cholesterol education program (ncep) adult treatment panel iii (atp iii) and the international diabetes federation (idf) [40, 41]. There are recent reports indicating that the onset of risk factors for metabolic syndrome under the age of 10 years can be considered . The ncep and idf criteria for metabolic syndrome may be modified to explain metabolic risks under the age of 10 years [14, 30, 45]. Thus, wc cutoffs and reference values in preschool children can be useful for identifying children with metabolic risk and might be helpful for early intervention . The preschool age is a difficult group for achievement and anthropometric measure while school - age children are easily accessible . Therefore, although many countries have their own reference values for wc [1, 1721, 27, 35, 39], a few studies cover preschool - age children [11, 12, 21, 37]. The aim of this study was to establish reference values of waist circumference in turkish preschool children . Furthermore, 50th and 90th percentiles of wc were compared with the ones in a few other countries [11, 37]. We analyzed the data of anthropometry of the turkish children aged 06 years (atca-06). The atca-06 study was conducted from september 2009 to may 2010 in one of the five great cities of turkey with about 1,200,000 residents . The sampling design of the study was a two - stage probability sampling for preschool children living in kayseri . The primary sampling unit was the family health centers (aile sagligi merkezi, asm) located in the city center and suburbs . At the first stage, children were selected from 21 asms in kayseri by stratifying according to the socio - economic levels of their parents . Children aged 06 years old were randomly selected among the list of district midwives and they were invited to asms with their parents . Those infants and children, whose parents did not accepted, were invited again to participate in the study by midwives . A total of 2,947 children (1,471 boys and 1,476 girls) whose parents gave consent were included in the study . After data collection, we removed 230 (119 boys and 110 girls, 7.9% of sample size) subjects from the study because of reasons such as missing data in the interviewing forms, children with growth disorders, or using any kind of medication which could interfere with growth . Then, to obtain normally distributed data, the higher and lower limits (3rd97th percentiles) for each gender and quarter age were removed (n = 115). Chronological age was calculated by subtracting the date of birth from the date of observation . Each quarter year elapsed from their birthday was noted . The who group recommended that early growth patterns should be documented in intervals shorter than 3 months [10, 13]. So, we calculated by age and gender in 06-year - old children in quarter - year intervals except for the 028-day newborn period . Parents written consent was obtained prior to the study and the procedures were in accordance with those outlined by the declaration of helsinki . Waist circumference was measured with a non - stretchable tape at the midpoint of the lowest rib cage and the iliac crest, to the nearest 0.1 cm, at the end of a gentle expiration . Construction of the centile curves was performed with the lms chart maker pro version 2.3 software program (the institute of child health, london), which fits smooth centile curves to reference data . This method summarizes percentiles at each age based on the power of age - specific box the final curves of percentiles are produced by three smooth curves representing l (lambda, skewness), m (mu, median), and s (sigma, coefficient of variation) (lms). Descriptive statistics for each quarter year (e.g., 38 m, etc .) Within sex were calculated by spss version 15.0 (chicago, il, usa). We analyzed the data of anthropometry of the turkish children aged 06 years (atca-06). The atca-06 study was conducted from september 2009 to may 2010 in one of the five great cities of turkey with about 1,200,000 residents . The sampling design of the study was a two - stage probability sampling for preschool children living in kayseri . The primary sampling unit was the family health centers (aile sagligi merkezi, asm) located in the city center and suburbs . At the first stage, children were selected from 21 asms in kayseri by stratifying according to the socio - economic levels of their parents . Children aged 06 years old were randomly selected among the list of district midwives and they were invited to asms with their parents . Those infants and children, whose parents did not accepted, were invited again to participate in the study by midwives . A total of 2,947 children (1,471 boys and 1,476 girls) whose parents gave consent were included in the study . After data collection, we removed 230 (119 boys and 110 girls, 7.9% of sample size) subjects from the study because of reasons such as missing data in the interviewing forms, children with growth disorders, or using any kind of medication which could interfere with growth . Then, to obtain normally distributed data, the higher and lower limits (3rd97th percentiles) for each gender and quarter age were removed (n = 115). Chronological age was calculated by subtracting the date of birth from the date of observation . Each quarter year elapsed from their birthday was noted . The who group recommended that early growth patterns should be documented in intervals shorter than 3 months [10, 13]. So, we calculated by age and gender in 06-year - old children in quarter - year intervals except for the 028-day newborn period . Parents written consent was obtained prior to the study and the procedures were in accordance with those outlined by the declaration of helsinki . Waist circumference was measured with a non - stretchable tape at the midpoint of the lowest rib cage and the iliac crest, to the nearest 0.1 cm, at the end of a gentle expiration . Construction of the centile curves was performed with the lms chart maker pro version 2.3 software program (the institute of child health, london), which fits smooth centile curves to reference data . This method summarizes percentiles at each age based on the power of age - specific box the final curves of percentiles are produced by three smooth curves representing l (lambda, skewness), m (mu, median), and s (sigma, coefficient of variation) (lms). Descriptive statistics for each quarter year (e.g., 38 m, etc .) Within sex were calculated by spss version 15.0 (chicago, il, usa). There were 1,471 (50%) boy and 1,476 (50%) girl infants . The descriptive statistics for waist circumference for boys and girls by age are given in table 1 . In tables 2 and 3, the selected waist circumference percentiles including 3rd, 10th 25th, 50th, 75th, 90th, and 97th percentiles are shown for each age and gender . The lms parameters for waist circumference are shown in table 4 . The mean and 1, 2, 3 standard deviations added and subtracted wc for each age group and gender are shown in tables 5 and 6.table 1descriptive statistics for waist circumference for boys and girls by ageageboysgirlsnmedian (min max)nmedian (min max)028 days10831.00 (28.0034.00)10831.00 (26.0040.00)28 days3 months4938.00 (30.5044.80)4437.50 (31.5045.00)3<6 m7041.00 (33.0048.00)6340.00 (34.5049.50)6<9 m7842.00 (35.0553.05)6441.13 (32.0049.00)9<12 m7144.00 (35.1052.00)7542.50 (34.6051.25)12<15 m5843.63 (39.5051.00)5643.50 (38.5050.00)15<18 m5744.00 (40.3050.50)6144.00 (39.0050.00)18<21 m5444.00 (39.5051.00)7343.80 (39.0050.00)21<24 m5745.00 (39.5051.00)6645.00 (38.1050.00)24<27 m3646.40 (41.0052.00)5246.00 (41.0053.00)27<30 m5648.00 (41.5054.00)4847.00 (41.0052.00)30<33 m5748.00 (41.0054.00)4846.70 (41.0051.00)33<36 m5648.00 (41.0054.00)4449.00 (43.0053.30)36<39 m5048.75 (45.0055.50)5149.00 (43.0057.00)39<42 m3750.00 (45.0056.75)5348.50 (43.0057.00)4245 m4150.00 (45.0055.20)4048.00 (42.5058.00)45<48 m5149.50 (45.5056.40)4450.75 (42.5058.00)48<51 m3850.90 (45.0057.00)4450.00 (45.0058.00)51<54 m4151.00 (45.0062.00)4551.00 (45.0061.30)54<57 m4651.70 (46.0060.60)6052.00 (45.0059.00)57<60 m4452.00 (48.0061.00)3851.50 (45.8061.50)60<63 m5452.75 (46.0062.00)2250.65 (45.0061.40)63<66 m4752.00 (46.0063.00)4652.75 (46.0061.00)66<69 m4652.00 (47.0068.00)5752.00 (45.062.00)69<72 m4752.00 (46.0066.00)5552.00 (45.0061.00)72<75 m4254.00 (48.0064.00)4151.60 (47.0064.60)75<78 m3051.75 (47.0060.00)3551.50 (47.0062.00)78<81 m3053.50 (47.0066.00)2453.00 (48.0066.00)81<84 m2055.00 (47.1066.00)1953.00 (47.0066.00)table 2smoothed age - specific waist circumference percentile values for boysage3p5p10p25p50p75p90p95p97p028 days26.627.328.229.731.232.533.634.334.728 days3 months32.232.833.835.437.239.040.541.442.03<634.935.536.538.240.042.043.744.845.56<936.537.138.139.841.743.745.546.747.49<1237.738.339.240.942.844.946.848.048.712<1538.639.240.241.843.745.847.748.949.715<1839.440.040.942.644.546.648.549.850.618<2140.140.741.643.345.247.349.350.551.421<2440.841.442.343.945.948.050.051.352.224<2741.442.042.944.646.548.650.752.052.927<3042.042.643.545.247.149.351.452.753.630<3342.643.244.145.747.749.952.053.454.433<3643.143.744.646.248.250.452.654.155.136<3943.644.245.146.748.751.053.254.755.739<4244.144.645.647.249.251.553.855.356.4424544.545.146.047.649.752.054.455.957.045<4844.945.546.448.050.152.554.956.557.648<5145.345.846.848.450.552.955.457.158.251<5445.646.247.148.850.953.355.957.658.854<5746.046.547.549.151.353.756.358.159.357<6046.346.947.849.551.654.156.858.659.960<6346.647.248.149.851.954.557.259.160.463<6646.947.448.450.152.354.857.659.560.966<6947.247.748.650.452.555.258.060.061.469<7247.448.048.950.652.855.558.460.461.9727547.748.249.250.953.155.858.760.862.3757847.948.549.451.153.456.159.161.262.8788148.148.749.651.453.656.459.461.663.2818448.448.949.951.653.956.659.762.063.7table 3smoothed age - specific waist circumference percentile values for girlsage3p5p10p25p50p75p90p95p97p028 days27.027.628.429.831.433.234.936.036.728 days3 months32.032.633.535.036.838.740.641.742.53<634.535.136.037.639.541.543.344.545.26<936.136.737.639.341.143.145.046.146.99<1237.337.938.840.442.344.346.247.348.112<1538.238.839.741.443.345.347.248.349.115<1839.039.640.542.244.146.148.049.250.018<2139.740.341.242.944.846.948.850.050.821<2440.340.941.943.545.547.649.650.851.624<2740.941.542.544.246.148.350.351.552.427<3041.542.143.144.746.748.951.052.353.230<3342.042.643.645.347.349.551.653.053.933<3642.543.144.145.847.850.152.253.654.636<3942.943.544.546.248.350.652.854.355.239<4243.343.944.946.748.851.153.454.955.9424543.744.345.347.149.251.653.955.556.545<4844.144.745.747.449.652.054.456.057.148<5144.445.046.047.850.052.454.956.557.651<5444.745.346.348.150.352.855.457.058.254<5745.045.646.648.450.753.255.857.558.757<6045.345.946.948.751.053.656.258.059.260<6345.546.247.249.051.353.956.658.459.763<6645.846.447.449.351.654.257.058.860.166<6946.046.747.749.551.954.557.359.260.669<7246.346.947.949.852.154.857.759.661.0727546.547.148.150.052.455.158.060.061.4757846.747.348.350.252.655.458.460.461.8788146.947.548.650.452.855.758.760.862.2818447.147.748.850.653.155.959.061.162.6table 4the power of a box cox transformation (l), the median (m), and the coefficient of variation (s) for waist circumference for both gendersageboysgirlslmslms028 days3.03031.1850.0670.19231.4490.08128 days3 months1.36037.2060.0700.14736.8130.0753<60.61140.0420.0700.09839.4880.0726<90.20141.6910.0700.07841.1340.0699<120.06142.8350.0680.09942.3200.06812<150.25843.7310.0670.14343.2660.06715<180.42444.5030.0660.20744.0790.06618<210.57845.2100.0660.28844.8140.06621<240.72945.8790.0650.38345.4980.06624<270.88146.5170.0650.48946.1410.06627<301.03447.1230.0650.60046.7420.06630<331.18847.6950.0640.71547.3060.06633<361.34248.2360.0640.83347.8330.06636<391.49348.7470.0640.94948.3240.06739<421.64249.2290.0651.06548.7830.06742451.78749.6840.0651.17849.2120.06845<481.92750.1140.0651.28949.6140.06848<512.06250.5190.0651.39649.9910.06951<542.19250.9030.0661.50050.3460.06954<572.31851.2660.0661.60050.6800.07057<602.43851.6110.0661.69750.9960.07060<632.55351.9380.0671.79051.2950.07063<662.66452.2500.0671.88051.5800.07166<692.77052.5480.0671.96751.8520.07169<722.87152.8330.0672.05152.1120.07272752.96853.1070.0682.13152.3620.07275783.06253.3710.0682.20952.6020.07278813.15253.6250.0682.28452.8340.07381843.23953.8700.0692.35653.0570.073table 5the mean and 1, 2, and 3 standard deviations added and subtracted wc for boysage3 sd2 sd1 sdmean+1 sd+2 sd+3 sd028 days36.627.129.030.932.834.736.628 days3 months47.531.534.737.941.144.347.53<6 m49.834.837.840.843.846.849.86<9 m51.435.438.641.845.048.251.49<12 m53.736.740.143.546.950.353.712<15 m52.638.141.043.946.849.752.615<18 m52.539.041.744.447.149.852.518<21 m53.038.541.444.347.250.153.021<24 m52.439.442.044.647.249.852.424<27 m55.440.943.846.749.652.555.427<30 m55.542.545.147.750.352.955.530<33 m55.941.944.747.550.353.155.933<36 m56.642.145.047.950.853.756.636<39 m56.943.946.549.151.754.356.939<42 m59.943.446.750.053.356.659.94245 m58.044.046.849.652.455.258.045<48 m58.045.047.650.252.855.458.048<51 m61.144.647.951.254.557.861.151<54 m62.144.147.751.354.958.562.154<57 m64.144.648.552.456.360.264.157<60 m61.646.649.652.655.658.661.660<63 m64.445.449.253.056.860.664.463<66 m64.145.148.952.756.560.364.166<69 m70.843.348.854.359.865.370.869<72 m64.844.348.452.556.660.764.872<75 m65.446.450.254.057.861.665.475<78 m63.645.148.852.556.259.963.678<81 m68.745.750.354.959.564.168.781<84 m69.645.650.455.260.064.869.6table 6the mean and 1, 2, and 3 standard deviations added and subtracted wc for girlsage3 sd2 sd1 sdmean+1 sd+2 sd+3 sd028 days23.526.128.731.333.936.544.328 days3 months28.331.434.537.640.743.853.13<6 m31.534.437.340.243.146.054.76<9 m31.935.038.141.244.347.456.79<12 m33.436.539.642.745.848.958.212<15 m34.937.840.743.646.549.458.115<18 m35.838.641.444.247.049.858.218<21 m36.539.041.544.046.549.056.521<24 m36.839.542.244.947.650.358.424<27 m37.440.443.446.449.452.461.427<30 m37.740.743.746.749.752.761.730<33 m39.141.644.146.649.151.659.133<36 m37.741.344.948.552.155.766.536<39 m40.743.546.349.151.954.763.139<42 m39.042.445.849.252.656.066.24245 m38.541.945.348.752.155.565.745<48 m38.842.746.650.554.458.370.048<51 m41.244.347.450.553.656.766.051<54 m39.943.747.551.355.158.970.354<57 m40.544.247.951.655.359.070.157<60 m39.043.447.852.256.661.074.260<63 m40.344.047.751.455.158.869.963<66 m42.045.649.252.856.460.070.866<69 m38.843.247.652.056.460.874.069<72 m39.543.747.952.156.360.573.172<75 m38.543.147.752.356.961.575.375<78 m42.345.749.152.555.959.369.578<81 m41.145.549.954.358.763.176.381<84 m39.744.248.753.257.762.275.7 descriptive statistics for waist circumference for boys and girls by age smoothed age - specific waist circumference percentile values for boys smoothed age - specific waist circumference percentile values for girls the power of a box cox transformation (l), the median (m), and the coefficient of variation (s) for waist circumference for both genders the mean and 1, 2, and 3 standard deviations added and subtracted wc for boys the mean and 1, 2, and 3 standard deviations added and subtracted wc for girls in comparison to 10th, 50th, and 90th percentiles between genders, boys wc were longer than girls after the infancy period (fig . 1the comparison of 10th, 50th, and 90th percentile between genders the comparison of 10th, 50th, and 90th percentile between genders we also compared the frequency of wc higher than 90th percentile between each gender to reveal the fluctuations in abdominal obesity prevalence (fig . 2). The 10th, 50th, and 90th percentiles of our study were compared with other studies, the methodologies of which are similar to ours (figs . 3 and 4).fig . 3the comparison of 10th, 50th, and 90th percentiles of our wc (turkey) with the preschool children of german (ger) and european american (eu am) for boysfig . 4the comparison of 10th, 50th, and 90th percentiles of our wc (turkey) with the preschool children of german (ger) and european american (eu am) for girls the frequency of wc higher than 90th percentile between each gender the comparison of 10th, 50th, and 90th percentiles of our wc (turkey) with the preschool children of german (ger) and european american (eu am) for boys the comparison of 10th, 50th, and 90th percentiles of our wc (turkey) with the preschool children of german (ger) and european american (eu am) for girls this is the first cross - sectional study for age- and gender - specific references of 0- to 6-year - old turkish children . In addition to finding a slightly low wc in girls compared with boys, in comparison with other studies in similar age groups, the wc of boys and girls were lower . The age- and gender - specific prevalence of abdominal obesity was also calculated . Because of difficulty in sampling in infancy and preschool children and the high number of studies about obesity prevalence in school children and adolescence, we concentrated on infants and preschool children [22, 42]. Early - onset obesity (<6 years) not only increases the risk of metabolic and cardiovascular disorders in adulthood but also indicates that the risk of adult obesity would be increased by at least 2550% [14, 25, 31]. Then, this study would at least provide the opportunity of determining the validity of the preceding statement by comparing with future similar cross - sectional studies in our population . There is a moderate correlation between obesity in early childhood and in adulthood . In a report by nader et al ., the authors stated that preschool children whose bmis were higher than 50p would have six - times - higher risk of overweight in later childhood . In addition to these findings, obesity at the age of 5 was proposed as the predictor of metabolic status at 9 years old . Then, early interventions to treat obesity would not only have a short time but would also have a long period of consecutions . Wc references which were determined in this study would be useful to determine metabolic risks in early childhood since a similar study was not done in our population . It is known that there is a decrease in bmi from infancy to 6 years old, the so - called adiposity rebounds, but because of individual variations during this period any two children who have the same bmi may be at different levels of adiposity . Since the onset of adiposity rebound varies individually in this period, children whose adiposity onset is thus, in preschool children (<6 years old), we may conclude that the use of bmi to predict adiposity is not reliable . Additionally, in this period, non - uniform segmental growth leads the need to use wc but not bmi since bmi reflects total body fat content but not body fat distribution [3, 4, 32]. Bmi may define large central fat deposits as normal, while it has poor sensitivity to define central obesity . Since wc in children has a good correlation with insulin resistance, it is considered as a useful tool to predict the risk of developing metabolic and cardiovascular complications . The correlation between wc and central adiposity is also confirmed by dual - energy x - ray absorptiometry . The rationale of this study depends on this hypothesis that segmental fat distribution is best reflected by wc compared with bmi . The primary contribution of this study is to provide the first wc references in turkish preschool children to our knowledge . Our findings indicate that the increase in wc through early childhood is faster than 1.5 to 6 years . According to our findings, predominance in central adiposity for boys compared with girls may be an indicator of sexual dimorphism in early childhood in accordance with previous studies [15, 38]. Although there are different cutoffs to define central obesity, we used wc> 90th percentile since it was proposed as the prerequisite in the definition of metabolic syndrome . In addition to smoothed references (3rd, 10th 25th, 50th, 75th, 90th, and 97th percentiles), we presented all descriptive characteristics of our data (mean, median, standard deviations) to let other researchers make comments on our results . The cited methods to define cutoff for wc can be stated as: z score 1.3 by fredrick, z score 1.5 by taylor, at> 75th by moreno, and age- and sex - specific 90th by katzmarzyk [12, 18, 26, 39]. Increased wc> 90th percentile is proposed by ncep - atp iii and idf, but cutoff for wc to define metabolic syndrome is lacking before 10 years old [9, 40, 41]. However, in recent studies, to diagnose metabolic risk, it is suggested that modified idf and ncep criteria can be used in the pre - pubertal period (610 years) [6, 14, 45]. In these modified criteria, wc> 90th percentile was accepted as cutoff value to define metabolic risk at older than 10 years . Although cutoff for abdominal obesity is not determined under 6 years, wc> 90th percentile may be speculated at this level of knowledge [6, 14]. According to this criterion, we found total abdominal obesity prevalence as 10.4% (boys 10.1%, girls 10.7%), where age - adjusted prevalence values were also given . We also compared the frequency of wc higher than 90th percentile between each gender and found significant fluctuations until the age of 2 years . After 2 years, wc showed a small decline until 3 years and it was followed by a gradual increase until 6 years in both genders, where abdominal obesity was higher in girls during this period (fig . 2). The observation that the increase in abdominal obesity was shifted towards the early years can be interpreted as early rebound . Although bmi and wc do not completely reflect the same metabolic parameters, early onset of abdominal obesity may require the onset of rebound obesity for bmi . Since wc reflects primarily the body fat distribution but not total body fat, inconsistent obesity rebounds in wc and bmi must be evaluated separately . There are few studies about wc percentiles for children under 6 years old . In a study conducted in sweden on children less than 5 year old, in another study conducted in 316-year - old indian children, there were calculated percentiles which can be compared with our references . We selected two previous studies providing wc references with a similar method in the same age of caucasians . The other one was a study conducted in 218-year - old european american children in usa [11, 37]. In comparing our data with these two studies, we found that our wc references were significantly lower than those (figs . 3 and 4). These differences may be explained by dissimilarities in ethnic, geographical, and nutritional behaviors as well as lifestyle . Even in the pre - pubertal period, these dissimilarities may be observed . We consider that behaviors related to sedentary activities such as watching television and/or playing with electronic games are established in the preschool period . Our data can then be used to determine the risk of central obesity in early childhood . We can conclude that wc together with bmi is a useful clinical tool to detect preschool - age children who may be at a higher risk for cardiovascular diseases.
|
Low back pain is common during pregnancy and has been reported in as many as 56% of pregnant woman because of hormonal changes and mechanical strain . However, the incidence of symptomatic lumbar disk herniation during pregnancy is very rare, occurring in only 1 in approximately 10,000 pregnancies . Cauda equine syndrome or severe and progressive neurologic deficit caused by lumbar disk herniation is a medical emergency that necessitates prompt surgery needed to avoid permanent prognostic symptom . We report a case of lumbar disk herniation underwent discectomy just after cesarean delivery in the third trimester of pregnancy . A 33-year - old woman presented at 32 weeks gestation . The cesarean delivery was planned because of cephalopelvic disportion . She had a low back pain and the left - sided leg pain below the knee . Straight leg raising test was restricted to 20. mri showed a large disk herniation at l4/5 on the left paracentral of the spinal canal (fig . The patient was managed with physical therapy and acetaminophen for the pain . However, at 34 weeks gestation, she had severe weakness of the left extension halluces longus, left ankle dorsiflexion . Mri showed a large disk herniation at l4/5 expanded to the spinal canal more (fig . We performed cesarean delivery in the supine position before a discectomy in the prone position . Although preoperatively we simulated that the patient really tried to be in some various prone positions on operating table, we found the prone position for discectomy was difficult to achieve with a 34-week gravid uterus . And there were few risks of newborn infant complications with the cesarean delivery at a 34-week . The cesarean delivery was performed with the patient under epidural anesthesia, resulting in the delivery of a normal baby . A healthy male (2569 g) the patient was then turned to a prone position, and a left l4/5 discectomy was performed . Neither the patient nor the baby had any complication related to surgery . In the immediate postoperative period, the patient experienced relief of left leg pain . But the day after surgery, she had a severe low back pain and the right leg pain below the knee . Mri showed a disk herniation at l4/5 on the right side of the spinal canal (fig . She could not walk because of the right leg pain . At 6 days after the first surgery, a right l4/5 discectomy was performed, and a large disk fragment that had displaced into the spinal canal was removed . In the immediate postoperative period, follow up after the last operation, she had a numbness and a slightly weakened dorsiflexion on the left extremity . Lumbar disk herniation commonly results in acute symptoms shooting and intractable pain in the low back and lower extremities . Although it is very rare, the lumbar disk herniation occurs in the pregnant woman . It could be speculated that in the third trimester the release of relaxin, a polypeptide hormone that regulates collagen and softens the ligaments of the pelvis in preparation of preparation, may predispose a massive lumbar disk prolapse . Lumbar disk prolapse should be considered in pregnant women presenting with severe back or leg pain . When we suspect lumbar disk herniation, mri is an useable diagnostic tool in pregnant woman . It permits a detailed spinal examination without the ionizing effects of x - ray to the developing fetus . An epidural injection of steroids can also be considered for women in their second or third trimester of pregnancy . Surgical management may be required in case of severe intractable back pain and leg pain unresponsive to conservative management, progressive neurological deficits or cauda equina syndrome in the patients . The literature clearly demonstrates that a pregnancy at any stage is not a contraindication to surgical intervention . But during surgery in a pregnant woman, special attention is necessary to avoid causing fetal injury . The prone position is most commonly used for lumbar disk surgery as it allows optimal surgical access and minimizes blood loss by reducing the epidural venous pressure . But for the pregnant women, an additional care should be taken for the position during surgery for excessive pressure can cause preterm delivery . During the first and early part of the second trimester when we perform the operation in the third trimester of pregnancy, it is necessary to decide whether pregnancy is continued and the discectomy is carried out in the lateral position, or pregnancy is interrupted with cesarean delivery and the discectomy is carried out in the prone position (table 1). If the former was chose, the pregnancy could be continued and the delivery by full term birth is possible . And the frequency of newborn infant complications may be decreased . However, the operation becomes technically difficult, it takes long time for surgery and there is a possibility that the burden to the fetus and mother increase . If the later was chose, it is not necessary to consider the effect on the fetus during surgery, and prone position is possible . However, in the case of a premature delivery, there is a risk of the increased complication, such as respiratory - organs complication . Based on these things, we make protocol of the operation for the lumbar disk herniation during pregnancy (fig . The decision whether pregnancy is continued or interrupted should not be made only by an orthopedist . It is necessary to cooperate with a pediatrician, an obstetrician, and an anesthesiologist . For obtaining the best outcome on mother and child, it is important to discuss in advance to be able to respond quickly for changeable situation . We experienced a patient who required an emergent herniated disk excision after the cesarean section in the third trimester . It is necessary to conduct the operation under pregnancy in consideration of the great influence on mother and child . Hironori ochi, ryuichi ohno, mitsuaki kubota, ryo hanyu, kensuke sakai, yu sugawara and fumihiro mukasa declare that they have no conflict of interest . All authors have contributed significantly, and that all authors are in agreement with the content of the manuscript . Hironori ochi, ryuichi ohno and ryo hanyu performed operation; hironori ochi, ryuichi ohno and ryo hanyu diagnosed; hironori ochi, ryuichi ohno, mitsuaki kubota, ryo hanyu, kensuke sakai, yu sugawara and fumihiro mukasa performed ward management.
|
Linagliptin (tradjenta, boehringer ingelheim, ridgefield, ct, usa) is a newly approved medication for the treatment of type 2 diabetes mellitus.1 this agent is a potent inhibitor of the serine protease enzyme, dipeptidyl peptidase-4 (dpp-4), which is responsible for rapid degradation of two incretin hormones, glucagon - like - peptide 1 (glp-1) and glucose insulinotropic polypeptide (gip). Glp-1 and gip have distinct physiologic actions in the regulation of glucose that would make their augmentation attractive in the patient with type 2 diabetes due to a propensity to achieve decreased levels of both hormones.2 glp-1 is secreted from intestine endocrine l - cells in response to glucose and is responsible for stimulation of insulin release from the pancreas in a glucose - dependent manner . Glp-1 inhibits the release of glucagon, thereby decreasing hepatic gluco - neogenesis and insulin inhibition . Glp-1 decreases gastric emptying, delaying arrival of glucose into the vasculature, and works centrally in the brain by increasing satiety with a decrease in food intake . Lastly, glp-1 can increase -cell mass by decreasing apoptosis and by increasing proliferation and neogenesis of -cells.3 however, this has only been shown in animal models, with no evidence of this noted in humans as yet.4 gip is secreted from the k - cells of the intestine wall, stimulates insulin secretion from the pancreas, and has been shown to decrease cellular death and increase regeneration of -cells.3 linagliptin has been shown to be a potent long - acting dpp-4 inhibitor . An in vitro study showed that linagliptin inhibited dpp-4 with a 50% inhibition concentration (ic50) of about 1 nm, compared with sitagliptin (19 nm), alogliptin (24 nm), saxagliptin (50 nm), and vidagliptin (62 nm).5 linagliptin has an elimination half - life of 131 hours,6 and achieves steady - state concentrations after three doses of 5 mg daily.1 linagliptin has also been shown to inhibit dpp-4 activity by more than 80% over 24 hours.68 the presence of these characteristics allows for once - daily oral dosing.7 linagliptin undergoes primarily hepatic elimination, with approximately 85% of the drug excreted unchanged in the feces.9 despite having a predominately hepatic route of elimination, the main metabolite is pharmacologically inactive.1 the overall pharmacokinetic profile of linagliptin may avoid the need to adjust the dose in patients with renal or hepatic impairment . The recommendations provided by the package insert indicate no dose adjustments are required for renal or hepatic impairment.1 multiple therapies have now been introduced to the market that target the incretin hormone system . Current guidelines recommend that these treatments be considered as part of a patient - centered approach and be used as a component of a two - drug or three - drug regimen in conjunction with metformin if a patient does not meet their individualized glycosylated hemoglobin (hba1c) goal.10 a medline search was performed using the keywords linagliptin, dpp-4 inhibitor, and type 2 diabetes for articles published through july 2012 . The literature search was limited by the following criteria: publication in the english language, clinical trials, randomized controlled trials, and research conducted in humans (figure 1). Here we summarize the available data with a focus on the clinical utility and tolerability of linagliptin . This phase iia study conducted by forst et al followed a randomized, double - blind, within - dose level, parallel, placebo - controlled design and examined the pharmacokinetic and pharmacodynamic properties of linagliptin in patients with type 2 diabetes after 4 weeks of treatment.11 participants enrolled in this study were either treatment - nave or had received up to two oral antidiabetic therapies other than a thiazolidinedione . Participants were 2170 (median 62) years of age, had a body mass index of 18.535 kg / m, and had an hba1c 8.5% for treatment - nave and/or one oral antidiabetic therapy, and 8.0% for patients treated with two oral antidiabetic therapies . The hba1c for the total cohort of 77 patients was 7.0% . In participants receiving an oral antidiabetic therapy, eligible patients were randomly assigned to receive linagliptin 2.5 mg (n = 26), 5 mg (n = 16), 10 mg (n = 19), or placebo (n = 16). Statistically significant decreases in mean hba1c from baseline were observed at the end of the 4-week period for all the linagliptin groups compared with placebo . The placebo - corrected mean change in hba1c was 0.31% for linagliptin 2.5 mg, 0.37% for linagliptin 5 mg, and 0.28% for linagliptin 10 mg (p = <0.025). Statistically significant decreases in fasting plasma glucose and postprandial plasma glucose were also observed from baseline to the end of the study period for all linagliptin doses (see table 1). Another randomized, double - blind, parallel - group study comparing treatment with either linagliptin 5 mg or placebo for 24 weeks in patients with type 2 diabetes was conducted by del prato et al.12 patients were aged 1880 (mean 55.7) years with a body mass index 40 kg / m, and were either treatment - nave or previously treated with one oral antidiabetic therapy other than a thiazolidinedione . Pretreated patients underwent a 6-week washout period, with the last 2 weeks being an open - label placebo run - in . Treatment - nave patients entered directly into the 2-week placebo run - in period . Hba1c levels had to be between 6.5% and 9.0% in non - treatment - naive patients or between 7.0% and 10% in treatment - nave patients . Eligible patients were then randomized to receive treatment with linagliptin 5 mg or placebo for 24 weeks . The adjusted mean difference in the change of hba1c comparing linagliptin and placebo was 0.69% (p <0.0001). Treatment with linagliptin also resulted in significant decreases in fasting plasma glucose and postprandial plasma glucose compared with placebo (see table 1). Taskinen et al performed a randomized, double - blind, placebo - controlled, multicenter, parallel - group study in 701 patients with type 2 diabetes aged 1880 years.13 subjects included had a mean age of 56.5 years, a body mass index 40 kg / m, and a mean baseline hba1c of 8.1% . Subjects eligible for inclusion needed to have received metformin at a dose 1500 mg / day (or the maximum tolerated dose) and not more than one other oral antidiabetic therapy . In patients who had previously been treated with metformin monotherapy, hba1c had to be 7.0%10.0% at screening; for patients treated with an additional medication, a1c had to be 6.5%9.0% . Patients taking antidiabetic therapy in addition to metformin were instructed to stop the medication and then underwent a 6-week washout period that included an open - label placebo run - in phase in the last 2 weeks . For patients taking metformin monotherapy at enrolment, all eligible patients continued their usual dose of metformin and were then randomized to treatment with either linagliptin 5 mg once daily or placebo for 24 weeks . The primary endpoint was the change from baseline hba1c, adjusted for baseline hba1c and the use of monotherapy versus combination therapy at enrolment, after 24 weeks of treatment . At the end of the study, linagliptin reduced the mean hba1c level by 0.49%, whereas hba1c in the placebo group rose by 0.15% (p linagliptin also led to significant reductions versus placebo in both fasting plasma glucose and postprandial plasma glucose (p <0.0001, see table 2). Haak et al conducted a 24-week, randomized, double - blind, placebo - controlled phase iii trial in 791 patients who were either treatment - nave or had been treated with one other antidiabetic therapy.15 eligible patients were 1880 years of age, had a diagnosis of type 2 diabetes, and had a body mass index of 40 kg / m . In treatment - nave participants, hba1c had to be 7.5% and <11%, and for patients pre - treated with one antidiabetic therapy had to be 7.0% to 10.5% . Patients pretreated with one antidiabetic therapy entered a 4-week washout period followed by a 2-week placebo run - in period that all patients participated in . Subjects were then treated for 24 weeks with one of two free combinations of linagliptin (linagliptin 2.5 mg twice daily + metformin 500 mg twice daily or 1000 mg twice daily) or placebo, linagliptin 5 mg once daily, metformin 500 mg twice daily, or metformin 1000 mg twice daily monotherapy . The primary endpoint was change in hba1c from baseline to 24 weeks of treatment, adjusted for baseline hba1c and previous oral antidiabetic therapy . Mean baseline hba1c values were similar for all treatment groups, with an overall mean of 8.7% . The adjusted placebo - corrected mean (95% confidence interval) changes in hba1c were 1.7% (2.0%, 1.4%) for linagliptin + metformin 1000 mg; 1.3% (1.6, 1.1) for linagliptin + metformin 500 mg; 1.2% (1.5%, 0.9%) for metformin 1000 mg; 0.8% (1.0, 0.5) for metformin 500 mg; and 0.6% (0.9%, 0.3%) for linagliptin monotherapy (all p <0.0001). Significant reductions in fasting plasma glucose from baseline to the end of the study period were seen with combination therapies relative to metformin monotherapy . The placebo - corrected changes in fasting plasma glucose from baseline were also statistically significant for each group . This study did not assess changes in postprandial plasma glucose (see table 2). This randomized, placebo - controlled, double - blind, parallel - group study enrolled subjects with type 2 diabetes receiving metformin 1500 mg / day (or the maximum tolerated dose) and the maximum tolerated dose of sulfonylurea.16 patients were 1880 (mean 58.1) years of age, with a body mass index 40 kg / m and hba1c 7.0% and 10.0% (mean 8.14%). Following a 2-week placebo run - in, a total of 1055 participants were randomized to treatment with linagliptin 5 mg once daily or placebo, in addition to the established background therapy of metformin in combination with a sulfonylurea . The primary endpoint was the change in hba1c levels between baseline and 24 weeks, stratified by baseline hba1c value . After 24 weeks, linagliptin was superior to placebo for the adjusted mean change in hba1c from baseline . The linagliptin placebo - corrected adjusted mean change from baseline was 0.62% (p <0.0001). Linagliptin also produced greater reductions in fasting plasma glucose than placebo at week 24 (p <0.0001, see table 2). This randomized, double - blind, parallel - group, active - controlled, noninferiority trial was conducted by gallwitz et al in 1519 patients with type 2 diabetes, aged 1880 years, and a body mass index of 40 kg / m.17 eligible subjects were receiving metformin 1500 mg / day (or the maximum tolerated dose) alone with an hba1c of 6.5%10.0% or 6.0%9.0% on metformin and one other oral antidiabetic therapy . Mean baseline hba1c and age were 7.7% and 59.8 years in each group, respectively . Participants receiving metformin and one additional antidiabetic therapy entered a 6-week wash - out period followed by a 2-week open - label placebo run - in . Those receiving metformin monotherapy entered directly into a 2-week, open - label, placebo run - in period . Subjects who met the inclusion criteria were then randomly assigned to treatment with linagliptin 5 mg once daily or glimepiride at an initial dose of 1 mg daily added to the current dose of metformin . The primary endpoint was the change in hba1c from baseline to week 104, and was stratified by baseline hba1c and previous antidiabetic therapy use . After 2 years of treatment, linagliptin was noninferior to glimepiride in reducing hba1c . The difference between the treatment groups met the noninferiority criteria and was 0.20% (p <0.125). As add - on to metformin, both linagliptin and glimepiride caused significant reductions in fasting plasma glucose and postprandial plasma glucose . The treatment differences for reductions in fasting and postprandial plasma glucose, respectively, were 6.31 mg / dl (p = 0.012) and 9.73 mg / dl (p = 0.0918, see table 2). The 12-week, multicenter, randomized, double - blind, placebo - controlled, five parallel - group study conducted by forst et al included patients with type 2 diabetes aged 2175 (mean 60) years with a body mass index of 2540 kg / m.14 patients were eligible if they were pretreated with metformin alone (baseline hba1c levels had to be 7.5%10%) or treated with metformin and one other oral antidiabetic therapy other than a thiazolidinedione (baseline hba1c levels had to be 7.0%9.0%). Eligible patients who had already received metformin monotherapy entered a 2-week open - label run - in phase . Patients who received metformin plus one other antidiabetic therapy entered a 6-week washout period, with the last 2 weeks being an open - label run - in phase . Three doses of linagliptin (1, 5, and 10 mg once daily) were explored when added to metformin . There was also an open - label treatment arm where patients were randomized to receive glimepiride (1, 2, or 3 mg once daily) as add - on therapy to metformin . The mean placebo - corrected lowering of hba1c levels was 0.39% for linagliptin 1 mg (p = 0.005), 0.75% for 5 mg (p <0.001), and 0.73% for 10 mg the change in mean placebo - corrected hba1c from baseline was 0.90% for glimepiride . The reduction in hba1c with open - label glimepiride was numerically greater versus linagliptin, but not statistically significant . Fasting plasma glucose reductions were also found to be significantly greater with all doses of linagliptin than with placebo at week 12 . Postprandial plasma glucose changes were not addressed in this study (see table 2). This randomized, double - blind, placebo - controlled, multicenter, parallel - group study was conducted by gomis et al in 389 patients with type 2 diabetes and aged 1880 (mean 57.5) years.18 at baseline, the patients had hba1c concentrations of 7.5%11.0% (mean 8.6%) and a body mass index 40 kg / m . Patients pretreated with oral antidiabetic therapies underwent a 6-week washout period that included an open - label placebo run - in phase in the last 2 weeks . For treatment - nave patients, only the 2-week run - in phase eligible subjects were then randomized to receive pioglitazone 30 mg once daily and linagliptin 5 mg once daily or pioglitazone 30 mg once daily and placebo for 24 weeks . The primary endpoint was change from baseline hba1c, adjusted for baseline hba1c and baseline antidiabetic therapy, after 24 weeks of treatment . At the end of the study, the adjusted mean change in hba1c from baseline for linagliptin plus pioglitazone was 1.06% compared with 0.56% for placebo plus pioglitazone . Changes in fasting plasma glucose were assessed as a secondary endpoint, showing a significantly greater reduction for linagliptin plus pioglitazone than for placebo plus pioglitazone . Changes in postprandial plasma glucose were not addressed in this study (see table 2). A 78-week open - label extension conducted by gomis et al evaluated participants who had previously completed one of the four 24-week, randomized, double - blind, placebo - controlled parent trials.19 these subjects received either linagliptin monotherapy, linagliptin plus metformin, linagliptin plus metformin and sulfonylurea, or linagliptin plus pioglitazone . All patients receiving one of these treatments during a previous trial continued the same treatment for an additional 78 weeks (n = 1532). Those patients previously treated with placebo were switched to linagliptin monotherapy (n = 589). Overall, the cohort of patients had a mean age of 57.7 years and mean baseline hba1c of 7.5% . This extension study was conducted primarily to assess the long - term safety and tolerability of linagliptin . Secondary efficacy outcomes evaluated the changes in hba1c and fasting plasma glucose from baseline to 102 weeks . In participants randomized to treatment with linagliptin in the four previous trials, the mean change from baseline hba1c during the initial 24 weeks of treatment was 0.8% . This was maintained over the 78 weeks of the extension study, with a change from baseline hba1c of 0.8% . The largest observed reduction in hba1c from baseline to week 102 was in the group receiving linagliptin plus pioglitazone at 1.5% . This was followed by those patients receiving metformin and metformin plus a sulfonylurea in combination with linagliptin (0.7%). Lastly, patients receiving linagliptin monotherapy showed a reduction of 0.5% at week 102 . Similarly, fasting plasma glucose values already reduced during the previous trials further decreased during the extension period . In subjects randomized to placebo in the previous trials and switched to linagliptin monotherapy in the extension phase, the change in mean hba1c was 0.90% . Fasting plasma glucose values also decreased from baseline over the study period (see table 2). Most adverse events with linagliptin were considered to be mild to moderate in nature . Adverse reactions that occurred in 2% of patients treated with linagliptin included nasopharyngitis, diarrhea, cough, urinary tract infection, and hypertriglyceridemia (in combination with sulfonylurea therapy), hyperlipidemia, and weight increase (in combination with pioglitazone).1 weight changes were reported or addressed in each of the studies above . No significant changes with regard to body weight were found when linagliptin was given as monotherapy . With regard to sulfonylurea therapy, two of the studies revealed an increase in body weight in patients treated with glimepiride versus those receiving linagliptin.14,17 however, in a study in which all patients received metformin and sulfonylurea therapy and were then randomized to placebo or linagliptin, no significant changes in body weight were seen.16 when patients received pioglitazone and either placebo or linagliptin, both groups showed an increase in body weight from baseline . The amount of weight gain was larger in patients receiving linagliptin, but the mean weight for patients receiving linagliptin was lower than that in patients receiving placebo at baseline.18 in general, linagliptin showed a low propensity to cause hypoglycemia . When used as monotherapy, no patients experienced hypoglycemia in the two studies reviewed.11,15 one study reviewing linagliptin as monotherapy versus placebo reported hypoglycemia occurring in one patient in each group.12 when combined with metformin and sulfonylurea, a higher percentage of patients receiving linagliptin experienced hypoglycemia versus placebo . However, a smaller percentage of patients experienced severe hypoglycemia when compared with placebo.16 three studies discussed or reported the occurrence of pancreatitis . One study reported zero cases15 while another study reported one case of pancreatitis in a patient receiving linagliptin.17 a 78-week, open - label extension study, which included 2121subjects, reported four cases of pancreatitis in patients who had received linagliptin for a total of 102 weeks, with two cases being acute and two chronic . This was an incidence of 0.2% in the overall treated set.19 according to the prescribing information, pancreatitis was reported more often in patients treated with linagliptin (21.9 per 10,000 patient years) versus placebo (eight per 10,000 patient years).1 one study prospectively assessed cardiovascular safety for linagliptin versus sulfonylurea (e.g. Glimepiride). Major cardiovascular events occurred in 2% of patients treated with linagliptin and 3% treated with glimepiride (p = 0.0213). This finding was mainly attributable to a significantly lower number of nonfatal strokes with linagliptin compared with glimepiride, without any relation to hypoglycemia.17 this phase iia study conducted by forst et al followed a randomized, double - blind, within - dose level, parallel, placebo - controlled design and examined the pharmacokinetic and pharmacodynamic properties of linagliptin in patients with type 2 diabetes after 4 weeks of treatment.11 participants enrolled in this study were either treatment - nave or had received up to two oral antidiabetic therapies other than a thiazolidinedione . Participants were 2170 (median 62) years of age, had a body mass index of 18.535 kg / m, and had an hba1c 8.5% for treatment - nave and/or one oral antidiabetic therapy, and 8.0% for patients treated with two oral antidiabetic therapies . The hba1c for the total cohort of 77 patients was 7.0% . In participants receiving an oral antidiabetic therapy, eligible patients were randomly assigned to receive linagliptin 2.5 mg (n = 26), 5 mg (n = 16), 10 mg (n = 19), or placebo (n = 16). Statistically significant decreases in mean hba1c from baseline were observed at the end of the 4-week period for all the linagliptin groups compared with placebo . The placebo - corrected mean change in hba1c was 0.31% for linagliptin 2.5 mg, 0.37% for linagliptin 5 mg, and 0.28% for linagliptin 10 mg (p = <0.025). Statistically significant decreases in fasting plasma glucose and postprandial plasma glucose were also observed from baseline to the end of the study period for all linagliptin doses (see table 1). Another randomized, double - blind, parallel - group study comparing treatment with either linagliptin 5 mg or placebo for 24 weeks in patients with type 2 diabetes was conducted by del prato et al.12 patients were aged 1880 (mean 55.7) years with a body mass index 40 kg / m, and were either treatment - nave or previously treated with one oral antidiabetic therapy other than a thiazolidinedione . Pretreated patients underwent a 6-week washout period, with the last 2 weeks being an open - label placebo run - in . Treatment - nave patients entered directly into the 2-week placebo run - in period . Hba1c levels had to be between 6.5% and 9.0% in non - treatment - naive patients or between 7.0% and 10% in treatment - nave patients . Eligible patients were then randomized to receive treatment with linagliptin 5 mg or placebo for 24 weeks . The adjusted mean difference in the change of hba1c comparing linagliptin and placebo was 0.69% (p <0.0001). Treatment with linagliptin also resulted in significant decreases in fasting plasma glucose and postprandial plasma glucose compared with placebo (see table 1). Taskinen et al performed a randomized, double - blind, placebo - controlled, multicenter, parallel - group study in 701 patients with type 2 diabetes aged 1880 years.13 subjects included had a mean age of 56.5 years, a body mass index 40 kg / m, and a mean baseline hba1c of 8.1% . Subjects eligible for inclusion needed to have received metformin at a dose 1500 mg / day (or the maximum tolerated dose) and not more than one other oral antidiabetic therapy . In patients who had previously been treated with metformin monotherapy, hba1c had to be 7.0%10.0% at screening; for patients treated with an additional medication, a1c had to be 6.5%9.0% . Patients taking antidiabetic therapy in addition to metformin were instructed to stop the medication and then underwent a 6-week washout period that included an open - label placebo run - in phase in the last 2 weeks . For patients taking metformin monotherapy at enrolment, all eligible patients continued their usual dose of metformin and were then randomized to treatment with either linagliptin 5 mg once daily or placebo for 24 weeks . The primary endpoint was the change from baseline hba1c, adjusted for baseline hba1c and the use of monotherapy versus combination therapy at enrolment, after 24 weeks of treatment . At the end of the study, linagliptin reduced the mean hba1c level by 0.49%, whereas hba1c in the placebo group rose by 0.15% (p <0.0001). Linagliptin also led to significant reductions versus placebo in both fasting plasma glucose and postprandial plasma glucose (p <0.0001, see table 2). Haak et al conducted a 24-week, randomized, double - blind, placebo - controlled phase iii trial in 791 patients who were either treatment - nave or had been treated with one other antidiabetic therapy.15 eligible patients were 1880 years of age, had a diagnosis of type 2 diabetes, and had a body mass index of 40 kg / m . In treatment - nave participants, hba1c had to be 7.5% and <11%, and for patients pre - treated with one antidiabetic therapy had to be 7.0% to 10.5% . Patients pretreated with one antidiabetic therapy entered a 4-week washout period followed by a 2-week placebo run - in period that all patients participated in . Subjects were then treated for 24 weeks with one of two free combinations of linagliptin (linagliptin 2.5 mg twice daily + metformin 500 mg twice daily or 1000 mg twice daily) or placebo, linagliptin 5 mg once daily, metformin 500 mg twice daily, or metformin 1000 mg twice daily monotherapy . The primary endpoint was change in hba1c from baseline to 24 weeks of treatment, adjusted for baseline hba1c and previous oral antidiabetic therapy . Mean baseline hba1c values were similar for all treatment groups, with an overall mean of 8.7% . The adjusted placebo - corrected mean (95% confidence interval) changes in hba1c were 1.7% (2.0%, 1.4%) for linagliptin + metformin 1000 mg; 1.3% (1.6, 1.1) for linagliptin + metformin 500 mg; 1.2% (1.5%, 0.9%) for metformin 1000 mg; 0.8% (1.0, 0.5) for metformin 500 mg; and 0.6% (0.9%, 0.3%) for linagliptin monotherapy (all p <0.0001). Significant reductions in fasting plasma glucose from baseline to the end of the study period were seen with combination therapies relative to metformin monotherapy . The placebo - corrected changes in fasting plasma glucose from baseline were also statistically significant for each group . This study did not assess changes in postprandial plasma glucose (see table 2). This randomized, placebo - controlled, double - blind, parallel - group study enrolled subjects with type 2 diabetes receiving metformin 1500 mg / day (or the maximum tolerated dose) and the maximum tolerated dose of sulfonylurea.16 patients were 1880 (mean 58.1) years of age, with a body mass index 40 kg / m and hba1c 7.0% and 10.0% (mean 8.14%). Following a 2-week placebo run - in, a total of 1055 participants were randomized to treatment with linagliptin 5 mg once daily or placebo, in addition to the established background therapy of metformin in combination with a sulfonylurea . The primary endpoint was the change in hba1c levels between baseline and 24 weeks, stratified by baseline hba1c value . After 24 weeks, linagliptin was superior to placebo for the adjusted mean change in hba1c from baseline . The linagliptin placebo - corrected adjusted mean change from baseline was 0.62% (p <0.0001). Linagliptin also produced greater reductions in fasting plasma glucose than placebo at week 24 (p <0.0001, see table 2). This randomized, double - blind, parallel - group, active - controlled, noninferiority trial was conducted by gallwitz et al in 1519 patients with type 2 diabetes, aged 1880 years, and a body mass index of 40 kg / m.17 eligible subjects were receiving metformin 1500 mg / day (or the maximum tolerated dose) alone with an hba1c of 6.5%10.0% or 6.0%9.0% on metformin and one other oral antidiabetic therapy . Mean baseline hba1c and age were 7.7% and 59.8 years in each group, respectively . Participants receiving metformin and one additional antidiabetic therapy entered a 6-week wash - out period followed by a 2-week open - label placebo run - in . Those receiving metformin monotherapy entered directly into a 2-week, open - label, placebo run - in period . Subjects who met the inclusion criteria were then randomly assigned to treatment with linagliptin 5 mg once daily or glimepiride at an initial dose of 1 mg daily added to the current dose of metformin . The primary endpoint was the change in hba1c from baseline to week 104, and was stratified by baseline hba1c and previous antidiabetic therapy use . After 2 years of treatment, linagliptin was noninferior to glimepiride in reducing hba1c . The difference between the treatment groups met the noninferiority criteria and was 0.20% (p <0.125). As add - on to metformin, both linagliptin and glimepiride caused significant reductions in fasting plasma glucose and postprandial plasma glucose . The treatment differences for reductions in fasting and postprandial plasma glucose, respectively, were 6.31 mg / dl (p = 0.012) and 9.73 mg / dl (p = 0.0918, see table 2). The 12-week, multicenter, randomized, double - blind, placebo - controlled, five parallel - group study conducted by forst et al included patients with type 2 diabetes aged 2175 (mean 60) years with a body mass index of 2540 kg / m.14 patients were eligible if they were pretreated with metformin alone (baseline hba1c levels had to be 7.5%10%) or treated with metformin and one other oral antidiabetic therapy other than a thiazolidinedione (baseline hba1c levels had to be 7.0%9.0%). Eligible patients who had already received metformin monotherapy entered a 2-week open - label run - in phase . Patients who received metformin plus one other antidiabetic therapy entered a 6-week washout period, with the last 2 weeks being an open - label run - in phase . Three doses of linagliptin (1, 5, and 10 mg once daily) were explored when added to metformin . There was also an open - label treatment arm where patients were randomized to receive glimepiride (1, 2, or 3 mg once daily) as add - on therapy to metformin . The mean placebo - corrected lowering of hba1c levels was 0.39% for linagliptin 1 mg (p = 0.005), 0.75% for 5 mg (p <0.001), and 0.73% for 10 mg (p <0.001). The change in mean placebo - corrected hba1c from baseline was 0.90% for glimepiride . The reduction in hba1c with open - label glimepiride was numerically greater versus linagliptin, but not statistically significant . Fasting plasma glucose reductions were also found to be significantly greater with all doses of linagliptin than with placebo at week 12 . Postprandial plasma glucose changes were not addressed in this study (see table 2). This randomized, double - blind, placebo - controlled, multicenter, parallel - group study was conducted by gomis et al in 389 patients with type 2 diabetes and aged 1880 (mean 57.5) years.18 at baseline, the patients had hba1c concentrations of 7.5%11.0% (mean 8.6%) and a body mass index 40 kg / m . Patients pretreated with oral antidiabetic therapies underwent a 6-week washout period that included an open - label placebo run - in phase in the last 2 weeks . For treatment - nave patients, only the 2-week run - in phase eligible subjects were then randomized to receive pioglitazone 30 mg once daily and linagliptin 5 mg once daily or pioglitazone 30 mg once daily and placebo for 24 weeks . The primary endpoint was change from baseline hba1c, adjusted for baseline hba1c and baseline antidiabetic therapy, after 24 weeks of treatment . At the end of the study, the adjusted mean change in hba1c from baseline for linagliptin plus pioglitazone was 1.06% compared with 0.56% for placebo plus pioglitazone . Changes in fasting plasma glucose were assessed as a secondary endpoint, showing a significantly greater reduction for linagliptin plus pioglitazone than for placebo plus pioglitazone . Changes in postprandial plasma glucose were not addressed in this study (see table 2). A 78-week open - label extension conducted by gomis et al evaluated participants who had previously completed one of the four 24-week, randomized, double - blind, placebo - controlled parent trials.19 these subjects received either linagliptin monotherapy, linagliptin plus metformin, linagliptin plus metformin and sulfonylurea, or linagliptin plus pioglitazone . All patients receiving one of these treatments during a previous trial continued the same treatment for an additional 78 weeks (n = 1532). Those patients previously treated with placebo were switched to linagliptin monotherapy (n = 589). Overall, the cohort of patients had a mean age of 57.7 years and mean baseline hba1c of 7.5% . This extension study was conducted primarily to assess the long - term safety and tolerability of linagliptin . Secondary efficacy outcomes evaluated the changes in hba1c and fasting plasma glucose from baseline to 102 weeks . In participants randomized to treatment with linagliptin in the four previous trials, the mean change from baseline hba1c during the initial 24 weeks of treatment was 0.8% . This was maintained over the 78 weeks of the extension study, with a change from baseline hba1c of 0.8% . The largest observed reduction in hba1c from baseline to week 102 was in the group receiving linagliptin plus pioglitazone at 1.5% . This was followed by those patients receiving metformin and metformin plus a sulfonylurea in combination with linagliptin (0.7%). Lastly, patients receiving linagliptin monotherapy showed a reduction of 0.5% at week 102 . Similarly, fasting plasma glucose values already reduced during the previous trials further decreased during the extension period . In subjects randomized to placebo in the previous trials and switched to linagliptin monotherapy in the extension phase, the change in mean hba1c was 0.90% . Fasting plasma glucose values also decreased from baseline over the study period (see table 2). Taskinen et al performed a randomized, double - blind, placebo - controlled, multicenter, parallel - group study in 701 patients with type 2 diabetes aged 1880 years.13 subjects included had a mean age of 56.5 years, a body mass index 40 kg / m, and a mean baseline hba1c of 8.1% . Subjects eligible for inclusion needed to have received metformin at a dose 1500 mg / day (or the maximum tolerated dose) and not more than one other oral antidiabetic therapy . In patients who had previously been treated with metformin monotherapy, hba1c had to be 7.0%10.0% at screening; for patients treated with an additional medication, a1c had to be 6.5%9.0% . Patients taking antidiabetic therapy in addition to metformin were instructed to stop the medication and then underwent a 6-week washout period that included an open - label placebo run - in phase in the last 2 weeks . For patients taking metformin monotherapy at enrolment, all eligible patients continued their usual dose of metformin and were then randomized to treatment with either linagliptin 5 mg once daily or placebo for 24 weeks . The primary endpoint was the change from baseline hba1c, adjusted for baseline hba1c and the use of monotherapy versus combination therapy at enrolment, after 24 weeks of treatment . At the end of the study, linagliptin reduced the mean hba1c level by 0.49%, whereas hba1c in the placebo group rose by 0.15% (p <0.0001). Linagliptin also led to significant reductions versus placebo in both fasting plasma glucose and postprandial plasma glucose (p <0.0001, see table 2). Haak et al conducted a 24-week, randomized, double - blind, placebo - controlled phase iii trial in 791 patients who were either treatment - nave or had been treated with one other antidiabetic therapy.15 eligible patients were 1880 years of age, had a diagnosis of type 2 diabetes, and had a body mass index of 40 kg / m . In treatment - nave participants, hba1c had to be 7.5% and <11%, and for patients pre - treated with one antidiabetic therapy had to be 7.0% to 10.5% . Patients pretreated with one antidiabetic therapy entered a 4-week washout period followed by a 2-week placebo run - in period that all patients participated in . Subjects were then treated for 24 weeks with one of two free combinations of linagliptin (linagliptin 2.5 mg twice daily + metformin 500 mg twice daily or 1000 mg twice daily) or placebo, linagliptin 5 mg once daily, metformin 500 mg twice daily, or metformin 1000 mg twice daily monotherapy . The primary endpoint was change in hba1c from baseline to 24 weeks of treatment, adjusted for baseline hba1c and previous oral antidiabetic therapy . Mean baseline hba1c values were similar for all treatment groups, with an overall mean of 8.7% . The adjusted placebo - corrected mean (95% confidence interval) changes in hba1c were 1.7% (2.0%, 1.4%) for linagliptin + metformin 1000 mg; 1.3% (1.6, 1.1) for linagliptin + metformin 500 mg; 1.2% (1.5%, 0.9%) for metformin 1000 mg; 0.8% (1.0, 0.5) for metformin 500 mg; and 0.6% (0.9%, 0.3%) for linagliptin monotherapy (all p <0.0001). Significant reductions in fasting plasma glucose from baseline to the end of the study period were seen with combination therapies relative to metformin monotherapy . The placebo - corrected changes in fasting plasma glucose from baseline were also statistically significant for each group . This study did not assess changes in postprandial plasma glucose (see table 2). This randomized, placebo - controlled, double - blind, parallel - group study enrolled subjects with type 2 diabetes receiving metformin 1500 mg / day (or the maximum tolerated dose) and the maximum tolerated dose of sulfonylurea.16 patients were 1880 (mean 58.1) years of age, with a body mass index 40 kg / m and hba1c 7.0% and 10.0% (mean 8.14%). Following a 2-week placebo run - in, a total of 1055 participants were randomized to treatment with linagliptin 5 mg once daily or placebo, in addition to the established background therapy of metformin in combination with a sulfonylurea . The primary endpoint was the change in hba1c levels between baseline and 24 weeks, stratified by baseline hba1c value . After 24 weeks, linagliptin was superior to placebo for the adjusted mean change in hba1c from baseline . The linagliptin placebo - corrected adjusted mean change from baseline was 0.62% (p <0.0001). Linagliptin also produced greater reductions in fasting plasma glucose than placebo at week 24 (p <0.0001, see table 2). This randomized, double - blind, parallel - group, active - controlled, noninferiority trial was conducted by gallwitz et al in 1519 patients with type 2 diabetes, aged 1880 years, and a body mass index of 40 kg / m.17 eligible subjects were receiving metformin 1500 mg / day (or the maximum tolerated dose) alone with an hba1c of 6.5%10.0% or 6.0%9.0% on metformin and one other oral antidiabetic therapy . Mean baseline hba1c and age were 7.7% and 59.8 years in each group, respectively . Participants receiving metformin and one additional antidiabetic therapy entered a 6-week wash - out period followed by a 2-week open - label placebo run - in . Those receiving metformin monotherapy entered directly into a 2-week, open - label, placebo run - in period . Subjects who met the inclusion criteria were then randomly assigned to treatment with linagliptin 5 mg once daily or glimepiride at an initial dose of 1 mg daily added to the current dose of metformin . The primary endpoint was the change in hba1c from baseline to week 104, and was stratified by baseline hba1c and previous antidiabetic therapy use . After 2 years of treatment, linagliptin was noninferior to glimepiride in reducing hba1c . The difference between the treatment groups met the noninferiority criteria and was 0.20% (p <0.125). As add - on to metformin, both linagliptin and glimepiride caused significant reductions in fasting plasma glucose and postprandial plasma glucose . The treatment differences for reductions in fasting and postprandial plasma glucose, respectively, were 6.31 mg / dl (p = 0.012) and 9.73 mg / dl (p = 0.0918, see table 2). The 12-week, multicenter, randomized, double - blind, placebo - controlled, five parallel - group study conducted by forst et al included patients with type 2 diabetes aged 2175 (mean 60) years with a body mass index of 2540 kg / m.14 patients were eligible if they were pretreated with metformin alone (baseline hba1c levels had to be 7.5%10%) or treated with metformin and one other oral antidiabetic therapy other than a thiazolidinedione (baseline hba1c levels had to be 7.0%9.0%). Eligible patients who had already received metformin monotherapy entered a 2-week open - label run - in phase . Patients who received metformin plus one other antidiabetic therapy entered a 6-week washout period, with the last 2 weeks being an open - label run - in phase . Three doses of linagliptin (1, 5, and 10 mg once daily) were explored when added to metformin . There was also an open - label treatment arm where patients were randomized to receive glimepiride (1, 2, or 3 mg once daily) as add - on therapy to metformin . The mean placebo - corrected lowering of hba1c levels was 0.39% for linagliptin 1 mg (p = 0.005), 0.75% for 5 mg (p <0.001), and 0.73% for 10 mg (p <0.001). The change in mean placebo - corrected hba1c from baseline was 0.90% for glimepiride . The reduction in hba1c with open - label glimepiride was numerically greater versus linagliptin, but not statistically significant . Fasting plasma glucose reductions were also found to be significantly greater with all doses of linagliptin than with placebo at week 12 . Postprandial plasma glucose changes were not addressed in this study (see table 2). This randomized, double - blind, placebo - controlled, multicenter, parallel - group study was conducted by gomis et al in 389 patients with type 2 diabetes and aged 1880 (mean 57.5) years.18 at baseline, the patients had hba1c concentrations of 7.5%11.0% (mean 8.6%) and a body mass index 40 kg / m . Patients pretreated with oral antidiabetic therapies underwent a 6-week washout period that included an open - label placebo run - in phase in the last 2 weeks . For treatment - nave patients, only the 2-week run - in phase was required . Eligible subjects were then randomized to receive pioglitazone 30 mg once daily and linagliptin 5 mg once daily or pioglitazone 30 mg once daily and placebo for 24 weeks . The primary endpoint was change from baseline hba1c, adjusted for baseline hba1c and baseline antidiabetic therapy, after 24 weeks of treatment . At the end of the study, the adjusted mean change in hba1c from baseline for linagliptin plus pioglitazone was 1.06% compared with 0.56% for placebo plus pioglitazone . Changes in fasting plasma glucose were assessed as a secondary endpoint, showing a significantly greater reduction for linagliptin plus pioglitazone than for placebo plus pioglitazone . Changes in postprandial plasma glucose were not addressed in this study (see table 2). A 78-week open - label extension conducted by gomis et al evaluated participants who had previously completed one of the four 24-week, randomized, double - blind, placebo - controlled parent trials.19 these subjects received either linagliptin monotherapy, linagliptin plus metformin, linagliptin plus metformin and sulfonylurea, or linagliptin plus pioglitazone . All patients receiving one of these treatments during a previous trial continued the same treatment for an additional 78 weeks (n = 1532). Those patients previously treated with placebo were switched to linagliptin monotherapy (n = 589). Overall, the cohort of patients had a mean age of 57.7 years and mean baseline hba1c of 7.5% . This extension study was conducted primarily to assess the long - term safety and tolerability of linagliptin . Secondary efficacy outcomes evaluated the changes in hba1c and fasting plasma glucose from baseline to 102 weeks . In participants randomized to treatment with linagliptin in the four previous trials, the mean change from baseline hba1c during the initial 24 weeks of treatment was 0.8% . This was maintained over the 78 weeks of the extension study, with a change from baseline hba1c of 0.8% . The largest observed reduction in hba1c from baseline to week 102 was in the group receiving linagliptin plus pioglitazone at 1.5% . This was followed by those patients receiving metformin and metformin plus a sulfonylurea in combination with linagliptin (0.7%). . Similarly, fasting plasma glucose values already reduced during the previous trials further decreased during the extension period . In subjects randomized to placebo in the previous trials and switched to linagliptin monotherapy in the extension phase, the change in mean hba1c was 0.90% . Fasting plasma glucose values also decreased from baseline over the study period (see table 2). Most adverse events with linagliptin were considered to be mild to moderate in nature . Adverse reactions that occurred in 2% of patients treated with linagliptin included nasopharyngitis, diarrhea, cough, urinary tract infection, and hypertriglyceridemia (in combination with sulfonylurea therapy), hyperlipidemia, and weight increase (in combination with pioglitazone).1 weight changes were reported or addressed in each of the studies above . No significant changes with regard to body weight were found when linagliptin was given as monotherapy . With regard to sulfonylurea therapy, two of the studies revealed an increase in body weight in patients treated with glimepiride versus those receiving linagliptin.14,17 however, in a study in which all patients received metformin and sulfonylurea therapy and were then randomized to placebo or linagliptin, no significant changes in body weight were seen.16 when patients received pioglitazone and either placebo or linagliptin, both groups showed an increase in body weight from baseline . The amount of weight gain was larger in patients receiving linagliptin, but the mean weight for patients receiving linagliptin was lower than that in patients receiving placebo at baseline.18 in general, linagliptin showed a low propensity to cause hypoglycemia . When used as monotherapy, no patients experienced hypoglycemia in the two studies reviewed.11,15 one study reviewing linagliptin as monotherapy versus placebo reported hypoglycemia occurring in one patient in each group.12 when combined with metformin and sulfonylurea, a higher percentage of patients receiving linagliptin experienced hypoglycemia versus placebo . However, a smaller percentage of patients experienced severe hypoglycemia when compared with placebo.16 three studies discussed or reported the occurrence of pancreatitis . One study reported zero cases15 while another study reported one case of pancreatitis in a patient receiving linagliptin.17 a 78-week, open - label extension study, which included 2121subjects, reported four cases of pancreatitis in patients who had received linagliptin for a total of 102 weeks, with two cases being acute and two chronic . This was an incidence of 0.2% in the overall treated set.19 according to the prescribing information, pancreatitis was reported more often in patients treated with linagliptin (21.9 per 10,000 patient years) versus placebo (eight per 10,000 patient years).1 one study prospectively assessed cardiovascular safety for linagliptin versus sulfonylurea (e.g. Glimepiride). Major cardiovascular events occurred in 2% of patients treated with linagliptin and 3% treated with glimepiride (p = 0.0213). This finding was mainly attributable to a significantly lower number of nonfatal strokes with linagliptin compared with glimepiride, without any relation to hypoglycemia.17 data from the clinical trials suggest that linagliptin administered as monotherapy or in combination with other antidiabetic therapies improves hba1c and reduces fasting plasma glucose.1119 when used as monotherapy, linagliptin resulted in a placebo - corrected change in hba1c ranging from 0.28% to 0.69%.11,12 when linagliptin was added to metformin or metformin and a sulfonylurea, similar hba1c reductions ranging from 0.39% to 0.75% were observed.13,14,16 when comparing linagliptin with glimepiride as add - on therapy to metformin, a numerically greater response was seen with glimepiride, but this was not statistically significant . However, when linagliptin was used in combination with pioglitazone, larger reductions in placebo - corrected hba1c of 1.06% were seen.18 those studies that evaluated the impact of linagliptin therapy on postprandial plasma glucose also reported an improvement.1113 when used as monotherapy, linagliptin decreased postprandial plasma glucose in the range of 27.257.7 mg / dl, and when used in combination with metformin, postprandial plasma glucose decreased by 66.7 mg / dl.1113 with this, the data suggest linagliptin used as monotherapy or in combination with other antidiabetic therapies offers improvement in glycemic control . Specific populations that may particularly benefit from linagliptin therapy should also be considered . In patients experiencing renal impairment precluding the use of metformin, linagliptin may have a niche in managing glycemia because it does not require dose adjustment in renal compromise . Several of the studies discussed in this review stratified the change in hba1c according to the baseline value . Reduction in hba1c was greater in patients with a baseline hba1c> 9%, offering another possible niche for linagliptin therapy . Dpp-4 inhibitors as a class are generally well tolerated . A minimal risk of hypoglycemia when used as monotherapy and lack of weight gain are some of the desirable characteristics of this class of medications . Overall, linagliptin has been shown to be well tolerated, with adverse events similar to others within its class . It is important to note that although linagliptin offers a low risk of hypoglycemia, this risk increases when this agent is combined with secretagogue therapy . Pancreatitis is also of concern and is a class effect of dpp-4 inhibitors, although the risk of the condition seems very low with this medication . A long - term safety and efficacy study evaluated linagliptin therapy in over 2000 patients for a total of 102 weeks and found an overall incidence of 0.2%.19 however, recent discussions have noted that the prevalence of pancreatitis among patients with type 2 diabetes is similar to that seen with incretin hormones . A study published in 2009 by noel et al found that patients with type 2 diabetes had an almost three - fold greater risk of pancreatitis than those patients without diabetes.20 this information suggests that there may not be an increased risk of pancreatitis with incretin therapy . It has a long half - life and undergoes less renal excretion, avoiding the need for dose adjustments in patients with renal impairment.6,9 however, to date, there are no head - to - head studies comparing the efficacy of this agent with other dpp-4 inhibitors in its class . Linagliptin is a newly approved dpp-4 inhibitor for use as a once - daily oral medication in the treatment of type 2 diabetes . The use of linagliptin as monotherapy or in combination with metformin or pioglitazone led to reductions in hba1c and fasting plasma glucose after 1224 weeks of therapy . This improvement in glycemic control was shown to be maintained for up to 102 weeks . It is generally considered to be weight neutral, unless used in combination with a thiazolidinedione, and has a low risk of hypoglycemia.
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.