text
stringlengths
0
868k
Fever in returning travelers is a common problem and usually the diagnosis is made within a few days or the traveler recovers, . We report here two travelers who presented with fever two weeks after returning from a six week vacation in south america . Over the following 18 months they presented with short attacks of fever, elevated crp and leukocytosis and a curious and key feature was, that they were completely synchronous both developing symptoms within an hour and presentation with the same laboratory findings of leukocytosis and elevated crp . After about a year it turned out that the couple used aroma oils (nature and decouvertes fig . 1) in the home applied by a nebulizer placed in the middle of a table . The oils were not used during summer, also explaining the absence of symptoms during the summer months . Since the use of the oils ended there has been no relapse in any symptoms . We are not aware of or have found any previous reports, in english or other languages, reporting similar events after the use of similar products . After traveling to south america for a six weeks tourist holiday the two patients returned home to denmark . Ten days after returning they were both admitted to hospital with fever, muscle and joint pains and vomiting . From the 8 september 2012 to the 22 october 2012 they spent 3 weeks in peru, half a week in bolivia, half a week in chile and 2 weeks in brazil . They traveled by local busses, stayed at medium level hotels and were not ill at any time during their travels . Prior to their travels they had received vaccines against hepatitis a and b, yellow fever and tetanus / diphtheria . Table 1 shows the patients history and table 2 lists crp, white blood cell count and recorded rectal temperatures . Day 0 is defined as the first day the couple was admitted to hospital, 10 days after the return from south america . There was no eosinophilia at any given time and the total ige remained normal throughout . Approximately nine episodes occurred within the following 18 months, all attacks being identical in symptoms, duration and paraclinical results for both patients (table 2). Initially the patients were tested negative for malaria and dengue fever . Under the suspicion of a rickettsial infection they were treated with doxycycline 100 mg two times daily initially for one week . This was immediately afterwards repeated again for one week . After the third relapse, day 20, the patients received 3 months doxycycline 100 mg two times daily plus moxifloxacin 400 mg 1, as it was believed they previously had had a good effect . The patients went through an elaborate program of serological tests and test for nucleic acids of different pathogens, which is summarized in table 3 . Through the whole course a wide range of tests were performed including heart echocardiography, pet - ct and an mri which were all normal . Definition of travel associated disease is a patient who has crossed an international boarder within the past 10 years and presents for a presumed travel - related disease . It is not uncommon for travelers to report an illness associated with their travels (2070%), but only a small portion of these actually seek medical attention,, . A detailed medical history is a very important tool in correct diagnosis, including destinations, risk factors, previous medical history . Incubation time is also important to keep in mind through the process (table 5),, . The geosentinel surveillance program has found that the most common causes of fever after traveling is malaria, dengue fever, enteric fever (salmonella typhi) and rickettsioses . Initially malaria and dengue fever were excluded and the patients were treated with doxycycline under the presumption of a rickettsia or bartonella infection . When the fever attacks continued we excluded endocarditis due to coxiella burnetii (q fever) and looked for south american trypanosomiasis due to trypanosoma cruzi (chagas disease), which can be transmitted orally through fresh fruit juice . We speculated that toxoplasma gondii was a possibility as t. gondii genotypes in south america are more pathogenic compared to europe, but only one of the subjects had antibodies at a low titer, not compatible with an acute infection . Leptospirosis was also a diagnostic option, especially with a second phase of fever shortly after the first; this was however also excluded by a negative serology . Acute schistosomiasis and other parasites were ruled out as there was no eosinophilia or elevated total - ige in either patient . Different centers were asked to assist with this case, including unit des rickettsies, france, porton down, uk and center for disease control and prevention (cdc), united states . See table 3, table 4 for list of all the test and results found on the patients . Cytomegalovirus and epstein barr virus were also considered as they are a common cause to fever of unknown origin in adults . Hiv and other sexually transmitted diseases were also screened for and these results were also negative . The patients were not tested for histoplasmosis as this rarely causes a prolonged course of disease in immunocompetent patients . Throughout the long period of symptoms with this couple it became more and more apparent that it was not an infectious agent at play . The attacks were short lived and the crp and leukocytosis normalized within a few days . Malignancy and inflammatory diseases were also ruled out as the cause of the recurrent fever . Both patients had a slight dry cough and small, non - tender, lymph glands at several stations . One would expect the patients to react differently to the same infectious agent as their immune systems are different as they differ genetically . We, therefore, started searching for an agent they could both be exposed to in the home . All the symptoms seemed to occur during autumn, winter and spring during which the windows are closed . It is therefore believed to be repeated exposure to aroma oils (nature and decouvertes) that is the cause of the symptoms . Since the exposure has stopped there have been no more events . For ethical reasons it has not been possible to test with expose . The oils used here were nebulized and we assume that the two patients inhaled a high concentration of the nebulized oils over a short time . This was actually recommended by the manufacturer and the oils and table top nebulizer was purchased together . As mentioned earlier, we are not aware of reports of any similar events after using other similar products . The investigational program was build up over time as new attacks continued to occur and suggestions from different centers which were consulted were followed up . The number of tests performed at different laboratories took time and emphasizes that a panel of analysis in returning travelers with continued symptoms but without a clear diagnosis should be developed . Written informed consent was obtained from the patient for publication of this case report and accompanying images . A copy of the written consent is available for review by the editor - in - chief of this journal on request.
Hirsutism is an abnormal growth of terminal hairs in areas dependent on androgen in women and is referred as an increase of unwanted hairs more than what is acceptable in a race or society . Hirsutism is a cultural attitude and what is considered hirsutism in one culture may be considered typical in another . For example, a woman who is regarded hirsute in a culture may be completely normal in another culture . In the conducted studies, the difference in iran from the foreign studies is probably due to racial difference and difference of age groups of the studies . Hirsutism is a symptom of hyperandrogenism and different causes such as polycystic ovary syndrome (pcos), congenital adrenal hyperplasia, androgen - secreting ovarian and adrenal tumors, cushing syndrome, pregnancy, hyperprolactinemia, gonads disorders, drug intake, and idiopathic causes can induce it . Its prevalent symptoms include obesity, acne, menstrual disorders, and alopecia which can cause affliction of the person with pcos . About half of the hirsute people are obese, and there is a significant relationship between obesity and hirsutism in different studies . Hyperprolactinemia is observed in about 510% of the patients with amenorrhoea which is almost accompanied by galactorrhoea and one of its important complications is infertility . Considering frequency of hirsutism and failure to study prolactin (prl) level in patients, the performance of this study about hirsutism causes can help confront with the hirsute patients to find the main cause and determine a suitable solution for patients . In this cross - sectional study, all patients with hirsutism referring to the dermatology clinic of babol city, northern iran, were included in the study . After giving necessary explanations about this study and receiving a letter of consent, a questionnaire including a history of the disease and physical examination history of disease included age, marital status, term of affliction with hirsutism, menstrual disorder (<21 days and more than 35 days), history of galactorrhoea, history of androgenic alopecia, history of hirsutism, history of thyroid disease, pcos, and treatment for infertility (bromocriptine, clomiphene, and metformin). Morning venous blood samples were obtained after a 12 h overnight fasting from the subjects at days 2 to 3 of a menstrual cycle, and immediately centrifuged, and the serum was frozen and stored until all the samples from all the cases had been collected . Follicle stimulating hormone (fsh), luteinizing hormone (lh), prl, dehydroepiandrosterone sulfate (dhea - s), 17-oh progesterone, testosterone, sex hormone - binding globulin (shbg), thyroid - stimulating hormone (tsh), t3, and t4 tests were performed for all patients . In case, there was suspicion about pcos syndrome, pelvic ultrasonography was requested for the patients . According to the definition, the cases with more than ten cysts with dimensions of 28 mm in ovary were called pcos . In the case of confirming the diagnosis, a chemiluminescence immunoassay system was used for the determination of sex hormones (diasorin, germany). Testosterone of more than 1.2 ng / ml, dhea - s of more than 340 g / ml, prl of more than 27 ng / ml, lh of more than 27 iu / l, and fsh of more than 15 iu / l, 17-hydroxy progesterone of more than 300 ng / ml, shbg of more than 20 nmol / l, tsh of more than 5.1 miu / ml, t3 of more than 3.1 data were collected and coded . After being recorded in the designed tables, it was entered in version 21 of spss version 21 for windows (ibm corp, armonk, ny, usa) and then statistically analyzed . The obtained information was described by presenting tables of frequency and the related figures . To describe qualitative characteristics, frequency and percent were used and for quantitative characteristics, mean and range of variations were used . To compare qualitative variables, chi - square test was used and to determine the relationship between quantitative variables, a t - test was used in case of normal distribution . During the study period, 200 patients were included . The mean age of the studied people was 26.17 6.05 years . The minimum age of patients was 16 years, and the maximum age was 45 years . Eighty - five patients (42.5%) were single, 115 (57.5%) were married, and 23 married patients (20%) underwent pharmacotherapy due to infertility . Half of the patients (100 patients) had regular menses, whereas the remaining 100 patients had irregular menses . Sixty percent found to have a first - degree family history of hirsutism . In studied patients, 18 patients (9%) had galactorrhoea, 45 patients (22.5%) had androgenic alopecia, and 29 patients (14.5%) had the history of ovary cyst . Out of the 200 patients in the study, 25 patients (12.5%) had hyperprolactinemia . The mean level of prl in the studied people was 16.69 7.24 ng / ml . Table 1 shows the comparison of the patients complaint with hyperprolactinemia . Comparing the studied variables with hyperprolactinemia in the studied patients the mean age of the people with hyperprolactinemia was 26.16 5.51 years, and the mean age of the people without hyperprolactinemia was 26.17 6.13 years . The mean age between the people with hyperprolactinemia and the people without hyperprolactinemia did not show a significant difference (p = 0.914). Hyperprolactinemia was found in two patients with galactorrhoea (8%), three patients with androgenic alopecia (12%), five patients with androgenic alopecia (12%), five patients with the history of ovary cyst (20%), one patient receiving drug for infertility (among 115 married women), and 15 patients with positive family history of hirsutism . There was no significant difference between these cases and hyperprolactinemia, but there was a significant difference between regular menses and hyperprolactinemia [table 1]. In general, measurement of dhea - s level showed that 18 patients (9%) had a serum level more than 340 g / ml, and there was hyperprolactinemia in two patients . Twenty - two patients (11%) had hypothyroidism, and all of them underwent treatment . Thyroid serum tests were normal in all treated cases, but three cases of these patients had hyperprolactinemia . After measuring lh and fsh and calculating the ratio of lh to fsh, lh / fsh ratio was more than 3 in four patients who did not have hyperprolactinemia, and ovary lesions were not found in these four patients after performing ultrasonography . Testosterone level was abnormal in 62 patients (31%) among whom 19 patients had hyperprolactinemia in 11 patients with high testosterone, dhea - s was high but they did not have hyperprolactinemia . Hirsutism makes different problems for women due to the creation of hairs in some parts of the body which are visible . For this reason, many patients who refer to treat hirsutism are young women so that mean age of the studied people was 26.18 6.05 in this study, and most patients were in age group of 2125 years . The mean term of affliction with hirsutism in the studied people was 4.96 3.75 years . Similar to our study, the patients with hirsutism are young women in similar studies . In a study by farnaghi et al ., which investigated 110 patients with hyperprolactinemia in the razi hospital of tehran, mean age of the patients was 29.7 3.2 years with an age range of 1638 years . The term of affliction with hirsutism was 8 months to 7 years with the mean age of 4.2 1.2 years . In the study by tirgar - tabari et al ., most patients (70.1%) were in age group of 2023 years . In the study by rahimnejad et al . In southern iran, which 81 patients with hirsutism were studied, mean age was 22.5 0.5 years (between 13 and 41 years). Considering that one of the symptoms of endogenous glands diseases particularly ovary diseases is irregular menses, irregular menses was also investigated in this study . In our study,, 38% in study by tirgar - tabari, 23.4% in study by yazdanfar et al ., 19.8% in study by ghaderi et al ., and 52% in study by rahimnejad et al . Difference in the reported percent can be attributed to other diseases and racial and hereditary causes . In our study, 60% of the patients had a positive family record in the first degree relatives in terms of affliction with hirsutism . In different studies, different percent have been reported in terms of positive family record among people with hirsutism . A positive family record of hirsutism was found in 29% of patients in study by farnaghi et al ., 28% of patients in study by tirgar - tabari, 72.8% in study by rahimnejad et al ., 40.7% in study by yazdanfar et al ., and considering high positive family record in our study, it can be said that genetic has played an effective role in hirsutism . It should be considered that there is a strong family relation in some endogenous glands such as pcos or adrenal congenital hyperplasia one of which is hirsutism . In this study, 9% of the patients had galactorrhoea, 22.5% had androgenic alopecia, and 14.5% had ovary cyst record . Moreover, 23 out of 115 married patients (20%) underwent pharmacotherapy due to infertility . In a study by tirgar - tabari et al . Low rate of androgenic alopecia in our study can be due to the exclusion of the patients with pco because androgenic alopecia is one of the manifestations of pcos syndrome . In our study, 25 patients (12.5%) had hyperprolactinemia . Hyperprolactinemia was found in two patients (8%) with galactorrhoea, three patients (12%) with androgenic alopecia, five patients (20%) with a history of ovary cyst, one patient receiving the drug for infertility (115 married women) and 15 patients with a positive family record of hirsutism . There was a significant difference between menstrual disorder and hyperprolactinemia . Comparison of mean age between the people with hyperprolactinemia and the people without hyperprolactinemia and comparison of the mean term of affliction with hirsutism between the people with hyperprolactinemia and the people without hyperprolactinemia did not show a significant difference . Hyperprolactinemia was 12.5% in our study, 22.8% in the study by ahmad et al ., 0.3% in the study by azziz et al ., 0% in the study by carmina et al ., and the important point of our study is that the patients with pcos, which may be accompanied by hyperprolactinemia, were excluded from the study unlike other studies so that high prl level is not be a confounding factor due to affliction with pco . Prolactinoma is the most prevalent pituitary gland tumor which secrets high amount of prl and can cause hirsutism, infertility, galactorrhoea, acne, and headache . Pituitary gland tumors should be considered in the people with high prl . Although increase in the concentration of blood prl can be due to pregnancy, primary hypothyroidism, intake of some drugs (chlorpromazine, perphenazine, haloperidol, metoclopramide, alpha methyldopa, resertin, opioids, amitriptyline, fluoxetine, verapamil, estrogen, and antiandrogen) and pcos . In our study, despite the exclusion of patients with pco, the prevalence of hyperprolactinemia was high . Therefore, high serum prl level should be considered in the referring people with hirsutism . Considering the importance of hyperprolactinemia as one of the causes of infertility and unawareness of patients with hirsutism, the hirsute patients particularly those with a positive family record of hirsutism are recommended to inform the physician and necessary studies should be conducted in this regard . The present work was supported by a grant from the babol university of medical sciences . No additional external funding received for this study . The present work was supported by a grant from the babol university of medical sciences . No additional external funding received for this study.
Breast cancer (bc) is the most common malignant tumor among women in the world and is the second cause of death in women between the ages of 3555 in developed countries . Bc can be divided based on molecular criteria into distinct phenotypes: the molecular subtypes are classified by (1) expression of estrogen receptors (ers) and/or progesterone receptors (prs), (2) human epidermal receptor 2 (her2/erbb2) amplification and (3) a triple negative type (er / pr and normal expression of her2). While estrogen has normal biological roles, such as reproduction, brain development and additional protective effects of sexual steroid hormones, prolonged exposure, combined with high levels of hormone increases the risk of bc by constitutively activating the transcription of genes predominantly implicated in metabolism and cell cycle regulation . Ers exist as two isoforms (er and er) that belong to the family of transcriptional receptors and recognize and bind to a specific dna consensus sequence to facilitate the transcriptional initiation of hundreds of target genes . Following estrogen treatment, the hormone binds to the e - domain of ers, induces er dimerization and favors its nuclear translocation, where the dimer finally interacts with dna on the estrogen response element (ere) and induces the activation of estrogen regulated genes (fig . 1). However, following estrogen stimulation, the transcription of additional genes lacking an evident ere is also activated in response to er interaction with particular transcriptional factors (tfs) such as ap-1, sp1 or nfkb . In the latter cases, mechanisms of er - dependent transcriptional activation are indirect and mediated by the recruitment of er on tf boxes (a) schematic representation of er domains and their potential interaction with co - activators / co - repressors and ere . (b) recruitment of liganded er on dna is mediated directly on ere or not directly via sp1 or nfkb interaction . Changes in gene expression caused by genetic mutations, which lead to oncogene activation or tumor suppressor gene silencing, have been studied in bc etiology and correlated with bc risk in a recent meta - analysis . For example, mutations in brca1/2 genes were frequently observed in hereditary bc . Over the last two decades, the idea of an epigenetic control of gene expression in diseases other than genetic disorders has emerged . This includes the deregulation of genes that participate in tumorigenesis initiation and progression . In the latter case, the outcome of both genetic and epigenetic modifications is an aberrant overexpression and/or silencing of genes implicated in cell proliferation and/or in the control of cell death . Epigenetic pathways regulate gene transcription by two different mechanisms that are not mutually exclusive: dna methylation and post - translational modification of histones . Dna methylation occurs in 23% of cytosines in cpg islands and is not randomly distributed throughout the dna as these sequences are mostly located in the upstream region of promoters . Dna methylation is implemented by a family of enzymes referred to as dna methyl transferases (dnmts) 1, 2, 3a, 3b and 3l . Promoters with a high density of cpgs are defined as cg - rich areas and are predominantly subject to dna methylation . Methylated dna is generally associated with a decreased tf binding capacity that diminishes / abolishes transcriptional expression of the corresponding gene . Two distinct forms of dna methylation processes have been described, the first is inherited dna methylation or maintenance dna methylation and is predominantly catalyzed by dnmt1, the second is de novo dna methylation and is performed mainly by dnmt3a and dnmt3b . Maintenance dna methylation permits the conservation of dna methylation patterns after dna replication by copying methylation on the newly synthesized strand using the hemi - methylated dna as a matrix . Conversely, de novo dna methylation occurs on both strands of unmethylated dna (for a review see ref . Artificial disruption of dna methylation complexes or invalidation of dnmt1 in normal cells leads to a decrease in global dna methylation and induces tumor formation in nude mice . This phenomenon is promoted by reactivation of non - coding repetitive elements leading to chromosomal instability and abnormal gene expression . Besides global dna hypomethylation, both local hypo and hypermethylation of promoters nucleosomes are made up of a duplicate of histones h2a, h2b, h3 and h4 enclosed in a dna loop and regulate chromatin compaction as well as tf accessibility for transcription initiation . Histone code refers to the sum of these modifications and allows a prediction of a favorable or unfavorable chromatin status for gene transcription . Acetylation of lysines in histones is associated with an uncondensed chromatin status, accessibility of tfs, and is processed by histone acetyl transferase (hats), while these acetyl groups are removed by histone deacetylases (hdacs). Histone methyl transferase (hmt) or histone demethylases (hdm), respectively, catalyze the methylation or demethylation of lysine or arginine in histones and these modifications favor the compaction or relaxation of chromatin, depending of the methylated residue (for a review see ref . Anti - estrogen therapies are used in treatment of bc but are inefficient in er negative patients . In these therapies, the most used drug over the past 50 years is tamoxifen, a competitive inhibitor of estradiol that binds to er. More recent pharmacological molecules include selective er down - regulators (sedrs), which inhibit er dimerization and nuclear translocation or aromatase inhibitors, which target the enzyme responsible for estrogen synthesis . As described above, estrogen dependent genes are controlled by er and er. However, a frequent decrease in er expression was observed in bc and may occur during the course of the disease . Er breast cancers were observed in 20% of low and 50% of high grade bc patients . Er expression status is paradoxical in bc . High er expression in high grade bc correlates with a better outcome, a lower aggressiveness and a better response to anti - estrogen therapies compared with er patients . This may be explained by the dual role of er in both proliferation and differentiation . Some studies also suggest that dna methylation - mediated promoter esr1 (estrogen receptor 1 gene) silencing is found frequently and may participate in tumorigenesis or progression of the disease in other cancers, such as leukemia or colon tumors . The etiology of the loss of expression of er (about 30% of bc patients are er) is due to dna hypermethylation in 41% of cases, which correlates with tumor size and histological grade . Moreover, a recent study on bc patients in india revealed that the proportion of esr1 hypermethylation was highly increased in triple negative tumors . For example, a 5 d bisphenol a (bpa) exposure in neonatal male rats induces persistent esr1 promoter hypermethylation in adults, associated with increasing levels of dnmts . Inactivation of dnmt1 using sirna or treatment with dna methylation inhibitors such as 5-azadeoxycytidine, restores er expression in er negative bc cells . As such, in addition to immunodetection of er, detection of esr1 methylation status may aid in predicting a response to anti - estrogen therapies in bc patients . Proposed a model of epigenetic inactivation of the er promoter (fig . 2). In er bc cells such as the mcf7 cell line, an activator complex composed of prb2/e2f4/5/hdac1/suv39h1/p300 binds to a region containing e2f boxes close to the initial transcription site in the esr1 promoter . The authors proposed that repressor activity of both hdac1 and the hmt suv39h1 might be overcome by the hat activity of p300 . Methylation of cpg by dnmt3a/3b in this promoter may induce the recruitment of icbp90 (inverted ccaat box binding protein of 90 kda) and consequently facilitate the replacement of p300 by dnmt1 in the repressor complex prb2/e2f4/5/hdac1/suv39h1/dnmt1 found in er- bc, mda mb231 cells . A further recruitment of mecp2 to an er methylated promoter may also participate in complete er repression, as illustrated in figure 2 . These epigenetic signals, in particular dna methylation near the ap-2 binding site, induce a repressive chromatin, blocking the loading of tfap2c, further rnap ii recruitment and thus transcription of esr1 . A recent study in male tissues revealed that among the methylated cpgs close to the esr1 promoter, the methylation of one particular cpg (located in the + 1 kb intragenic region of esr1) correlates with low esr1 expression . This cpg is included in a tgif box, and its methylation provokes the recruitment of the repressor tgif, targeting of hdac1 and esr1 silencing . Interestingly, methylation status of esr1 in these tissues was not sensitive to estrogen exposure . Moreover, in mcf7 cells, estrogen treatment induces esr1 repression in an er-mediated mechanism: while coactivators and er are found at both distal and proximal esr1 promoters, sin3a / er complex is specifically recruited on the proximal promoter and represses esr1 transcription . Figure 2 . Primary methylation and recruitment of icbp90 on er promoter, provoke histone deacetylation and a large secondary methylation and er silencing . Ac, acetylation of histones; white circles symbolize unmethylated cpgs and black circles symbolize methylated cpgs . However, one study has demonstrated a frequent occurrence of esr2 promoter methylation in er- bc in chinese women . Indeed, esr2 methylation was significantly higher in high grade bc (45%) than in starting neoplasia and was strongly correlated with esr1 methylation, suggesting common epigenetic mechanisms of regulation . Similarly, hypermethylation of esr2 was also identified in prostate tumors and present on 3 cpg islands during disease progression . All of these observations strongly suggest a role of epigenetics in the inactivation of esr genes in hormone dependent cancers . Hdac inhibitors (hdaci) such as entinostat or valproic acid, have been tested in bc cells and efficiently restored both er expression and letrozole sensibility in er bc in vitro and in vivo . The association of hdaci or 5-azadeoxycytidine with a treatment inducing overexpression of tfap2c might improve esr1 expression in er patients . A combined hdaci and 5-azadeoxycytidine treatment surprisingly however, addition of tamoxifen does not produce a tumorigenic response in er bc cells . Demonstrated that a better response to tamoxifen in bc cells, correlated with a lower level of the rna - stabilizing hur protein . Tamoxifen treatment increased hur content, and contributed to its own resistance while hdaci/5-azadeoxycytidine decreased hur . Preliminary treatment with hdaci/5-azadeoxycytidine was given before delivering tamoxifen to attempt to obtain the best tamoxifen sensitivity . The precise roles of tamoxifen are complex: although it competes with 17-estradiol to bind to er, er bound to tamoxifen is still able to target the tff1 (also called ps2) promoter without constitutive activation of gene transcription . The loss of transcriptional activity of the tamoxifen - er complex is mediated by changes in the balance of co - activators / co - repressors and er-interacting partners . How epigenetic changes affect the transcriptional response of estrogen stimulation in cancer, and particularly in bc, is still poorly understood . However, several groups have shown a connection of both estrogen and er in epigenetic regulation . Several reports suggest that er cooperates with co - activators to epigenetically regulate estrogen responsive genes . Only a small percentage of genes with putative ere are really activated following estrogen stimulation, suggesting that additional proteins could specifically control er - responsive gene pathways . Maximal er-mediated transcription requires the addition of some epigenetic changes and the removal of others . Estrogen bound er orchestrates the recruitment of hats (p300 and cbp) and hat coactivators of the p160 family (src1/src2/src3) to modulate chromatin status and allow rnap ii recruitment . Indeed, overexpression of src3 increases bc cell proliferation, while inhibition of src1/src2 blocks their proliferation . Moreover, in the absence of estrogen stimulation, a direct interaction between hdac1 and unbound er, via its af2 and dna binding domains, is constitutive in bc and inhibits its activity . Methylation of histones and the enzymes that control this methylation are highly implicated in estrogen signaling . An increase in the epigenetic mark h3k4me3 is generally associated with positive effects on transcription and such an increase on the tff1 promoter is due to a direct interaction between er and the protein linker men1 . Based on studies done on jmjd2b / mll2/er interactions, a model was developed in which demethylation of h3k9me by the hdm jmjd2b (jumonji domain - containing protein 2b) is first required for the further methylation of h3k4 by mml2 . An increase of h3k4me3 after direct interaction between er and mll 24, via its lxxll domain, was required for activation of cathepsin, liver x - receptor genes . Besides methylated marks, removal of other methylation may also be implicated in estrogen responsive gene regulation . Recruitment of the hmt smyd3, whose levels increase in bc, was also able to produce the tri - methylation of h3k4me3 and was mediated by both a direct er/smyd3 interaction on the ere of the tff1 promoter and/or by the identification of the ser10 phosphorylation mark on histone h3 . The hdm lsd1 (lysine specific demethylase, also called kdm1) also contributes to h3k9 demethylation on er targets genes and recruitment of coactivators but this required the presence of activated er. In some other genes, however, recruitment of lsd1 also follows h3k9 deacetylation and provokes h3k4 demethylation, which is unfavorable to transcription . The specificity of h3 methylated substrate on er target loci such as tff1 promoter, is orchestrated by the co - recruitment of pelp1/activated er/lsd1 . Pelp1 (proline glutamic acid and leucine rich protein 1) is a reader of methylation marks that recognizes both h3k4me2 and h3k9me2 but its interaction with er and lsd1 decreases the lsd1-mediated hdm activity on h3k4me2 in favor of h3k9me2 demethylation and increased er target gene expression . Moreover, the early engagement of some factors on condensed chromatin, in a specific sequence that is dependent of an epigenetic signature, refers to a class called competence or pioneer factors . Magnani et al . Reported that the association of activated er with the pioneer factors pbx1 (pre - b - cell leukemia homeobox 1), and foxa1 (forkhead box a1) considerably increased estrogen dependent transcriptional response via pbx1-dependent identification of h3k4me2 and chromatin remodeling . Expression of carm1 (coactivator - associated arginine methyltransferase), a coactivator of er, correlates with low grade bc and with a decrease in bc cell proliferation . Carm1 is believed to partially govern the proliferation / differentiation balance in bc by controlling 16% of estrogen dependent genes . While mechanisms implicating carm1 are complex and still under investigation, carm-1-mediated h3r17me and h3r26me seems to be implicated in estrogen response, while methylation of p300 may regulate its activity . A direct interaction between free er and phosphorylated carm-1 may be used to recruit other coactivators, while association of carm-1 with activated er may require a p160 coactivator src-2 . Indeed, carm1-mediated cbp methylation is required for cbp recruitment to some er target genes and increases its hat activity . Fewer studies have been performed to identify er coactivators . Indeed, as has been observed for er/mll interactions, mll1 - 4/er complexes however, er/enos (endothelial nitric oxide synthase) complex was observed in prostate cancer and provoked the activation of htert, msh2, cyclind1 and tff1, 4 genes previously identified in prostate cancer grading . On the other hand, this complex was also associated with the epigenetic repression of gstp1 expression, a gene frequently silenced in prostate tumors . Further investigation will be necessary for a better view of the mechanisms controlling epigenetic - mediated er target gene expression . Although the link between er and upregulation of gene transcription is well studied, some transcriptome analyses have revealed that about 50% of er target genes are downregulated following estrogen treatment . Indeed, estrogen exposure or er loss using both chemical mimetics or sirna, leads to epigenetic modifications in er target genes requiring both histone modifying enzymes and dnmts . Hmt ezh2 (enhancer of zeste homolog 2) is a polycomb protein that catalyzes h3k27me3, a chromatin repressive mark . A high level of ezh2 has been reported in several cancers and is associated with malignancy and the grade in bc . Interestingly, an increase in ezh2 expression both in mcf7 and in vivo, was also reported following estrogen - like exposure . Overexpression of ezh2 induces a decrease in the expression of numerous genes, in particular in the er responsive gene pathway . Ezh2-mediated h3k27me3 on er target genes in bc cells requires ezh2 interaction with rea (repressor of estrogen activity) which preferentially targets ere and may also recruit hdacs for complete gene silencing . On the other hand, bcl2 is an estrogen responsive gene encoding a major anti - apoptotic protein, upregulation of which is often observed in many cancers including bc . Bcl2 is normally silenced by ezh2-mediated repressive mark h3k27me3 in its enhancer, promoting the recruitment of other polycomb group proteins (prc1 and 2). Constitutive s21 phosphorylation - mediated inhibition of ezh2 following pi3k / akt activation in her2 positive bc and/or demethylation of h3k27me via er/jmjd3 complex recruitment on bcl2, induce gene expression and contribute to apoptosis resistance in bc . Er methylation appears essential for non - nuclear functions of er such as activation of akt following er/src / pi3k interaction . Prmt1-mediated r260 methylation of cytosolic er within its dna interacting domain occurs rapidly after estrogen treatment and er hypermethylation has been reported in 55% of bc . This methylation also required p160 coactivators and is implicated in the non - genomic functions of er, leading to a constitutive activation of akt signaling and a promotion of proliferation and survival signals . In fact, epigenetic silencing of er target genes was most frequent in er than in er patients and was comparable to the panel of epigenetic modifications observed in mcf7 following er inactivationby rnai . According to the literature, dna methylation and histone modification can cooperate to govern the sequence of epigenetic events leading to the silencing of one gene . Dna methylation and histone modification can be catalyzed within the same complex or successively by independent complexes . Investigations on the kinetics of the addition of epigenetic marks on er target loci revealed that chromatin remodeling begins 36h after er invalidation . First, hdac1 and the polycomb co - repressors yy1 and ezh2 are recruited while addition of persistent heritable epigenetic marks via dnmt1 recruitment occurs only at 168h . Local hypermethylation in bc may be the consequence of an increase in dnmts followed by mecp2 induction, as was observed in rats treated with high amounts of estrogen . Following estrogen exposure, a similar increase in both dnmt3b expression and activit, in endometrial cancer cells was reported and could be inhibited by an er antagonist, suggesting a direct implication of er in dnmts regulation . However, diethylstilbestrol exposure in mice provokes a decrease in dnmts and sp3 on day 5 while sp1 levels only decreased at day 14, followed by demethylation of several dna loci . Dnmt3a / b expression is under estrogen regulation in normal female tissues . To date, the effects of estrogen and the er pathway on the recruitment of sp1/sp3 to dnmt promoters have not been investigated . This could be studied with folate treatment, which preferentially permits the recruitment of sp3 in detriment to sp1 and increases dnmt genes transcription . Relative amounts and/or preferential recruitment of sp1/sp3 may explain the tissue - specific response to estrogen exposure . Indeed, hypermethylation of ercc1, xpc, ogg1 and mlh1 genes, all involved in dna repair, after estrogen treatment contributed to chromosomal instability and mutations that occur in bc . Conversely, expression of hoxa10 was increased following bpa exposure and ere hypomethylation . Moreover, some experiments show that estrogen exposure of breast progenitor cells induces epigenetic modifications and confers a cancer - like methylome in these cells, suggesting a possible role of epigenetic modifications in breast progenitor cells in the initiation of bc . Epigenetic modifications (global dna hypomethylation and histone modifications) occurred as soon as 6 weeks in treated rats, while evident signs of neoplasia could be detected only after 12 weeks . Indeed, estrogen stimulation provoked long - range epigenetic silencing (lres) in a cluster of 14 genes located at 16p11.2 in normal breast cells . The silencing is mediated by er translocation into the nucleus and addition of epigenetic marks such as h3k27me3 . Prolonged estrogen exposure induces progressive dna methylation which confers a persistence of epigenetic modifications, similar to those of neoplastic cells . Expression of glut-4 in mef cells required the interaction between er and the glut-4 promoter, which prevented methylation of cpg 11 and therefore allowed the recruitment of sp1 to this region and activation of transcription . Progression of pre - cancerous lesions provoked by estrogen exposure in neoplastic lesions required continuous exposure to estrogen in aci rats . Indeed, removal of estrogen treatment after 4 weeks followed by 8 weeks of recovery induced a regression of hyperplasia in conjunction with modifications in dnmts expression . Epigenetic mechanisms implicated in er target gene silencing seem highly variable and require different co - repressors . Indeed, ctcf (ccctc - binding factor) recruitment on the cdkn1c promoter following estrogen stimulation lcor, a repressor able to bind to ligand - associated receptors to repress their transcriptional activity also interacts with nuclear hdac6 and attenuates specific er target genes, including igfbp4, but not tff1 in bc cells . Moreover, the lcor / ctbp1 repressor complex interacts with hdac1 and er on tff1 and other estrogen responsive promoters . Nevertheless, hdac7-mediated gene silencing was not related to the weak hdac activity of hdac7 but rather to additional properties of this protein . (peptidylarginine deiminase iv) interaction was also associated with tff1 silencing . Indeed, this complex provoked h3r deimination, resulting in either a blockade of h3r methylation or in a demethylation of monomethylated h3rme and therefore inhibited the addition of the positive transcriptional mark h3rme2, normally processed by carm1 or prmt1 (h3r17me and h4r3me). On the other hand, carm1-mediated h3rme2 blocks h3r deimination and allowed the recruitment of er to the active tff1 promoter . Sin3a is frequently associated with hdac1/2 in the sin3 repressor complex and can also be involved in er - mediated gene silencing (including esr1) via its multiple interactions with both additional repressors and er. Similarly, mta1 (metastasis associated antigen 1), the expression of which correlates with bc progression, can also bind hdac1/2 and er and participate in er - mediated gene silencing such as brca1 silencing . Brca1 was associated with a repression of a subset of estrogen responsive genes in 293 t cells while its overexpression induces an almost 90% decrease in er target gene expression, including tff1, in mcf7 cells . This inhibition required a direct interaction between active er and brca1 (aa 338379 of er) and their co - recruitment on ere which blocked further er recognition by coactivators such as p300 . Increasing concentrations of estrogen or overexpression of cyclin d1 which antagonizes and excludes brca1, induces estrogen responsive genes . Cyclin d1 is frequently overexpressed in bc and its interaction with er increases p160 recruitment and promote estrogen signaling . A strong correlation between foxa1 and er recruitment on activated / silenced genes after estrogen exposure was reported following high scale chip analysis, suggesting a cooperation between tf and er not only in gene activation but also in their silencing . (a) schematic representation of action of coactivators and corepressors . (b) direct and indirect interactions of er with how epigenetic changes affect the transcriptional response of estrogen stimulation in cancer, and particularly in bc, is still poorly understood . However, several groups have shown a connection of both estrogen and er in epigenetic regulation . Several reports suggest that er cooperates with co - activators to epigenetically regulate estrogen responsive genes . Only a small percentage of genes with putative ere are really activated following estrogen stimulation, suggesting that additional proteins could specifically control er - responsive gene pathways . Maximal er-mediated transcription requires the addition of some epigenetic changes and the removal of others . Estrogen bound er orchestrates the recruitment of hats (p300 and cbp) and hat coactivators of the p160 family (src1/src2/src3) to modulate chromatin status and allow rnap ii recruitment . Indeed, overexpression of src3 increases bc cell proliferation, while inhibition of src1/src2 blocks their proliferation . Moreover, in the absence of estrogen stimulation, a direct interaction between hdac1 and unbound er, via its af2 and dna binding domains, is constitutive in bc and inhibits its activity . Methylation of histones and the enzymes that control this methylation are highly implicated in estrogen signaling . An increase in the epigenetic mark h3k4me3 is generally associated with positive effects on transcription and such an increase on the tff1 promoter is due to a direct interaction between er and the protein linker men1 . Based on studies done on jmjd2b / mll2/er interactions, a model was developed in which demethylation of h3k9me by the hdm jmjd2b (jumonji domain - containing protein 2b) is first required for the further methylation of h3k4 by mml2 . An increase of h3k4me3 after direct interaction between er and mll 24, via its lxxll domain, was required for activation of cathepsin, liver x - receptor genes . Besides methylated marks, removal of other methylation may also be implicated in estrogen responsive gene regulation . Recruitment of the hmt smyd3, whose levels increase in bc, was also able to produce the tri - methylation of h3k4me3 and was mediated by both a direct er/smyd3 interaction on the ere of the tff1 promoter and/or by the identification of the ser10 phosphorylation mark on histone h3 . The hdm lsd1 (lysine specific demethylase, also called kdm1) also contributes to h3k9 demethylation on er targets genes and recruitment of coactivators but this required the presence of activated er. In some other genes, however, recruitment of lsd1 also follows h3k9 deacetylation and provokes h3k4 demethylation, which is unfavorable to transcription . The specificity of h3 methylated substrate on er target loci such as tff1 promoter, is orchestrated by the co - recruitment of pelp1/activated er/lsd1 . Pelp1 (proline glutamic acid and leucine rich protein 1) is a reader of methylation marks that recognizes both h3k4me2 and h3k9me2 but its interaction with er and lsd1 decreases the lsd1-mediated hdm activity on h3k4me2 in favor of h3k9me2 demethylation and increased er target gene expression . Moreover, the early engagement of some factors on condensed chromatin, in a specific sequence that is dependent of an epigenetic signature, refers to a class called competence or pioneer factors . Magnani et al . Reported that the association of activated er with the pioneer factors pbx1 (pre - b - cell leukemia homeobox 1), and foxa1 (forkhead box a1) considerably increased estrogen dependent transcriptional response via pbx1-dependent identification of h3k4me2 and chromatin remodeling . Expression of carm1 (coactivator - associated arginine methyltransferase), a coactivator of er, correlates with low grade bc and with a decrease in bc cell proliferation . Carm1 is believed to partially govern the proliferation / differentiation balance in bc by controlling 16% of estrogen dependent genes . While mechanisms implicating carm1 are complex and still under investigation, carm-1-mediated h3r17me and h3r26me seems to be implicated in estrogen response, while methylation of p300 may regulate its activity . A direct interaction between free er and phosphorylated carm-1 may be used to recruit other coactivators, while association of carm-1 with activated er may require a p160 coactivator src-2 . Indeed, carm1-mediated cbp methylation is required for cbp recruitment to some er target genes and increases its hat activity . Fewer studies have been performed to identify er coactivators . Indeed, as has been observed for er/mll interactions, mll1 - 4/er complexes however, er/enos (endothelial nitric oxide synthase) complex was observed in prostate cancer and provoked the activation of htert, msh2, cyclind1 and tff1, 4 genes previously identified in prostate cancer grading . On the other hand, this complex was also associated with the epigenetic repression of gstp1 expression, a gene frequently silenced in prostate tumors . Further investigation will be necessary for a better view of the mechanisms controlling epigenetic - mediated er target gene expression . Although the link between er and upregulation of gene transcription is well studied, some transcriptome analyses have revealed that about 50% of er target genes are downregulated following estrogen treatment . Indeed, estrogen exposure or er loss using both chemical mimetics or sirna, leads to epigenetic modifications in er target genes requiring both histone modifying enzymes and dnmts . Hmt ezh2 (enhancer of zeste homolog 2) is a polycomb protein that catalyzes h3k27me3, a chromatin repressive mark . A high level of ezh2 has been reported in several cancers and is associated with malignancy and the grade in bc . Interestingly, an increase in ezh2 expression both in mcf7 and in vivo, was also reported following estrogen - like exposure . Overexpression of ezh2 induces a decrease in the expression of numerous genes, in particular in the er responsive gene pathway . Ezh2-mediated h3k27me3 on er target genes in bc cells requires ezh2 interaction with rea (repressor of estrogen activity) which preferentially targets ere and may also recruit hdacs for complete gene silencing . On the other hand, bcl2 is an estrogen responsive gene encoding a major anti - apoptotic protein, upregulation of which is often observed in many cancers including bc . Bcl2 is normally silenced by ezh2-mediated repressive mark h3k27me3 in its enhancer, promoting the recruitment of other polycomb group proteins (prc1 and 2). Constitutive s21 phosphorylation - mediated inhibition of ezh2 following pi3k / akt activation in her2 positive bc and/or demethylation of h3k27me via er/jmjd3 complex recruitment on bcl2, induce gene expression and contribute to apoptosis resistance in bc . Er methylation appears essential for non - nuclear functions of er such as activation of akt following er/src / pi3k interaction . Prmt1-mediated r260 methylation of cytosolic er within its dna interacting domain occurs rapidly after estrogen treatment and er hypermethylation has been reported in 55% of bc . This methylation also required p160 coactivators and is implicated in the non - genomic functions of er, leading to a constitutive activation of akt signaling and a promotion of proliferation and survival signals . In fact, epigenetic silencing of er target genes was most frequent in er than in er patients and was comparable to the panel of epigenetic modifications observed in mcf7 following er inactivationby rnai . According to the literature, dna methylation and histone modification can cooperate to govern the sequence of epigenetic events leading to the silencing of one gene . Dna methylation and histone modification can be catalyzed within the same complex or successively by independent complexes . Investigations on the kinetics of the addition of epigenetic marks on er target loci revealed that chromatin remodeling begins 36h after er invalidation . First, hdac1 and the polycomb co - repressors yy1 and ezh2 are recruited while addition of persistent heritable epigenetic marks via dnmt1 recruitment occurs only at 168h . Local hypermethylation in bc may be the consequence of an increase in dnmts followed by mecp2 induction, as was observed in rats treated with high amounts of estrogen . Following estrogen exposure, a similar increase in both dnmt3b expression and activit, in endometrial cancer cells was reported and could be inhibited by an er antagonist, suggesting a direct implication of er in dnmts regulation . However, diethylstilbestrol exposure in mice provokes a decrease in dnmts and sp3 on day 5 while sp1 levels only decreased at day 14, followed by demethylation of several dna loci . Dnmt3a / b expression is under estrogen regulation in normal female tissues . To date, the effects of estrogen and the er pathway on the recruitment of sp1/sp3 to dnmt promoters have not been investigated . This could be studied with folate treatment, which preferentially permits the recruitment of sp3 in detriment to sp1 and increases dnmt genes transcription . Relative amounts and/or preferential recruitment of sp1/sp3 may explain the tissue - specific response to estrogen exposure . Indeed, hypermethylation of ercc1, xpc, ogg1 and mlh1 genes, all involved in dna repair, after estrogen treatment contributed to chromosomal instability and mutations that occur in bc . Moreover, some experiments show that estrogen exposure of breast progenitor cells induces epigenetic modifications and confers a cancer - like methylome in these cells, suggesting a possible role of epigenetic modifications in breast progenitor cells in the initiation of bc . Epigenetic modifications (global dna hypomethylation and histone modifications) occurred as soon as 6 weeks in treated rats, while evident signs of neoplasia could be detected only after 12 weeks . Indeed, estrogen stimulation provoked long - range epigenetic silencing (lres) in a cluster of 14 genes located at 16p11.2 in normal breast cells . The silencing is mediated by er translocation into the nucleus and addition of epigenetic marks such as h3k27me3 . Prolonged estrogen exposure induces progressive dna methylation which confers a persistence of epigenetic modifications, similar to those of neoplastic cells . Expression of glut-4 in mef cells required the interaction between er and the glut-4 promoter, which prevented methylation of cpg 11 and therefore allowed the recruitment of sp1 to this region and activation of transcription . Progression of pre - cancerous lesions provoked by estrogen exposure in neoplastic lesions required continuous exposure to estrogen in aci rats . Indeed, removal of estrogen treatment after 4 weeks followed by 8 weeks of recovery induced a regression of hyperplasia in conjunction with modifications in dnmts expression . Epigenetic mechanisms implicated in er target gene silencing seem highly variable and require different co - repressors . Indeed, ctcf (ccctc - binding factor) recruitment on the cdkn1c promoter following estrogen stimulation lcor, a repressor able to bind to ligand - associated receptors to repress their transcriptional activity also interacts with nuclear hdac6 and attenuates specific er target genes, including igfbp4, but not tff1 in bc cells . Moreover, the lcor / ctbp1 repressor complex interacts with hdac1 and er on tff1 and other estrogen responsive promoters . Nevertheless, hdac7-mediated gene silencing was not related to the weak hdac activity of hdac7 but rather to additional properties of this protein . Indeed, this complex provoked h3r deimination, resulting in either a blockade of h3r methylation or in a demethylation of monomethylated h3rme and therefore inhibited the addition of the positive transcriptional mark h3rme2, normally processed by carm1 or prmt1 (h3r17me and h4r3me). On the other hand, carm1-mediated h3rme2 blocks h3r deimination and allowed the recruitment of er to the active tff1 promoter . Sin3a is frequently associated with hdac1/2 in the sin3 repressor complex and can also be involved in er - mediated gene silencing (including esr1) via its multiple interactions with both additional repressors and er. Similarly, mta1 (metastasis associated antigen 1), the expression of which correlates with bc progression, can also bind hdac1/2 and er and participate in er - mediated gene silencing such as brca1 silencing . Brca1 was associated with a repression of a subset of estrogen responsive genes in 293 t cells while its overexpression induces an almost 90% decrease in er target gene expression, including tff1, in mcf7 cells . This inhibition required a direct interaction between active er and brca1 (aa 338379 of er) and their co - recruitment on ere which blocked further er recognition by coactivators such as p300 . Increasing concentrations of estrogen or overexpression of cyclin d1 which antagonizes and excludes brca1, induces estrogen responsive genes . Cyclin d1 is frequently overexpressed in bc and its interaction with er increases p160 recruitment and promote estrogen signaling . A strong correlation between foxa1 and er recruitment on activated / silenced genes after estrogen exposure was reported following high scale chip analysis, suggesting a cooperation between tf and er not only in gene activation but also in their silencing . Model of er - mediated epigenetic response in er target genes . (a) schematic representation of action of coactivators and corepressors . Studies on er target gene regulation have introduced a new degree of complexity by reporting cycling of active / repressive states of the tff1 promoter . A combination of interactions between er and hat, hdac, hmt, mdt, coactivators, corepressors, tfs and rnap ii reveals a complex histone code that regulates competent or transcriptionally engaged tff1 and cathepsind promoters with periodic waves of transcription interrupted by clearing of tfs from promoters . Recently, a dynamic process of dna methylation was also reported to be involved in the control of the cyclic expression of er target genes . Cycled methylation / demethylation of cpg in the ptff1 and wisp-2 promoters following estrogen stimulation revealed the importance of dnmts control on estrogen dependent gene expression . Each cycle, corresponding to an active transcription time, was determined by first, a demethylation of cpgs catalyzed by dnmt3a / dnmt3b associated with tdg (thymine dna glycosylase) complex, and a remethylation and gene silencing assumed by dnmt1/dnmt3a / dnmt3b, in collaboration with nurd complex . The recruitment of tdg via a direct interaction with the af2 domain of er might occur in some specific targets rather implicated in the co - recruitment of other coactivators than for its glycosylase activity . As the tdg mutant, incapable of dna repair, still increased er responsive gene transcription . As methylation and demethylation are cyclic, global methylation status on these promoters is conserved . Interestingly, as discussed above, er seems implicated in the establishment of new and stable methylation . All of these results provide strong evidence that estrogen target gene expression is tightly regulated by multiple and highly dynamic machineries implicating ers, coactivators and corepressors in a classical and epigenetic manner.
To study the short - term effects of waterborne depleted uranium (du), atlantic salmon parr (n = 6) were exposed for 48 h to 0, 0.25, 0.5 and 1.0 mg / l uranyl acetate (uo2(ch3coo)22h2o, purity 98.0%, specific activity 1.459 10 bq / g, fluka, sigma - aldrich, buchs, switzerland) dissolved in lake water collected from lake maridalsvannet, oslo, norway . Fish experiments were approved by the norwegian animal research authority (nara i d: 3026) and conducted at the figaro facility for environmental radioactivity studies (norwegian university of life sciences, s, norway). All operations strictly followed the norwegian welfare act and research animal legislation . Immediately after the exposure samples were then stored in ultrafreezer (80 c) until further analysis . For rna isolation, the rneasy plus mini kit (qiagen, hilden, germany) was used to extract total rna from 20 to 30 mg frozen liver . The procedures have been previously described in detail, . The rna yield and purity (yield> 200 ng/l, 260/230> 2.0, 260/280> 1.8) were determined using nanodrop spectrophotometer (nd-1000, nanodrop technologies, wilminton, delaware, usa). The rna integrity (rin> 9.0) was determined using bioanalyzer rna 6000 nano chips (agilent technologies, santa clara, california, usa) following the manufacturer's manual . The microarray probes (totally 55,418 features) were designed using the consensus sequences of two salmonid fish, salmo salar and oncorhynchus mykiss from the cgrasp 44 k salmonid oligoarray (35,920 sequences), release 11/09 complimented by ncbi unigenes (2995 sequences from s. salar, build 31 and 16503 sequences from o. mykiss, build 27). The cross - hybridization potential of the array probes was predicted to be less than 7% (3587 probes). A high density 60,000-feature (60 k) custom salmonid oligonucleotide array was then manufactured by agilent technologies (santa clara, ca, usa). The custom salmonid array platform is currently available in gene expression omnibus (geo i d: gpl18864). The agilent one - color microarray - based gene expression analysis (v6.5) protocol (agilent technologies) was used in the microarray analysis with small modifications . Two hundred nanogram of liver total rna was used as input material for array experiment (n = 3). The hybridized array slides were scanned using agilent microarray c scanner (agilent technologies, scan region: 61 21.6 mm, resolution: 3 m, output tiff image: 20 bit). The agilent feature extraction (fe) software (v10.7) was used to extract raw data from scanned array images . The quality assessment for extracted data was based on the quality control (qc) files generated by the fe software (table 1) and correlations of signal intensity of control probes between different arrays . High quality raw data (signal intensity values) was further processed using genespring software (v11.0, agilent technologies). Briefly, raw data were first corrected for background signals, flagged for low quality and missing features and then normalized within- and between - array using 75% quantile method . Values from replicate features were computed for median and merged to a single normalized signal intensity value for each rna source sequence . After raw data processing, in total 40,267 features were log-2 transformed and used for downstream statistical analysis to determine differentially expressed gene transcripts (degs). To study the short - term effects of waterborne depleted uranium (du), atlantic salmon parr (n = 6) were exposed for 48 h to 0, 0.25, 0.5 and 1.0 mg / l uranyl acetate (uo2(ch3coo)22h2o, purity 98.0%, specific activity 1.459 10 bq / g, fluka, sigma - aldrich, buchs, switzerland) dissolved in lake water collected from lake maridalsvannet, oslo, norway . Fish experiments were approved by the norwegian animal research authority (nara i d: 3026) and conducted at the figaro facility for environmental radioactivity studies (norwegian university of life sciences, s, norway). Samples were then stored in ultrafreezer (80 c) until further analysis . For rna isolation, the rneasy plus mini kit (qiagen, hilden, germany) was used to extract total rna from 20 to 30 mg frozen liver . The procedures have been previously described in detail, . The rna yield and purity (yield> 200 ng/l, 260/230> 2.0, 260/280> 1.8) were determined using nanodrop spectrophotometer (nd-1000, nanodrop technologies, wilminton, delaware, usa). The rna integrity (rin> 9.0) was determined using bioanalyzer rna 6000 nano chips (agilent technologies, santa clara, california, usa) following the manufacturer's manual . The microarray probes (totally 55,418 features) were designed using the consensus sequences of two salmonid fish, salmo salar and oncorhynchus mykiss from the cgrasp 44 k salmonid oligoarray (35,920 sequences), release 11/09 complimented by ncbi unigenes (2995 sequences from s. salar, build 31 and 16503 sequences from o. mykiss, build 27). The cross - hybridization potential of the array probes was predicted to be less than 7% (3587 probes). A high density 60,000-feature (60 k) custom salmonid oligonucleotide array was then manufactured by agilent technologies (santa clara, ca, usa). The custom salmonid array platform is currently available in gene expression omnibus (geo i d: gpl18864). The agilent one - color microarray - based gene expression analysis (v6.5) protocol (agilent technologies) was used in the microarray analysis with small modifications . Two hundred nanogram of liver total rna was used as input material for array experiment (n = 3). The hybridized array slides were scanned using agilent microarray c scanner (agilent technologies, scan region: 61 21.6 mm, resolution: 3 m, output tiff image: 20 bit). The agilent feature extraction (fe) software (v10.7) was used to extract raw data from scanned array images . The quality assessment for extracted data was based on the quality control (qc) files generated by the fe software (table 1) and correlations of signal intensity of control probes between different arrays . High quality raw data (signal intensity values) was further processed using genespring software (v11.0, agilent technologies). Briefly, raw data were first corrected for background signals, flagged for low quality and missing features and then normalized within- and between - array using 75% quantile method . Values from replicate features were computed for median and merged to a single normalized signal intensity value for each rna source sequence . After raw data processing, in total 40,267 features were log-2 transformed and used for downstream statistical analysis to determine differentially expressed gene transcripts (degs). This article describes high quality transcriptomic datasets generated from an ecotoxicological study on the early stress responses in atlantic salmon after short - term (48 h) exposure to waterborne depleted uranium (du) using a custom microarray for salmonid fish . The full study has recently been published and these datasets may serve as a platform to understand the toxic mechanisms and ecological hazard of environmental radionuclides such as du in fish.
The global initiative for chronic obstructive lung disease (gold) strategy document recommends that the pharmacological therapy of chronic obstructive pulmonary disease (copd) should be predicated according to the individual patient s level of symptoms, airflow limitation, and history of exacerbations.1 the preferred option for maintenance therapy of copd is long - acting bronchodilators,1,2 either alone or in combination with an inhaled corticosteroid (ics). The gold strategy document1 recommends treatment with at least one long - acting bronchodilator for patients with moderate - to - very severe copd . The strategy of combining short - acting bronchodilators with different mechanisms of action, ie, ipratropium bromide and salbutamol, has previously been shown to provide better symptomatic relief and to be cost - saving in patients with copd.3,4 in line with this, more recent studies have shown that also combining long - acting bronchodilators with different mechanisms of action provides additional benefits over the use of a single long - acting bronchodilator, without significantly increasing the risk of adverse effects.57 previous studies have shown that combining a long - acting 2-agonist with a long - acting anti - muscarinic antagonist leads to significant improvements in symptoms and lung function compared with either type of bronchodilator used alone.5,7 acute exacerbations of copd are associated with a poor prognosis in regard to health status, physical activity, decline in lung function, and mortality.813 prevention of exacerbations is therefore of outmost importance in the management of copd,1 and, in keeping with this, a key objective for new drugs for copd . The aim of this review is to provide an overview of the clinical studies evaluating the safety and clinical efficacy of the once - daily fixed - dose dual bronchodilator combination of indacaterol and glycopyrronium bromide for the treatment of copd . In order to perform this review, the general principles of the preferred reporting items for systematic reviews and meta - analyses (prisma) guidelines14,15 were adopted . A planned series of systematic searches was carried out, last updated february 2014, using the databases pubmed, embase, cochrane central register of controlled trials, and clinicaltrials.gov using the following algorithm of mesh terms: glycopyrronium bromide, indacaterol, qva149, long - acting bronchodilators, qab149, nva237, aclidinium bromide, tiotropium bromide, formoterol, salmeterol, and copd . These searches were repeated with these terms in combination with fev1, dyspnoea, health status, quality of life, day - time symptoms, night - time symptoms, exacerbations, hyperinflation, and exercise capacity, in order to identify published studies . All searches were limited to english - language articles . As the methods and results could not be fully assessed, clinical trials published only in abstract form were excluded from this review . Studies were included if they met all of the following criteria: 1) published in a peer - reviewed journal; 2) inclusion of adults 40 years of age with stable copd defined according to the gold strategy document1 or the american thoracic society / european respiratory society guideline criteria;2 3) comparison of fixed - dose glycopyrronium bromide plus indacaterol with placebo, glycopyrronium bromide, indacaterol, tiotropium bromide, aclidinium bromide, formoterol, or salmeterol; and 4) also reporting at least one of the following outcomes: onset of action; trough forced expiratory volume in 1 second ([fev1] 24 hours post - dosing) at the end of the treatment period; peak change in fev1; health status (st george s respiratory questionnaire [sgrq]); symptom relief transition dyspnea index (tdi); use of rescue medication; acute exacerbations; exercise capacity; and inspiratory capacity (ic). Due primarily to the relatively limited number of published clinical trials fulfilling all inclusion criteria, a meta - analysis was not included in the present review . Of the 147 potential relevant citations identified by the series of searches, nine clinical trials fulfilled all inclusion criteria (6,166 participants). Characteristics of the included studies are given in table 1 . All subjects included in the trials were stable but symptomatic at baseline and fulfilled the spirometric criteria for a diagnosis of copd . Two studies compared fixed - dose indacaterol / glycopyrronium with indacaterol (and placebo); one study with indacaterol and glycopyrronium; two studies with tiotropium (and placebo); one study with glycopyrronium and tiotropium; one study with fixed - combination salmeterol / fluticasone (sfc); one study with indacaterol, glycopyrronium, and tiotropium (and placebo); and one study with placebo . The cardiovascular safety of fixed - dose indacaterol / glycopyrronium was evaluated by van de maele et al16 in a randomized, double - blind, placebo - controlled, parallel - group study of 257 patients with moderate - to - severe copd . The enrolled patients were randomized to receive fixed - dose indacaterol / glycopyrronium (600/100 g, 300/100 g, or 150/100 g), indacaterol 300 g, or placebo once daily for 14 days, and the primary endpoint was change from baseline in 24-hour mean heart rate versus placebo on day 14 . No clinical significant difference was observed for the primary endpoint, and once - daily fixed - dose indacaterol / glycopyrronium was, in general, well tolerated among the enrolled copd patients with a cardiovascular safety profile, including qtc interval, and an overall rate of adverse events (aes) similar to that of placebo . The safety of fixed - dose indacaterol / glycopyrronium was further investigated in the enlighten study by dahl et al,17 in which 339 patients were randomized to either fixed - dose indacaterol / glycopyrronium or placebo for 52 weeks . No difference between treatment groups was observed for the primary endpoint; likewise, no clinically relevant differences were observed for vital signs and electrocardiographic parameters . The overall incidence of aes was similar between the two treatment arms (57.8% and 56.6%, respectively), and the most frequently reported ae was worsening of copd (28.5% and 25.7%, respectively, for active and placebo treatment). The most common severe ae was exacerbation of copd, and the second most common severe ae was pneumonia, the latter only reported in the indacaterol / glycopyrronium - treated group (n=8). A post hoc analysis of serious pneumonia aes stratified by copd severity was reported not to provide conclusive evidence that fixed - dose indacaterol / glycopyrronium was associated with a higher incidence of pneumonia than placebo (rate of events 3.6%, odds ratio 5.11; p=0.10). Although no statistically significant difference was observed, aes that led to hospitalization or prolonged hospitalization were reported for 15.1% and 8.8%, respectively, of patients treated with fixed - dose indacaterol / glycopyrronium and placebo . In contrast to this, in the illuminate study,18 pneumonia (confirmed by chest x - ray) was only reported in patients treated with fixed - combination sfc (1.5%; no cases among patients treated with fixed - dose indacaterol / glycopyrronium). The beacon study by dahl et al19 compared fixed - dose indacaterol / glycopyrronium with the concurrent administration of the mono - components indacaterol and glycopyrronium and found that the safety and efficacy profile was similar for the two treatment arms . Mahler et al20 investigated the effect of fixed - dose indacaterol / glycopyrronium versus placebo and tiotropium on dyspnea in the blinded, double - dummy, crossover blaze study comprising 247 patients with moderate - to - severe copd (staging according to the gold 2007 criteria; mean post - bronchodilator fev1 56% predicted [pred]). Changes in dyspnea were assessed by the self - administered computerized versions of the baseline dyspnea index and the tdi after 6 weeks . The tdi total score was statistically significantly improved with fixed - dose indacaterol / glycopyrronium at 6 weeks compared to both placebo and tiotropium . However, only the improvement with fixed - dose indacaterol / glycopyrronium versus placebo reached the minimal clinically important difference (mcid) of 1 point;21 this mcid in total tdi score with fixed - dose indacaterol / glycopyrronium was seen in patients with both moderate (least squares mean [lsm] treatment difference 1.11; p<0.001) and severe (lsm treatment difference 1.92; p<0.001) copd (defined on spirometric criteria) compared with placebo . A tdi responder analysis comparing fixed - dose indacaterol / glycopyrronium and tiotropium revealed that the proportion of patients achieving the mcid of at least 1 point was higher with fixed - dose indacaterol / glycopyrronium than with either placebo (35.9% and 18.1%, respectively; p<0.001) or tiotropium (24.4%; p=0.012). However, it should be noted that the mcid for comparisons between active treatments has not yet been established . The blaze study20 also showed a significant improvement in percentage of nights with no awakenings, days with no daytime symptoms, and days with usual daily activities compared with placebo, whereas no significant difference in these outcomes was observed between fixed - dose indacaterol / glycopyrronium and tiotropium; in line with this, no statistically significant differences were observed between the two active treatment arms with regard to mean daily total and individual symptom (respiratory symptoms, cough, wheeze, and amount of sputum) scores . However, the patients treated with fixed - dose indacaterol / glycopyrronium used less rescue medication and had a higher percentage of days with no use of rescue medication compared to both placebo (p<0.001) and tiotropium (p=0.002 and p<0.001). Similar findings with regard to symptoms and use of rescue medication were reported in the enlighten study.17 vogelmeier et al18 reported that fixed - dose indacaterol / glycopyrronium significantly increased the tdi focal score after 26 weeks of treatment compared with fixed - combination sfc, with a treatment difference of 0.76 (p=0.003). Although, on average, not reaching the mcid for tdi score, 67.5% of patients treated with fixed - dose indacaterol / glycopyrronium compared with 56.8% of patients on sfc had an increase of at least 1 point in tdi score (p=0.046). However, no difference in change in total sgrq score was observed between the two treatment groups; likewise, only modest and, in general, nonsignificant differences were reported with regard to symptoms and use of rescue medication.18 with regard to rescue medication, van noord et al22 found no difference in number of puffs used by patients treated with fixed - dose indacaterol / glycopyrronium and indacaterol, whereas wedzicha et al23 reported a significant decrease in use of rescue medication (salbutamol) for patients treated with fixed - dose indacaterol / glycopyrronium compared with glycopyrronium and tiotropium . The shine study24 showed significant improvements in tdi focal score, use of rescue medication, daytime symptoms, nighttime symptoms, and ability to perform usual daily activities for fixed - dose indacaterol / glycopyrronium compared with monotherapy with a long - acting bronchodilator and placebo . Furthermore, the shine study also showed a significant improvement in sgrq total score at week 12 and week 26 compared with placebo, whereas no significant improvement was observed for the other active treatments (indacaterol, glycopyrronium, and tiotropium) or placebo.24 wedzicha et al23 reported an improvement in sgrq total score from baseline of 89 units with fixed - dose indacaterol / glycopyrronium; 6 units with glycopyrronium; and 56 units with tiotropium, and the treatment differences in sgrq total score between fixed - dose indacaterol / glycopyrronium were 1.9 to 2.8 and 1.7 to 3.1, respectively, compared with glycopyrronium (p<0.01) and tiotropium (p<0.05). In keeping with this, the percentage of patients achieving the mcid in total sgrq score was significantly higher for fixed - dose indacaterol / glycopyrronium compared with both glycopyrronium and tiotropium up to week 52 . Van noord et al,22 in a four - period crossover study (n=154), compared the efficacy of once - daily fixed - dose indacaterol / glycopyrronium (300/50 g) with indacaterol (600 g and 300 g) and placebo . The lsm trough fev1 on day 7 was significantly higher for fixed - dose indacaterol / glycopyrronium compared with placebo (treatment difference 0.226 l; p<0.001) and with indacaterol 300 g or 600 g (treatment difference 0.123 l and 0.117 l, respectively; p<0.001). Furthermore, fixed - dose indacaterol / glycopyrronium had a faster onset of action (at 5 minutes post - dose on day 1) compared with placebo and with indacaterol 300 g or 600 g (p<0.0001); the treatment difference between fixed - dose indacaterol / glycopyrronium and placebo was 0.141 l, whereas no exact data were reported for the treatment difference between fixed - dose indacaterol / glycopyrronium and indacaterol . In the shine study, bateman et al24 investigated the efficacy of fixed - dose indacaterol / glycopyrronium versus its mono - components indacaterol and glycopyrronium, tiotropium, and placebo over 26 weeks . Patients with moderate - to - severe copd (defined according to the gold 2007 spirometric criteria; n=2,144) were randomized to once - daily fixed - dose indacaterol / glycopyrronium (110/50 g), indacaterol (150 g), glycopyrronium (50 g), open - label tiotropium (18 g), or placebo (table 1). The primary outcome was trough fev1 at week 26 for fixed - dose indacaterol / glycopyrronium versus its mono - components . At week 26, a significant improvement was seen in trough fev1 for fixed - dose indacaterol / glycopyrronium compared with both indacaterol (treatment difference 0.07 l; p<0.001) and glycopyrronium (treatment difference 0.09 l; p<0.001); likewise, a significant improvement was observed for fixed - dose indacaterol / glycopyrronium compared with tiotropium and placebo (treatment difference 0.08 l and 0.20 l, respectively; p<0.001). The observed statistically significant differences between fixed - dose indacaterol / glycopyrronium versus all active treatments and placebo in trough fev1 were maintained throughout the study period . Similar to the findings reported by van noord et al,22 the shine study24 revealed that fixed - dose indacaterol / glycopyrronium provides rapid bronchodilation after administration of the first dose on day 1, as the fev1, fev1 4-hour area under the curve, and peak fev1 were higher compared with placebo, glycopyrronium, and tiotropium, whereas data were not given for the comparison with indacaterol . Subgroup analysis showed that the improvement in trough fev1 was seen both in patients with moderate and with severe copd (defined by the spirometric gold criteria), although the treatment differences between fixed - dose indacaterol / glycopyrronium and monotherapy with a long - acting bronchodilator (indacaterol, glycopyrronium, and tiotropium) was less than 0.10 l. vogelmeier et al,18 in the illuminate study, compared the safety and efficacy of fixed - dose indacaterol / glycopyrronium versus fixed - combination sfc over 26 weeks in patients with moderate - to - severe copd . In this double - blind, double - dummy, parallel - group study, 523 patients (without exacerbations in the year prior to study entry) were randomized to either fixed - dose indacaterol / glycopyrronium (110/50 g once daily) or sfc (50/500 g twice daily). The primary outcome was the standardized area under the fev1 curve from 012 hours post - dose (fev1auc012) at week 26 . Thirty - five percent of the enrolled patients were treated with ics at baseline, and the mean post - bronchodilator fev1 was 60.2% pred (table 1). The fev1auc012 was significantly higher for patients treated with fixed - dose indacaterol / glycopyrronium (1.70 l) than for patients treated with sfc (1.56 l), with a treatment difference of 0.14 l (p<0.0001) at week 26; this treatment difference in fev1auc012 was observed throughout the study period . Similar findings were reported for other spirometric parameters, including peak fev1 and forced vital capacity.18 after 6 weeks of treatment in the blaze study,20 a significant and clinically meaningful25 improvement in mean fev1 was seen at every time point from 45 minutes pre - dose to 4 hours post - dose versus both placebo and tiotropium (p<0.001). The enlighten study17 showed a significant improvement in pre - dose fev1 at week 52 compared with placebo (treatment difference 0.189 l; p<0.001), and the treatment difference in pre - dose fev1 from week 3 to week 52 versus placebo was in the range of 0.1520.189 l (p<0.001). Furthermore, the 60-minute post - dose fev1 was significantly higher for patients treated with fixed - dose indacaterol / glycopyrronium compared with placebo (treatment difference 0.2000.286 l; p<0.001). Trough fev1 in the spark study23 was significantly higher for fixed - dose indacaterol / glycopyrronium at all evaluated time points compared with glycopyrronium (treatment difference 0.080.09 l; p<0.0001) and tiotropium (treatment difference 0.060.08 l; p<0.0001). In the bright study, beeh et al26 investigated the effect of fixed - dose indacaterol / glycopyrronium compared with placebo and tiotropium on exercise tolerance in patients with moderate - to - severe copd (defined according to the gold 2007 spirometric criteria; mean fev1 55.9% pred) (table 1). A total of 85 patients were randomized to fixed - dose indacaterol / glycopyrronium (110/50 g), placebo, or tiotropium (18 g) once daily in a blinded, three - period, crossover study for 3 weeks . The primary outcome variable was exercise endurance time at day 21 for fixed - dose indacaterol / glycopyrronium versus placebo . Fixed - dose indacaterol / glycopyrronium significantly improved exercise endurance time at day 21 compared with placebo (lsm treatment difference 60 seconds). A similar improvement in exercise endurance time was observed with tiotropium compared with placebo (lsm treatment difference 66 seconds). In line with this, an analysis of data for the subgroup of patients with hyperinflation (defined as functional residual capacity [frc]> 120% pred), showed that the mean changes in exercise endurance time from baseline were 85 seconds and 88 seconds, respectively, for indacaterol / glycopyrronium and tiotropium . A significant improvement in ic at peak exercise was observed for fixed - dose indacaterol / glycopyrronium compared with both placebo and tiotropium, and a similar difference was observed for trough ic . In the study by van noord et al,22 changes in ic, although not stated as a secondary outcome variable, were also determined . The authors reported that both lsm ic and trough ic were significantly better for fixed - dose indacaterol / glycopyrronium compared with both indacaterol and placebo (p=0.02). Wedzicha et al, in the spark study,23 investigated the effect of fixed - dose indacaterol / glycopyrronium on exacerbations in patients with severe and very severe copd (defined according to the gold 2007 spirometric criteria). In a parallel - group study, 2,224 patients (having had at least one exacerbation of copd in the year prior to enrollment) were randomized to fixed - dose indacaterol / glycopyrronium (110/50 g), glycopyrronium (50 g), or open - label tiotropium (18 g) for 64 weeks . The primary outcome variable was to demonstrate superiority of fixed - dose indacaterol / glycopyrronium for the rate of moderate (defined as worsening of symptoms treated with systemic corticosteroids or antibiotics or both) and severe (defined as worsening of symptoms requiring emergency treatment or hospitalization) exacerbations compared to monotherapy with glycopyrronium . The key secondary outcome variable was to demonstrate superiority of fixed - dose indacaterol / glycopyrronium compared with tiotropium with regard to the rate of moderate and severe exacerbations . Twenty - two percent of the patients included in the efficacy analyses had had two or more exacerbations in the previous year, and 88% of the patients had one or more cardiovascular risk factors at baseline, although few patients had a history of cardiovascular disease . Furthermore, 75% of the patients in all three treatment arms were treated with icss throughout the study period . The rate of moderate or severe exacerbations was significantly reduced by 12% for the fixed - dose indacaterol / glycopyrronium group compared with the glycopyrronium group (p=0.038), whereas the 10% reduction in the rate of moderate or severe exacerbations with fixed - dose indacaterol / glycopyrronium compared with tiotropium was nonsignificant . The overall rate of exacerbations (mild, moderate, and severe) was significantly reduced with fixed - dose indacaterol / glycopyrronium, by 15% and 14%, respectively, compared with glycopyrronium and tiotropium . The cardiovascular safety of fixed - dose indacaterol / glycopyrronium was evaluated by van de maele et al16 in a randomized, double - blind, placebo - controlled, parallel - group study of 257 patients with moderate - to - severe copd . The enrolled patients were randomized to receive fixed - dose indacaterol / glycopyrronium (600/100 g, 300/100 g, or 150/100 g), indacaterol 300 g, or placebo once daily for 14 days, and the primary endpoint was change from baseline in 24-hour mean heart rate versus placebo on day 14 . No clinical significant difference was observed for the primary endpoint, and once - daily fixed - dose indacaterol / glycopyrronium was, in general, well tolerated among the enrolled copd patients with a cardiovascular safety profile, including qtc interval, and an overall rate of adverse events (aes) similar to that of placebo . The safety of fixed - dose indacaterol / glycopyrronium was further investigated in the enlighten study by dahl et al,17 in which 339 patients were randomized to either fixed - dose indacaterol / glycopyrronium or placebo for 52 weeks . No difference between treatment groups was observed for the primary endpoint; likewise, no clinically relevant differences were observed for vital signs and electrocardiographic parameters . The overall incidence of aes was similar between the two treatment arms (57.8% and 56.6%, respectively), and the most frequently reported ae was worsening of copd (28.5% and 25.7%, respectively, for active and placebo treatment). The most common severe ae was exacerbation of copd, and the second most common severe ae was pneumonia, the latter only reported in the indacaterol / glycopyrronium - treated group (n=8). A post hoc analysis of serious pneumonia aes stratified by copd severity was reported not to provide conclusive evidence that fixed - dose indacaterol / glycopyrronium was associated with a higher incidence of pneumonia than placebo (rate of events 3.6%, odds ratio 5.11; p=0.10). Although no statistically significant difference was observed, aes that led to hospitalization or prolonged hospitalization were reported for 15.1% and 8.8%, respectively, of patients treated with fixed - dose indacaterol / glycopyrronium and placebo . In contrast to this, in the illuminate study,18 pneumonia (confirmed by chest x - ray) was only reported in patients treated with fixed - combination sfc (1.5%; no cases among patients treated with fixed - dose indacaterol / glycopyrronium). The beacon study by dahl et al19 compared fixed - dose indacaterol / glycopyrronium with the concurrent administration of the mono - components indacaterol and glycopyrronium and found that the safety and efficacy profile was similar for the two treatment arms . Mahler et al20 investigated the effect of fixed - dose indacaterol / glycopyrronium versus placebo and tiotropium on dyspnea in the blinded, double - dummy, crossover blaze study comprising 247 patients with moderate - to - severe copd (staging according to the gold 2007 criteria; mean post - bronchodilator fev1 56% predicted [pred]). Changes in dyspnea were assessed by the self - administered computerized versions of the baseline dyspnea index and the tdi after 6 weeks . The tdi total score was statistically significantly improved with fixed - dose indacaterol / glycopyrronium at 6 weeks compared to both placebo and tiotropium . However, only the improvement with fixed - dose indacaterol / glycopyrronium versus placebo reached the minimal clinically important difference (mcid) of 1 point;21 this mcid in total tdi score with fixed - dose indacaterol / glycopyrronium was seen in patients with both moderate (least squares mean [lsm] treatment difference 1.11; p<0.001) and severe (lsm treatment difference 1.92; p<0.001) copd (defined on spirometric criteria) compared with placebo . A tdi responder analysis comparing fixed - dose indacaterol / glycopyrronium and tiotropium revealed that the proportion of patients achieving the mcid of at least 1 point was higher with fixed - dose indacaterol / glycopyrronium than with either placebo (35.9% and 18.1%, respectively; p<0.001) or tiotropium (24.4%; p=0.012). However, it should be noted that the mcid for comparisons between active treatments has not yet been established . The blaze study20 also showed a significant improvement in percentage of nights with no awakenings, days with no daytime symptoms, and days with usual daily activities compared with placebo, whereas no significant difference in these outcomes was observed between fixed - dose indacaterol / glycopyrronium and tiotropium; in line with this, no statistically significant differences were observed between the two active treatment arms with regard to mean daily total and individual symptom (respiratory symptoms, cough, wheeze, and amount of sputum) scores . However, the patients treated with fixed - dose indacaterol / glycopyrronium used less rescue medication and had a higher percentage of days with no use of rescue medication compared to both placebo (p<0.001) and tiotropium (p=0.002 and p<0.001). Similar findings with regard to symptoms and use of rescue medication were reported in the enlighten study.17 vogelmeier et al18 reported that fixed - dose indacaterol / glycopyrronium significantly increased the tdi focal score after 26 weeks of treatment compared with fixed - combination sfc, with a treatment difference of 0.76 (p=0.003). Although, on average, not reaching the mcid for tdi score, 67.5% of patients treated with fixed - dose indacaterol / glycopyrronium compared with 56.8% of patients on sfc had an increase of at least 1 point in tdi score (p=0.046). However, no difference in change in total sgrq score was observed between the two treatment groups; likewise, only modest and, in general, nonsignificant differences were reported with regard to symptoms and use of rescue medication.18 with regard to rescue medication, van noord et al22 found no difference in number of puffs used by patients treated with fixed - dose indacaterol / glycopyrronium and indacaterol, whereas wedzicha et al23 reported a significant decrease in use of rescue medication (salbutamol) for patients treated with fixed - dose indacaterol / glycopyrronium compared with glycopyrronium and tiotropium . The shine study24 showed significant improvements in tdi focal score, use of rescue medication, daytime symptoms, nighttime symptoms, and ability to perform usual daily activities for fixed - dose indacaterol / glycopyrronium compared with monotherapy with a long - acting bronchodilator and placebo . Furthermore, the shine study also showed a significant improvement in sgrq total score at week 12 and week 26 compared with placebo, whereas no significant improvement was observed for the other active treatments (indacaterol, glycopyrronium, and tiotropium) or placebo.24 wedzicha et al23 reported an improvement in sgrq total score from baseline of 89 units with fixed - dose indacaterol / glycopyrronium; 6 units with glycopyrronium; and 56 units with tiotropium, and the treatment differences in sgrq total score between fixed - dose indacaterol / glycopyrronium were 1.9 to 2.8 and 1.7 to 3.1, respectively, compared with glycopyrronium (p<0.01) and tiotropium (p<0.05). In keeping with this, the percentage of patients achieving the mcid in total sgrq score was significantly higher for fixed - dose indacaterol / glycopyrronium compared with both glycopyrronium and tiotropium up to week 52 . Van noord et al,22 in a four - period crossover study (n=154), compared the efficacy of once - daily fixed - dose indacaterol / glycopyrronium (300/50 g) with indacaterol (600 g and 300 g) and placebo . The lsm trough fev1 on day 7 was significantly higher for fixed - dose indacaterol / glycopyrronium compared with placebo (treatment difference 0.226 l; p<0.001) and with indacaterol 300 g or 600 g (treatment difference 0.123 l and 0.117 l, respectively; p<0.001). Furthermore, fixed - dose indacaterol / glycopyrronium had a faster onset of action (at 5 minutes post - dose on day 1) compared with placebo and with indacaterol 300 g or 600 g (p<0.0001); the treatment difference between fixed - dose indacaterol / glycopyrronium and placebo was 0.141 l, whereas no exact data were reported for the treatment difference between fixed - dose indacaterol / glycopyrronium and indacaterol . In the shine study, bateman et al24 investigated the efficacy of fixed - dose indacaterol / glycopyrronium versus its mono - components indacaterol and glycopyrronium, tiotropium, and placebo over 26 weeks . Patients with moderate - to - severe copd (defined according to the gold 2007 spirometric criteria; n=2,144) were randomized to once - daily fixed - dose indacaterol / glycopyrronium (110/50 g), indacaterol (150 g), glycopyrronium (50 g), open - label tiotropium (18 g), or placebo (table 1). The primary outcome was trough fev1 at week 26 for fixed - dose indacaterol / glycopyrronium versus its mono - components . At week 26, a significant improvement was seen in trough fev1 for fixed - dose indacaterol / glycopyrronium compared with both indacaterol (treatment difference 0.07 l; p<0.001) and glycopyrronium (treatment difference 0.09 l; p<0.001); likewise, a significant improvement was observed for fixed - dose indacaterol / glycopyrronium compared with tiotropium and placebo (treatment difference 0.08 l and 0.20 l, respectively; p<0.001). The observed statistically significant differences between fixed - dose indacaterol / glycopyrronium versus all active treatments and placebo in trough fev1 were maintained throughout the study period . Similar to the findings reported by van noord et al,22 the shine study24 revealed that fixed - dose indacaterol / glycopyrronium provides rapid bronchodilation after administration of the first dose on day 1, as the fev1, fev1 4-hour area under the curve, and peak fev1 were higher compared with placebo, glycopyrronium, and tiotropium, whereas data were not given for the comparison with indacaterol . Subgroup analysis showed that the improvement in trough fev1 was seen both in patients with moderate and with severe copd (defined by the spirometric gold criteria), although the treatment differences between fixed - dose indacaterol / glycopyrronium and monotherapy with a long - acting bronchodilator (indacaterol, glycopyrronium, and tiotropium) was less than 0.10 l. vogelmeier et al,18 in the illuminate study, compared the safety and efficacy of fixed - dose indacaterol / glycopyrronium versus fixed - combination sfc over 26 weeks in patients with moderate - to - severe copd . In this double - blind, double - dummy, parallel - group study, 523 patients (without exacerbations in the year prior to study entry) were randomized to either fixed - dose indacaterol / glycopyrronium (110/50 g once daily) or sfc (50/500 g twice daily). The primary outcome was the standardized area under the fev1 curve from 012 hours post - dose (fev1auc012) at week 26 . Thirty - five percent of the enrolled patients were treated with ics at baseline, and the mean post - bronchodilator fev1 was 60.2% pred (table 1). The fev1auc012 was significantly higher for patients treated with fixed - dose indacaterol / glycopyrronium (1.70 l) than for patients treated with sfc (1.56 l), with a treatment difference of 0.14 l (p<0.0001) at week 26; this treatment difference in fev1auc012 was observed throughout the study period . Similar findings were reported for other spirometric parameters, including peak fev1 and forced vital capacity.18 after 6 weeks of treatment in the blaze study,20 a significant and clinically meaningful25 improvement in mean fev1 was seen at every time point from 45 minutes pre - dose to 4 hours post - dose versus both placebo and tiotropium (p<0.001). The enlighten study17 showed a significant improvement in pre - dose fev1 at week 52 compared with placebo (treatment difference 0.189 l; p<0.001), and the treatment difference in pre - dose fev1 from week 3 to week 52 versus placebo was in the range of 0.1520.189 l (p<0.001). Furthermore, the 60-minute post - dose fev1 was significantly higher for patients treated with fixed - dose indacaterol / glycopyrronium compared with placebo (treatment difference 0.2000.286 l; p<0.001). Trough fev1 in the spark study23 was significantly higher for fixed - dose indacaterol / glycopyrronium at all evaluated time points compared with glycopyrronium (treatment difference 0.080.09 l; p<0.0001) and tiotropium (treatment difference 0.060.08 l; p<0.0001). In the bright study, beeh et al26 investigated the effect of fixed - dose indacaterol / glycopyrronium compared with placebo and tiotropium on exercise tolerance in patients with moderate - to - severe copd (defined according to the gold 2007 spirometric criteria; mean fev1 55.9% pred) (table 1). A total of 85 patients were randomized to fixed - dose indacaterol / glycopyrronium (110/50 g), placebo, or tiotropium (18 g) once daily in a blinded, three - period, crossover study for 3 weeks . The primary outcome variable was exercise endurance time at day 21 for fixed - dose indacaterol / glycopyrronium versus placebo . Fixed - dose indacaterol / glycopyrronium significantly improved exercise endurance time at day 21 compared with placebo (lsm treatment difference 60 seconds). A similar improvement in exercise endurance time was observed with tiotropium compared with placebo (lsm treatment difference 66 seconds). In line with this, an analysis of data for the subgroup of patients with hyperinflation (defined as functional residual capacity [frc]> 120% pred), showed that the mean changes in exercise endurance time from baseline were 85 seconds and 88 seconds, respectively, for indacaterol / glycopyrronium and tiotropium . A significant improvement in ic at peak exercise was observed for fixed - dose indacaterol / glycopyrronium compared with both placebo and tiotropium, and a similar difference was observed for trough ic . In the study by van noord et al,22 changes in ic, although not stated as a secondary outcome variable, were also determined . The authors reported that both lsm ic and trough ic were significantly better for fixed - dose indacaterol / glycopyrronium compared with both indacaterol and placebo (p=0.02). Wedzicha et al, in the spark study,23 investigated the effect of fixed - dose indacaterol / glycopyrronium on exacerbations in patients with severe and very severe copd (defined according to the gold 2007 spirometric criteria). In a parallel - group study, 2,224 patients (having had at least one exacerbation of copd in the year prior to enrollment) were randomized to fixed - dose indacaterol / glycopyrronium (110/50 g), glycopyrronium (50 g), or open - label tiotropium (18 g) for 64 weeks . The primary outcome variable was to demonstrate superiority of fixed - dose indacaterol / glycopyrronium for the rate of moderate (defined as worsening of symptoms treated with systemic corticosteroids or antibiotics or both) and severe (defined as worsening of symptoms requiring emergency treatment or hospitalization) exacerbations compared to monotherapy with glycopyrronium . The key secondary outcome variable was to demonstrate superiority of fixed - dose indacaterol / glycopyrronium compared with tiotropium with regard to the rate of moderate and severe exacerbations . Twenty - two percent of the patients included in the efficacy analyses had had two or more exacerbations in the previous year, and 88% of the patients had one or more cardiovascular risk factors at baseline, although few patients had a history of cardiovascular disease . Furthermore, 75% of the patients in all three treatment arms were treated with icss throughout the study period . The rate of moderate or severe exacerbations was significantly reduced by 12% for the fixed - dose indacaterol / glycopyrronium group compared with the glycopyrronium group (p=0.038), whereas the 10% reduction in the rate of moderate or severe exacerbations with fixed - dose indacaterol / glycopyrronium compared with tiotropium was nonsignificant . The overall rate of exacerbations (mild, moderate, and severe) was significantly reduced with fixed - dose indacaterol / glycopyrronium, by 15% and 14%, respectively, compared with glycopyrronium and tiotropium . The combination of two long - acting bronchodilators with different mechanisms of action is likely to have the potential to enhance efficacy compared with single long - acting bronchodilators, without a concomitant increase in adverse effects . Fixed - dose indacaterol / glycopyrronium is, based on the available evidence, a safe and well - tolerated dual long - acting bronchodilator . In patients with moderate - to - very severe copd (defined by gold spirometric criteria), fixed - dose indacaterol / glycopyrronium has clinically important effects on symptoms, including dyspnea score, health status, level of fev1, exercise endurance time, and rate of exacerbations . Bronchodilation improves airway conductance and airflow and reduces hyperinflation, which subsequently leads to a reduction in dyspnea . Sustained bronchodilation is therefore, in accordance with the current gold strategy document,1 recommended as maintenance therapy for patients with symptomatic copd . The published studies show that treatment with once - daily fixed - dose indacaterol / glycopyrronium leads to clinically important improvements, not only in lung function, but also in other important endpoints such as dyspnea index, health status, symptoms, exercise endurance time, and use of rescue medication, although the findings with regard to use of rescue medication were not absolutely consistent . The studies of fixed - dose indacaterol / glycopyrronium are therefore in accordance with several previously published studies that have investigated the efficacy of free combinations of long - acting 2-agonists and long - acting anti - muscarinic agents2730 in patients with copd . Furthermore, these studies are also in accordance with a very recently published study by celli et al31 investigating the safety and efficacy of once - daily fixed - dose umeclidinium / vilanterol in patients with copd . Sustained bronchodilation is also thought to contribute to the reduction in exacerbations of copd seen with treatment with long - acting bronchodilators, and, although long - acting anti - muscarinic agents are primarily thought to reduce exacerbations by reducing dynamic hyperinflation, both long - acting 2-agonists and long - acting anti - muscarinic agents may have anti - inflammatory effects.3234 the studies published so far investigating the safety and, not least, efficacy of fixed - dose indacaterol / glycopyrronium support the gold 2013 strategy1 alternative - choice recommendation that add - on of a second long - acting bronchodilator in patients with moderate - to - very severe copd (gold 2013 groups b d) may improve symptom control, and, in line with this, that patients classified as being (group b), who remain symptomatic on a single long - acting bronchodilator, may significantly benefit from fixed - dose indacaterol / glycopyrronium . Furthermore, the reported findings also support the gold 2013 strategy secondary choice recommendation for high - risk patients (groups c and d based on symptoms and exacerbations), as a long - acting 2-agonist plus a long - acting anti - muscarinic agent is recommended as an alternative to a long - acting -agonist plus ics (group c) or ics plus long - acting 2-agonist and/or long - acting anti - muscarinic agent (group d). The published studies indicate that once - daily fixed - dose indacaterol / glycopyrronium may become an important therapeutic maintenance option for patients with moderate - to - very severe copd . In years to come, combination therapy with a long - acting antimuscarinic agent and a long - acting 2-agonist, preferably as fixed combination, may become the treatment of choice for maintenance therapy - nave patients with symptomatic copd.
Clubbing of digits, periosteal new bone formation along the shafts of the tubular bones of the extremities and synovial effusions characterize hypertrophic osteoarthropathy (hoa). Primary hoa is a rare syndrome, not associated with other systemic diseases, and usually occurs in childhood, whereas secondary hoa is associated with various underlying pulmonary and non - pulmonary causes, such as bronchogenic carcinoma and right - to - left cardiac shunts . Although various intrathoracic malignancies have been associated with the development of hoa, it has been extremely rare for hoa to occur in a patient with a malignant neoplasm of the thymus . Since the first case was reported in 1939, a few cases have been reported worldwide . Recently, we experienced a case of hoa with a thymic carcinoma, and herein report the case with a review of the literature . A 63-year - old woman was referred to our hospital because she had a chief complaint of both leg pains . The pain was noted several months ago without any prior history, such as trauma and it was wax and wane and slowly progressing . She did not have any other systemic symptoms, such as weight loss or fever . Her past and family history was not contributory except for the diagnosis of hypertension one year before and antihypertensive medication thereafter . Physical examination at presentation was normal except for tenderness of both the lower extremities and clubbing of the fingers (figure 1). Laboratory investigation showed no abnormal findings except for mild anemia (hgb 10.2 g / dl). The plain radiograph of both lower legs showed cortical thickening along the shaft of the tibia and the bone scan revealed diffusely increased uptake along the cortex of both lower extremities (figure 2). The radiologic findings were not consistent with bone metastasis but with hypertrophic osteo arthropathy (hoa). In order to find the possibility of the secondary hoa, we performed a chest radiograph, which revealed a left mediastinal bulging mass (figure 3). The chest ct scan confirmed the presence of a soft tissue density mass in the anterior mediastinum with pericardial effusion (figure 4). For a pathologic confirmation microscopic examination showed irregular nests of poorly differentiated malignant cells with hyperchromatic and irregular nuclei (figure 5). According to the microscopic examination hypertrophic osteoarthropathy (hoa) begins as periostitis followed by new bone formation, which is seen as a solid lamination involving the proximal and distal diaphyses of the tibia, fibula, radius, ulna and, less frequently, the femur, humerus, metacarpals, metatarsals and phalanges . As the process of new bone formation progresses, these changes extend to involve metaphyses . Initial radiological finding is a radiolucent area between the new bone formation and subjacent cortex . In the long - standing process, para - cortical increase of uptake is a characteristic finding of the bone scan study . Proliferation of connective tissue occurs in the nail bed and volar pad of the digits, giving rise to clubbing . Clubbing is almost always a feature of hoa but can occur as an isolated manifestation . This isolated manifestation of clubbing may represent an early stage of hoa, so it may have the same clinical significance as hoa . Secondary hoa occurs in association with a variety of underlying disorders, including heart, lungs, pleura, gastrointestinal tract and liver . Although several theories have been suggested for the pathogenesis of hoa, its underlying mechanism is still controversial . . Then, most platelets are produced in the lungs, especially, in pulmonary capillaries, by physical fragmentation of cytoplasms of megakaryocytes, because they are large and cannot pass unchanged through the normal lung vasculature, which is narrow . In patients with disorders associated with right - to - left shunts, such as cyanotic congenital heart disease and severe liver cirrhosis (where the pulmonary circulation is abnormal due to the development of arteriovenous connections in the lungs), these megakaryocytes and large platelet particles may bypass the lung and reach the distal extremities, leading to the interaction with endothelial cells . This interaction in the distal portion of extremities would then result in degranulation and the production of platelet - derived growth factor (pdgf) and other factors, causing proliferation of connective tissue and periosteum . Hoa has been associated with many different benign and malignant intrathoracic tumors and occurs in 510% of patients with intrathoracic malignancies including lung cancer and pleural tumors . The most frequently associated cancer is non - small cell lung cancer . In these situations, the tumor itself may supply a vascular shunt from right to left without being filtered through pulmonary capillaries . Megakaryocytes are larger in lung cancer than normal and may have increased pdgf synthetic activity . The relatively frequent association of hoa with lung cancers suggests that some additional factors may be involved in the development of hoa in lung cancer . Growth hormone secretion by bronchogenic carcinoma was suggested for the underlying mechanism of the occurrence of hoa and clubbing . Reported an elevated serum growth hormone level and growth hormone - releasing hormone (ghrh)-producing cells in a non - small lung cancer patient with hoa . Recently, vascular endothelial growth factor (vegf) has been implicated in the pathogenesis of hoa . Silveira et al . Reported that plasma levels of vegf were significantly higher in patients with primary hoa and in those with lung cancer associated with hoa, compared with healthy control . In addition, serum vegf levels were higher in patients with lung cancer and hoa compared with lung cancer patients without hoa . Thymic carcinoma is a rare epithelial neoplasm of the thymus that has a poor prognosis . In the past, invasive thymoma has a similar cytological feature to benign thymoma but thymic carcinoma exhibits malignant cytological features . There has been no explanation for the mechanism of the coexistence of thymic carcinoma and hoa . Reported that serum levels of vegf and basic fibroblast growth factor (bfgf) were significantly elevated in patients with thymic carcinoma compared with those in healthy volunteers . Therefore, the results suggested that serum vegf and bfgf might serve as markers for thymic carcinoma and these angiogenic factors could be associated with the invasiveness of thymic carcinoma . On the other hand, lauriola et al thus, we measured the serum level of vegf in the patient by using human vegf elisa (enzyme - linked immunosorbent assay) kit (amersham pharmacia biotech, buckinghamshire, uk). Serum vegf level was elevated in the patient (1,120 pg / ml) compared with the mean value of healthy volunteers (388 68.9 pg / ml). We also measured the serum level of the growth hormone in the patient . Although it might not have significance because provocation and suppression tests were not done, the serum level of the growth hormone (5.6 ug / l) was not increased compared with a normal control value (<10 ug / l). However, further study is warranted to evaluate the mechanism of hoa and the relationship between hoa and thymic carcinoma . The patient was initially treated with external radiation therapy because of poor resectability and increased operative risk ., new metastatic brain lesion was observed in a brain mri that was performed when the patient complained of neurologic symptoms . Brain metastasis was known to be rare in thymic carcinoma, so it was also an unusual presentation of thymic carcinoma . Because high serum vegf has been known to relate with metastasis and invasiveness of cancer and poor clinical outcome, brain metastasis might be associated with elevated serum vegf in the patient . Considering the possible relationship between serum vegf and the development of hoa, it may be suggested that hoa could be a poor prognostic sign in thymic carcinoma . In summary, we experienced a rare case of poorly differentiated thymic carcinoma associated with hoa and suggest a possible association between thymic carcinoma and hoa.
17-hydroxysteroid dehydrogenase (17-hsd) enzymes are involved in the interconversion of inactive and active sex - steroid hormones, thereby playing an essential role in the intracrine regulation of estrogen-, androgen-, and progesterone - dependent physiological functions . 17-hsd1 is responsible for the conversion of estrone to estradiol, the most potent natural estrogen . Importantly, 17-hsd1 expression showed a negative correlation with breast cancer progression and was identified as an independent prognostic marker for the disease - free and overall survival of patients with breast cancer [2, 3]. Elevated expression of 17-hsd1 was observed in endometrial cancer and nonsmall cell lung cancer . Furthermore, the expression ratio of 17-hsd1 and 17-hsd2 was found to be a predictor of the response to tamoxifen in postmenopausal breast cancer patients . The administration of specific 17-hsd1 inhibitors led to significantly decreased tumor growth in breast cancer cell xenograft tumor mouse models [7, 8] and reversed estrogen - dependent endometrial hyperplasia in transgenic mice, indicating that this enzyme is a promising drug target against estrogen - dependent diseases such as endometriosis and endometrial cancer as well as breast and ovarian tumors . Several classes of chemicals inhibiting 17-hsd1 were tested in vitro, including steroid - like molecules, nonsteroidal compounds, and chimeric molecules, acting on both the active center and the cofactor binding site of the enzyme [8, 1016]. However, only a limited number of inhibitors have been tested in vivo so far and further research is needed . In order to develop potent and selective 17-hsd1 inhibitors, a profound understanding of the structure - function relationships of the enzyme is essential . 17-hsd1 belongs to the short - chain dehydrogenase / reductase (sdr) family and contains the conserved rossmann - fold for nucleotide binding, the catalytic triad with residues ser, tyr, and lys and a dimerization region . Lys is a critical residue for the discrimination between c-18 and c-19 steroid substrates . Targeting of functionally essential cysteine residues in proteins is suggested as a promising approach for the design of new types of pharmaceutical agents ., we demonstrated that the structurally related enzyme 11-hydroxysteroid dehydrogenase type 2 (11-hsd2) contains a cysteine residue at position 90, analogous to cys on 17-hsd1 . Therefore, we hypothesized that cys on 17-hsd1 may represent a target site for novel inhibitors . In the present study, we applied 3d structure modeling and enzyme activity measurements to investigate the biochemical properties of cysser mutant 17-hsd1 and to compare its sensitivity towards sulfhydryl modifying agents with that of wild - type 17-hsd1 . Cell culture media were purchased from invitrogen (carlsbad, ca) and [2,4,6,7-h]-estrone from amersham pharmacia (piscataway, nj, usa). All other chemicals were from fluka ag (buchs, switzerland) and of the highest grade available . In order to facilitate detection, an octahistidine tag was added to the c - terminus of human 17-hsd1 by pcr amplification using oligonucleotide primers containing the tag - coding sequence (forward primer 5-taaaccctgaggaggtggcggaggtcttc-3, reverse primer 5-tgctctagaagcttaatgatgatgatgatgatgatgatgctgcggggcggccggaggatcg-3). The substitution of cys to serine was introduced into the c - terminal histidine - tagged 17-hsd1 cdna in bluescript vector by site - directed mutagenesis using the forward primer 5-tcatcaccggctcttcctcg-3 and the reverse primer 5-gaggaagagccggtgatgag-3 according to the quick change mutagenesis kit (stratagene, amsterdam, the netherlands), followed by subsequent recloning into pcdna3.1 expression plasmid . Hek-293 cells were grown to 6070% confluence in dulbecco's modified eagles medium (dmem) supplemented with 10% fetal bovine serum, 4.5 g / l glucose, 50 units / ml penicillin / streptomycin, and 2 mm glutamine, followed by transfection using the calcium phosphate precipitation method . The transfection efficiency was 32 3% . To examine the expression levels of the overexpressed proteins, we performed sds - page (30 g of total cellular proteins loaded per lane) followed by immunoblotting and detection of the histidine - tagged proteins using tetra - his antibody (qiagen gmbh, hilden, germany; cat . Was visualized using an anti--actin antibody (santa cruz biotechnology, santa cruz, ca; cat . Cells were harvested 48 h after transfection, washed twice with phosphate - buffered saline (pbs), and centrifuged for 4 min at 150 g . Supernatants were removed and the cell pellets were quick - frozen in a dry ice - ethanol bath and stored at 80c . The reductase activity of 17-hsd1 was measured by incubation of cell lysates for 10 min at 37c in the presence of 200 nm radiolabeled estrone and 400 m nadph in a reaction buffer containing 20% glycerol, 1 mm edta, and 50 mm potassium phosphate, ph 7.4 . Inhibitors were diluted from stock solutions in dimethylsulfoxide (dmso) and immediately used in the assays . The dmso concentration did not exceed 0.1% and had no effect on the enzyme activities . For the enzyme activity assay in intact cells, hek-293 cells were grown in 10 cm culture dishes, transfected with plasmids for histidine - tagged wild - type 17-hsd1 or cysser mutant, detached 24 h after transfection and distributed in 96-well plates at a density of 10,000 cells per well . After 16 h, cells were incubated in serum- and steroid - free medium, and the conversion of radiolabeled estrone to estradiol was determined upon incubation for 30 min at 37c in a total volume of 50 l containing 200 nm estrone . The reaction was stopped by adding methanol containing 2 mm unlabeled estrone and estradiol, followed by separation of steroids by tlc and scintillation counting . For determination of enzyme kinetics, estrone concentrations ranging from 10 to 800 nm were used . Data (mean sd) were obtained from three independent experiments and were calculated using the data analysis toolbox (elsevier mdl, allschwil, switzerland). The stability of wild - type and mutant 17-hsd1 protein was analyzed basically as described previously . Briefly, to investigate the protein half - life of wild - type 17-hsd1 and mutant cysser, hek-293 cells grown in six - well plates were transfected with plasmids for mutant and wild - type enzyme, washed once with pbs 24 h after transfection, and incubated with fresh medium containing 50 g / ml cycloheximide . At 0, 12, 24, and 48 h, alternatively, cells transfected with plasmids for mutant and wild - type enzyme were washed once 16 h after transfection, followed by incubation in leucine - free dmem (mp biomedicals, illkirch, france) for 45 min to deplete endogenous leucine . The medium was then replaced by 1 ml of leucine - free dmem supplemented with 20 ci / ml l - leucine-[3,4,5-h(n)], followed by incubation for 3 h. the labeling was terminated by addition of 5 mm unlabeled leucine, washing twice with dmem, and incubation in dmem . At 0, 12, 24, and 48 h, aliquots of cells were snap - frozen prior to purification of histidine - tagged proteins by using a ni - nta agarose kit according to the manufacturer (qiagen ag, hombrechtikon, switzerland). After elution, proteins were subjected to sds - page, the gels were dried and exposed to tritium - sensitive screens (tr uncoated bafbr: eu screens) for 16 h, followed by analysis using a cyclone phosphor - imager (perkinelmer life and analytical sciences, shelton, ct, usa). The protein sequences of 17-hsd1 from different species and different human sdrs were compared using the clustalw algorithm, run on http://www.ebi.ac.uk/, with default program parameters . To investigate the effect on the structure of 17-hsd1 of mutating cys to ser, we extracted 1fdt from the protein data bank (pdb). Cys was converted to serine using the biopolymer option in the insight ii software package . The structure of the ser mutant 17-hsd1 was refined with discover 3 for 10,000 iterations, using a distant dependent dielectric constant of 2 . The analysis of the peptide sequence of human 17-hsd1 using the clustal w algorithm revealed that residue cys is highly conserved among species, including rodents and zebrafish (figure 1), suggesting a role for this residue in the stability and/or function of the protein . Cys is located between the first two of three highly conserved glycine residues of the rossmann - fold nucleotide binding domain . Interestingly, the cysteine and the two downstream serine residues also are present in all - trans retinol dehydrogenase rdh8, which like 17-hsd1 belongs to the sdr28c family . Moreover, the cysteine residue at this position is conserved in all members of the sdr9c family, except for 17-hsd2, which has a cysteine residue downstream by two positions . To begin to understand the role of cys for 17-hsd1 function, we analyzed the interactions of cys with adjacent amino acids in 17-hsd1 cocrystalized with estradiol and nadp . The crystal structure of 1fdt reveals that cys has van der waals contacts with ile, gly, gly, ala, and thr . Gly, gly, and thr directly stabilize the binding of the cofactor nadp (figure 2(a)). The numerous close contacts of cys with amino acids in the nadp(h)-binding site indicate that substitution of the sulfhydryl group with a larger chemical would disrupt this site and probably alter nadp(h) binding and catalytic activity . To begin to study the function of this cysteine residue as revealed by the 3d model (figure 2(b)), mutating cys to serine does not lead to significant changes in contacts between ser and ile, gly and ala . However, all three contacts between ser and gly are shorter than between cys and gly, and gly is more distant from a phosphate oxygen on nadp (figure 2(b)). Also, ser is a little more distant from the backbone oxygen on thr, and thr is 4.7 from the oxygen on the adenosine phosphate . The backbone nitrogen on gly is 4.5 from the same phosphate oxygen on nadp (figure 2(b)). In a previous study, sulfhydryl modifying chemicals were found to exert potent inhibitory effects on 11-hsd2 and substitution of cys by serine abolished enzymatic activity . To test the hypothesis that cys on 17-hsd1 has similar essential stabilizing interactions in the nadph binding region, we assessed the inhibitory potential of the cysteine modifying agent n - ethylmaleimide (nem) and of dithiocarbamate chemicals . Nem appeared to be a weak inhibitor with an ic50 of 22 6 m upon simultaneous incubation of lysates of 17-hsd1 expressing hek-293 cells with 200 nm estrone and increasing concentrations of nem . In line with an irreversible mode of inhibition, preincubation with nem resulted in a more pronounced inhibitory effect in a time - dependent manner . Preincubation of lysates with 20 m nem for 1 h prior to the addition of estrone completely abolished 17-hsd1 activity (data not shown). In contrast to the previously observed potent inhibition of 11-hsd2, dithiocarbamates turned out to have rather modest inhibitory effects on 17-hsd1 . The ic50 values for thiram (21 4 m), disulfiram (8 1 m), maneb (25 3 m), and zineb (24 3 m) upon simultaneous incubation of the 17-hsd1 enzyme preparation with substrate and inhibitor were about two orders of magnitude higher than those obtained for 11-hsd2, indicating that 17-hsd1 is much less prone to inhibition by sulfhydryl modification . Importantly, as shown in figure 3, preincubation with nadph for 15 min protected from inhibition by nem, an effect which was concentration dependent . Preincubation with nadph also protected from inhibition by dithiocarbamates (data not shown), suggesting that binding of nadph prevents the covalent modification of cys in the cofactor binding region . To study the role of cys for 17-hsd1 function, we generated mutant cysser and compared the expression of histidine - tagged wild - type and mutant enzymes upon transient expression in hek-293 cells, which lack endogenous 17-hsd1 expression . Despite comparable transfection efficiency, mutant cysser was expressed at approximately twofold lower levels than wild - type 17-hsd1 (figure 4). Moreover, several low - molecular weight bands were detected, indicating a lower stability of the cysser mutant protein . Next, we performed experiments in transfected hek-293 cells using cycloheximide in order to block de novo protein synthesis and estimate protein half - life . The signal detected for histidine - tagged 17-hsd1 protein was not significantly decreased 48 h after blocking translation with cycloheximide (figure 5(a)), indicating a protein half - life greater than 48 h. longer incubations are not appropriate due to the cytotoxicity of cycloheximide . In contrast, mutant cysser was less stable and the protein half - life of the mutant enzyme was estimated to be 26 7 h (mean sd). A pulse - chase experiment using h - leucine labeling confirmed the decreased stability of the mutant protein (estimated protein half - life of 15 6 h) compared with the wild - type 17-hsd1 (estimated protein half - life of 36 10 h) (figure 5(b)). The differences in the protein half - life estimation by the pulse - chase and cycloheximide methods may be explained by the incomplete inhibition of protein synthesis in the latter approach . A comparison of the enzyme activities of lysates expressing wild - type 17-hsd1 or mutant cysser showed approximately 50% lower activity for the mutant (data not shown). However, after correction for protein expression using anti - histidine - tag antibody there was no significant difference between wild - type and mutant enzymes . The analysis of enzyme kinetics revealed a slightly higher apparent km but no significant change in the maximal velocity (vmax) for estrone reduction (table 1). In intact cells, the activity of mutant cysser was indistinguishable from that of the wild - type enzyme (data not shown). Next, we compared the effect of different dithiocarbamate chemicals on the activity of wild - type 17-hsd1 and mutant cysser . Mutant cysser was protected from inhibition by all of the dithiocarbamates tested (figure 6). Similarly, the cysteine - modifying agent nem inhibited the activity of the wild - type enzyme approximately two times stronger than that of mutant cysser, confirming the role of this cysteine for 17-hsd1 function (data not shown). Analysis of the 17-hsd1 protein sequences from different species revealed that the cysteine at position 10 in the human enzyme is highly conserved . Protein sequence alignment further revealed that a cysteine at this position in the rossmann - fold nucleotide binding region is conserved in the sdr subfamilies sdr28c and sdr9c . The 3d structure of 17-hsd1 predicts several van der waals contacts between cys and residues involved directly in the binding of nadph . The 3d model of ser mutant 17-hsd1 finds that although most contacts are conserved there are changes that may be significant . For example, ser is closer to gly, and gly is more distant from a phosphate oxygen on nadp . Also, in the ser mutant 17-hsd1, the backbone oxygen on thr and backbone nitrogen on gly move to 4.7 and 4.5, respectively, from the oxygen on the adenosine phosphate . In wild - type 17-hsd1, the backbone oxygen on thr and backbone nitrogen on gly are 3.3 and 3.8, respectively, from this oxygen on nadp . The loss of these two stabilizing contacts could reduce the affinity for nadp(h) in the ser mutant 17-hsd1 . Another possible contribution to lower stability of nadp(h) in the ser mutant may be the different chemical properties of the thiol group on cys and alcohol on ser . For instance, only the thiol group is predicted to be partially deprotonated at neutral ph, which could better stabilize the site around cys . Km values for nadph will need to be determined in follow - on studies to address this question . Nevertheless, our prediction is supported by results from huang et al . Who demonstrated that insertion of a positively charged lysine residue in the neighborhood of cys and ser led to a more than 20-fold increase in the preference of 17-hsd1 for nadp(h) against nad(h). In a previous study, we found that the related sdr enzyme 11-hsd2 also contains a cysteine residue at the position corresponding to cys on 17-hsd1 in the cofactor binding region . The 11-hsd2 cysser mutant almost completely lost its enzymatic activity, due to impaired protein folding and mislocalization of the mutant protein . Interestingly, mutations of the analogous residue cys in the human (r)-3-hydroxybutyrate dehydrogenase led to a slight increase in the apparent km for both nadp(h) and nad(h). The cysser mutant of the (r)-3-hydroxybutyrate dehydrogenase, analogous to 17-hsd1 cysser, showed a twofold lower apparent vmax compared with the wild - type enzyme . The slight increase in the apparent km of 17-hsd1 mutant cysser for estrone, observed in our measurements in cell lysates, indicates a decreased affinity for the substrate as a result of disturbed interactions with the cofactor nadph . A careful structural comparison between the interactions of residues with the cofactor and substrate in 17-hsd1, 11-hsd2, and (r)-3-hydroxybutyrate dehydrogenase should offer an explanation for the different effects of the modification of the analogous cysteine residues of the three sdrs . In human retinol dehydrogenase, the function of the analogous cys is not studied in detail; however, boerman and napoli showed that the protein contains cysteine residues in close proximity, which are essential for the catalytic activity . In our experiments, the preincubation with increasing concentrations of nadph was able to protect 17-hsd1 from inhibition by the sulfhydryl modifying agents nem and dithiocarbamates, suggesting an indirect role of cys in stabilizing the binding of the cofactor . Dithiocarbamates and nem were able to inhibit the activity of 17-hsd1, although at concentrations significantly higher than those needed for inhibition of 11-hsd2 . The high sensitivity of 11-hsd2 toward sulfhydryl modifying chemicals was recently shown to be dependent on the presence of a cysteine residue in the substrate binding region . Our western blot experiments detected low - molecular bands for the 17-hsd1 cysser mutant, suggesting increased degradation of the mutant enzyme . The more rapid degradation is likely due to changes in the protein conformation and thus exposure of amino acid residues normally buried inside the protein, followed by activation of the proteasome . A limitation of the present study includes that wild - type and mutant enzymes were overexpressed and expression levels are higher than endogenous levels . Thus, the estimated half - life of the proteins may be different in an endogenous situation . Nevertheless, the results demonstrate a reduced stability of the mutant compared with the wild - type enzyme . The present work provides novel information on the structure - activity relationship of 17-hsd1 and reveals that cys is involved in essential stabilizing interactions in the cofactor binding region . Future studies using protease digestion of purified 17-hsd1 wild - type and cysser mutant proteins should provide further mechanistic insight into the stabilizing interactions of this residue.
The use of an indelible ink mark on the fingernail is a practice during the elections in india . As the fingernail grows, the level of the mark shifts distally . According to the election commission of india, 540 million people voted with 23 million belonging to the age group 1819 years, making the 2014 general election the largest ever election in the world . With these overwhelming statistics, the election period from april to may 2014 was selected as an appropriate time to conduct a study on the rate of nail growth as this indelible mark could be easily used as a simple tool to carry out a large - scale study in a short period of time in our country . In other countries such as cambodia and maldives, the voter dips a finger in the ink, whereas in afghanistan an ink pen is used . Exports indelible ink to 28 countries, including turkey, south africa, nigeria, canada, and malaysia thus making it a possibility to use this indelible ink mark as a universal tool to measure the rate of nail growth not just in our country but worldwide to obtain data across a vast epidemiological and geographical spectrum which will further help to confirm the role of age, gender, race and temperature among other factors affecting the rate of nail growth . To the best of our knowledge, there has been no such study undertaken in the past to assess the rate of nail growth in the south indian population . To ascertain whether the indelible ink mark used during elections can be used as a tool to rapidly attain statistics in a large population nationwide, for assessing the rate of nail growthto assess other demographic and systemic factors affecting the rate of nail growth . To ascertain whether the indelible ink mark used during elections can be used as a tool to rapidly attain statistics in a large population nationwide, for assessing the rate of nail growth to assess other demographic and systemic factors affecting the rate of nail growth . To ascertain whether the indelible ink mark used during elections can be used as a tool to rapidly attain statistics in a large population nationwide, for assessing the rate of nail growthto assess other demographic and systemic factors affecting the rate of nail growth . To ascertain whether the indelible ink mark used during elections can be used as a tool to rapidly attain statistics in a large population nationwide, for assessing the rate of nail growth to assess other demographic and systemic factors affecting the rate of nail growth to ascertain whether the indelible ink mark used during elections can be used as a tool to rapidly attain statistics in a large population nationwide, for assessing the rate of nail growthto assess other demographic and systemic factors affecting the rate of nail growth . To ascertain whether the indelible ink mark used during elections can be used as a tool to rapidly attain statistics in a large population nationwide, for assessing the rate of nail growth to assess other demographic and systemic factors affecting the rate of nail growth in our study, 74 patients who presented to the outpatient department (opd) of st . John's medical college in the month of july 2014 with the voter's ink mark were included in the study . The voter's mark on the left index fingernail of patients during the recent elections was used as a marker for measuring the length of the nail [figure 1]: left index finger with indelible ink mark the length of the nail was calculated from the center of the proximal nail fold to the proximal end of the voter mark using a magnifying lens, calipers, and measuring scale [figures 2 and 3] the date of voting and the date of recording the length of the nail were noted for each individualthe rate of nail growth was calculated by dividing the length of the nail (in mm rounded up to 3 decimal places) by the number of daysthe time period between the election date and the date of the measurement of the rate of nail growth was> 60 days . The length of the nail was calculated from the center of the proximal nail fold to the proximal end of the voter mark using a magnifying lens, calipers, and measuring scale [figures 2 and 3] the date of voting and the date of recording the length of the nail were noted for each individual the rate of nail growth was calculated by dividing the length of the nail (in mm rounded up to 3 decimal places) by the number of days the time period between the election date and the date of the measurement of the rate of nail growth was> 60 days . Measurement with calipers calipers with digital scale the following information was obtained from each patient: demographic detailsassociated systemic diseasescutaneous diseasedrug intakeother factors, e.g. Pregnancy, lactation . The average rate of nail growth was calculated in each of the following groups: age (<35 years,> 35 years)sexchronic diseases: diabetes mellitus, hypertension, anemia, tuberculosis, connective tissue diseasesdermatological conditions: psoriasis, pemphigus, leprosynutritional supplementsimmunosuppressive drugs: methotrexate, cyclophosphamide . Age (<35 years,> 35 years) chronic diseases: diabetes mellitus, hypertension, anemia, tuberculosis, connective tissue diseases dermatological conditions: psoriasis, pemphigus, leprosy nutritional supplements immunosuppressive drugs: methotrexate, cyclophosphamide . Females had a higher rate of nail growth (0.0980.141 mm / day) as compared to males (0.0720.124 mm / day). The rate of nail growth in younger patients (<35 years) was found to be 0.1080.141 mm / day as compared to older patients (> 35 years) which was 0.0720.120 mm / day [table 1]. Effect of age and sex on the rate of nail growth patients with chronic systemic disorders such as diabetes, tuberculosis, hypothyroidism, hypertension and connective tissue disorder had a reduced rate of nail growth as compared to patients without any chronic disorder (0.1110.122 mm / day) [table 2]. Effect of systemic disease on the rate of nail growth patients suffering from psoriasis had an increased rate of nail growth (0.1180.124 mm / day) whereas patients with other dermatological conditions such as pemphigus and leprosy had a lower rate of nail growth [table 3]. Effect of cutaneous diseases on the rate of nail growth patients who were on nutritional supplements such as vitamin d and calcium had an increased rate of nail growth . Patients on anti - tubercular therapy and immunosuppressants such as methotrexate and cyclophosphamide were found to have a slower rate of nail growth [table 4]. Effect of drugs on the rate of nail growth the median number of days for which the rate of nail growth was measured for our entire study sample was 111 days . The median number of days for which rate of nail growth was measured for the remaining subclassifications has been mentioned below . The average rate of nail growth in our study was found to be 0.113 mm / day . This coincided with the average rate of nail growth in a study done by bean which was found to be 0.119 mm / day . However in a study done by rani et al . In bhopal, the average rate of nail growth of the left index finger, was found to be lower (0.086 mm / day). The rate of nail growth depends on the age, with it being higher in a younger age group that is, <35 years which is consistent with a study conducted by peter . The rate of nail growth is more in females than males which are consistent with a study conducted by rani et al . In 2000 . The rate of nail growth was retarded in patients with connective tissue disease (0.106 mm / day) as compared to the healthy individuals (0.118 mm / day). In a study done by hamilton patients with rheumatoid arthritis had a lower rate of nail growth (0.085 mm / day) as compared to healthy individuals (0.09 mm / day). This study also showed that the nail grows slower in patients on steroids as compared to healthy individuals which were consistent with our study . The rate of nail growth was reduced in patients with anemia, hypothyroidism, infections such as tuberculosis and drugs like methotrexate and was increased in pregnancy and psoriasis which was consistent with the findings in a study by orentreich et al . However, our study showed an increased rate of nail growth in patients on nutritional supplements as compared to the same study which showed no effect on the rate of nail growth . As far as adverse effects related to indelible voter's ink is concerned none of our patients reported the above, however there have been reports in literature about the fatal irritant potential of this ink resulting in chemical burns . This study conducted on 74 patients included 38 males and 36 females who during the month of april to may 2014 participated in the general election and presented to our opd in the month of july . The findings revealed the slightly higher rate of nail growth as compared to literature by rani et al . The rate of nail growth was found to be higher in females, the younger age group which was consistent with that of rani et al . It was also found to be higher in pregnancy, patients with psoriasis and patients on nutritional supplements . However, reduced rate of nail growth was found in patients with chronic diseases such as connective tissue disorders, diabetes, hypertension, hypothyroidism, and patients on steroids and methotrexate . This study helped highlight a simple observation like the indelible ink mark which can be successfully used to rapidly assess the rate of nail growth within a short span of time over the entire spectrum of a country around the time of an election . And as this study was found to be successful in relation to correlation of data with other studies, this method can also be used across other countries to obtain much wider and varied demographic details to study various other factors affecting nail growth . However, the limited sample size was found to be a limitation of the study . This study depicts how a simple observation like the indelible ink mark can be used to rapidly assess the rate of nail growth within a short span of time over the entire spectrum of a country around the time of an election.this method can be used as a simple tool across not just our country but also other nations to obtain demographic details across a wider cross section of the society . This information can be extrapolated to obtain factors affecting rate of nail growth across a more variable epidemiological society . This study depicts how a simple observation like the indelible ink mark can be used to rapidly assess the rate of nail growth within a short span of time over the entire spectrum of a country around the time of an election . This method can be used as a simple tool across not just our country but also other nations to obtain demographic details across a wider cross section of the society . This information can be extrapolated to obtain factors affecting rate of nail growth across a more variable epidemiological society . This study depicts how a simple observation like the indelible ink mark can be used to rapidly assess the rate of nail growth within a short span of time over the entire spectrum of a country around the time of an election.this method can be used as a simple tool across not just our country but also other nations to obtain demographic details across a wider cross section of the society . This information can be extrapolated to obtain factors affecting rate of nail growth across a more variable epidemiological society . This study depicts how a simple observation like the indelible ink mark can be used to rapidly assess the rate of nail growth within a short span of time over the entire spectrum of a country around the time of an election . This method can be used as a simple tool across not just our country but also other nations to obtain demographic details across a wider cross section of the society . This information can be extrapolated to obtain factors affecting rate of nail growth across a more variable epidemiological society . This study depicts how a simple observation like the indelible ink mark can be used to rapidly assess the rate of nail growth within a short span of time over the entire spectrum of a country around the time of an election.this method can be used as a simple tool across not just our country but also other nations to obtain demographic details across a wider cross section of the society . This information can be extrapolated to obtain factors affecting rate of nail growth across a more variable epidemiological society . This study depicts how a simple observation like the indelible ink mark can be used to rapidly assess the rate of nail growth within a short span of time over the entire spectrum of a country around the time of an election . This method can be used as a simple tool across not just our country but also other nations to obtain demographic details across a wider cross section of the society . This information can be extrapolated to obtain factors affecting rate of nail growth across a more variable epidemiological society.
An ophthalmological evaluation is mandatory to get a correct diagnosis in a case of acute acquired onset of concomitant esotropia (aace) with diplopia . We describe a complex case of a child of 8 years affected by a short duration of diplopia and esodeviation (from 2 to 4 h), so that signs are not directly recognized by the ophthalmologist, but just reported by the child, parents, or other health care providers . The peculiarity of our case is the short duration of strabismus and diplopia and their spontaneous regression . Being transient, it cannot be classified among aaces; we therefore considered it as a different entity which we have called acute acquired onset of transient esotropia (aate). Aate is probably due to ophthalmoplegic migraine (om) or accommodative spasm (as). This is the first report in the literature that differentiates aate from aace, trying to investigate possible causes, the diagnostic algorithm, and potential treatments . An 8-year - old caucasian female was evaluated in the outpatient clinic of pediatric ophthalmology of melegnano hospital, after she had been hospitalized 1 week before in another hospital for aate . The child was born at term with vaginal delivery, she had normal mental and motor growth, and she was in good health . The presentation of symptoms first occurred at school: the patient suddenly complained of double vision, and the teachers noticed esodeviation of the left eye (le). Three hours later, the patient was accompanied by her father to the nearest emergency department, but on the way, diplopia and strabismus regressed . Symptoms reappeared only when the child was solicited, first by her father in the waiting room and then during the pediatric visit, to fix on a near target . In these cases, diplopia and esotropia regressed in about 15 min . During the ophthalmological evaluation both diplopia and le esotropia were no longer present . The patient had a best corrected visual acuity of 20/20 in both eyes using her own spectacles: right eye (re) 0.75 cylinder (cyl)/160 and le 0.25 cyl/20. Refraction after cycloplegia was not tested . The ophthalmologist required further investigation . The neurological examination and the simpson test for myasthenia were negative . Brain ct, brain mri, and electroencephalogram were within the range of normality . Finally, blood tests (complete blood cell count, inflammatory markers, and thyroid function indices) and neuropsychiatric evaluation were normal . The diagnosis at discharge was of suspected om, because the patient had reported a slight headache with spontaneous resolution and without nausea and vomiting the day before the aate attack . When we evaluated the patient, a week after hospital discharge, the ophthalmological and orthoptic examination was similar to that performed during hospitalization, the only difference being visual acuity of 20/25 in le with her glasses . We performed refractive examination in cycloplegia half an hour after the administration of tropicamide 1% 3 times in each eye . Refractive cycloplegic values with an autorefractometer (ar600; nidek, japan) were re 1.00 cyl/160 and le + 0.75 cyl/85. Cycloplegic visual acuity was 20/40 in re and 20/25 in le without lens correction, 20/20 in re and 20/32 in le with glasses in use, and 20/20 in le with + 0.75 cyl/85. The patient's glasses had a low myopic astigmatism (0.25 cyl/20) in le, although in cycloplegia she presented a hyperopic astigmatism (+ 0.75 cyl/85) in the same eye . Therefore, in addition to the om, the as could be considered as a possible cause . For 18 months thereafter, the child was instructed to continuously wear glasses with the proper correction, and no episodes of strabismus occurred . The case here described may meet group ii criteria, characterized by minimal hypermetropia and diplopia, but in the literature there are only a few case reports and case series about aace . Moreover, in these studies all patients of group ii were referred for strabismus surgery due to persistent esotropia [1, 2, 3]. Only kemmanu et al . Described a case of aace where the patient did not receive surgery . In fact the cause was an as in le associated with mild hypermetropia in cycloplegia (+ 0.75 sphere). The peculiarity of aate with respect to aace is the short duration of strabismus and diplopia (about 3 h) and their spontaneous regression . Aate could be caused by om, a rare neurological syndrome characterized by recurrent attacks of headache and ophthalmoplegia . The oculomotor nerve is the most commonly involved cranial nerve, and diplopia, ptosis, and mydriasis are common; also the other cranial nerves may be affected (and, of note, in the case of om an inconcomitant deviation may be rarely present). Most patients recover completely within days to weeks, but a minority could show persistent neurological deficits . In our case, the patient had a mild headache the day before the onset of symptoms, and the aate could have been caused by paralysis of the sixth cranial nerve; but she had no abdominal pain, nausea, and vomiting . Moreover, a family history of migraine headaches was not reported (table 2). During the ophthalmological evaluation both diplopia and esotropia in le were no longer present, and it was not possible to assess whether the deviation was concomitant or inconcomitant . However, the short duration of symptoms and spontaneous remission of aate could support the om diagnosis, especially if such attacks had recurred in the future . It is an involuntary condition occurring in the presence of greater than normal accommodative response than accommodative stimulus . As is characterized by transient episodes of variable esotropia, pseudomyopia, and miosis . It may begin suddenly, is more likely to be bilateral, disappears with cycloplegia, and may resolve spontaneously (table 2). In our case, aspects which may be compatible with a diagnosis of as are as follows: (a) the patient had a hypermetropic astigmatism in le but the left lens presented a myopic astigmatism; (b) symptoms reappeared when the father and the pediatrician showed fixation aims for a near target; (c) longer reading / study sessions in the last 2 weeks; (d) the short duration and spontaneous regression of symptoms; and (e) the absence of aate after 18 months, using spectacles with proper correction in a continuous manner . Factors limiting the correct diagnosis were (a) features of aate were just reported by the patient, father, and pediatrician; as symptoms regressed before the ophthalmological evaluation, the characteristic signs of as (miosis and pseudomyopia) could not be evaluated; (b) the disorder was unilateral; and (c) a slight hypermetropic defect was present in le . It will be important to assess future recurrence of the condition, with proper lens correction, with long follow - ups . The aate diagnosis is complex . It is necessary to exclude nonophthalmological causes through the execution of neurological examination, test for myasthenia, brain ct, blood tests (complete blood count, inflammatory markers, and thyroid function indices), and neuropsychiatric evaluation . If all tests are negative, full ophthalmological (including cycloplegic refraction) and orthoptic evaluation are mandatory to avoid the unnecessary execution of expensive tests (such as electroencephalogram and brain mri) which may be a source of anxiety for children and their families . The parents of the patient (the patient was under 18 years of age) signed a comprehensive consent form according to good clinical practice guidelines before proceeding with all examinations and treatments . It satisfied all the requirements of the declaration of helsinki and the italian national law for the protection of personal data . The local ethics committee decided that no formal ethics approval was required in this particular case.
Hunter syndrome (mucopolysaccharidosis type ii or mps ii) is an x - linked metabolic disorder caused by a deficiency in the lysosomal enzyme iduronate-2-sulfatase (i2s) [1, 12]. I2s catalyzes a step in the degradation of dermatan sulfate and heparan sulfate, and in affected patients, these enzyme substrates accumulate in cells and tissues and contribute to the multiorgan pathologies associated with hunter syndrome . It has been estimated that the incidence is about 1 in 162,000 live male births . Hunter syndrome patients usually appear normal at birth with clinical signs and symptoms emerging between the ages of 2 and 4 years [8, 12]. The presenting signs typically include coarse facial features; respiratory obstruction caused by enlarged tongue, tonsils, and adenoids; joint stiffness and skeletal abnormalities; and enlarged liver and spleen [1517]. The severe phenotype is characterized by progressive central nervous system involvement that results in severe cognitive impairment and developmental regression, with death typically occurring in the second decade of life [7, 12, 17]. Patients with the attenuated phenotype do not experience cognitive impairment but may still demonstrate all of the somatic signs and symptoms of the disease [8, 12, 16]. Diagnosis of hunter syndrome can be challenging as signs and symptoms of hunter syndrome are not specific to the disease, and not all clinical features will be present in the same order or equally rapidly in each patient . Diagnosis may therefore be delayed, especially in patients without a known family history of hunter syndrome . Enzyme replacement therapy (ert) with recombinant human i2s is available for the treatment of hunter syndrome [10, 11]. In addition to ert, there is a hope that hunter syndrome may be responsive to bone marrow transplantation in the future . Therefore, although a rare disease, pediatricians and other primary care physicians have an obligation to be aware of the signs and symptoms of hunter syndrome and methods and tools to effectively establish a diagnosis . Mnemonics are commonly employed in clinical medicine as screening tools or to guide clinical management [2, 13], and here, we describe the development of a simple mnemonic screening tool that may aid pediatric specialists and primary care physicians in the recognition and diagnosis of hunter syndrome . Hunter outcome survey (hos) is an international, long - term observational registry designed to increase the knowledge of the natural history of hunter syndrome and to evaluate the safety and effectiveness of long - term ert with idursulfase (elaprase, shire human genetic therapies, inc . All participating centers receive approval from their local institutional review board or ethics committee before enrolling any patients into hos . Hos is controlled by physicians and is overseen by national, regional, and international advisory boards comprising physicians experienced in the management and treatment of hunter syndrome patients . Any patient with a biochemically or genetically confirmed diagnosis of hunter syndrome is eligible to enroll in hos independent of whether receiving treatment or not . The hos database consists of data collected from medical examinations conducted during the usual medical care of the patients . The signs, symptoms, and other clinical information (e.g., medical history, laboratory values, etc .) Surveyed are described in detail by wraith and colleagues and cover all the major organ and system involvement that occurs in hunter syndrome . Shire hgt maintains the database and provides statistical support to hos physicians and advisory boards . For the purposes of this study, the investigators were given permission, by the global executive committee of the hos participating investigators, to query the database regarding the prevalence of specific signs and symptoms present in individual patients . The preliminary assessment was based on the hos database as of january 10, 2008, and the final assessment was based on the april 16, 2009 data extract . The goal of the present study was to develop a sensitive screening tool to aid in the diagnosis of hunter syndrome using medical history data collected in hos . Table 1 presents the hunter mnemonic, which was based on the key clinical features observed in patients with hunter syndrome . The january 2008 data extract of the hos database was queried for the prevalence of the signs and symptoms before diagnosis within individual patients as shown in table 2 . A random sample of 25 patients in hos with available information and who did not have a prenatal diagnosis was used to characterize the utility of a uniform weighting (table 2, weighting 1) of these ten signs and symptoms to specifically identify patients with hunter syndrome . A second weighting scheme was also evaluated (table 2, weighting 2) using a second random sample of 25 patients in hos with available information who were not included in the first sample and who did not have a prenatal diagnosis or family history of hunter syndrome . With this scheme, signs and symptoms unlikely to be observed in a non - affected child these signs and symptoms included dysmorphic facial features, nasal obstruction, enlarged tongue, enlarged liver, enlarged spleen, and joint stiffness . After this preliminary evaluation of the weighting schemes, weighting 2 was again evaluated using the april 2009 extract of the hos database, which included 237 patients with available data who did not have a prenatal diagnosis or a family history of hunter syndrome and who were not included in the two random samples of 25 patients used to assess the two weighting schemes.table 1the hunter mnemonic screening instrument for identifying patients with hunter syndromemnemonickey clinical featurehherniahearingherniahearing loss or impairment, hearing aids, chronic or acute otitisuunusual facesdysmorphic facial featuresnnasal obstructionnasal obstruction, rhinorrheattongue and tonsilsenlarged tongue, enlarged tonsilseenlarged liver and spleenhepatomegaly, splenomegalyrrespirationrange of motionairway obstruction, sleep apneajoint stiffnesstable 2signs and symptoms used in the development of the hunter score screening toolsigns or symptomsweighting 1weighting 2hernia11hearing loss, use of a hearing aid, acute or chronic otitis11dysmorphic facial features12nasal obstruction or rhinorrhea12enlarged tongue12enlarged tonsils11hepatomegaly12splenomegaly12airway obstruction or sleep apnea11joint stiffness12maximum score for a patient1016 the hunter mnemonic screening instrument for identifying patients with hunter syndrome signs and symptoms used in the development of the hunter score screening tool no formal statistical analysis of the weighting schemes was performed . The investigators relied on their clinical experience to determine if the results appeared to be specific enough to correctly identify patients with hunter syndrome . Hunter outcome survey (hos) is an international, long - term observational registry designed to increase the knowledge of the natural history of hunter syndrome and to evaluate the safety and effectiveness of long - term ert with idursulfase (elaprase, shire human genetic therapies, inc . All participating centers receive approval from their local institutional review board or ethics committee before enrolling any patients into hos . Hos is controlled by physicians and is overseen by national, regional, and international advisory boards comprising physicians experienced in the management and treatment of hunter syndrome patients . Any patient with a biochemically or genetically confirmed diagnosis of hunter syndrome is eligible to enroll in hos independent of whether receiving treatment or not . The hos database consists of data collected from medical examinations conducted during the usual medical care of the patients . The signs, symptoms, and other clinical information (e.g., medical history, laboratory values, etc .) Surveyed are described in detail by wraith and colleagues and cover all the major organ and system involvement that occurs in hunter syndrome . Shire hgt maintains the database and provides statistical support to hos physicians and advisory boards . For the purposes of this study, the investigators were given permission, by the global executive committee of the hos participating investigators, to query the database regarding the prevalence of specific signs and symptoms present in individual patients . The preliminary assessment was based on the hos database as of january 10, 2008, and the final assessment was based on the april 16, 2009 data extract . The goal of the present study was to develop a sensitive screening tool to aid in the diagnosis of hunter syndrome using medical history data collected in hos . Table 1 presents the hunter mnemonic, which was based on the key clinical features observed in patients with hunter syndrome . The january 2008 data extract of the hos database was queried for the prevalence of the signs and symptoms before diagnosis within individual patients as shown in table 2 . A random sample of 25 patients in hos with available information and who did not have a prenatal diagnosis was used to characterize the utility of a uniform weighting (table 2, weighting 1) of these ten signs and symptoms to specifically identify patients with hunter syndrome . A second weighting scheme was also evaluated (table 2, weighting 2) using a second random sample of 25 patients in hos with available information who were not included in the first sample and who did not have a prenatal diagnosis or family history of hunter syndrome . With this scheme, signs and symptoms unlikely to be observed in a non - affected child these signs and symptoms included dysmorphic facial features, nasal obstruction, enlarged tongue, enlarged liver, enlarged spleen, and joint stiffness . After this preliminary evaluation of the weighting schemes, weighting 2 was again evaluated using the april 2009 extract of the hos database, which included 237 patients with available data who did not have a prenatal diagnosis or a family history of hunter syndrome and who were not included in the two random samples of 25 patients used to assess the two weighting schemes.table 1the hunter mnemonic screening instrument for identifying patients with hunter syndromemnemonickey clinical featurehherniahearingherniahearing loss or impairment, hearing aids, chronic or acute otitisuunusual facesdysmorphic facial featuresnnasal obstructionnasal obstruction, rhinorrheattongue and tonsilsenlarged tongue, enlarged tonsilseenlarged liver and spleenhepatomegaly, splenomegalyrrespirationrange of motionairway obstruction, sleep apneajoint stiffnesstable 2signs and symptoms used in the development of the hunter score screening toolsigns or symptomsweighting 1weighting 2hernia11hearing loss, use of a hearing aid, acute or chronic otitis11dysmorphic facial features12nasal obstruction or rhinorrhea12enlarged tongue12enlarged tonsils11hepatomegaly12splenomegaly12airway obstruction or sleep apnea11joint stiffness12maximum score for a patient1016 the hunter mnemonic screening instrument for identifying patients with hunter syndrome signs and symptoms used in the development of the hunter score screening tool the investigators relied on their clinical experience to determine if the results appeared to be specific enough to correctly identify patients with hunter syndrome . As of april 16, 2009, a total of 541 prospective patients (i.e., alive at hos entry) were enrolled in hos . The mean patient age at their most recent examination as entered into hos was 12.3 years (median 10.3 years, 10th90th percentile 3.723.4 years). The age at onset of signs and symptoms and the age at diagnosis are summarized in table 3.table 3age at onset of signs and symptoms and diagnosis of hunter syndromenumbermean (years)median (years)10th to 90th percentileage at onset of symptoms4052.01.50.24.0age at diagnosis4794.03.51.27.1delay between onset of symptoms and diagnosis3991.91.304.4based on prospective patients (i.e., alive at hos entry) from the april 16, 2009 data extract age at onset of signs and symptoms and diagnosis of hunter syndrome based on prospective patients (i.e., alive at hos entry) from the april 16, 2009 data extract figure 1 illustrates the results of the preliminary testing of the utility of uniform weighting (weighting 1) of the ten signs and symptoms presented in table 2 as well as the second weighting scheme (weighting 2) using a second random sample . No threshold hunter score was found that could identify a hunter patient without yielding too many false negative results . For example, a score of 1 failed to identify 12% of the patients with hunter syndrome and a score of 2 failed to identify 20% of the patients . The failure of uniform weighting to identify hunter syndrome patients was likely due in part to the fact that patients with a family history of hunter syndrome were included in the test sample of 25 randomly selected patients . Because a family history of hunter syndrome may result in diagnosis before the emergence of many signs and symptoms, this test sample included many patients with low scores . In addition, many of the signs and symptoms are common in children without hunter syndrome, e.g., otitis and rhinorrhea.fig . The maximum score for weighting 1 is 10, and the maximum score for weighting 2 is 16 . N = 25 randomly selected patients from hos . Based on two random samples of patients from the january 10, 2008 data extract . The maximum score for weighting 1 is 10, and the maximum score for weighting 2 is 16 . Based on two random samples of patients from the january 10, 2008 data extract . Hos hunter outcome survey weighting scheme 2 (table 2) was developed to give greater weight to those signs and symptoms that are more likely to be specifically associated with hunter syndrome . Preliminary testing with 25 randomly selected patients from hos who did not have a family history of hunter syndrome suggested that a hunter score of 6 or 7 would correctly identify more than 95% of patients with hunter syndrome . Weighting 2 was further evaluated by using the 237 patients in hos who had complete information regarding the prevalence of signs and symptoms and who had no prenatal diagnosis and no family history of hunter syndrome . A score of 6 or greater correctly identified 95% of this population as having hunter syndrome (fig . 2). No association between age of diagnosis and hunter score at diagnosis was observed (fig . The median (10th90th percentile) hunter score for patients <2, 2 to 4, and> 4 years old at diagnosis was 12 (716), 13 (816), and 13 (716), respectively.fig . Based on the april 16, 2009 data extract and excluding patients with missing information, prenatal diagnosis, or family history of hunter . Based on the april 16, 2009 data extract and excluding patients with missing information or with prenatal diagnosis or family history of hunter . . Based on the april 16, 2009 data extract and excluding patients with missing information, prenatal diagnosis, or family history of hunter . Based on the april 16, 2009 data extract and excluding patients with missing information or with prenatal diagnosis or family history of hunter . This simple mnemonic screening tool correctly identified patients as having hunter syndrome with 95% accuracy at a hunter score of 6 or above . This score appears to be unlikely to be attained by a person without hunter syndrome or other mps disorders . Mnemonics are frequently used in clinical practice as screening tools or to guide clinical management, for example, mnemonic or scoring systems have been employed to screen newborns for down syndrome, to identify infants in need of resuscitation, and to describe heart sounds . A newborn screening test is not yet available, and the low awareness of rare, genetic diseases hinders the recognition and diagnosis of this syndrome . The recognition and diagnosis of hunter syndrome is often delayed because its complex and diverse signs and symptoms are not specific to hunter syndrome, making a simple tool to help narrow the differential diagnosis is an asset in pediatric and primary care settings . The goal of the present study was to develop a simple, sensitive, and unified screening tool for identifying hunter syndrome . The first iteration in which the ten signs and symptoms were given equal weight was not sufficiently sensitive and failed to yield a reliable threshold score that would identify hunter syndrome without producing a large number of false negatives (and presumably false positives). The inclusion of patients with a family history of hunter syndrome may have contributed to the failure of uniform weighting to correctly identify patients with hunter syndrome because these patients may have had earlier diagnoses before the emergence of many signs and symptoms of hunter syndrome than patients without a family history . The final iteration in which the hunter syndrome - specific signs and symptoms were weighted 2 points (table 2) appeared to correctly identify 95% of hunter patients in the study cohort with a hunter score of 6 or higher . Additionally, it seems unlikely that patients without hunter syndrome or other mps disorders would be likely to meet or exceed this threshold hunter score . It is important to note that exceeding this threshold is only suggestive of hunter syndrome and biochemical and/or genetic confirmation is still necessary to confirm the presence of this disease and other forms of mps . We acknowledge that this tool requires validation in a clinical setting to assess the tool s sensitivity, specificity, positive and negative predictive values, and patient variability across all types of pediatric patients . This study represents the first step in the development of tool based on hundreds of observations of children with hunter syndrome, which would otherwise be impossible to develop without such a registry, given the rarity of this disorder . The tool at present is likely to generate false positive but may also help in the identification of other children with rare inherited disease, which will still be of great value . We hope this paper will serve as a first step toward a more refined tool with high predictive value . The hunter mnemonic had a sensitivity of over 95% to detect hunter syndrome at a hunter score of 6 or greater and, given the overlap of clinical features, may also help in the identification of other mpss . Validation of this tool in the clinical setting will be required to determine the sensitivity, specificity, as well as positive and negative predictive value of this tool, and to confirm its utility as a screen for hunter syndrome in routine clinical practice . The approach described herein illustrates the utility of disease registries in the development of tools that may assist physicians in the diagnosis and management of rare, genetic disorders . As newborn screening for hunter syndrome is presently unavailable, it is hoped that this simple mnemonic and associated scoring system will prove useful for pediatricians or other primary care clinicians when faced with a patient with hunter syndrome or other mps disease.
Correct positioning of the upper first molar (u1 m) on the arch and its proper relationship to the opposing arch is one of the foundations of successful orthodontic treatment . The rotation of the u1 m can mean a greater need for space in the arch, due to its trapezoidal shape . As a result, failure in interarch engagement may occur . It is reported that mesio - palatal rotation of the u1 m is present in about 95% of patients with angle class ii, division 1 malocclusion, and in 83% of them as a whole . Some authors reported the frequent need to correct the rotation of u1 m in order to obtain space in the arch and a correct intercuspal engagement . In addition, mcdonald et al . Observed that in patients with class ii, who used the headgear, there was great influence in rotation correction of the molars associated with distalization . They found that on average, for each 3 mm of distal movement, there is a contribution of 1 mm regarding the correction in the rotation of the molar (average equivalent to 10). Given the importance of diagnosing and quantifying molar rotation, this study investigated the average rotation of the u1 m in patients with class i, ii and iii, showing patterns of facial profiles i (dental class i and dental class ii), ii (skeletal class ii) and iii (skeletal class iii). This study was previously approved by the ethics committee on human research (cep: 301916 - 09, caae: 0128.0.214.000 - 09). This is an analytical observational study of photocopies of plaster models in order to evaluate the rotation of the u1 m in cases of class i, ii, and iii malocclusion, with facial patterns i (dental class i and dental class ii), ii (skeletal class ii) or iii (skeletal class iii). The sample was selected from the documentation collection of the dental press educational center (cedp) in maringa, pr, brazil . We included 100 patients divided into 5 groups of 20 patients in each: (1) group class i, facial pattern i; (2) group class ii, facial pattern i that was dental class ii, (3) group class ii, facial pattern ii that is skeletal class ii; (4) group class iii, facial pattern iii; and (5) a treated group class i, facial pattern i. the cases were selected consecutively until they reached 20 individuals for each group, according to the cedp file order for the years 20002005 respecting the following inclusion criteria: presence of the four first molars; 1 upper molar in occlusion and in good condition (cusps without excessive wear and without prosthetic reconstruction); and absence of posterior cross bite . The average age of patients in skeletal class ii group was 13 years and 2 months; 8 of them were male and 13 female . The group of dental class ii had an average age of 17.2, with 14 males and 9 females . Class iii group had mean age of 15 years and 7 months, 10 of them were male and 10 female . Those in the class i group were 15 years old, and 18 of them were female and 7 male . The patients who had been treated were 20, and the sample was composed of 17 women and 3 men . All selected patient's upper impressions were photocopied (xerox / konica minoltabiz hub 210, norwalk, ct / united states), with the mesio - palatal cusps and distobuccal of first upper molars carefully marked with pencil graphite 0.5 mm . On the photocopies, measurements were taken for the angles formed by the intersection of lines going over the tips of the mesio - palatal and distobuccal cusps of each molar (ricketts line) with a straight line marked over the palatine raphe, as shown in figure 1 . (a and c) reference lines drawn on the photocopied model for the angles related to upper first right and left molars; (c) median raphe line . The marked regions illustrate the locations for reading both sides the angle between those two straight lines was measured with a protractor (trident / desetec, itapui, sp / brazil), with 0.5 as assigned values for the intermediate readings . The marks and measurements were done by a previously trained examinator . In order to assess the accuracy of the copies for this purpose a 2 mm glass plate was placed on these models up on which the angle of interest was reproduced and measured . The t - paired test revealed no statistically significant difference between measurements (p <0.05). The readings on the photocopies were repeated after an interval of 1 week to test the reproducibility and random error, using the intraclass correlation coefficient and dalberg's formula, respectively . The intraclass correlation test showed excellent reproducibility between the repeated measurements (0.91) and dalberg error was 0.45 . The rotations of the upper right and left molars were not statistically different in any of the groups (p <0.05), so the means of the left and right angles were used for comparisons between groups . When comparing the groups [table 1], there was a different behavior observed for the molars . Individual values, means, and standard deviations of the molar angulation in each studied groups, compared by one - way analysis of variance the average angle between the ricketts line and the median raphe for the treated group was 67.46 (sd = 2.98) ranging from a minimum of 63.25 to a maximum of 72.5 [table 1]. The rotation mean for the class i group was 71.23 (sd = 3.83) ranging from a minimum of 64 up to 80 [table 1]. For the dental class ii group, it was 78.95 (sd = 6.19), ranging from a minimum of 68.5 to a maximum of 90 [table 1]. For groups with skeletal discrepancies, skeletal cl ii and skeletal cl iii, respectively, had an average rotation of 74.45 (sd 5.83) and 73.83 (sd 7.05). Considering that the above values 73 reflect rotation of the molars (based on the treated group) the percentages of the cases with molar rotation are presented by group in table 2 . Absolute distribution and percentage of cases with molar rotation by groups in 1972 andrews reported that in order to achieve the six keys for the normal occlusion there should be no dental rotation . In a routine treatment of any malocclusion it can be advisable to correct the rotation of the u1 ms with a palatal bar, for example, before the alignment and leveling phase with a preadjusted fixed appliance . A leveling wire positioned without prior correction of the molars can promote buccal inclination of the upper second molars and palatal movement of the upper second premolars causing premature contacts in addition to jiggling [figure 2]. Schematic drawing of the unwanted effect of arch leveling with pre adjusted appliance, without previous correction of rotation of the molars considering that, with the correction of the rotation of the molars one can gain space in the arch, it can be said that especially in dental class ii (division ii class ii) using a palatal bar for example, may assist in space adjustment . The incidence of mesio - palatal rotation for the u1 m in this study agrees with the results obtained by henry who had reported this finding in 83% of malocclusions, which is also supported by the study of lamons and holmes, who found a frequency of up to 95% of mesio - palatal rotation in class ii patients . These results are very close to the data obtained in this study [table 2]. When rotation measurements were compared between the groups, there were statistically significant differences between them, highlighting the highest values for the dental class ii (78.95) (p <0.05), followed by skeletal class ii (74.45) and skeletal class iii (73.83) with no statistical difference, and class i (71.23) and treated individuals (67.46) [table 1]. However, if we consider the value of 73 as an acceptable value for the position of the first molar, the two groups with skeletal error (skeletal ii and iii) do nt have a clinically significant expression in behavior, both with regards to intensity as well as frequency of rotation [tables 1 and 2]. As for tolerance for some rotations of the molars, the literature also reports that ricketts reference line can be very strict for this evaluation . Dahlquist et al . Observed that the molars can have ideal occlusion with this line going through the distal of the opposite canine, or even more, through the mesial of first premolars . In millimeters, on average, they observed 11 mm per distal from the cusp of the canines . This value of 73, as a limit of what is considered an acceptable normal, derives from the minimum value observed in the class i group treated . This means that with a slight degree of rotation, it is possible to obtain normal occlusion . For this rotation parameter, a more significant and more frequent rotation was evident in the cases of class ii [tables 1 and 2]. Nery and barbosa also found a higher prevalence of rotation of the molars (71.4%) in patients with class ii division 1 malocclusion . However, no details were given over the skeletal involvement of the studied class ii sample . The results illustrate that the dental cl ii is the one with higher mesial rotation of the molar when compared to skeletal cl ii . The works which show only the relationship of the molars and do not distinguish the skeletal involvement of malocclusion, probably underestimated the rotation present in the cases of dental class ii only . Therefore, in the cases with dental class ii, one may consider a potential space gain in the mesial arch to the first superior molar when it is rotated in the mesio - buccal direction . Molar rotation represents an average situation of of class ii, in other words around 2 mm . Such a gain in space it also seems reasonable to say that class ii with good facial profile (pattern i sic capelozza filho) may require further intervention on the rotation of the molars than those with skeletal involvement (pattern ii). In this study the average behavior of the molars on both sides was similar, contrary to what was reported by friel and dahlquist et al . Who found statistically significant difference between the right and left sides with regard to the rotation of the upper molars . Amin found that upper right molar presented more rotation than its contralateral in class i and ii, and more rotation in the upper left molar in class iii . In fact, in some cases in the present study, there were not ably different rotations, however on average the position of the molars was similar on both sides . These results corroborate the data of lamons and holmes and scanavini et al . Who also found no statistical difference between the molars on the right and the left . The symmetrical position of the teeth in the arch can facilitate correction and obtain a stable interarch occlusion . Studies have shown great variability in the morphology of the maxillary first molar, thus more studies are needed to identify whether there are greater chances of each specific facial pattern has a more prevalent morphology . It was concluded that the dental class ii group had the highest mean mesio - palatal rotation of the u1 m (78.6) and more frequency, followed by the skeletal class ii group (74.95), skeletal class iii group (73.83), and the class i group (71.9).
Primary lymphoma of the parotid gland is an uncommon entity . Predominantly (84 - 97%) parotid lymphomas are non - hodgkin lymphomas (nhl) and most of them are of b - cell origin . There may be coexisting lymphadenopathy of the cervical region . However, to categorize them as a primary from the parotid, the first clinical manifestation should arise in the parotid gland . We report a case of primary nhl of the parotid gland in a 61-year - old male that was diagnosed on fine needle aspiration cytology (fnac) with further histological confirmation . A 61-year - old male presented with a painless swelling in the right parotid region for the last 1 year and right sided cervical swelling for the last 3 months . On examination, a mass of 5 cm 5 cm was identified in the parotid region . In addition, the patient had an enlarged right sided level v cervical lymph node . Hematological investigations were within normal limits (hemoglobin 11.8 gm / dl, total leukocyte count 6000/cumm and a differential count of 66% neutrophils, 28% lymphocytes, 4% eosinophils and 2% monocytes, platelet count 1.6 lakhs / cumm). His erythrocyte sedimentation rate was elevated with 58 mm at the end of the first hour . Contrast - enhanced computed tomography (cect) revealed a lobulated mass of 7 cm 5 cm 2.5 cm arising from the deep lobe of the parotid . Fnac was advised from both the parotid swelling and the enlarged right sided level v cervical lymph node . Smears were moderately cellular and comprised of large atypical lymphoid cells with high n: c ratio, irregular nuclear contour, vesicular chromatin, and prominent nucleoli and scanty agranular cytoplasm . The background showed lymphoglandular bodies alongwith normal - appearing salivary gland acini and ducts [figure 1a]. Subsequently, immunocytochemistry (icc) was performed on the papanicolaou - stained smears without destaining . These cells were positive for leukocyte common antigen (lca), cluster of differentiation (cd) 20 (inset) and negative for cd3 and cytokeratin . In view of the icc findings, a diagnosis of high grade nhl favoring diffuse large b - cell lymphoma (dlbcl) was offered . (a) fnac of the parotid mass shows moderately cellular smears comprising of large atypical cells with scant cytoplasm, irregular nuclei, vesicular chromatin, and prominent nucleoli . Background shows normalappearing salivary gland acini and ducts (arrow) (mgg, 400). Inset: b - cell marker (cd20) positivity of the tumor cells (icc, 100) (b) cervical lymph node fnac shows similar cytomorphology (mgg, 100) fnac from the cervical lymph node showed similar cytomorphology [figure 1b]. In view of the above findings, a diagnosis of high grade b - cell nhl favoring dlbcl involving the right parotid gland with secondary involvement of the level v cervical lymph node was made . Excision biopsy of the cervical lymph node revealed diffuse effacement of the architecture with sheets of atypical lymphoid cells with vesicular chromatin and scanty cytoplasm . Based on the above histological and ihc findings, a diagnosis of dlbcl was made . Correlating with the clinical history and radiological findings, final diagnosis of a primary dlbcl of the right parotid gland with secondary involvement of level v cervical lymph node was made . The patient was treated with six cycles of rituximab - cyclophosphomide - hydroxydoxorubicin - oncovin - prednisolone (r - chop) chemotherapy . Malignant lymphoma of the parotid gland is relatively rare and constitutes about 4 - 5% of extranodal lymphomas, and 1 - 4% of all parotid tumors . Facial nerve paresis and associated cervical lymphadenopathy may be a feature as well . In the present case they may be associated with autoimmune diseases such as sjgren's syndrome . In the present case, the lymphoma may originate from the intraparotid lymph nodes or from the parenchyma (mucosa - associated lymphoid tissue [malt]) or both . In view of this, lymphoma primarily affecting the parotid gland to refer to lymphoma affecting the parotid region . The differentials of malt lymphoma are lymphoepithelial sialadenitis (lesa) and warthin's tumor . The cytology of lesa reveals a mixture of acinar cells, epithelial, and myoepithelial cells admixed with polymorphous lymphoid cell population . Warthin's tumor is considered a benign primary parotid gland neoplasm that is composed of a mixture of oncocytic cells, basal cells, and stroma that contains numerous lymphocytes usually arranged in papillary and cystic structures . By contrast, the diagnosis of non - malt high grade lymphomas is usually straightforward, as they have overt cytological atypia . The criteria for primary parotid lymphoma, as suggested by hyman and wolff, include the first clinical manifestation in the parotid gland, histologically involving the parotid gland parenchyma and malignant nature of the lymphoid infiltrate . In the present case, the parotid swelling developed earlier than the cervical lymph node and the parenchyma was infiltrated by malignant lymphoid cells, meeting all the criteria as suggested by hyman and wolf for primary lymphoma of the parotid . Lymphoma of the salivary gland is highly chemo - radiosensitive and, therefore, a timely diagnosis is important . Moreover, surgical management of parotid lymphoma patients carries a high risk of morbidity due to infiltrative nature of the neoplasm . The role of fnac thus becomes important in such a setting for an early definitive diagnosis.
Sexuality is an important aspect of health, which can impact the overall wellbeing of men and women . Disorders of sexual functioning are common among men and women of all ages, ethnicities, and cultural backgrounds . Despite their apparent prevalence there is a deficit of data on the prevalence of sexual disorders from any large - scale epidemiologic studies . The present epidemiological study was conducted in a south indian rural population to fill this gap . The results obtained from this study might help policy makers and sexual health practioners to develop appropriate and timely strategies for identifying and treating sexual disorders . The current study was undertaken to estimate the prevalence of sexual disorders and association of sexual disorders with various socio - demographic variables in the selected rural area . Study: it was a descriptive epidemiological study conducted through a door - to - door survey on a sample size of 1529 . (n = 1529;742-males; 787- females). Individuals above the age of 18 years, who gave consent and were sexually active were included in the study . Individuals above the age of 18 years but with severe psychotic symptoms, dementia or severe and profound mental retardation and those not fulfilling the inclusion criteria were excluded . A door to door survey of the entire population residing at suttur village (25 km from mysore city in south india; population ~4100 with predominant hindu community and ~1000 families). There is a primary health center at suttur run by the government of karnataka in collaboration with jss medical college and hospital . Out of 3000 subjects above 18 years, 1529 male and female subjects who fulfilled our inclusion and exclusion criteria were taken up for the study . All individuals were met at their respective homes (working hours were avoided) and briefed about the study . Weight, height, pallor and blood pressure were measured; individuals were educated regarding basic health issues, obesity and diet and referred to a physician if necessary . Individuals who had at least one sexual intercourse in the last 1 year, were considered as sexually active . Those who fulfilled the study criteria were administered arizona sexual experience scale as a screening tool for identifying the presence of sexual problems . Those who were found to be having sexual problems based on arizona sexual experience scale were further interviewed in detail to identify the type of sexual disorder . Male sexual disorder assessment was done using international index of erectile function (iief), premature ejaculation diagnostic tool (pedt); structured questionnaire was prepared for the purpose of this study to assess male hypoactive sexual desire disorder (hsdd), postcoital dysphoria, anorgasmia, dyspareunia, paraphilias, sexual aversion disorder and gender identity disorders based on international classification of disease 10 (icd-10) and diagnostic and statistical manual of mental disorders, fourth edition text revision (dsm - iv tr) diagnostic criteria . Female sexual disorder assessment was done using female sexual functioning questionnaire and a structured questionnaire which was prepared for the purpose of this study to assess female postcoital dysphoria, anorgasmia, dyspareunia, paraphilias, female sexual aversion disorder and gender identity disorders based on icd-10 and dsm - iv tr diagnostic criteria . Socio - demographic data and sexual activity were recorded on a proforma; socioeconomic status was assessed based on modified prasad's classification . Female sexual functioning was recorded using the female sexual function questionnaire; also a structured interview schedule for diagnosing sexual disorders (developed for the purpose of this study) based on dsm iv and icd-10 criteria was used: this tool was used to interview and diagnose sexual disorders not covered by the other validated questionnaires used in here . (this questionnaire contained items corresponding to various areas of sexual disorders among men and women described in dsm - iv tr and icd-10 classification .) The disorders specifically tapped here include, hsdd, anorgasmia, postcoital dysphoria, sexual aversion disorder, paraphilias and gender identity disorders . Questions were framed in simple language of day - to - day use and validation was done . Contingency coefficient tests were applied to study the association using spss for windows, version 16.0 . A total of 1529 individuals (who fulfilled the inclusion and exclusion criteria) were taken up for the study . Majority of the males were from 18 to 30 years of age followed by 31 - 40 and 41 - 50 years age groups . Married and unmarried males were almost similar in distribution . Agriculturists and daily wage laborers formed the majority of the study group, and most of them were residing in a nuclear family; 20% of the male subjects consumed alcohol . Majority of the males belonged to lower middle and upper lower socioeconomic group . On applying chi - square test, male study subject's distribution was significant for all the above mentioned sociodemographic variables except for marital status . Majority of the female subjects were from 18 to 30 years of age followed by 31 - 40 years age group . On applying chi - square test, female study subjects distribution was significant for all the above mentioned sociodemographic variables . About 21.15% of the male subjects were diagnosed to be suffering from one or more male sexual disorder [table 1.1]. Among those who were diagnosed to have sexual disorders, 26.75% suffered from more than one sexual disorder . Prevalence of erectile dysfunction was found to be 15.77%, male hsdd 2.56% and premature ejaculation in 8.76% of the male subjects [table 1.2]. No cases of male anorgasmia, postcoital dysphoria or paraphilias were found in our study . Prevalence of male sexual disorders prevalence based on type of male sexual disorder distribution of erectile dysfunction based on severity male sexual disorders are found to be highly prevalent from 41 to 60 years of age when compared to other age groups . Male erectile dysfunction is least among 26 - 30 years age group (8.6%) and highest among 51 - 60 years age group (27.6%). Premature ejaculation was not found among 18 - 25 years age group and in those above 60 years . Prevalence of erectile dysfunction and premature ejaculation was more among unmarried males, whereas hsdd was found to be more among the married males . Male sexual disorders were 2 to 3 times more prevalent among illiterates when compared with the literates . Study subjects with an occupation as student or home maker were very few; considering occupation, male sexual disorders, were highest among daily wage laborers (32.3%), followed by agriculturists (18.6%). Male sexual disorders were found to be more in subjects belonging to a nuclear family (24.4%) compared to those in a joint family (16.4%). Male sexual disorders are more prevalent among upper lower (29.3%) and lower class (27.6%) compared to upper middle class (11%) and lower middle class (14.6%). 87.5% of the subjects with chronic obstructive pulmonary disease and 57.7% of subjects with hypertension had a diagnosable male sexual disorder . 15.4% of the population with hypertension had premature ejaculation(pme), whereas none had pme, among diabetics and chronic obstructive pulmonary disease patients . 63.8% of males who consumed alcohol had sexual disorders compared to only 10.5% among those who did not consume alcohol [table 1.4]. The association between male sexual disorders and various sociodemographic variables among 3033 rural population, 1503 were females . All the female subjects who fulfilled the inclusion / exclusion criteria were interviewed for female sexual disorders . Fourteen percent of the female subjects were diagnosed to have a sexual disorder [table 2.1]. Among those who were diagnosed to have sexual disorders, 44.54% had more than one sexual disorder . Prevalence of female sexual arousal dysfunction was found to be 6.65%, female hsdd 8.87%, female anorgasmia 5.67%, dyspareunia 2.34% and female sexual aversion disorder was found to be prevalent in 0.37% of the subjects [table 2.2]. Prevalence of female sexual disorders prevalence based on type of female sexual disorder female sexual disorders were more prevalent from 31 - 50 years of age; however majority of males had sexual problems in 41to 60 years age group . Female subjects above 60 years and sexually active were few but no sexual disorder was diagnosed among such subjects . All the cases of sexual aversion disorder were found among 18 - 25 years age group . Seven out of 13 unmarried sexually active females were found to have a sexual disorder . Females with occupation as daily wage laborer and home maker formed the major groups and had 14.5% and 14.8% prevalence of female sexual disorder respectively . Females with occupation as salaried / business had lesser prevalence of sexual disorder (8.8%). There was no significant difference in the prevalence of female sexual disorder between females living in nuclear vs joint family . Female sexual disorders were found to be highest among upper socioeconomic class females and least among lower socioeconomic class but these two groups had fewer study population . Upper middle, lower middle, upper lower socioeconomic class females formed the major study population and had 15.6%, 11.2% and 11.4% prevalence of sexual disorders respectively . Except for subjects with diabetes mellitus, none of the female subjects with hypertension or chronic obstructive pulmonary disease had any diagnosable sexual disorder . Eight out of 18 female subjects who consumed alcohol had a sexual disorder [table 2.3]. In our study, 21.15% (211/1000 population) of the male subjects were diagnosed to have a sexual disorder . Epidemiologic data are relatively scant to compare our findings but a few available community studies show the prevalence of male sexual disorders to be ranging from 10% to 52% . In our study, kinsey et al . Found that erectile dysfunction occurs in <1% of the male population before age 19, increasing to 25% by age 75 . In our study premature ejaculation a review of community studies revealed an estimate of the 1 year prevalence of a premature ejaculation range to be 4%-5% . In our study prevalence of male hsdd studies have reported the prevalence rates of male hsdd to be ranging from 1% to 7% . Reported prevalence of male hsdd, to be 16% in the general population, which is higher when compared to other studies . No cases of male anorgasmia, postcoital dysphoria or paraphilias were found in our study . This probably reflects the rare prevalence of these disorders among indian population . In our study male sexual disorders are found to be highly prevalent among 41 - 50 and 51 - 60 years age groups compared to other age groups . Erectile dysfunction is least among 26 - 30 years age group and highest among 51- 60 years age group . Data from the massachusetts male aging study has shown that 34.8% of men aged 40 to 70 years have moderate to complete erectile dysfunction, which is strongly related to age, health status, and emotional function . Found that erectile dysfunction occurs in <1% of the male population before age 19, increasing to 25% by age 75 suggesting that as age increases sexual disorders also increase . The prevailing cultural beliefs and stigma in india might discourage and inhibit the older individuals to consult a doctor and discuss their sexual life leading to increased prevalence of sexual disorders among elderly individuals . Also, age related physiological changes like andropause can attribute to increased sexual disorder prevalence rates among elderly individuals . The unmarried had a higher prevalence of male sexual dysfunction compared to the married population . It was observed that prevalence of erectile dysfunction and premature ejaculation was more among the unmarried, whereas hsdd was found to be more among the married . This finding is not in accordance with few other indian studies which have shown that there is a slightly higher prevalence of sexual disorders among married compared to the unmarried . These differences reflect that both the married and unmarried population have sexual disorders and both the groups should be assessed adequately . Our study findings might be due to performance anxiety or changing life style in the indian society with premarital sexual activity being on the rise, which could lead to higher prevalence of sexual disorders among the unmarried . Male sexual disorders were 2 to 3 times more prevalent among illiterates compared to literates . Male subjects with occupations such as daily wage laborers had the highest prevalence followed by agriculturists . The lower classes had a higher prevalence of male sexual disorders, compared to the middle class population . Gebhard and johnson found that male subjects who did not attend college were 3 times more likely to experience erectile dysfunction when compared to males who had studied upto the college level . A study done in america concluded that elevated risks associated with low educational attainment and minority status attest to the fact that better - educated individuals are healthier and have lifestyles that are physically and emotionally less stressful . The current study concluded that male sexual disorders were more among subjects with chronic medical illness compared to those without chronic medical illness . Many researches have shown that prevalence of sexual disorder increases with age, history of heart disease, diabetes, treated hypertension, untreated ulcer, arthritis, allergy, and smoking . Sexual dysfunction was found to be significantly related to subjective poor health and diabetes mellitus . Data suggests that, although sexual dysfunction is more common in the aged, it is more often related to comorbid illness than aging alone . The present study found that 63.8% of the male subjects who consumed alcohol had a sexual disorder compared with 10.5% among those males who did not consume alcohol . Hsdd in males was almost equally prevalent among both the groups but erectile dysfunction and premature ejaculation were more prevalent among those males who consumed alcohol . Study by van thiel and lester reported that 61% of patients dependent on alcohol reported sexual dysfunction, the most common being erectile dysfunction followed by reduced sexual desire . Studies show that all aspects of the human sexual response are affected by alcohol especially sexual desire and erection . The current study concluded that 14% of the female subjects were diagnosed to have female sexual disorder . Population - based study in china by parish et al . Showed a 35% prevalence of female sexual dysfunction . Shifren and colleagues did a study in the united states, in 31,581 household samples and found prevalence of female sexual dysfunction to be 43% . Although our study adopted a well validated interviewing methodology, lesser prevalence of female sexual dysfunctions was noted compared to studies from china and america, which can be due to cultural factors and the different diagnostic tools used in these different studies . In our study, among those who were diagnosed to have female sexual disorder, 44.54% were having more than one that is, comorbid sexual disorder . A study done in the portuguese population concluded that more women than men had presented with a secondary diagnosis . A review of seven studies has shown prevalence estimates for female hsdd ranging from 5% to 46% . Our findings of 8.87% for female hsdd is well within the range of the above findings . With depression prevalence rates increasing, the incidence of hypoactive sexual desire has been found to be increasing by few studies, which makes way for the possible hypothesis that increase in depression is leading to increased prevalence of hsdd as part of depressive symptomatology . Goggin and colleagues have reported a positive correlation between hsdd, depressive symptoms and low life satisfaction . Levine and yost in their community study have found prevalence rates of female arousal dysfunction to be 11% in the general population . Have reported that 14% of their study sample indicated sexual arousal difficulties on the basis of the sexual history form . Prevalence rates of female orgasmic disorder range from 4% to 7% based on the analysis of three large population sample studies . Another indian study by avasthi et al . Found that 9% of the subjects had difficulty reaching orgasm . Levine and western studies have shown prevalence of dyspareunia to be ranging from 3% to 18% in the general population . Though avasthi and colleagues have reported the prevalence of dyspareunia to be 7% in a north indian study sample, in the south indian study sample which we studied, the prevalence was found to be 2.34% . Our study found female anorgasmia and female arousal disorder to be almost equally prevalent among the female population . A similar finding was reported by spector and carey in their review article that female arousal disorder and female orgasm disorder disorders are equally prevalent in the community . Female sexual disorders were more prevalent among 31 - 40 and 41 - 50 years age groups compared to other age groups . Female subjects above 60 years and sexually active were few, but no sexual disorder was diagnosed among them . All the cases of sexual aversion disorder were found among 18 - 25 years age group . An american study observed that female sexual disorders were more prevalent in younger age groups . A study conducted in nigeria also concluded that younger age was a risk factor for female sexual disorders . Since young women are more likely to be single, their sexual activities might involve higher rates of partner turnover as well as periodic spells of sexual inactivity and performance anxiety . In indian rural population poor sexual knowledge this instability, coupled with inexperience, generates stressful sexual encounters, providing the basis for sexual pain and anxiety which later on leads to a sexual disorder . Unlike in males, female sexual disorders were less prevalent among illiterate females compared to literate females in our study . Females with occupation as daily wage laborer and home maker formed the major groups and had 14.5% and 14.8% prevalence of female sexual disorders respectively . Females with occupation as salaried / business had lesser prevalence of sexual disorder . Studies done in both nigeria and malaysia, have reported an association between higher education and the lesser prevalence of female sexual disorders . Lower economic position due to lower education levels or low - income occupation leads to poor economic status, and with most housewives being dependent on their husband, there is poor economic independence . Unlike in males, females with chronic medical condition had lesser prevalence of female sexual disorders compared to females without chronic medical illness in our study . Except for subjects with diabetes mellitus, none of the female subjects with hypertension, chronic obstructive pulmonary disease, cataract, chronic kidney disease, migraine had diagnosable female sexual disorders . South indian studies have found similar results that the risk factors for the development of male sexual disorders such as hypertension, diabetes mellitus, hyper - lipidemia, and a history of cardiac diseases were not strongly correlated to the presence of sexual disorder among females . In our study, 21% of the female subjects with diabetes mellitus had a sexual disorder . Similar findings were reported by other studies that female sexual disorders were associated with diabetes mellitus . Vascular diseases secondary to diabetes might preclude adequate arousal, hence higher prevalence of sexual disorder among diabetic females . The study findings reflect the current sexual health scenario in indian rural areas and also signify the need for more studies in the field of sexologythe current findings may serve as a good foundation for the policy makers and the research councils to take necessary steps so as to improve the health care facilities catering to the needs of those with sexual disorders . Inclusion of sexology in the training of undergraduate and postgraduate medical students should be considered, in order to meet the increasing need for trained professionals in this specialty . The study findings reflect the current sexual health scenario in indian rural areas and also signify the need for more studies in the field of sexology the current findings may serve as a good foundation for the policy makers and the research councils to take necessary steps so as to improve the health care facilities catering to the needs of those with sexual disorders . Inclusion of sexology in the training of undergraduate and postgraduate medical students should be considered, in order to meet the increasing need for trained professionals in this specialty . The study findings reflect the current sexual health scenario in indian rural areas and also signify the need for more studies in the field of sexologythe current findings may serve as a good foundation for the policy makers and the research councils to take necessary steps so as to improve the health care facilities catering to the needs of those with sexual disorders . Inclusion of sexology in the training of undergraduate and postgraduate medical students should be considered, in order to meet the increasing need for trained professionals in this specialty . The study findings reflect the current sexual health scenario in indian rural areas and also signify the need for more studies in the field of sexology the current findings may serve as a good foundation for the policy makers and the research councils to take necessary steps so as to improve the health care facilities catering to the needs of those with sexual disorders . Inclusion of sexology in the training of undergraduate and postgraduate medical students should be considered, in order to meet the increasing need for trained professionals in this specialty . The current study was a door to door epidemiological study covering the population of an entire rural area and about one in five males and one in seven females were found to have sexual disorders . Even with increasing literacy, sex is still a taboo in india . Sexual knowledge is poor among most of the individuals and those suffering from sexual disorders do nt often seek treatment . There is a need to address the raising prevalence rates of sexual disorders by providing sex education via media and health centers . There is also a necessity to include sexology in undergraduate and postgraduate medical curriculum, so that we can meet the treatment needs and increase identification of cases in the general population; also health care professionals need to educate and treat such individuals at the earliest.
A modified radical mastectomy is a procedure in which the entire breast is removed; including the skin, areola, nipple, and level i and level ii axillary lymph nodes, but the pectoralis major muscle is spared . In breast cancer cases with pectoral muscle involvement a radical mastectomy may need to be done if there is persistence of disease despite neoadjuvant chemoradiation . In a radical mastectomy all of the breast tissue along with the nipple, lymph nodes in the axilla, and chest wall muscles, under the breast are removed . Due to the invasive nature of the procedure higher incidence of post - operative complications surgeons have relied on vision and clinical judgment to evaluate tissue perfusion . While experienced surgeons are often comfortable making this assessment, it remains subjective and 1 is an imaging system used as an adjunctive method for the evaluation of tissue perfusion in surgical procedures where additional perfusion information is needed . The spy elite system provides objective, intraoperative assessment of blood flow to tissues, allowing for immediate surgical changes that can lead to improved wound healing and reduce the risk for postoperative conditions . Icg is a sterile, water soluble tricarbocyanine dye with a peak spectral absorption at 800810 nm . Icg binds tightly to plasma proteins and has a short half - life of 2.53 min allowing for repeat evaluations during the surgical procedures . The spy elite intraoperative perfusion assessment system is available in the united states and canada . The system is cost effective because most hospitals view the complications that can arise when not using the device to far exceed the cost of the device . This study illustrates the use of the spy elite system to assess flap viability following a nipple - sparing radical mastectomy with an unusual incision site . A 65-year old african american female was diagnosed with grade 3 papillary carcinoma on biopsy of a palpable 3.7 cm left breast mass at 12 oclock position in april 2009 . In june 2009 pathology showed stage t2n0mx ductal carcinoma that was er / pr and her-2/neu negative with clear margins . The patient was advised chemotherapy by her initial treating oncologist but refused conventional treatment and opted for naturopathic treatment engaging in vitamin and dietary supplements . In december 2010 a biopsy showed invasive high grade ductal carcinoma with papillary features, er / pr and her-2/neu negative . The mass continued to grow occupying almost the entire left breast with increasing pressure and pain . In september 2011 the patient presented to our facility . A ct scan revealed a 14.5 cm 9.5 cm mass in the left breast extending toward the axillary with smaller adjacent nodules and slight nodular thickening of the skin with no metastatic disease . Pathology confirmed a stage t2n0mx ductal carcinoma that was er / pr and her-2/neu negative with clear margins as shown in fig . 2 . Although this was a triple negative disease, the patient was advised neoadjuvant chemotherapy followed by a mastectomy to potentially avoid resecting the pectoralis muscle during the mastectomy . The patient received six cycles of 365 mg of carboplatin and 100 mg of taxotere from september 2011 to march 2012 . During this time the patient had a break in chemotherapy due to neutropenia and for going on vacation . To may 2012 the patient got 5000 cgy to the left breast in 25 fractions . In july 2012, given the mass still involved the pectoral muscle despite some response to neoadjuvant chemo and radiation therapy, a left nipple - sparing radical mastectomy with axillary dissection was performed in coordination with the spy elite system for assessing flap perfusion by injection of icg under general anesthesia . An elliptical incision was made, above the nipple areola from the lateral edge of the sternal border and pointing toward the axilla in its lateral aspect as shown in fig . There were dense adhesions of the skin to the upper flap area and given the concern that there could be tumor involvement, multiple frozen sections were done and all were negative for malignancy . The tumor was high up in the chest wall approximately 4 cm below the level of clavicle and was involving the pectoral muscle . The superior portion of the chest wall was dissected down to the level of the chest wall by going through the pectoralis muscle . The pectoralis major muscle was resected and the breast tissue was taken off the serratus anterior muscle inferiorly . The inferior envelope of the breast skin and nipple were spared and this helped in the closure of the wound later . Frozen section of the breast tissue from just under the nipple was also negative for malignancy . A 14.5 cm 9.5 cm specimen was removed with a thin portion of skin . Two number fifteen blake drains were placed, one in the axilla, and the other in the left anterior chest . Although clinically the margins appeared well - perfused, it was decided preoperatively to use the spy elite imaging system to capture and view fluorescence images for the visual assessment of blood flow as an adjunctive method for the evaluation of tissue perfusion . 1 was positioned at the correct distance from the patient to achieve optimal imaging . Using a three way stopcock attached to an injection port on the infusion line the prepared 2.5 mg / ml icg solution was injected as a tight bolus . The access on the stopcock was then switched to the syringe containing saline to briskly flush the icg bolus through the line with 10 ml of sterile saline to achieve optimal image quality . The 100 percent mark was placed in an area of undamaged skin where there was good perfusion . Angiography with indocyanine green showed poor perfusion of the inferior flap quantified by the 15 and 25 percent marks as shown in fig . An additional 2 cm of skin of the inferior flap was resected and then approximated with the superior flap . After resection this border the dermis was closed with multiple interrupted 3 - 0 vicryl sutures, and the skin was approximated with running continuous 4 - 0 monocryl in a subcuticular fashion . There were no complications during the procedure, and the patient recovered well from surgery . The patient was discharged home at day one following surgery . At the last follow - up in august 2013, thirteen months after surgery, ct and pet scan images showed no evidence of recurrent disease . The patient did not receive post - operative radiotherapy or chemotherapy as there was no recurrent disease . This case study shows that an individualized approach resulted in an optimal outcome for the patient . The infrequent procedure of a nipple - sparing radical mastectomy was done, with an unusual elliptical incision made in the superior aspect of the breast wall at least 6 cm above the areola as shown in fig . The spy elite intraoperative tissue perfusion assessment system to assess flap viability was used successfully to find a viable flap edge to promote optimal wound healing although clinical judgment erroneously suggested that the initial flap edges were well perfused . Fluorescence angiography with icg is a sensitive diagnostic tool for detecting compromised tissue perfusion in trauma surgery and microsurgery . The spy elite system allowed the surgeon to compare areas of good tissue perfusion in undamaged skin to areas of poor perfusion . In this case the spy elite system showed poor perfusion in the inferior flap of the breast leading to an additional 2 cm being resected resulting in improved perioperative management and better clinical results . Final pathology showed that all margins were clear of disease and there was no lymph node involvement . The patient recovered well from surgery with satisfactory wound healing and a good cosmetic result with minimal scarring as shown in fig . The surgeon is provided with an on - table assessment of breast skin perfusion that facilitates identification and removal of poorly perfused tissue that results in decreases complication rates . In this case study we illustrate the use of a tissue perfusion assessment system to assess flap viability in a patient undergoing a nipple - sparing radical mastectomy with an unusual incision site . This study shows that uncommon surgical practices can be performed successfully when technology is used to complement good clinical judgment in assessing tissue perfusion . Written informed consent was obtained from the patient for publication of this case report and any accompanying images . A copy of the written consent is available for review by the editor - in - chief of this journal.
Mii oocytes were collected from superovulated 45-week - old c57bl/6babr mice, under a stereomicroscope, by mouth pipetting, and stored at 80c . Prior to scbs - seq, 2 oocyte lysis buffer (10 mm tris - cl ph7.4, 2% sds) and 0.5l proteinase k were added (final volume 12l) followed by incubation at 37c for 1h . E14 escs were cultured in serum plus lif or 2i plus lif conditions as described previously . The 2i escs had been maintained in this medium for 24 days and matched serum escs were cultured in parallel . Single escs were collected by facs in 12l of esc lysis buffer (10 mm tris - cl ph7.4, 0.6% sds, 0.5l proteinase k) using a bd influx instrument in single cell 1 drop mode . Topro-3 and hoechst 33342 staining were used to select for live cells with low dna content (i.e. In g0/g1). Escs were incubated at 37c for 1h and stored at 20c until required for library preparation . Negative controls were either lysis buffer alone (empty tubes) or sorted bd accudrop beads, and were prepared and processed concomitantly with all single cell samples . Bisulfite conversion was performed on cell lysates using the imprint dna modification kit (sigma) with the following modifications: all volumes were halved, and chemical denaturation was followed by incubation at 65c for 90min, 95c for 3min and 65c for 20min . Purification was performed as described previously, and dna eluted in 10 mm tris - cl (ph 8.5) and combined with 0.4 mm dntps, 0.4m oligo1 ([btn]ctacacgacgctcttccgatctnnnnnnnnn) and 1 blue buffer (sigma) (24l final) before incubation at 65c for 3min followed by 4c pause . 50u of klenow exo- (sigma) were added and the samples incubated at 4c for 5min, + 1c/15s to 37c, 37c for 30min . Samples were incubated at 95c for 1min and transferred immediately to ice before addition of fresh oligo1 (10pmol), klenow exo- (25u), and dntps (1nmol) in 2.5l total . The samples were incubated at 4c for 5min, + 1c/15s to 37c, 37c for 30min . This random priming and extension was repeated a further 3 times (5 rounds in total). I (neb) for 1h at 37c before dna was purified using 0.8 agencourt ampure xp beads (beckman coulter) according to the manufacturer s guidelines . Samples were eluted in 10 mm tris - cl (ph 8.5) and incubated with washed m-280 streptavidin dynabeads (life technologies) for 20min with rotation at room temperature . Beads were washed twice with 0.1n naoh, and twice with 10 mm tris - cl (ph 8.5) and re - suspended in 48l of 0.4 mm dntps, 0.4m oligo2 (tgctgaaccgctcttccgatctnnnnnnnnn) and 1 blue buffer . Samples were incubated at 95c for 45s and transferred immediately to ice before addition of 100u klenow exo- (sigma) and incubation at 4c for 5min, + 1c/15s to 37c, 37c for 90min . Beads were washed with 10 mm tris - cl (ph 8.5) and resuspended in 50l of 0.4 mm dntps, 0.4m pe1.0 forward primer (aatgatacggcgaccaccgagatctacactctttc - cctacacgacgctcttccgatct), 0.4m indexed ipcrtag reverse primer, 1u kapa hifi hotstart dna polymerase (kapa biosystems) in 1 hifi fidelity buffer . Libraries were then amplified by pcr as follows: 95c 2min, 12 - 13 repeats of (94c 80s, 65c 30s, 72c 30s), 72c 3min, 4c hold . Amplified libraries were purified using 0.8 agencourt ampure xp beads, according to the manufacturer s guidelines, and were assessed for quality and quantity using high - sensitivity dna chips on the agilent bioanalyser, and the kapa library quantification kit for illumina (kapa biosystems). Pools of 12 - 14 single cell libraries were prepared for 100bp paired - end sequencing on a hiseq2500 in rapid - run mode (2 lanes / run). Samples from bulk cell populations were prepared according to the protocol above, with some modifications . For the bulk oocyte sample, 120 mii oocytes were collected and lysed as described above . For esc bulk cell samples, dna was purified from cell pellets using the qiaamp micro kit (qiagen), according to the manufacturer s instructions, and 50ng of purified dna was used in the library preparation . One round of first strand synthesis was performed using 0.8 mm dntps and 4m oligo1, and second strand synthesis also used 0.8 mm dntps and 4m oligo2 . Raw sequence reads were trimmed to remove the first 9 base pairs, adapter contamination and poor quality reads using trim galore (v0.3.5, www.bioinformatics.babraham.ac.uk/projects/trim_galore/, parameters: --clip_r1 9 --clip_r2 9 --paired). Due to the multiple rounds of random priming performed with oligo1, scbs - seq libraries are non - directional . Trimmed sequences were first mapped to the human genome (build grch37) using bismark (v0.10.1; parameters: --pe, --bowtie2, --non_directional,--unmapped), resulting in 1.4% mapping efficiency (0.2 - 13.2% range). Remaining sequences were mapped to the mouse genome (build ncbi37) in single - end mode (bismark parameters: --bowtie2--non_directional). Methylation calls were extracted after duplicate sequences had been excluded . For oocyte bulk analysis, our mii bulk dataset was merged in silico with previously published datasets8 (ddbj / genbank / embl accession number dra000570). Data visualization and analysis were performed using seqmonk, custom r and java scripts . For figure 1c, cg methylation was calculated as the average of methylation for each cpg position, and non - cpg methylation was extracted from the bismark reports . Percentage of concordance was calculated as the percentage of cpgs presenting the same methylation call at the same genomic position across two cells . For correlation analysis (pearson s), 2 kb windows were defined informative if at least 8 cpgs per window were sequenced . Hyper - methylated and hypo - methylated cgis were defined as 80% and 20% methylation respectively . 12 and supplementary table 2) were extracted from previously published datasets . Statistical analysis for estimating sample - specific methylation rates, estimating mean methylation rates and for clustering mii oocytes were collected from superovulated 45-week - old c57bl/6babr mice, under a stereomicroscope, by mouth pipetting, and stored at 80c . Prior to scbs - seq, 2 oocyte lysis buffer (10 mm tris - cl ph7.4, 2% sds) and 0.5l proteinase k were added (final volume 12l) followed by incubation at 37c for 1h . E14 escs were cultured in serum plus lif or 2i plus lif conditions as described previously . The 2i escs had been maintained in this medium for 24 days and matched serum escs were cultured in parallel . Single escs were collected by facs in 12l of esc lysis buffer (10 mm tris - cl ph7.4, 0.6% sds, 0.5l proteinase k) using a bd influx instrument in single cell 1 drop mode . Topro-3 and hoechst 33342 staining were used to select for live cells with low dna content (i.e. In g0/g1). Escs were incubated at 37c for 1h and stored at 20c until required for library preparation . Negative controls were either lysis buffer alone (empty tubes) or sorted bd accudrop beads, and were prepared and processed concomitantly with all single cell samples . Bisulfite conversion was performed on cell lysates using the imprint dna modification kit (sigma) with the following modifications: all volumes were halved, and chemical denaturation was followed by incubation at 65c for 90min, 95c for 3min and 65c for 20min . Purification was performed as described previously, and dna eluted in 10 mm tris - cl (ph 8.5) and combined with 0.4 mm dntps, 0.4m oligo1 ([btn]ctacacgacgctcttccgatctnnnnnnnnn) and 1 blue buffer (sigma) (24l final) before incubation at 65c for 3min followed by 4c pause . 50u of klenow exo- (sigma) were added and the samples incubated at 4c for 5min, + 1c/15s to 37c, 37c for 30min . Samples were incubated at 95c for 1min and transferred immediately to ice before addition of fresh oligo1 (10pmol), klenow exo- (25u), and dntps (1nmol) in 2.5l total . The samples were incubated at 4c for 5min, + 1c/15s to 37c, 37c for 30min . This random priming and extension was repeated a further 3 times (5 rounds in total). Samples were then incubated with 40u exonuclease i (neb) for 1h at 37c before dna was purified using 0.8 agencourt ampure xp beads (beckman coulter) according to the manufacturer s guidelines . Samples were eluted in 10 mm tris - cl (ph 8.5) and incubated with washed m-280 streptavidin dynabeads (life technologies) for 20min with rotation at room temperature . Beads were washed twice with 0.1n naoh, and twice with 10 mm tris - cl (ph 8.5) and re - suspended in 48l of 0.4 mm dntps, 0.4m oligo2 (tgctgaaccgctcttccgatctnnnnnnnnn) and 1 blue buffer . Samples were incubated at 95c for 45s and transferred immediately to ice before addition of 100u klenow exo- (sigma) and incubation at 4c for 5min, + 1c/15s to 37c, 37c for 90min . Beads were washed with 10 mm tris - cl (ph 8.5) and resuspended in 50l of 0.4 mm dntps, 0.4m pe1.0 forward primer (aatgatacggcgaccaccgagatctacactctttc - cctacacgacgctcttccgatct), 0.4m indexed ipcrtag reverse primer, 1u kapa hifi hotstart dna polymerase (kapa biosystems) in 1 hifi fidelity buffer . Libraries were then amplified by pcr as follows: 95c 2min, 12 - 13 repeats of (94c 80s, 65c 30s, 72c 30s), 72c 3min, 4c hold . Amplified libraries were purified using 0.8 agencourt ampure xp beads, according to the manufacturer s guidelines, and were assessed for quality and quantity using high - sensitivity dna chips on the agilent bioanalyser, and the kapa library quantification kit for illumina (kapa biosystems). Pools of 12 - 14 single cell libraries were prepared for 100bp paired - end sequencing on a hiseq2500 in rapid - run mode (2 lanes / run). Samples from bulk cell populations were prepared according to the protocol above, with some modifications . For the bulk oocyte sample, 120 mii oocytes were collected and lysed as described above . For esc bulk cell samples, dna was purified from cell pellets using the qiaamp micro kit (qiagen), according to the manufacturer s instructions, and 50ng of purified dna was used in the library preparation . One round of first strand synthesis was performed using 0.8 mm dntps and 4m oligo1, and second strand synthesis also used 0.8 mm dntps and 4m oligo2 . Raw sequence reads were trimmed to remove the first 9 base pairs, adapter contamination and poor quality reads using trim galore (v0.3.5, www.bioinformatics.babraham.ac.uk/projects/trim_galore/, parameters: --clip_r1 9 --clip_r2 9 --paired). Due to the multiple rounds of random priming performed with oligo1, trimmed sequences were first mapped to the human genome (build grch37) using bismark (v0.10.1; parameters: --pe, --bowtie2, --non_directional,--unmapped), resulting in 1.4% mapping efficiency (0.2 - 13.2% range). Remaining sequences were mapped to the mouse genome (build ncbi37) in single - end mode (bismark parameters: --bowtie2--non_directional). Bulk analysis, our mii bulk dataset was merged in silico with previously published datasets8 (ddbj / genbank / embl accession number dra000570). Data visualization and analysis were performed using seqmonk, custom r and java scripts . For figure 1c, cg methylation was calculated as the average of methylation for each cpg position, and non - cpg methylation was extracted from the bismark reports . Percentage of concordance was calculated as the percentage of cpgs presenting the same methylation call at the same genomic position across two cells . For correlation analysis (pearson s), 2 kb windows were defined informative if at least 8 cpgs per window were sequenced . Hyper - methylated and hypo - methylated cgis were defined as 80% and 20% methylation respectively . Statistical analysis for estimating sample - specific methylation rates, estimating mean methylation rates and for clustering are detailed in supplementary note 1.
For decades metal ceramic restorations have been considered the gold standard treatment for the fabrication of prosthetic crowns and fixed partial dentures (fpds). Ceramic materials with different processing routes were developed to play this role without the inherent disadvantage of a metal framework . At first, the main drawback with the use of all - ceramic crowns was bulk fractures due to the brittle nature of ceramics and the lower mechanical properties when compared with metal frameworks . The advent of computer - aided design / computer - aided manufacturing (cad / cam) technology allowed the possibility of working with high strength polycrystalline materials, shifting the problem to the veneering ceramics . This seems reasonable since the veneering ceramics present lower flexural strength (90 - 120 mpa) compared with the yttria - stabilized tetragonal zirconia polycristals substructure (900 - 1200 mpa). This way, the use of glass - ceramic ingots for pressing veneering ceramics onto zirconia frameworks was proposed to reduce the prevalence of veneer chippings / fractures . However, attempts to improve the microstructure and mechanical properties of veneering ceramics did not result in increased reliability . In addition, identical chipping failure patterns were observed . Despite the numerous advantages of cad / cam technology, it seems that at some point clinicians and laboratory technicians started paying less attention to basic principles of substructure design in fixed prosthodontics . This article describes an alternative technique for the customization of cad / cam frameworks through a dual - scan process . This procedure provides adequate porcelain support and thickness in a predictable manner with little additional effort and cost to both clinicians and laboratories . A 46-year - old woman, presented with a carious lesion under a metal onlay restoration on tooth number 16 requesting an esthetic restoration . She was advised of the available metal ceramic and all - ceramic options before selecting a zirconia - based all - ceramic crown . First, a full - contour waxing of the final restoration was made to guide all clinical and laboratory steps . The other uncut was used to fabricate the temporary restoration with bis - acrylic resin (protemp 4, 3 m espe, st . Tooth preparation was carried out leaving 1.5 mm of space for the final restoration in the axial walls and 2.0 mm in the occlusal area [figure 1]. The temporary restoration corresponded to the patient and dentist's expectations functionally, biologically and esthetically . Commonly cad / cam systems deliver a uniform substructure ranging from 0.3 mm to 0.6 mm in thickness . The software provides uniform substructure width, but the restorations end up with an extensive and non - uniform space for porcelain application over the zirconia framework, being more prone to chipping and cracking . In the technique described in this article, waxing cut back was performed to obtain uniform and adequate porcelain thickness [figure 2]. This way, substructure thickness is not uniform, but the zirconia substructure provides support for the overlying porcelain . The only difference to a metal ceramic substructure is that there is no palatal / lingual collar since zirconia exposure to moist environments may be detrimental to its performance . Hence, what needs uniformity in thickness is the porcelain and not the zirconia substructure . A dual - scan procedure was used to combine the datasets from the die with and without the waxed substructure . Then, the wax pattern was sealed to the die, which was scanned a second time . The scanner (cercon eye; dentsply usa) used the sub marginal data points to orient the two scans and merge the data sets . It works as a subtraction of the images: the die with the waxed substructure minus the die with the tooth preparation . The result of this image subtraction is the personified substructure for that specific case [figure 3]. The merged file was transmitted to a milling facility and the coping was manufactured [figure 4]. The porcelain veneering (cercon ceram, dentsply, usa) was completed [figure 5] and the crown cemented (relyx unicem, 3 m espe, st . Paul, mn, usa) after surface treatment with sandblasting and alloy primer application . This procedure works as if a subtraction of the images is made: the die with the waxed substructure minus the die with the tooth preparation . And the result of this image subtraction is the customized framework for that specific case ready to be milled from zirconia blocks milled zirconia substructure identical to the waxed substructure ceramic crown after porcelain application the chipping problem is the most frequent reason for failures in all - ceramic zirconia restorations, irrespective of the zirconia veneer system applied . Veneer fracture rates are reported at 2 - 9% for single crowns after 2 - 3 years and at 3 - 36% for fpds after 1 - 5 years . Implant - supported zirconia - based restorations revealed even higher rates at 8% for single crowns after 6 months and at 53% for fdps after 1 year . Impaired proprioception and rigidity of osseointegrated implants associated with higher functional loads might further aggravate cohesive veneer fractures . Persuasive literature exists pointing to thermal processing problems as a possible cause of residual stress and defects (too rapid heating and cooling given the very low thermal conductivity of zirconia). However, chipping seems to be a phenomena not limited to zirconia restorations and also related to the design of the substructure . The design of the substructure especially with the launch of cad / cam generated zirconia restorations provided no support for the veneering ceramic . This lack of porcelain support may have contributed to the actual high numbers of chipping on fpds as opposed to failures on the interface between substructure and veneering alone as supposed earlier . The lack of a uniform layer of the veneering ceramic because of improper framework design has been discussed as a possible reason for chipping fractures . Few clinical data on optimal design of zirconia - supported restorations have been published . With the introduction of cad / cam technologies in dentistry, excessive veneer layer thickness (> 2.5 mm) was created because of the uniform layer thickness of the copings for crowns and bar - shaped connectors for fdps . Improved customized zirconia coping design derived from the conventional porcelain fused to metal technique has been recommended to provide adequate support for the veneering ceramic . A dual - scan procedure of the die and full - contour wax pattern has been merged to customize the desired framework . Preliminary in vitro studies showed that cohesive fractures within the veneering ceramic could not be avoided with the improved support, but the size of the fractures decreased significantly and failure initiated at higher loads . Hence, the effect of framework design modifications on residual stress states needs to be better elucidated . It allows for the individualization of the substructures in a predictable manner and possibly improves longevity of all - ceramic crowns since core and porcelain thicknesses can be controlled . This technique needs to be further studied in a controlled clinical trial to determine the effectiveness of substructure modification.
Maxillofacial and mandibular fracture patients are common in the emergency department of a referral hospital . Appropriate airway management is a major concern in these cases for both the anaesthesiologist and the surgeon . The standard oral / nasal route for tracheal intubation may not be suitable for le - fort ii / iii maxillary fractures or may not be available as a result of a deformity or fractures in the nasal bone, respectively . Oro - tracheal intubation may not only obstruct surgical field but can also make immediate maxillomandibular fixation impossible . An elective short - term tracheostomy just before the operation is an alternative but it is associated with its own set of complications, especially in children, or may be contraindicated in cases of cervical spine injury patients and those with neck mass at the operative site . Alternatives such as submental or submandibular route for tracheal intubation that bypass the surgical area appear promising . We conducted this clinical observational study to demonstrate the feasibility and the reliability of submandibular tracheal intubation as an alternative method for airway management in such situations . This study was conducted from june 2011 to august 2015 after getting approval by the institutional clinical research and ethical committee . Patients with cervical spine / intracranial injury, long bone fractures, hollow viscous injury, glasgow coma scale <12 and those who might need mechanical ventilation in the post - operative period were excluded . Ten selected patients with maxillofacial fractures in whom conventional oral intubation was not an option for surgery or nasal intubation was contra - indicated were chosen for submandibular intubation as the elective surgical procedure . Anaesthesia protocol included premedication with intravenous (iv) midazolam 1 mg, iv glycopyrrolate 0.2 mg, iv ondansetron 4 mg and then anaesthesia was induced with iv fentanyl 2 g / kg and iv propofol 2 - 3 mg / kg along with iv vecuronium as a paralysing agent . Anaesthesia was maintained with sevoflurane and 100% oxygen till endotracheal intubation was achieved using conventional laryngoscopy technique . A levering blade and bougie were used in difficult cases while fibreoptic bronchoscope was kept standby . Anaesthesia was maintained with oxygen, sevoflurane and nitrous oxide after successful conversion of oro - tracheal route of intubation to the submandibular route . Standard intra - operative monitoring included pulse oximetre, end tidal carbon dioxide, electrocardiogram and non - invasive blood pressure with an emphasis on episodes of arterial desaturation, bradycardia during conversion of oral to submandibular intubation . The primary aim was to study two important parameters: (1) the time required for the procedure since submandibular intubation needs disconnection from anaesthetic circuit which carries the risk of arterial desaturation and (2) intra- and post - operative complications such as accidental extubation, endotracheal tube migration or haemorrhage that could have an adverse effect on patient outcome . In case submandibular intubation was difficult, elective tracheostomy or fibreoptic intubation was the standby options . Initially, oro - tracheal intubation was performed using a prepared armoured tracheal tube along with surgical preparation of the submandibular area [figure 1]. The side of the submandibular area preferred was governed by the presence of a mandibular fracture . A transverse skin incision of 1.5 cm was made in the submandibular area, about 1 inch below and 1/2 inch anterior to the angle of the mandible [figure 2] thus avoiding injury to the marginal mandibular nerve . Using a curved artery forceps (pedicle clamp), blunt dissection was performed through the platysma, the deep cervical fascia and mylohyoid muscle; thus creating a tunnel in close proximity to the lingual cortex of the mandible [figure 3] and preventing injury to the lingual and submandibular gland . Mucous membrane just medial to the second molar tooth was tented over the tip of the artery forceps and incised to allow forceps entry into the oral cavity . The connector of the armoured tracheal tube was removed and its end was grasped with the tip of the artery forceps and pulled through the dissected track to come out through the submandibular incision . The anaesthesiologist's index finger was used to support the tracheal tube in the oropharynx, while the tube was being pulled through the track . Patient with initial oro - tracheal intubation incision being taken 1 inch below right angle of jaw flexometallic tube close to lingual plate of mandible flexometallic tube sutured to skin at the incision site initially, oro - tracheal intubation was performed using a prepared armoured tracheal tube along with surgical preparation of the submandibular area [figure 1]. The side of the submandibular area preferred was governed by the presence of a mandibular fracture . A transverse skin incision of 1.5 cm was made in the submandibular area, about 1 inch below and 1/2 inch anterior to the angle of the mandible [figure 2] thus avoiding injury to the marginal mandibular nerve . Using a curved artery forceps (pedicle clamp), blunt dissection was performed through the platysma, the deep cervical fascia and mylohyoid muscle; thus creating a tunnel in close proximity to the lingual cortex of the mandible [figure 3] and preventing injury to the lingual and submandibular gland . Mucous membrane just medial to the second molar tooth was tented over the tip of the artery forceps and incised to allow forceps entry into the oral cavity . The connector of the armoured tracheal tube was removed and its end was grasped with the tip of the artery forceps and pulled through the dissected track to come out through the submandibular incision . The anaesthesiologist's index finger was used to support the tracheal tube in the oropharynx, while the tube was being pulled through the track . Patient with initial oro - tracheal intubation incision being taken 1 inch below right angle of jaw flexometallic tube close to lingual plate of mandible flexometallic tube sutured to skin at the incision site all ten patients in this study were adults with age ranging from 18 to 45 years (mean 30.4 years). Eight out of ten patients had panfacial fractures with two having associated fracture of the base of the skull . One patient had post - operative superficial infection that responded well to local treatment and recovered completely after 3 - 4 days . Airway management in panfacial reconstruction surgery underwent a major breakthrough when this approach was first described by hernndez altemir in 1986 . Various incision sites have been proposed since then with their own risk and benefits that are discussed ahead . Hernndez altemir in 1986 first described submandibular intubation, a modification of submental intubation as an alternative method for short - term tracheostomy . Initially, a 2 cm submental incision at one - third of the distance between the symphysis and the angle of the mandible, lying just medial to the lower border of the mandible was used . Potential complications of this approach were damage to adjacent salivary structures and lingual nerve . A more posterior incision in the same area was proposed that avoided injury to the important salivary structures . In our series safety of the procedure was enhanced by careful extra - periosteal blunt dissection in close proximity to the inner side of the mandible since the narrow subperiosteal passage is not essential . A strict midline submental incision though associated with satisfactory outcome, pulling the tube through the deep cervical fascia in the submandibular area may probably be easier than in the tight submental area . A remote possibility of interfering the surgical field, sterilisation and risk of aspiration that may occur due to intra - operative exchange from nasal to oral tube is avoided by submandibular intubation . Hypoxia is a potential risk that may be encountered while passing the tube through the incision . To overcome this, use of two tubes has been suggested, a conventional oro - tracheal tube securing the patient's airway, whereas a second armoured tube passing through the incision from the exterior to interior and then into the trachea just after the removal of the first tube using magill forceps . Careful removal of fixed connector by artery forceps can create an appropriate fitting removable connector . More recently, armoured tubes having detachable connector attachment are available making it ideal for submandibular tracheal intubation . A track from oral to skin surface carries the risk of mucocoele formation secondary to entrapment of mucosal fragments in track . Complications such as accidental dislodgement of the tube to the right main bronchus and accidental extubation and inward displacement of the tube were not encountered in our experience . Early post - operative airway concerns such as oedema, haematoma and low level of consciousness are real . Extubation may therefore be delayed until the patient is fully awake and oedema has subsided to ensure airway protection . In general, the endotracheal tube through this route is kept for <72 h due to the fear of laryngeal damage or pneumonia . At the end of the procedure, it is recommended to switch the tube to the oral route because the major concern is the easy accessibility to the airway in the post - operative period . In our series, we did not come across complications such as salivary duct injury, lingual nerve paraesthesia, mucocele formation probably because of a small sample size, lack of blinding, randomisation and less severe injuries in the patients chosen . As a result, we cannot be sure regarding the absolute safety of this procedure . In our series, the use of rigid plate fixation rendered immediate post - operative maxillomandibular fixation unnecessary while on the contrary, some authors have recommended submandibular tracheal tube rather than oro - tracheal one in the post - operative period as it appears to be better tolerated by the patient with easy fixation in addition to avoiding the risk of disruption of the surgical reconstruction if the patient accidentally bit on the oral tube . Intra - operative early complications related to tracheostomy such as loss of airway, arterial desaturation, haemorrhage, pneumomediastinum, pneumothorax and recurrent laryngeal nerve damage range between 6% and 8% . The incidence of late complications related to tracheostomy is as high as 60% including stomal and respiratory tract infections, tracheal stenosis, trachea - oesophageal fistula and unaesthetic scar . The role of tracheostomy was questioned in cases of re - construction of panfacial injury and has been replaced by submandibular / submental intubation . These procedures were recently evaluated and were been found to be simple technically and favoured by maxillofacial surgeons due to fewer complications related to these techniques . Overall, the technique used in this study proved to be optimal both for surgeon and anaesthesiologist with respect to surgical access and patient's airway safety, respectively . In patients with complex maxillofacial injuries undergoing corrective surgery, when oral or nasal intubation is not possible or acceptable, submandibular intubation is an effective and acceptable alternative technique to short - term tracheostomy and is associated with small risk potential . There is a need to emphasise its regular application in such cases so that technique can be mastered by both surgeons and anaesthesiologist.
Goodpasture syndrome (gps) was first identified in 1959 by drs stanton and tange, with the description of nine patients with renal failure and pulmonary hemorrhage, all of whom eventually died . Subsequently, the molecular basis of this disease was found to be auto - antibodies formed against the 3 and 5 domains within the non - collagenous part of type iv collagen present in basement membranes of glomeruli and alveoli . Left untreated, gps carries a poor prognosis . Conventional treatment for anti - glomerular basement membrane however, because of the infrequent nature of anti - gbm disease, there is a paucity of randomized clinical trial data with which to inform and optimize therapy . Nonetheless, a small, randomized trial in 1985 of 17 subjects revealed the superiority of immunosuppressive therapy in combination with plasma exchange versus immunosuppression alone . It is this trial that forms the basis of current treatment recommendations for this disease . Following infusion, rapid b - cell lysis occurs with consequent decline in antibody production, antigen presentation and activation of t - cells and macrophages . We present a case of concurrent anti - gbm disease and membranous nephropathy, which was resistant to conventional therapy, yet treated successfully with rituximab . A 24-year - old caucasian male, without a significant past medical history, presented with a 2-week history of hematuria and occasional expectoration of blood - tinged sputum . He reported a smoking history of 1 pack per day for the past 5 years . Physical examination revealed the following vital signs: temperature of 36.5c, heart rate of 78 bpm, blood pressure of 131/82 mmhg and respiratory rate of 18 per minute with 99% saturation on room air . Laboratory evaluation showed the following values: hemoglobin 1.7 mmol / l (11.0 g / dl), hematocrit 32.4%, wbc 10.5 k/l, platelets 227 k/l, sodium 138 mmol / l, potassium 4.3 mmol / l, chloride 100 mmol / l, serum creatinine (scr) 247.35 mol / l (2.8 mg / dl) and a glucose level of 5.49 mmol / l (99 mg / dl). The scr rose to 379.86 mol / l (4.3 mg / dl) over 4 days despite volume expansion with intravenous fluids . His initial urine albumin - to - creatinine ratio (acr) was 1004 mg / g . He had normal complement levels with c3 and c4 levels of 160 mg / dl (normal range, 90230) and 29 mg / dl (normal range, 1051), respectively . Other negative tests included the following: antinuclear antibody, anti - neutrophilic cytoplasmic antibody, anti - dna antibody, rheumatoid factor, human immunodeficiency virus antibody, hepatitis c antibody and hepatitis b surface antigen . Anti - gbm titers were pending at the time of kidney biopsy . The kidney biopsy (figure 1) revealed a crescentic glomerulonephritis with 54% of 13 glomeruli demonstrating cellular crescents and linear igg staining of the glomerular capillary basement membrane characteristic of anti - gbm disease, along with faint capillary loop granular staining . Electron microscopy confirmed the presence of occasional small epimembranous and intramembranous electron dense deposits characteristic of membranous nephropathy . 1.hematoxylin and eosin staining of renal biopsy specimen from a patient with concurrent diagnoses of anti - gbm disease and idiopathic membranous nephropathy that demonstrates a glomerular crescent; original magnification 200 (a). Linear immunofluorescent staining of gbm by anti - human rabbit immunoglobulin g; original magnification 400 (c). Electron - dense epimembranous deposits shown by arrows; original magnification 15 750 (d). Hematoxylin and eosin staining of renal biopsy specimen from a patient with concurrent diagnoses of anti - gbm disease and idiopathic membranous nephropathy that demonstrates a glomerular crescent; original magnification 200 (a). Linear immunofluorescent staining of gbm by anti - human rabbit immunoglobulin g; original magnification 400 (c). Electron - dense epimembranous deposits shown by arrows; original magnification 15 750 (d). Daily apheresis treatments were initiated and were reduced to a thrice - weekly regimen after three consecutive treatments . He was transitioned to prednisone 60 mg daily by mouth, after 3 intravenous pulse doses of 1 g methylprednisolone and oral, daily cyclophosphamide (cyc) 250 mg (2.5 mg / kg) that was soon reduced to 150 mg daily after adjustment for renal function . Approximately 2 weeks after admission, he was discharged on prednisone 60 mg daily, cyc 150 mg daily and thrice - weekly apheresis treatments . At discharge, mol / l (5.2 mg / dl) and the anti - gbm titer was 86 units . His scr increased to 644.88 mol / l (7.3 mg / dl) and his anti - gbm titer rose to 132 units . The patient also became volume overloaded . He received 17 apheresis treatments during his second hospitalization, on a near daily basis . He also received four hemodialysis treatments that were eventually stopped due to substantial improvement in his kidney function . Mol / l (4.5 mg / dl) with a creatinine clearance of 26 ml / min/1.73 m determined by a 24-h urine collection . Although the scr declined to 362.19 mol / l (4.1 mg / dl), the anti - gbm titer was persistently elevated . The patient remained apheresis - dependent and attributable to the lack of response to conventional therapy, b - cell depletion with rituximab was attempted to eliminate antibody production . Approximately 2 months after his initial presentation, the patient received a single, 1000 mg dose of rituximab . Subsequently, the patient's anti - gbm titer normalized (figure 2), and the patient was maintained on cyc and prednisone . Prednisone was slowly reduced and ultimately discontinued over a 6-month time period . Presently, his scr is 181.98 mol / l (2.06 mg / dl) and the acr is 366 mg / 3.acr, albumin - to - creatinine ratio; cyc, cyclophosphamide; d, day; m, month; p, prednisone; scr, serum creatinine (mg / dl); titer reported in units . Acr, albumin - to - creatinine ratio; cyc, cyclophosphamide; d, day; m, month; p, prednisone; scr, serum creatinine (mg / dl); titer reported in units . Our patient experienced a rapidly progressive course typical of anti - gbm disease eventuating in hemodialysis . The treating care providers opted initially for a treatment regimen consisting of apheresis, cyc and prednisone . The cyc plus prednisone approach has been one of the main regimens to treat membranous nephropathy, and initially, we felt that this approach would provide efficacious treatment of both glomerulopathies . A review published in 2011 reported a case of concurrent anti - gbm disease and membranous nephropathy and reviewed 25 previously reported cases . More recently, the etiopathogenesis of idiopathic membranous nephropathy has been characterized and determined to result from auto - antibodies directed against the podocyte - related antigen, phospholipase a2 [810]. Previously, basford et al . Hypothesized that concurrent disease resulted from the induction of one disorder from the other . It is also possible that a biclonal autoimmune response is responsible for the simultaneous occurrence of anti - gbm disease and membranous nephropathy . Biclonality is a rare but established phenomenon and has been described in multiple myeloma and lymphomas . The index patient demonstrated a clear correlation between his anti - gbm titers and his kidney function (figure 2). Our patient's initial presenting anti - gbm titers were highly elevated (nine times the reference range) but minimally responsive to conventional therapy (cyc and prednisone). Since he was apheresis - dependent and required renal replacement therapy, conventional therapy was considered a failure . Given the persistence of the anti - gbm titer, the alternative anti - cd20 b - cell depletion treatment represented a plausible and rational option in this disorder . There has been increasing evidence that rituximab is effective for the treatment of membranous nephropathy [1214], and this treatment has been efficacious in six of seven isolated cases of anti - gbm disease (table 1) [1519]. This report represents the seventh successful instance of rituximab treatment of anti - gbm disease and the second case where independence from renal replacement therapy was achieved . Moreover, this is the first case where rituximab has been used as simultaneous treatment of coexistent membranous nephropathy and anti - gbm disease . Table 1.summary of anti - gbm cases reporting the use of rituximabcaselung involvementanti - gbm titer before treatmenttreatmentanti - gbm titer after treatmentoutcomeweschler et al.55-year - old male with hivno symptomatic lung involvement8.6 eu / dl (nl <5)p, mmf, ivig, 375 mg / m rituximab 4 weekly dosesnegative for 16 months of follow - upscr 1.2 mg / dl at 16 months follow - uparzoo et al.73-year - old female with gps relapse after 1-year remissionclinical lung involvement51 iu / dlplex, p and cyc, followed by rituximab 375 mg / m, 6 weekly doses, followed by azathioprine maintenance after 4th cyclenegativein remission after 10 monthsshah et al.54-year - old male, anti - gbm disease dialysis - dependent at outsetovert lung hemorrhage>680 u / mlpmp, plex, cyc that was switched to rituximab 375 mg / m 4 weekly dosesnegativedialysis - dependent and on transplant listshah et al.64-year - old male, anti - gbm disease, p - anca positive, required dialysis, initial scr 6.37 mg / dl (536 mol / l)49 u / mlhigh - dose steroids, plex, cyc converted to rituximab 375 mg / m, 4 weekly dosesnegativedialysis - independent with scr 2.94 mg / dl (260 mol / l)shah et al.17-year - old maleanti - gbm disease, initial scr 3.08 (272 mol / l)clinical lung involvement131 u / l(nl <3)four doses of pmp, plex, and 2 weekly doses of rituximab 375 mg / mnegativescr 1.13 mg / dl after 33 monthssyeda et al.68-year - old female dialysis - dependent, scr 11.3 mg / dl, p - anca positive developed ttpno lung involvementanti - gbm ab> 1:160,nl <1:20plex, p, cyc (5 days), 4 doses of rituximab 375 mg / mnegativedialysis - dependentsauter m. et al.29-year - old, male status post - ddkt because of goodpasture's, presented with aki 16 mo post - transplantno symptomatic lung disease after recurrence95.5 iu / dl (nl <4)plex, mmf dose escalation to 3 g / d, and pafter 2 weeks mmf substituted by cycrituximab 375 mg/ for 3 weekly dosesloss of renal graft, patient on rrtab, antibody; acr, albumin - to - creatinine ratio; anca, antineutrophil cytoplasmic antibody; cyc, cyclophosphamide; ddkt, deceased donor kidney transplant; gbm, glomerular basement membrane; gps, goodpasture syndrome; hiv, human immunodeficiency virus; ivig, intravenous immunoglobulin; mo, month(s); mmf, mycophenolate mofetil; nl, normal; p, prednisone; plex, plasma exchange; rrt, renal replacement therapy; scr, creatinine (mg / dl); ttp, thrombotic thrombocytopenic purpura; wk, week(s); u, antibody titer units . Summary of anti - gbm cases reporting the use of rituximab ab, antibody; acr, albumin - to - creatinine ratio; anca, antineutrophil cytoplasmic antibody; cyc, cyclophosphamide; ddkt, deceased donor kidney transplant; gbm, glomerular basement membrane; gps, goodpasture syndrome; hiv, human immunodeficiency virus; ivig, intravenous immunoglobulin; mo, month(s); mmf, mycophenolate mofetil; nl, normal; p, prednisone; plex, plasma exchange; rrt, renal replacement therapy; scr, creatinine (mg / dl); ttp, thrombotic thrombocytopenic purpura; wk, week(s); u, antibody titer units . The index patient, formerly dialysis- and apheresis - dependent, is now apheresis - independent and completed cyc and prednisone therapies after just a single rituximab treatment . The proteinuria nearly completely resolved and the scr stabilized at 181.98 mol / l (2.06 mg / dl). We contend that rituximab has induced a coincident and complete remission of his two separate glomerulopathies . Lastly, given the positive outcomes of this case and the pathobiology of anti - gbm disease, we suggest b - cell depletion therapy as an alternative treatment modality in refractory anti - gbm disease.
Carious lesion of the oral cavity is one of the most common disease among the primary, mixed dentition and adult age groups . Cariogenesis itself is the outcome of multifactorial events that includes plaque microflora, susceptibility of host immune system, dietary habits, and most importantly maintenance of oral hygiene . Plaque formation per se is conceived as a physiologically normal event, which otherwise is disrupted and removed by effective brushing techniques . However, when maintenance of oral hygiene suffers the bacterial flora within the plaque begins to mature with early and late colonizers, which in the availability of carbohydrate rich substrates becomes preferentially populated by acidogenic and acid - tolerant species . Higher prevalence of streptococcus mutans has frequently been associated with cariogenesis though not all caries patients test positive for s. mutans . While s. mutans is known to occur at higher prevalence, several other acidogenic species have also been reported to co - prevail within the niche areas such as supra- and sub - gingival plaque substance and dentinal caries . Some of the most commonly reported bacteria include lactobacillus, granulicatella, gemella, haemophilus, veillonella, actinomyces, rothia, selenomonas, atopobium, neisseria, eikenella, fusobacterium, leptotrichia, and enterococcus . Several studies have indicated co - existence of above bacteria in various combinations, though the detection depended on the source of sample saliva, mature plaque or dentinal caries from primary, secondary or mixed dentition age groups . In the background of these data, we designed the present study to specifically investigate the bacterial prevalence in the patients with carious lesions from within the same family . The advantage of investigating subjects from within the same family is that, it provides a well - controlled sample collection and assay system without any bias that otherwise may arise as a result of variation in dietary intake and maintenance of oral hygiene . The subjects included three brothers and their four children with polycaries lesions, all of whom were pure vegetarians and had fairly similar knowledge on oral health maintenance . As 16s rrna gene - based metagenomics assay provides a rapid and broad spectrum analysis platform to reliably identify the microbial flora in a given sample in a quantitative manner, we used this technique to identify the existence of bacterial flora in the saliva of these subjects in relation to four unrelated control subjects without carious lesions . Unstimulated saliva samples from seven patients three brothers of age 52, 45 and 36 respectively, and their four children of age 22, 16, 13 and 7 respectively, all with polycaries lesions and dmft> 5, and four non - caries healthy control subjects of age 55, 45, 22 and 16 with dmft <1 were analyzed in the study . The caries samples were designated as ca1 to ca7 according to the above age order for ease of identification . The saliva samples were collected in 15 ml pyrogen free tubes (tarsons, india) and stored in the freezer until being used . At the time of dna extraction, the saliva samples were thawed to room temperature and 1 ml of the saliva was centrifuged in a fresh tube at 2000 rpm for 15 min at room temperature to pellet the bacterial cells . After discarding the supernatant, the cell pellet was processed for dna extraction with bacterial genome extraction kit (cat #na2110 - 1kt, sigma - aldrich). Polymerase chain reaction (pcr) amplification of the 16s rrna gene hypervariable region v6 was performed on 100 ng of total dna with a pool of six degenerate forward and reverse primers, the 5 ends of which were tagged with an adaptor sequences as per ion torrent - sequencing library preparation protocol to barcode each of the sample in the subsequent emulsion pcr step (second pcr). These primers are designed to efficiently amplify the v6 hypervariable region of all aerobic, anaerobic, culturable and non - culturable bacteria present in any given sample, due to selective sequence ambiguity . Pcr amplification of the v6 region was performed under the following conditions: initial denaturation at 94c for 4 min, followed by 35 cycles of 94c for 30 s, 58c for 30 s, 72c for 30 s, and a final extension at 72c for 5 min . The pcr amplicon libraries thus generated were estimated for size using trackit 1 kb plus dna ladder (pn 10488 - 085; life technologies) on 1.5% agarose gel, and purified subsequently using gel elution kit (cat #ge28 - 9034 - 70, sigma - aldrich) to remove primer dimers and non - specific amplification products . Following purification, the eluted pcr amplicon libraries were quantified with qubit dsdna hs assay kit (qubit v2, vienna). The amount of dna fragments per microliter of the eluted pcr amplicon library was calculated from the total concentration and average size of each amplicon library, which was then diluted to obtain a final concentration of 2.8 10 dna molecules as described earlier . Emulsion pcr (second pcr) was carried out to generate bar - coded libraries using the ion xpress plus fragment library kit (catalog #4471269; life technologies) according to instructions of the manufacturer . The mixed emulsion was amplified under the following conditions: 94c for 6 min, followed by 40 cycles at 94c for 30 s, 58c for 30 s, and 72c for 90 s and then 5 cycles at 94c for 30 s and 68c for 6 min . This amplification step results in clonal amplification of first pcr product that upon sequencing reveals their percent prevalence . The clonal library thus generated was sequenced on a 314 chip using the ion torrent personal genome machine (pgm) system with ion sequencing 200 kit (cat #4482006, life technologies) according to the supplier's instructions . The dna sequence of each of the clone from the library was processed and filtered with pgm software to remove low homology, ambiguous and polyclonal sequences . The following filtration criteria are used to remove low quality reads: (1) length of target sequence <150 bp (optimal chosen length was 150200 bp), (2) reads with more than three errors with the adapter sequences, (3) reads with more than two errors or not matching with the degenerated pcr primers, (4) sequences with ambiguous bases (long repeats of homopolymers> 6 bp), and (5) reads with <95% confidence interval . In order to calculate diversity, the 16s rrna operational taxonomic units (otus) were clustered independently for each of the sample at 97% identity threshold using qiime and a reference dataset from the ribosomal database project . Otus were assigned, and hierarchical clustering of most common and abundant taxa was performed using upgma clustering (unweighted pair group method with arithmetic mean, also known as average linkage). Unstimulated saliva samples from seven patients three brothers of age 52, 45 and 36 respectively, and their four children of age 22, 16, 13 and 7 respectively, all with polycaries lesions and dmft> 5, and four non - caries healthy control subjects of age 55, 45, 22 and 16 with dmft <1 were analyzed in the study . The caries samples were designated as ca1 to ca7 according to the above age order for ease of identification . The saliva samples were collected in 15 ml pyrogen free tubes (tarsons, india) and stored in the freezer until being used . At the time of dna extraction, the saliva samples were thawed to room temperature and 1 ml of the saliva was centrifuged in a fresh tube at 2000 rpm for 15 min at room temperature to pellet the bacterial cells . After discarding the supernatant, the cell pellet was processed for dna extraction with bacterial genome extraction kit (cat #na2110 - 1kt, sigma - aldrich). Polymerase chain reaction (pcr) amplification of the 16s rrna gene hypervariable region v6 was performed on 100 ng of total dna with a pool of six degenerate forward and reverse primers, the 5 ends of which were tagged with an adaptor sequences as per ion torrent - sequencing library preparation protocol to barcode each of the sample in the subsequent emulsion pcr step (second pcr). These primers are designed to efficiently amplify the v6 hypervariable region of all aerobic, anaerobic, culturable and non - culturable bacteria present in any given sample, due to selective sequence ambiguity . Pcr amplification of the v6 region was performed under the following conditions: initial denaturation at 94c for 4 min, followed by 35 cycles of 94c for 30 s, 58c for 30 s, 72c for 30 s, and a final extension at 72c for 5 min . The pcr amplicon libraries thus generated were estimated for size using trackit 1 kb plus dna ladder (pn 10488 - 085; life technologies) on 1.5% agarose gel, and purified subsequently using gel elution kit (cat #ge28 - 9034 - 70, sigma - aldrich) to remove primer dimers and non - specific amplification products . Following purification, the eluted pcr amplicon libraries were quantified with qubit dsdna hs assay kit (qubit v2, vienna). The amount of dna fragments per microliter of the eluted pcr amplicon library was calculated from the total concentration and average size of each amplicon library, which was then diluted to obtain a final concentration of 2.8 10 dna molecules as described earlier . Emulsion pcr (second pcr) was carried out to generate bar - coded libraries using the ion xpress plus fragment library kit (catalog #4471269; life technologies) according to instructions of the manufacturer . The mixed emulsion was amplified under the following conditions: 94c for 6 min, followed by 40 cycles at 94c for 30 s, 58c for 30 s, and 72c for 90 s and then 5 cycles at 94c for 30 s and 68c for 6 min . This amplification step results in clonal amplification of first pcr product that upon sequencing reveals their percent prevalence . The clonal library thus generated was sequenced on a 314 chip using the ion torrent personal genome machine (pgm) system with ion sequencing 200 kit (cat #4482006, life technologies) according to the supplier's instructions . The dna sequence of each of the clone from the library was processed and filtered with pgm software to remove low homology, ambiguous and polyclonal sequences . The following filtration criteria are used to remove low quality reads: (1) length of target sequence <150 bp (optimal chosen length was 150200 bp), (2) reads with more than three errors with the adapter sequences, (3) reads with more than two errors or not matching with the degenerated pcr primers, (4) sequences with ambiguous bases (long repeats of homopolymers> 6 bp), and (5) reads with <95% confidence interval . In order to calculate diversity, the 16s rrna operational taxonomic units (otus) were clustered independently for each of the sample at 97% identity threshold using qiime and a reference dataset from the ribosomal database project . Otus were assigned, and hierarchical clustering of most common and abundant taxa was performed using upgma clustering (unweighted pair group method with arithmetic mean, also known as average linkage). To determine the bacterial diversity in the saliva of patients with dental caries, we investigated the total genomic dna extracted from the saliva of three adults and four children with polycaries lesions along with four caries - free controls . The dna samples were processed for 16s rrna gene sequencing on the next generation sequencing platform, ion torrent pgm system . The target sequence for the 16s rrna gene sequencing was limited to the v6 hypervariable region corresponding to positions 9841047 of escherichia coli as it has been shown to discriminate and unambiguously map the amplicons at the genus level . Besides, the v6 region is also frequently analyzed to determine the bacterial population in environmental and medical samples . The pgm system expresses the prevalence of all bacterial genera present in the analyzed sample as read counts . Accordingly, a higher read count for a specific bacterial genus implies a higher population of that particular bacterium within the sample flora . Data analysis showed read counts in the range of 39,0001, 8,000 and 20003500 in caries and noncaries control samples respectively, which indicated a higher bacterial population in caries samples relative to controls [figure 1]. Variation of values was observed in the read counts across the samples, which indeed implied that the total bacterial population varied in each of the samples . However, the obtained read counts represented true bacterial population in respective samples as the sequence data was filtered based on two criteria: (1) the bacterial sequence should have a 97% homology with the respective reference sequence maintained at the public database (ncbi.nlm.nih.gov/nucleotide), and (2) the read count of bacterial genus should be> 1000 . When a bacterial genus met the above criteria, it was considered as highly prevalent in the sample . Those bacterial genera with comparison of the total read counts of eight bacterial genus in caries and control samples as expressed by the personal genome machine system the dominant bacteria identified in the saliva of caries patients based on the above criteria included a total of eight bacterial genera from three different phyla, streptococcus, granulicatella, gemella, veillonella, selenomonas [firmicutes], rothia and actinomyces (actinobacteria) and haemophilus (proteobacteria) [table 1]. Stratification according to their respective read counts showed a higher range for all identified bacterial genera in caries patients relative to controls . Streptococcus, rothia and granulicatella (mentioned as srg here after) were highly prevalent in all caries samples (ca1 to ca7, 100%). These were followed by gemella, actinomyces and selenomonas in 57% (4/7), 43% (3/7) and 29% (2/7) of caries samples respectively [table 2]. Samples from non - caries control group had read counts <400 for the above six bacterial genera and hence were regarded as not prevalent . The read count observed for streptococcus was highest among all, which indicated this genus to be the most dominant in the salivary bacterial flora of caries patients . Haemophilus and veillonella showed read counts of> 1000 in both caries and non - caries samples . While haemophilus was higher in 71% (5/7) and 75% (3/4) of caries and non - caries samples respectively, veillonella was higher in 100% (7/7) and 75% (3/4) of caries and non - caries controls respectively [table 2]. Bacterial genera with read counts> 1000 identified in the caries and control group of samples actual read counts of bacterial genus expressed by pgm system for each of the caries and control samples we next analyzed to ascertain the co - prevalence of bacteria in the caries group, as the bacterial community associated with cariogenesis and its progression is known to be complex . Ca1, ca2 and ca3 had a higher prevalence of srg + gemella, ca4 had higher prevalence of srg + actinomyces, ca5 had higher prevalence of srg + actinomyces + selenomonas, ca6 had higher prevalence of srg + gemella + actinomyces, and ca7 had higher prevalence of srg + selenomonas . Though haemophilus and veillonella were found in both caries and control groups, their comparative prevalence was several folds higher in caries group relative to controls [figure 2a and b], and hence was considered to be associated with cariogenesis in respective samples . This indicated that the co - prevalence of the bacteria varied among the caries samples even though the patients were from within the same family . The read counts for both of these bacteria were several folds higher in, (a) haemophilus and (b) veillonella positive caries samples than the controls . To determine the bacterial diversity in the saliva of patients with dental caries, we investigated the total genomic dna extracted from the saliva of three adults and four children with polycaries lesions along with four caries - free controls . The dna samples were processed for 16s rrna gene sequencing on the next generation sequencing platform, ion torrent pgm system . The target sequence for the 16s rrna gene sequencing was limited to the v6 hypervariable region corresponding to positions 9841047 of escherichia coli as it has been shown to discriminate and unambiguously map the amplicons at the genus level . Besides, the v6 region is also frequently analyzed to determine the bacterial population in environmental and medical samples . The pgm system expresses the prevalence of all bacterial genera present in the analyzed sample as read counts . Accordingly, a higher read count for a specific bacterial genus implies a higher population of that particular bacterium within the sample flora . Data analysis showed read counts in the range of 39,0001, 8,000 and 20003500 in caries and noncaries control samples respectively, which indicated a higher bacterial population in caries samples relative to controls [figure 1]. Variation of values was observed in the read counts across the samples, which indeed implied that the total bacterial population varied in each of the samples . However, the obtained read counts represented true bacterial population in respective samples as the sequence data was filtered based on two criteria: (1) the bacterial sequence should have a 97% homology with the respective reference sequence maintained at the public database (ncbi.nlm.nih.gov/nucleotide), and (2) the read count of bacterial genus should be> 1000 . When a bacterial genus met the above criteria, it was considered as highly prevalent in the sample . Those bacterial genera with comparison of the total read counts of eight bacterial genus in caries and control samples as expressed by the personal genome machine system the dominant bacteria identified in the saliva of caries patients based on the above criteria included a total of eight bacterial genera from three different phyla, streptococcus, granulicatella, gemella, veillonella, selenomonas [firmicutes], rothia and actinomyces (actinobacteria) and haemophilus (proteobacteria) [table 1]. Stratification according to their respective read counts showed a higher range for all identified bacterial genera in caries patients relative to controls . Streptococcus, rothia and granulicatella (mentioned as srg here after) were highly prevalent in all caries samples (ca1 to ca7, 100%). These were followed by gemella, actinomyces and selenomonas in 57% (4/7), 43% (3/7) and 29% (2/7) of caries samples respectively [table 2]. Samples from non - caries control group had read counts <400 for the above six bacterial genera and hence were regarded as not prevalent . The read count observed for streptococcus was highest among all, which indicated this genus to be the most dominant in the salivary bacterial flora of caries patients . Haemophilus and veillonella showed read counts of> 1000 in both caries and non - caries samples . While haemophilus was higher in 71% (5/7) and 75% (3/4) of caries and non - caries samples respectively, veillonella was higher in 100% (7/7) and 75% (3/4) of caries and non - caries controls respectively [table 2]. Bacterial genera with read counts> 1000 identified in the caries and control group of samples actual read counts of bacterial genus expressed by pgm system for each of the caries and control samples we next analyzed to ascertain the co - prevalence of bacteria in the caries group, as the bacterial community associated with cariogenesis and its progression is known to be complex . Ca1, ca2 and ca3 had a higher prevalence of srg + gemella, ca4 had higher prevalence of srg + actinomyces, ca5 had higher prevalence of srg + actinomyces + selenomonas, ca6 had higher prevalence of srg + gemella + actinomyces, and ca7 had higher prevalence of srg + selenomonas . Though haemophilus and veillonella were found in both caries and control groups, their comparative prevalence was several folds higher in caries group relative to controls [figure 2a and b], and hence was considered to be associated with cariogenesis in respective samples . This indicated that the co - prevalence of the bacteria varied among the caries samples even though the patients were from within the same family . The read counts for both of these bacteria were several folds higher in, (a) haemophilus and (b) veillonella positive caries samples than the controls . The present study describes the utilization of recent but well established 16s rrna gene - based metagenome analysis of salivary bacterial flora in two groups patients with polycaries lesions and dmft index> 5 and non - caries control group with dmft <1, to understand: (1) prevalence pattern of bacterial hierarchy, and (2) co - prevalence and comparative prevalence of bacterial genera among the groups . Sequence analysis identified a dominant pattern of bacteria from three phyla firmicutes, actinobacteria and proteobacteria [table 1]. Since taxonomic resolution down to species - level is impossible in 16s rrna gene - based metagenomic analysis of those identified, srg showed a higher prevalence in all caries samples, while the rest were found to be associated in 2957% of them [table 2]. The prevalence of other bacterial genera, besides srg, was similar in at least two members of the family . This selective prevalence of bacteria in only a few members of the family may be due to their independent exposures to environmental and habitual factors or competing bacterial flora within the niche areas of the oral cavity . Several earlier studies have reported co - prevalence of streptococcus, rothia, granulicatella, gemella, actinomyces, selenomonas, haemophilus and veillonella in caries samples, very similar to the observation made in the present study . But, what makes our study significant is that the co - prevalence of the bacteria was observed in the saliva samples of caries samples, in contrary to plaque or dentinal caries samples reported in other studies . It is important to note that rothia and selenomonas have been specifically identified in dentinal caries and subgingival biofilms, where the environment is anaerobic . Hence, the finding of rothia and selenomonas in the saliva of caries samples was quite unexpected . We believe that these two bacteria may have entered the salivary flow from dislodged subgingival plaque or dentinal carious substance, while the other six bacteria may have originated from dental biofilms, gingival crevicular fluid and/or supragingival plaque . Nevertheless, a careful in - depth analysis of the prevalence of these two bacteria in the saliva, subgingival plaque and dentinal caries substance on a larger sample size is essential to identify the extent of their occurrence in saliva, and confirm whether or not, it could be used as an indicator to predict the severity of cariogenesis process . Of the caries specific bacteria that were identified in the present study, all except veillonella are acidogenic and hence may be expected to promote cariogenesis [table 2]. Veillonella, on the other hand, is an acid tolerant genus and is known to utilize lactate as its energy source . Hence, it is only logical to expect higher prevalence of veillonella in locus of high lactate producers . In line with this, we found higher prevalence of veillonella in the caries than the control group [figure 2], which indeed strongly correlated with the corresponding higher occurrence of acidogenic bacteria in each of them [table 2]. Studies from other laboratories have also identified higher prevalence of veillonella in caries group in association with other acidogenic genera . Given this strong correlation between veillonella and acidogenic bacteria, we believe that veillonella may be an opportunistic bacterium . On the other side, since the read counts of veillonella were <1000 in 75% of control samples it may also be interpreted, with caution however that veillonella in controls may act to ameliorate the caries process in the absence higher acidogenic population, which otherwise was found in the caries group . Careful analysis of the data also indicated read counts> 500 for gemella, actinomyces, selenomonas and haemophilus in a few samples in the caries group [table 2], which suggested the possibility that these bacteria may be just beginning to populate in order to co - inhabit the community in these samples . However, it remains to be investigated further as the biofilm and bacterial community within may be expected to be mature in established carious lesions and hence for a new genera to compete and populate an existent niche may not be straight forward . Since the age groups of patients analyzed in the present study were in a broad range 752 years, it was not possible to relate age wise distribution or prevalence of the bacterial genera . Nevertheless, the overall prevalence pattern of srg was identical in all the family members, which is suggestive of a novel caries specific bacterial signature . The confidence of the above being used as a predictor of cariogenesis in high - risk group, however, depends on the outcome of similar analysis on a larger sample size . Taken together, the study has given a clear snap shot of the bacterial community at family and genera level along with their co - existent pattern in the saliva of caries patients . The 16s rrna gene - based metagenomics study has identified for the first time co - prevalence of the bacterial genera streptococcus, rothia, granulicatella, gemella, actinomyces, selenomonas, haemophilus and veillonella in the saliva of patients with polycaries lesions . The finding gains significance as the co - prevalence of streptococcus, rothia, granulicatella was observed in all caries patients, but not control subjects and hence is likely to be strongly associated with cariogenesis . The higher prevalence of other identified bacteria needs to be explored along with streptococcus, rothia and granulicatella on a higher sample size to determine categorically their extent of association with cariogenesis, and determine their usage as distinct caries specific bacterial signature to predict cariogenesis in high risk group.
The cost of treating metastatic colorectal cancer has increased significantly after the introduction of targeted antivascular therapies . We report the unusual case of a patient with colorectal cancer with several large liver metastases at diagnosis, who was cured after removal of the primary tumor and treatment with 5-fu / lv only . Colorectal cancer (crc) is the second most common cause of cancer - related mortality in both men and women and the third most common type of cancer in the united states . Until 2000, 5-fluorouracil / leucovorin (5-fu / lv) had been the standard of therapy for metastatic colorectal cancer (mcrc). Response rates (rr) of 21% and overall survivals (os) of 11.7 months have been reported with 5-fu / lv compared to 11% and 11 months, respectively, with 5-fu alone 1 . Long - term survival in patients with mcrc receiving palliative 5-fu / lv chemotherapy only has been described but it occurs rarely 24 . We report an unusual case of a patient with recto - sigmoid cancer with several large liver metastases at diagnosis who underwent surgery of the primary tumor, received chemotherapy with 5-fu / lv for 1 year, and currently is alive with disease - free survival of more than 12 years . A 72-year - old woman with past medical history of hypertension and bronchial asthma presented to the emergency department in august 2000 complaining of intermittent rectal bleeding accompanied by 6 months of colicky abdominal pain . Family history was unremarkable for cancer and the patient had never used tobacco or alcohol . She had stable vital signs and a normal physical examination on admission . An abdomino - pelvic ct scan revealed irregular thickening of the sigmoid colon, suggesting a nonobstructing sigmoid mass . Three hypodense liver lesions, measuring 8 5 cm, 6 5 cm, and 2 cm, respectively, also were noted (figs.1). Postcontrast ct image through the upper abdomen at initial presentation showing two large hypo - attenuating masses in the right and left hepatic lobes, respectively, (single arrows). Note the perihepatic ascites (double arrows). Postcontrast ct image through the upper abdomen acquired 10 years after the initial presentation demonstrates no residual or recurrent masses within the liver . She subsequently underwent colonoscopy with a biopsy of the apple - core lesion at the recto - sigmoid junction, which came back positive for an adenocarcinoma . Then, she underwent recto - sigmoid resection and liver inspection during the surgical intervention . Examination of the surgical specimen revealed moderately differentiated adenocarcinoma with subserosal invasion and negative surgical margins . Metastatic adenocarcinoma was removed from the pericolic fat (8 4 2.5 cm mass). Palliative chemotherapy was initiated within 4 weeks following resection, with the roswell park regimen 5 consisting in weekly 5-fu (500 mg / m) and lv (20 mg / m) for 6 weeks followed by a 2-week drug - free period for 1 year . She received the last dose of chemotherapy in september 2001 . Of note, 1 month following the initial diagnosis of colon cancer, the patient was readmitted to the hospital in september 2000 for an acute saddle pulmonary embolism . Anticoagulation with coumadin was initiated and the patient was maintained on coumadin until the present time . A ct scan of the abdomen 3 months after completion of 1 year of chemotherapy revealed complete resolution of liver metastases . Cea levels decreased as well, from 9.14 ng / ml at diagnosis to 0.5 ng / ml 2 months after surgery . No mucosal recurrence was seen on follow - up colonoscopies in august 2005 and january 2009 . Yearly follow - up ct scans of the abdomen and pelvis were grossly normal (fig 2). The last ct scan of the abdomen and pelvis, done in september 2013, did not reveal any signs of metastatic disease . She has been in complete remission since 2001, off all treatment, with no evidence of tumor recurrence as of 6 september 2013 . A complete sequencing of her genome done at ludwig center for cancer research did not reveal any salient features that may explain her long survival (dr . Survival of patients with mcrc has advanced steadily over the past decade . A retrospective review done on 2470 patients followed at two large cancer centers, md anderson and mayo clinic, found that the os rate increased from 9.1% for patients diagnosed in 19901997 to 13% for those diagnosed in 19982001, 19.2% for those diagnosed in 20012003, and an estimated 5-year survival rate of 32% for patients diagnosed in 20042006 6 . These improvements were likely due to both an increase in the number of hepatic metastetectomies and more efficacious chemotherapy regimens . In 2000, saltz published the results of a randomized phase iii study that compared irinotecan and bolus 5-fu / lv with the mayo clinic regimen of 5-fu / lv . In this study, the irinotecan combination demonstrated a near doubling of response rate (51% vs. 28%) 7 . Almost at the same time, in a european trial, de gramont showed that an oxaliplatin / infusional 5-fu / lv regimen (folfox4) compared with 5-fu / lv alone produced a 51% versus 22% response rate, also with a statistically significant improvement in progression - free survival (9.0 months vs. 6.2 months) 8 . The median os for patients with metastatic colon cancer treated with a 5-fluorouracil (5-fu)-based regimen improved from approximately 12 months to an os of more than 18 months with the folfox regimen 9; primarily, it has been the newer combinations of chemotherapy and biological agents such as bevacizumab, cetuximab, and panitumumab that led to a substantial jump in os, which went beyond 2 years in some studies 10 . As per current nccn guidelines (v.3.2014), combination therapy with folfox, folfiri, capeox, folfoxiri and bevacizumab, cetuximab, or panitumumab as well as 5-fu / lv or capecitabine alone or in combination with bevacizumab are recommended regimens for the first - line treatment of mcrc . In rare cases, mcrc patients may have prolonged survival with 5-fu - based regimens . There have been three case series published so far that showed long - term survival (lts) of mcrc treated with systemic chemotherapy alone (table 1). Mcrc long - term survival case series the north central cancer treatment group and mayo clinic reported long - term survival beyond 5 years from initiation of chemotherapy for mcrc 2 . Thirteen patients out of 3407 treated with chemotherapy (0.4%) had no evident site of disease involvement for> 5 years from last treatment . Twelve out of the thirteen patients who achieved lts were treated with 5-fu - based regimens . The second study was a retrospective review of 2751 patients who presented with mcrc at md anderson from 1990 to 2003 . 2541 patients were included, of which six (0.24%) were without evidence of disease after an average follow - up of 10.3 years . In this series, the use of 5 fu - based regimens also was associated with lts in this series, as five of the six patients who achieved lts were treated with 5-fu - based regimens . A third study, published in the french literature, included 445 mcrc patients; three patients treated with 5-fu - based chemotherapy (of whom one was lost from follow - up after 6.3 years) achieved complete remission 4 . In this series, however, one of the limitations of studies and case reports on lts is that the inherent tumor biology is unknown; thus, the contribution of this variable to treatment - associated lts cannot be established and remains a potential confounding factor 2 . In general, it is difficult to distinguish between cases where response to treatment (i.e., complete remission) prolongs survival and cases where the favorable prognosis is due to intrinsic patient factors differing from response 11 . Individual patients may have both tumors that are uniquely sensitive to chemotherapy and genetic or epigenetic characteristics that confer them a survival advantage . 5-fu / lv still may be an effective treatment for a small subgroup of patients with tumors sensitive to this drug combination . 5-fu is a fluoropyrimidine that inhibits thymidylate synthase, which leads to inhibition of dna synthesis and dna repair 12 . Leucovorin (lv) is added to it in order to enhance its effect on cancer metabolism . Significant attempts have been made in order to identify biomarkers associated with 5-fu / lv response, with particular attention given to the enzymes involved in the metabolism of 5-fu . The results evaluating the levels of thymidylate synthase, thymidine phosphorylase, and dihydropyrimidine dehydrogenase have been inconclusive (reviewed in 13). In 2003, using a gene expression profiling approach, john et al . Described a panel of 50 genes significantly associated with 5-fu response 13 . More recent clinical data suggest an association between 5-fu response and replication error status . In an in vitro study using a large panel of crc cell lines, also, a recent meta - analysis that reviewed data from 2,402 patients receiving 5-fu treatment for crc found that the thymidylate synthetase genotype of the lowest protein expression (2r/2r) was associated significantly with improved clinical benefit (the pooled risk ratio was relative risk = 1.36 [1.11, 1.65]; p = 0.003); however, this effect size was too small to be considered clinically useful 15 . In our patient, the complete sequencing of her genome was noncontributory, but it is possible that her long survival may have been related to still unidentified specific genetic or epigenetic factors . The resection of the primary tumor may have also had an impact on the lts of our patient . Five of the six patients in the md anderson series underwent resection of their primary tumor and all three patients from the french series had their primary tumor resected . The status of the primary tumor was not reported in the series from north central cancer treatment group and mayo clinic . A multivariate analysis of 1155 individual patients data from four randomized trials presented in 2012 at asco confirmed that primary tumor resection in patients with crc and unresectable metastasis was an independent predictor of better os (hr: 0.63 [0.530.75]; p <0.0001) and may be a surrogate for progression - free survival (pfs) (hr: 0.82 [0.700.95]; p = 0.0007) 16 . Did coumadin anticoagulation given in combination with the 5fu / lv chemotherapy plays a role in this patient's long - term survival? Thirty years ago, a study on the clinical and pharmacokinetic effects of combined warfarin and 5-fu in advanced colon cancer showed a greater overall median survival for patients who received the combined therapy of warfarin and 5-fu (19.2 months), but these earlier results were never reproduced 17 . 5fu is not a substrate for hepatic drug metabolizing cyp enzymes but an interaction between 5fu and the cyp enzymes has been previously described 18,19 . No toxicity related to the concomitant use of 5fu and warfarin was observed in our patient . The cost of treating mcrc has increased dramatically after the introduction of targeted antivascular therapies . Colorectal cancer is a heterogeneous disease with a wide variety of biologic abnormalities, making each patient and each tumor unique . 5-fu / lv still may be an effective treatment for a small subgroup of patients with tumors that are sensitive to this drug combination . The development of more refined molecular biology techniques may allow oncology practitioners to predict which patients may benefit from this combination . Our case demonstrates the possibility of curing mcrc using 5-fu / lv, even in patients bearing a high tumor burden.
A 53-year - old caucasian male was evaluated for bright red blood per rectum with colonoscopy . The patient's past medical history was significant for end - stage liver disease due to hepatitis c and hepatitis b, asthma, and erythropoietic porphyria . The patient had prior episodes of hematemesis which required multiple sessions of esophageal variceal rubber band ligation treatment . The patient complained of bright red blood per rectum for a four month period without clinical evidence of active or massive bleeding . Family history was notable for colon cancer in the patient's father at age 60 . His medications included propanolol, lasix, aldactone, lactulose, thiamine, and folate . Pertinent review of symptoms was negative for fevers, chills, weight loss, diarrhea, constipation, melena, weakness, or loss of consciousness . Physical examination revealed a well - developed, well - nourished male in no acute distress appearing his stated age . Vitals signs were as follows: blood pressure 108/58 mm hg, heart rate 66/min, respiratory rate 18/min, and temperature 36.9c . In addition, abdominal examination revealed a 2 2 cm umbilical hernia and a right - sided inguinal hernia . Recent complete blood count prior to colonoscopy revealed a hemoglobin of 11.5 g / dl, hematocrit of 34.6%, and a platelet count of 36,000 with a mcv of 81.3 . The patient had positive serologies proving both infection with hepatitis b and c. the patient's hepatitis c viral load was undetectable . Recent abdominal ultrasound was notable for hepatomegaly, nodular and heterogeneous in consistency, massive splenomegaly, and ascites . Colonoscopy was significant for internal hemorrhoids as well as cecal and proximal ascending colon varices without any endoscopic evidence of bleeding (fig . Reported cases of varices have been found in the stomach, small bowel, biliary tree, colon, rectum, and even the site of a surgical ostomy . The stomach and the rectum are the most common sites of extraesophageal varices and up to 30% of variceal bleeding may originate from an extraesophageal location . A history of abdominal surgery may predispose a patient to develop varices of the lower gastrointestinal tract [5, 6]. Other causes include biliary atresia, biliary sclerosis, congestive heart failure, superior mesenteric vein thrombosis, and inferior mesenteric vein thrombosis . A smaller number are of idiopathic origin . Due to the patient's history of esophageal varices as a result of portal hypertensive gastropathy this case of cecal and ascending colon varices is presented because of the uniqueness of this anomaly within the colon and most notably the cecum . In the literature, a total of seventeen cases (including this one) of cecal varices have been reported [2, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20]. The cases of cecal varices that have been reported have all presented clinically with massive lower gastrointestinal bleeding necessitating urgent management with blood products and surgical or endoscopic intervention . To our knowledge this is the first case of cecal varices reported that has not resulted in massive lower gastrointestinal bleeding . He did not demonstrate any episodes of massive gastrointestinal bleeding requiring immediate intervention as in the previous cases reported . Given the colonoscopic finding, we believe that the internal hemorrhoids and not the cecal varices may have contributed to his clinical presentation . By reporting our experience we emphasize that cecal varices are very rare and may also be present in stable patients without massive lower gastrointestinal bleeding . Because of the paucity of data, the proper management of patients with colonic varices is unknown . Treatment of cecal varices has included colectomy as well as transjugular portal - systemic shunt in cases of varices attributed to portal hypertension . There are no established guidelines for the treatment of extraesophageal varices due to the scarcity of cases reported . He is clinically stable and has no clinical evidence indicating a history of active bleeding from those varices . However, further study is needed to determine whether sclerotherapy, band ligation, or even surgical treatment is effective for bleeding associated with cecal varices . Careful patient follow - up should also be instituted for those who are incidentally noted to have cecal varices but have not bled.
Preparation of primary goat testis cells: one two - week old lamb (nubian breed) was sacrificed, and tissue including his testis and ears was removed . The use and experimental protocols were approved by the committee on the ethics of animal experiments of national chung hsing university (approval numbers: 101 - 40). The testis cells derived from removed testis and fibroblasts from ears were cultured in 1 rpmi 1640 medium with 10% fetal bovine serum (fbs). When cells grew to full confluency, cells were trypsinized and subcultured in 1:1 or 1:2 ratios . Virus inoculation and adaptation to cell culture: samples were collected from orfv affected animals in central taiwan (hoping) in 2009 . Half gram of collected scab from mouth of infected goats was soaked and homogenized in 5 ml te buffer (50 mm tris - hcl and 10 mm edta, ph 8.0) with additional antibiotic . After centrifugation at 3,500 rpm for 10 min, the supernatant was transferred, filtrated through a 0.45 m filter and stored as a crude viral stock . The homogenate was subsequently inoculated into the primary goat testis cells . During viral absorption, after 1 hr, the unattached virus was removed by washing the cells twice with pre - warmed 1 pbs, and the cells were maintained in complete medium 1 rpmi 1640 with 2% fbs . If no cytopathy was found, another run of blind passage and the detection of orf viral dna were conducted . Then, 10 microliter of cell lysate was incubated with 4-fold volume of quickextract solution (dna extraction soln . 1.0, epicentre, madison, wi, u.s.a .) At 65c for 6 min and then 98c for 2 min, followed by detection of viral dna by pcr (the method was described in the following section). The pcr - positive cellular lysates were sonicated for three cycles (10 sec each cycle at 4c). Subsequently, the lysate was added into fresh primary testis cells for further incubation for 7 days, and cytopathy was examined by microscopy . Continued passages were repeated until viral cytopathy was obvious . Detection of viral dna by nested pcr: during blind passages, the presence of viral dna was examined by the nested pcr using 2 sets of b2l gene specific primers: outer primer set ovb2lf1 and ovb2lr1, and inner primer set ovb2lf2 and ovb2lr2 (sequences are listed in table 1table 1.list of the primersprimersequenceovb2lf15 tccctgaagccctattatttttgtg 3ovb2lr15 gcttgcgggcgttcggaccttc 3ovb2lf25 gcagcttctgctgcaacctgag 3ovb2lr25 aaggcgtggtagcggtagtg 3fp5 gtgttgatcatcgaagactcggtg 3rp15 gtcgcccttgtcgcccttagtctc 3rp25 the expected size of pcr products obtained from the first and second round amplification is 1.2 kbp (ovb2lf1 and ovb2lr1; full length b2l gene) and 889 bp (ovb2lf2 and ovb2lr2), respectively . In the first round of nested pcr, the pcr condition started with a denaturation step at 94c for 4 min, followed by 29 cycles of 94c for 1 min (denaturation), 55c for 1 min (annealing) and 72c for 1 min (extension), and the reaction was ended by a final extension at 72c for 7 min . One microliter of the first round pcr product was used for the next round of pcr which was followed the same conditions, except with 25 amplification cycles . Pcr products were analyzed by 1% agarose gel electrophoresis with health safe nucleic acid stain . For detection of viral gene during the plaque purification, the pcr was conducted using the inner set of b2l - specific primers (ovb2lf2 and ovb2lr2) following the same pcr condition with a 35 amplification cycles . Pcr for strain classification of isolated orfv: after three runs of plaque purification, the picked plaques were selected for identification of viral strains by single - step pcr . Viral dna for pcr was prepared by the dna extraction soln . Pcr was conducted with three primers (fp, rp1 and rp2; table 1) targeting the c - terminus of the atpase gene . The pcr program proceeded with an initial denaturation at 94c for 5 min, 35 cycles of brief denaturation at 94c for 30 sec, annealing at 63c for 30 sec, extension at 72c for 30 sec and a final extension at 72c for 7 min . Restriction enzymes digestion: the primary goat testis cells were seeded on the 10-cm cell culture dish (approximate 2 10 cells) and were infected with 0.1 moi (multiplicity of infection) of orfv . The infected cells were trypsinized and collected when 80% infected cells showing cytopathy (~24 hr). The total dna was obtained by following a method previously described . For each reaction, 5 g of extracted dna was digested with 20 units of a restriction enzyme at 37c for 2 hr . The mixture was analyzed by electrophoresis at 70 volts in a 0.7% agarose gel . Examination of viral gene expression by rt - pcr: the primary goat testis cells (3.5 10) were infected with 10 moi of orfv and incubated at 37c with 5% co2 . Total cellular rna was extracted from the infected cells following the instruction of the rneasy mini kit (qiagen, limburg, netherlands). After rna quantification, one microgram of rna was treatment with rq1 rnase - free dnase (promega, madison, wi, u.s.a .) To eliminate dna contamination . Reverse transcription was conducted with 0.5 g of rna, and the cdna was synthesized by superscript iii reverse transcriptase (invitrogen, waltham, ma, u.s.a . ). The condition of pcr was a first denaturation at 94c for 4 min, following with 35 cycles of brief denaturation at 94c for 45 sec, annealing at 60c for 45 sec and extension at 72c for 45 sec, and a final extension at 72c for 7 min . Western blot analysis: the primary goat testis cells were infected with 1 plaque forming unit (pfu) of orfv and maintained with 1 rpmi 1640 medium containing 2% fbs at 37c with 5% co2 . The cellular lysate was prepared by rupturing cells with sample buffer after twice washing with pbs . Following boiling at 100c for 6 min, proteins were separated by the sds-15% page and transferred onto a pvdf membrane (amersham, ge healthcare, buckinghamshire, u.k . ). After blocking with tbst (20 mm tris, 150 mm nacl and 0.1% tween 20, ph 7.6) containing 5% skim milk, the membrane was incubated with 1: 2,000 diluted mouse polyclonal anti - ov20.0 antibody generated from mice immunized with purified ov20.0 recombinant protein at 4c overnight . The secondary antibody, the horseradish peroxidase - conjugated goat anti - mouse antibody (jackson immunoresearch, suffolk, u.k . ), was added and incubated for 1 hr at room temperature . The signal was then developed using an enzyme - linked chemiluminescence system (ecl, amersham, ge healthcare). Electron microscopy: electron microscopy was used to examine the morphology of isolated virus particles . The cells were maintained at 37c with 5% co2 and observed the cpe formation . When 80% of the infected cells show severe cpe, the cells and medium were collected by scraping off the attached cells with tip . After brief sonication on ice, the cell debris was removed by centrifugation . The cell supernatant was transferred to a new tube and processed for negative - strain electron microscopy by staining with 2% phosphotungstic acid (pta). Cytokines expression in orfv - infected thp-1 cells: total 1 10 thp-1 cells kindly provided by professor s.s . Chiou in graduate institute of microbiology and public health, national chung hsing university were seed in 6 well multiple plates within 1 ml of rpmi 1640 medium containing 10% fbs . Subsequently, 10 moi of orfv was inoculated into the cells and incubated with the human monocyte thp-1 cells . Forty - eight hr later, the supernatant was collected by brief centrifugation and transferred to a new tube which was then kept at 80c . The cytokine expression in the culture medium was examined by using the human il-8 and tumor necrosis factor alpha (tnf-) elisa kit (koma biotech inc . A set of standard cytokines, provided within the kit, with known concentrations were analyzed in parallel for establishment of standard curve . Finally, the od value of each sample was obtained from reading the plate at 450 nm wavelength . The mean value of the results was obtained from three independent experiments and was then assessed by t - test . P - value (p<0.05) indicated the significant difference between two groups of samples . Effect of orfv on subsequent influenza virus infection in cells: goat fibroblast primary cells were infected with orfv at moi of 1, and the cell media were collected at 0, 6, 12 and 24 hr post - infection (hpi). A549 cells were pre - treated with the orfv infected cell medium for 24 hr . After removal of the cell medium and pbs washing, the a549 cells were infected with 1 moi of influenza virus (pr8 strain). Cellular lysate of infected human lung carcinoma a549 cells obtained from atcc (ccl-185) was harvested at 12 hpi and resolved by sds - page electrophoresis followed by western blot analysis using igy antibody against influenza virus np generated from chickens immunized with purified np recombinant protein . The overall procedures of western blot analysis followed the description in the previous section . Densitometric quantifications of each band indicating np expression level were carried out using national institutes of health imagej software version 1.43 (http://rsb.info.nih.gov/ij). Effect of orfv on subsequent influenza virus infection in mice: the inhibitory activity on influenza virus infection by orfv was further tested in mice . Six weeks old, female balb / c mice received uv - inactivated 2 10 plaque formation unit (pfu) of isolated orfv, hoping strain (n=4) or pbs (n=4, as negative control) by intramuscular (i m) or subcutaneous (sc) routes . Two days after infection, the mice were intranasally challenged with 1 10 influenza virus (pr8 strain). Seven days post infection, blood was taken from each mouse for determining the concentrations of il-6 and tnf- in serum by elisa kits (biolegend; san diego, ca, u.s.a .) Performed following the manufacturer s procedure . Subsequently, the mice were scarified, and the lungs of the mice were collected . After brief centrifugation, the supernatant was used for measurement of the influenza virus titer on mdck cells . After two to three days post - infection, the infected mdck cells were fixed in methanol and stained with crystal violet . Viral infection and adaptation to the primary testis cells: the crude virus stock was serially diluted and inoculated into the primary goat testis cell . Cells were observed daily for appearance of cpe, and the presence of viral dna was determined by pcr in each run (1 week interval). After 3 - 5 rounds of blind passages, stronger bands were amplified in the second round of nested pcr, although no apparent cpe was observed . In subsequent cycles of blind passages, orfv was adapted and enriched in primary goat testis cells; viral dna can be detected in the first round of the nested pcr . Plaque purification of the orfv: with continued viral passages, the infected primary goat testis cells began to show the cytopathic effect (cpe) and form a viral plaque . The cpe in primary goat testis cells was local and limited on the area of affected cells after four to five days after infection (fig . (a) the infected primary goat testis cells showed rounding, shrinking and detachment, and eventually formed a viral plaque (200 magnification). The isolated plaque (v) showed the expected sizes (~900 bp, as indicated by the arrow) of amplified products of partial b2l gene . The positive control (+) was the virus - infected cell lysate in pcr; the negative control () was done without any dna template . (c) identification of isolated orfvs by the single - step pcr . As the pcr amplification yielded two dna fragments with characteristic sizes (180 and 254 bp, as indicated by arrows), it indicated the isolated orfv is the hoping strain (chan et al ., 2009). Lane 1: dna treated with ecor i; lane 2: treatment with bamh i; lane 3: treatment with hind iii; lane 4: treatment with kpn i; lane 5 is the uninfected cell, and the stained dna is smearing after kpn i digestion . That is consistent with one previous study that parapoxviruses form plaques in primary bovine testis cells . After three times of plaque purification, the purity of isolated orfv was examined by pcr using primers targeting viral b2l gene . 1b), and subsequent dna automated - sequencing confirmed the nucleotide identity of orfv b2l gene (data not shown). (a) the infected primary goat testis cells showed rounding, shrinking and detachment, and eventually formed a viral plaque (200 magnification). The isolated plaque (v) showed the expected sizes (~900 bp, as indicated by the arrow) of amplified products of partial b2l gene . The positive control (+) was the virus - infected cell lysate in pcr; the negative control () was done without any dna template . (c) identification of isolated orfvs by the single - step pcr . As the pcr amplification yielded two dna fragments with characteristic sizes (180 and 254 bp, as indicated by arrows), it indicated the isolated orfv is the hoping strain (chan et al ., 2009). Lane 1: dna treated with ecor i; lane 2: treatment with bamh i; lane 3: treatment with hind iii; lane 4: treatment with kpn i; lane 5 is the uninfected cell, and the stained dna is smearing after kpn i digestion . Identification of isolated orfv: a single - step pcr developed in our laboratory that shows distinct amplification patterns of three orfv strains in taiwan was used for identifying the isolated viruses . The nantou and taiping strain could amplify 180 and 217 bp product, respectively, and 2 different length fragments (180 and 254 bp) can be produced at the same time in the primary cells from goats . The nucleotide sequences of the hoping strain were further confirmed by automated dna sequencing (data not shown). Furthermore, the restriction enzyme digestion pattern of viral dna of the hoping strain was also confirmed (fig . In comparison with the smearing dna of uninfected sample (lane 5 in fig . 1d), all the dna of virus - infected samples treated with restriction enzymes showed characteristic cutting patterns . Viral gene expression examined by rt - pcr and immunoblotting: to examine viral gene expression in the primary goat testis cell, the viral rna was detected by rt - pcr . Despite the weaker expression, the transcripts of b2l can be detected at the early stage of infection (23 hpi), and it was largely synthesized after 12 hpi (fig . 2afig . 2.detection of the viral b2l gene expression and viral ov20.0 protein in infected primary goat cells . (a) rna was extracted from cells infected with orfv at 0, 1, 2, 3, 12, 20 and 24 hpi (lanes 17) for reverse transcription (rt) pcr detection . The transcription of b2l appeared at 2 and 3 hr post - infection and then was saliently increased at 12, 20 and 24 hpi . + indicates a positive control in which dna template is derived from virus lysate . (b) the expression of ov20.0 (the ortholog of vaccinia virus e3 protein) was observed at 6 hr, 12 hr and 24 hr after infection; the expected molecular weight of ov20.0 is 25 kda indicated by the arrowhead . Electron micrograph of orf viruses (c) prepared from primary goat testis cells . The characteristic morphology of orf virus was observed, and viral particles showed ovoid - shape with a spiral crisscross pattern (bar=100 nm).). Moreover, the orfv gene expression was verified by western blotting by using the mouse polyclonal anti - ov20.0 antibody . 2b demonstrated the viral ov20.0 protein (25 kda) was produced after 6, 12 and 24 hpi . These data indicated that genes of isolated orfv can be actively expressed in the primary goat testis cells . Detection of the viral b2l gene expression and viral ov20.0 protein in infected primary goat cells . (a) rna was extracted from cells infected with orfv at 0, 1, 2, 3, 12, 20 and 24 hpi (lanes 17) for reverse transcription (rt) pcr detection . The transcription of b2l appeared at 2 and 3 hr post - infection and then was saliently increased at 12, 20 and 24 hpi . + indicates a positive control in which dna template is derived from virus lysate . (b) the expression of ov20.0 (the ortholog of vaccinia virus e3 protein) was observed at 6 hr, 12 hr and 24 hr after infection; the expected molecular weight of ov20.0 is 25 kda indicated by the arrowhead . Electron micrograph of orf viruses (c) prepared from primary goat testis cells . The characteristic morphology of orf virus was observed, and viral particles showed ovoid - shape with a spiral crisscross pattern (bar=100 nm). Electron micrograph observation: morphological confirmation of orf virions in the infected goat testis cells was achieved with electron microscopy . The electron micrograph results demonstrated the presence of ovoid - shape virions with a spiral crisscross pattern (fig . 2c). Detection of cytokines produced in thp-1 cells with orfv: the orfv infection elicits expression of proinflammatory cytokines, such as several interleukins (ils) and tnf-, which contributes to the immune regulation of orfv and has been demonstrated in many studies [8, 9, 15, 26, 37]. It is important to explore whether orfv (hoping strain) harbors the immunostimulating activity . The human monocyte cell line, thp-1 cell, was infected with our local isolate at moi of 10 for 48 hr . The cell medium was collected for detection of il-8 and tnf- cytokine production . As the result shown in fig . 3fig . 3.expression of il-8 and tnf- in orfv treated human monocyte thp-1 cells . To examine whether our orfv can affect the cellular cytokine levels, thp1 cells were incubated with 10 moi of orfv for 48 hr . The cell medium was collected for examination of the cytokine il-8 and tnf- expressions by using the elisa kit (koma biotech inc .) The results demonstrated that il-8 and tnf- expression level significantly increased in cells infected with orfv, compared with that of pbs control . The column of each group was the mean (+ /sd) of three independent experiments . Statistical analysis was performed using unpaired t - test, and p value <0.05 (shown with a star symbol) indicates the statistical significance ., compared with a mock control, infection of orfv indeed caused the rise of the il-8 and tnf- expressions in thp-1 cells . Expression of il-8 and tnf- in orfv treated human monocyte thp-1 cells . To examine whether our orfv can affect the cellular cytokine levels, thp1 cells were incubated with 10 moi of orfv for 48 hr . The cell medium was collected for examination of the cytokine il-8 and tnf- expressions by using the elisa kit (koma biotech inc .) The results demonstrated that il-8 and tnf- expression level significantly increased in cells infected with orfv, compared with that of pbs control . The column of each group was the mean (+ /sd) of three independent experiments . Statistical analysis was performed using unpaired t - test, and p value <0.05 (shown with a star symbol) indicates the statistical significance . Orfv inhibited influenza virus replication in a549 cells: as an immune modulator, orfv has been shown to act as an inhibitor to prevent other virus infection and also to work as a tumor killer [3, 16, 19, 31]. The orfv infected cell medium, of which the infectivity of orfv was under detection, was collected at 6, 12 and 24 hpi, and overlaid onto a549 cells . After 24 hr treatment, the a549 cells were then infected with influenza virus pr8 strain for 12 hr . A significant decrease of viral np protein expression was observed in cells pre - treated with orfv infected cell medium (fig . 4.pre-treatment of orfv - infected cell medium prevents a549 cells from type a influenza virus (iav) infection . The primary goat testis cells were infected with orfv (hoping strain). At two hr post infection (hpi), the cells were maintained in complete rpmi 1640 medium with 10% fbs . At 6, 12 and 24 hpi, the medium was collected and used for treatment of human a549 cells . After 24 hr treatment, the a549 cells were infected with 1 moi of iav (pr8 strain). At 12 hpi, expression of viral nucleoprotein (np) of the iav was analyzed by immunoblotting (panel a), and the quantitative analysis of np production was shown in panel b. the column of each group was the mean (+ /sd) of three independent experiments . The p value <0.05 (shown with a star symbol) indicates the difference between 2 groups is statistically significant . ). Noticeably, increase of inhibitory strength coincided with the length of orfv infection; the longer orfv infection, the stronger inhibitory effect was observed . It indicates orfv (hoping strain) can prevent influenza virus infection in a549 cells . Pre - treatment of orfv - infected cell medium prevents a549 cells from type a influenza virus (iav) infection . The primary goat testis cells were infected with orfv (hoping strain). At two hr post infection (hpi), the cells were maintained in complete rpmi 1640 medium with 10% fbs . At 6, 12 and 24 hpi, the medium was collected and used for treatment of human a549 cells . After 24 hr treatment, the a549 cells were infected with 1 moi of iav (pr8 strain). At 12 hpi, expression of viral nucleoprotein (np) of the iav was analyzed by immunoblotting (panel a), and the quantitative analysis of np production was shown in panel b. the column of each group was the mean (+ /sd) of three independent experiments . The p value <0.05 (shown with a star symbol) indicates the difference between 2 groups is statistically significant . Inhibition of subsequent influenza virus replication in mice inoculated with uv - inactivated orfv: to further investigate the inhibitory activity on influenza virus infection by uv - inactivated orfv, 6 weeks old female balb / c mice were inoculated with either 2 10 pfu of uv - inactivated orfv (n=4) or pbs (n=4, as a negative control) by i m and sc routes for 2 days and subsequently infected with influenza virus . As shown in fig . 5afig . Orfv was administrated intra - muscularly (i m) or subcutaneously (sc) to balb / c mice (6 weeks old, n=4) at dosage of 2 10 pfu before iav infection . Two days later, all groups of mice received a dosage of 1 10 pfu iav via intra - nasal route . Seven days post infection, all the mice were sacrificed, and their lungs were removed for titration of the virus loads (a), and il-6 and tnf- expressions in blood were evaluated by elisa (biolegend) (b). Values display the means (+ /sd) of each group . P value<0.05, shown with a star symbol, indicates statistical difference between 2 groups ., in mice groups received the inactivated orfv via both i m and sc routes, the titer of influenza viruses significantly decreased (fig . The cytokine profile was also determined in mice inoculated with orfv . Elevated il-6 and tnf- expressions in mice with the inactivated orfv were noticed; however, only increased il-6 was statistically significant (fig . Orfv was administrated intra - muscularly (i m) or subcutaneously (sc) to balb / c mice (6 weeks old, n=4) at dosage of 2 10 pfu before iav infection . Two days later, all groups of mice received a dosage of 1 10 pfu iav via intra - nasal route . Seven days post infection, all the mice were sacrificed, and their lungs were removed for titration of the virus loads (a), and il-6 and tnf- expressions in blood were evaluated by elisa (biolegend) (b). P value<0.05, shown with a star symbol, indicates statistical difference between 2 groups . Orfv, an epitheliotropic parapoxvirus, causes proliferative dermatitis in goats and sheep, and persistence infection usually occurs in an outbreak farm . Although molecular identification by pcr and phylogenetic analysis of viral dna purified from the animal tissues are common, the isolation of orfv from the field and production of virions in cell culture are still formidable tasks . The isolation of parapoxviruses from cows, goats and sheep and serows as well as from ruminant animals (musk ox and sichuan takin) of a zoo was claimed [13, 14, 18, 22, 24, 30, 36, 38]; two of these studies investigated diseases of goats [18, 30]. So far, the most studied orfv strains are nz2, ia82, sa00 and d1701 which were isolated from new zealand, north america and germany [10, 25, 29]. In this work, a new orfv strain was isolated from current outbreak in taiwan, and the immunoregulation activity of this asian strain was demonstrated for the first time . The primary cells from goats, sheep or cattle source have been used to isolate parapoxviruses [18, 22, 24, 38], and subsequently, some cell lines were found to be susceptible to orfv infection, for examples, madin - darby ovine kidney (mdok) cells and madin - darby bovine kidney (mdbk) cells [13, 14, 23, 30]. The primary testis cells of goat, the original host of orfv, were used to isolate the virus from the field samples . After several rounds of plaque purification, our local orfv was purified in homogeneity as indicated by pcr amplifications and by electron microscopy; the typical ovoid - shaped virus particles with particular surface pattern of orfv were demonstrated . On the basis of pcr genotyping, we confirmed the resulted purified orf viruses were the hoping strain, one of the three strains of orfv identified in taiwan . Reported that the inactivated orfv particles (iowa strain) mediated activities against infections of different microbes and transient induction of certain innate immune mechanisms by orfv administration likely contributing to the immunostimulant effects . Weber et al . Showed treatment of orfv (d1701 strain) protects mice from acquiring and recurrent of herpes simplex virus type 1 infection . More recently, the effect of orfv particles on inhibition of viral infection was further demonstrated in different models: paulsen et al . Replication of hepatotropic pathogens, i.e. Hepatitis b virus and hepatitis c virus, was significantly reduced in a mouse model or in vitro, respectively; and such an anti - viral activity can be observed in 2 different viral strains (d1701 and nz2). Moreover, d1701 strain, a highly attenuated viral strain with reduced pathogenicity, is the main component of the commercially available immunomodulator . Considering the immunoregulatory effect might be variable between strains with different virulence, and hence, in this study, we set out experiments to explore the effect of hoping strain on subsequent influenza virus infection that poses a severe threat to humans and animals and is considered a major worldwide public health problem . Our results indicated that the production of proinflammatory cytokines, such as il-6 and tnf-, was significantly increased in the sera of mice pre - treated with orfv compared with that in the sera of mice receiving the pbs before iav infection (fig . 5b). Tnf- and il-8 were also higher in medium of orfv treated human monocyte thp-1 cells (fig . 3) that indicates an important role for orfv in modulating production of multiple inflammatory cytokines . This is in line with previous findings; tnf- contributes to resolving influenza virus infection in the host respiratory tract, and il-6 promotes viral clearance and reduces mortality to influenza virus infection via enhancing neutrophil survival from influenza virus - induced death . Recently, rohde et al . Generated 2 orfv recombinants expressing the hemagglutinin (ha) or nucleoprotein (np) of the highly pathogenic avian influenza virus (hpaiv, strain h5n1), and via i m route immunization of two doses (10 pfu of each) of ha - expressing orfv protects mice from lethal hpaiv infection . The present study showed that without expressing any influenza specific antigen, treatment of orfv significantly inhibited expression of np protein in cells, and also, one dose (10 pfu) of orfv immunization is able to reduce the influenza viral load in mouse lung . Based on the cytokine expression profile, it appears orfv infection elevates levels of proinflammatory cytokines (il-6 or il-8). However, further studies are required to elucidate the mechanisms of suppressing influenza virus infection . In summary,
Necrotising fasciitis (nf) is a serious soft tissue and life threatening infection, primarily involving the skin and superficial fascia, characterised by a rapid and extensive necrosis of the subcutaneous tissue . Most patients have associated comorbidities, such as diabetes, hiv infection or treatment with immunosuppressive drugs, but it can also affect previously healthy individuals . Infection is one of the common causes of morbidity and mortality in patients with systemic lupus erythematosus (sle). It is associated with immunosuppressive agents, renal failure, and increased disease activity . Despite the increased propensity of sle patients to develop common and opportunistic infections, nf has rarely been reported . To our knowledge, only 31 cases are described in the literature to date (see table 1). Nf has also been described in other rheumatic diseases including polymyositis, dermatomyositis, systemic sclerosis, rheumatoid arthritis and ankylosing spondylitis, but it appears that this association is more common in sle.1 2 clinical features of nf in systemic lupus erythematosus a, asian; aa, african american; aps, antiphospholipid syndrome; art, arthritis; avn, avascular necrosis; aza, azathioprine; cad, coronary artery disease; cs, corticosteroid therapy; cyc, cyclophosphamide; d, died; dm, diabetes mellitus; f, female; fg, fournier's gangrene; h, hispanic; hcq, hydroxychloroquine; lym, lymphocytes; m, male; mmf, mycophenolate; mtx, methotrexate; n, nephritis; na, not available; nf, necrotising fasciitis; pe, pulmonary embolism; rtx, rituximab; s, survived; sa, staphylococcus aureus; ttp, thrombotic thrombocytopenic purpura; wbc, white blood cells . We describe the case of a nf caused by pseudomonas aeruginosa, complicated by recurrent sepsis and multiorgan failure in a young patient with a history of sle . A 26-year - old asian woman with a complex history of sle, diagnosed at age 14 years when she presented with malar rash, arthralgia, mouth ulcers, pulmonary vasculitis, strongly positive anti - nuclear antibody and anti - dsdna antibodies . Subsequently, she had idiopathic detrusor overactivity with repeated urinary tract infection . Linked to her corticosteroid treatment she developed avascular necrosis of her elbow (at that time, on prednisolone 6 mg daily). The patient was also treated with hydroxychloroquine (hcq), azathioprine (aza) (100 mg from 1999 to 2009) and had 14 courses of cyclophosphamide (cyc) (a cumulative dose of 14 g) and two of rituximab (rtx) (two 1 g intravenous infusions separated by 2 weeks), the last being given in march 2012 for a sle flare manifested by severe vasculitic rash . Immediately prior to b - cell depletion, her c3 level was 0.33 g / l (normal: 0.651.65), cluster designation (cd) 19 count was 0.146/l (0.110.69), and immunoglobulin g level was 23.4 g / l (716). In may 2012, she presented to her local hospital with painful swelling of her left lower limb, she denied a history of trauma, and her inflammatory markers and ultrasonography were normal, and she was discharged . Within 12 h she was found at home with a glasgow coma scale of 6, and was admitted to the intensive care unit (icu). On examination, the patient was in septic shock with hypotension (systolic blood pressure 60 mm hg), tachycardia (135/min), and respiratory failure (sao2 70%). Laboratory results showed erythrocyte sedimentation rate 96 mm / h (normal: 17), c - reactive protein 281 mg / dl (05), white blood cells 15 400/l (300010 000) (97% neutrophils; 1.9% lymphocytes), haemoglobin 9.6 g / dl (11.515.5), platelet 50 000/l (150 000400 000), na 138 mmol / l (135145), creatine kinase 474 iu / l (26140), urea 16.8 mmol / l (1.78.3), alamine transaminase 384 iu / l (1035), total bilirubin 11 mg / dl (0.31.9), albumin 17 g / l (3450), creatinine 290 mol / l (4992) and proteinuria 2.30 g / l (00,10). Her c3 level was 1.0 g / l (0.651.65), cd19 count was 0.001/l (0.110.69), and immunoglobulin g level was 9.32 g / cultures of muscle tissue only grew p aeruginosa, resistant to piperazillin - tazobactam; therefore, she was treated with meropenem, teicoplanin and clindamycin . As her clinical condition however, 1 week later, she deteriorated, with thick yellowish sputum, fever, respiratory distress and the chest x - ray showed right consolidation . Ciprofloxacin and teicoplanin were empirically started, and the patient's clinical condition gradually improved . A week after this treatment had finished, the patient became worse with a new left lower lobe consolidation, so the antibiotic therapy was changed to ceftazidime . Her lupus flared with a marked malar rash over both cheeks, so her steroids (prednisolone) were increased to 20 mg per day and hcq was restarted . She was in the icu from may to august 2012, but made a remarkable recovery and was discharged home with a steroid - tapering regimen and hcq . Later, she developed two more sle flares, which were treated again with cyc and rtx, achieving good response . At 18 months follow - up, there is no evidence of new recurrent or severe ongoing infections . Most patients with nf ranged from 38years to 44 years, with a male to female ratio of 23: 1, and apparently an increased incidence in african and asian countries.3 the true incidence is not known (it is estimated to be approximately 0.4 cases per 100 000), with a reported mortality from 20% to as high as 80%.35 the causative agents of nf vary and include two main categories, polymicrobial (type 1) and infection of group a streptococcal (type 2). Patients with sle have an increased risk of infections, due to immunological dysfunction and the use of steroids and immunosuppressive agents.6 other factors, such as the presence of a variant form of the fc receptor are also believed to contribute to the risk of pneumococcal infection.7 nf due to pseudomonas has very rarely been reported.8 9 the clinical presentation of patients with nf may be deceptively benign at onset, and it may not be possible to distinguish it clearly from minor soft tissue infections . Our patient was discharged from the original hospital before being admitted subsequently severely ill to university college hospital . The lesion was rapidly progressive, probably due to her sle, and the prolonged steroid treatment and recent administration of cyc and rtx might have increased the risk of infection . During the initial period, exploration of the wound may be necessary even before the diagnosis is clear, particularly in a patient who is clearly toxic . In addition to the present case, the other 31 cases of nf in sle patients that have been reported are summarised in table 1 . The ages ranged from 12 years to 66 years, and 27 (84%) were female . Most of the patients reported were asian (33%, 7 patients), 33% (7 patients) hispanic and 19% (4 patients) african american . The sites of infection included the upper or lower limb (60%, 17 patients), the face, neck or tongue (18%, 5 patients), the genital area (11%, 3 patients) and the abdomen (11%, 3 patients). Nf type 1 was identified in 22 patients (71%) and type 2 in 7 patients (23%), and when reported, the most common isolation was streptococcus (50%, 16 patients). Most of the patients presented with intense pain, poorly demarcated erythematous, swollen lesions over the limbs and systemic inflammatory response; 28 patients (88%) were receiving corticosteroids and 7 hcq (22%). Additionally, use of other immunosuppressive drugs has been reported (5 cyc, 5 aza, 2 rtx, 1 mycophenolate, 1 methotrexate, 1 plasmapheresis) before or at the time of infection . Other associated conditions have been identified, including nephritis (54%; 15 patients of 28 reported), either during the current presentation or in the past, 13 (42%) had active disease (presumably those taking> 20 mg prednisolone or equivalent per day), 76% (13 of 17 reported) had lymphopenia, 100% (12 out of 12 reported) low serum albumin levels and 12 (37%) had anaemia . Interestingly, before the admission, 9 (28%) reported a previous episode of infection: urinary, bartholin abcess, diarrhoea, respiratory tract infection, carious tooth, colitis, hepatitis c, cutaneous ulcers (2), breast abscess and diverticulitis . Most patients responded to therapy, but 8 of the 32 patients died (25%), probably due to the infection or because of complications (such as sepsis or pulmonary embolism). The case presented here and the literature reviewed suggests that active disease, nephropathy, lymphopenia, anaemia, low serum albumin levels, immunosuppressive therapy and significant infections in the past, may constitute risk factors for the development of nf in patients with sle . A high index of suspicion for the diagnosis is required, and surgical exploration should not be delayed, especially during the early stages, to improve the prognosis of this devastating complication.
A custom nimblegen 12x135k microarray designed from d. serrata expressed sequence tags (ests) (frentiu et al . 2009) was used to measure expression of 11,631 ests (supplementary file s3, supplementary material online). A panel of 43 wild - derived inbred lines of d. serrata from a single population (st lucia, brisbane, australia) were used for the whole - body samples (n = 2 hybridizations per sex for each line for a total of 168), and a laboratory stock from the same location was used to obtain samples of several body parts: head (n = 4 per sex), thorax (female n = 3; male n = 4), gonadectomized abdomen (n = 4 per sex), ovaries (n = 3), testes (n = 4), and accessory glands (n = 4); all replicate hybridizations are biological replicates from independent rna extractions of different groups of flies . Flies were reared in 50 ml holding vials containing standard yeast medium and maintained at 25 c with a 12-h day / night cycle . Offspring were collected as virgins with the use of light co2 anesthesia and held for 3 days in same - sex groups of five flies . Two replicate pools of 30 flies per line per sex and four replicate pools of 100 flies for the whole - body and tissue samples, respectively, were snap - frozen in liquid nitrogen, without the use of co2 anesthesia . Rna extractions were performed by using the trizol procedure followed by rna isolation using rneasy minikits . Cdna synthesis, labeling, hybridization, and microarray scanning were performed by the centre for genomics and bioinformatics, bloomington, in . 2004; carvalho and irizarry 2010; draghici 2012) and the experimental metrics report provided by nimblegen . For the whole - body samples, this reduced the data set from n = 168 to n = 142 hybridizations, but no hybridizations were excluded for the tissue - specific samples (n = 34 hybridizations). Expression measurements were normalized via a log2 transformation and summarized by taking the median of a probe set (draghici 2012) where probe - level observations were the mean of the two replicates of that probe on the array . The expression data have been submitted to the ncbi gene expression omnibus (gse45801). Genes were tested for sex - biased expression using welch s t - tests and applying a false discovery rate (fdr) of 0.05 (benjamini and hochberg 1995). 2008), there is strong chromosome level conservation of orthologous genes between d. serrata and d. melanogaster (stocker et al . Stand - alone blast (version 2.2.27 +) was used to perform tblastx (default settings) between our est sequences and d. melanogaster chromosome, coding, gene, transcript, and pseudogene sequences obtained from flybase . Genes associated with chromosomes 2 (4,323 genes, 37%), 3 (4,938 genes, 43%), and x (1,706 genes, 15%) were used in the analysis; these chromosomes accounted for 10,967 (95%) of the genes in our microarray . A further 547 (4.7%) of the genes in our array had poor - quality blast hits (e - value> 0.1) and were therefore omitted from further analyses . Due to intrinsic variability in microarray data,, we identified genes that are likely expressed exclusively in a single sex by using a sex - specific metric of tissue specificity: (1) where ei is mean expression of tissue i and emax is the maximum of the tissue - specific mean expression across all tissues (yanai et al . 2005). This metric ranges from 0, for genes expressed at the same level in all tissues, to 1, for genes that are highly expressed in one tissue only, and has previously been used to classify genes as sex - limited if expression was highly biased toward sex - limited tissues such as the ovaries and testes (meiklejohn and presgraves 2012; meisel et al . We calculated using measures of gene expression for nine different tissue types (male- and female - only dissections of head, thorax, and abdomen plus ovaries, testes, and accessory gland). Using a stringent threshold of 0.9, genes were classified as sex - specific if expression was highly biased for any of the sex - limited tissues or, for example, head of females only . Likewise, genes were classified as co - expressed in both sexes if they fell below the threshold . To test whether sex - biased genes were distributed nonrandomly across chromosomes, we used permutation tests where the chromosomal location of each gene was permuted 1,000 times (meisel et al . 2012). The number of sex - biased genes per chromosome was deemed to not differ from random if more than 5% of the permuted estimates were greater / less than the observed value . The same permutation approach was used to assess demasculinization and feminization of the x chromosome by testing whether the chromosomal distribution of testis-, accessory gland-, abdomen-, and ovary - specific genes was nonrandom . To test for differences in global expression between the x chromosome and autosomal genes, mann whitney tests were performed on males and females separately (meisel et al . 2012). Mann whitney tests were further performed on sex - specific and co - expressed subsets of the male and female data to determine whether observed x autosome expression differences were specific to one or both of these gene classes . A custom nimblegen 12x135k microarray designed from d. serrata expressed sequence tags (ests) (frentiu et al . 2009) was used to measure expression of 11,631 ests (supplementary file s3, supplementary material online). A panel of 43 wild - derived inbred lines of d. serrata from a single population (st lucia, brisbane, australia) were used for the whole - body samples (n = 2 hybridizations per sex for each line for a total of 168), and a laboratory stock from the same location was used to obtain samples of several body parts: head (n = 4 per sex), thorax (female n = 3; male n = 4), gonadectomized abdomen (n = 4 per sex), ovaries (n = 3), testes (n = 4), and accessory glands (n = 4); all replicate hybridizations are biological replicates from independent rna extractions of different groups of flies . Flies were reared in 50 ml holding vials containing standard yeast medium and maintained at 25 c with a 12-h day / night cycle . Offspring were collected as virgins with the use of light co2 anesthesia and held for 3 days in same - sex groups of five flies . Two replicate pools of 30 flies per line per sex and four replicate pools of 100 flies for the whole - body and tissue samples, respectively, were snap - frozen in liquid nitrogen, without the use of co2 anesthesia . Rna extractions were performed by using the trizol procedure followed by rna isolation using rneasy minikits . Cdna synthesis, labeling, hybridization, and microarray scanning were performed by the centre for genomics and bioinformatics, bloomington, in . 2004; carvalho and irizarry 2010; draghici 2012) and the experimental metrics report provided by nimblegen . For the whole - body samples, this reduced the data set from n = 168 to n = 142 hybridizations, but no hybridizations were excluded for the tissue - specific samples (n = 34 hybridizations). Expression measurements were normalized via a log2 transformation and summarized by taking the median of a probe set (draghici 2012) where probe - level observations were the mean of the two replicates of that probe on the array . The expression data have been submitted to the ncbi gene expression omnibus (gse45801). Genes were tested for sex - biased expression using welch s t - tests and applying a false discovery rate (fdr) of 0.05 (benjamini and hochberg 1995). The chromosomal location of ests was established based on homology with d. melanogaster . As observed among other drosophila species (bhutkar et al . 2008), there is strong chromosome level conservation of orthologous genes between d. serrata and d. melanogaster (stocker et al . Stand - alone blast (version 2.2.27 +) was used to perform tblastx (default settings) between our est sequences and d. melanogaster chromosome, coding, gene, transcript, and pseudogene sequences obtained from flybase . Genes associated with chromosomes 2 (4,323 genes, 37%), 3 (4,938 genes, 43%), and x (1,706 genes, 15%) were used in the analysis; these chromosomes accounted for 10,967 (95%) of the genes in our microarray . A further 547 (4.7%) of the genes in our array had poor - quality blast hits (e - value> 0.1) and were therefore omitted from further analyses . Due to intrinsic variability in microarray data, it is difficult to define genes as not expressed . To overcome this issue, we identified genes that are likely expressed exclusively in a single sex by using a sex - specific metric of tissue specificity: (1) where ei is mean expression of tissue i and emax is the maximum of the tissue - specific mean expression across all tissues (yanai et al . 2005). This metric ranges from 0, for genes expressed at the same level in all tissues, to 1, for genes that are highly expressed in one tissue only, and has previously been used to classify genes as sex - limited if expression was highly biased toward sex - limited tissues such as the ovaries and testes (meiklejohn and presgraves 2012; meisel et al . We calculated using measures of gene expression for nine different tissue types (male- and female - only dissections of head, thorax, and abdomen plus ovaries, testes, and accessory gland). Using a stringent threshold of 0.9, genes were classified as sex - specific if expression was highly biased for any of the sex - limited tissues or, for example, head of females only . Likewise, genes were classified as co - expressed in both sexes if they fell below the threshold . To test whether sex - biased genes were distributed nonrandomly across chromosomes, we used permutation tests where the chromosomal location of each gene was permuted 1,000 times (meisel et al . 2012). The number of sex - biased genes per chromosome was deemed to not differ from random if more than 5% of the permuted estimates were greater / less than the observed value . The same permutation approach was used to assess demasculinization and feminization of the x chromosome by testing whether the chromosomal distribution of testis-, accessory gland-, abdomen-, and ovary - specific genes was nonrandom . To test for differences in global expression between the x chromosome and autosomal genes, mann whitney tests were performed on males and females separately (meisel et al . 2012). Mann whitney tests were further performed on sex - specific and co - expressed subsets of the male and female data to determine whether observed x autosome expression differences were specific to one or both of these gene classes . Supplementary files s1s3 and figures s1 and s2 are available at genome biology and evolution online (http://www.gbe.oxfordjournals.org/).
Betanodaviruses (family nodaviridae) are the causative agents of viral nervous necrosis (vnn) or viral encephalopathy and retinopathy (ver) in a variety of cultured marine fishes worldwide . Necrosis and the vacuolation of central nervous tissues (brain and spinal cord) and eye retina are the most characteristic lesions of vnn, and affected fish shows abnormal swimming behavior . The spread of vnn among populations of cultured marine fish may be attributable to either vertical or horizontal transmission . The first description of vnn in korea was reported apparently in cultured groupers (epinephelus septemfasciatus), recently, oh et al . Reported mass mortality in hatchery - reared red drum (sciaenops ocellatus), which was associated with a betanodavirus . Vnn in the guppy (poicelia reticulata), a freshwater ornamental fish, was described previously, though the viral etiology was not fulfilled . Korea imports a variety of aquarium (marine or freshwater) fishes from southeast asian countries; the number of such imported species increases annually . However, appropriate quarantine practices are often neglected or overlooked in the importation of aquarium fishes and invertebrates in many countries . As a result, imported fishes and invertebrates sometimes die of infections soon after arrival, or during transport . In order to know, we evaluated apparently healthy fish and invertebrate samples collected from a commercial aquarium in korea for the presence of betanodavirus, by polymerase chain reaction (pcr)-based techniques, to determine whether these imported aquarium fishes and invertebrates might be one of the sources of vnn . From november 2005 to february 2006, 237 samples of marine (65 species) and freshwater (12 species) fishes and marine invertebrates (4 species) were collected from a commercial aquarium in seoul, korea . From these aquarium fish samples, 20 samples (8 species) other aquarium fishes were imported from different sources, such as japan with 58 samples (25 species), singapore with 58 samples (17 species), the amazon river with 45 samples (11 species), indonesia with 22 samples (5 species), the philippines with 13 samples (5 species), australia with 3 samples (2 species), the united states of america with 9 samples (1 species), canada with 1 sample (1 species), the caribbean sea with 1 sample (1 species) and the pacific ocean with 1 sample (1 species). With regard to the invertebrate samples, 2 samples (2 species) were from japan, 2 samples (1 species) were from hawaii, and 2 samples (1 species) were from the pacific ocean . The brains or other pooled organs were collected aseptically from the samples, then maintained at a temperature of -80 until use . Total rna was extracted from the brains or pooled organ tissues using an rna extraction kit with trizol reagent (invitrogen, usa), in accordance with the manufacturer's instructions . In brief, the tissues were homogenized with trizol reagent and shaken with chloroform, then centrifuged for 15 min at 12,000 g. rna in the aqueous phase was precipitated with isopropanol, then dissolved in diethylpyrocarbonate - treated water (biosesang, korea). Pcr amplification was conducted using primers (bnv - rt, bnv - ur1, bnv - uf1) for rt - pcr and (bnv - ur2, bnv - uf2) for nested pcr designed for the target regions (570 bp and 420 bp) of the sgnnv rna2, as previously described . After reverse transcription using reverse transcriptase superscript ii (invitrogen, usa) at 45 for 60 min, pcr was conducted using ex taq polymerase (takara, japan) with 30 cycles of denaturation at 94 for 30 s, annealing at 57 for 20 s, and a final extension step at 72 for 60 s. nested pcr was conducted using the protocol described above . The rnas from the uninfected redspotted grouper (e. akaara) larvae were used as negative controls for both rt - pcr and nested pcr . From november 2005 to february 2006, 237 samples of marine (65 species) and freshwater (12 species) fishes and marine invertebrates (4 species) were collected from a commercial aquarium in seoul, korea . From these aquarium fish samples, 20 samples (8 species) other aquarium fishes were imported from different sources, such as japan with 58 samples (25 species), singapore with 58 samples (17 species), the amazon river with 45 samples (11 species), indonesia with 22 samples (5 species), the philippines with 13 samples (5 species), australia with 3 samples (2 species), the united states of america with 9 samples (1 species), canada with 1 sample (1 species), the caribbean sea with 1 sample (1 species) and the pacific ocean with 1 sample (1 species). With regard to the invertebrate samples, 2 samples (2 species) were from japan, 2 samples (1 species) were from hawaii, and 2 samples (1 species) were from the pacific ocean . The brains or other pooled organs were collected aseptically from the samples, then maintained at a temperature of -80 until use . Total rna was extracted from the brains or pooled organ tissues using an rna extraction kit with trizol reagent (invitrogen, usa), in accordance with the manufacturer's instructions . In brief, the tissues were homogenized with trizol reagent and shaken with chloroform, then centrifuged for 15 min at 12,000 g. rna in the aqueous phase was precipitated with isopropanol, then dissolved in diethylpyrocarbonate - treated water (biosesang, korea). Pcr amplification was conducted using primers (bnv - rt, bnv - ur1, bnv - uf1) for rt - pcr and (bnv - ur2, bnv - uf2) for nested pcr designed for the target regions (570 bp and 420 bp) of the sgnnv rna2, as previously described . After reverse transcription using reverse transcriptase superscript ii (invitrogen, usa) at 45 for 60 min, pcr was conducted using ex taq polymerase (takara, japan) with 30 cycles of denaturation at 94 for 30 s, annealing at 57 for 20 s, and a final extension step at 72 for 60 s. nested pcr was conducted using the protocol described above . The rnas from the uninfected redspotted grouper (e. akaara) larvae were used as negative controls for both rt - pcr and nested pcr . The results of betanodavirus detection by rt - pcr and nested pcr are summarized in table 1, and the detection rate in nested pcr was 11/237 (4.64%). Marine aquarium fish with no clinical signs positive for nodavirus by nested pcr were as follows: 3 of the 58 samples from japan, 3 of 58 from singapore, 1 of 13 from indonesia and 1 of 9 from the united states of america . 2 of 45 freshwater aquarium fish from the amazon river also tested positive for nodavirus by nested pcr . 1 of 2 marine invertebrates obtained from japan also tested positive for nodavirus by nested pcr . Other marine aquarium fish from korea (20), the philippines (13), australia (3), canada (1), the pacific ocean (1), the caribbean sea (1) as well as freshwater aquarium fish from indonesia; and marine invertebrates from hawaii (2) and the pacific ocean (2) tested negative for nodavirus by both rt - pcr and nested pcr tests . Positive nested pcr results were obtained from the brain samples of 8 apparently healthy marine aquarium fish species: shrimp fish (aeoliscus strigatus), milkfish (chanos chanos), three spot damsel (dascyllus trimaculatus), japanese anchovy (engraulis japonicus), pinecone fish (monocentris japonica), blue ribbon eel (rhinomuraena quaesita), look down fish (selene vomer) and the yellow tang (zebrasoma flavesenes). Other positive nested pcr results were obtained from the brains of 2 apparently healthy freshwater fish species, south american leaf fish (monocirrhus polyacanthus), red piranha (pygocentrus nattereri) and the marine invertebrate, the spiny lobster (pamulirus versicolor). Representative amplicons of the fish and invertebrate samples tested positive on nested pcr are shown in fig . 1 . The positive data from the nested pcr results show that betanodavirus is present in both marine and freshwater fish, as well as marine invertebrates, displayed in one commercial aquarium in korea . Korea imports a variety of aquarium fish from different countries, and the majority of these fish or invertebrates are imported without appropriate quarantine protocol . In the present system, there were no specific rules regarding quarantine practices on the importation of aquarium fishes and invertebrates in korea, and there was also an absence of proper documentation from the exporting countries with regard to whether the fishes or invertebrates were pathogen - free or not prior to export . Positive samples were obtained from the brains of 8 different marine fish species imported from 4 different countries: indonesia, japan, singapore and the usa, in which vnn has previously occurred, and have also been reported in different marine fish species . Nodavirus positive samples were also obtained from the brains of 2 freshwater fish species imported from the amazon river . It is interesting to note that, until now, there have been no cases of vnn reported on the latin american continent . Other nodavirus - positive sample was obtained from the brain of the spiny lobster, a marine invertebrate, imported from japan . In taiwan, chi et al . Reported the detection of vnn in other live food organisms, such as crustaceans including the brine shrimp (artemia sp .) Nauplii, the copepod (tigriopus japonicus), and the shrimp (acetesinte medius). It has also been reported in taiwan, china, and the french west indies, that freshwater shrimp (macrobrachium rosenbergii) with white tail disease (wtd) have also been infected with a virus, and the causative pathogen has been identified as the m. rosenbergii nodavirus (mrnv). However, thus far, there have been no reports of betanodavirus infections in aquarium fish and invertebrates in korea . To our knowledge, this study is the first report of betanodavirus in subclinically infected aquarium fish and invertebrates in a korean commercial aquarium . So, what is the significance of the detection of betanodaviruses from apparently healthy marine or freshwater aquarium fish or marine invertebrates? It is possible that samples from exporting countries in which vnn infections have occurred were already infected vertically from broodstock to larvae, or horizontally from fish via water or other by biological organisms, thus becoming carriers of the nodavirus prior to transport to the importing countries . The results of the present study indicated that approximately 4.64% of the fish or invertebrate samples imported from different countries were tested positive for nodavirus in the korean commercial aquarium . In the cases in this study, the brains were usually negative on rt - pcr, but were confirmed positive on nested pcr, which suggests that the samples had been latently infected with betanodaviruses . Another possibility is that the imported samples might also be infected soon after transport via horizontal transmission, as the fishes are usually maintained together in one aquarium with other subclinically infected wild fishes collected from the korean sea . Sohn et al . Previously reported the first incidence of vnn in a cage - cultured grouper (e. septemfasciatus) on the southern coast of korea . Recently, incidences of nodavirus disease outbreaks have been recorded in cultured marine fish such as the red drum (s. ocellatus). These nodavirus - contaminated fish or invertebrates may cause problems, as they may die soon after arrival or during transport, due to the combination of stress and nodavirus infection which could entail economic losses . We are also unable to predict what the consequences are likely to be when betanodaviruses are introduced to different countries, due primarily to a lack of proper documentation and limited information regarding the factors relevant to betanodavirus infections in the exporting countries . The office international des epizooties (oie) has detailed provisions regarding the importation and exportation of aquatic animals, as well as aquaculture products targeted at avoiding the risk of spreading aquatic animal diseases . Furthermore, these subclinically infected samples may constitute a persistent potential source of nodavirus from exporting countries for susceptible fish species cultured in korea . It cannot yet be established as to what the source of the virus may be, as well as the most likely route of infection . Due to the paucity of reports regarding the detection of betanodaviruses in healthy aquarium fish and invertebrates, the results of this study indicate the possibility of a new route of the infection into cultured fish populations . The fact that this virus was detected in produce imported from foreign countries implies an urgent necessity for the establishment of a quarantine system in korea . Until such laws have been implemented, imported aquarium fishes or invertebrates should be randomly assessed by pcr - based techniques, either on a routine basis, to verify that they are pathogen - free; in cases in which fish or invertebrate are infected, a particular batch of samples should not be accepted, or appropriate treatments should be administered prior to clearance and domestic distribution throughout korea.
Surgical procedures performed on the aged account for a high percentage of all surgeries in the united states . A national center for health statistics (nchs) report (pokras, 1983) estimates that in 1979 more than 20 percent of all procedures were for patients 65 years of age or over . The rate of all listed procedures per 10,000 population was estimated by nchs to be 2,583 for the aged and only 1,371 for all ages in that year . Lubitz and deacon (1982) have noted that the incidence of surgery among the nation's aged increased at a faster rate between 1967 and 1977 than for younger people . Because mortality following surgery generally increases with age (lubitz, riley, and newton, 1985; jensen and tondevold, 1979; and gersh et al ., 1983), postsurgical mortality among the aged is an important aspect of surgical outcomes . Among hospitals, surgical outcomes can vary considerably in a manner not fully explained by measurable differences in individual patient characteristics . The national halothane study (national academy of sciences, 1966) examined the effects of halothane anesthesia on patients undergoing surgery . The study, adjusting for differences in procedures, age, and preoperative physical status, produced evidence of considerable variation in inhospital death rates among the 34 hospitals . The stanford center for health care research (1974), using professional activities study (pas) data collected from 1,224 hospitals, studied differences in institutional mortality rates after indirectly standardizing for demographic and clinical differences in patient populations . The study also addressed the relationship between various hospital characteristics (e.g., size, teaching programs, and staffing levels) and standardized mortality ratios (mr's) for various categories of procedures . The investigators found that standardized mr's differed according to hospital characteristics, but the nature and strength of the relationship varied strongly by procedure . In general, the amount of variation in standardized mr's explained by hospital characteristics was rather small for each procedure . Schumacher and horn (1978) examined postoperative death rates among maryland hospitals both for those located in standard metropolitan statistical areas (smsa's) and those in non - smsa's . Controlling for case mix, the investigators found an inverse relationship between cost per case and mortality rates in smsa's, but did not find significant relationships between mortality rates and other hospital characteristics, such as number of residency training programs, hospital salary level, and presence of high technology facilities (e.g., coronary care units and intensive care units). The commission on professional and hospital activities (1970), using professional activity study (pas) data, found that after adjusting for differences in patient mix, cholecystectomy patients discharged from small hospitals experienced a much higher mortality rate than those discharged from large hospitals . Luft, bunker, and enthoven (1979) and luft (1980) examined the issue of whether hospitals that perform large numbers of specific surgical procedures have different mortality outcomes than hospitals that perform relatively few of these procedures . From pas data, hospital - specific mortality rates were compared with expected mortality rates, adjusting for age, sex, and presence of single or multiple diagnoses . Mortality rates decreased as volume of the specific operations increased for several procedures, including open heart surgery, coronary artery bypass graft, transurethral resection of the prostate (turp), and hip arthroplasty (total replacement). This association was determined to exist independent of the effects of hospital size such as total admissions and total number of operations performed . No significant volume - mortality relationship was found for some procedures, e.g., vagotomy . Although the data suggest that greater surgical experience may lead to lower mortality rates for some procedures, luft (1980) also provided evidence that suggests a referral effect may exist, i.e., that better outcomes may lead to more referrals and higher volume . Regardless of the exact nature of the relationship between volume and mortality, luft, bunker, and enthoven (1979) have argued that the data support the concept of establishing regional referral centers for some procedures . Additional evidence supporting the establishment of regional centers for performing certain procedures was reported recently by flood, scott, and ewy (1984a and 1984b). They used 1972 data from the commission on professional and hospital activities, and found strong and consistent evidence that high volume is associated with lower inhospital mortality for surgical patients, after controlling for patient mix . In particular, low - volume hospitals were associated with poorest outcomes relative to expectations for low - risk surgical patients . Our study examines the relationship between hospitals' postsurgical mortality rates and surgical volume for aged medicare beneficiaries undergoing eight types of procedures in 1979 or 1980 . The procedures are turp, hip arthroplasty (total hip replacement and other arthroplasties are examined separately), femur fracture reduction, resection of the intestine, cholecystectomy, inguinal hernia repair, and coronary artery bypass . All, with the exception of coronary artery bypass surgery, are common among the aged . For five of the eight study procedures, more than half of all operations were performed on the aged . In 1979, 86 percent of all hip arthroplasties (not including total hip replacement), 74 percent of all turp's, 69 percent of all femur fracture reductions, 57 percent of total hip replacements, and 52 percent of resections of the intestine were performed on the aged (national center for health statistics, 1982). Between 23 percent and 28 percent of the coronary artery bypass surgeries, repairs of inguinal hernia, and cholecystectomies in addition, all these procedures, except for femur fracture reduction, are often of a nonemergency nature . This means that, aside from the decision to operate or not, there is often considerable discretion available as to which hospital the procedure will be performed in . Lastly, several of the procedures exhibit rather high mortality rates following surgery (lubitz, riley, and newton, 1985). The association of volume and mortality rates is particularly important for the aged, because the relative frailty of this population and the frequent presence of co - morbidity may make the aged more sensitive to the effects of surgical experience . Data for this study were obtained from two files of the medicare statistical system of the health care financing administration (hcfa): the medicare provider analysis and review (medpar) file and the enrollment file . The medpar file contains information on discharges from short - stay hospitals for a 20-percent probability sample of medicare beneficiaries (selected on the basis of their medicare identification numbers). The information includes demographic data (e.g., age, sex), hospital data (e.g., size, location), and stay data (e.g., principal surgical procedure, principal diagnosis, and inhospital patient death). In 1979 and 1980, the principal surgical procedure and principal diagnosis were coded for each discharge using the international classification of diseases, ninth revision, clinical modification (icd-9-cm). The records of hospital stays for the eight selected procedures were linked to the enrollment file to identify all deaths, regardless of where the death occurred, for 60 days following surgery . This variable, referred to in this article as volume, is the annual number of surgeries of a given type performed on the medicare aged in a specific hospital . Volume was derived by summing, for each hospital, the number of surgeries performed in the appropriate year and then multiplying by 5 . First, the experience of many hospitals with a very low volume of specific surgeries is not represented in the analysis . This is true because, under the 20-percent sample selection criterion, no patients are selected from many hospitals that perform only a few operations of a specific type in a given year . Consequently, it should be more difficult to detect mortality - volume relationships that exist at a low range of surgical volumes . A related problem is that some error is present in the measurement of surgical volumes for individual hospitals because the medpar file discharges are selected as a national sample and not on a hospital - by - hospital basis . This error can be substantial at very low sample volumes (table 1). Second, the exact date of death is not always identified because, in the medicare enrollment file, the date of death is sometimes coded as the last day of the month of death . This is most often true for railroad retirees, who constituted approximately 3 percent of our sample . Railroad retirees were therefore excluded from the analyses, and for the remainder of the sample it was estimated that 5 percent of all deaths were erroneously recorded as having occurred on the last day of the month . The effect of erroneously recorded death dates would be to slightly underestimate the number of deaths occurring within 60 days of surgery, but there is no reason to believe that this invalidates the results relating to mortality - volume relationships . Third, there are known to be some problems with the reliability of diagnostic and surgical data in the medicare statistical system (national academy of sciences, 1977). The problems uncovered in the national academy of sciences study are described in another article (lubitz, riley, and newton, 1985). The study did not reveal any errors that would appear to systematically bias our study results . For six of the procedures, cases with a principal diagnosis of cancer for the stay in which the study procedure was performed were excluded from the sample; the six procedures are hip arthroplasty (total), hip arthroplasty (other), femur fracture reduction, inguinal hernia repair, cholecystectomy, and coronary artery bypass . Among beneficiaries undergoing these operations, there were few cancer patients (1.2 percent); their mortality experience was considerably different from that of the noncancer patients . Cancer patients were retained in the sample for turp and resection of the intestine because there were significant numbers of such patients . The study also does not include medicare beneficiaries entitled because of disability (all of whom are under 65), who constitute approximately 10 percent of the medicare population . Discharges of aged beneficiaries with the appropriate icd-9-cm surgical codes, occurring in 1979 and 1980, were selected and pooled across both years . If an individual underwent more than one hospitalization for the study procedures during 1979 - 80, each discharge was included as a separate observation . In addition to individual patient attributes for each discharge, such as age and sex, characteristics of the hospital in which the surgery was performed were appended to the unit record, including the annual number of procedure - specific surgeries from the medpar file (volume). It should be noted that for patients undergoing either hip arthroplasty (total) or hip arthroplasty (other), volume represents the sum of the operations of either type performed in a given hospital and year . The surgical outcome focused on in the study was whether the patient died within 60 days of surgery . This time period was chosen because of evidence that high mortality persists for these procedures for at least 2 months after surgery (lubitz, riley, and newton, 1985). The use of deaths within 60 days of surgery represents an important difference from earlier studies on the relation of surgical volume to mortality; those studies were limited to inhospital deaths (luft, 1980; flood et al . 1984a and 1984b). Following patients for 60 days removes any possible confounding effect of a relation between length of hospital stay and other variables . The associations between outcome and patient and hospital attributes were examined using multiple logistic regression, with the dependent variable defined as death within 60 days of surgery (1 = yes, 0 = no). Logistic regression is commonly used to ascertain the association between one or more independent variables and a binary response variable . The logist procedure of statistical analysis system (sas) was used to estimate the regression relationships (harrell, 1983). Throughout the analyses, a significance level of .05 is used, although p - values are shown to indicate the strength of the relationships . The sample sizes of the eight study procedures are shown in table 2, along with the number of deaths that occurred within 60 days of surgery . The most common procedure was turp with 55,742 sample cases in 1979 - 80, and the least common procedures were coronary artery bypass, with 6,157, and hip arthroplasty (total), with 9,862 . The highest mortality rates within 60 days of surgery were experienced by patients undergoing resection of the intestine (11.0 percent), and femur fracture reduction (10.2 percent). In the latter case, the high death rate is partly because of the advanced age of the patients (mean 80.4 years), as indicated in table 3 . The lowest death rate was for patients undergoing inguinal hernia repair (1.5 percent). The independent variables examined in the study, with their mean values by procedure, are listed in table 3 . The number of hospitals represented is also given by procedure . Average annual surgical volume for aged medicare patients for specific procedures (volume) was highest for turp, with an annual average of 84 such operations in hospitals performing one or more turp's . The second highest surgical volume was attributed to coronary artery bypass, with 70 such procedures per hospital . This fact and the fact that only 990 hospitals are represented in our sample for coronary artery bypass suggest that this operation is concentrated in relatively few hospitals and that the volume of coronary artery bypass procedures tends to be large in these hospitals . The smallest procedure - specific surgical volumes were attributed to femur fracture reduction, with 34 mean annual operations, and resection of the intestine, with 36 mean annual operations . There is an unknown degree of upward bias in these average figures because some hospitals with a very low volume of specific procedures are not identified for the study, given the 20-percent sample size limitation of the medpar file . Coronary artery bypass differs from other procedures with respect to the hospital - specific variables . More than 70 percent of coronary artery bypass operations were performed in hospitals with a medical school affiliation, compared with 52 percent for the next highest procedure, hip arthroplasty (total). The percentage of coronary artery bypass procedures performed in proprietary hospitals was somewhat lower (5 percent) than for any other procedure, and nearly all (98 percent) were performed in a hospital located in an smsa area . The percentage of patients dying within 60 days of surgery varied by surgical volume for several study procedures (table 4). Mortality rates exhibited a rather consistent decrease as volume increased for resection of the intestine, coronary artery bypass, turp, and hip arthroplasty (other). Mortality rates declined most sharply for resection of the intestine, from 12.4 percent for the lowest volume group to 9.7 percent for the highest . Hip arthroplasty (total) patients exhibited a substantial decrease in mortality among the highest volume hospitals . Repair of inguinal hernia patients exhibited a less consistent decline in mortality as volume increased, and femur fracture reduction and cholecystectomy patients did not show any consistent relation between death rate and surgical volume . In table 4, the percentage of procedures performed in low - volume and high - volume hospitals is shown . On the one hand, more than one - half of all operations on the medicare aged for femur fracture reduction and resection of the intestine are done in low - volume hospitals (sample size of fewer than seven procedures). On the other hand, procedures for turp, coronary artery bypass, and hip arthroplasty (total) are frequently performed in high - volume hospitals (sample size of more than 15 procedures). The relative concentration of these procedures in high - volume hospitals probably reflects the electiveness of these procedures . Even so, approximately 27 percent of coronary artery bypass and hip arthroplasty (total) operations were done in low - volume hospitals . The number of surgeries performed does not represent any hospital's complete surgical experience for the study procedures, but rather that with aged medicare beneficiaries . Consequently, the study focuses on the relationship between a hospital's institutional experience in the surgical treatment of aged patients and the mortality of those patients . Surgical care of aged patients often requires special attention to co - morbid conditions, and involves substantially greater risk of complications and death . Thus, surgical volume related specifically to aged patients is an important measure of experience . The relationship between mortality rates and surgical volume is more clearly identified through the multiple logistic regression equations developed separately for each procedure (table 5). Because the regression coefficients are not readily interpretable in a logistic regression equation, only the signs of the coefficients are given in table 5 along with their approximate p - values . A negative sign indicates that mortality decreases with an increase in the value of the independent variable and vice versa . (the logarithm of volume was used because previous research has shown that the curve describing the association between surgical volume and mortality flattens as surgical volume increases [luft, 1980]). Dummy variables were used to indicate sex, geographic region, presence of specific principal diagnoses, medical school affiliation of the hospital in which the surgery was performed, proprietary status, and location in an smsa area . For resection of the intestine, cholecystectomy, and inguinal hernia repair, an additional dummy variable was included to indicate whether or not the date of surgery and the date of admission were the same . Surgery on the day of admission may indicate that the admission was for an emergency or urgent case . As further controls for patient mix, length of stay and total charges were considered for inclusion as independent variables; however, they were dropped because they could equally well be considered dependent variables, e.g., a poor surgical outcome often involves complications that increase length of stay as well as total charges . Dummy variables indicating proprietary status and smsa location were excluded from the equation for coronary artery bypass because so few of these procedures were performed in proprietary hospitals or non - smsa areas . Under the model described above, surgical volume exhibits a significant association with mortality for several of the study procedures, with higher volumes being associated with a lower probability of mortality . Resection of the intestine patients (p <.001) and those undergoing turp (p = .017) exhibit a highly significant relationship between volume and mortality . Patients undergoing coronary artery bypass or hip arthroplasty (other) also show a significant association between volume and mortality (p = .031 and p = .043 respectively). The regression coefficients for patients undergoing femur fracture reduction, cholecystectomy, repair of inguinal hernia, and hip arthroplasty (total) are not statistically significant with respect to log (volume). It is interesting to observe that all eight of the regression coefficients with respect to log (volume) are negative, which would not be expected in the absence of any volume - mortality relationships . It cannot be determined with certainty whether the association between volume and mortality reflects the effects of procedure - specific surgical volume or the volume of surgical cases in general . It is possible, for example, that general operating room experience acquired by hospital personnel may affect outcomes for certain procedures more so than experience with that particular type of procedure . If this is true, then our procedure - specific volume variable may only be a proxy for general surgical volume . We attempted to measure the effect of general surgical volume on mortality by introducing into the equations a general surgical volume variable measuring the number of all operations performed on the elderly; the high positive correlations among the general and procedure - specific volume variables and bed size (beds) (table 6) produced substantial multicollinearity problems in the models, with the exception of coronary artery bypass . Thus, no firm conclusion could be drawn about the relationship between mortality and general surgical volume . Age exhibits a strong positive association with mortality for all eight procedures (p <.001). The regional dummy variables exhibit a consistent pattern for several procedures, with superior outcomes for patients residing in the west . (the west is the region excluded from the regression and therefore each regional dummy variable represents a comparison of that region with the west .) Patients undergoing turp, hip arthroplasty (other), and femur fracture reduction in the west exhibit significantly better outcomes than patients undergoing the same procedures in most or all of the other three regions (p <.05 for the regional dummy variables). Similarly, for resection of the intestine and coronary artery bypass, patients in the west had the lowest mortality, although only one regional coefficient for each procedure is significant at the .05 level . These findings confirm those obtained from earlier univariate analyses on the same data set (lubitz, riley, and newton, 1985). These findings are also similar to those reported by luft, who found significantly better outcomes in the west for 7 out of 12 procedures studied . No evidence of a regional effect on mortality among cholecystectomy, hip arthroplasty (total) or inguinal hernia repair patients is shown in table 5 . Medical school affiliation exhibits a positive association with mortality at the .05 level for resection of the intestine and inguinal hernia repair . For hip arthroplasty (total) patients, however, an often cited explanation for poorer outcomes in hospitals affiliated with a medical school is that the patients undergoing operations in these facilities tend to be in poorer health than those treated elsewhere . The dummy variable designating location of the hospital in an smsa exhibits no consistent relationship for this set of procedures . Proprietary status yields positive regression coefficients for six of seven procedures, but none of the coefficients achieves statistical significance . Higher mortality is significantly associated (p <.001) with a principal diagnosis of cancer for turp patients, with obstructed hernia for inguinal hernia repair patients, and with femur fracture for hip arthroplasty (total) patients . Patients undergoing resection of the intestine exhibit more favorable outcomes with a principal diagnosis of diverticula of the intestine, and, surprisingly, with a principal diagnosis of cancer . It is possible that the remaining patients, who exhibited a variety of principal diagnoses and who constituted only 35 percent of all resection patients, suffered from multiple conditions, and that cancer or some other serious illness was present, but not coded as the principal diagnosis associated with the hospitalization . It is also possible that many of the residual patients were nonelective cases, and constituted poorer risks for surgery than the cancer patients, who are commonly elective cases . The predicted probability of death within 60 days of surgery is given for various levels of volume for resection of the intestine, coronary artery bypass, turp, and hip arthroplasty (other) (table 7), which are the four procedures for which volume was significant in table 5 . The predicted probability of death decreases substantially as volume increases for resection of the intestine, coronary artery bypass, and hip arthroplasty (other). For resection of the intestine, a change in volume from 10 to 25 operations decreases the predicted probability of death from .109 to .097 (a 11.0 percent decrease). An increase in volume from 10 to 40 operations decreases the predicted probability of death from .109 to .091, or 16.5 percent . Similarly, an increase in volume of coronary artery bypass surgeries from 20 to 40 results in a decrease in predicted mortality from .067 to .061 (a 9.0 percent decrease). An increase in volume from 20 to 80 coronary artery bypass operations per year results in a decrease in the predicted probability of death from .067 to .056 (a 16.4 percent decrease). For hip arthroplasty (other), an increase in volume from 10 to 25 reduces the predicted probability of death from .081 to .076 (or 6.2 percent); an increase from 10 to 50 operations reduces it from .081 to .072 (11.1 percent). For turp, the impact of a change in volume is considerably less . An increase in volume from 20 to 100 operations produces a decrease in predicted probability of death from .027 to .023 . Although this represents a 14.8 percent decrease, the decline is not very substantial in absolute terms because of the relatively low mortality rate associated with turp . The models are not suitable for predicting individual probabilities of death . In these cases, outcome can be affected by many additional variables that cannot be controlled in a model of this type . As mentioned earlier, previous studies of the volume - mortality relation looked at deaths during the initial stay for surgery; we developed an additional set of models using inhospital deaths as the dependent variable . As indicated in table 8, the association between surgical volume and inhospital mortality is much stronger than it is between volume and mortality within 60 days of surgery . Five of the eight procedures show a statistically significant relation between volume and inhospital deaths and the relation approaches significance for a sixth . For turp, hip arthroplasty (other), and hip arthroplasty (total), the magnitude of the regression coefficients is much greater for the model using inhospital deaths, and the p - values are considerably lower; both facts indicate a stronger volume - mortality relationship for inhospital mortality than mortality within 60 days of surgery . For coronary artery bypass and resection of the intestine, this is not too surprising, given the fact that many deaths following these procedures occur in the hospital (table 8). Luft (1980) found a significant inverse association between inhospital mortality and surgical volume for all four of the procedures common to both studies: turp, cholecystectomy, coronary artery bypass, and hip arthroplasty (total). The reasons for a stronger relationship between inhospital mortality and surgical volume are not clear . Because most deaths that occur during the surgical stay happen earlier than 60 days following surgery, it is possible that the effects associated with greater volume are manifested shortly after surgery, and may not be as evident for longer postoperative periods . It is also possible that high - volume hospitals may tend to discharge ill patients sooner than low - volume hospitals, and that more of their postoperative deaths may occur following discharge from the surgical stay . This might happen if, for example, many low - volume hospitals were located in rural areas where there are relatively few opportunities to transfer patients to other hospitals or nursing homes . Our findings indicate that for the aged, increased institutional volume of surgery is associated with lower postsurgical mortality for some procedures . A significant inverse association between volume and mortality was found for resection of the intestine, turp, coronary artery bypass, and hip arthroplasty (other). No statistically significant relationship was found between volume and mortality within 60 days of surgery for cholecystectomy, inguinal hernia repair, hip arthroplasty (total), or femur fracture reduction . The inverse association between volume and mortality appears to be much stronger when inhospital deaths, rather than death within 60 days of surgery, are used as the mortality measure . Although procedure - specific volumes were used in the analysis, it is possible that some of the effects attributed to procedure - specific surgical volume may result from general surgical volume of any kind . Although every attempt was made to control for appropriate patient characteristics, the results could be attributable to differences in case mix not measured by this study . For example, flood, scott, and ewy (1984a and 1984b) and luft, bunker, and enthoven (1979) found expected mortality to be generally higher in low - volume hospitals . High mortality in low - volume hospitals could reflect the fact that their caseload may contain a higher proportion of emergency or urgent cases . Lower mortality in high - volume hospitals could reflect less stringent indications for surgery and hence better results . On the other hand patients are often referred to larger specialty hospitals and that their case mix is worse than that for less experienced community hospitals . Although we have no way of determining whether this is the case, we can say that, if true, this phenomenon would tend to mask any underlying mortality - volume relationship rather than falsely suggest it . Farber, kaiser, and wenzel (1981) found a significant inverse relationship between surgical volume and incidence of postoperative wound infection for six of seven procedures including cholecystectomy, colon resection, and herniorrhaphy . Some of our study procedures, particularly those with low mortality, may be sensitive to surgical volume in terms of morbidity outcomes or patient functioning, but not mortality . Specific causation cannot be attributed to the volume - mortality relationship found in our study . One possible interpretation is that greater surgical experience leads to improved technique, which results in lower mortality rates over time . Another interpretation is that hospitals that exhibit the best outcomes will attract more referrals and thereby increase their surgical volume . Further research is needed on the reasons for the mortality - volume relationship, particularly the importance of the operating surgeon's experience . For example, it is possible that hospitals with high surgical volume have more skilled or experienced surgeons on their medical staffs, which would account for their superior outcomes . The role of the anesthesiologist, the operating room team, and other hospital personnel needs to be investigated . High - volume hospitals may recruit more skilled staffs, or, conversely, the personnel at such hospitals may develop superior skills with increased experience . It is also possible that high - volume hospitals may have more specialized facilities and equipment (e.g., icu's, ccu's). . Some of these hospitals may be geographically isolated, and it may not be practical for them to either increase their volume or to refer certain kinds of cases to other hospitals . The results of this study indicate that hospitals with low surgical volumes should be reluctant to undertake certain procedures on a nonemergency basis . Although our study does not pinpoint the separate effects of specific surgical volume and general surgical volume, our findings support the concept of establishing guidelines that include minimum volume levels for hospitals that undertake certain kinds of surgeries . Whether minimum levels are developed for specific procedures or operations in general would depend on the nature of each procedure . Many other factors must also be taken into consideration in establishing recommended minimum levels, such as types of facilities and equipment and availability of services elsewhere . Luft, bunker, and enthoven (1979) have called for regionalization of certain procedures, based on their volume - mortality data . For example, our study found a significant volume - mortality relationship for coronary artery bypass, resection of the intestine, and hip arthroplasty (other), which are relatively complex procedures with substantial mortality rates among the elderly . It is these types of operations that would be the most likely candidates for regionalization . Before these or other specific procedures are recommended for regionalization, policymakers should do detailed analyses to insure that the volume - mortality relationship is not due to differences in patient risk factors that could not be taken into account in the present study . The findings also suggest the desirability of making information available to patients and referring physicians on the number of operations by hospital and by surgeon as a guide to the choice of hospital and surgeon . Information on the outcomes of surgery, of course, would be even more valuable . But, at this stage, we are not sure if there is enough understanding of the factors that determine outcome, especially at the physician level, to assure the correct interpretation of outcome data . Without such understanding, publicizing outcome data may create an incentive for physicians to avoid risky cases . A goal of future research should be the development of sufficient understanding of the factors determining outcome to enable dissemination of outcome data and to guide action to correct instances of less than optimal outcome . These findings also have possible applications under medicare's new prospective payment system (pps) for hospitals . There has been concern that under pps the financial incentives for hospitals to economize might adversely affect quality of care . On the other hand, pps could encourage hospitals to specialize in the procedures they do most efficiently and thereby increase the concentration of particular procedures in a smaller number of hospitals . Under pps, hcfa is collecting information on up to three procedures and five diagnoses per hospital stay on 100 percent of inpatient stays in short - stay hospitals . Surgical outcomes could be monitored on a hospital - specific or area - specific basis, using hcfa's expanded data system . If poor outcomes following certain procedures are associated with a given hospital, a low surgical volume for these procedures may, in the context of other information, explain the reason for these unfavorable outcomes . Solutions might be found, in cooperation with other area hospitals, that would guarantee a minimum number of procedures in any hospital receiving medicare reimbursement for these procedures . Lastly, more favorable outcomes were experienced by patients in the west for five out of the eight procedures studied . Because death within 60 days of surgery is the mortality measure used in this study, rather than inhospital deaths, this finding is not a function of the fact that length of stay tends to be shorter in the west . Further research is needed to determine why patients in the west fare so much better following surgery.
Twin and family studies are an important counterpart to the genomic revolution that has taken place since the sequencing of the human genome . Although molecular genetic techniques, such as genome - wide association and sequencing, have the advantage of allowing us to identify individual genetic variants that are important for population variation in traits and diseases, twin and family studies have the advantage of taking into account all dna variation throughout the genome and the population, simply by using what we know about genetic relatedness within twin pairs of different zygosity . One obvious contribution of twin and family studies to genetics in the postgenomic era has been in setting the benchmark for studies that aim to identify genetic variants that have a role in the inheritance of complex traits . The gap between the population variance accounted for by the current catalog of variants and the variance we estimate to be accounted for by genetic effects has come to be known as the search for the sources of missing heritability has spawned scientific innovation and collaboration on a global scale . The second great advantage of twin and family studies is that they give us insight into the other side of the etiology of complex traits and disorders that is completely invisible to dna microarrays and next - generation sequencing platforms: the action of the environment on variation at the population level . In the midst of the genomic revolution, it is easy to forget that even under the optimistic premise that we will eventually identify every genetic variant that influences a complex trait, we will still only know half the story of its origin, because identifying the influential environments that account for the remaining variance is just as important . This array of physical and psychosocial environmental exposures has been characterized as an exposome' that parallels the genome in its influence on complex traits . As with genetic variation, so, although we have not yet identified all the important elements of the exposome (there are missing environments' as well as missing heritability), twin studies still allow us to explore the mass influence of environmental variation on the phenotype . Similar to early forays into molecular genetics, early twin studies were often victims of small sample sizes and limited technology . However, the modern twin studies of recent decades often number in the thousands, or tens of thousands, of participants, and take advantage of advances in maximum likelihood structural equation modeling to fit sophisticated etiological models . These studies have proved robust to methodological challenges and produce results that replicate consistently to identify important aspects of the joint action of genes and environments . These analyses allow us to carve nature and nurture at the joints, suggesting targeted hypotheses for our studies of specific genetic and environmental variation . One aspect of these large, population - based epidemiological samples that has remained unexplored is how geographical location can affect the influence of nature and nurture on a phenotype . We aimed to address this question using geocoded data on 45 phenotypes collected at age 12 from 6759 twin pairs participating in the twins early development study (teds). However, making sense of the genetic and environmental etiology of childhood traits and disorders is a complex process that requires input from experts in a wide range of fields, so we sought an approach that could capitalize on this distributed expertise . Here we describe a novel twin modeling approach that incorporates spatial information, and the design of the space interactive visual analysis tool that allowed us to collaboratively explore the geocoded twin data, with contributions from geneticists, psychologists, statisticians, clinicians, geographers and teachers . The uk office for national statistics contacted parents of all twins born in england and wales between 1994 and 1996, and invited them to take part in a longitudinal investigation of genetic and environmental influences on behavior and cognition . The vast majority (over 12 000 families) agreed to take part and have been followed over the first 16 years of life . To date most have remained in england and wales, although a few have migrated to scotland or overseas . In keeping with the uk population, most (96%) identify themselves as white british with english as their first language; for this analysis, we included only these families, to avoid greater genetic heterogeneity in cities biasing our results . Ethical approval was provided by the institute of psychiatry ethics committee of king's college london . When the twins were 12 years of age, we carried out our broadest survey to date, using web - based testing, parent questionnaires and teacher reports to assess a wide range of cognitive abilities, behavioral (and other) traits, environments and academic achievement in 6759 reared - together twin pairs . All 6759 pairs of twins were assigned geographical coordinates using the uk national postcode database . As the uk postcodes are generally unique to a street or a small group of addresses, this gave us an accurate location to a sub - neighborhood scale . We used maximum likelihood structural equation modeling of the twin data in openmx to calculate genetic and environmental contributions to a range of childhood phenotypes assessed at 12 years of age (see table 1), for a series of target locations across the united kingdom . The locations were chosen to represent the local density of twin data, to provide a visual cue to the data available for the estimation of variance components in different areas . However, to preserve anonymity, they do not correspond to the locations of individual twin pairs . Every family contributed to each calculation, but with a weight assigned according to spatial proximity to the target location (figure 1). Each twin pair's contribution to the analysis was weighted by the inverse of their distance from the point of estimation: where x represents the point of estimation, xi represents the location of a twin pair, d is the euclidean distance between x and xi, and p is the power parameter (0.5 for these analyses). We applied the weights by calculating weighted covariance matrices for monozygotic and dizygotic twin pairs, and using these as an input for the structural equation twin model, iterating over the target locations . Supplementary figures 1 and 2 describe a series of simulations we carried out to test this approach using an artificial data set with known parameters . Following principles of human perception and interaction design, we developed a purpose - built visual analysis tool programmed in the processing visualization language to display and explore the output, as described in figure 2 . This revealed patterns of geographical variation in genetic and environmental contributions to the childhood phenotypes . The space visualization tool is available as supplementary software, loaded with the 45 teds phenotypes, from http://sgdp.iop.kcl.ac.uk/davis/teds/geocoding/, where there is also a video demonstrating the visualization . The software download includes an openmx script for the r statistical computing environment that demonstrates our approach to geographically sensitive twin models . Fitting further structural equation models can formally test these patterns for statistical significance . In the example to do this, we used the continuous moderator twin model that allows the contribution of genetic and environmental variance components to vary as a function of a measured environment (supplementary figure 5). Testing the significance of the moderation term allows us to establish moderation of the genetic and environmental effects by the measured environment . Simulations suggest that our sample for this analysis (the 5073 pairs of twins with matching phenotype data) gives us 80% power to detect a moderation of the e - term of the size we observed . For more discussion of the continuous moderator model,, we test for the moderation of the variance components by local variance in household income, estimated by calculating the variance in household income from our population sample, weighted by geographical distance in the same way as our twin model . The uk office for national statistics contacted parents of all twins born in england and wales between 1994 and 1996, and invited them to take part in a longitudinal investigation of genetic and environmental influences on behavior and cognition . The vast majority (over 12 000 families) agreed to take part and have been followed over the first 16 years of life . To date most have remained in england and wales, although a few have migrated to scotland or overseas . In keeping with the uk population, most (96%) identify themselves as white british with english as their first language; for this analysis, we included only these families, to avoid greater genetic heterogeneity in cities biasing our results . Ethical approval was provided by the institute of psychiatry ethics committee of king's college london . When the twins were 12 years of age, we carried out our broadest survey to date, using web - based testing, parent questionnaires and teacher reports to assess a wide range of cognitive abilities, behavioral (and other) traits, environments and academic achievement in 6759 reared - together twin pairs . All 6759 pairs of twins were assigned geographical coordinates using the uk national postcode database . As the uk postcodes are generally unique to a street or a small group of addresses, this gave us an accurate location to a sub - neighborhood scale . We used maximum likelihood structural equation modeling of the twin data in openmx to calculate genetic and environmental contributions to a range of childhood phenotypes assessed at 12 years of age (see table 1), for a series of target locations across the united kingdom . The locations were chosen to represent the local density of twin data, to provide a visual cue to the data available for the estimation of variance components in different areas . However, to preserve anonymity, they do not correspond to the locations of individual twin pairs . Every family contributed to each calculation, but with a weight assigned according to spatial proximity to the target location (figure 1). Each twin pair's contribution to the analysis was weighted by the inverse of their distance from the point of estimation: where x represents the point of estimation, xi represents the location of a twin pair, d is the euclidean distance between x and xi, and p is the power parameter (0.5 for these analyses). We applied the weights by calculating weighted covariance matrices for monozygotic and dizygotic twin pairs, and using these as an input for the structural equation twin model, iterating over the target locations . Supplementary figures 1 and 2 describe a series of simulations we carried out to test this approach using an artificial data set with known parameters . Following principles of human perception and interaction design, we developed a purpose - built visual analysis tool programmed in the processing visualization language to display and explore the output, as described in figure 2 . This revealed patterns of geographical variation in genetic and environmental contributions to the childhood phenotypes . The space visualization tool is available as supplementary software, loaded with the 45 teds phenotypes, from http://sgdp.iop.kcl.ac.uk/davis/teds/geocoding/, where there is also a video demonstrating the visualization . The software download includes an openmx script for the r statistical computing environment that demonstrates our approach to geographically sensitive twin models . Fitting further structural equation models can formally test these patterns for statistical significance . In the example below, we explore the relationship between income inequality and classroom behavior . To do this, we used the continuous moderator twin model that allows the contribution of genetic and environmental variance components to vary as a function of a measured environment (supplementary figure 5). Testing the significance of the moderation term allows us to establish moderation of the genetic and environmental effects by the measured environment . Simulations suggest that our sample for this analysis (the 5073 pairs of twins with matching phenotype data) gives us 80% power to detect a moderation of the e - term of the size we observed . For more discussion of the continuous moderator model, see hanscombe et al . In our example, we test for the moderation of the variance components by local variance in household income, estimated by calculating the variance in household income from our population sample, weighted by geographical distance in the same way as our twin model . The main outcome of this study is the collection of interactive maps that highlight genetic and environmental hotspots for a wide range of psychiatrically relevant childhood phenotypes, available for full exploration at http://sgdp.iop.kcl.ac.uk / davis / teds / geocoding/. There are many research questions that may be addressed using visual analysis of these data, and we hope that looking at one example in detail here will encourage interest in the corresponding maps for components of the autism spectrum, attention - deficit hyperactivity disorder, mood, or cognitive abilities, such as reading, mathematics or general cognitive ability, for instance . A full list of the 45 phenotypes is provided in table 1 . As an example, here we explore the relationship between income inequality, classroom behavior and educational outcomes in early adolescence . A notable pattern in our plots of the geographical distribution of genetic and environmental influences is a trend towards greater environmental influence on classroom behavior variables and academic achievement in london, compared with the rest of the uk . We hypothesized that the metropolitan area has a greater juxtaposition of extremely rich and extremely deprived neighborhoods than in any other part of the country, and that local variability in household income during childhood could be contributing to the increased environmental influence in the london area . Plotting the locally weighted variance in household income (an index of regional income inequality) side - by - side with the environmental influence on the total classroom behavior problems index, as in figure 3, fits with this hypothesis, and figure 4 shows one plotted against the other . Supplementary figures 3 and 4 explore how likely it is that the pattern of results in figure 3 occurred by chance . We observe the same pattern for teacher - rated narcissism and academic performance against national curriculum targets, indicators that have previously been associated with income inequality on both national and international scales . Of course, this correlation does not necessarily demonstrate causality, although plausible mechanisms linking these indicators have been suggested, both at the psychological level (with inequality leading to status anxiety, narcissistic self - promotion, deterioration of classroom behavior and poor academic achievement), and at the neural level . Using structural equation models, it is possible to fit environmental variables, such as local income inequality, as continuous moderators of the genetic and environmental parameters of the twin model . Fitting these models confirms a significant relationship between income inequality and the other measures (see figure 4, and supplementary figures 5 and 6). How should geographical variation in genetic and environmental effects be interpreted? In some ways, geographical variation in environmental effects seems more straightforward; finding an environmental hotspot simply suggests that environmental variation has more effect on the phenotype in that region . However, in our example, local variation in household income seemed to moderate the non - shared environmental effect rather than the shared environmental effect . Surely, local variation in household income is an environment shared by children growing up in the same family? One of the great strengths of the twin method is that it tells us at least as much about the environment as it does about genetics . An early and surprising finding from modern, well - powered twin cohorts was that the same environments are often experienced differently by children growing up in the same family . Even environments that would intuitively be classed as shared environments end up making children in the same family different . This is particularly easy to imagine with an environment such as local variation in household income; in areas with high variation, it would be easier for children from the same family to make friends with peers from quite different backgrounds . In fact, it is usually not possible to classify particular environments as either shared or non - shared, because it is likely that any one environment will have a mix of effects, some shared by members of the same family and some not . Geographical differences in genetic effects seem more difficult to interpret, because it is unlikely that there are large genetic differences between people living in different regions of the united kingdom . However, we should remember that the map shows not genetic differences, but differences in the effect that dna variation has on a phenotype; we are looking at environmental moderation of genetic effects . Regions with large genetic effects are regions where the environment allows genetic variation to express itself through the phenotype . For example, imagine living next door to a field of wind - pollenated crops; in this situation, genetic variants that increase or decrease the risk of hayfever will lead to more phenotypic variation in the population than in an area where no pollen is present (where no one suffers from hayfever, irrespective of his or her genotype). In this way, presence of a strong genetic effect could in fact represent the presence of an environment that reveals relevant genetic variation (or the absence of a masking environment). We should note that in our model, the genetic and environmental parameters are not constrained to add up to one at any one location, so it is possible for a region to be both a genetic and an environmental hotspot at the same time . Clearly, like any technique, our approach has limitations . For example, one of the main purposes of this method is to nominate environments that interact with genetic and environmental influences on traits . However, it will only be able to identify environments that are geographically distributed on a large scale . Such environments may include social environments, such as district - level health, education provision or the psychosocial stress of urban living, or physical environments, such as water or air pollution . But many environments vary on much smaller scales; noise from an airport or main road may have a discernable influence, but the effect of noisy neighbors will not be apparent on a map of this resolution . In some cases it may help to follow up the visualization with further statistical models where a specific environment is measured at a fine - grained level . In other cases, these small - scale environments may go undetected by our approach . In addition, the twin method, though useful, has idiosyncrasies . For example, not all of the variance components are estimated with equal power; the shared environment is particularly difficult to detect and the non - shared environmental term also encompasses measurement error (although this seems unlikely to vary geographically). More generally, as we saw earlier, the environmental terms are open to misinterpretation; it is sometimes remarked that the twin method does not take into account epigenetic variation . The truth is that the twin model does include epigenetic effects, but they (at least effects that are not inherited cross - generation) are included as environments, because the environment incorporates everything other than dna sequence . In fact, this has fueled fascinating speculation that epigenetic variation may mediate long - term environmental effects on phenotypes . Again, it seems that epigenetic factors are unlikely to vary geographically unless they are mediating some environmental effect, so this will probably not impact our findings . The first is that some of our measures comprise rating scales completed by class teachers . Where twins share a class, they will likely share a rater . Where they do not share a class, they will not . However, in our sample we do not find that monozygotic twins share a classroom any more often than dizygotic twins, and our data suggest no systematic regional effect on sharing . The second characteristic is that teds is currently an adolescent sample, so the twins have had relatively little freedom to seek out geographical regions correlated with their genetic propensities . This means that we are limited in our ability to explore the effects of gene environment correlation . Tracking how individuals seek out new environments will be a fascinating topic for future waves of the study . Our demonstration that the genetic and environmental contributions to complex traits vary depending on where we live has implications for several fields . For example, one plausible explanation of the missing heritability encountered by genome - wide association studies has been gene - by - environment interactions . Our findings suggest a new mechanism for the identification of relevant environments, where exposure to the environment correlates with geographical distribution . Our findings also imply that when we conduct studies to identify variants associated with complex traits, the area where the sample is recruited will influence the power of our analysis to detect the variants . To take our earlier example, because the environment accounts for more of the variance in childhood behavior problems in london, this environmental variability will have a greater effect in masking the genetic associations in a sample recruited in london than it will in the rest of the united kingdom . Researchers have invested a great deal of effort in identifying endophenotypes that are more heritable than their trait of interest to maximize their chances of finding genetic associations . Our findings suggest that a similar principle applies to geographical location; as well as considering the logistics of sample collection in recruiting participants for association studies, researchers may also benefit from considering the variability of relevant environments in their catchment area . Recruiting in areas where the trait of interest is more heritable is likely to improve power to detect the effects of individual genetic variants . In addition, new analyses of genome - wide association data have been used to estimate the proportion of heritability captured by genotyping arrays . Our approach is likely to translate directly to this type of data, reproducing our twin study results using molecular genetic information . For example, it is easy to imagine applications in which time - of - travel is used instead of euclidean distance, or even maps in which the axes represent conceptual dimensions rather than geographical ones . Recently, there has been growing interest in the potential of visualization to take advantage of the broad information bandwidth of the human visual system in integrating large amounts of scientific data and spotting patterns amongst complexity . One particularly interesting aspect of this, that we believe will gain further ground in coming years, is the trend towards integrating visualization into the analytic process, instead of approaching it as a way to effectively communicate the outcome of a completed study . Alongside this, there is increasing recognition of how principles of visual perception, human machine interaction and design can help us to construct visual analysis tools in a way that complements the idiosyncrasies of the way we perceive the world . Just as with statistical analysis, there are principles that must be followed to produce a valid result . For example, one challenge we faced in designing our interactive map was choosing a color scale . We opted for a two - color scale that diverges from the mid - range, because this highlights the extremes of the distribution of values, picking out the high and low points that were most interesting in our analysis . The colors we chose were red and blue, avoiding red and green, because around 8% of men have a genetic mutation that makes it impossible for them to distinguish the two . Even so, color scales can be prone to optical illusions, such as simultaneous color contrast, in which the color we perceive is affected by the surrounding colors . To overcome this, we anchored the color scale, displaying numeric values on mouseover while indicating the point's position in the full distribution of values in a histogram to the left . Such challenges aside, new open - source initiatives such as the r project for statistical computing (http://www.r-project.org/) and the processing visualization language (http://www.processing.org/) mean that it is now possible to construct a purpose - made custom visual analysis tool as part of the analytic process, an undertaking that previously would often have required too great an investment of time and resources to be practical . Embedding visualization into our analysis has been crucial to arrive at these insights and connections . By bringing together experts from many different disciplines in the pursuit of a common goal, it revealed patterns that merited further exploration . Beyond advancing our understanding of how nature and nurture interact on a national scale in the origins of childhood traits, we predict that collaborative visualization will play an increasingly important role in the scientific community's efforts to overcome the modern data deluge and arrive at an integrated understanding of complex systems.
Intrauterine infection by bacteria is well established as a pathway leading to spontaneous abortion and spontaneous preterm birth [1, 2]. Other pathways, however, may be equally important including decidual hemorrhage, cervical disorders, genetic components, and environmental exposures like smoking . Much less human papillomavirus (hpv), which is known as a well - established cause for cervical cancer, does though constitute a candidate . The over 180 known hpv - types are small, double - stranded dna viruses with a circular genome of nearly 8,000 base pairs . Hpv infections are common, but about 90% of all infections can be cleared within less than 2 years by unknown mechanisms [46]. Hpv-6 and hpv-11 are the most common low - risk types and are found to be causative for genital warts . The cancer associated high - risk types include hpv-16 and hpv-18 and there is growing evidence of hpv infections playing a relevant role in other anogenital and head and neck cancers [79]. Worth to mention is also the morbidity of cutaneous hpv lesions, particularly in immunosuppressed people . Pregnancy has previously proven to be a state of mild immunosuppression due to the decrease in the number of natural killer cells, possibly making pregnant women more prone to infections with, for example, hpv . Various immunological theories have been discussed to explain the possibility for pregnancy and the survival of the semiallogeneic fetus . Theories include immunological privilege in the uterus, antigenic immaturity of the fetus, and maternal immunosuppression during pregnancy . While attempting to explain the immunological basis of normal pregnancy, the argumentation may have implications for the generation of immune responses to pathogens infecting the placenta, as viruses seem to face similar confrontations like the invading trophoblast . Thus, it is not surprising that viruses take up some of the same strategies to avoid immune detection as do trophoblast cells . Also there is some evidence that elevated steroid hormone levels during pregnancy influence the increase of hpv virus replication by interacting with hormone response elements in the viral genome, thereby giving another possible explanation for the higher incidence of hpv infection during pregnancy [13, 14]. In 2014, liu et al . Conducted a systematic review on hpv prevalence in pregnant and nonpregnant women and reported an increased risk of hpv infection in pregnant women, thereby supporting the debate of how far hpv may be involved in adverse pregnancy outcomes . Various authors report an infection with hpv during pregnancy to be associated with the risk of spontaneous abortion, spontaneous preterm delivery, and placental abnormalities [1621]. Hpv dna has been detected in the cervix [13, 2123], fetal membranes, amniotic fluid, umbilical cord blood [26, 27], and the placenta [13, 18, 2729]. Hpv detection rates range however widely from 6 to 65% and the results are controversial [13, 18, 20, 22, 23, 27, 3032]. It is therefore of great interest to examine how widespread hpv infections are among pregnant women and whether or not there is an association between hpv infection and spontaneous abortion or spontaneous preterm delivery . Moreover, nowadays there exists a successful vaccination to prevent infection and disease caused by infection with hpv-6, hpv-11, hpv-16, and hpv-18 . Thus, there might be a chance to minimize the risk for pregnancy complications by applying the same or a modified version of vaccination . Our group studies the impact of placental hpv infection on spontaneous abortion and preterm delivery . In this context the aim of this study is to provide an overview of the existing literature by doing a systematic review on hpv prevalence in pregnancy . We focused on pregnancies with adverse outcome and included a discussion of possible factors influencing or explaining the reported differences in hpv detection rates . A systematic literature search was conducted in the pubmed and embase databases and search terms were used as follows: (1) human papillomavirus and pregnancy; (2) human papillomavirus and preterm delivery; (3) human papillomavirus and preterm birth; (4) human papillomavirus and abortion . The search was restricted to articles in english, on humans and published between january 1995 and october 2014 . The search was carried out on october 28, 2014 . In order to identify relevant articles for whole - paper revision, duplicates were removed and titles and abstracts were screened based on the following exclusion criteria: studies investigating cell lines only, hpv vaccines, or sperm - related aspects, as well as guideline articles, general articles describing public health, and literature reviews . The inclusion criteria were set to the following: studies on asymptomatic healthy pregnant women and women experiencing a spontaneous preterm delivery or spontaneous abortion; investigation of hpv infection within cervix, placenta, amniotic fluid, or umbilical cord blood; hpv detection test directly linkable to index pregnancy . Studies restricted to nonpregnant women or hpv positive women only, case reports, follow - up and association studies, and in vitro fertilization studies were excluded . Studies including women with history of hpv - related lesions were not excluded, as this will be the case in any normal study population . There was no restriction for studies of different geographical origins, the time point of sample collection, methods of sample collection, and hpv testing method . Data, which includes information about the investigated tissue types, country where the study was performed, sample size, sampling time point, hpv prevalence, and hpv detection method, was extracted and analyzed using matlab (version r2011b). Data from all studies was pooled and women were grouped according to their pregnancy outcome or the pregnancy status at time point of sample collection . An overall hpv prevalence was calculated including 95% confidence interval (ci) in normal pregnancies and in pregnancies with adverse outcome . This was done for various tissue types, geographical origins, time points of sample collection, and hpv detection methods used . Statistical significance between two proportions was tested using two - sample test of proportions . The initial pubmed database search resulted in the identification of a total of 650 articles (figure 1). After removal of duplicates and screening of titles and abstracts, the remaining 57 articles were subjected to whole - paper revision (figure 1). Of these, 42 articles met the final inclusion criteria and were used for data extraction and quantitative analyses (figure 1). The supplementary search in embase database was conducted in the same way and three additional articles were included for data extraction and quantitative analysis . The 45 articles included investigated 14 470 pregnant women in total, of which 13 757 underwent normal full - term pregnancies, 145 experienced spontaneous preterm deliveries, 536 experienced spontaneous abortions, and 32 had performed an induced abortion . The study populations were from europe (n = 4639) [13, 22, 27, 28, 32, 38, 40, 42, 43, 45, 47, 51, 5860, 6264, 66, 67], asia (n = 7116) [23, 34, 35, 37, 39, 41, 46, 52, 55, 57, 61], usa (n = 1681) [18, 20, 21, 29, 48, 53, 56, 65, 68], and latin america (n = 1034) [36, 44, 49, 50, 54]. Table 1 shows demographic characteristics, key aspects of study design, and study strength and potential biases of all included studies . Hpv prevalence in healthy pregnant women giving birth at term was investigated in 38 of the 45 included studies and provided data on 13 757 pregnant women . Hpv prevalence appears to be highly dependent on the tissue type tested (figure 2). In all studies included, hpv prevalence varied between 2.2% and 75% in cervical tissue, with a summary estimate of 17.5% (95% ci; 17.317.7). In placental tissue and abortion products, 8.3% (95% ci; 7.69.1) of the analyzed pregnancies were found to be hpv positive and varied between 0% and 47.2% . Hpv prevalence in amniotic fluid varied between 0% and 25%, with a summary estimate of 5.7% (95% ci; 5.16.3). Finally, umbilical cord blood was calculated to be hpv positive in 10.9% (95% ci; 10.111.7) of all cases and varied between 0% and 57.9% . The difference between all proportions was significant (p <0.05, p <0.001, and p <0.0001, resp . ). Hpv prevalence in pregnancies with adverse outcome, including spontaneous abortion and spontaneous preterm delivery, was investigated in 10 of the 45 included studies and provided data on 681 pregnancies . Three studies were investigating cervical hpv infection and seven studies looking at hpv prevalence in placental tissue . Only one study analyzed hpv prevalence in cervical tissue of spontaneous abortions and found 24.5% of all cervical samples to be hpv positive (table 2). Placental hpv prevalence in spontaneous abortions varied between 0% and 70.4%, with a summary estimate of 24.9% (95% ci; 22.427.5) (table 2). Hpv prevalence in spontaneous preterm deliveries was found to be 47% (95% ci; 42.351.6) in cervix, with a variation between 15.6% and 67.1% (table 2). Placental tissue of spontaneous preterm deliveries was only investigated in one study where a hpv prevalence of 50% was observed (table 2). The overall hpv prevalence in cervical tissue of normal pregnancies was found to be 17.5% (95% ci; 17.317.7) (figure 2). This is significantly lower than in spontaneous preterm deliveries (47%, p <0.0001) and spontaneous abortions (24.5%, p <0.05) (figure 3). Normal pregnancies are found to be hpv positive in 8.3% (95% ci; 7.69.1) of all cases (figure 2), whereas placental tissues of spontaneous preterm deliveries and spontaneous abortions are found to be positive in 50% (p <0.0001) and 24.9% (p <0.0001) of cases, respectively (figure 3). Information on geographical distribution of the investigated studies was collected to see if ethnicity might be a contributing factor to the great variation in hpv prevalence observed . The goal of the investigation was to determine whether women from different countries may be differentially exposed to hpv and some may thereby have a higher risk for possible hpv - induced pregnancy deficiencies . Figure 4 shows the geographical distribution of hpv prevalence in cervical specimens from women with normal full - term pregnancies . Here it is clear that pregnant women from usa and latin america have a significantly higher (p <0.0001) hpv prevalence compared to european and asian women (figure 4). Latin america is represented by mexico and brazil and the summary estimate for hpv prevalence was 35.5% (95% ci; 34.636.5). The analysis of the population from usa found a hpv prevalence of 29.6% (95% ci; 29.529.7). Here the cervical hpv prevalence in asia varied between 10.1% and 36.2%, with a summary estimate of 16.4% (95% ci; 16.316.6). The european population is represented by spain, france, italy, germany, belgium, netherlands, finland, switzerland, austria, hungary, greece, croatia, turkey, poland, and lithuania and the hpv prevalence varied between 2.2% and 36.6%, with a summary estimate of 11% (95% ci; 10.711.3). The difference between all proportions was highly significant (p <0.01 and p <0.0001, resp . ), meaning that hpv prevalence in pregnant women is dependent on geographical or ethnical parameters, with pregnant women from usa and latin america having the highest hpv prevalence reported . The same tendency can be observed in placenta, amniotic fluid, and umbilical cord blood, but numbers were insufficient for proper analyses . Variation of hpv prevalence between studies conducted on different continents can also be observed in studies investigating pregnancies with adverse outcome (table 2), but a proper analysis is difficult due to the small number of studies . However, it can be stated that studies from usa consistently report a significantly higher hpv prevalence in spontaneous abortions and spontaneous preterm deliveries compared to normal pregnancies, in both cervical and placental tissue [18, 20, 21, 29]. European studies vary a lot in their hpv prevalence found in placenta, which makes it difficult to estimate the risk of a hpv infection for european pregnant women . There are no studies conducted on cervical specimens of spontaneous abortions or spontaneous preterm deliveries in europe . Asian and latin american studies are also limited [35, 36] and a conclusion of the risk of hpv infection for pregnant women is not possible . It can though be speculated whether the relatively high hpv prevalence found in the latin american population of normal pregnancies (figure 4) may influence the pregnancy outcome in those countries . Data on the time point of sample collection and the hpv detection methods used were collected . Figure 5(a) shows cervical hpv prevalence in relation to the time point of sample collection . Samples from the first trimester of pregnancy were found to be hpv positive in 23.9% (95% ci; 23.424.4) of all cases and showed a variation between 1.1% and 41.2% . Samples taken at birth were tested positive in 21.7% (95% ci; 21.322.2) of all cases . Here the second and third trimester as well as postpartum samples showed a hpv prevalence of 16.7% (95% ci; 16.517.0), 15.2% (95% ci; 14.915.6), and 17.3% (95% ci; 16.717.9). Hpv prevalence varied between 2.2% and 40%, 5.2% and 75%, and 6.2% and 27% . The difference between proportions was significant (p <0.05, p <0.01, p <0.001, and p <0.0001 resp . ). Not significant was the difference between the proportions for the first trimester and at birth samples (p = 0.12), the second trimester and the third trimester, respectively, and the postpartum period (p = 0.07 and p = 0.39), and the third trimester and the postpartum period (p = 0.14). Also the hpv detection methods used may influence the found hpv prevalence . Figure 5(b) shows the analysis of hpv prevalence according to the hpv detection method used . Hybrid capture assay identified hpv in 26.4% (95% ci; 25.627.2) of all analyzed samples . The summary estimate for hpv prevalence by pcr was calculated to be 15.5% (95% ci; 15.315.8) and varied between studies from 0% to 100% . Hpv prevalence identified by dna chip varied between 0% and 24.3%, with a summary estimate of 15.1% (95% ci; 15.015.3). Southern blotting was only used in two studies and a hpv prevalence of 19.9% (95% ci; 18.721.0) has been found . The difference between all but one of the proportions was significant (p <0.05, p <0.01, and p <0.0001, resp . ). Not significant was the difference between proportions for pcr and dna chip (p = 0.25). The hpv detection method used most widely was pcr with n = 9674 followed by dna chip with n = 5461 . In this quantitative analysis on the prevalence of hpv infection in normal pregnancies and pregnancies with adverse outcome, 45 studies were included and data on 14 470 pregnant women were analyzed and summarized . Hpv prevalence in normal pregnancies was found to vary between tissue types and study populations of different geographical locations . The highest hpv prevalence could be reported in cervix (17.5%; 95% ci; 17.317.7) and in the population from latin america (35.5% (95% ci; 34.636.5)) and usa (29.6% (95% ci; 29.529.7)). In comparison to hpv prevalence found in normal pregnancies, spontaneous abortions and spontaneous preterm deliveries were found to have higher hpv positive detection rates (p <0.05 and p <0.0001), in both placenta (spontaneous abortions: 24.9%, and preterm deliveries: 50% versus 8.3%, resp .) And cervix (spontaneous abortions: 24.5%, and preterm deliveries: 47% versus 17.5%, resp . ). Beyond the geographical location, the time point of sample collection in pregnancy as well as the hpv detection methods used may influence the results on hpv prevalence . First, heterogeneity between studies is a problem . Due to the limited number of studies conducted within the field of hpv infections and adverse pregnancy outcomes, this results in a higher number of pregnancies to analyze but possibly more heterogeneous study groups and thereby inflict restricted options to compare directly between studies . The possibility of forming totally homogenous study groups is limited by the study quality and information given, and data on patient - level is missing in most, if not all, of the included studies, which makes controlling for all potential biases difficult . Potential biases may include some of the following: unclear inclusion and exclusion criteria for participating women, missing information on ethnicity / method of sample collection / time point of sample collection / mode of delivery, study on highly selected group of women (cesarean sections, amniocentesis, and cvs) or group from low socioeconomically regions, and so forth . The interconnection between hpv infection and pregnancy outcome is complex and will therefore most probably not be explainable by a single parameter analyzed in the present work . The analyses done can however point towards a possible explanation by pregnancy outcome, geographical location, or hpv detection method . Second, studies vary in their inclusion of women with histories of hpv - related diseases . Approximately one - third excludes women with hpv - related lesions, whereas one - third does not exclude but report it and in the last third of studies this information is missing . Genital warts and cervical lesions are known to be hpv - related and a higher percentage of hpv infection would be expected . Third, studies of adverse pregnancies were few . The actual hpv prevalence may therefore be higher or lower than the ones reported in this paper . On the other hand, the present quantitative analysis includes over 14 000 pregnancies and covers many different factors possibly influencing hpv prevalence, thereby providing a broad overview . Fourth, only studies published in english were included, which might limit the results . However, english is the primary common scientific language and the selection criterion publications in english is therefore considered to be acceptable . Hpv prevalence in pregnant women has been reported to be higher compared to nonpregnant women [54, 68, 69]. Our analysis of normal pregnancies, including 38 studies from 19 different countries on four continents, yields an overall hpv prevalence in the cervix for pregnant women of 17.5% (95% ci: 17.317.7). A worldwide meta - analysis by de sanjos et al . From 2007 reported a prevalence of cervical hpv infections in nonpregnant women with normal cytology of 10.4% . The difference between the proportions is noticeable and it can therefore be speculated if a higher hpv prevalence in pregnant women can lead to various pregnancy complications . Pregnancy has previously been described as a state of immune suppression, facilitating the survival of the semiallogeneic fetus . The inhibition of the host immune response may simultaneously increase the susceptibility to hpv and make it more difficult to clear hpv infections [54, 69, 7174]. Higher incidences of hpv infection during pregnancy may though possibly be explained by the presence of hormone response elements in the hpv gene that could be triggered through high steroid levels [13, 14]. An infection with hpv during pregnancy has been associated with risk for spontaneous abortion and spontaneous preterm delivery as well as placental abnormalities [1621]. Our analysis of 10 studies investigating hpv infection in pregnancies with adverse outcome found hpv prevalence in cervix and placenta to be higher than in normal full - term pregnancies, supporting the hypothesis of hpv infection being a risk for pregnancy outcome . Typically the placenta is a relatively effective barrier guarding against many microbes [75, 76] and the fetus in utero is therefore well protected . Nevertheless, multiple studies indicate that viral infection can impair trophoblast function, potentially contributing to pregnancy loss or abnormal implantation [76, 77]. Furthermore, upper genital tract infection was found to be an important cause of preterm birth . As previously mentioned, the wide range of hpv prevalence found is related to several factors including study design, geographic and demographic characteristics, choice of detection method, and risk factor profiles, such as maternal age, gestational age, and history of cesarean section [31, 35, 70, 79]. The present work underlines the importance to consider geographical and demographic variances . The hpv prevalence around the world was found to differ significantly (1135.5%) with latin america having the highest cervical hpv prevalence in pregnant women . This is well in line with the previous literature where latin america and africa are reported as the geographical areas with the highest cervix cancer rate in the world . North american studies do in general report a relatively high hpv prevalence [20, 48, 56, 65, 68] and our analysis found a hpv prevalence of 29.6% (95% ci; 29.529.7) for usa . This may be a bit puzzling since the population in north america due to historical reasons is expected to resemble the population in europe . It can therefore be speculated that studies conducted in north america include a distinct number of the latin american and african american population as has been stated by gomez et al . In 2008 . Unfortunately information of ethnicity of participating women is not available for many of the included studies, providing a potential bias to the results presented on geographical origin . The time point of sample collection during pregnancy is thought to have an influence on hpv prevalence as differences in hpv prevalence regarding the trimester tested have been published [8083]. Our analysis involved over 13 000 samples and summarized many of the studies investigating the topic . Hereby the first trimester was found to have the highest overall hpv prevalence, closely followed by the samples taken at birth . Analyzed samples collected in the second and third trimester as well as in the postpartum period showed lower hpv prevalence . This is contradictory to studies reporting highest hpv prevalence during the second and third [54, 65, 68] trimester . On the other hand, multiple hpv infections were observed in the first trimester by yamasaki et al . In 2011 and high - risk hpv - types were found to be selectively increased in the first trimester as well [46, 68]. It is however important to keep in mind that all those time points in reality are time intervals, thereby making a comparison very difficult . To reduce potential bias due to uncertainty about the time point of sample collection, we have chosen to include only studies providing information on the time point of sample collection . Finally, we compared hpv prevalence with respect to choice of hpv detection methods, since studies have shown that hpv dna detectable and the hpv - genotypes identified largely depend on this . Our analysis of hpv prevalence in regard to the applied detection methods revealed hybrid capture assay as the method detecting most hpv positive cases (figure 5(b)). Pcr is thought to be the most sensitive method, detecting less than 10 copies of hpv dna [46, 84, 85]. In our analysis the hpv prevalence detected by pcr was found to be 15.5% (95% ci; 15.315.8). Currently an increasing number of studies use broad spectrum primers [26, 31, 56] instead of type - specific primers . These are designed to detect various hpv - types at the same time, hereby giving a broader picture of the hpv - types present . The downside of high sensitivities allowed by pcr is the risk of false - positives due to contamination . It is therefore crucial to evaluate tissue samples on different molecular levels, confirming the detected virus to be correctly localized and active, thus being able to explain the causality of adverse pregnancy outcome or diseases in general . Functional studies investigating hpv infection in relation to pregnancy are limited . Following the detection of hpv in placental tissue [17, 18, 62] most research is focused on the study of hpv infections in trophoblast cell lines . Being one of the most critical tissues of the placenta, the trophoblast layer plays an important role in contacting maternal tissues and serves multiple roles during gestation . Several lines of evidence point towards the trophoblasts as being the target cells of placental hpv infection . First, it was shown that hpv is able to undergo a complete life cycle in trophoblast cell lines [86, 87]. Second, trophoblast morphology and behavior during hpv infection have been investigated, reporting a higher rate of apoptosis and lower invasion capabilities, agreeing with possible placental dysfunction and adverse pregnancy outcome . Third, studies analyzing trophoblast cells transfected with the hpv genes e5, e6, and e7 report effects on trophoblastic adhesion and increased migratory and invasive properties and may eventually explain potential abnormal implantation due to inappropriate trophoblast spreading . However, a convincing role for hpv infection in connection with spontaneous abortion and spontaneous preterm delivery, at the molecular level, has still to be demonstrated . Based on the present quantitative analyses it can be concluded that hpv prevalence is higher in pregnancies with adverse outcome, such as spontaneous abortion or spontaneous preterm delivery, compared to women experiencing a normal full - term pregnancy . Hpv prevalence has been shown to be dependent on the tissue type tested and the geographical location of the study population analyzed . However, the number of studies investigating hpv infection on material from spontaneous abortions and spontaneous preterm deliveries is very limited and study groups are heterogeneous which makes a reliable conclusion difficult . It can be stated that study design is important, the selection of proper controls is essential, and, for a valuable comparison between studies, similarity in samples / patients needs to be controlled as strictly as possible . Furthermore, one should keep in mind that the simple detection of a virus never is equal to a real causative role in the adverse outcome of a pregnancy or diseases in general . It is therefore inevitable to study the viral activity and cellular localization to be able to conclude on the impact for a given situation . Therefore we recommend including an investigation of the molecular mechanism of hpv infections in material of pregnancies with adverse outcome and inviting researchers to conduct new studies to clarify hpv's impact on spontaneous abortion and spontaneous preterm delivery . As a consequence of the aforementioned limitations our study group has initiated a prospective study addressing the complexity of hpv in pregnancy.
Twenty - eight post mortem lower eyelids (14 right, 14 left) from 16 japanese cadavers were examined and divided into 2 groups . One group of 14 lower eyelids of 7 cadavers (7 right, 7 left; 3 males, 4 females) with an average age at death of 80.4 years (range: 73~97), were sagittally incised from the lower lacrimal punctum (figure 1). The other 14 lower eyelids of 9 cadavers (7 right, 7 left; 4 males, 5 females) with an average age at death of 76.3 years (range: 69~95) were incised from the lower lacrimal punctum with 5 degrees lateral inclination to the sagittal plane (figure 1). All cadavers were registered in the cadaveric service of aichi medical university, with proper consent from our institutional review board and approval to use them for educational purposes and studies . All methods for securing human tissue were humane and complied with the tenets of the declaration of helsinki . In the first group, which underwent a strict sagittal incision, 10 canaliculi of 7 cadavers (6 right, 4 left; male 5 eyelids, female 5 eyelids) were interrupted at the halfway point of the vertical portion and so the distal part of the canaliculi were not included (figures 2a, b). However, 4 canaliculi of 4 cadavers (1 right, 3 left; male 1 eyelids, female 3 eyelids) did include the whole length of the vertical portion . In the second group with 5 degrees laterally inclined incision, all specimens included the whole length of the vertical portion (figures 3a, b). Most vertical portions of the lower lacrimal canaliculus examined here demonstrated a laterally inclined course of approximately 5 degrees (figure 4). The course of the laterally directed vertical portion of the lacrimal canaliculus should be considered not only in lacrimal probing, syringing, and trephining but also in eyelid surgeries . The 5 degrees lateral inclination of the vertical portion significantly emphasizes the need of a laterally directed insertion and lateral lid traction during the passage of a lacrimal probe, syringing needle or trephine to accord with the true course of the vertical portion . As well, since the vertical portion takes its lateral course within 1 mm laterally from the lacrimal punctum (whitnall 1979; hwang et al 2005), surgeons, during eyelid surgery, need to recognize the area within 1 mm laterally from the punctum as being a zone with a potential for serious lacrimal canalicular injury . The vertical portion changes its direction medially because of the inward eyelid movement (kakizaki et al 2005) caused by the contraction of horner s muscle . At this time, the closure of the vertical portion may become insufficient, because the relative angle of the muscle of riolan and the vertical portion of the lacrimal canaliculus becomes milder . To maintain the relative perpendicular angle to each other, although all the cadavers were in an eye - closed state, and the muscle tonus of the orbicularis oculi had been completely lost, this state would have been similar to the eye - opening state in live humans whose muscle tonus of the orbicularis oculi is little . As the lacrimal probing syringing and trephining is usually performed in eye - opening state, the present result is reasonable for the true clinical situations . First, as the study samples were all taken from elderly cadavers, we may not be able to apply the results to younger generations . Confirming our results in a younger patient population through clinical procedures such as lacrimal probing is possible . Our experience is that the lateral inclination of a probe usually enables easy lacrimal probing, even in young generations . Second, as we did not examine samples of caucasians or blacks, we cannot conclude that they have the same inclination . However, to date, racial variations have not been reported with regard to the lacrimal drainage system; therefore, we may be able to speculate that they have the same inclination . In conclusion, most vertical portions of the lower lacrimal canaliculus are directed laterally at approximately 5 degrees . Surgeons need to recognize the true course so as not to cause injury to the vertical portion of the lower lacrimal canaliculus . This anatomical view will be helpful for a better understanding of the lacrimal drainage system.
Diabetes is a metabolic disease clinically expressed by chronic hyperglycemia that has been extensively reported to be linked to several micro- and macrovascular diseases that significantly impair the quality of life . Among diabetic vascular complications, foot ulcers represent the first cause of hospitalization in diabetic patients and a significant cause of health care costs . Despite promising therapeutic strategies, morbidity and mortality in diabetic patients with peripheral artery disease clinical studies have indicated that diabetic patients have impaired endothelial function and are prone to suffer from severe organ damage due to poor collateral vessel formation in response to tissue ischemia . Accumulating evidence suggests that circulating endothelial progenitor cells (epcs) are mainly derived from the monocyte / macrophage lineage, and are capable of forming new blood vessels in ischemic tissues through a process of vasculogenesis [3, 4]. It has been reported that in patients with diabetes the numbers and function of circulating epcs are decreased, although the mechanisms underlying this decrease are poorly understood [5, 6]. Clinical and experimental studies have indicated that micro- or macrovascular complications associated with diabetes may be due to the reduced count and impaired functionality of circulating epcs [5, 6]. Coenzyme q (coq10), also known as ubiquinone, acts as an electron transport carrier from complex i or complex ii to complex iii within the inner mitochondrial membrane and exerts an important role in maintaining bioenergy homeostasis in mitochondria [7, 8]. Additionally, coq10 is also an antioxidant which neutralizes free radicals and inhibits cellular apoptosis . There is a considerable amount of data suggesting that supplementation of coq10 has beneficial effects on cardiovascular disease, metabolic syndrome, and diabetes by improvement of mitochondrial membrane potential and counteracts oxidative stress in myocytes [9, 10]. Recent reports have also shown that coq10 augments endothelial function of type 2 diabetic patients and ischemic heart disease [11, 12]. However, whether treatment with coq10 improves dysfunctional epc and prevents apoptosis in high glucose conditions remains unclear . In this study, we aim to investigate whether administration of coq10 could attenuate high glucose - induced apoptosis of epcs and whether nitric oxide (no) could be involved in the corresponding signaling pathway in this process . Our findings provide novel evidence that coq10 could be a potential therapeutic strategy to diminish ischemia - induced tissue damage by enhancement of epc function in diabetic patients . Total mononuclear cells (mncs) were isolated by density gradient centrifugation with histopaque-1077 (1.077 g / ml, sigma) from peripheral blood of healthy young volunteers . Briefly, 5 10 mncs were seeded in egm-2mv medium (cambrex, east rutherford, nj, usa), with supplements (hydrocortisone, human epidermal growth factor, r - insulin - like growth factor 1, human fibroblast growth factor, vascular endothelial growth factor (vegf), gentamicin, amphotericin b, vitamin c, and 20% fetal bovine serum) on 0.1% fibronectin - coated plate . The medium was changed after every four days of culture, and epcs appeared within 715 days after the start of the mnc culture . Additionally, we identified the epcs by the antibodies cd34, cd133, kdr, cd31 (santa cruz), and vwf (neomarkers) using immunofluorescence . Coenzyme q10 was purchased from sigma, dissolved in 0.04% lutrol f127, and then diluted in culture medium . After cells were cultured with different glucose conditions for 4 days or coq10 for 1 day, epcs were treated with mtt (0.5 mg / ml, sigma). The migratory function of the epcs was evaluated by a modified boyden chamber (transwell, costar). Briefly, 4 10 epcs were placed in the upper chambers of transwell plates with serum - free endothelial growth medium . In the lower chambers, stromal cell - derived factor 1 (sdf-1) (50 ng / ml) after incubation for 24 hours, the membrane of chamber was washed by pbs twice and stained using lectin - fitc (uea-1 lectin, sigma). Then the upper membrane side was scraped with a cotton ball and fixed with 2% paraformaldehyde . The migrated cells in lower membrane side were counted by 6 random high - power (100) microscopic fields by fluorescence microscopy . Epcs aging was evaluated with a senescence cell staining kit (sigma, usa). Then the cells were incubated at 37c without co2 in fresh x - gal staining solution (1 mg / ml x - gal, 5 mm potassium ferricyanide, and 2 mm mgcl2; ph6). The level of senescence of epcs was evaluated by calculating relative percentages of green - stained and total cells . Apoptosis was detected by a change in jc-1-labeled fluorescence from red to green with flow cytometer and analyzed with cell quest alias software, as described in the literature . Mitochondrial function was determined by measurement of mitochondrial membrane potential via rhodamine 123 (rh123), as described in . After treatment with high glucose or coq10, the cells were stained with rh123 (5 mm, sigma) and incubated at 37c for 30 min . The intensity of fluorescence (relative fluorescence units) was measured at excitation wavelength 485-nm and emission wavelength 530-nm by a fluorescence microplate reader . No production was determined by staining with 3-amino,4-aminomethyl-2,7-difluorofluorescein (daf - fm) diacetate (10 m, molecular probes) for 30 min . The intensity of fluorescence (relative fluorescence units) was evaluated at excitation wavelength 495-nm and emission wavelength 515-nm by a fluorescence microplate reader . Ros was determined by h2o2 detection using 2,7-dichlorodihydrofluorescein diacetate (dcfh - da 20 m, molecular probes) as a probe . The intensity of fluorescence was evaluated at excitation wavelength 485-nm and emission wavelength 530-nm by a fluorescence microplate reader . Epcs were lysed in protein lysis buffer (62.5 mm tris - hcl, 2% sds, 10% glycerol, 1 mm pmsf, and 1 g / ml aprotinin, pepstatin, and leupeptin). Membranes were probed with antibodies against -actin, enos, phosphorylated enos (millipore, billerica, ma, usa), akt, phosphorylated akt (cell signaling, denvers, ma), ampk, phosphorylated ampk (sigma, st . Louis, mo, usa), activated - caspase 3, bcl-2, and ho-1 (cell signaling, danvers, ma). This animal study conforms to the guide for the care and use of laboratory animals published by the us national institutes of health (nih publication 1996) and all experimental procedures involving the animals received the approval of the institutional animal care committee of national yang - ming university (taipei, taiwan). Experimental mice received unilateral hindlimb surgery to induce ischemia, which involved excision of the right femoral artery as previously described . The blood perfusion of hindlimb was measured by a laser doppler perfusion imaging system (moor instruments limited, devon, uk). At 24 hours after surgery, epcs, high glucose - cultured epcs, and high glucose combined with coq10-cultured epcs were labeled with pkh26 (2 nm, sigma) for 5 min . The pkh26-labeled cells (1 10) were injected into the ischemia limbs of operated nude mice . Statistical analyses were executed using spss software (version 14; spss, chicago, il, usa). Unpaired student's t - test or analysis of variance was used to evaluate comparisons between groups . As shown in figure 1, mncs were cultured on a fibronectin - coated dish on the fourteenth day (a). Most cells expressed dii - acldl uptake simultaneously (b) and fluorescein isothiocyanate uea-1 (lectin, green (c)) binding . Then epcs were characterized by immunofluorescence detection of cd133 (d), kdr (e), cd31 (f), cd34 (g), ve - cadherin (h), and vwf (i). To clarify the effects of coq10 on high glucose - induced viability and migratory function, mtt and modified boyden chamber assays epcs were cultured for 4 days in high glucose medium (25 mm) with and without the indicated concentrations of coq10 (520 m). High glucose environment decreased cell viability and attenuated epc migration by 25% and 30%, respectively . However, treatment with coq10 significantly improved epc viability and migration in high glucose conditions (figures 2(a) and 2(b)). We further examined whether coq10 improves epc senescence under high glucose condition . Compared with the control group, epcs incubated with high glucose showed a significant increase in senescence (-galactosidase - positive cells) by 28% . As shown in figure 2(c), administration of coq10 for 24 hours attenuated high glucose - induced senescence by 30% . Rhodamine 123 (rh123) emits green fluorescence and localizes in mitochondria and was used to determine mitochondrial membrane potential by accumulation of green fluorescence . As shown in figure 2(d), high glucose reduced mitochondrial membrane potential of epcs by 20%; however, treatment with coq10 significantly reversed this mitochondrial effect . During cellular apoptosis, disruption of the mitochondrial membrane potential (m) is one of the earliest intracellular events . To elucidate mitochondrial apoptosis of epcs, jc-1 assay was used to analyze cellular apoptosis by the change in jc-1-derived fluorescence from red to green . Therefore, decline of mitochondrial membrane potential during apoptosis was represented by a decrease in red fluorescence intensity . The data shows that mitochondrial membrane potential (m) of high glucose - cultured epcs fell by 22% and administration of coq10 reversed the mitochondrial membrane potential by 25% . Therefore, coq10 recovered mitochondrial apoptosis in high glucose - stimulated epcs (figure 3(a)). To further assess the effect of coq10 on antiapoptosis capacity in epcs the results showed that high glucose increased activated - caspase 3 and decreased bcl-2 expressions; however, treatment with coq10 (10 m and 20 m) significantly inhibited activated - caspase 3 and increased bcl-2 expressions in high glucose - cultured epcs (figure 3(b)). To identify the possible mechanistic pathway of coq10 to recover epc functions suppressed by high glucose, phosphorylated - ampk expression was investigated in cultured epcs exposed to high glucose . As shown in figure 4(a), phosphorylated - ampk expression was not enhanced in response to high glucose stimulation, but treatment with coq10 (10 m) significantly upregulated phosphorylated - ampk expression . The data shows that high glucose reduced no production of epcs by 28% and treatment with coq10 reversed no production by 30% (figure 4(b)). On the other hand, ros production was promoted by high glucose medium (increased 28%), and high glucose promoted - ros production was significantly attenuated by treatment with coq10 (figure 4(c)). Moreover, administration of coq10 upregulated phosphorylation of akt, enos and increased ho-1 expressions of epcs in high glucose conditions (figures 4(d)4(f)). Of note, these effects were significantly nullified by administration of ampk inhibitor . Furthermore, the administration of a no inhibitor (l - name) reduced the activation of coq10-promoted ho-1 in the high glucose environment . These results suggested coq10 could activate enos, akt, and ho-1 expressions through the ampk pathway in high glucose - induced epcs . To confirm that ho-1, no, and ampk pathways are involved in the effects of coq10 on cell functions suppressed by high glucose, epcs were pretreated with compound c (ampk inhibitor, 10 m), l - name (no inhibitor, 100 m), and snpp ix (ho-1 inhibitor, 5 m) for 1 hour before coq10 treatment . As shown in figure 5(a), treatment of epcs with compound c, l - name, and snpp ix reduced coq10-improved migratory capacity by 25%, 33%, and 23%, respectively . In addition, administration of compound c, l - name, and snpp ix significantly reversed coq10-improved mitochondrial apoptosis, mitochondrial membrane potential, and ros production (figures 5(b)5(d)). Western blot analysis revealed that high glucose increased activated - caspase 3 expression, and treatment with coq10 suppressed this effect . Additionally, coq10-induced activated - caspase 3 protein was significantly downregulated by ampk and no inhibitors (34% and 32%, resp .) After coq10 treatment in high glucose conditions (figure 5(e)). Moreover, the antiapoptotic protein bcl-2 was downregulated by high glucose stimulation but recovered by coq10 treatment . However, this upregulation was reduced by ampk and no inhibitors by 40% and 45%, respectively . In addition, administration of ho-1 sirna (10 nm) enhanced coq10 suppressed activated - caspase 3 protein in high glucose medium (figure 5(f)). These data indicate that coq10 improved epc function and attenuated cellular apoptosis through ampk, no, and ho-1 pathways . To further elucidate whether coq10 improves epcs' angiogenic function, epcs, high glucose - treated epcs, and high glucose - treated epcs incubated with coq10 were separately transplanted into ischemic hindlimbs in nude mice . Epcs were labeled with pkh26 fluorescence after being cultured with high glucose or high glucose treated with coq1k0 (10 m). Blood flow of normal saline mice kept constant throughout the study, by about 50% of that measured in the nonischemic limb (3 weeks after operation). By contrast, mice transplanted with epc were cultured with high glucose and coq10 medium and had a better blood flow recovery than only high glucose cultured epc (figure 6). These data suggest that blood flow in ischemic hindlimbs could be improved by transplantation with healthy epcs and coq10-treated epcs cultured under high glucose conditions . The defects in epc functions and behavior may underlie some of the vascular complications associated with diabetes, such as endothelial dysfunction, that predispose a diabetic patient to diffuse atherosclerosis and impaired neovascularization after ischemic events [6, 16, 17]. Consequently, the idea of using epcs as a therapeutic agent has grown in popularity . To the best of our knowledge, this is the first study to show the benefit of coq10 on high glucose - suppressed epc functions . Administration of coq10 improved epc functions, decreased ros, increased no production, and attenuated cellular apoptosis, with the mechanism of these effects being shown to involve ampk, enos, and ho-1 pathways . Transplantation of coq10-treated epcs under high glucose conditions into ischemic hindlimbs improved blood flow recovery more than in those that received only high glucose - incubated epcs . Our findings provide novel evidence that coq10 could be a potential therapeutic agent to diminish high glucose - attenuated epc angiogenic functions in diabetic patients . Diabetes mellitus has reached epidemic proportions worldwide and is associated with a large economic burden and markedly increased risk of cardiovascular diseases . A large body of evidence suggests a causal link between diabetic hyperglycemia and the development of vascular complications . However, the mechanisms that underlie diabetic hyperglycemia - induced vascular complications remain to be determined . Circulating epcs are derived mainly from the monocyte / macrophage lineage, and are capable of forming new blood vessels through a process of vasculogenesis [3, 4]. Clinical studies have reported that epcs are markedly decreased in diabetic patients, and epcs from diabetic patients show reduced capacity to induce angiogenesis in vitro . The impairment of epc functions and behavior may promote some of the vascular complications associated with diabetes that predispose diabetic patients to diffuse atherosclerosis and attenuated neovascularization after ischemic events . It is well known that a causal link between diabetic hyperglycemia and the development of macrovascular and microvascular complications . Macrovascular complications include coronary artery disease, atherosclerosis and peripheral vascular disease, and microvascular complications include retinopathy, nephropathy and neuropathy . Recent evidence suggests that no has a crucial role in maintaining epc and endothelial cells function . Long - term exposure to high glucose conditions might enhance epcs senescence and decrease cell numbers and functional competencies of epcs via no - related mechanisms . Moreover, high glucose induces cytochrome - c release and promotes apoptosis of endothelial cells due to downregulation of no bioavailability . In line with previous reports, our results indicated that high glucose impaired akt / enos activity of epcs, as well as no production, and administration of coq10 recovered enos activation through the ampk pathway . Coq10, also known as ubiquinone-10 or ubiquinol-10, is well understood as an important component in the oxidative phosphorylation of mitochondria and the production of adenosine triphosphate . Coq10 is stored in the mitochondria of cells as a mobile lipophilic electron carrier and regulates respiratory chain activity . In addition, coq10 involves nad(p)h - oxidoreductase - dependent reactions such as in no synthesis in golgi and plasma membranes . Previous studies have indicated that coq10 attenuates cellular apoptosis in corneal fibroblasts by inhibition of mitochondrial depolarization [13, 26] and prevents huvec apoptosis through suppression of mitochondria dependent caspase 3 protein . However, there has been no report investigating the direct effect of coq10 on epc in vitro . In our study, we described that administration of coq10 improved high glucose - suppressed epc function and reversed apoptosis of epcs by enhancement of mitochondrial function, enhanced bcl-2 expression, and downregulation of caspase 3, which suggest that coq10 might improve epc functional impairment and survival in diabetic patients . Additionally, coq10 was shown to reduce ros production under high glucose conditions and improve epc function by upregulation of enos and ho-1 through the ampk pathway . These findings are consistent with previous reports and suggest that activation of coq10 might reduce hyperglycemia - induced mitochondrial dysfunction and promote mitochondrial biogenesis in epcs exposed to high glucose [27, 28]. Coq10, an antioxidant, scavenges free radicals and inhibits apoptosis in the mitochondria of cells . A recent study indicated that coq10 inhibited caspase 3 dependent apoptosis which was regulated by mitochondrial signaling in high glucose - treated huvecs . Moreover, coq10 displayed an antiapoptotic effect by suppressing mitochondrial membrane depolarization, cytochrome - c release, and caspase activation [14, 30]. Coq10 has the ability to mediate oxidative stress and prevent diabetic endotheliopathy by enos activation . In the current report, we showed that high glucose impaired akt / enos phosphorylation and no production, reduced epc functional activity, and increased cell apoptosis . Treatment with coq10 improved akt / enos phosphorylation and no production and reversed high glucose - induced epc damage . Besides, li et al . Indicated that ampk transgenic mice were resistant to hyperglycemia - induced impairment in endothelium dependent relaxation and reendothelialization of injured carotid arteries through ho-1 . In our study, we found that ho-1 expression was upregulated by coq10, and administration of snpp ix (ho-1 inhibitor) blocked coq10-improved epcs' migration and apoptosis . These results extended previous studies suggesting that ho-1 overexpression in epcs promoted reendothelialization and inhibited neointimal hyperplasia in injured vessels . The beneficial effects may provide a new viewpoint for the use of coq10 therapy for its vascular protective properties in diabetic patients with critical limb ischemia or provide a clinical incentive to improve dysfunctional epcs before cell therapy . This study provides a notion that coq10 has beneficial effects in high glucose - induced epc apoptosis and dysfunction in vitro . These data may clarify the underlying mechanisms responsible for the benefit of coq10 on the treatment of diabetic vasculopathy and cardiovascular diseases (figure 7).
Osteoarthritis (oa) reflects the degradation and erosion of the extracellular matrix (ecm) and the subsequent narrowing of space in joints . The changes in ecm structure are due to the activation of enzymatic systems, that is, matrix metalloproteinase (mmps) and aggrecanase in chondrocytes and synoviocytes [1, 2]. The proinflammatory interleukin- (il-) 1 has a key role in inducing the oa phenotype in chondrocytes . Likewise, nitric oxide (no) production also correlates with pathophysiological changes in chondrocytes [48]. Il-1-activated chondrocytes produce a variety of chemokines [912]; this might reflect the implication of cell recruitment during inflammatory processes in oa diseases . Glucosamine and chondroitin have been the most promising substances so far identified, although their effectiveness is a matter of debate . Clinical studies have demonstrated a beneficial effect of rose hip powder (rhp) in the treatment of oa [1315] (for reviews see [16, 17]). One of its constituents, galacto - lipid (2s)-1, 2-di - o-[(9z, 12z, 15z)-octadeca-9, 12, 15-trienoyl]-3-o--d - galacto - pyranosyl glycerol (glgpg), has been found to inhibit chemotaxis of neutrophils [13, 14] and thus could impair pathophysiological cell recruitment to oa lesions . Other rhp constituents such as ascorbic acid, polyphenols, flavonoids, and unsaturated fatty acids might contribute to alleviate oa mainly via their anti - inflammatory properties . Indeed, rhp extracts and unsaturated fatty acids inhibited cyclooxygenase- (cox-) 1 and cox-2 activity [18, 19] and associated pge2 production . In a previous in vitro study, the multiple effects of rhp on the production of inflammatory mediators by peripheral blood leukocyte and anabolic and catabolic processes in chondrocytes have been described . The current study aimed at the identification of biological activities of different parts of the rose hip fruit and an improved use of rose hip preparations in the management of oa conditions . Rhp was prepared from rosa canina and provided by axellus, ishj, denmark; rh - a consists of dried rose hip powder as described previously; rh - b was prepared from dried rose hip, where the seeds had been removed before the preparation of the powder . The contents in main constituents (see table 1) have been measured by standard procedures implemented at the analytical research center, dsm nutritional products, kaiseraugst (switzerland). Briefly, betulinic acid, oleanolic acid, and ursolic acid were determined according to validated in - house methods (available on request); vitamin c and vitamin e were analyzed according to official methods en14130 and en12822, respectively; linoleic acid, epa, and dha were measured according to the official method of iso 12966 - 2 . Rhp solutions were prepared in dmso and added to the culture medium concomitantly with the stimulating agent . E. coli lipopolysaccharide (lps, serotype 055:b5) and fetal bovine serum (fbs) were from sigma / aldrich (saint - louis, mo). Rpmi 1640, dmem, 2-mercaptoethanol, and mem nonessential amino acids (neaa) were from invitrogen (carlsbad, ca). Human il-1 and recombinant interferon- (ifn-) were from peprotech ec (london, uk). Human peripheral blood leukocytes (pbl) and primary chondrocytes from healthy individuals have been cultured and treated with inflammatory stimuli as described [2022]. Human primary cell culture protocols and in vitro peripheral blood leukocyte experiments were approved by the swiss federal office of public health (no . Pbl (at 8 10 viable cells / ml) were cultured for 1224 h in phenol - red free rpmi 1640 (containing 0.25% fbs, 0.1 mm neaa, 50 u / ml penicillin, 50 g / ml streptomycin, and 50 m 2-mercaptoethanol) and stimulated with lps (100 ng / ml) and ifn- (20 u / ml) with graded amounts of test substances . Normal human articular chondrocytes from knee (nhac - kn) were seeded into 6-well plates at 0.5 10 cells per well and, where indicated, activated with 10 ng / ml il-1 in supplemented cbm (lonza, walkersville, md) in the presence of graded amounts of test compounds for 4 h. in all cell cultures, vehicle (i.e., dmso) was included at 0.5% final concentration . For molecular analysis, nhac - kn cells and pbls were lysed in rlt buffer (qiagen, hilden, germany) after 4 and 12 h of culture, respectively, and total rna was extracted . For the analysis of secreted mediators and proteins, pbls were cultured for 24 h; supernatants were collected and stored at 80c until use for analysis . The isolation of total rna, synthesis of cdna and quantitative rt - pcr has been performed as detailed before . Multiparametric kits were purchased from bio - rad laboratories (hercules, ca) and used in the liquichip workstation is 200 (qiagen, hilden, germany) to measure the amount of secreted proteins . P values <0.05 (obtained by using student's t test or one - way anova) were considered to reflect statistically significant differences . Principal component analysis (pca) was performed with the package chemometrics of the statistical software using the nipals algorithm with centered and scaled input data . Rh - b, prepared from rose hip fruits after removal of seeds, displayed more potent anti - inflammatory effects . The distinct biological activity of rh - a and rh - b correlated with different contents of constituents: rh - b contained higher amounts of ursolic acid, betulinic acid, glgpg, and dha (table 1). Of those, ursolic acid and betulinic acid and 3-omega pufas, but not -carotene, vitamin c, or vitamin e, displayed anti - inflammatory effects (our unpublished data and [25, 26]). Removal of seeds increased the contents of -tocopherol and glgpg; the latter had anti - inflammatory properties . Other constituents (e.g., vitamin c) we investigated the effect of rose hip preparations on cells of the peripheral blood, which is an obligatory passage for nutritional supplements to the target tissue (i.e., cartilage). Lps / ifn- treatment induced the secretion of large quantities of ccl2/mcp-1, ccl3/mip-1, ccl4/mip-1, ccl5/rantes, cxcl10/ip-10, and cxcl8/il-8 (table 2 and figure 1). Rose hip preparations significantly reduced the secretion of, for example, ccl5/rantes, and cxcl10/ip-10 . Conversely, cxcl8/il-8 and ccl3/mip-1 secretion were increased, while other chemokines (ccl11/eotaxin, ccl2/mcp-1, and ccl4/mip-1) were not markedly altered . Similarly the secretion of interleukins and cytokines was influenced by rh preparations: il-6 and il-12(p70) were less produced in the presence of increasing rhp amounts, while il-10, il-1, and tnf- were secreted at higher levels . The secretion of ccl5/rantes, cxcl10/ip-10, and il-12(p70) was influenced by the lowest tested concentration, whereas changes in others (e.g., cxcl8/il-8, ccl3/mip-1, and il-6) required high rhp concentrations . Rh - b had more potent effects and thus a larger impact on inflammatory mediators than its rh - a counterpart (see table 2). It should be mentioned that secretion of pge2, ccl2/mcp-1, ccl4/mip-1, and cytokines (e.g., il-1, il-6 and tnf-) was stimulated by rh - a or rh - b even in the absence of lps / ifn- (figure 1). Rh - a and rh - b did not impair cell viability (data not shown; see also), since some of the cellular parameters were not altered by graded amount of the substances . Changes in gene expression levels showed a pattern which was similar to that of the respective proteins, as best illustrated for cxcl10/ip-10, il-6, and cxcl8/il-8 (table 3 and figure 2). In comparison to rh - a, the rh - b counterpart had a stronger impact on the expression of inflammatory genes . This suggests that rh - b and rh - a modulated the lps / ifn--induced changes in pbl at the level of transcription . One notable exception was ccl5/rantes, which was released from activated pbl even though the respective gene activity was virtually unaltered . Also, il-1 mrna levels were decreased by rhp, whereas the cells discharged increased amounts of il-1 (see figure 1). Rhp induced pge2 in unstimulated pbl and increased it in lps / ifn--activated pbl (not shown; see also). This might be explained by the presence of fatty acids that were converted into substrates for cox-1 in pbl . Treatment of nhac - kn with il- drastically increased expression levels of catabolic and inflammatory genes which reflect the induction of oa conditions in normal chondrocytes (table 4 and figure 3). Within 4 h of stimulation, il-1 significantly upregulated catabolic genes (mmp-1, mmp-3, mmp-13, and adamts-4), cytokine genes (il-1, il-6, and tnf-), and chemokines (cxcl8/il-8, ccl5/rantes, cxcl2/mip-2, and cxcl20/mip-3). Rh - a concentration - dependently reduced mmp-1 and mmp-3 expression by> 50%, while mmp-13 expression was diminished by 90% at the highest dose of rh - a . Proinflammatory cytokine genes like il-1 and il-6 were significantly downregulated . With regard to chemokine genes (cxcl8/il-8, ccl5/rantes, cxcl2/mip-2, and cxcl20/mip-3), rh - a mitigated their expression levels to a similar extent at 125500 g / ml (up to 80% reduction). Rh - b induced changes in gene expression that were comparable to those observed by rh - a, although there were quantitative differences in mmp-1, mmp-13, il-1, cxcl8/il-8, and ccl-2/mip-2: in general, rh - b exerted weaker effects than rh - a (see fold change in table 4). Notably, ccl5/rantes gene expression was dramatically induced in il-1 treated chondrocytes, but it was not upregulated in pbl . This observation points to cell- and tissue - specific modes of action of rhp and to distinct effects of rh - a and rh - b, respectively, in pbl and chondrocytes . In order to comprehensively assess the rose hip induced changes in oa biomarkers, we performed principal component analyses (pca). Pca is a dimension reduction method that allows transforming a complex highly correlated dataset (e.g., all oa biomarkers) into a much smaller set of uncorrelated variables, that is, principal components (pcs). In our experimental data meta - biomarker and derived in decreasing order of importance, the first pc explaining most of the variation (and thus representing most of the information) contained in the original dataset . Plotting the oa biomarkers in pca space allows to visualize and interpret these changes, which is very difficult in the high - dimensional setting of before . Three different pcas were run, illustrating the global effects of rh - a and rh - b on pbls at the protein and gene level and on nhac - kn gene level . The pca were based on the expression of 17 pbl proteins, 10 pbl genes, and 14 nhac - kn genes, respectively . At the protein level, lps / ifn--activated pbl were clearly separated from the lps / ifn--activated / rhp - treated cells showing a treatment effect on pc1 . Additionally a concentration - dependent effect for rh - a could be observed for pc1 as well . Concentration - dependent effects for rh - b were mainly visualized by principal component 2 (figure 4). At the gene level, lps / ifn--activated pbl were separated from higher dose lps / ifn--activated / rhp - treated cells within the first principal component . Additionally, rh - b exerted a more discriminating effect than rh - a within pc2 . The cumulative explained variability (cev) (explained variation of pc1 + pc2 + pc3) for pbl at the protein and gene level was 96% and 94%, respectively, with pc1 explaining 51% and 45% of the variability . For nhac - kn, cev was 94% for variations observed at the gene level (pc1 + pc2, pc1 by itself explaining 80%). An effect of treatment was observable and mostly reflected by pc1, whereas the effect of substance concentrations (especially contrasting the high dose from the other doses) was mainly distinguished by principal component 2 . A stronger effect of rh - b as compared to rh - a could also be observed in pc1 . Taken together, the data indicate a distinguishable and beneficial effect of rh on oa biomarkers with rh - b being a stronger discriminator than rh - a . In this study, a panel of biological activities of rose hip powder prepared from the whole fruit or from shells has been compared . It provides evidence that cellular features related to inflammatory responses and cartilage destruction were modulated by the complex mixture of substances contained in rhp (see table 1). These have been measured in murine and human cellular models and are fully consistent with those previously reported . In lps - activated murine macrophages rhp exhibited mainly anti - inflammatory properties including reduced production of nitric oxide, cox-2 dependent pge2, various chemokines, and proinflammatory cytokines . In pbl, the expression of interleukins and cytokines were mostly mitigated by rhp, while growth factor production like gm - csf and g - csf were increased . We observed a dichotomy with regard to chemokine expression: ccl5/rantes, ccl11/eotaxin, and cxcl10/ip-10 drastically decreased, whereas others augmented in the presence of rhp (e.g., cxl8/il-8, ccl3/mip-1, and ccl4/mip-1). With regard to ccl5/rantes and cxcl8/il-8, therefore, rhp could contribute to improve the amplitude and length of the acute inflammatory response through a more vigorous mobilization of lymphocytes and macrophages, while it dampens an excessive cell mobilization in chronic inflammation processes like in oa . This needs to be investigated in further experiments, where rhp should be tested on distinct subpopulations of pbl such as neutrophils, monocytes, and lymphocytes . The pattern of observed in vitro activities was more definite in the target tissue cell equivalent, that is, chondrocytes, where gene expression of ccl5/rantes, cxcl10/ip-10, cxcl2/mip-2, and ccl20/mip-3 was reduced by rhp . Concomitantly, the expression of genes that degrade ecm was diminished and thus reflected a chondroprotective effect of rhp on cartilage tissue . Previous studies highlighted the importance of chemokines in oa, with ccl5/rantes and cxcl8/il-8 being activated in chondrocytes [911, 28]. The results of the present study corroborate previous data obtained with another source of rhp . It is premature to unambiguously define the bioactive constituents of rh - a and rh - b, whose composition considerably differed (table 1). Removing seeds from rose hip preparations resulted in higher contents of anti - inflammatory substances like betulinic acid, ursolic acid, galactolipids, epa, and dha . On the other side, seeds contained the bulk of fatty acids which could serve as substrate for inflammatory mediators such as pge2 . These analyses demonstrated that rh - a and rh - b robustly modified a pattern or cluster of biological responses, as anticipated for beneficial effects of nutritional supplements (reviewed by, e.g.,). More importantly, two of the three pcas performed (at the level of pbl and nhac - kn genes) showed that rh - b exhibited an overall stronger effect on oa biomarkers than rh - a . Given the demonstrated health benefit of rose hip in clinical studies (for review see, e.g.,), we hypothesize that in clinical studies rh - b is more efficacious or can be used in lower doses than rh - a in the treatment of oa conditions . Indeed, a recently completed randomized active - controlled trial provided evidence that, taken at half the original dose, the novel enhanced rosehip powder (rh - b) had similar effects in patients with symptomatic oa as the original rosehip product (rh - a). A new form of rosehip powder has enhanced in vitro anti - inflammatory and chondroprotective properties in human peripheral blood leukocytes and primary chondrocytes.
Typical tunisian dietary foods were chosen with reference to a number of epidemiologic studies (2224). The aim was to include a wide range of foods that require some aid to assess portion sizes in a questionnaire and to span the selected visual appearance which is likely to influence perception of amounts from photos . Construction of the food photography manual involved cooking, weighing, and taking digital photographs of three different portion sizes: small (a), medium (b), and large portion (c). Foods that needed to be cooked (vegetables, pasta, meat, fish, etc .) Were weighed before and after cooking . Two types of scales of different capacity were used to weigh the different portions (a precision scale chimazou, bw 420 h with a precision of 0.001 g and a maximum capacity of 420 g, and a daewoo dks 2055 scale with a precision of 1 g and a maximum capacity of 5,000 g). Digital photographs of three identified portions were taken under standard lighting conditions in a room by a professional photographer using a digital camera (canon (r) 40 d lens, canon 70200 mm). The three portion sizes considered to be representative of the range of portion sizes actually consumed (2224) were placed on a white dining plate (26 cm in diameter) in a colored background contrast . All photographs were taken at approximately the same angle of 45 and from a distance of 50 cm above the plate, which was considered the best compromise between showing the depth and height of the food (25). This technique, sitting at a table, is necessary to show the differences between the size of the portions depending on the height of the food on a plate and depth in a soup bowl (15). This offers the best compromise by showing the size and the depth of the portion, the number and size of items, size and slice thickness, depth in a bowl, etc . These appearance characteristics are likely to influence the perception of portion sizes (2628). The 400 photos in the manual cover eight food groups: bread, cereals (including pasta, rice, couscous); potatoes, vegetables (raw and cooked); fresh fruits, animal products (meat and meat products, fish and fish products, eggs); dairy products (milk, cheese); and sweet products . Each page of the manual presents three sets of three pictures of three different foods . Each food was presented in three portion sizes: small, medium and large (labelled a, b, and c, respectively) that are considered representative of the tunisian population consumption . But an incorporated scale enables the person to select intermediate sizes as well, giving a total of seven portion sizes: <a, a, a b, b, b c, c, and> c. the actual weight of the portions of raw or cooked food was presented in the appendix of the manual . This manual has the advantage of being the first to represent a wide list of foods usually consumed by the tunisian population, for which a visual aid to estimate portion sizes is necessary (6, 7). The photographs were designed to help estimate the amount of foods consumed the previous day by the 24-hour recall method . Example of photographs from the photos manual shows portion sizes of food and the amounts in grams . (a) couscous, (b) fish, (c) fresh vegetables, (d) apples . Thirty - one volunteers of both sexes in the cap - bon governorate (bouargoub town) were invited to participate in the study . A nutritionist from the same region visited the participants in their homes and explained the procedure of the study and its purpose, explaining that the aim was to assess the usual dietary intake of the participants by the fw method but without indicating that the portion sizes of the foods consumed would also be evaluated on the next day . Their participation depended on their willingness to be followed closely for 1 day during the preparation and consumption of their meals . On the first day, participants received the investigator at home during the preparation and consumption of three main meals . The dietary survey technique used to estimate nutrient intake was fw, which was considered as the reference method (3). For each meal, the amount of foods consumed by each individual was recorded and weighed by the trained dietician at the time of serving . If any food was left over, the weight was recorded, and the amount of food eaten was calculated as the difference between the amount served and the amount left . In the case of mixed meals, the raw ingredients used in their preparation were weighed (0.1 g). The final total weight of the mixed dish was weighed using a second scale with greater capacity (5,0001 g). The body mass index (bmi) was computed as weight (kg)/height squared (m) and evaluated using the world health organization classification (29). On the following day, the investigator conducted a modified 24-hour recall (fp 24-hr) to estimate the amount of food consumed by the participants the day before . The participants were asked to recall the food intake during the preceding day . For each food, they were asked to mark a cross on the manual photos that they believed represented most closely the size of the portion they had consumed . The dietary intakes of participants estimated by the fp 24-hr using the photographic manual and the fw method were transformed into key macro and micronutrients using the bilnut software . To validate the fp 24-hr method, we used three tests: the differences between amounts in portion sizes of food categories weighed and estimated were tested using wilcoxon signed rank test (data not normally distributed), and differences between nutrient intake estimated by fp 24-hr and fw were tested using paired t-test.pearson's or spearman's rank correlation coefficients were calculated to assess the association between the weighed and estimated amounts of food (spearman) and also nutrient intake (pearson).agreement between the two methods was evaluated according to bland the mean differences of food amounts and nutrients intake between the two methods were plotted against their average value, and the 95% limits of agreement and the 95% confidence interval (ci) were marked . The differences between amounts in portion sizes of food categories weighed and estimated were tested using wilcoxon signed rank test (data not normally distributed), and differences between nutrient intake estimated by fp 24-hr and fw were tested using paired t - test . Pearson's or spearman's rank correlation coefficients were calculated to assess the association between the weighed and estimated amounts of food (spearman) and also nutrient intake (pearson). Agreement between the two methods was evaluated according to bland altman analysis (30). The mean differences of food amounts and nutrients intake between the two methods were plotted against their average value, and the 95% limits of agreement and the 95% confidence interval (ci) were marked . Statistical analysis was done by spss version 20.0 software . The significance level for statistical tests typical tunisian dietary foods were chosen with reference to a number of epidemiologic studies (2224). The aim was to include a wide range of foods that require some aid to assess portion sizes in a questionnaire and to span the selected visual appearance which is likely to influence perception of amounts from photos . Construction of the food photography manual involved cooking, weighing, and taking digital photographs of three different portion sizes: small (a), medium (b), and large portion (c). Foods that needed to be cooked (vegetables, pasta, meat, fish, etc .) Were weighed before and after cooking . Two types of scales of different capacity were used to weigh the different portions (a precision scale chimazou, bw 420 h with a precision of 0.001 g and a maximum capacity of 420 g, and a daewoo dks 2055 scale with a precision of 1 g and a maximum capacity of 5,000 g). Digital photographs of three identified portions were taken under standard lighting conditions in a room by a professional photographer using a digital camera (canon (r) 40 d lens, canon 70200 mm). The three portion sizes considered to be representative of the range of portion sizes actually consumed (2224) were placed on a white dining plate (26 cm in diameter) in a colored background contrast . All photographs were taken at approximately the same angle of 45 and from a distance of 50 cm above the plate, which was considered the best compromise between showing the depth and height of the food (25). This technique, sitting at a table, is necessary to show the differences between the size of the portions depending on the height of the food on a plate and depth in a soup bowl (15). This offers the best compromise by showing the size and the depth of the portion, the number and size of items, size and slice thickness, depth in a bowl, etc . These appearance characteristics are likely to influence the perception of portion sizes (2628). The 400 photos in the manual cover eight food groups: bread, cereals (including pasta, rice, couscous); potatoes, vegetables (raw and cooked); fresh fruits, animal products (meat and meat products, fish and fish products, eggs); dairy products (milk, cheese); and sweet products . Each page of the manual presents three sets of three pictures of three different foods . Each food was presented in three portion sizes: small, medium and large (labelled a, b, and c, respectively) that are considered representative of the tunisian population consumption . But an incorporated scale enables the person to select intermediate sizes as well, giving a total of seven portion sizes: <a, a, a b, b, b c, c, and> c. the actual weight of the portions of raw or cooked food was presented in the appendix of the manual . This manual has the advantage of being the first to represent a wide list of foods usually consumed by the tunisian population, for which a visual aid to estimate portion sizes is necessary (6, 7). The photographs were designed to help estimate the amount of foods consumed the previous day by the 24-hour recall method . Example of photographs from the photos manual shows portion sizes of food and the amounts in grams . (a) couscous, (b) fish, (c) fresh vegetables, (d) apples . Thirty - one volunteers of both sexes in the cap - bon governorate (bouargoub town) were invited to participate in the study . A nutritionist from the same region visited the participants in their homes and explained the procedure of the study and its purpose, explaining that the aim was to assess the usual dietary intake of the participants by the fw method but without indicating that the portion sizes of the foods consumed would also be evaluated on the next day . Their participation depended on their willingness to be followed closely for 1 day during the preparation and consumption of their meals ., participants received the investigator at home during the preparation and consumption of three main meals . The dietary survey technique used to estimate nutrient intake was fw, which was considered as the reference method (3). For each meal, the amount of foods consumed by each individual was recorded and weighed by the trained dietician at the time of serving . If any food was left over, the weight was recorded, and the amount of food eaten was calculated as the difference between the amount served and the amount left . In the case of mixed meals, the raw ingredients used in their preparation were weighed (0.1 g). The final total weight of the mixed dish was weighed using a second scale with greater capacity (5,0001 g). Besides, the investigator measured the height and weight of the participants . The body mass index (bmi) was computed as weight (kg)/height squared (m) and evaluated using the world health organization classification (29). On the following day, the investigator conducted a modified 24-hour recall (fp 24-hr) to estimate the amount of food consumed by the participants the day before . The participants were asked to recall the food intake during the preceding day . For each food, they were asked to mark a cross on the manual photos that they believed represented most closely the size of the portion they had consumed . The dietary intakes of participants estimated by the fp 24-hr using the photographic manual and the fw method were transformed into key macro and micronutrients using the bilnut software . To validate the fp 24-hr method, we used three tests: the differences between amounts in portion sizes of food categories weighed and estimated were tested using wilcoxon signed rank test (data not normally distributed), and differences between nutrient intake estimated by fp 24-hr and fw were tested using paired t-test.pearson's or spearman's rank correlation coefficients were calculated to assess the association between the weighed and estimated amounts of food (spearman) and also nutrient intake (pearson).agreement between the two methods was evaluated according to bland the mean differences of food amounts and nutrients intake between the two methods were plotted against their average value, and the 95% limits of agreement and the 95% confidence interval (ci) were marked . The differences between amounts in portion sizes of food categories weighed and estimated were tested using wilcoxon signed rank test (data not normally distributed), and differences between nutrient intake estimated by fp 24-hr and fw were tested using paired t - test . Pearson's or spearman's rank correlation coefficients were calculated to assess the association between the weighed and estimated amounts of food (spearman) and also nutrient intake (pearson). The mean differences of food amounts and nutrients intake between the two methods were plotted against their average value, and the 95% limits of agreement and the 95% confidence interval (ci) were marked . Statistical analysis was done by spss version 20.0 software . The significance level for statistical tests participants were aged between 9 and 89 (mean: 33.614.5 years). Of the 31 participants, the bmi of children and adolescents was 24.12.2 kg / m . According to cole's cutoff point reference values (31), 43.8 and 14.2% of children were overweight and obese, respectively . The bmi of adults was 25.74.9 kg / m (24.73.1 and 26.35.8, for males and females, respectively). Nevertheless, 11.1% of males and 13.3% of females were overweight (25 bmi <30) and 11.1% of males and 40% of females are obese (bmi 30). For the whole sample, prevalence of overweight and obesity was 12.5 and 29.1%, respectively . The overall assessments were grouped in the following eight major food categories: animal products (meat and meat products, fish and fish products, and eggs); vegetables (raw and cooked), potatoes; fruits (fresh); bread, pasta, dairy products (milk and dairy products); and sweet products . The amounts of food (mean and standard deviation) estimated by fp 24-hr and actually consumed (fw) and the differences in the means are presented in table 1 . All food categories were overestimated (ranged from 2.2% for dairy products to 18.6% for pasta), but animals products and sweet products were underestimated by 9.9 and 4.5%, respectively . Statistical analysis by paired t - test series shows that the differences between the amounts estimated by fp 24-hr and those weighed were not statistically significant, except for pasta (p<0.01) and dairy products (p<0.05). The correlation coefficient was calculated to study the relationship at the individual level between the estimated and the actually consumed amounts . A highly significant correlation (p<0.001) the value of r ranged from 0.882 (potatoes) to 0.989 (dairy products). The agreement between the estimated and the weighed amounts for the eight food groups was assessed by bland altman plots for mean daily intakes for three of the major food groups (meat, vegetables, and fruits) are presented in fig . Overall, these plots indicate acceptable agreement between the two methods for assessment of dairy products, potatoes, and sweet products . (a) meat, (b) vegetables, (c) fruits . Amount of food estimated by fp 24-hr and compared with amount weighed in fw sd: standard deviation . Percent of the mean difference=[(amount from fp 24-hramount from fw)/(mean amount from fw)*100]. The means of the estimated and the actually consumed amounts of energy, protein, fat, carbohydrates, dietary fiber, vitamin b1, vitamin c, vitamin e, folate, calcium, iron, and zinc are presented in table 2 . The average differences between the recall and weighing methods were negative for lipids (8.2%), zinc (11.1%), vitamin b1 (2.4%), and vitamin e (11.6%). The differences were positive for protein (0.43%), carbohydrate (6.5%), fiber (9%), and vitamin c (3.6%). The differences vary insignificantly from 11.6% for vitamin e intake to 9% for fiber intake . Significant differences were observed for lipid (p<0.01) and fiber intake (p<0.05). Correlation coefficients for the estimates of nutrient intakes between the two methods are presented in table 2 . The value of the correlation coefficient ranged from 0.644 (folate) to 0.985 (vitamin b1). In order to assess the agreement between the methods for all nutrients, bland altman plot for carbohydrate indicated broad limits of agreement . In addition, the difference in the estimates of carbohydrate intakes between fp 24-hr and fw became progressively greater with higher mean intakes (fig . 3, like carbohydrate intake, the difference in estimates of total protein (g) and fiber (g) intakes between the two methods became progressively greater with higher mean intakes . Correlations varied from 0.889 (protein) to 0.943 (carbohydrate). For micronutrients, correlation coefficients were low for folate (0.644) and high for vitamin b1 (0.985). The majority of the measurements of calcium, iron, and vitamin e were scattered along the equality line . (a) protein, (b) fat, (c) carbohydrate . Mean nutrient intake and comparison of the results obtained with the fp 24-hr and fw methods sd: standard deviation . Participants were aged between 9 and 89 (mean: 33.614.5 years). Of the 31 participants, the bmi of children and adolescents was 24.12.2 kg / m . According to cole's cutoff point reference values (31), 43.8 and 14.2% of children were overweight and obese, respectively . The bmi of adults was 25.74.9 kg / m (24.73.1 and 26.35.8, for males and females, respectively). Nevertheless, 11.1% of males and 13.3% of females were overweight (25 bmi <30) and 11.1% of males and 40% of females are obese (bmi 30). For the whole sample, prevalence of overweight and obesity was 12.5 and 29.1%, respectively . The overall assessments were grouped in the following eight major food categories: animal products (meat and meat products, fish and fish products, and eggs); vegetables (raw and cooked), potatoes; fruits (fresh); bread, pasta, dairy products (milk and dairy products); and sweet products . The amounts of food (mean and standard deviation) estimated by fp 24-hr and actually consumed (fw) and the differences in the means are presented in table 1 . All food categories were overestimated (ranged from 2.2% for dairy products to 18.6% for pasta), but animals products and sweet products were underestimated by 9.9 and 4.5%, respectively . Statistical analysis by paired t - test series shows that the differences between the amounts estimated by fp 24-hr and those weighed were not statistically significant, except for pasta (p<0.01) and dairy products (p<0.05). The correlation coefficient was calculated to study the relationship at the individual level between the estimated and the actually consumed amounts . A highly significant correlation (p<0.001) the value of r ranged from 0.882 (potatoes) to 0.989 (dairy products). The agreement between the estimated and the weighed amounts for the eight food groups was assessed by bland altman plots for mean daily intakes for three of the major food groups (meat, vegetables, and fruits) are presented in fig . Overall, these plots indicate acceptable agreement between the two methods for assessment of dairy products, potatoes, and sweet products . (a) meat, (b) vegetables, (c) fruits . Amount of food estimated by fp 24-hr and compared with amount weighed in fw sd: standard deviation . The means of the estimated and the actually consumed amounts of energy, protein, fat, carbohydrates, dietary fiber, vitamin b1, vitamin c, vitamin e, folate, calcium, iron, and zinc are presented in table 2 . The average differences between the recall and weighing methods were negative for lipids (8.2%), zinc (11.1%), vitamin b1 (2.4%), and vitamin e (11.6%). The differences were positive for protein (0.43%), carbohydrate (6.5%), fiber (9%), and vitamin c (3.6%). The differences vary insignificantly from 11.6% for vitamin e intake to 9% for fiber intake . Significant differences were observed for lipid (p<0.01) and fiber intake (p<0.05). Correlation coefficients for the estimates of nutrient intakes between the two methods are presented in table 2 . The value of the correlation coefficient ranged from 0.644 (folate) to 0.985 (vitamin b1). In order to assess the agreement between the methods for all nutrients, bland in addition, the difference in the estimates of carbohydrate intakes between fp 24-hr and fw became progressively greater with higher mean intakes (fig . 3, like carbohydrate intake, the difference in estimates of total protein (g) and fiber (g) intakes between the two methods became progressively greater with higher mean intakes . Correlations varied from 0.889 (protein) to 0.943 (carbohydrate). For micronutrients, correlation coefficients were low for folate (0.644) and high for vitamin b1 (0.985). The majority of the measurements of calcium, iron, and vitamin e were scattered along the equality line . (a) protein, (b) fat, (c) carbohydrate . Mean nutrient intake and comparison of the results obtained with the fp 24-hr and fw methods sd: standard deviation . The aim of this work was to develop and validate a tunisian food photography manual . This manual could be used as a visual aid to improve the accuracy of the estimation of food quantities consumed by surveyed individuals . This food photography manual has the advantage of being the first to represent a wide list of foods usually consumed by the tunisian population and requiring a visual aid for estimating portion sizes . Many studies have shown interest in using food photography to reduce the errors in estimating the quantities of consumed foods (27, 32, 33). However, it is of utmost importance to validate the photographic manual and to determine the presence or absence of bias and its direction when estimating food amounts . Comparison of the amount of consumed food estimated by the fp 24-hr method and weighing method showed that the mean differences between the two methods were not significant for all food groups, except for pasta (18.6%) and dairy products (2.2%) (p<0.05). Some researchers (15, 34) reported that the portion size of some foods seems to be more difficult to estimate accurately than others . De souza et al . Indicated that it was easier to estimate the portions of food that are part of the food habit (35). The consistency between portion weights and estimated portion sizes of the foods eaten is revealed by the high mean correlation coefficients . Regarding nutritional intake, the average differences between the two methods ranged from 11.6 (vitamin e) to 8.9% (fibers). These average differences in dietary intake were not statistically significant . On the contrary, the estimate of food and nutrient intakes estimated by the recall of 24 hours with photos is highly correlated with the actually consumed amounts . These results are consistent with those found in the literature (13, 15, 27, 28). In figs . 2 and 3, the bland almost all of the points are in a band of plus or minus double the standard deviation of the straight equality of means . Altman analysis shows that most measures of categories of foods and nutritional intake are scattered on either side of the mean differences and all along the line of equality (difference=0). Our data analyses of individual food categories and nutrients intake show that the fp 24-hr was able to adequately estimate the weights of food portions and gave results that are comparable to the actually consumed amounts (fw). The number and size of the photos used to estimate portion sizes vary from one study to another, from one to eight (27). It has been shown that the greater the number of serving size categories, the smaller the estimation error (36). A complex process is triggered when using photographs to identify the portion size of food during a food interrogation . These three elements depend on the number of different portion sizes, location in the manual, the size of each photo, and some characteristics of the respondents (gender, age, body size, etc .) However, a study in south africa (18) showed that accuracy of estimation was not affected by sex, age, or education . The estimated size of the portions was not influenced by sex and bmi of the individuals and that it was easier to estimate the portions of food that are habitual (35). In a dietary study using the 24-hour recall method, two main tasks are required by the subject in estimating portion size: 1) memory of the foods eaten and 2) conceptualization (i.e. The ability to translate an abstract mental impression of an amount eaten into an amount depicted in a photograph) (28). More recently, portion size photographs have also been developed to be used on a computer screen . Recent studies have reported that the photos taken by the participants themselves when food intake occurs in many environments, for example, cafes and restaurants, can improve the accuracy of collected data (3840). The amount of food is estimated on the basis of this comparison and the application automatically calculates the energy and nutrient intake . This use of digital photography has the advantage of reducing the burden on participants when estimating portion sizes . But it does not exclude the need for a manual of standards for evaluating the photographed portion sizes and those consumed by the subjects (41, 42). Possible limitations of the present study are the small number of participants (which affects the power of the statistical tests), wide age range, and the simplicity of the examined menus . Such limits may explain the high correlations and low differences between the results of the two methods . One possible reason for the poor agreement is that respondents might be less able to conceptualize portion sizes and are less practiced in estimating measures . The validation method bears international relevance for individual - level dietary assessment, because it is one of the few studies that have used measures of agreement to test a photographic atlas for this purpose under the interest of this study is that it was conducted under the conditions of normal living on a population sample that is heterogeneous regarding sex, age, and bmi . Therefore, the food consumption of the participants can be considered as representative of their usual consumption . Our study may be the first using photographs to assess nutrient intake in free - living conditions in tunisia . It appears to be a useful tool for portion size estimation of the common foods in the tunisian diet . The analysis of data of food and nutrient intake shows that 24-hour recall with the use of food photos yields results that are comparable to those obtained by fw . The 24-hour recall method in combination with food photos therefore, this food photography manual can be used as a standard basis for dietary surveys to estimate the amounts of consumed food . It is a better alternative for obtaining an accurate and representative estimation of the current or usual nutrient intake in large - scale dietary surveys in tunisia . Further work to develop and test sets of food photographs for use in different areas and population groups in the mediterranean region and africa is needed . Mongia bouchoucha contributed to the formulation of the research, the study design, and writing the article . Fadwa tarhouni and rim bouchoucha performed the food survey: 24-hour recall method and fw . Mouna akrout and bchir zouari contributed to the formulation of the research and analyzed the data . This study was conducted according to the guidelines laid down in the declaration of helsinki, and all procedures involving human subjects / patients were approved by the ethic committee of abderrahman mami hospital, ariana, tunisia . Verbal informed consent was obtained from all subjects: verbal consent was not formally recorded . The authors have not received any funding or benefits from industry or elsewhere to conduct this study.
Isolated nccm was first described in 1984, but it only regained recognition in the last decade . Now, it increasingly attracts scientific attention, especially because the condition has not been fully understood so far and is thus a subject of ongoing investigations on its pathology, development, clinical course, and therapy (1). Nccm is a primary genetic cardiomyopathy, caused by a defect in endomyocardial morphogenesis . As a result, the muscle of the ventricle is built out of trabeculae with intratrabecular recesses, giving a typical appearance of muscular bands in a spongy mashwork. This specific morphology is reminiscent of the myocardium during early embryogenesis . Between the 4th and 18th week of cardiogenesis, a non - compacted structure is essential for the nutrition of the cells, since the muscle is being supplied primarily by diffusion of blood that flows in the intratrabecular spaces . When the angiogenesis of coronary arteries is not accompanied by a simultaneous regression of trabeculae, nccm is occurring (2). Mostly, they encode for sarcomere and cytoskeleton proteins, such as tafazzin (taz), lim domain binding protein 3 (ldb3), -dystrobrevin (dtna), lamin a / c (lmna), etc . The exact prevalence is not known and it is assumed to bear a significant number of undiagnosed cases . In echocardiography, it is found in 1 of 2,000 studies . Since the diagnosis is defined by structural features, which can only be evaluated by cardiac imaging, mostly transthoracic echocardiography . A diagnosis can be made in the presence of three factors: 1) a thickened left ventricular wall consisting of two layers with a maximum ratio of non - compacted to compacted myocardium> 2:1 at end - systole in pax, 2) color doppler evidence of flow within the deep intertrabecular recesses, 3) prominent trabecular meshwork in the lv apex or midventricular segments of the inferior and lateral wall (3). Various criteria systems have been described; however, they all disembogue in the structural features and quantifications . Cardiac mri is an advanced option for gaining a closer motion insight of the myocardium . It is especially useful if the morphology is overlapped with other cardiopathies (4), due to its enhanced spatial resolution, improved tissue characterization, and lack of ionizing radiation (5). The disease may remain silent along the entire life or appear unspecifically, depending to what extent the heart function is affected: dyspnea, fatigue, limbs edema, limited physical capacity, and exercise intolerance . Furthermore, tachycardia has recently been found associated with nccm, leading to hypotension . Syncopies have not been mentioned so far in possible signs of the disease but are plausible since it is a result of cerebral hypoperfusion . In advanced stages, the prognosis is difficult to predict and has to be individualized, but it can be geared to the resulting cardiac impairment grade . Since there is no specific treatment so far, the essential approach is the early recognition of any cardiac dysfunction, prevention of complications and symptom - based therapy, including ace inhibitors, beta - blockers, and aspirin . More aggressive treatments such as surgical interventions have been reported in severe nccm cases (6). In our case, the symptoms were still limited to situations where our patient is physically challenged . Thus, she was advised to forego intensive sports and advised to have regular check - ups with a cardiologist (including loop recording and tte). Patient's children have been advised to undergo a cardiologic check - up as well . Its molecular genetic basis is not yet fully clear, and the same is true of its diagnosis, treatment, and prognosis . The author has not received any funding or benefits from industry or elsewhere to conduct this study.
Folic acid belongs to the vitamin b complex . It is vital for red blood cells and for many other cells in the body . Folic acid is also known as folate, folacin, vitamin b9, vitamin m, folvite, acifolic, folcidin, and scientifically as pteroylglutamic acid . The form of folic acid occurring naturally in food is called folate and it is a water - soluble vitamin . Previous studies have described anti - inflammatory effects exerted by folic acid, although the mechanisms underlying these actions are still not yet fully clarified [2, 3]. It was reported that combined supplementation of micronutrients, folate, and vitamin b12 has a beneficial effect in reducing inflammation in pregnancy, acting on the levels of inflammatory cytokines . Folate and vitamin b supplementation has been assessed as a potential clinical intervention in vascular disease [5, 6]. In addition, the administration of folic acid to subjects with primary arterial hypertension caused a decreased concentration of inflammation markers (hscrp, icam-1, and vcam-1). Kolb and petrie reported that folate deficiency enhances the proinflammatory cytokine output of raw264.7 monocytes, suggesting that a folate deficiency may exacerbate cardiovascular disease by augmenting proinflammatory signals in the monocyte - macrophage lineage . Microglia, immune cells resident in the central nervous system (cns), are responsible for monitoring the cns environment protecting neurons from invading microorganisms, as well as removing cell degradation products . After recognizing specific pathogen - associated patterns they initiate both innate and adaptive immune responses by producing an array of proinflammatory cytokines, free radicals, and nitric oxide (no). These microglia responses bring about pathogen clearance and tissue regeneration, but the resulting inflammatory state, if overactivated, may cause neuronal injury . It is now accepted that neuroinflammation is an important contributor to neurodegeneration in various cns diseases . Suppressors of cytokine signaling (socs) proteins are intracellular proteins that inhibit cytokine signaling in a wide variety of cell types . In particular, socs proteins have been found to be expressed by immune cells, as well as by cells of the cns, including microglia [11, 12]. In the context of the inflamed cns they are involved in preventing excess inflammation, protecting the brain tissue from severe inflammation - induced tissue damage . The anti - inflammatory effects of folic acid in microglia cells have not yet been well described . Here we reported the effects of folic acid on lps - induced inflammatory responses of bv-2 microglia cells . The regulatory mechanisms that cause the upregulation of socs1 and socs3 expression were also investigated . The murine - microglia cell line was obtained from the american type culture collection (manassas, va, usa). Cells (2 10 cells / ml) were plated onto 24-well plates and incubated overnight in dulbecco's modified eagle's medium (dmem; invitrogen) containing supplementary 10% fetal bovine serum (fbs), 100 units / ml penicillin, 100 g / ml streptomycin, and 2 mm - glutamine, (life technologies - invitrogen, milan, italy) at 37c in a 5% co2 humidified atmosphere at 37c . Then, the cells were treated with folic acid (sigma - aldrich, milan, italy) at final concentrations of 5, 10, 30, 50, 70 g / ml for 1 hour and then stimulated with lps (from escherichia coli 055:b5; sigma - aldrich) (1 g / ml) for the time indicated in the different assays . Cell viability was determined by an mtt (sigma - aldrich) assay . In brief, bv-2 microglial cells (2 10 cells / ml) were plated onto 24-well plates, submitted to folic acid treatment and incubated overnight . Then, culture media were carefully removed and 100 l of 0.5 mg / ml mtt in cell culture medium was added to each well and incubated for 4 h. finally, 100 l of 10% sds and 0.01 m hcl solution were added to each well to dissolve the formed formazan crystals . The cell viability was calculated according to the following formula:% cell viability = [od (560 nm) tested compound / od (560 nm) control cells] 100 . In controls, after 24 hours of incubation, supernatants of cultured cells were collected and assayed for no production using griess reagent . Briefly, the samples were mixed with an equal volume of griess reagent (carlo erba, milan, italy) and then incubated at rt for 10 minutes . The absorbance of supernatants was spectrophotometrically measured at 540 nm and the no concentration was calculated by extrapolation from a standard curve of sodium nitrite (nano2). To avoid interference by nitrites possibly present in the medium, a blank of each experiment total rna was isolated from cells using trizol reagent according to the manufacturer's protocol . The mrna levels of various genes were quantified using the sybr green quantitect rtpcr kit (roche, south san francisco, ca, usa). Data were analyzed using the relative standard curve method according to the manufacturer's protocol . The mean value of each gene after gapdh normalization at the time point showing the highest expression was used as calibrator to determine the relative levels of tnf-, il-1, inos, il-10, arginase (arg)-1, and cd206 at different time points . After treatment as previously described, cells were washed twice in pbs, detached with ice - cold pbs, collected, and centrifuged at 600 g for 10 min . The supernatants were then removed and the pellet was harvested and lysed by ice - cold lysis buffer [1% (v / v) triton x-100, 20 mm tris - hcl, 137 mm nacl, 10% (v / v) glycerol, 2 mm edta, 1 mm phenylmethylsulfonyl fluoride (pmsf), 20 m leupeptin hemisulfate salt, and 0.2 u / ml aprotinin (all from sigma aldrich)] for 30 min on an ice - bath . The protein concentration in the supernatant was spectrophotometrically determined by bradford's protein assay and the lysate was subjected to sds - page (nupage electrophoresis system, invitrogen). After electrophoresis, the resolved proteins were transferred from the gel to nitrocellulose membranes using iblot dry blotting system a (life - technologies). Antibodies directed against -actin, inos, erk 1/2, p - erk 1/2, p - ib, ib, p38 mapk, p - p38 mapk, jnk, p - jnk, socs1, and socs3 were all obtained from santa cruz biotechnology, inc . (santa cruz, heidelberg, germany) (diluted 1: 1000 for p - ib, erk 1/2, p - erk 1/2, p - p38 mapk, p38 mapk, jnk, p - jnk; 1: 100 for inos; 1: 500 for socs1 and socs3, and 1: 10,000 for -actin). Membranes were incubated with the secondary antibody horseradish peroxidase (hrp) conjugate (santa cruz biotechnology) diluted 1: 2000, for 60 min at room temperature in the dark on a shaker . Finally, bands were visualized by the chemiluminescent method (biorad laboratories, hercules, ca, usa). The bands obtained after immunoblotting were submitted to densitometric analysis using i d image analysis software (kodak digital science), expressing results expressed as arbitrary units . For elisa assay, the supernatant of cultured cells stored at 70c was used to measure the cytokines release . The concentrations of il-1, il-10, and tnf- were determined by elisa according to the manufacturer's protocols (r&d system inc ., student's t - test and analysis of variance (one - way anova) were performed on the results of at least five independent biological replicates . None of the 550 g / ml range concentrations of folic acid tested affected the viability of bv-2 microglial cells, although folate 70 g / ml resulted to be cytotoxic (table 2). Thus, for the study of microglial cells functional responses we used concentrations ranging from 550 g / ml, as reported in literature . Folate treatment significantly lowered the lps - induced no release by microglia cells (figure 1(a)). We also found that folate significantly and dose - dependently attenuated no production after 24 h lps treatment, reaching a maximal inhibition at 50 g / ml . Interestingly, inos expression was significantly and dose - dependently downregulated in the presence of folate (figure 1(b)). The qpcr analysis confirmed these results also for the mrna levels of this inflammatory mediator (figure 1(c)). Taken together, these results indicate that folate treatment suppresses the release of no in lps - stimulated bv-2 microglial cells by modulating inos expression also at transcriptional levels . Rt - pcr was performed to determine whether folic acid regulates proinflammatory cytokine and microglia activation markers expression at transcriptional level . As shown in figure 2(a) we demonstrated a marked increase in tnf- and il-1 mrna in bv-2 microglial cells after 6 h of lps treatment . By contrast a significant reduction of arg-1 and cd206 microglia activation markers was evidenced in lps treated bv-2 microglial cells . No effect of treatment with folic acid alone on proinflammatory gene expression was observed in cells, proinflammatory cytokines mrna levels being similar in all tested concentrations (550 g / ml) and comparable to the levels detected in control cells . Interestingly, we observed that mrna expression of proinflammatory cytokines was significantly decreased in lps - treated cells after pretreatment with folic acid in comparison to microglial cells stimulated with lps alone, suggesting that, in lps - activated cells, folic acid was able to downregulate proinflammatory cytokine mrna expression, in a dose - dependent manner, reaching a maximal reduction at 50 g / ml (figure 2(a)). Folic acid treatment alone had no effect on the production of il-1 and tnf- in bv-2 microglia . The increased levels of il-1 and tnf- levels in supernatants obtained from 24 h lps - stimulated bv-2 microglia resulted significantly reduced after pretreatment with folic acid in a dose - dependent manner, as shown in figure 2(b). Concerning the effect of folate on the regulation of the anti - inflammatory cytokine, il-10, in lps treated cells we observed a significant increase of il-10, while folate pretreatment was able to upregulate this expression . Interestingly, il-10 levels resulted significantly increased in folate pretreated cells in terms of both transcript and protein and this regulation was dose - dependent, as reported in figures 2(a) and 2(b). Same results were revealed for the arg-1 and cd206 mrna of lps treated bv-2 microglial cells pre - treated with folic acid (figure 2(a)). The role played by folic acid in cell signalling induced by 12 h lps stimulation was also investigated . For this purpose, we firstly investigated nf-b activation . Since the degradation of ib- is essential for the nuclear translocation of nf-b p65, we determined the effect of folic acid on lps - induced phosphorylation of the ib- protein, by western blotting . Cells stimulated with lps exhibited a significantly increased p - ib expression in comparison to controls (figure 3). Densitometric analysis revealed a faint phosphorylation of ib in unstimulated cells (figure 3). Pretreatment with folic acid significantly dose - dependently reduced p - ib- in lps - activated cells, as reported in figure 3 . In addition to the nf - kb pathway, the effect of folic acid on the activation of the erk 1/2, jnk, and p38 pathways was examined in lps - activated microglia cells using western blotting analysis . As shown in figures 4(a) and 4(b), folic acid significantly increased lps - induced phosphorylation of p38 kinase in bv-2 cells in a concentration - dependent manner, whereas jnk phosphorylation was dose - dependently reduced by folic acid (figures 4(a) and 4(d)). Conversely, erk 1/2 kinases phosphorylation was not affected by folic acid treatment (figures 4(a) and 4(c)). Finally, the amounts of total erk 1/2, jnk, and p38 were unaffected by lps in combination with folic acid treatment . These results suggest that folic acid could modulate lps - induced inflammatory mediatory production through regulating multiple signalling pathways . To confirm the role of p38 on il-10 overproduction by 24 h lps activated cells, pretreated with folic acid (50 g / ml), the cytokine expression levels were analyzed by elisa . As shown in figure 5, treatment with the p38 pharmacological inhibitor, sb203580 (10 m), induced a significant decrease of il-10 levels with respect to both lps - stimulated cells in presence of folate and cells treated with folic acid alone, highlighting the important role of p38 kinase in the upregulation of il-10 production by folic acid treatment . Conversely, lps treatment determined a significant downregulation of the expression levels of socs proteins in bv-2 cells in comparison to control, according to that reported in literature . Cell treatment with folic acid alone increased, in a dose - dependent manner, both socs1 and socs3 expression levels in bv-2 cells . Interestingly, folic acid pretreatment before lps stimulation was able to prevent the lps - induced inhibition, as reported in figure 6(a). Finally, the qpcr analysis revealed a significant increase of socs1 and socs3 transcripts in lps - activated bv-2 cells submitted to folate pretreatment (figure 6(b)). In this study we show, for the first time, that folic acid pretreatment was able to polarize proinflammatory responses to anti - inflammatory responses in lps - activated microglia cells, blocking the activation of nf-b and jnk and upregulating p38 mapk phosphorylation . The modulation of signaling pathways may also be related both to a potent inhibitory effect of folic acid on the expression of inos, as well as of no, il-1, and tnf- production induced by lps, and to an upregulating action on anti - inflammatory cytokine il-10 release in activated microglia . Finally, we also demonstrated that folic acid was able to dose - dependently upregulate socs proteins expression in microglia cells . The hallmark of neuroinflammation is the activation of microglia and the production of cytokines and inflammatory mediators including no, tnf-, il-1, il-6, and inf-, which can trigger neuronal damage [9, 1517]. In the substantia nigra of parkinson's diseases patients an increased density of microglial cells expressing inos has been observed, which is considered responsible for no derived neuronal toxicity [19, 20]. In addition, proinflammatory cytokines, such as tnf-, il-1, and inf-, are described to cause a potent activation of inos . In this context, the deletion of inflammatory inos using gene targeting has been shown to have a neuroprotective effect in mptp - treated mice [22, 23]. Interestingly, our findings demonstrated that folic acid treatment significantly inhibited in a dose - dependent manner no, tnf-, and il-1 production in lps - activated bv-2 cells . In addition, reduced no production was dose - dependently modulated by folic acid through a downregulation of inos expression . Several intracellular signal molecules are involved in the regulation of the inflammatory responses, such as the mapks, a group of serine / threonine protein kinases comprising three subfamilies: the p42/p44 erks, jnks, and the p38 [24, 25]. Mapk signaling pathways regulate a variety of cellular activities such as proliferation, differentiation, apoptosis, survival, and inflammatory responses [26, 27]. Mapks can be activated by various extracellular molecules, such as lps, leading to the activation of transcription factors, including nf - kb which orchestrates the induction of many inflammatory cytokines [2830]. In this regard, our results showed that folic acid was able to dose - dependently downregulate jnk phosphorylation in lps - stimulated cells . Similar effects have been reported on raw264.7 macrophages, in which folic acid treatment inhibited lps - stimulated jnk phosphorylation, resulting in the inhibition of proinflammatory responses . Intriguingly, our results showed that p38 phosphorylation resulted enhanced by folic acid treatment in a dose - dependent manner . Considering the importance of mapk signaling in the regulation of inflammatory responses we proceeded to investigate the role of p38 in the il-10 overregulation after folic acid treatment of lps - activated microglia cells . For this purpose, we examined the effect of the p38 pharmacological inhibitor, sb203580, and observed how il-10 production was significantly reduced in folic acid treated cells, suggesting a crucial role for p38 phosphorylation in the il-10 modulation . In this context, the p38 pathway has been reported to be important for il-10 induction in tlr - activated antigen - presenting cells as well as in lps - stimulated b cells . Il-10 is a potent anti - inflammatory cytokine able to inhibit the production of endotoxin - inducible proinflammatory cytokines such as tnf-, il-1, and il-6 in mononuclear phagocytes . It has been shown that il-10 interferes with the activation of nf - kb, and this activity has been correlated with its ability to block the synthesis of other proinflammatory cytokines . Then, it is possible to postulate that, in our in vitro model, folic acid treatment of bv-2 cells determined a p38-dependent increase of il-10, which in turn was able to block nf - kb activation . Il-10 has also been shown to induce the expression of socs1 and socs3 and this upregulation is thought to be one of the mechanisms by which il-10 mediates its downstream effects [11, 35]. Moreover, it has been reported that il-10 induces the expression of socs3 in monocytes . In addition, forced expression of the socs3 gene in myeloid cell lines markedly inhibits cytokine - induced activation of the jak / stat signaling pathway, indicating that il-10 may inhibit the production of proinflammatory cytokines, as observed in monocytes . Socs1 and socs3 have received increasing attention due to their pivotal roles in regulating immune responses, which result from the fatal effects of a deficiency of either protein [37, 38]. It has been reported that both socs1 and socs3 directly bind nf-b p65, leading to its proteolysis and the suppression of nf-b activation [3941]. Interestingly, socs1 and socs3 have also been shown to regulate m1 and m2 macrophage polarization [42, 43]. In this regard, it was observed that socs1 is necessary to limit the m1 phenotype in response to ifn-/lps stimulation . Socs1-deficient mice resulted hypersensitive to lps signaling, as shown by an enhanced ib phosphorylation demonstrating the role of socs1 as a negative regulator of tlr-4 signaling . Similarly to m1 macrophage, microglia cells also respond to insults by transiently activating the release of tnf-, no, and other pro - inflammatory mediators in order to eliminate pathogenic insults . Brain barrier, leukocyte recruitment, a leukocyte and lymphocyte influx, and typical hallmarks of neurodegenerative diseases [47, 48]. To ensure wound healing, microglia must rapidly return to a resting m2-like state, attenuating the inflammatory response and assuring homeostasis . M2-polarized microglia secrete anti - inflammatory factors, including il-10, as well as expressing socs proteins . Failure to shift to a m2 microglia phenotype or a predominance of m1-polarized microglia is associated with worsening tissue damage and neuronal loss, suggesting that m2-polarized microglia act as gate - keepers against neuroinflammation [46, 4951]. In vivo socs1 overexpression in oligodendrocytes suppresses deleterious actions observed in experimental autoimmune encephalomyelitis, as well as attenuating socs1 expression in microglia - promoted proinflammatory m1-like microglia and worsening neuroinflammation, suggesting that socs1 plays a crucial role in modulating cytokine responses and might be a promising therapeutic modulator in cns disease states . Socs3 expression resulted enhanced in rat cerebral cortex following a cortical impact injury and in the hippocampus following lithium - pilocarpine - induced seizure [53, 54]. These observations underline the importance of socs1 and socs3, among the socs family members, in regulating innate immune responses in cns . Although in literature a number of reports have described the anti - inflammatory effects of folic acid, there is a paucity of information regarding the modulation of socs proteins by folic acid in microglia cells [8, 13]. Our study demonstrated that folic acid significantly attenuated the release of proinflammatory mediators in lps - activated microglia, blocking nf-b, and overregulating il-10 dependent socs proteins expression through p38 pathways (figure 7). Thus, we propose that upregulation of socs1/3 expression by folate may be an integrated part of the regulatory machinery of inflammatory responses in activated microglia and that at least two distinct pathways may lead to this result . Further in vivo studies of this activity could be useful to investigate the mechanisms involved in the anti - inflammatory actions of folate in order to permit their full exploitation and further explore their promise as therapy in neuroinflammatory diseases.
Clinical professions are often concerned not only with knowledge acquisition, but also with achievement of skills and their application . In clinical dentistry, the ultimate goal is to acquire the essential skills, so students must become familiar with the pattern of clinical skills and an appropriate condition should be provided for their education and improvement . Proper acquisition of clinical skills requires time, patience, and practice in a proper context . Since medical and dental schools have the duty of training students to become dedicated and skilled workforce, its profound impact and significant role in providing health care cannot be overemphasized . Clinical training of dental students directly affects the health and treatment of oral and dental diseases in the society; therefore, not only is the students motivation and effort effective in their learning process, but also presence of experienced and caring educators together with the existing facilities in each department has a significant role in their education . Since assessment of the students perspective is one of the necessary elements of effective educational quality evaluation, the results obtained from evaluating the qualitative and quantitative status of the departments via assessing students viewpoints in clinical courses better helps to identify the strengths and weaknesses associated with each department . Therefore, awareness of the level of students satisfaction or dissatisfaction from the teaching methods implemented in each department is a determining factor in the improvement of future performance in different departments . So far, a variety of researches have been done, working on different methods for creating learning motivations among students, evaluating the performance of both students and instructors and assessing academic competence of the learners . Ghapanchi et al . Examined the level of patient satisfaction at shiraz dental school and the results suggest that although the majority of patients were pleased with the delivered services, there are still weaknesses in the fields of students practical skills, pain control, and the ability to communicate with patients . Furthermore, a number of surveys evaluating the training of practical skills were conducted at qazvin and esfahan university of medical sciences . With regard to this review, the students and trainers views, which are considered as the main elements of clinical education, could have an effective role in clarifying the strengths and weaknesses of the clinical environment and educational planning . As a result, assessing students and trainers views could be helpful in improving the quality of education . This investigation was aimed at assessing the status of clinical education as viewed by the students of shiraz dental school . In this cross - sectional survey, a questionnaire consisting 23 standardized questions, 17 questions numbered 04 and 6 questions numbered 05 according to the likert scale, was used . All the juniors and seniors of shiraz school of dentistry were invited to complete the questionnaires . Among the collected forms, demographic information included the students year of entrance in dental education and his / her total average grade . The questions were categorized into four subgroups to evaluate the students perspective in the following four areas: level of knowledge among the academic staffattitude of clinical faculty members and that of the personnel toward the studentsclinical facilitiesoverall students satisfaction in each of the 11 departments . Level of knowledge among the academic staff attitude of clinical faculty members and that of the personnel toward the students overall students satisfaction in each of the 11 departments . All the items in the questionnaire were constructed and standardized in terms of validity and reliability . Face and content validity were confirmed by a group of five experts including an orthodontist, a specialist in restorative dentistry, an endodontist, a general dentist and an education expert . Questionnaires were evaluated in terms of the year of entrance (5 and 6 year) and total average grade (grade <17/20, grade 17/20). This study was conducted using spss version 17 (chicago, il, usa) for statistical analysis . Tukey test, pearson correlation coefficient, and two sample t - tests were used . This study was conducted using spss version 17 (chicago, il, usa) for statistical analysis . Tukey test, pearson correlation coefficient, and two sample t - tests were used . A total of 168 fully completed questionnaires were entered in our study . In all items including proper time planning, presence of a regular educational program in each department, relevance between the contents of theoretical lessons and practical courses, mastery in providing theoretical as well as practical training programs, quality and quantity of the equipment, and overall students satisfaction from each department maximum satisfaction was shown in removable prosthodontics and orthodontics departments whereas minimum satisfaction was scored to oral surgery and comprehensive treatment departments [figure 1, tables 1 and 2]. Comparison of average clinical quality scores of different departments comparison of scores among different departments of shiraz school of dentistry average score for clinical quality in different departments in the majority of items including educators supervision and guidance over students performance, respecting the principles of infection control by both the clinical educators and the personnel and mastery of students in practical skills, removable prosthodontics and orthodontics departments obtained the highest scores whereas lowest score levels were related to comprehensive treatment department [table 2]. In all the departments, personnels respectful attitude toward the students had the highest score whereas minimum grade was given to stressful workload and overall satisfaction in each department [table 1]. There was no significant correlation between year of entrance in dental education (5 and 6 year) and average satisfaction scores (p = 0.126) [table 3]. Average satisfaction scores among 5 and 6 year students no significant correlation was reported between students total average grade and average satisfaction scores from departments (p> 0.05). The results showed that the highest level of student satisfaction belonged to removable prosthodontics and orthodontics departments, and the lowest level was scored to the oral surgery and the comprehensive treatment departments . In a study conducted by janda et al . At california university in 1996, the level of newly graduates expectations from their occupational future was evaluated . In another survey done by alvesalo in finland, the level of patients satisfaction from the delivery of dental health care services was assessed . The result was 6094% positive; however, 54% claimed that the fees were too high . A survey conducted by shetty et al . On 45 dental students in india revealed that> 95% of the graduates were satisfied with the curriculum and between 60% and 90% of the students admitted that the various components of teaching - learning process has been adequate . Furthermore, the overall result suggests that despite the fact that educational programs have been satisfactory according to many students, there are still areas of shortcomings and concerns that need improvement . In a study by patel et al ., students reported that the time spent training the practice of medicine, especially medical economics has been inadequate . A higher - intensity curriculum in health care systems may hold substantial potential to overcome these perceptions of training inadequacy . Amini et al . At the tabriz university of medical sciences and health services assessed the interns viewpoints regarding their competency level in performing basic clinical procedures as well as the effect of learning opportunities on their competency level . The results showed that the mean level of skills for the general techniques was 51.4% . Moreover, the students claimed that they have learnt most of the techniques through observation; besides that, most of them performed the procedures without direct supervision of teachers or residents . Furthermore, the satisfaction of medical trainees and interns from different aspects of education such as educators performance, medical facilities, training methods, variety and number of the patients, and educational locations at isfahan university of medical sciences was assessed and the results indicated that the highest level of satisfaction was related to outpatient training in health centers, clinical teachers performance, training methods, and variety and number of patients, whereas the medical equipment and welfare facilities had the lowest scores . A study conducted by zamanzad et al . Assessed the satisfaction of medical students from quality of education in clinical courses at shahrekord university of medical sciences, and it showed that students were unsatisfied with inadequacy of proper education in teaching rounds, outpatient clinic, and theory courses in major clerkship periods . In contrast, high rate of satisfaction belonged to morning report programs . In a study conducted by amanat et al . At shiraz dental school the highest level of satisfaction, regarding clinical teachers and personnels attitude, was from the pediatrics and periodontics departments and the lowest level of satisfaction regarding the equipment and facilities was from the oral surgery department . An investigation done at the mashhad university of medical sciences evaluated the acquisition of practical skills among medical students . The results revealed that the existing status of medical students capabilities is far from the optimal situation . This educational deficit was mostly in essential skills and emergency knowledge for saving patients lives . In a study conducted at qazvin university of medical sciences, in an evaluation of clinical teaching from the viewpoints of residents, interns, and trainees of internal departments, 72.7% of residents, 67.04% of interns and 63.4% of trainees, reported the clinical teaching to be satisfactory . According to eslamipour's survey, assessing dental students satisfaction of clinical departments at isfahan dental school, the highest level of student satisfaction belonged to the periodonctics and orthodontics departments whereas the lowest score in student satisfaction was given to endodontics and prosthodontics departments . Borhan - mojabi also evaluated the dental clinical educational status from the perspective of both the clinical educators and the students at qazvin university of medical sciences . The results showed that almost half of the students reported good performance of the departments of pediatrics, oral diseases, radiology, pathology and restorative departments, moderate performance of prosthodontics, oral surgery, endodontics, and periodontics departments and poor performance of orthodontics department . In this survey, the results indicate that the highest level of overall students satisfaction is from the removable prosthodontics and orthodontics departments, and the lowest level belongs to the comprehensive treatment and oral surgery departments . In comparison with a similar study conducted 3 years ago, the level of student satisfaction from orthodontics and removable prosthodontics has increased whereas the level of satisfaction from pediatrics, periodontics, and comprehensive treatment has declined . It could be said that the high performance of the orthodontics department is possibly related to the fact that expectations from the students are being clearly defined; other contributing factors are high accountability of the academic staff, respectful attitude of the personnel toward the students, and different viewpoints among the educators . However, the most important factor is considered to be the presence of skilled and experienced educators along with younger faculty members, indicating a proper management system . The result of this survey is in contrast with mojaby's findings which were indicative of poor performance of the orthodontics department . Moreover, the reason for promotion of the removable prosthodontics department, in comparison with a similar study conducted 3 years ago, could be related to all the previously mentioned reasons besides the coordination and high relevance between the implemented educational programs in the department with the curriculum of the ministry . The low level of overall student satisfaction from the comprehensive treatment department could be due to recent establishment of the department, insufficiency of the equipment, inadequacy in the number of the faculty members, and lack of enough time for clinical practice . The low scores of the two departments of pediatrics and periodontics could be related to replacement of skilled, experienced educators with the younger less experienced members, poor educational programming and lack of enough motivation among the professors . Also, students current level of satisfaction from the oral surgery department can be attributed to the improvement in the application of new teaching methods, direct tutors supervision during and after each procedure, and the altered policy for increasing the number of academic members and the change in the educational program, all of which occurred during the last 3 years . The low level of satisfaction from the prosthodontics and endodontics departments in other studies, similar to the current study, could be due to the stress and heavy workload, lack of adequate financial resources, and insufficient equipment in these departments . It is worth changing the program of the postgraduate students in a way that leads to their participation in the undergraduate training program . Moreover, the policy of increasing employment of the specialists in these fields should be subject to revision by the university officials . On the other hand, the reduction in the student satisfaction level from the pediatrics department of shiraz dental school during the past 3 years might be due to quitting of some of the more experienced faculty members, and this could be the result of some general university policies which requires serious revision . The moderate performance of the oral surgery and restorative departments, similar to the studies conducted by eslamipour and farinaz and borhan - mojabi, also demands more attention from ministry authorities to major dental departments such as oral surgery, endodontics, restorative and periodontics, in order to increase the scientific capability of dental students in these fields, which is extremely important in the dental health care system . Regarding the results, the highest level of student satisfaction was from removable prosthodontics and orthodontics departments and the least amount of satisfaction was from a comprehensive treatment and oral surgery departments . Compared to a previous study conducted 3 years ago, the level of student satisfaction from orthodontics and prosthodontics departments has raised, whereas there has been a decrease in satisfaction for the pediatrics, periodontics, and comprehensive treatment departments.
As a country develops, the types of diseases that affect its population shift from primarily infectious, such as diarrhea and pneumonia, to primarily noncommunicable diseases, such as cardiovascular disease (cvd), obesity, and cancer.1 the global burden of cvd has increased, mostly in wealthy countries . However, many low and middleincome countries now face a growing burden from the modern health risks (physical inactivity, tobacco), while still fighting an unfinished battle with traditional health risks (undernutrition, sanitation).1, 2, 3 cvds are now the leading cause of mortality in the world, causing 17.5 million deaths in 2012, which represented 31% of total global mortality.4 in france, cvds are the second major cause of mortality the first among women and represent nearly one third (28%) of total mortality.5 optimistically, simple and costeffective measures such as dietary changes could reduce the obesity epidemic and the resultant cvd burden, as it has been estimated that lifestyle choices can account for up to 40% of premature cvd deaths.5 in the past few decades, associations between individual nutritional factors and chronic diseases, especially cvd, have been widely investigated . More recently, alternative approaches that consider the whole diet (for example, dietary indices reflecting diet quality) have been used, making it feasible to capture nutrient interactions in the food matrix.6, 7 in particular, the adherence to a traditional mediterranean dietary pattern, including a high consumption of plant foods and olive oil, low intakes of saturated fat and sugar, and a low / moderate consumption of wine, has been associated with a lower risk of cvd and mortality in many epidemiological studies,8, 9 as well as with lower levels of inflammation.10, 11, 12 indeed, the association between inflammatory mechanisms and the development of cvd has been largely brought to light.13, 14, 15 inflammatory pathways promote thrombosis, a late complication of atherosclerosis responsible for myocardial infarctions (mi) and most strokes.14 to assess the adherence to a dietary pattern, several dietary scores or indices have been developed, such as the dietary inflammatory index (dii). This index was developed in 200916 and then updated in 2014.17 the dii aims to measure the inflammatory potential of the diet based on the pro and antiinflammatory properties of its various components, including macronutrients, vitamins, minerals, flavonoids, specific food items, and energy intake, according to the existing literature based on tissue culture, and animal and human studies . To our knowledge, only 3 published studies have investigated the association between the dii and the risk of cardiovascular disease . All 3 studies reported a protective role of a more antiinflammatory diet.18, 19, 20 these recent studies have begun to fill an important gap in understanding the relationship between systemic inflammation a phenomenon with multiple underlying causes and cardiovascular disease, by focusing specifically on diet, which appears to be a key modifiable factor involved in inflammatory pathways.10, 11, 12 additionally, to the best of our knowledge, no study has yet investigated the association of the dii with the incidence of specific cvd subtypes . In order to contribute to filling this research gap, we assessed the prospective association between the inflammatory potential of the diet, as measured by the dii, and the incidence of overall cvd and subtypes of cvd namely, mi; strokes; angina pectoris and revascularization interventions in a large cohort of french adults with a longterm followup . Subjects were selected from the supplmentation en vitamines et minraux antioxydants (su.vi.max) study . The su.vi.max study was a randomized, doubleblind, placebocontrolled primary prevention trial conducted between 1994 and 2002 . It included 12 741 french adults (women aged 3560 years and men aged 4560 years). Its primary aim was to evaluate the potential efficacy of daily supplementation with antioxidant vitamins and minerals (ascorbic acid, vitamin e, carotene, selenium, and zinc) delivered at nutritional (ie, nonpharmacologic) doses on the prevention of cancer, ischemic heart disease, and overall mortality.21 the trial phase ended in 2002 and health events monitoring was pursued until september 2007 . The su.vi.max study was registered at clinicaltrials.gov (number nct00272428) and was conducted according to the guidelines laid down in the helsinki declaration of 1975 as revised in 1983, and was approved by the ethics committee for studies with human participants of pariscochin hospital (ccpprb no . All subjects provided written informed consent . In this analysis, we selected men and women who provided at least 3 valid 24hour dietary records during the first 2 years of followup (n=8108) and who had no missing data for covariables (7743) to be included in the models (figure). Selection of participants for our analyses, su.vi.max study, france . Cvd indicates cardiovascular diseases; dii, dietary inflammatory index; su.vi.max, supplmentation en vitamines et minraux antioxydants . Throughout the entire su.vi.max study trial phase (19942002), participants were asked to provide a 24hour dietary record every 2 months, for a total of 6 records per year covering all days of the week and all seasons of the year . For these analyses, mean dietary intakes were calculated across all available, valid 24hour dietary records obtained during the first 2 years of followup, in order to obtain a proxy for habitual dietary intakes . Dietary records were considered invalid if energy intake was <100 or> 6000 kcal / day . Additionally, men reporting <800 kcal / day and women reporting <500 kcal / day across one third or more of records were excluded to account for energy underreporting . An instruction manual including validated photographs of generic foods and portion sizes was provided to facilitate coding food portions.22 a food composition table was used to estimate nutrient intake.23 we used the dii to determine the inflammatory potential of the diet . This index relies on information contained in 1943 published studies reporting association between nutritional factors and inflammatory markers.17 briefly, points were assigned to every food parameter on the basis of relevant articles found in the literature, according to whether each food parameter increased (+ 1), decreased (1), or had no (0) effect on 6 inflammatory biomarkers: interleukin1b, interleukin4, interleukin6, interleukin10, tumor necrosis factor, and creactive protein . The dii computed from the 24hour records in this study includes data on 36 of the 45 food parameters comprising the dii: carbohydrate, protein, total fat, energy, alcohol, fiber, cholesterol, saturated fatty acids, monounsaturated fatty acids, polyunsaturated fatty acids, omega 3, omega 6, niacin, thiamin, riboflavin, vitamin b6, vitamin b12, iron, magnesium, vitamin a, vitamin c, vitamin d, vitamin e, folic acid, carotene, anthocyanidins, flavan3ol, flavonols, flavonones, flavones, isoflavones, garlic, ginger, pepper, onion, and tea . Dietary intakes for these parameters were first standardized using a world mean and sd, derived from nutritional databases from 11 populations around the world, then transformed to percentiles and multiplied by literaturederived inflammatory points for each food parameter, then summed up . Dii scores were computed on the basis of participantspecific mean nutrient and food intakes, which were obtained by averaging intakes across all available dietary records, as explained in the first paragraph of the dietary data section (ie, dii scores were not first calculated per day and then averaged). More details on the score computation can be found elsewhere.17 information about health was selfreported via a monthly questionnaire during the followup . Other sources of information regarding outcome included yearly clinical examinations . In case of no contact with a participant for a long period, or nonattendance at the yearly visit, an investigation was launched to determine the reasons . In case of a suspected event, investigations were conducted to obtain relevant medical data (clinical, biochemical, histological, and radiological reports) from participants, physicians, and/or hospitals . All cardiovascular events were reviewed and validated by an independent expert committee, unaware of the supplementation group assignment, and then classified using the international classification of diseases, 10th revision, clinical modification (codes i20i24, i64).24 first, we considered as outcome the occurrence of all cvds . Sociodemographic data, including sex, date of birth, education (primary education only, up to secondary education, higher education), as well as information on marital status (couple or single), smoking status (neversmoked, former or current smoker), and physical activity level were obtained by a (nonvalidated) baseline questionnaire . The items concerning physical activity inquired whether a participant had a regular physical activity, and if yes, whether they estimated this activity to be equivalent to 1 hour of walking per day . Body mass index was calculated using baseline weight and height measurements performed by trained personnel according to standardized procedures, using an electronic scale (seca, hamburg, germany) and a wallmounted stadiometer . Subjects contributed persontime up to the date of the cardiovascular event (n=292), death (n=193), the last completed questionnaire or last contact (n=1704) or september 1, 2007 (n=5554), whichever occurred first . For analyses concerning subclasses of cvd, participants who reported another cvd event than the one studied during followup were included as noncases for the studied cvd and censored at the date of that diagnosis . Nutritional intakes were energyadjusted using the residual method,25 and thus presented as adjusted (least squares) means with 95% ci . Values for all other quantitative variables were presented as means (sd), and values for qualitative variables as percentages . We estimated hazard ratio (hr) of cvd risk and 95% cis both for the continuous dii score and for quartiles of dii scores, using cox proportional hazard models.26 graphic methods (log log [survival] versus log time plots) were used to check for proportional hazards assumptions for this study . The lowest quartile of dii score (q1, reflecting the most antiinflammatory diet) was used as the reference category . The first model was crude (model 0), with only age as the timescale in the cox model . A second model was adjusted for age (timescale in the cox model), sex, and daily energy intake without alcohol (continuous, in kcal / day) (model 1). A multivariate model was further adjusted for number of available 24hour dietary records (continuous), smoking status, physical activity, education level, marital status, and treatment allocation group (placebo or active) (model 2our main model). Two additional models (3a and 3b) were created in order to verify whether our results would remain stable even when adjusting for baseline body mass index (continuous, in kg / m) and for alcohol intake (continuous, in g / day), respectively . The reason why model 3b was, in addition to body mass index, further adjusted for alcohol intake is that alcohol consumption is considered in a linear manner for the computation of the dii score while only moderate alcohol consumption is associated with a reduced cvd risk.27 the same models were used for both overall cvds and analyses focused on cvd subtypes . In order to verify the robustness of our findings first, we reanalyzed our data after removing participants who developed a cardiovascular event during the first 2 years of followup . Second, we selected only participants with at least six 24hour records during the first 2 years of followup in order to improve the accuracy of nutritional estimates . Finally, we repeated our analyses with a dii score in which dietary intakes for all parameters were first adjusted for overall energy intake, using the energy density method ([crude intakes / total energy intake]1000), named dii 2 . All tests were 2sided and p<0.05 was considered statistically significant, except for interaction tests for which statistical power is often weak in observational studies.28 thus, p<0.10 was applied for these models . Interactions between the dii score (modeled both as a continuous variable and as quartiles) and sex and intervention group were investigated . All analyses were performed using sas software (version 9.3; sas institute inc, cary, nc). Subjects were selected from the supplmentation en vitamines et minraux antioxydants (su.vi.max) study . The su.vi.max study was a randomized, doubleblind, placebocontrolled primary prevention trial conducted between 1994 and 2002 . It included 12 741 french adults (women aged 3560 years and men aged 4560 years). Its primary aim was to evaluate the potential efficacy of daily supplementation with antioxidant vitamins and minerals (ascorbic acid, vitamin e, carotene, selenium, and zinc) delivered at nutritional (ie, nonpharmacologic) doses on the prevention of cancer, ischemic heart disease, and overall mortality.21 the trial phase ended in 2002 and health events monitoring was pursued until september 2007 . The su.vi.max study was registered at clinicaltrials.gov (number nct00272428) and was conducted according to the guidelines laid down in the helsinki declaration of 1975 as revised in 1983, and was approved by the ethics committee for studies with human participants of pariscochin hospital (ccpprb no . In this analysis, we selected men and women who provided at least 3 valid 24hour dietary records during the first 2 years of followup (n=8108) and who had no missing data for covariables (7743) to be included in the models (figure). Cvd indicates cardiovascular diseases; dii, dietary inflammatory index; su.vi.max, supplmentation en vitamines et minraux antioxydants . Throughout the entire su.vi.max study trial phase (19942002), participants were asked to provide a 24hour dietary record every 2 months, for a total of 6 records per year covering all days of the week and all seasons of the year . For these analyses, mean dietary intakes were calculated across all available, valid 24hour dietary records obtained during the first 2 years of followup, in order to obtain a proxy for habitual dietary intakes . Dietary records were considered invalid if energy intake was <100 or> 6000 kcal / day . Additionally, men reporting <800 kcal / day and women reporting <500 kcal / day across one third or more of records were excluded to account for energy underreporting . An instruction manual including validated photographs of generic foods and portion sizes was provided to facilitate coding food portions.22 a food composition table was used to estimate nutrient intake.23 we used the dii to determine the inflammatory potential of the diet . This index relies on information contained in 1943 published studies reporting association between nutritional factors and inflammatory markers.17 briefly, points were assigned to every food parameter on the basis of relevant articles found in the literature, according to whether each food parameter increased (+ 1), decreased (1), or had no (0) effect on 6 inflammatory biomarkers: interleukin1b, interleukin4, interleukin6, interleukin10, tumor necrosis factor, and creactive protein . The dii computed from the 24hour records in this study includes data on 36 of the 45 food parameters comprising the dii: carbohydrate, protein, total fat, energy, alcohol, fiber, cholesterol, saturated fatty acids, monounsaturated fatty acids, polyunsaturated fatty acids, omega 3, omega 6, niacin, thiamin, riboflavin, vitamin b6, vitamin b12, iron, magnesium, vitamin a, vitamin c, vitamin d, vitamin e, folic acid, carotene, anthocyanidins, flavan3ol, flavonols, flavonones, flavones, isoflavones, garlic, ginger, pepper, onion, and tea . Mean and sd, derived from nutritional databases from 11 populations around the world, then transformed to percentiles and multiplied by literaturederived inflammatory points for each food parameter, then summed up . Dii scores were computed on the basis of participantspecific mean nutrient and food intakes, which were obtained by averaging intakes across all available dietary records, as explained in the first paragraph of the dietary data section (ie, dii scores were not first calculated per day and then averaged). Other sources of information regarding outcome included yearly clinical examinations . In case of no contact with a participant for a long period, or nonattendance at the yearly visit, an investigation was launched to determine the reasons . In case of a suspected event, investigations were conducted to obtain relevant medical data (clinical, biochemical, histological, and radiological reports) from participants, physicians, and/or hospitals . All cardiovascular events were reviewed and validated by an independent expert committee, unaware of the supplementation group assignment, and then classified using the international classification of diseases, 10th revision, clinical modification (codes i20i24, i64).24 first, we considered as outcome the occurrence of all cvds . Sociodemographic data, including sex, date of birth, education (primary education only, up to secondary education, higher education), as well as information on marital status (couple or single), smoking status (neversmoked, former or current smoker), and physical activity level were obtained by a (nonvalidated) baseline questionnaire . The items concerning physical activity inquired whether a participant had a regular physical activity, and if yes, whether they estimated this activity to be equivalent to 1 hour of walking per day . Body mass index was calculated using baseline weight and height measurements performed by trained personnel according to standardized procedures, using an electronic scale (seca, hamburg, germany) and a wallmounted stadiometer . Subjects contributed persontime up to the date of the cardiovascular event (n=292), death (n=193), the last completed questionnaire or last contact (n=1704) or september 1, 2007 (n=5554), whichever occurred first . For analyses concerning subclasses of cvd, participants who reported another cvd event than the one studied during followup were included as noncases for the studied cvd and censored at the date of that diagnosis . Nutritional intakes were energyadjusted using the residual method,25 and thus presented as adjusted (least squares) means with 95% ci . Values for all other quantitative variables were presented as means (sd), and values for qualitative variables as percentages . We estimated hazard ratio (hr) of cvd risk and 95% cis both for the continuous dii score and for quartiles of dii scores, using cox proportional hazard models.26 graphic methods (log log [survival] versus log time plots) were used to check for proportional hazards assumptions for this study . The lowest quartile of dii score (q1, reflecting the most antiinflammatory diet) was used as the reference category . The first model was crude (model 0), with only age as the timescale in the cox model . A second model was adjusted for age (timescale in the cox model), sex, and daily energy intake without alcohol (continuous, in kcal / day) (model 1). A multivariate model was further adjusted for number of available 24hour dietary records (continuous), smoking status, physical activity, education level, marital status, and treatment allocation group (placebo or active) (model 2our main model). Two additional models (3a and 3b) were created in order to verify whether our results would remain stable even when adjusting for baseline body mass index (continuous, in kg / m) and for alcohol intake (continuous, in g / day), respectively . The reason why model 3b was, in addition to body mass index, further adjusted for alcohol intake is that alcohol consumption is considered in a linear manner for the computation of the dii score while only moderate alcohol consumption is associated with a reduced cvd risk.27 the same models were used for both overall cvds and analyses focused on cvd subtypes . In order to verify the robustness of our findings first, we reanalyzed our data after removing participants who developed a cardiovascular event during the first 2 years of followup . Second, we selected only participants with at least six 24hour records during the first 2 years of followup in order to improve the accuracy of nutritional estimates . Finally, we repeated our analyses with a dii score in which dietary intakes for all parameters were first adjusted for overall energy intake, using the energy density method ([crude intakes / total energy intake]1000), named dii 2 . All tests were 2sided and p<0.05 was considered statistically significant, except for interaction tests for which statistical power is often weak in observational studies.28 thus, p<0.10 was applied for these models . Interactions between the dii score (modeled both as a continuous variable and as quartiles) and sex and intervention group were investigated . All analyses were performed using sas software (version 9.3; sas institute inc, cary, nc). These analyses included a total of 7743 participants (3197 men and 4546 women). Mean age at baseline (sd) was 51.94.7 and 47.16.6 years for men and women, respectively . Baseline characteristics of the study population are presented by sexspecific quartiles of the dii in table 1 . Given the relatively large size of our sample, the following comparisons of characteristics across quartiles should be interpreted with caution, as not every statistically significant result is biologically and clinically meaningful . Compared to those with a lower dii score (q1), reflecting an antiinflammatory diet, participants with higher dii scores (q4), (ie, more proinflammatory) were slightly younger, less educated, less physically active, smokers, and less often postmenopausal women . A higher dii score also was associated with slightly higher glycemia, slightly higher total blood cholesterol concentration, and slightly higher blood pressure, both systolic and diastolic . In addition, a higher dii score was associated with lower total daily energy intake, as well as a lower fruit and vegetable consumption, a lower intake of mono and polyunsaturated fatty acids including n3 and n6vitamins (c, e, b6, b9, and b12), carotene, calcium, magnesium, sodium, iron, iodine, potassium, phosphorus, and fibers but a higher intake of saturated fatty acids and a higher alcohol consumption (table 2). Baseline characteristics across sexspecific quartiles of the dii score, su.vi.max study, france (n=7743) values for quantitative variables are means (sd), except for the dii where mean (interquartile range) is presented . Dii indicates dietary inflammatory index; hdl, highdensity lipoprotein; htm, hormonal treatment for menopause; ldl, lowdensity lipoprotein; su.vi.max, supplmentation en vitamines et minraux antioxydants . Oral contraceptive use: 3621; postmenopausal women: 4197; htm medication: 1092; glycemia: 7514; cholesterol: 7669; hdl and ldl cholesterol: 7618; systolic and diastolic blood pressure: 6422 . Nutritional data across sexspecific quartiles of the dii score, su.vi.max study, france (n=7743) values are means (sds) or least squares means (95% ci), as specified . Dii indicates dietary inflammatory index; mufa, monounsaturated fatty acids; pufa, polyunsaturated fatty acids; sfa, saturated fatty acids; su.vi.max, supplmentation en vitamines et minraux antioxydants . Carbohydrate, fat, and protein are presented as percentage of total daily energy intake . Data were energyadjusted using the residual method, and thus presented as least squares means (95% cis). During the 13year followup (mean duration was 11.4 years, corresponding to 87 932 personyears of observation), the distribution was as follows: 93 mi, 58 strokes, 128 angina pectoris and revascularization interventions, and 13 sudden deaths . In the crude model 0, we observed a positive association between the dii score, reflecting a proinflammatory diet, and risk of cvd (hrq4 versus q1=1.73, 95% ci=1.252.39) (table 3). However, this association was no longer observed after adjustment for confounding factors in any of the models (1, 2, 3a, or 3b). Interactions tested between the dii score and sex or intervention group were not significant, whether the dii was modeled as a continuous variable or as quartiles . Association between the dii and incidence of overall cardiovascular disease, su.vi.max study, france (n=7743) the values listed next to model 0model 3b are hazard ratio (95% cis), estimated through cox proportional hazard models, corresponding to sexspecific quartiles of the dii . Model 2: model 1+supplementation group, number of 24h records, education level, marital status, smoking status, and physical activity . Dii indicates dietary inflammatory index; iqr, interquartile range; q, sexspecific quartile; su.vi.max, supplmentation en vitamines et minraux antioxydants . P for trend (obtained by modeling dii quartiles as an ordinal variable). When separating cvds into subclasses (table 4), being in the highest dii score quartile was associated with a higher incidence of mi, as compared to being in the lowest quartile (hrquartile 4 versus quartile 1=2.24, 95% ci: 1.084.67) in the fully adjusted model (model 2), although the hr for a onepointincrease in dii was not statistically significant (hr continuous dii=1.11, 95% ci=0.971.27). No significant relationship was found regarding incidence of cerebrovascular accident or angina pectoris and revascularization intervention . Association between the dii and incidence of subclasses of cardiovascular disease, su.vi.max study, france (n=7743) values are hazard ratio (95% cis), estimated through cox proportional hazard models, corresponding to sexspecific quartiles of the dii . Persontime per quartile (q) in days: q1, 22 432; q2, 22 117; q3, 21 912; q4, 21 471 . Model 2: model 1+supplementation group, number of 24h records, education level, marital status, smoking status, and physical activity . Ap indicates angina pectoris; dii, dietary inflammatory index; mi, myocardial infarction; q, sexspecific quartile; ri, revascularization intervention; su.vi.max, supplmentation en vitamines et minraux antioxydants . Three sets of supplemental analyses were conducted in order to investigate the stability of our results concerning mi . First, when removing participants with cardiovascular events declared during the first 2 years of followup (n=7602), findings were very similar (table 5). Next, when selecting participants with at least six 24hour records (n=6362), findings were strengthened (hrq4 versus q1 for mi risk=3.23, 95% ci=1.377.62), and the hr for a onepointincrease in dii was significantly different from 1.00 (hr continuous=1.18, 95% ci=1.011.38) (table 6). Finally, in analyses using a dii score based on energyadjusted nutritional parameters, the results were broadly consistent with those of our main analysis, although the observed association was weaker (table 7). Association between the dii and incidence of myocardial infarction among participants without early cardiovascular events, su.vi.max study, france (n=7602) values are hazard ratio (95% cis), estimated through cox proportional hazard models, corresponding to sexspecific quartiles of the dii . Model 2: model 1+supplementation group, number of 24h records, education level, marital status, smoking status, and physical activity . Dii indicates dietary inflammatory index; iqr, interquartile range; q, sexspecific quartile; su.vi.max, supplmentation en vitamines et minraux antioxydants . Association between the dii and incidence of myocardial infarction among participants with at least six 24h dietary records, su.vi.max study, france (n=6362) values are hazard ratio (95% cis), estimated through cox proportional hazard models, corresponding to sexspecific quartiles of the dii . Model 2: model 1+supplementation group, number of 24h records, education level, marital status, smoking status, and physical activity . Dii indicates dietary inflammatory index; iqr, interquartile range; q, sexspecific quartile; su.vi.max, supplmentation en vitamines et minraux antioxydants . Association between a dii calculated on the basis of energyadjusted nutritional parameters (dii 2) and incidence of myocardial infarction, su.vi.max study, france (n=7743) values are hazard ratio (95% cis), estimated through cox proportional hazard models, corresponding to sexspecific quartiles of the dii . Model 2: model 1+supplementation group, number of 24h records, education level, marital status, smoking status, and physical activity . Dii indicates dietary inflammatory index; iqr, interquartile range; q, sexspecific quartile; su.vi.max, supplmentation en vitamines et minraux antioxydants . In this large cohort study of middleaged french adults, a prospective association was found between a proinflammatory diet, as reflected by higher dii scores, and the incidence of myocardial infarction over a 13year period, even after adjusting for a wide range of potential confounders including sociodemographic data and lifestyle habits . No statistically significant relationship was observed for overall cvd risk, stroke, or angina pectoris and revascularization intervention incidence . To the best of our knowledge, no previous study had investigated the association between the dii score and different subtypes of cvd . As indicated by the distribution of nutrient intakes by dii quartiles in our study (table 2), lower dii scores do not simply reflect diets with a higher antiinflammatory potential, but also diets that are generally healthier . Thus, our findings also should be interpreted in the light of studies that have found a preventive role of diets with an overall high quality with respect to mi incidence . For example, lower risks of mi were found among individuals exhibiting a healthy diet, as defined by a score above 27 points on a slightly modified version of the smartdiet index in the troms study,29 and defined by being in the top quintile of recommended food score in a prospective cohort of swedish men.30 the mediterranean diet also has been related to a lower mi incidence.31 the dii was associated with increased mi risk but not with other cvd outcomes in our study . A possible explanation could be that inflammation is more strongly linked to mi than other subtypes of cvd . Indeed, the infiltration and retention of lowdensity lipoprotein cholesterol in the arterial intima initiates an inflammatory response in the artery wall, involving the binding of blood cells, especially monocytes, which then differentiate into macrophages and internalize a broad range of molecules including oxidized lowdensity lipoprotein particles . Ultimately, the macrophages are transformed into foam cells, the prototypical cells in atherosclerosis . Several endogenous and microbial molecules can ligate patternrecognition receptors (tolllike receptors) on these cells, leading to the release of proinflammatory cytokines and ultimately to tissue damage . As activated macrophages produce inflammatory cytokines that can destabilize lesions and initiate thrombus formation, all of these inflammatory reactions can finally lead to the activation and rupture of plaques, and mi.13, 14, 15 angina pectoris and revascularization interventions which are generally conducted among highrisk people before any cardiovascular event might reflect the early stages of inflammatory mechanism,14 compared to mi, which reflects the cumulative effect of advancedstage inflammation in the artery . On the other hand, ischemic or hemorrhagic strokes may or may not be linked to mechanisms of inflammation32; nevertheless, it was hard to separate the 2 types in our study . To the best of our knowledge, only 3 other studies have investigated the association between the dii score and overall cvd risk using a prospective design . Two of these studies that were based on the spanish cohorts predimed (prevencin con dieta mediterrnea)18 and sun (seguimiento universidad de navarra)19 have investigated quartiles of the dii, and have found a positive association, showing a linear dose response trend, with overall cvd risk . The respective hr, comparing the fourth with the first quartile, were 1.73 (95% ci=1.152.60),18 and 2.03 (1.063.88),19 respectively . Another study, conducted in a cohort of australian men,20 has investigated the dii as a binary variable (negative versus positive scores); it also found positive dii scores to be associated with an elevated overall cvd risk: odds ratio=2.07 (1.20, 3.55). Other studies have focused on other dietary indexes . For instance, a higher level of adherence to the french dietary guidelines, as reflected in programme national nutrition santguideline score (pnnsgs), was associated with a lower risk of cvd.33 this result is consistent with those obtained examining other diet quality indexes.34, 35 nevertheless, these dietary indices do not focus on the inflammatory potential of the diet, and thus the measured association may reflect different mechanisms of action . Some limitations of this study should be acknowledged . First, the subjects in our analysis, who were volunteers participating in a nutritional intervention study,21 generally had a higher educational level than the general population, and probably a higher general interest in nutrition . Furthermore, we included only participants who had completed at least 3 dietary records during the first 2 years of the study; thus, they may have been particularly compliant and health conscious . Moreover, participants of the su.vi.max cohort were aged between 35 (women) or 45 (men) and 60 years old at baseline . Thus, any generalization of these results to younger or older subjects should be done cautiously; further studies may be needed in other populations . Additionally, the limited number of cases may have impaired our ability to detect some of the hypothesized associations, especially for specific cvd subtypes . Finally, these findings are based on observational data; thus, residual confounding cannot be ruled out . Strengths of the present study include its large sample size and its prospective design, allowing us to assess the association between baseline inflammatory potential of the diet and cvd risk through a long followup period of 13 years . In addition, our clinical and dietary data exhibited a high level of accuracy, with a mean of nine 24hour dietary records per participant . Finally, we used an index that was specifically designed to measure the inflammatory potential of any diet: the dii was based on peerreviewed literature focusing specifically on inflammation; furthermore, this index can be adapted to virtually any dietary assessment method that provides estimates of nutrient intake; and it is standardized to dietary intakes from representative populations around the world, thus facilitating easy quantitative comparisons across studies . The results of this study provide new arguments for dietary prevention of mi, suggesting that favoring antiinflammatory nutritional compounds and limiting proinflammatory foods and nutrients may contribute to lower the risk of mi . This is in line with the major role of inflammation in the development of atherosclerosis, the most important contributor to the growing burden of cvd . The authors responsibilities were as follows: galan, hercberg, and kesseguyot were responsible for developing the concept, design, and protocol of the study and for coordinating data collection; neufcourt performed the statistical analysis and wrote the article; kesseguyot provided methodological guidance and had primary responsibility for the final content; neufcourt, assmann, fezeu, touvier, graffouillre, shivappa, hbert, wirth, hercberg, galan, julia, and kesseguyot were involved in interpreting results and editing the manuscript for important intellectual content . This work was supported by grants from the fondation coeur et artres, the french national research agency (agence nationale de recherche, anr) (grant no . Anr05pnra010) and the french ministry of health (direction gnrale de sant, dgs). Assmann was supported by a doctoral fellowship from the ecole doctorale galile, university of paris 13, sorbonne paris cit . Drs shivappa, hbert, and wirth were supported by the united states national institute for diabetes, digestive and kidney diseases (grant no . Dr james r. hbert owns controlling interest in connecting health innovations llc (chi), a company planning to license the right to his invention of the dietary inflammatory index (dii) from the university of south carolina in order to develop computer and smartphone applications for patient counseling and dietary intervention in clinical settings.
Pelvic organ prolapse (pop) is a major health issue for women, affecting quality - of - life and requiring costly surgery.1,2 pop is an age - related disorder, and the prevalence increases as a population ages . Women who attain the age of 80 years have a greater than 10% risk of requiring surgery to treat pop.3 treatment of genital prolapse in elderly women is challenging and almost always depends on the medical condition and sexual activity level of the patient . Although pessaries are offered as first - line therapy to such patients,4,5 surgery may be indicated for patients who have failed or do not desire the lifelong use of a pessary . Various surgical techniques using laparotomy, laparoscopy, and vaginal surgery, including colporrhaphy (with or without mesh placement), sacrospinous ligament fixation (sslf), abdominal sacrocolpopexy (asc), high sacrouterine ligament fixation, prolapse kit placement, colpocleisis, and constricting surgical procedures, have been utilized . Asc has an 80%85% long - term success rate, while sslf has a 70%75% long - term success rate.6,7 prolapse kits (gynecare prolift; ethicon, inc ., somerville, nj, usa) have a success rate of 96.5%.8 however, all procedures may cause major complications, such as bladder injury, hemorrhage, wound dehiscence, rectal injury, and postoperative vault infection . Asc has disadvantages, including a long operative time, a long recovery time, possible injury to pelvic structures, hemorrhage, and ileus . Sslf also has disadvantages, including the possibilities of hemorrhage, infection, and nerve damage . Prolift kits can have adverse events, such as bladder injury and mesh erosion . On the other hand, obliterative and constrictive surgical procedures have lower levels of complications, a low risk of perioperative morbidity, and an extremely low risk of prolapse recurrence . Patients who are not interested in a functional vagina because they are not sexually active and have no desire to be so active in the future, are the best candidates for obliterative or constrictive vaginal surgery . Various techniques have been described, but lefort colpocleisis is the preferred procedure for obliterative surgery.911 although colpocleisis with uterine preservation is effective, drawbacks are apparent . Other drawbacks include late vaginal bleeding, ureteric occlusion or injury as a result of kinking in the distal ureter, a risk of gynecological cancer, vaginal discharge, and an uncomfortable feeling of fullness in the vagina.12,13 constricting surgical procedures are alternatives avoiding these drawbacks . The goal is to narrow the vaginal tube to close the defect . We performed constricting anterior and posterior colporrhaphy, levator myorrhaphy, and high perineorrhaphy with concurrent hysterectomy, and investigated the feasibility, intraoperative complications, and short - term follow - up results of these constricting procedures in 54 patients aged 75 years or older . We performed constricting anterior and posterior colporrhaphy, levator myorrhaphy, and high perineorrhaphy with concurrent hysterectomy, and investigated the feasibility, intraoperative complications, and short - term follow - up results of these constricting procedures in 54 patients aged 75 years or older . This study was performed at the obstetrics and gynecology department at tepecik training and research hospital . The study was approved by the institutional review board of tepecik education and research hospital and all participants provided informed consent . The hospital database was searched for cases treated between january 2011 and january 2014; we sought women over the age of 75 years who underwent surgery for pelvic floor disorders, with or without incontinence surgery . In total, 202 such women were identified . With the increase in life expectancy, an age of 75 years has been used as a cutoff for elderly in several studies.14,15 we used the same cutoff . Our study inclusion criteria were an age greater than 75 years and surgery for pop stage 2 or higher (figure 1), with vaginal hysterectomy, constricting anterior and posterior colporrhaphy, levator myorrhaphy, and a high perineorrhaphy, with or without a urinary incontinence procedure . A total of 123 patients who underwent other types of pop surgery were excluded . Demographic characteristics, including age, parity, mode of delivery, and the presence / absence of hypertension and diabetes, were recorded . Prolapse assessment was performed by a specialist, using the pop quantification (pop - q) system.16 objective recurrence was defined as stage 2 or higher pop . Subjective recurrence was defined as a perception of prolapse (bulge symptoms) by the patient . Regret and satisfaction were assessed using the decision regret scale pelvic floor disorders (drs - pfd) and satisfaction decision scale pelvic floor disorders (sds - pfd) forms.17 the drs - pfd is a five - item questionnaire with a five - point response scale . The sds - pfd is a six - item questionnaire with a five - point response scale . The pelvic floor distress inventory (pfdi) was used to assess quality of life outcomes.18 pfdi has three subscales: the urinary distress inventory, the colorectal - anal distress inventory, and the pelvic organ prolapse distress inventory . Patient answers are ranked on a likert scale, with 1= not at all, 2= somewhat, 3= moderately, and 4= quite a bit . The mean value of all questions answered is then multiplied by 25 for the actual score (range 0100). The higher the score, the greater the perceived impact that pelvic floor dysfunction has on a patient s life . Results were presented as mean standard deviation (sd) or as median (interquartile range). Preoperatively, all patients underwent a stress test in the standing position, at a bladder volume of 300 ml, with the pessary placed and the prolapse reduced . The results of the cough stress test were recorded as positive if urine loss occurred with a cough, or as negative if no urine loss was noted . They received an intravenous first - generation cephalosporin 1 hour before surgery and underwent a prophylactic antiseptic vaginal wash with iodine - containing soap before surgery . After hysterectomy, the anterior midline of the vaginal cuff was used as the starting point for anterior vaginal wall incision . A full - length and full - width dissection of the anterior vaginal wall from the underlying musculoconnective tissue was performed . After dissection of the vaginal epithelium from the underlying pubocervical fascia, a vicryl #2 suture was placed on the fascias, using a continuous circular clockwise motion . The floor of the bladder was next pushed up as the purse - string suture was tied . Excess vaginal epithelium was excised, and the paravaginal connective tissue and vaginal epithelium were approximated in the midline, using a delayed absorbable suture . After the anterior colporrhaphy, the vaginal cuff was closed with three interrupted 0-dexon sutures . Ovarian ligaments, the round ligaments, and the cardinal and uterosacral ligaments were attached to the vaginal vault to support the vaginal apex . Next, two allis clamps were placed at the 4- and 8-oclock positions of the hymenal ring . The goal of vaginal incision was to allow separation of epithelium from the underlying connective tissue . The plane of separation was continued as far laterally as necessary, in either direction, toward the pelvic sidewall to expose the puborectalis muscle, the bulbocavernosus muscle, and the perineal membrane . Excess vaginal epithelium was excised and the puborectalis muscle, the bulbocavernosus muscle, and the vaginal epithelium approximated in the midline, using a delayed absorbable suture . Finally, the vaginal introital epithelium was approximated with an absorbable running suture, rendering the resultant genital hiatus about 1 cm in length (figure 3). A concomitant transobturator sling operation, using a safyre t (promedon, cordoba, argentina) polypropylene monofilament sling (placed through a separate vaginal incision) was performed in women for whom the stress test was positive . After surgery, saline - soaked gauze was packed into the vagina, and a urethral catheter inserted . Preoperatively, all patients underwent a stress test in the standing position, at a bladder volume of 300 ml, with the pessary placed and the prolapse reduced . The results of the cough stress test were recorded as positive if urine loss occurred with a cough, or as negative if no urine loss was noted . They received an intravenous first - generation cephalosporin 1 hour before surgery and underwent a prophylactic antiseptic vaginal wash with iodine - containing soap before surgery . After hysterectomy, the anterior midline of the vaginal cuff was used as the starting point for anterior vaginal wall incision . A full - length and full - width dissection of the anterior vaginal wall from the underlying musculoconnective tissue was performed . After dissection of the vaginal epithelium from the underlying pubocervical fascia, a vicryl #2 suture was placed on the fascias, using a continuous circular clockwise motion . The floor of the bladder was next pushed up as the purse - string suture was tied . Excess vaginal epithelium was excised, and the paravaginal connective tissue and vaginal epithelium were approximated in the midline, using a delayed absorbable suture . After the anterior colporrhaphy, the vaginal cuff was closed with three interrupted 0-dexon sutures . Ovarian ligaments, the round ligaments, and the cardinal and uterosacral ligaments were attached to the vaginal vault to support the vaginal apex . Next, two allis clamps were placed at the 4- and 8-oclock positions of the hymenal ring . The goal of vaginal incision was to allow separation of epithelium from the underlying connective tissue . The plane of separation was continued as far laterally as necessary, in either direction, toward the pelvic sidewall to expose the puborectalis muscle, the bulbocavernosus muscle, and the perineal membrane . Excess vaginal epithelium was excised and the puborectalis muscle, the bulbocavernosus muscle, and the vaginal epithelium approximated in the midline, using a delayed absorbable suture . Finally, the vaginal introital epithelium was approximated with an absorbable running suture, rendering the resultant genital hiatus about 1 cm in length (figure 3). A concomitant transobturator sling operation, using a safyre t (promedon, cordoba, argentina) polypropylene monofilament sling (placed through a separate vaginal incision) was performed in women for whom the stress test was positive . After surgery, saline - soaked gauze was packed into the vagina, and a urethral catheter inserted . Of these 79 patients, 12 did not respond to phone calls, six patients moved or died, and seven patients did not agree to participate in the study . There was no significant difference between the study group and the nonresponders / nonagreement cohorts in terms of age, body mass index, parity, comorbidities, and stage of prolapse (data not shown). The patients mean (sd) age was 79.7 (2.6) years, the mean (sd) body mass index was 29.14 (3.16) kg / m, and the mean (sd) parity was 3.51 (1.55). Intraoperative complications occurred in only one patient: this was a bladder injury that was identified and repaired intraoperatively (table 2). Three patients fitted with midurethral slings had postoperative voiding difficulties, which spontaneously resolved within 3 days . The mean follow - up time was 24.4 months after constricting surgery (range: 8 to 44 months). The mean sds - pfd score was 4.82, suggesting a high satisfaction (table 3). There were four cases (7%) of de novo urge incontinence (the symptoms resolved with anticholinergic medication). Two patients developed de novo stress urinary incontinence after the procedure and were given midurethral sling surgery . No anatomical (no prolapse beyond hymen) or subjective recurrence of the prolapse was noted during follow up . We found that treatment of advanced prolapse using a constricting technique in elderly women is a feasible, safe, and effective surgical option that may represent an alternative to colpocleisis and other techniques that install mesh or graft material . The complication rates were low, but the operation time and hospital stay rather long in our study . Only one intra - operative complication occurred, and no patient developed prolapse recurrence during follow up . The low complication and high success rates are similar to those of other studies exploring the colpocleisis procedure and new sling techniques . Lu et al12 reported on 63 elderly pop patients of stages 3 or 4 who underwent total or partial colpocleisis . Similarly, zebede et al10 reported a 98.1% anatomical success rate in elderly women after lefort colpocleisis . Cho et al20 showed that the anatomical success rate was 97.1% after total mesh repair using the prolift technique to treat advanced pop in elderly women . Although the complication and success rates were similar to those of obliterative techniques, the mean operating time was longer in our study.12,20 the ultimate decision on the approach and procedure when older women require pop should be based on the overall health, physical activity status, and future sexual activity plans of the patient, as well as on surgeon training, skills, and preference . Colpocleisis is less invasive, requires a shorter operative time, and has fewer surgical risks compared with constricting procedures . When the pelvic anatomy limits or prevents colpocleisis, or if women chose hysterectomy after being provided with detailed information, a constricting anterior and posterior colporrhaphy, with levator myorrhaphy and high perineorrhaphy, is an option in elderly patients at low anesthesiological risk . A decision to perform (or not) an incontinence procedure in such patients is difficult and should be individualized . Patients should be preoperatively evaluated for urinary incontinence and bladder function because the morbidity of postoperative stress incontinence must be balanced against the possibility of urinary retention . Hysterectomy is often suggested and performed at the time of pop repair because most of the common techniques for apical prolapse repair require hysterectomy . In sslf and asc, uterine - sparing procedures correct apical prolapse by attaching the lower uterus or cervix to a support structure . These techniques are not widely used because most surgeons have not been trained to perform them . Also, the common wisdom has been that retaining the uterus increases the risk of recurrent prolapse, although there are no data to support this notion . Hysterectomy eliminates future cervical or intrauterine pathology but causes pelvic neuropathy and disruption of natural support structures . Uterine - sparing surgery has less impact on sexual function and may preserve fertility . In our study group, we performed constricting surgery in 79 (39%) of 202 patients who had no desire to be sexually active . We believe that this high rate of sexual inactivity is attributable to culturally induced religious beliefs in our country, to the effect that sexual activity is for the young . None of our patients reported having had intercourse in the previous 1 year . It has been reported that recurrent anterior vaginal wall prolapse after conventional repair occurs in more than 30% of cases.21 to improve outcomes, synthetic graft materials have been introduced to reinforce native tissues . It has been reported that anterior colporrhaphy with synthetic graft reinforcement significantly reduces anatomical recurrence, but no difference in symptomatic recurrence was noted, and the mesh erosion rate was high . We preferred to not use mesh because of the high mesh erosion rate, and we performed constricting surgery because we did not expect a high recurrence rate . The major limitations of our study are as follows: there was no control group that underwent either standard nonconstricting repair or colpocleisis; preoperative questionnaires were not completed; and all patients were of american society of anesthesiologists anesthesia risk class 1 or 2.22 it may be difficult to perform this procedure in patients of higher anesthesia risk classes . However, the performance of all surgeries by the same surgical team enhanced the validity of our study . Our results indicate that constricting anterior and posterior colporrhaphy, levator myorrhaphy, and high perineorrhaphy with concurrent hysterectomy, is a feasible, safe, and effective surgical option in elderly patients at low anesthesiological risk . The decision to perform an incontinence procedure should be individualized based on preoperative findings after prolapse reduction . Constricting procedures should not be the sole forms of surgery offered for prolapse, being a part of the pelvic surgeon s armamentarium when treatment of severe pop is required.
Sex has long been a popular topic of research among evolutionary biologists . Our personal fascination with the subject is related to the variation that is seen in sexual behavior . This includes the different roles that make up mating rituals, such as courtship traits or preference for the traits, and the variation of these behaviors observed both within and between species . Understanding the biological basis of mating behavior is not only interesting, it is also important for our understanding of evolution as it can shed light on how species boundaries are formed and maintained . Different mating behaviors of closely related species can act as an isolating barrier that stops gene flow between two interbreeding populations . This usually results from closely related species having diverse mating signals: one or both of the sexes fail to identify the other as a suitable mate [14]. For example, males of some species court conspecific females more often or with more vigor than heterospecific females and females mate more readily with conspecific than heterospecific males [6, 7]. The impact of drosophila in this area of research has been pronounced primarily because many obstacles can be bypassed in this system . First, the stereotypical mating behavior observed in this genus is relatively easy to score [810], there are genetic tools available to allow manipulation of the development and physiology of mating behavior, and there is relative ease in housing large numbers of individuals in a uniform environment . Second, many drosophila sister species are only partially isolated in a lab setting, producing viable and fertile hybrids . Males preferentially court conspecific females with larger body sizes, which is a good indicator of female fecundity, and in some species (e.g., d. virilis) males are able to discriminate against heterospecific females . However, it is more often found that males readily court heterospecific females, while females discriminate against heterospecifics males . Females easily prevent unwanted copulations by flying away from the courting male orextruding her ovipositor . Furthermore, mating behavior has been found to be cyclic with alternating bouts of high mating activity and low mating activity; with the use of arrhythmic mutants, it has been shown that females determine when mating occurs . Therefore, in order to understand what isolates species from each other, attention should be focused on female mating behavior . The majority of research in behavioral isolation has been influenced by the modern synthesis, which is a general account of speciation and evolution . The tenants of the modern synthesis state that a population contains genetic variation which is apparent at both the gene level (with multiple alleles produced by random mutation) and at the chromosomal level (with different combinations of alleles within individuals produced by recombination). A population's gene frequencies and allele combinations can change over time through multiple processes, including natural selection and genetic drift . While the contribution of natural selection has been wellsupported, the impact of genetic drift has been debated within the literature . For example, a computer model exploring the development of behavioral isolation via sexual selection and research that employed extreme bottlenecking both showed that genetic drift can rapidly lead to some level of sexual isolation . On the other hand, speciation by genetic drift has been shown to be unlikely to occur [18, 19] because genes for mating behavior are most likely either pleiotropic and directly under natural selection, or are closely linked to genes that are under selection and therefore would not simply be fixed by a random process . If a population is divided, the newlyformed subpopulations can potentially become genetically differentiated from each other . Over time, the genomes of each subpopulation can diverge from each other either due to the different distribution of alleles that made up the founder population, the different selective pressures on these alleles, and new genetic mutations that arise . As with other traits, the genetic variants that contribute to male and female mating behaviors may cause a difference in phenotype between individuals of the two subpopulations (for review, see). Differences in mating signals can influence female mate choice, which can subsequently act to reduce gene flow between the groups if they come into contact . Secondary contact between diverging populations can, however, produce hybrids between species in nature . If these hybrids have a relatively high fitness, it is possible that enough gene flow can occur between these two species to cause them to merge back into one . In contrast, if hybrids have a low fitness, a selective pressure to assortatively mate within both populations can act directly on the genes for mating behavior, favoring alleles that differentiate courtship behaviors and enhance preferences for traits that distinguish potential mates of the two groups . This phenomenon, known as reinforcement, has been observed in nature where two closely related species, for example, drosophila pseudoobscura and d. persimilis, have partially overlapping regions . In response to the selective pressure to avoid heterospecific matings, populations from the sympatric region have a greater level of behavioral isolation compared to those from allopatric populations [22, 23]. However, reinforcement's role in speciation was historically disputed as alternative theories could explain the increased level of behavioral isolation, controlled experiments on the topic were generally lacking, and some experiments failed to support the theory of reinforcement . For example, the presence of reinforcement within d. mojavensis and d. arizonensis was tested with the use of two groups: one with the traditional rearing substrate of banana agar food, and the other with fermenting cactus the natural food of these two species . Although behavioral isolation was still found between the species, and the general pattern of reinforcement was still present, the sympatric population was not significantly more behaviorally isolated than the allopatric population . Additionally, reinforcement is not required for differences in mating behavior to arise . For example, a population of drosophila was subdivided into three groups within the lab: one group remained on the ancestral food source, while two other subpopulations were reared on novel food sources for multiple generations . Afterwards, female mating preferences were tested and were found to be changed in parallel with population divergence . Lab investigations have shown that reinforcement can strengthen behavioral isolation between two closely related species, and once the selective pressure for species discrimination is removed, the likelihood of interspecific mating has been found to increase . A meta - analysis also found evidence to support the previouslyuntested predictions of reinforcement, such as concordant isolation asymmetries (because reinforcement potentially evolves due to unfit hybrids, pre- and postzygotic isolation should evolve in the same direction) and rare - female effect (females from the smaller population would encounter more heterospecific males and therefore have a stronger selective pressure to choose conspecific males). Thus, separated populations can evolve divergent behaviors, and these behaviors can potentially be enhanced when the populations are once again in contact . The relationship between within- and between - species mating preferences is not fully understood, but they are often considered extreme ends of the same continuum . With time, two populations of a species are thought to slowly slide from assortative mating to heterospecific discrimination, by sexual selection either directly acting on genes that influence mating behavior or indirectly acting on genes that enhance survival . Blows and allan argued that if species isolation was produced by sexual selection, then the traits involved in species isolation should be the same traits used by both sexes during within - species mate choice . To test this hypothesis these two species have overlapping geographic regions along the east coast of australia . Although morphologically very similar, there is strong behavioral isolation between the two species . They showed that the two species have different cuticular hydrocarbon (chc) profiles, which are used as sexual pheromones . By performing perfuming experiments, which transferred chcs from one species onto another, these researchers determined that the same mechanism (olfaction sensation of chcs) is used for within - species mate choice (sexual selection) and between - species female mate preference (behavioral isolation). Although this shows that variation in the same trait can be used for both within- and between - species female mate choice, it does not necessarily mean that they have the same genetic basis . The assumption is that there is a set of genes that control female mating behavior in the ancestral population, and once the population is divided, those genes accumulate mutations in the new populations which cause changes in the behavior . The genes that control intraspecific behavioral variation, however, may not be the same genes that are important in interspecific behavioral variation . Although, for example, genes for olfactory system development used to detect different chc profiles could be important for normal female mating behavior in both species, the genetic basis for the interpretation of variation in the chc profile may vary between species . Investigation into this question led to a series of studies that showed the relationship between interspecific hybridization and intraspecific receptivity . Proposed that if intraspecific and interspecific mating behaviors have the same genetic basis, females that are slower to accept conspecific males may also be more reluctant to accept heterospecific males . In other words, high level of general within - species receptivity would be selected against due to its pleiotropic effect on high interspecies hybridization . In the lab, when a high level of interspecies hybridization (reduced choosiness) in females was selected for, a decrease in time to start copulation with conspecific males this was interpreted as a linked increase in intra- and interspecific receptivity, giving support to the notion that both types of mating behavior have the same genetic underpinning . However, when interspecific mating was directly tested by placing females in a choice assay with conspecific and heterospecific flies of the opposite sex, almost no heterospecific matings were observed, showing that selection for heterospecific mating is unlikely to influence within species mate choice in nature, where multiple mates are available . The ultimate test of whether the genetic bases of intra- and interspecific mating behavior are under the same genetic control would be to determine and compare the genetic basis of both systems . Unfortunately, no gene has been identified to be involved with interspecific female mate choice . However, a few studies that have identified the regions that most likely contain genes that isolate species do not seem to overlap those regions that contain genes known to influence within - species mating behavior [6, 7, 35]. When migrants populate a new island, it is likely that the least choosy females will propagate the most offspring since the most choosy females may not find a high - quality male and therefore will not reproduce [36, 37]. Assuming that low intraspecific choosiness results in high hybridization rates, we would then expect isolated island species to have high levels of hybridization . Although we do find this relationship in the north american and bogota strains of d. pseudoobscura, we see the opposite trend in many other species pairs . For example, d. mauritiana and d. sechellia females, both from island populations, are more choosy against males from the closely related mainland species, d. simulans, than mainland females are against island males . Mating behaviors in drosophila usually have a genetic basis (e.g., of an exception, see). The genetic information that one inherits can predispose a female to behave a specific way: which partner she chooses to accept . These genetic factors can influence both behavioral variation within a species and behavioral differences between species . The latter of these two is critical for our understanding of the genetic basis of species isolation, as it is thought that these behavioral differences are the first barrier to arise in species isolation . By identifying the genetic variants that cause interspecific differences in mating behavior, we can determine which mutations and alterations in the genetic material cause the differences in behavior between two isolated species, and thus may underlie the speciation process itself . Despite its importance for species isolation, this is primarily due to the most commonly used method in genetics for locating genes that contribute to variation in a quantitative trait, namely, recombination mapping . However, by definition, separate species usually do not produce either fertile or viable offspring . Second, identifying the genetic basis of a behavior requires the location of multiple genes with different effect sizes, necessitating a repeatable measure of the behavior, large sample sizes, and the availability of powerful genetic tools such as readily available single gene mutant lines . Despite these obstacles, the genetic basis of mating behavior has been studied in different species of animals and plants . The genetic basis of floral scent production in petunia axillaris (petunia) has been found to play an important role in pollinator attraction and thus contributes to isolation between related species of plants . Research on butterfly mating behavior has found a consistent relationship between wing color and mate preference and both traits may be caused by the same gene (wingless) or multiple genes linked to wingless . Male cichlids in lake victoria have divergent species - specific coloration which has been shown to be driven by female choice and this interspecific female mating preference for conspecific coloration has been found to be heritable in cichlids, with only a few loci responsible . Although butterfly and cichlid coloration and preference have provided insight into the genetic basis of behavioral isolation, these systems are limited in that they do not have the powerful genetic tools that are available in drosophila, a well - developed genetic model system . Using mutagenesis studies, multiple genes have been identified in d. melanogaster that influence within - species mating behaviors for both males and females . Male behavior has traditionally taken the spotlight in genetic studies on mating behavior . Through mutagenesis studies, approximately 55 genes have been identified to influence within species male mating behavior, while only a handful of genes have been identified that act within a female to increase or reduce her receptivity (see supplementary table 1 available online at doi:10.1155/2012/328392). These studies are of great importance as they provided crucial information into both the sensory system used in drosophila mating and the types of genes that can influence the construction of mating behavior . However, these studies eliminate the gene's function in order to test whether it affects a behavior . While this demonstrates that the gene is important for creation of the behavior, it does not necessarily tell us anything about the naturally occurring genetic variation that contributes to the differences seen within or between species . For example, genes identified during mutagenesis for normal male mating behavior were not found to contribute to variation seen in courtship, did not contribute to variation between low and high mating male lines, and did not vary in expression in a natural population of d. melanogaster . The genes important for normal female mating behavior were also not found to vary in expression between courted and nave same - age virgin females . The genes identified through mutagenesis consistently do not appear to influence the variation in mating behavior within a species, and, therefore, may also not contribute to the variation observed between species . Although no individual genes for behavioral isolation have been identified, recombination mapping studies have located regions of the genome that influence behavioral isolation, which do not include genes identified through mutagenesis (see below). However, since the preliminary observations of interspecific female mating behavior do not resemble the expectations set out by prevailing theory, it is difficult to determine strong candidate genes for interspecific female receptivity within these regions [52, 53]. In order to identify which genes are candidates for influencing interspecific female mating behavior, we could first evaluate which signals females are basing their choice upon . The variability we see in female preference, both within and between species, is most likely dictated by the integration of the auditory and olfactory systems . To complicate investigation of these two systems, the amount that females of each species rely on one system over the other is most likely species specific [3, 4, 55, 56]. A gene for interspecific female preference is most likely going to be associated with the signaling pathway of the auditory system used to recognize differences in male courtship song characteristics [3, 57], the olfactory system used to recognize chc pheromone profiles, or both systems via the organization of the part of the brain that receives and interprets signals from both pathways [54, 58]. This is because both modes of signaling are used during drosophila courtship [810] and vary between species [1, 3, 56, 59]. A candidate region for such integration in the brain is the mushroom body, which receives signals from many sensory systems in drosophila, including the olfaction system, and has been linked to sexual behavior [62, 63], specifically female receptivity . There are two main elements to the courtship song the sine song and the interpulse interval and males of different species usually differ from each other on both accounts . A female's ability to identify conspecific song over heterospecifics can lead to behavioral isolation . For females in the melanogaster group of drosophila, the most important element of courtship song is the interpulse interval (ipi) which differs among the males, and preference for variants of ipi seems to differ among females . The most famous gene to influence courtship song is the period (per) gene . Mutations in this gene influence ipi, and transgenic d. melanogaster flies with d. simulans per produced d. simulans - typical rhythm . Instead of a species difference reflecting a complex genetic basis, the species differences in song rhythm reflect just a small number of amino acid changes . Females from this same transgenic line showed associated preference for the transgenic male's ipi, and a later study also showed evidence of assortative mating with a different per - transgenic line . Although the genetic basis of this preference is not straightforward, it is clear that females may be using the variations in song between species in determining mate choice . Females can detect male song and male movement with use of the receptors in the antenna; neurons from the antenna project to the dorsal brain, which requires feminization in order for females to be receptive (for review, see). Each species of drosophila has cuticular hydrocarbons (chcs) on the outer surface of their body that act as a protective barrier to desiccation and most likely evolved as an adaptation to dry climates . These compounds also are important in mating behavior and are used during mate selection as pheromones that both allow males to distinguish females and affect female receptivity . The majority of chcs are nonvolatile compounds that are detected by both males and females, most likely through touch (gustation) at close proximity, rather than smell at long distances . Detection of the chc profile occurs through a large family of odorant receptors that send information about the environment via odorant sensory neurons to the antennal lobe, which is analogous to the olfactory bulb in mammals (for a review, see). Billeter et al . Used a gal4-uas system to block the development of oenocytes, which are cells specialized to produce the cuticular hydrocarbons . Flies without working oenocytes (oe) were completely devoid of all chcs but behave normally . However, female response towards oe males was significantly altered: wildtype females were significantly less receptive to oe males and oe males took significantly longer to achieve copulation . Therefore, chcs not only enhance within species female receptivity, but they can also potentially be used to deter females from heterospecific matings . Furthermore, it has been shown that males' chc profiles respond more easily to lab - induced natural and sexual selection than the females' chc profile, indicating that the male profile could be a more likely avenue by which selection acts in nature . Although there are more than 20 different chc molecules on the cuticle of the fly, only the predominant hydrocarbons have received much examination and have been primarily studied within the melanogaster subgroup of drosophila . D. simulans and d. mauritiana have a monomorphic chc profile, with the main hydrocarbon of both males and females being the same 23-carbon chain compound, cis 7-trisosene (7-t). However, d. melanogaster and d. sechellia are dimorphic: the males have large amounts of 7-t, but females lack this hydrocarbon and instead have large amounts of a 27-carbon molecule, cis, cis-7,11-heptacosadiene (7,11-hd). Most drosophila species have males that predominately produce 7-t as their main chc and also share multiple minor compounds as well . However, the ratio between the different chcs is slightly altered between species, creating unique pheromone blends . Through mutagenesis studies, genes have been identified to affect chc production, such as dsat1 and dsat2, enhancer of zest, ddc, nerd, seven pentacosene, and smoq, as well as some sex determination genes, such as doublesex . However, only the genetic basis of the main chc components (7-t and 7,11-hd) have been examined . Additionally, it is unclear if variation in these genes produces the variation that is seen in chc production between populations of the same species, or variation in production between species [56, 82, 83]. From the research dedicated to identifying the genetic basis of chc variation between species and courtship song variation between males of different species, we can comfortably deduce that different species have different chc profiles, different courtship songs, and females preferentially mate with conspecific males based at least partially on both signals . To date, no individual genes have been identified as influencing intra- or interspecific female preference in drosophila, although the trait has a clear heritable basis . Due to the requirement of fertile hybrids for traditional recombination mapping, the majority of studies seeking to address this question have been done in drosophila species other than d. melanogaster (table 1), since d. melanogaster does not produce fertile offspring with any of its sibling species[2, 3, 6, 7, 59, 84]. The majority of studies that have examined the behavioral isolation between d. melanogaster and d. simulans have done so in a limited way, showing that specific chromosome arms influence behavioral isolation, and until recently these attempts have not come close to isolating individual genetic variants that affect behavioral isolation [8587]. However, the genomes of 12 different species of drosophila have now been sequenced, and recently the powerful genetic tools available in d. melanogaster, such as the gal4-uas system (used to manipulate gene expression) and transposon vectors (for use in mutagenesis studies), have now been modified for other species of drosophila . Despite the previous limitations, various genomic regions have been identified that contribute to behavioral isolation in multiple species of drosophila, and the expansion of the available tools makes further refinement of these studies now possible . Drosophila pseudoobscura are found across much of western north america and are located both in sympatry and in allopatry with d. persimilis . The initial genetic basis of isolation between these species, termed basal isolation, was found to be caused by only two regions in the genome: one on the left arm of the x chromosome (which is homologous to the x in d. melanogaster) and one on the second chromosome (homologous to the right arm of chromosome 3, called 3r, in d. melanogaster), within an interspecific inversion that differentiates d. pseudoobscura and d. persimilis . Female d. pseudoobscura from sympatric regions hybridize less with male d. persimilis than females from allopatric regions without d. persimilis, which has made this a model system for studying reinforcement . Ortiz - barrientos et al . Investigated the genetic basis of the increased discrimination of sympatric d. pseudoobscura females . By introgressing (crossing) pieces of the sympatric d. pseudoobscura genome into an allopatric d. pseudoobscura background, they mapped the increase in behavioral isolation to two alleles of strong effect, one on the right arm of the x chromosome (called coy-1; homologous to 3l in d. melanogaster) and one on the fourth chromosome (called coy-2; homologous to 2l in d. melanogaster). However, barnwell and noor used six pairs of different inbred strains in a quantitative trait locus (qtl) mapping study to try to replicate the previous identification of coy-1 and coy-2 . They could not, and therefore determined that coy-1 and coy-2, although they may be important, are not the primary loci causing increased behavioral isolation in sympatric versus allopatric populations . These alleles may be present at low frequencies in natural populations and therefore would not be present in most inbred laboratory lines . Although they may not underlie species - wide discrimination, an examination of the two loci could still provide important insight into the genetic basis of reinforcement . To this end, each of the d. pseudoobscura sympatric and allopatric coy2 alleles was introgressed into a d. persimilis background (creating percoy2sym and percoy2allo lines). If the reinforced behavioral isolation was caused by an increased receptivity for d. pseudoobscura (conspecifics) by the d. pseudoobscura sympatric population, the expected results would be that percoy2sym females are more likely to mate with d. pseudoobscura than percoy2allo, but instead they found the opposite: percoy2sym females were less likely to mate with d. pseudoobscura than percoy2allo . This suggests that an allele for reduced interspecific mating within a species (coy2sym) can cause the same reduction in interspecific mating when placed within another species . The explanation provided by ortz - barrientos and noor is that coy-2 may be a this theory suggests that one allele (coy-2) can exist in both the sympatric population of d. pseudoobscura and in d. persimilis population, and aids in the reinforced behavioral isolation between these populations, but not in the basal behavioral isolation . In other words, the same allele causes females of both species to have an increased discrimination against heterospecifics . This is possible if, for example, the gene encodes for increased odor sensitivity or reduced dispersal . This theory would explain why percoy2sym females were less likely to mate with d. pseudoobscura than percoy2allo . Males of both species court females of both species, but there is strong female interspecific female preference that reduces the gene flow between the two . The genetic basis of this behavior was first explored with female f1 hybrids, which were found to prefer d. ananassae males over d. pallidosa males . This suggests that d. ananassae genes for interspecific female choice must be dominant over those from d. pallidosa . The same study created introgression lines to locate the genomic regions responsible for this behavior . A region on the left arm of the second chromosome (homologous to 3r in d. melanogaster) near the delta locus was identified to play a role in female species mate choice: females that were almost entirely d. pallidosa except for a small region near the delta locus mated significantly more with d. ananassae males and significantly less with d. pallidosa males . In other words, this locus both increased intraspecific mating in d. ananassae and decreased interspecific mating between d. ananassae females with heterospecific males . This region was later confirmed by a study that found 2l (3r in d. melanogaster) to be important for the willingness of d. pallidosa females to mate with d. ananassae males, and xl, 2l, and 3r (x, 3r, and 2l in d. melanogaster, resp .) For d. ananassae female's willingness to mate with d. pallidosa males . All of the identified regions had species specific inversions, suggesting that regions of the genome with reduced recombination between the species may be more likely to harbor behavioral isolation loci . D. yakuba is wide - spread across africa, including some of the islands off of the coast . On one of these islands, d. santomea are found . Although this species pair has a small overlapping geographic region, no reinforcement has been observed . Male courtship behavior may contribute to the behavioral isolation between these two species as d. santomea males do not court heterospecific females with any vigor . To investigate the genetic basis behind the female interspecific mating, three qtls were identified for d. santomea female discrimination against d. yakuba males: two on the x chromosome (homologous to x in d. melanogaster) and one on the third chromosome (3r in d. melanogaster). Drosophila simulans is a cosmopolitan species, while its closely related sibling species d. sechellia is only found on the seychelles islands in the indian ocean . There is an asymmetrical behavioral isolation between d. simulans and d. sechellia: d. simulans females are less choosy against d. sechellia males than d. sechellia females are against d. simulans males . Hybrids have an intermediate level of d. simulans rejection when paired with d. simulans males, suggesting an additive genetic basis . Further backcrossing of these f1 hybrids to d. simulans males, and pairing the female offspring with d. simulans males, revealed no isolation, and therefore locating the genes for behavioral isolation in d. sechellia females is not possible with this technique . When the f1 hybrids are backcrossed to d. sechellia males, and the resulting females were assayed with d. simulans males, the second and third chromosomes (2 and 3 in d. melanogaster) were found to have a moderate and strong effect, respectively . D. simulans is a cosmopolitan species and d. mauritiana is only found on the island of mauritius in the indian ocean . It is thought that d. mauritiana resulted from colonization by a recent common ancestor with d. simulans about 250,000 years ago . Females of these species are almost identical, and the males are only distinguishable by the shape of their genital arch . Asymmetrical species isolation is present, with d. simulans being the less choosy of the two courted females . Although d. simulans females are not choosy and readily mate with d. mauritiana males, matings between these two species are abnormally short and result in no or limited sperm transfer, decreasing the number of hybrid offspring . The absence of heterospecific mating by d. mauritiana females is due to the rejection of males by these females, since females of both species are courted vigorously by males of both species . Hybrids produced by d. mauritiana males and d. simulans females mate readily with d. simulans males, and thus the genes for interspecific mate discrimination in d. mauritiana females must be recessive [2, 13]. By backcrossing the hybrids to d. mauritiana males, coyne was able to asses each d. mauritiana chromosome's effect on decreasing mating with d. simulans males, he found each of the main autosomes has very large effects with the effect of x being very small . Further dissections of the second chromosome determined that each arm of the second chromosome contains at least one gene for reducing d. mauritiana female mating with d. simulans males (2r and 2l in d. melanogaster); this method of uncovering recessive d. mauritiana genes also possibly removed d. simulans genes for conspecific mate preference when the same pairings were examined with a more refined map, seven qtl were identified that contribute to d. mauritiana discrimination against d. simulans males: two on the x chromosome, two on the second chromosome, and three on the third chromosome (x, 2, and 3 in d. melanogaster, resp . ). Drosophila melanogaster and d. simulans are both cosmopolitan species found worldwide and have broad overlapping geographic distribution . Although both females show some behavioral isolation, d. simulans females are far more choosy [131, 132]: interspecific crosses with d. melanogaster females are produced with relative ease in the lab, but the reciprocal interspecific cross with d. simulans females very rarely occurs . F1 hybrids made from d. melanogaster females are all sterile females, and from the reciprocal cross are all sterile males . Due to the complete sterility of hybrids, the conventional method of qtl mapping is not possible as this would require an f2 generation, typically through backcrossing to one of the parental species . Therefore, other methods used to determine the genetic basis of behavioral isolation between these two species have been employed . Using chromosomal substitution, a genomic region was identified on the third chromosome for d. melanogaster female receptivity, and genomic regions on all three major chromosomes were identified for rejection of d. simulans males by d. melanogaster females . Although there is some evidence that male d. simulans may have reduced courtship of interspecific females, and thus contribute to the behavioral isolation, there is no such evidence for discrimination by d. melanogaster males . Therefore, the strong behavioral isolation demonstrated by d. simulans females is largely due to rejection of heterospecific (d. melanogaster) males . To investigate whether there is genetic variation for d. simulans female preference, different lab strains of d. simulans females [86, 135] and d. crossability, the ability for the parental strains or species to successfully produce offspring, varied among strains for both d. melanogaster males and d. simulans females [86, 87], but were still highly correlated . When strains of d. simulans were crossed, the pure species f1 females were then crossed d. melanogaster males and the crossability was compared to the two parental strains . Mixed results were found: while one study found that f1 females always showed greater levels of hybridization, another study found that in most cases f1 females showed significantly lower levels of hybridization, making it unclear whether increased discrimination within d. simulans against heterospecifics is dominant or not . Further inconsistencies include one study that found that x and the third chromosome act additively to contribute to the rejection of d. melanogaster males by d. simulans females, while another study found that the x and the left arm of the second chromosome influenced the trait . These results may be due to the low genetic variability within inbred laboratory lines, and may support the hypothesis that the genetic basis of behavioral isolation varies among populations of the same species . Recently, the right arm of the third chromosome (3r) was mapped using deficiency mapping, revealing five regions (all in areas of low recombination) that contribute to the rejection behavior of d. simulans females towards a courting d. melanogaster male . While a list of candidate genes in these regions was generated, fine mapping of these regions to the individual gene level remains . Drosophila melanogaster are found all over the world, usually commensally with humans, and it was once thought that there was gene flow between populations, including those found spread across large continents . However, a zimbabwe population was found to have twice the amount of genetic variation compared to north american populations, with certain variants only present in zimbabwe . Females from these zimbabwe lines (z) show behavioral isolation against males from cosmopolitan regions (m): when they have the choice, z females prefer to mate with z males, but show no postzygotic isolation (hybrid sterility or inviability) when they are mated with m males . Females from cosmopolitan regions also show behavioral isolation with z males, but it is weaker than that seen in z females . The genetic basis for this strong preference in z females was mapped to all three major chromosomes, with the largest effect being contributed by the third chromosome . With the use of recombinant lines and visible markers (dominant mutations to identify which homologous chromosome was inherited from which parental species), the genetic basis of the female preference in z females for z males was mapped to four regions: a region of large effect and a region of minor effect on the left arm of the third chromosome (3l) and a region that most likely houses two loci on the right arm of the third chromosome (3r). In the quest to identify the genetic basis of behavioral isolation, genomic regions have been mapped for interspecific female receptivity in a variety of species pairs . These efforts have yielded maps that vary in refinement from whole chromosomes, chromosomal arms, subchromosomal regions, to specific qtls . Although the genetic basis of female discrimination may be species pair specific, one common attribute of these loci is their location in the genome: most of these loci fall within areas of low recombination, such as species inversion polymorphisms, regions near the centromere, and regions near the telomere . Behavioral isolation loci between d. santomea and d. yakuba were found near the centromere on 3r, and near the telomere for both the d. simulans and d. mauritiana species pair and the m and z forms of d. melanogaster . Loci responsible for the behavioral isolation between d. ananassae and d. pallidosa, and the isolation between d. pseudoobscura and d. persimilis all fell within interspecific inversion polymorphisms . Although this was not true for the regions responsible for increased behavioral isolation caused by reinforcement in the latter species pair, these loci for reinforcement were not confirmed by further studies . Inversions have also been shown to play a role in within - species assortative mating . Unlike other species of drosophila, d. ananassae males have spontaneous meiotic recombination which contributes to the entire species having a high degree of inversion polymorphisms . One inversion, called alpha, is a large paracentric inversion covering the majority of 2l (3r in d. melanogaster). To investigate whether this inversion could contribute to behavioral isolation within this species, nanda and singh created karyotypically different strains homozygous for one of three naturally occurring inversions . Through mate choice assays, they found a preference for homogamic matings in all three populations . Genomic rearrangements, centromeric, and telomeric areas can act as an island of low recombination between two potentially interbreeding populations, allowing for the creation and maintenance of population - specific gene complexes (genes inherited together). Over time, new mutations can occur within theses complexes and, due to reduced recombination, can create a population - typical phenotype if the complexes contain variants for local adaptation . Therefore, even in the face of gene flow between the two groups, a new population identity can be created . While it has been shown that similar sensory systems may be used for both intra- and interspecific mate discrimination, it is unknown whether these two levels of discriminatory behavior have the same genetic basis . Genomic regions identified as influencing species - specific female preference could contain genes that affect either the auditory or olfactory system, as both are used in mate discrimination, or the brain where this information is processed . If these genes could tolerate a genetic variant causing a slight change in function, selection could then act directly on a new allele, or on other genes within this genetic island, to cause different alleles to reach a high frequency in different populations, causing a slight difference in female mating preference between them . If mutations that occur within these regions cause a change in female preference by influencing assortative mating within species, these areas can influence behavioral isolation between species, and thus potentially induce a speciation event [84, 140]. The genetic basis of interspecific female preference is a significant component necessary for understanding the genetic basis of species isolation . While many broad - scale mapping studies have allowed for a solid understanding of the genetic architecture underlying female preference the number and relative location of genomic regions contributing to female discrimination to date, no individual genes for this trait have been identified . This limits the ability to assess the mechanism by which females process and evaluate heterospecific mating signals, and thus maintain species isolation . As the genetic tools available in d. melanogaster become more widely available in other systems, and as new mapping techniques are developed, refined genetic dissection of this trait is becoming more tenable . By identifying the genetic mutations that cause interspecific variation in mating behavior, we can start to understand the biological basis species isolation, and better our understanding on the definition of a species . Perhaps the most interesting aspect, however, is that we can finally begin to understand the molecular basis of sex.
Tumor lysis syndrome (tls) occurs in malignancies that have high proliferative potential and high tumor burden, such as lymphomas and leukemias . It is characterized by rapid release of intracellular metabolites from lysed malignant cells into the blood stream . The resulting metabolic derangements are hyperuricemia, hyperkalemia, hyperphosphatemia, and hypocalcemia, causing acute renal failure and which may lead to cardiac arrhythmias, seizures, and death . The prevention and management of tls include aggressive hydration and reduction in the plasma uric acid levels by drugs that decrease production or increase excretion of uric acid . With the advent of rasburicase, a recombinant urate oxidase, there has been a tremendous decline in the tls - mediated renal failure and the need for dialysis . But the recommended regimen and doses pose a heavy financial burden for the poor patients in developing countries like india . With data and studies proving a similar efficacy with reduced dose and lesser number of rasburicase, it will be economical to devise a strategy that will help us to achieve reasonably comparable standards of efficiency, efficacy, and safety in tls management . We report here a case series of seven children with acute leukemia, whose tls was managed by a single dose of rasburicase . A retrospective analysis of case records of seven children with acute lymphoblastic leukemia (all) and tls, admitted to our pediatric oncology unit of our hospital between the period 2011 and 2013, was done to evaluate the effectiveness of single - dose rasburicase (sdr) in the management of tls . The children were administered a single dose of rasburicase at the rate of 0.15 mg / kg . All patients were screened for glucose-6-phosphate dehydrogenase (g6pd) deficiency before the administration of rasburicase . Hemoglobin, white cell count, differential count, platelets, serum electrolytes, serum calcium, phosphorous, uric acid, blood urea nitrogen, and creatinine tests were done at the time of admission and repeated daily until the renal parameters and uric acid levels returned to normal levels . The demographic details and clinical parameters of the children are enumerated in table 1 . Demographic details and clinical parameters at the time of admission among the seven children, four had pre - b cell (common all) antigen - positive all and the other three had t - cell all determined by flow cytometry . The highest and lowest uric acid levels at admission were 32.2 mg / dl and 9.7 mg / dl, respectively . All of them had hypertension, hypocalcemia, hyperphosphatemia, and hyperuricemia and 3 had hyperkalemia . All were managed with hyperhydration, anti - hypertensives, allopurinol, and a single dose of rasburicase at 0.15 mg / kg . The dose was rounded off to the nearest available concentration of vials due to the financial constraints . A single dose of rasburicase produced a rapid and sustained therapeutic effect of lowering the plasma uric acid levels in all seven patients . Uric acid levels remained below 4 mg / dl throughout the administration of chemotherapy until discharge . Depicting the serum uric acid and, creatinine levels and urine output before and after administering a single dose of rasburicase acute renal failure is one of the most immediate, serious, and costly tls - related complication of treatment for hematologic malignancies . Hyperuricemia results from rapid catabolism of purine - containing nucleic acids from tumor cells and can lead to renal insufficiency when uric acid precipitates into the renal tubules and distal collecting system . This causes renal vasoconstriction, which in turn leads to impaired autoregulation, decreased renal flow, oxidation and inflammation, finally leading to acute kidney injury . Markedly increased phosphate levels compounded with calcium phosphate deposition in the renal tubules can also cause acute kidney injury . High concentrations of both uric acid and phosphate potentiate the risk of acute kidney injury because uric acid precipitates more readily in the presence of calcium phosphate and vice versa . Allopurinol has been used for many years in the prevention and management of tls - related hyperuricemia . Allopurinol decreases the new production of uric acid by inhibiting enzyme xanthine oxidase and blocking oxidation of xanthine and hypoxanthine into uric acid . Therefore, following allopurinol administration, there is a time lag for reduction in uric acid levels and hence should be administered for more than 3 days for the achievement of significant reduction in uric acid levels . An alternative to inhibiting uric acid formation by inhibiting xanthine oxidase with allopurinol is to promote the catabolism of existing pool of uric acid to allantoin, which is 510 times more soluble in urine by urate oxidase . Rasburicase offers potential advantage over allopurinol because of its rapid onset of action, reducing pre - existing pool of uric acid within few hours, and also helping in avoiding accumulation of xanthine and hypoxanthine, which has poor water solubility and can worsen renal function . Urate oxidase is an endogenous enzyme commonly found in many mammalian species but not in humans because of nonsense mutation i, the coding region in the gene during hominoid evolution . Rasburicase is indicated for the prophylactic management as well as treatment of high plasma uric acid levels (> 7.5 mg / dl) in pediatric and adult patients with leukemia, lymphoma, and solid tumor malignancies, which have the highest risk of tumor lysis such as those with tumors that have a high proliferative rate(all, burkitt's lymphoma), tumors with high sensitivity to cytotoxic therapy, patients with large tumor masses, and those with pre - existing renal insufficiency and high serum ldh levels . It is administered as an intravenous (iv) infusion over 30 min and should never be given as a bolus . The reconstituted solution can be stored at 28c for 24 h. repeated use of rasburicase increases risk of hypersensitivity reactions . Rasburicase was initially approved by the us food and drug administration for the management of tls in the pediatric setting, based on a randomized controlled phase iii clinical trial whereby rasburicase (0.15 or 0.2 mg / kg) was administered for 5 consecutive days . Has confirmed the effectiveness and safety of rasburicase over allopurinol in children with hematologic malignancies . Rasburicase was administered at a dose of 0.2 mg / kg iv over 30 min for 57 days in this study population . Though the efficiency and advantage of rasburicase has been proved beyond doubt more than a decade ago, it's the cost of the product that has been the main inhibiting factor against its usage . In a developing country like india, where majority of the patients have to bear the brunt of the medical expenses with no insurance to support them, the use of rasburicase for 5 days is beyond the scope of the poor patients . So, when several noncontrolled studies involving retrospective case series suggested shorter duration of treatment to minimize the cost but without compromising the efficacy, it was boon for children in resource limited settings . Evaluated the efficacy of a single dose rasburicase 0.15 mg / kg followed by as - needed dosing with a maximum of five doses instead of the standard 5-day regimen with 0.2 mg / kg in adult patients at risk for tls and concluded that single dose was effective in most patients and only a subset of high - risk patients received a second dose . A study in south carolina depicted that a single dose of rasburicase 6 mg was effective in the management of tls in adults . In california, sdr for adult cancer patients with hyperuricemia or at high risk for tls demonstrated better response rate and stronger control of uric acid level compared with allopurinol . Sdr response rate was not inferior to that of daily - dose rasburicase (ddr), and the standard - dose sdr generates more cost savings compared with the ddr . Though majority of the studies had been in adult patients, lee et al had proven the effectiveness of a single dose of rasburicase in three children with all and concluded that it is feasible and will improve the cost - effectiveness profile of the otherwise expensive compound . All the children received a single dose of rasburicase, and their electrolyte abnormalities, and renal parameters, hyperuricemia and hypertension normalized in 72 h. the children were started on chemotherapy as per children's oncology group protocol . The uric acid levels were well below the normal levels during the entire period of chemo administration . The rasburicase was administered on the day of admission in all our patients at the earliest and within 12 h of admission . The time lag of 12 h in few patients was due to the financial constraints in arranging the drug . Our experience suggests that in appropriately monitored patients single dose followed by dosing as needed can be cost - saving . None of our patients required dialysis, which otherwise would have added to the economic burden . Administration of rasburicase does not require any expertise like catheters, central lines, intensive care unit care unlike dialysis, and no dose modifications are needed in spite of deranged renal parameters . From an economic point of view, especially in a developing country like india, the promising single low - dose approach of rasburicase administration achieved satisfactory results with a great reduction of cost per patient, which can result in better cost - effectiveness with no compromise in clinical efficacy.
The availability or utilization of health services does not always guarantee better health outcomes and it requires safe delivery of quality health services . Unsafe care is a global challenge, which often leads to adverse events and poor treatment outcomes . The limited data from low- and middle - income countries reports wrong identification of patients, medication errors, misdiagnosis, etc . Patient safety is an important element of an effective and efficient healthcare and is one of the most referred components in quality of care . Though broad approaches to safer patient care are applicable for the majority of the settings, there is always need to understand the local issues to tailor - made strategies to increase patient safety . This study was conducted to understand the key challenges and to propose solutions to improve overall patient care in the hospitals in delhi . The population of delhi state was 16.8 million in 2011 with 97.5% urban population, 1483 km geographical area and population density of 11,297 (range: 3800 to 37,346/km). The health services in the state are provided by a number of agencies, and the city has good health infrastructure including bed population ratio, both in public and private sectors . The study was planned as qualitative research design with some quantitative data from desk review . The desk review of the available published and unpublished information on patient safety, in general, and in gynecology and obstetrics set - ups in specific, in india since the year 2000 was conducted . The desk review was followed by in - depth interviews (idis) and focused group discussions (fgds) to triangulate the information . The head of the departments or the nodal officers from the departments / units of obstetrics and gynecology in the identified hospitals participated in the discussion . These were restricted to secondary and tertiary care facilities as gynecology and obstetrics specialty usually exist at these levels only . The participants were grouped into two sets (hospitals with more than 500 bed capacity and those 500 or less bed capacity). This grouping was done to keep the fgd participants homogenous and to ensure that the representatives from the larger health facilities not trying to over - emphasize their experiences . Therefore, nodal persons responsible for patient safety at gynecology and obstetrics departments from 20 of 39 hospitals run by government of delhi were included . For the literature review, it was agreed that studies prior to the year 2000 may not be representative of the ground scenario as a lot has changed in the last few years . The participants for in - depth interview were purposively selected to supplement and triangulate the information generated . The desk review and in - depth discussions were conducted by all authors during the months of january the fgds were conducted at maulana azad medical college, new delhi and were facilitated by resource persons from govind ballabh pant hospital and world health organization country office for india . The discussions were moderated using a few probe topics to ensure that relevant aspects are addressed . One of the authors (cl) has extensive experience in conducting idis and fgds for almost a decade . The fgds were conducted in english, were recorded and a sociogram for each fgd was prepared to check the participant interactions . The facilitators role was to ensure that discussion were free flowing, not dominated by any one individual and also to keep it on track . The findings from desk review, idis, and fgds were summarized and analyzed using health system framework . The process helped in generating list of codes, which were grouped as per health system functions and analyzed . The population of delhi state was 16.8 million in 2011 with 97.5% urban population, 1483 km geographical area and population density of 11,297 (range: 3800 to 37,346/km). The health services in the state are provided by a number of agencies, and the city has good health infrastructure including bed population ratio, both in public and private sectors . The study was planned as qualitative research design with some quantitative data from desk review . The desk review of the available published and unpublished information on patient safety, in general, and in gynecology and obstetrics set - ups in specific, in india since the year 2000 was conducted . The desk review was followed by in - depth interviews (idis) and focused group discussions (fgds) to triangulate the information . The head of the departments or the nodal officers from the departments / units of obstetrics and gynecology in the identified hospitals participated in the discussion . These were restricted to secondary and tertiary care facilities as gynecology and obstetrics specialty usually exist at these levels only . The participants were grouped into two sets (hospitals with more than 500 bed capacity and those 500 or less bed capacity). This grouping was done to keep the fgd participants homogenous and to ensure that the representatives from the larger health facilities not trying to over - emphasize their experiences . Therefore, nodal persons responsible for patient safety at gynecology and obstetrics departments from 20 of 39 hospitals run by government of delhi were included . For the literature review, it was agreed that studies prior to the year 2000 may not be representative of the ground scenario as a lot has changed in the last few years . The participants for in - depth interview were purposively selected to supplement and triangulate the information generated . The desk review and in - depth discussions were conducted by all authors during the months of january the fgds were conducted at maulana azad medical college, new delhi and were facilitated by resource persons from govind ballabh pant hospital and world health organization country office for india . The discussions were moderated using a few probe topics to ensure that relevant aspects are addressed . One of the authors (cl) has extensive experience in conducting idis and fgds for almost a decade . The fgds were conducted in english, were recorded and a sociogram for each fgd was prepared to check the participant interactions . The facilitators role was to ensure that discussion were free flowing, not dominated by any one individual and also to keep it on track . The findings from desk review, idis, and fgds were summarized and analyzed using health system framework . The process helped in generating list of codes, which were grouped as per health system functions and analyzed . The available published literature on patient safety in india was found to be limited and mainly focuses on reuse of syringes, accidental needle stick injuries, and on biomedical waste disposal practices . The authors did not find any published study on patient safety from obstetrics and gynecology facilities in india since the year 2000 . A brief summary of the findings from the literature review on different aspects on patient safety in india is provided in table 1 . Identified challenges and proposed solutions in patient safety in maternal healthcare idis were conducted with five senior level government officials working in the area of patient safety . In total, two fgds were also conducted, which were attended by 20 participants (12 participants in first and 8 participants in second fgd). Each fgd session lasted for approximately 90 min . In both the fgds, in the beginning the participants highlighted challenges and issues, and possible solutions, which have been summarized by health system functions [table 1]. In addition, the appropriate management of emergency cases, the issue of near miss cases and interchange of the newborn babies were flagged as patient safety issues . The participants felt that any consideration for improvement in the quality of health services should be linked to strengthening of health services at all levels and as part of the continuity of care . It was emphasized by a number of participants that the patient safety is a very appropriate entry point for overall improvement in quality of healthcare services . Intra - hospital prescription audits and medical audits, use of checklists to monitor and maintain the equipment, standardized patient consent forms (possibly in vernacular), implementation and compliance with the safe surgery checklist, and use of monitoring indicators i.e., surgical site infections and reporting of errors / monitoring (nonmedical incident reporting), development of protocols appropriate for specific health facilities, provision of benchmarks for the hospital workforce were suggested as approaches or solutions to improve patient safety . The quality in simple to understand terms is meeting the expectations of the users . Quality has been defined as the degree to which health services for individuals and population increase the likelihood of desired health outcomes and are consistent with professional knowledge . In operational terms, quality in health services has six dimensions of effective, efficient, accessible, acceptable and patient - centered, equitable, and safe care . The review of the literature conducted for this study indicates that there has been insufficient research in the field of patient safety (excluding injection safety that has relatively more data) in india . The lack of research evidence could probably be a reason for limited attention on patient safety and quality of health services and the related issues in health facilities in india, both in public and private sector . This highlights the need for more research for evidence - informed decision making, to initiate efforts to improve the quality of healthcare and to measure the trends in patient safety in india . The frequent reports in the print and online media often highlight the gap between the needs and what is being done . These media reports have at times highlighted the unsafe care at all levels, beginning from primary to tertiary levels . These findings have been corroborated by the experience of the participants in this study as well . Other corroborative evidence of low quality of health services have been analyzed and noted that in the 5 years period (200610); there was nearly 100% increase in institutional deliveries in india but maternal mortality ratio has come down by 50% only . The rate of reduction in maternal mortality during this period was not commensurate to the rate of increase in the institutional deliveries in india . This reflects that while the institutional deliveries or access to services might have increased quantitatively, the quality of services offered during these deliveries may not have been up to the mark to reduce maternal deaths . A proportion of these deliveries was being conducted at primary healthcare set - up level which are often reported to have limited facilities to handle complicated cases and provision for appropriate and timely referrals . Though, this study had participants from secondary and tertiary care facilities primary care facilities which are often less equipped are likely to have similar challenges and should be systematically studied . A common theme across all discussions was the need for adoption of approaches such as prescription audits, random checking of case sheets, cases record audits, the audits at pharmacy levels and the formulation, adoption of standard treatment guidelines (stgs), and drug dosages charts . There are emerging evidence from existing literature in different parts of the world that audits in hospital and community set - ups and use of stgs improve patient safety and treatment outcomes . The findings that the delayed referrals often are more prone to unsafe practices are consistent with the observations by other researchers . This is very well - linked to the often - recognized need and demand for effective patient transport and emergency transport system . The improved patient transport systems are closely linked to the patient safety and quality of care . The referrals and transportations are important not only between facilities but the patient handovers and transportation within the different units and the departments within the same facilities and were reported to be closely linked to patient safety issues and participants highlighted the need for strengthening at all levels . The studies on needle stick injuries noted that the reasons for such injuries included professional hierarchy where orders have to be strictly followed without questioning, poor communication regarding guidelines among staff members and heavy patient load . The limited attention on incident reporting and administrative sanctions have also been recognized as barrier in patient safety . A consultation on regulation and accreditation of health service delivery institutions in india recommended that the quality of health services has to be a mainstream and explicit discourse in india . It suggested that the stakeholders need to innovate and accelerate efforts to improve the quality of health services and that there is a need for establishing the multi - stakeholder forum on regulation and accreditation as a linkage platform . There were recommendations related to the capacity building of policy makers, other stakeholders, and institutions, in improving quality of health service, need to provide technical assistance for implementation of the clinical establishment (registration and regulation) act, 2010 and that of to document best practices for licensing, regulation, and accreditation of health service delivery institutions in india . Though there is an increasing dialogue among stakeholders and more attention on accreditation, the fact is that only a limited numbers of hospitals in india are accredited by any system . Many of the participants in this study commented that there is a culture of not recognizing the patient safety issues . Unless the mindset is going to change, the quality of care is unlikely to improve . In this context, it is suggested that for improved patient safety, the initial step could be the identification of problems and agreeing on a pragmatic roadmap and implementation plan to improve patient safety at facility levels . This study highlights the need for increased community participation, awareness of patient's rights, community awareness, and the advocacy for patient communication in the field of patient safety . This is likely to help by on one hand, the caregivers demanding for a better quality of health care and on the other hands, setting up realistic expectations for community and the family members of patients . Analysis of the findings from health system framework indicated that to improve patient safety (and quality of services), there is need to look at various functions of health system by making all components of services available, making referrals timely and which are respected at the next levels of health facilities (service provision); having different categories of people available and trained in the safety issues (creating resources); providing sufficient finances for meeting the additional requirement, and conducting trainings (financing) and this has to be done with a clearly laid out strategies and plans, well - supported by management and leadership of the facilities (stewardship and governance) [table 1]. Though the primary healthcare facilities were not represented in the sample selected for this study, the participants highlighted the role of primary healthcare facilities and provider could play in the improved patient safety by decision on timely referral, ensuring all precautions are taken while providing health care at lower levels . It was discussed that the patient safety is across the continuity of care, which start from primary care level . Moreover, there are more providers (both in public and private sector combined) at the primary care and changing their practices in patient safety would have a major contribution to the overall outcome . It is proposed that in future while conducting such studies, inclusion of primary care facilities and providers could be given due consideration . This is an area where even less data are available in india and more research is required . One of the impacts of this study had been that in the following months, the information generated from this study was used for designing of a training program on patient safety; inclusion of patient safety agenda in two conferences / meetings organized in delhi; and the government of delhi conducting 2-day capacity building workshops in patient safety for hospital and health facility focal points . These are not the ultimate solutions; however, they are the right steps for generating awareness and preparing the system for better patient care . A limitation of this work is that it is based on interactions with medical doctors from one specialty in government owned secondary and tertiary care facilities in one state only . It is possible that inclusion of private sector hospitals, other categories of staff (nurses and orderly, etc . ); care providers from other departments, and inclusion of primary care facility could have provided additional insight . However, it is expected that the findings from this study are still valid, though more studies are needed for additional set - ups and types of providers . The qualitative narrative of this study was by design and the authors supplemented quantitative component by conducting literature review . However, these limitations should not affect the conclusions as the key objectives of this study was to understand the local context, to improve the patient safety through selection of appropriate interventions and to implement the best practices . The quality of health services in india, with specific case of maternal health services as in this study, needs major improvement . The providers are often aware of the challenges and are keen to implement the solutions . Available local information could be used for selection, designing, and implementation of measures to improve patient safety . A systematic and sustained approach with attention on all functions of health systems patient safety could be used as an entry point for bringing attention on overall quality of healthcare services in india . The momentum and opportunity to bring improvement in quality of health services has to be sustained by more funding, capacity building, and strong leadership with clearly outlined intentions through policy proposals . The quality has to be a mainstream discourse in public policy and programmatic discourses, as india intends to advance toward universal health coverage . The opinions expressed in this article are solely those of the individual authors and should not be attributed to the institutions / organizations they have been affiliated to in the past or at present . The opinions expressed in this article are solely those of the individual authors and should not be attributed to the institutions / organizations they have been affiliated to in the past or at present.
Is cancelled because it emphasized on loading learner s accumulator minds and interrogating in tests as jean piaget said the main goal of education must be training of innovators who could think not to repeat . It is training of investigators and researchers not those who adopt whatever is said (1). Obviously, it is not possible to train new generation for the living in a changeable society for present and next days without new planning to change functions and works of education system including goals, contents, teaching and learning methods also evaluation and assessment methods (2) contemporary, in domain of training science, evaluation has received such an importance that identified as an independent and specialized scientific field . Because of the importance of evaluation some specialists in domain of curriculum development like tiler presented it as a center of education process (3). Evaluation indicated as the last link for the teaching - learning process which is used in the end of educational period to separate students with different learning process . If it could present suitable information permanently through feedbacks to students, it would be more effective to improve learning . It is found that the educational and evaluation method could not be able to meet the needs of learning in many times during the process of english learning as a foreign language . Most of the approaches in secondary schools are theoretical ones, while using the teaching application and performance method many of the english concepts are more tangible and likable and english learning would be more profound and stable permanent (4). Language educational specialists suggest that the best method in language learning is creating desired possibilities and training through different practices so that there would be a satisfied learning experience (5). While the traditional evaluation method frequently aiming the lower classes of cognitive domain, the achievement evaluation of the student should be composing of the test s results and the teacher s distinguishing of the student s educational state (6). To achieve english learning goals, the authentic assessments could be a suitable alternative for usual and traditional assessments which are still using in these classes . In authentic assessments methods there are often real and natural situations to evaluate the performance of the learners assessed directly (7). There is not any research in our country related to the title of this study at the level of the university but similar studies have been done at the level of education . Khoramabadi (2008) in his doctoral on the subject of the effect of applying traditional and alternative methods on achievement motivation, attitude and academic achievement of the students observed the results including: students who their performance have been tested using alternative methods in comparison with those who are assessed by traditional ones, encounter more achievement motivation . They have position attitude to school and get higher educational achievement in psychomotor and cognitive domain (8). Kowsari (2000) in a study entitled survey of acquaintance amount and application of assessment methods through the student s learning by teachers of secondary schools obtained the following results: the selection of aware and specialized persons in assessment as instructor in teacher training center and in - service periods acquaintance of students with the topic of assessments, considering two types of scores that is theatrical, pragmatic and performing in assessment of student learning appropriate more class hours and decrease the content of lesson books (9). Firozfard and gholam nattaj (2006) in a research entitled: how could we improve the teaching - learning process by using the new assessment approach (process center and formative) presented the following results: it represents a real, stable and profound learning new assessment approach- this plan gets more interest of students cooperation in teaching process and changes the traditional atmosphere of the class -it decrease the stress and agitation of the final test using different tools of new assessment approach and increase noticeable confidence of student in learning (10). Hopkins (1987) showed in a study that the more improvement and disputable matter in assessment is differences in level of instructor skills in using tools and methods . Lack of acquaintance of instructors, effective tools and methods in formative assessment are the example of their weakness in evaluation (11). Lee (1994) surveyed research named the effect of assessment approach on reported study strategy use and found that the students tend to use different study strategies according to the type of given exam . The deep process strategies in his studies while surface strategies were correlated to paper- pencil test (12). Brokhart and durkin (2003), in a research named classroom assessment, student motivation and achievement in high school, showed that the type of assessment causes different perception of presented homework and different efficiency in students . Policy and validity prospect for performance- based assessment showed that performance assessments encourage the divergent thinking and concentration on high level or complex skills, besides the knowledge application in concrete situations these methods provide the proper background to involve them with subjects individually or in group by encouraging students to find different solutions and consider special value for educational goals . The general goal of present research is the comparison of learning and memorization rate of english, based on authentic and traditional assessment . The main hypothesis: using authentic assessment approach is more effective than traditional assessment on the rate of students english learning and memorization (14). Hypothesis 1: the rate of performance learning in authentic assessment is more than the traditional ones.hypothesis 2: the rate of memorization in authentic methods is more than the traditional ones.hypothesis 3: the rate of post - test scores is more in authentic assessment in comparison with traditional one.hypothesis 4: the attitude toward test in authentic methods is more positive than the traditional ones . Hypothesis 1: the rate of performance learning in authentic assessment is more than the traditional ones . Hypothesis 2: the rate of memorization in authentic methods is more than the traditional ones . Hypothesis 3: the rate of post - test scores is more in authentic assessment in comparison with traditional one . Hypothesis 4: the attitude toward test in authentic methods is more positive than the traditional ones . The research method is semi - experimental and the sample includes 60 students selected by simple random sampling . Assessment devices used in the research were: 1-academic achievement pre - test of english . 2-academic achievement post - test 3-revised questionnaire of attitude toward tests (saas - r).4-english performance test before carrying the authentic and traditional assessment approaches into execution, two groups had been taken the scholar academic achievement pre - test in order to assure not to be any significant differences between two groups . After the execution of above mentioned method (about 14 weeks), the academic achievement post - test, and performance test and attitude toward tests (saas - r) were performed . Moreover, 2 months after post - test, it was replicated to measure the rate of memorization . In order to analyze data the statistical method, the dependent and independent t- tests were used to determine mean differences of two groups and k2 test was applied to assign the differences of two groups attitude toward tests . Hypothesis 1: the rate of students performance learning in authentic assessments is more than the traditional ones . As the calculated (t=4/527) in confidence level of 99% (a=0/01) and (df=29) is more than tc(=2/756), the null hypothesis is rejected and the research hypothesis is approved . It means that there is significant difference between the rate of students performance learning in authentic assessment and traditional assessment . The mean of authentic assessment is bigger, so the rate of students performance learning in authentic assessment is more . T - test statistics to determine the discrepancy of performance learning in authentic & traditional assessment . Hypothesis 2: the rate of post - test scores is more in authentic assessment in comparison with traditional one as the calculated (t=1.29) in confidence level of% 95 (a=0.05) and (df=58) is less than tc (= 2), the null hypothesis is approved and alternative one is rejected . It implies that there was no significant difference between two groups post - test scores . T - test statistics to determine the discrepancy of post - scores in authentic & traditional assessment . Hypothesis 3: the rate of memorization in authentic methods is more than the traditional ones . Because the calculated (t=3.908) in confidence level of% 99 (a=0.01) and (df=29) is more than tc (= 2.756), the null hypothesis is rejected and alterative one is approved . It means that there is significant difference between the rate of english memorization in authentic and traditional methods . The mean of authentic assessment is bigger, so the memorization rate of it is more . T - test statistics to determine the discrepancy of memorization in authentic & traditional assessment . Hypothesis 4: the attitude toward test in authentic methods is more positive than the traditional ones . K is used to inferential analysis of this hypothesis . As calculated k (566.66) in confidence level of 99% (a=0.01) and (df=3) is bigger than k of table (= 11.345), it implies that there is significant difference among the observed and expected frequencies statistically and the null hypothesis is rejected and research hypothesis is approved . It means that the students attitude toward test in authentic methods is more positive than the traditional ones hypothesis 1: in order to determine this effect the rate of gained scores from students performance learning test were surveyed among two groups (control and experimental groups). The results imply that the rate of students performance learning in authentic methods are more in comparison to traditional assessments performance statistically . These results are associated with the results of other researcher as lee (7, 12 - 15) hypothesis2: to determine this effect the student academic achievements in authentic groups were surveyed in comparison to traditional groups . The gained results show that there is nt signification difference between the scores of two group in academic achievement test in cognitive domain . These results are similar to other researchers findings as: (1, 7, 13, 15). Hypothesis 3: in the case of this hypothesis, the results imply that there is significant difference between the scores of two groups . Hypothesis 4: the mean of attitude scores of students included in authentic assessment group was surveyed in comparison to traditional assessment one . It means that the authentic assessment group has more positive attitude toward the tests and has higher perception of self - academic . They evaluate the school goals more internalized and meet more self - regulation and motivation . The results are similar to the findings of (13, 14, 17, 18). Considering the results of this research, some suggestions are as follow: * most teachers are familiar with traditional assessments methods but they do nt have systematic and enough knowledge with authentic and new assessment methods . So it is suggested to be presented the teachers necessary awareness and knowledge about these kinds of assessments through the co - service courses. *it is suggested that the writers of english class books should concentrate on the materials that, firstly they are needed for real life and secondly they should be commensurable and able to evaluate directly though performance tests and other alternative methods. *noticing that assessment methods follow the assessments goals it is suggested to curriculum planners and teachers consider the assessments goals, the evaluated subject, the features of learners and other related consideration before using any assessment method. *as the teaching based on performance assessments is time - consuming, it is suggested to be considered more time during the course. *it is suggested to the teachers to use different kinds of assessment methods until the students can show their abilities better according to their personal features (for example: cognitive styles). *it is suggested to curriculum planners and teachers not to consider the authentic assessments in contrast to traditional ones, and not to limit their choices just to one of these methods . It would be better they consider the methods complementary that assess different educational goals . Most teachers are familiar with traditional assessments methods but they do nt have systematic and enough knowledge with authentic and new assessment methods . So it is suggested to be presented the teachers necessary awareness and knowledge about these kinds of assessments through the co - service courses . It is suggested that the writers of english class books should concentrate on the materials that, firstly they are needed for real life and secondly they should be commensurable and able to evaluate directly though performance tests and other alternative methods . Noticing that assessment methods follow the assessments goals it is suggested to curriculum planners and teachers consider the assessments goals, the evaluated subject, the features of learners and other related consideration before using any assessment method . As the teaching based on performance assessments is time - consuming, it is suggested to be considered more time during the course . It is suggested to the teachers to use different kinds of assessment methods until the students can show their abilities better according to their personal features (for example: cognitive styles). It is suggested to curriculum planners and teachers not to consider the authentic assessments in contrast to traditional ones, and not to limit their choices just to one of these methods.
Lung cancer risk prediction models provide an estimate of individual's risk of developing lung cancer such that at - risk subjects can be targeted for preventive and treatment interventions (1). Risk models hold promise for improving patient care by aiding the clinicians decision making process regarding choice of interventions and/or treatments . Risk models can also guide selection of individuals at the population level, for screening: this ensures limited resources are focussed on those individuals who are most likely to benefit . Existing lung cancer absolute risk prediction models are mostly based on traditional epidemiological and/or clinical risk factors (27), limiting their predictive and discriminative abilities . For an improved precision, incorporation of genetic and molecular markers of disease in risk models has been advocated (8) and aided by recent proliferation of genetic / genomic research which has led to the identification of susceptibility genes and biological markers in many diseases (912). Common gene variants involved in lung cancer have been recently identified through a number of large, collaborative, genome - wide association studies . Susceptibility genes identified to date include those on chromosomes 5p15.33, 6p21, and 15q24 - 25.1 (1315). Apart from these, other genetic loci have also been identified in candidate gene association studies targeting specific molecular pathways; such as genes encoding proteins in cell cycle control, oxidant response, apoptosis, dna repair, cell adhesion and airways inflammatory response (16,17). While genomics research has been very fruitful in identifying these common, low - risk allelic variants, there is a growing scepticism regarding their usefulness in risk prediction . It has been shown that risk profiles generated by common low - moderate susceptibility loci, in a simple additive model, provides limited discrimination (18,19). The limited contribution of single nucleotide polymorphisms (snps) to risk profiling has been partly blamed on restriction to a limited number of significant alleles, methodological limitations regarding assessment of model performance and statistical approaches for incorporating the variants (19). Whilst the usual approach has been to utilise only the significant variants for risk profiling, an improved disease prediction may be attained by accounting for a large ensemble of markers (20). For the relatively few markers arising from candidate - gene studies, incorporation of the interactive effect of these genes, through epistasis modelling, may provide better predictions beyond that afforded by the limited effect of multiple loci using additive effects (21). Models including epistatic interactions take into account the complex biological relationships among the loci and extend the traditional method that focuses only on additive score using a weighted or unweighted number of risk alleles, which assume independence between the markers (22). In the past three decades, improvements in risk prediction models brought about by the inclusion of markers and genetic factors were quantified using changes in the area under the receiving - operating characteristic curve (auc) (23). Recently, an increasing popular measure of evaluating improvements in risk predictions, the net reclassification improvement was introduced (24). This measure involves cross - tabulating categories of predicted risk for 2 models, usually one with the new marker under study and the other without it, to see how persons are classified differently when these models are used (25). In this study, we investigated the presence of epistasis among a panel of snps previously validated individually in lung cancer (26) and used both area under the receiver operating characteristic (auc) analysis and net reclassification improvement (nri) to assess the contribution of adding an interactive epistatic effect to an extensively validated clinical - based risk model for lung cancer . Details of recruitment procedure, study design and validation have been previously reported (3,27). Briefly, incident cases of histologically or cytologically confirmed lung cancer, ages between 20 and 80 years, were included . Lung cancer included any of topographical subcategories of code c34 of the international classification of disease for oncology 9th revision . Two population controls per case, matched on year of birth (2 years) and gender, were selected from registers of general practitioners in liverpool area . The study protocol was approved by the liverpool research ethics committee, and all research participants provided written informed consent in accordance with the declaration of helsinki . In this study, we utilised complete genotype data on individuals included in the independent validation of snps identified in a candidate - gene genetic association study (26). The data comprises of 2385 subjects (cases=718, controls=1667) selected from individuals recruited into the llp between 2000 and 2008 . Of this number, 1362 (cases=418 and controls=914) were included in llp case - control data used to develop the llp risk model (3). Data on epidemiological, clinical and lifestyle factors were collected using a standardised questionnaire supplemented with hospital case note reviews conducted by trained llp research nurses . Information documented includes: patients smoking status (smoking duration), previous history of pulmonary diseases (pneumonia, copd and bronchitis), previous history of malignant diseases excluding skin melanoma, occupational exposure to asbestos, family history of lung cancer with age at onset, and case diagnosis details (date of diagnosis, histological subtype and staging). Genetic data consist of 20 snps independently validated from 157 snps screened in a candidate - gene discovery study; details of selection and genotyping have been described elsewhere (26). Briefly, 157 candidate snps were screened in a discovery cohort of 439 subjects (200 controls and 239 lung cancer cases), which identified 30 snps associated with either the healthy smokers (protective) or lung cancer (susceptibility) phenotype . After genotyping this 30 snp panel in a validation cohort of 491 subjects (248 controls and 207 lung cancers) and, using the same protective and susceptibility genotypes from the discovery cohort, a 20 snp panel were selected based on replication of snp associations in the validation cohort that includes variants in the metabolism of smoking - derived carcinogens (nat2 and cyp2e1), inflammatory cytokines [interleukins 1(il1b), 8(il8), and 18(il18), tissue necrosis factor 1 receptor (tnfr1), toll - like receptor 9 (tlr9)], smoking addiction [dopamine d2 receptor (drd2) and dopamine transporter 1(dat1)], nicotine dependency [5-nachr (chrna3)], antioxidant response to smoking [1 anti - chymotrypsin (serpina3) and extracellular super - oxide dismutase (sod3)], cell cycle control, dna repair and apoptosis (xpd, tp73, bcl-2, fasl, cerb1, and rev1) and integrins (itga11, itgb3) implicated in apoptosis . Genomic dna was extracted from whole blood samples by standard salt - based methods and purified genomic dna was aliquoted (10 ng/l concentration) into 96-well plates . Genotyping was performed on a sequenom system (sequenom autoflex mass spectrometer and samsung 24 pin nanodispenser) (26). Characteristics of the subjects in the cases and controls were compared using t - test for continuous variables and test or fisher's exact test for discrete variables as appropriate . Genotype and allele frequencies were checked for each snp for hardy - weinberg equilibrium (hwe). The multifactor dimensionality reduction (mdr) and random forest (rf) were used to investigate gene - gene interactions by identifying snp combinations that provide the best discrimination of the status of the subjects . Mdr is a non - parametric, model - free method that utilises a constructive induction technique to collapse high - dimensional genetic data into a single dimension (28,29). It pools multi - locus genotypes into high and low risk groups using an exhaustive search to identify optimal combination of polymorphisms, which can then be evaluated for its ability to classify or predict disease status . In our implementation of mdr the relief - f algorithm as implemented in the mdr was used as a first approach to select among the 20 snps that are most likely to interact . An exhaustive search of all possible 15 loci were then explored using 10-fold cross validation as described by hahn et al (28). Cross - validation allows estimation of the prediction error by leaving out a portion of the data as an independent test set . With 10-fold cross - validation, the data are divided into 10 equal parts, the model was developed on 9/10 of the data (i.e. The training data) and then evaluated on the remaining 1/10 of the data (i.e. The independent testing data). This is repeated for each possible 9/10 and 1/10 of the data and the resulting ten prediction errors are averaged (29). Mdr, then, seeks to find the single - locus or multi - locus predictor(s) for explaining the outcome (based on a balanced accuracy measure - the arithmetic mean of sensitivity and specificity), based on the available genomic information (30). The prediction accuracy and cross - validation consistency defined as the number of cross - validation replicates (partitions) in which that same n - locus predictor(s) was chosen as the best predictor of lung cancer status i.e. The number of replicates in which it minimised the classification error were used to select the best snps in each 1 to 5-locus combination (31). The overall best snp classifier of lung cancer status was selected as the one with the maximum prediction accuracy and cross - validation consistency and evaluated statistically using 1000-fold permutation test . For comparison, we used the freely available willows software package for generating rf (32). Rf ranks variables by a variable importance index, a measure which reflects the importance of a variable on the basis of the classification accuracy, while considering the interaction among variables (33). A classification tree was built by the recursive partitioning method; each tree is constructed using a different cohort of bootstrap samples from the original cohort . Approximately one - third of the samples are left out of the bootstrap (oob) samples and hence not used in the construction of the tree . The number of trees was set to 10,000 and the default values of the other parameters as provided by the program were used . Several classification trees were created with replacement from the original data imput into the program . To determine the importance of an snp, first the values of the snp in the oob samples are randomly permuted; then both the original oob samples and the permuted oob samples are classified by the corresponding tree . The difference in the correct classification rates between the original and permuted oob samples determines the importance of the snp, and the variable importance is obtained by averaging the differences over all trees in the random forest (32,34). Risk prediction was performed using the same risk factors included in the llp risk model (3). Multivariable logistic regression was employed to generate estimates of predicted 5-year absolute risk of lung cancer in i) a model with epidemiological data and ii) an extended model with both genetic and epidemiological data . The baseline risk (, the constant term in the regression model) for the prediction of 5-year absolute risk using the extended model with both genetic and epidemiological data was recalculated . The method for calculating the baseline from age- and gender - specific lung cancer incidence rates from the liverpool area has been described (3). The only difference is that the probability model now includes information on rs1799732 (drd2), rs5744256 (il-18) and rs2306022 (itga11). The area under the receiver - operating characteristics (auc) was used to i) assess the discriminatory ability of the models, and ii) compare the models with and without snps . The increase in auc furthermore, the net reclassification improvement (nri) was used to assess the added discrimination offered by the addition of snps to the risk model (24). Improvement in model calibration was assessed using akaike information criteria (aic) and bayesian information criteria (bic). Unless otherwise stated, all analyses were performed using r version 3.1.1 and stata version 13.1 (statacorp lp, college station, tx, usa). Details of recruitment procedure, study design and validation have been previously reported (3,27). Briefly, incident cases of histologically or cytologically confirmed lung cancer, ages between 20 and 80 years, were included . Lung cancer included any of topographical subcategories of code c34 of the international classification of disease for oncology 9th revision . Two population controls per case, matched on year of birth (2 years) and gender, were selected from registers of general practitioners in liverpool area . The study protocol was approved by the liverpool research ethics committee, and all research participants provided written informed consent in accordance with the declaration of helsinki . In this study, we utilised complete genotype data on individuals included in the independent validation of snps identified in a candidate - gene genetic association study (26). The data comprises of 2385 subjects (cases=718, controls=1667) selected from individuals recruited into the llp between 2000 and 2008 . Of this number, 1362 (cases=418 and controls=914) were included in llp case - control data used to develop the llp risk model (3). Data on epidemiological, clinical and lifestyle factors were collected using a standardised questionnaire supplemented with hospital case note reviews conducted by trained llp research nurses . Information documented includes: patients smoking status (smoking duration), previous history of pulmonary diseases (pneumonia, copd and bronchitis), previous history of malignant diseases excluding skin melanoma, occupational exposure to asbestos, family history of lung cancer with age at onset, and case diagnosis details (date of diagnosis, histological subtype and staging). Genetic data consist of 20 snps independently validated from 157 snps screened in a candidate - gene discovery study; details of selection and genotyping have been described elsewhere (26). Briefly, 157 candidate snps were screened in a discovery cohort of 439 subjects (200 controls and 239 lung cancer cases), which identified 30 snps associated with either the healthy smokers (protective) or lung cancer (susceptibility) phenotype . After genotyping this 30 snp panel in a validation cohort of 491 subjects (248 controls and 207 lung cancers) and, using the same protective and susceptibility genotypes from the discovery cohort, a 20 snp panel were selected based on replication of snp associations in the validation cohort that includes variants in the metabolism of smoking - derived carcinogens (nat2 and cyp2e1), inflammatory cytokines [interleukins 1(il1b), 8(il8), and 18(il18), tissue necrosis factor 1 receptor (tnfr1), toll - like receptor 9 (tlr9)], smoking addiction [dopamine d2 receptor (drd2) and dopamine transporter 1(dat1)], nicotine dependency [5-nachr (chrna3)], antioxidant response to smoking [1 anti - chymotrypsin (serpina3) and extracellular super - oxide dismutase (sod3)], cell cycle control, dna repair and apoptosis (xpd, tp73, bcl-2, fasl, cerb1, and rev1) and integrins (itga11, itgb3) implicated in apoptosis . Genomic dna was extracted from whole blood samples by standard salt - based methods and purified genomic dna was aliquoted (10 ng/l concentration) into 96-well plates . Genotyping was performed on a sequenom system (sequenom autoflex mass spectrometer and samsung 24 pin nanodispenser) (26). Characteristics of the subjects in the cases and controls were compared using t - test for continuous variables and test or fisher's exact test for discrete variables as appropriate . Genotype and allele frequencies were checked for each snp for hardy - weinberg equilibrium (hwe). The multifactor dimensionality reduction (mdr) and random forest (rf) were used to investigate gene - gene interactions by identifying snp combinations that provide the best discrimination of the status of the subjects . Mdr is a non - parametric, model - free method that utilises a constructive induction technique to collapse high - dimensional genetic data into a single dimension (28,29). It pools multi - locus genotypes into high and low risk groups using an exhaustive search to identify optimal combination of polymorphisms, which can then be evaluated for its ability to classify or predict disease status . In our implementation of mdr the relief - f algorithm as implemented in the mdr was used as a first approach to select among the 20 snps that are most likely to interact . An exhaustive search of all possible 15 loci were then explored using 10-fold cross validation as described by hahn et al (28). Cross - validation allows estimation of the prediction error by leaving out a portion of the data as an independent test set . With 10-fold cross - validation, the data are divided into 10 equal parts, the model was developed on 9/10 of the data (i.e. The training data) and then evaluated on the remaining 1/10 of the data (i.e. The independent testing data). This is repeated for each possible 9/10 and 1/10 of the data and the resulting ten prediction errors are averaged (29). Mdr, then, seeks to find the single - locus or multi - locus predictor(s) for explaining the outcome (based on a balanced accuracy measure - the arithmetic mean of sensitivity and specificity), based on the available genomic information (30). The prediction accuracy and cross - validation consistency defined as the number of cross - validation replicates (partitions) in which that same n - locus predictor(s) was chosen as the best predictor of lung cancer status i.e. The number of replicates in which it minimised the classification error were used to select the best snps in each 1 to 5-locus combination (31). The overall best snp classifier of lung cancer status was selected as the one with the maximum prediction accuracy and cross - validation consistency and evaluated statistically using 1000-fold permutation test . For comparison, we used the freely available willows software package for generating rf (32). Rf ranks variables by a variable importance index, a measure which reflects the importance of a variable on the basis of the classification accuracy, while considering the interaction among variables (33). A classification tree was built by the recursive partitioning method; each tree is constructed using a different cohort of bootstrap samples from the original cohort . Approximately one - third of the samples are left out of the bootstrap (oob) samples and hence not used in the construction of the tree . The number of trees was set to 10,000 and the default values of the other parameters as provided by the program were used . Several classification trees were created with replacement from the original data imput into the program . To determine the importance of an snp, first the values of the snp in the oob samples are randomly permuted; then both the original oob samples and the permuted oob samples are classified by the corresponding tree . The difference in the correct classification rates between the original and permuted oob samples determines the importance of the snp, and the variable importance is obtained by averaging the differences over all trees in the random forest (32,34). Risk prediction was performed using the same risk factors included in the llp risk model (3). Multivariable logistic regression was employed to generate estimates of predicted 5-year absolute risk of lung cancer in i) a model with epidemiological data and ii) an extended model with both genetic and epidemiological data . The baseline risk (, the constant term in the regression model) for the prediction of 5-year absolute risk using the extended model with both genetic and epidemiological data was recalculated . The method for calculating the baseline from age- and gender - specific lung cancer incidence rates from the liverpool area has been described (3). The only difference is that the probability model now includes information on rs1799732 (drd2), rs5744256 (il-18) and rs2306022 (itga11). The area under the receiver - operating characteristics (auc) was used to i) assess the discriminatory ability of the models, and ii) compare the models with and without snps . The increase in auc furthermore, the net reclassification improvement (nri) was used to assess the added discrimination offered by the addition of snps to the risk model (24). Improvement in model calibration was assessed using akaike information criteria (aic) and bayesian information criteria (bic). Unless otherwise stated, all analyses were performed using r version 3.1.1 and stata version 13.1 (statacorp lp, college station, tx, usa). Seven hundred and eighteen cases and 1667 population controls were successfully genotyped for 20 snps, which had been independently validated from 157 snps screened in a candidate - gene discovery study (26). Men constituted the majority of the study population cases (57.7%) and (58.1%) controls . The proportion of ever smokers was significantly higher in cases (93.2%) compared with controls (65.2%). Significant differences were observed in other risk factors including smoking duration, prior diagnosis of pneumonia, occupational exposure to asbestos, and prior diagnosis of tumour (p<0.001). Heterozygosity for rs1799732 (drd2), rs5744256 (il-18) and rs2306022 (itga11) conferred an increased risk for lung cancer in reference to the wild - type genotype [or 1.74 (95% ci 1.312.32); 1.42 (95% ci 1.161.72) and 2.53 (95% ci 2.063.12), respectively]. The homozygote genotype for rs16969968 (chrna3/5), rs13181 (ercc2), rs5744256 (il-18) and rs2306022 (itga11) increased the risk of developing lung cancer with reference to the wild - type [or 1.46 (95% ci 1.111.93); 1.46 (95% ci 1.131.89); 4.07 (95% ci 3.115.31) 4.09 (95% ci 2.217.56), respectively]. Table iii summarises the result obtained from the mdr analysis investigating epistatic effects among the snps . The best candidate classifiers of lung cancer status based on five snp loci selected using the cross - validation consistency, training and testing accuracy were as follows: single locus: rs2306022 (itga11); 2 loci: rs5744256 (il-18), rs2306022 (itga11); 3 loci: rs1799732 (drd2), rs5744256(il-18), rs2306022 (itga11); 4 loci: rs1696998 (chrna3/5), rs1799732 (drd2), rs5744256 (il-18), rs2306022 (itga11); 5 loci: rs1799732 (drd2), rs763110 (fasl), rs5744256 (il-18), rs4073 (il-8), rs2306022 (itga11). The 3 loci consisting of snps rs1799732 (drd2), rs5744256 (il-18) and rs2306022 (itga11) appears to be the overall best classifier of lung cancer status . These loci had training and testing accuracy of 0.6592 and 0.6572 respectively, and the cross validation consistency of 10/10 (model selected as the best of 3 in 10 cv) p<0.0001 (permutation test). Rf ranks variables by a variable importance index, which is an indication of the importance of a variable on the basis of classification accuracy while considering interaction among variables . The three snps [rs1799732 (drd2), rs5744256 (il-18) and rs2306022 (itga11)] selected as the overall best classifier of lung cancer status in mdr were also ranked top 3 by rf using variable importance index . Table v summarises reclassifications for cases and controls using epidemiological model and models with snps [rs1799732 (drd2), rs5744256 (il-18) and rs2306022 (itga11)]. Subjects were categorised into three different thresholds; low - risk (<0.91), intermediate risk (0.91 to 5.12), and high - risk (> 5.12) groups . The threshold values were defined from the predicted 5-year absolute risks for the original llp control samples (n=1,272), assuming the risk distribution in this group is similar to that of the general liverpool population . The upper threshold (5.12) corresponds to the value for the top 20% of predicted absolute risks in the population; individuals whose 5-year predicted absolute risk is equal to or above this value are designated as high risk group . The lower threshold value of 0.91 corresponds to the bottom 40% of absolute risks in the control population and represents the low risk group . This definition of high risk and low risk groups was used in an earlier study (13). Overall, 42.7% of cases (311/727) and 35.7% of controls (592/1657) had their predicted risks re - classified into other risk groups when snps were incorporated into risk prediction model . This reclassification showed improvement (upward shift) in approximately 25% of cases and became worse (downward shift) for 18% resulting in a net gain of ~6% . The net gain was higher for controls (10%) with overall improvement in risk (downward shift) for 23% and worse performance (upward shift) for 13% . Table vi depicts the odds ratios (or) and 95% confidence intervals (95% ci) of the multivariate logistic regression models for the epidemiological model and the extended model with snps . The ors and 95% ci for both models were comparable which suggests the absence of any serious confounding effects of snps on the relationship between each of the other clinical and epidemiological risk factors and lung cancer risk . Model fit was assessed using akaike information criterion (aic) and bayes information criteria (bic). There was an improvement in model fit as indicated by the reduction of the aic from 2098.42 from the epidemiological model to 1930.14 for the extended model with snps . Likewise, a similar reduction was observed in bic from 2167.75 from the epidemiological model to 2016.80 for the extended model with snps . The apparent auc of the epidemiological model without snps was 0.75 (95% ci 0.730.77). When epistatic data were incorporated in the extended model, the auc increased to 0.81 (95% ci 0.790.83) which corresponds to 8% increase in auc for the model with snps (delong's test p=2.2e-). After correction for optimism, the auc was 0.73 for the epidemiological model and 0.79 for the extended model . This study demonstrates the use of comprehensive analytical techniques for investigating the contribution of adding an interactive effect of a panel of genetic markers (snps) to the prediction of individual absolute risk of developing lung cancer, using a risk model similar to the llp model (3). Using genotype data from 2385 individuals included in the independent validation of snps identified in a candidate - gene genetic association study from the llp case - control study, we found the 3 loci genotype interaction rs2306022 (itga11), rs5744256 (il-18) and rs1799732 (drd2) provided the best classifier of disease status using both mdr and rf . Adding these snps to a clinically - based lung cancer risk model lead to an increase in auc (0.75 to 0.81); and we utilised two different approaches; discrimination and reclassification to evaluate the contribution of adding an interactive epistatic effect to a risk model for lung cancer . Auc is the most popular metric used for measuring the discriminatory power of a model to correctly classify subjects with or without a disease . Our result showed 8% increase in auc (delong's test p=2.2e-) for risk prediction in the extended model with snps (auc=0.81) compared with the epidemiological model without snps (auc=0.75), which is higher than that reported by li et al (9). Li et al, in a chinese case - control study, genotyped five snps identified in genome wide association study of 5068 subjects . The genetic risk scores based on these snps were estimated by two approaches: a simple risk alleles count (cgrs) and a weighted method (wgrs). Their auc in combination with the bootstrap resampling method was used to assess the predictive performance of the genetic risk score for lung cancer . Smoking history contributed significantly to lung cancer (p<0.001) risk [auc=0.619 (0.6030.634)], and incorporated with wgrs gave an auc value of 0.639 (0.6210.652) after adjustment for over - fitting (9). For clinical risk prediction, it is expedient that a new risk model correctly classify individuals into higher or lower risk categories (37). Pencina et al introduced a new metric, the nri that assesses the improvement in model performance by quantifying the degree of correct classification (24). By applying the nri, we demonstrated that the addition of snps lead to a 17.5% improvement in the risk classification of the subjects . This study is the first to replicate the association between the itga11 locus and lung cancer described by young and colleagues (26). Itga11 (integrin 11) belongs to the family of transmembrane receptors that mediate physical interactions between cells and extracellular matrix protein collagens (38). Itga11 is localised to stromal fibroblast and commonly overexpressed in non - small cell lung cancer (nsclc) (38). Earlier studies have reported that the interactions of tumour cells with the stroma play a crucial role in tumour growth, invasion, metastases, angiogenesis, and chemoresistance (3841). It has been shown that carcinoma - associated fibroblasts in nsclc express higher levels of itga11 . One of the factors which are affected by higher levels of itga11 during tumour growth is igf2 (38,42). Higher levels of igf2, in turn, can stimulate growth of tumour epithelial cells leading to tumour progression and metastasis (38). Il18 (interleukin-18) is a multifunctional cytokine (an extracellular signalling molecule) that augments ifn- production and affects tumour immune response, leukocyte recruitment, cancer proliferation, and angiogenesis (43,44). An earlier study reported the presence of il-18 in induced sputum of lung cancer patients (45). Farjadfar et al also reported an association between il-18 and lung cancer in a case - control study including 73 lung cancer patients (53 squamous carcinoma and 20 small cell lung carcinoma), and 97 healthy regional aged - matched individuals (46). They suggested that their finding may be attributed to the disruption of the potential of camp responsive element - binding protein site and subsequent reduction in il-18 production as observed in other cancer types (46). Reduced production of il-18 can result in decreased ifn- synthesis, imbalanced th1/th2 differentiation, insufficient activation of natural killer cells and cd8 lymphocytes (46,47) impairment of cancer cell apoptosis and efficient angiogenesis (47,48). Ddr2 is a receptor tyrosine kinase that binds collagen as its endogenous ligand (49). It has been previously shown to promote cell migration, proliferation, and survival when activated by ligand binding and phosphorylation (49,50). Harmmerman et al reported that ddr2 mutations are present in 4% of small cell lung carcinomas; gain - of - function mutations in this gene are important oncogenic events and are amenable to therapy with dasatinib (49). Since epistasis is known to contribute to unexplained genetic variation of common diseases, some genetic variants may have a weak and insignificant independent effect, but strong epistatic effect (biological interaction) with other variants . The integration of genetic variants in risk prediction models beyond the traditional epidemiological covariates have been applauded as the way forward in lung cancer risk prediction modelling (8). Genetic factors function primarily through complex mechanisms that involve interactions between multiple genes and environmental factors (21,22). However, the effect of interaction will be disregarded if the genetic effect is examined in isolation, without taking cognisance of potential interactions with other unknown factors (31). The inherent nonlinearity implies that epistasis can occur among polymorphisms even in the absence of independent effect of the components, presenting computational intensive difficulties and statistical challenges because an infinite number of combinations that needs to be evaluated (21,22). The use of nonparametric and genetic model - free machine learning algorithms such as mdr (28,29) and rf (32,33) have been proposed to overcome the caveat of the traditional parametric statistics and have proven to be useful in this study . Here we see that the addition of the three snps increases the auc, indicating that the interaction of these loci may be important . There was an improvement in model fit, as indicated by the reduction of the aic and bic . Furthermore, the snps used in this study were internally validated using a two stage design as described by young et al (26) and the use of hwe to minimise genotyping error are methodological advantages utilised to minimise false positive results . To the best of our knowledge, this is the first study to evaluate the addition of these specific interactions of snps to a lung cancer risk model . However, the result of this study must be considered in the light of a number of limitations . First, our prediction model used covariates in the llp risk model but did not include other risk factors for lung cancer such as chronic obstructive pulmonary diseases . However, the objective of this study is to evaluate the contribution of adding an interactive effect of a panel of genetic snps to the llp risk model and the model has been validated in three independent external datasets with good discrimination and calibration (27). Second, our study demonstrates how a modest increase in auc can lead to a substantial improvement in reclassification as quantified by the nri . This finding supports a suggestion by pencina et al that a small increase in auc might still be suggestive of a meaningful improvement (24). Third, the llp comprise predominantly caucasians and therefore, the lack of ethnic diversity implies that this model may be less applicable in non - white population . Fourth, our approach to reclassification did not distinguish between persons with competing events and those without an event because both are classified as not having the event of interest . Fifth, the lack of validation of the epistatic model in an independent population is a limitation, however, the application of bootstrap correction for optimism addresses in part the lack of independent validation . Sixth, many of the 20 snps from table ii failed to replicate in the current study, particularly given the larger sample size (718 cases, 1667 controls) in the current study when compared with previous study (248 cases, 207 controls). A plausible explanation for this observation may be due to the fact that the non - significant snps play lesser or no role in epistatic interaction . Finally, our threshold values for risk classification was based on the predicted 5-year absolute risk for original llp control samples but the appropriateness of these threshold values in other populations is uncertain . Using different values could have affected the results of our reclassification analyses and subsequent clinical implications . In conclusion, our result shows in principle how an snp epistatic factor can be incorporated into an epidemiological risk prediction model . In this study, inclusion of snps rs1799732 (drd2), rs5744256 (il-18), rs2306022 (itga11) resulted in a modest improvement in lung cancer risk prediction.
Decompressive craniectomy is a critical treatment modality for the control of highly increased intracranial pressure10,18,21). Nonetheless, it can lead to large cranial defect that requires subsequent cranioplasty for neural tissue protection, successful cosmetic outcome and improvement of cerebral function4,20). An autogenous bone flap obtained at the time of the craniectomy can be used in subsequent cranioplasty because it is viable and fits well into the cranial defect . However, in many clinical situations, autogenous bone is unavailable because of bone resorption preventing good cosmetic outcome and cerebral protection14). Recently, alloplastic materials including polymethyl - methacrylate (pmma), hydroxyapatite, and metallic mesh have been suggested as intra - operative malleable substitutes . These materials, however, require complex processes, such as intraoperative mixing for the preparation, adaptation, and contouring of the implant for the defect, which result in increased surgical time . In addition, the molding process may lead to poor cosmetic outcomes in patients with large or complicated defects . Furthermore, the contouring of implant by direct contact to the dura can develop exothermic reactions or the release of toxic monomers intraoperatively . It results in focal tissue damage, which implicate local and systemic reactions9,19). In order to overcome the shortcomings of intraoperative molding, many techniques have been introduced for the prefabrication of customized cranioplastic implants using medical imaing and three - dimensional (3d) biomodeling1,3,5,6,8,11,12,17,19,22). The prefabrication of alloplastic implants that are tailored to individual patients' defects not only improves aesthetic outcomes, but also decreases surgical time, blood loss, and the risk of infection16). In this study, the authors demonstrate a simple and cost - effective cranioplasty method using individualized mold prefabrication with a 3d printer and pmma casting . Between november 2009 and april 2011, 16 patients with large skull defects (> 100 cm) underwent cranioplasty with individualized prefabricated molds created by the 3d model and pmma casting method at our institution . The median patient age at the time of cranioplasty was 52.5 years (range, 16 to 71 years). The cranial defects were caused by head trauma in eight cases (50%), cerebral infarction in three cases (19%), and intracerebral hemorrhage in five cases (31%). Most of the cranial defects were located in the fronto - temporo - parietal region (88%) (table 1). For unilateral cranial defect, digital imaging and communications in medicine (dicom) data were acquired with the spiral volumetric technique during preoperative axial 1-mm spiral computed tomography (ct) scans (philips brilliance 64 slice ct, philips healthcare, best, the netherlands). Subsequently, the dicom data were processed and converted to 3d images with mimics 13.1 software (interactive medical image control system; materialise inc ., the image of the implant was generated by a digital subtraction mirror - imaging process whereby the normal side of the cranium was used as a model (fig . Preoperative spiral ct scan data (5- to 10-mm slice thickness) were obtained before the decompressive craniectomy (fig . The stair - like surface of the 3d - implant model was processed with a smoothing technique by the mimics 13.1 software (materialise inc .) The pre- and postcraniectomy ct images were merged, and the 3d implant images were then cropped (fig . The 3d modeling of the mold was processed with magics 15 software (rapid prototyping software; materialise inc .) Prefabrication of the mold was performed by powder depositional modeling with the use of a spectrum z 510 3d printer (z corporation, burlington, ma, usa) (fig . The prefabrication process took an average of 6 hours, and the mold was then sterilized by autoclave . After aseptic draping, a skin incision was made along a scar from a previous operation . The pmma implant was constructed using the prefabricated mold during the dissection procedure . Due to the unknown biocompatibility of the prefabricated materials, the molds were wrapped with two layers of sterilized plastic . In order to prevent adhesion between the implant and the plastic, the volume of pmma was determined from the volume of the implant, which had been calculated preoperatively with the mimics 13.1 software (materialise inc . ). The pmma resin was prepared by mixing polymer powder with a liquid monomer . In the liquid state, the pmma resin was poured into the prefabricated molds and the molds were compressed to each other . The implant required minor trimming around the margins in order to achieve an exact fit into the defective region . The pmma implant was fixed to the defective region with titanium plates and self - tapping screws of 4 mm in length . Plane x - rays of the skull and a ct scan were conducted immediately after surgery . Between november 2009 and april 2011, 16 patients with large skull defects (> 100 cm) underwent cranioplasty with individualized prefabricated molds created by the 3d model and pmma casting method at our institution . The median patient age at the time of cranioplasty was 52.5 years (range, 16 to 71 years). The cranial defects were caused by head trauma in eight cases (50%), cerebral infarction in three cases (19%), and intracerebral hemorrhage in five cases (31%). Most of the cranial defects were located in the fronto - temporo - parietal region (88%) (table 1). For unilateral cranial defect, digital imaging and communications in medicine (dicom) data were acquired with the spiral volumetric technique during preoperative axial 1-mm spiral computed tomography (ct) scans (philips brilliance 64 slice ct, philips healthcare, best, the netherlands). Subsequently, the dicom data were processed and converted to 3d images with mimics 13.1 software (interactive medical image control system; materialise inc ., the image of the implant was generated by a digital subtraction mirror - imaging process whereby the normal side of the cranium was used as a model (fig . Preoperative spiral ct scan data (5- to 10-mm slice thickness) were obtained before the decompressive craniectomy (fig . The stair - like surface of the 3d - implant model was processed with a smoothing technique by the mimics 13.1 software (materialise inc .) The pre- and postcraniectomy ct images were merged, and the 3d implant images were then cropped (fig . The 3d modeling of the mold was processed with magics 15 software (rapid prototyping software; materialise inc .) Following the imaging of the required implant (fig . Prefabrication of the mold was performed by powder depositional modeling with the use of a spectrum z 510 3d printer (z corporation, burlington, ma, usa) (fig . The prefabrication process took an average of 6 hours, and the mold was then sterilized by autoclave . After aseptic draping, a skin incision was made along a scar from a previous operation . The pmma implant was constructed using the prefabricated mold during the dissection procedure . Due to the unknown biocompatibility of the prefabricated materials, the molds were wrapped with two layers of sterilized plastic . In order to prevent adhesion between the implant and the plastic, the volume of pmma was determined from the volume of the implant, which had been calculated preoperatively with the mimics 13.1 software (materialise inc . ). The pmma resin was prepared by mixing polymer powder with a liquid monomer . In the liquid state, the pmma resin was poured into the prefabricated molds and the molds were compressed to each other . The implant required minor trimming around the margins in order to achieve an exact fit into the defective region . The pmma implant was fixed to the defective region with titanium plates and self - tapping screws of 4 mm in length . Plane x - rays of the skull and a ct scan were conducted immediately after surgery . The median operation time was 184.3626.07 minutes (range, 150 - 380 minutes). The median follow - up period was 23 months (range, 14 - 28 months). Post - operative ct scans showed excellent restoration of the bony symmetry in all cases (fig . One patient who had an open wound defect developed a postoperative infection, which resulted in implant removal at 6 weeks . A representative case of a unilateral cranial defect and a case of bilateral cranial defects are described in this paper . A 71-year - old woman underwent cranioplasty with individualized pmma casting for the reconstruction of a large right fronto - temporo - parietal cranial defect . She had undergone a decompressive craniectomy for severe brain swelling that had been caused by a middle and posterior cerebral artery infarction 6 months before . Using the mirror - imaging process, an image of the cranial defect was generated, and the mold was prefabricated with the 3d printer . Intraoperatively, the pmma implant was created with the mold and then fit into the defect . A 49-year - old man underwent a bilateral decompressive craniectomy due to traumatic brain swelling . A 71-year - old woman underwent cranioplasty with individualized pmma casting for the reconstruction of a large right fronto - temporo - parietal cranial defect . She had undergone a decompressive craniectomy for severe brain swelling that had been caused by a middle and posterior cerebral artery infarction 6 months before . Using the mirror - imaging process, an image of the cranial defect was generated, and the mold was prefabricated with the 3d printer . Intraoperatively, the pmma implant was created with the mold and then fit into the defect . A 49-year - old man underwent a bilateral decompressive craniectomy due to traumatic brain swelling . An intra - operative molding process is required in traditional cranioplasties using allografts, although it causes poor cosmetic result, increased operation time and tissue injury . In order to overcome these shortcomings, however, there are some drawbacks for customized models including manufacturing time, biocompatibility, and cost . In this study, we developed a computer - generated model, which can be applied a prefabricated mold to the cranial defect . By using the pmma casting method our model may have beneficial effects on the clinical application for the reconstruction of cranial defects . Craniofacial biomodels can be fabricated by conventional milling techniques, laser stereolithography, and 3d printing technology5,8,11,16,19,23). In 1990, the construction of biomodels using 4-axis computer numerical control milling techniques was first reported . These biomodels were then used as templates for implants or as a master tool for making molds for the fabrication of implant15). However, a major disadvantage of the conventional milling technique was that it was not able to accurately represent the complex anatomy or the inner structure of the craniofacial bones5). In the late 1990s, modified cranioplasty techniques were introduced to the reconstruction of complex or extensive cranial defects, consisting of 3d stereolithography and template modeling5,7). Laser stereolithography is accurate to less than 1 mm, which is an improvement compared to conventional milling techniques . In addition, this technique demonstrated excellent results for the replication of complex geometric shapes5). In customized cranioplasty using stereolithography, the defect - bearing biomodel is utilized to mold a master implant following the creation of an impression mold of the cavity . Subsequently, a carbon - fiber reinforced polymer or acrylic implant is shaped by the mold5,19,23). However, the master implant must be constructed by hand into the defect in this model . In addition, the biomodel manufacturing time for stereolithography is about twice as long as that of 3d printing technology . Recently, the development of 3d printing technology has introduced 3d medical models to generate an exact copy of various patients' skulls and facial bone structures8,16,17). It allows prefabricated copy models to simulate preoperative or intraoperative procedures3). In the present study, we applied 3d printing technology for the prefabrication of a mold which can create an implant for the reconstruction of the cranial defect . The image of the implant was generated by a digital subtraction mirror - imaging process whereby the normal side of the cranium was used as a model . We developed a 3d model by using high - resolution (1-mm cuts) spiral ct scans . Consequently, the prosthesis had a stair - like surface because the 3d model was manufactured using the relatively thick spiral ct data . Therefore, a routine ct image may not be suitable for the creation of a precise model . It cannot develop precise model because there is no normal side of the cranium to use as a model . In order to overcome this problem, we used a precraniectomy routine ct image and modified it with a 3d model image program . It can also be useful by minor trimming around the margins as shown in fig . It may be a first time report to develop customized cranioplasty implant in bilateral cranial defect . By using our 3d model during the cranioplasty, the operation time may be reduced . In this study, the median operation time was 184.3626.07 min, whereas, in our previous report, it was 285128 min for cranioplasties using non - customized pmma implants13). The reason is that the preparation of the implant is performed during the exposure of the cranial defect . In addition, most of the pmma implants used in this study required only minor trimming before being fit into the cranial defects . A postoperative infection was found in one case (6.2%), who had an open wound defect previously . Considering the infection rate, this model is comparable to other procedures2). There were no other complications for 23 months follow - up period . Pmma is one of the most biocompatible alloplastic materials currently available, and its use has long been established for cranioplasty . . However, pmma induces an exothermic and potentially toxic nature of polymerization when it is conducted in situ . Polymerization can cause damage to sensitive dural and subdural structures and release monomers into the patient's blood circulation5,9,16). Therefore, a prefabricated implant has the advantage to prevent these potential complications of pmma, as like our model . Individualized prefabrication of the mold and pmma casting is an easier and more cost - effective method than the previously customized cranial prostheses3,5,6,8,11,16,19). In the present study, we performed the cranioplasty in two steps: the prefabrication of the mold and the casting of the pmma implant . It takes 1 and 6 hours to generate 3d images for the molding and prefabrication process, respectively . In addition, the cost of manufacturing a prefabricated mold is $450 usd approximately . There are some considerations for our customized cranioplasty method in case of complex cranial defects . In cases of bilateral cranial defects and asymmetrical skulls, although we used precraniotomy routine ct scans (5- to 10-mm slices) to generate 3d images of the implant for the bilateral cranial defects, satisfactory results may sometimes not be obtained as readily as with unilateral cranial defects . In addition, the degree of skin contracture over large or complex cranial defects can cause a problem with skin closure5). Therefore, one must be careful to assess the degree of skin contracture required over large or complex cranial defects prior to implant design, although we did not have this problem . In conclusion, cranioplasty using the individualized prefabrication of implants assures satisfactory aesthetic results, reduces surgical time, and decreases the potential complications associated with the use of pmma . In addition, our customized cranioplasty model may have advantages with respect to cost, manufacturing time, and the simplicity of the procedure.
While there has been little attention paid to kidney disease on a public health level, the reality is that many countries hardly bear the costs of providing end - stage renal disease care through renal replacement therapy . According to the latest usrds report, while the prevalence of diabetes has clearly increased and the prevalence of congestive heart failure has remained stable, the prevalence of chronic kidney disease appears to have declined slightly in 2009, from 15.8 percent to 15.1 percent when calculated with the mdrd-4 formula and from 14.7 percent to 14.5 percent when calculated with the ckd - epi formula; prevalence estimates of chronic kidney disease in usa in 19881994 had been 12.8 and 12 percent, respectively . Obviously, differences in the prevalence estimates may in part differ depending on the criteria and equations employed . Among the most frequent causes of end - stage renal disease, mesangioproliferative glomerulonephritis, mostly iga nephropathy, is the most frequent primary glomerular disorder worldwide, and progressive mesangioproliferative nephropathy constitutes a major cause of end - stage renal disease [2, 3]. Recent long - term controlled studies assessing the prognosis have shown that the condition does not represent a benign disorder as previously mentioned [47]. Once renal function impairment develops, end - stage renal disease appears inevitable, often in the long term . Over 25 years of followup, about 3050% of patients with igan will enter renal replacement therapy [8, 9]. Other causes of mesangial glomerulonephritis consist of pure mesangial proliferative glomerulonephritis, igm glomerulonephritis, and c1q glomerulonephritis . Progression in mesangioproliferative glomerulonephritis generally involves increasing proteinuria, pathological renal extracellular matrix protein accumulation, cell proliferation, and inflammatory cell infiltration [1115]. Pharmacological treatment of progressive mesangioproliferative disease is practically limited to renin - angiotensin system inhibition using angiotensin - converting enzyme inhibitors or type 1 angiotensin receptor antagonists, which serves to decelerate but is generally not capable of halting the advance of the disease [2, 13, 15]. As recently remarked by floege and eitner, there are few randomized controlled trials for iga nephropathy and very rarely do patient numbers exceed 200 . Consequently, most guidelines relating to igan are based on a low - to - very - low level of evidence and, in many cases, suggestions cannot even be offered . Thus, the majority of patients will continue to be treated based largely on opinion . With respect to the other causes of mesangioproliferative glomerulonephritis, in the absence of controlled trials, it is difficult to determine the efficacy of therapy . Administration of various immunosuppressive regimes, containing steroids and cytotoxic / cytostatic drugs, is increasingly adopted . Since there is no final agreement regarding the antiproteinuric efficacy of these protocols, which also vary in different disease states, and side effects are important, the clinical efficacy of new immunosuppressors is increasingly assessed [1719]. Among these, the mammalian target of the rapamycin (mtor) inhibitor family, which includes sirolimus and everolimus, is frequently used immunosuppressant with proliferation signal inhibitors properties employed in nephrology [1720]. However, serious side effects including renal injury and proteinuria have been described during treatment with these drugs, in the setting of renal allograft nephropathy, human glomerulonephritis as well as in experimental kidney disease [19, 2123]. Despite this, mtor inhibition has been shown to be beneficial in chronic mesangioproliferative nephropathy and to reduce proteinuria in an experimental anti - thy1 nephritis (a chronic model of progressive mesangioproliferative nephropathy) and in focal segmental glomerulosclerosis . Aberrant proliferation of mesangial cells is a common finding in a number of diseases that can lead to end - stage renal failure . A variety of initial insults, which may be metabolic (as in diabetic nephropathy) or immunological (as in iga disease and lupus nephritis), can cause uncontrolled mesangial cell proliferation . This in turn causes an increase in extracellular matrix deposition, ultimately leading to glomerulosclerosis, with subsequent activation of common intermediate pathways, associated with increased synthesis and a release of growth factors, cytokines, chemokines, and oxidant species, which stimulate the further proliferation of mesangial cells and finally mediating the damage of the kidney parenchyma . It is important to understand the proliferation mechanism of mesangial cell in order to determine the key regulatory molecular pathways involved in the pathological response to injury and ultimately to identify potential targets for therapeutic intervention . Platelet - derived growth factor (pdgf) has been recognized as a major mitogen and one of the most important growth factors, which mediates multiple cellular activities such as cell proliferation, hypertrophy, and extracellular matrix protein synthesis in various types of cells including mesangial cells, and plays an important role in the changes in glomerular morphology in diabetic nephropathy [25, 26] and mesangioproliferative glomerulonephritis, mainly igan (figure 1). In recent years some authors suggest that adiponectin stimulates endothelial cell growth and angiogenesis [28, 29], whereas others perceive it as a negative regulator of cell proliferation [30, 31]. Mechanistic insights into this phenotype suggest that adiponectin attenuates pdgf - induced phosphorylation of mtor via ampk activation . Interestingly, in a recent study it has been reported that in subjects with mesangial cell proliferation, as igan and diabetic nephropathy, there exists an increase of urinary adiponectin levels, which may partly result from enhanced filtration of circulating adiponectin through the changes of glomerular permselectivity and intraglomerular hydraulic pressure . The mammalian target of rapamycin plays a critical role in cell differentiation, migration, and survival [3335]. Mtor is an intracellular serine / threonine kinase and a central component of a complex signaling network that is highly conserved in evolutionary terms and expressed ubiquitously throughout the cells of the body . Mtor is a component of two major intracellular signaling complexes (mtorc1 and mtorc2), that play different roles downstream . Mtorc1 is activated by growth factors and amino acids and controls cellular proliferation, promoting processes such as dna translation, rna transcription, ribosomal biogenesis, and cell cycle progression . Inhibitors of mtor, such as rapamycin or everolimus, bind to an intracellular cytoplasmatic receptor, the fk506-binding protein-12 . The complex formed then interacts and disrupts mtor function and leads to cell cycle arrest in the g1 phase . In addition to blocking cell proliferation, mtor inhibitors have been found to be anti - inflammatory, antifibrotic, antitumoral, and antifungal, which underscores the involvement of mtor signaling in a wide range of cellular functions [33, 34, 36] (figure 1). Thus, mtor is essential for the proliferation of mesangial cells, as is the case of mesangioproliferative glomerulonephritis . In this regard, in vitro studies with mice mesangial cells under the effect of different concentrations of rapamycin showed that a remarkably low dose (0.01 ng / ml) inhibited both proliferation and type iv collagen production . However, this dose is below that used to produce clinically immunosuppressive effects (4.514 ng / ml), but could also minimize other potential adverse drug effects . In experimental studies, different doses of mtori may play opposite effects on mesangial expansion . This may appear to be particularly true with respect to mesangioproliferative glomerulonephritis . In this respect, low - dose rapamycin (2.5 mg / kg / body weight in rats) confers antiproteinuric effects in a chronic model of progressive mesangioproliferative nephropathy, that is, anti - thy1-induced glomerulosclerosis in the rat . Briefly, rapamycin remarkably limits the progressive course of chronic anti - thy1 antibody - induced renal disease towards glomerulosclerosis, tubulointerstitial fibrosis, and renal insufficiency . Renoprotection by low - dose rapamycin presents beneficial effects on a number of key pathways of renal disease progression, that is, proteinuria, renal matrix protein accumulation, cell proliferation, and leukocyte infiltration [1215, 36]. Moreover, the beneficial effects of mtor inhibition have recently been reported in several rat models of chronic kidney disease, that is, hypertensive 5/6 nephrectomy, diabetic nephropathy, hypertrophy following unilateral nephrectomy, tubulointerstitial fibrosis due to uretheral obstruction or nephrotic syndrome, and polycystic kidney disease, but not chronic transplant glomerulopathy [3843]. Since these experimental studies represent the vast majority of human chronic kidney disease, their findings together imply that mtor signaling acts as a rather common key pathway in the progression of renal disease . Furthermore, these studies suggest that inhibition of mtor might be a novel, generally effective therapeutic approach to chronic kidney disease . However, the latter option may also apply to early preventive treatment, since this represents generally the timing of mtor inhibition in experimental rat studies . However, the outcome of mtor inhibition in anti - thy1-induced glomerulosclerosis contrasts with the one previously reported in anti - thy1-induced acute glomerulonephritis [44, 45]. In the latter, the mtor inhibitor everolimus before or during the early marked mesangial cell proliferation turned out to be detrimental, manifesting aggravation of proteinuria, impaired self - healing, increased uremic mortality, and persistent glomerular fibrotic changes . The studies in anti - thy1 acute and chronic renal disease unanimously indicate that unaffected mtor signaling is critical for the very early and marked mesangial cell proliferation and subsequent normal glomerular repair of acute anti - thy1 glomerulonephritis [36, 44, 45]. In the further course of the disease, inhibition of mtor even acts beneficially and prevents chronic disease progression . Application of everolimus as late treatment for 14 weeks attenuated proteinuria and the time course of chronic anti - thy1 nephritis in the rat, through reduction in vascular endothelial growth factor vegf and tgf-1expression . Vegf is a potent mitogen expressed in podocytes and tubular cells that normally facilitates both glomerular and interstitial endothelial proliferation and angiogenesis [38, 46, 47]. Outlined by schrijvers et al ., the role of vegf in normal renal physiology is essentially unknown . However, vegf and its receptors are upregulated in experimental animals and humans with type 1 and 2 diabetes and mesangioproliferative glomerulonephritis as igan [4850]. Overexpression of vegf - a leads to glomerular collapse, proteinuria, and end - stage renal disease in mice [50, 51]. In subjects with early igan, some vegf polymorphisms may be associated with the increased risk of renal progression in patients with iga nephropathy . Finally, vegf expression is genetically regulated via the mtor pathway [53, 54], which is in turn well known to be inhibited by both sirolimus and everolimus . In contrast to daniel et al ., ramadan et al . Have shown that either early or late low (20 mg / l) but not high doses (100 mg / l) of everolimus attenuated the loss of the slit diaphragm proteins nephrin and podocin in adriamycin - induced nephrotic syndrome (an experimental nephropathy that mimics minimal change disease), suggesting that the antiproteinuric effect of this agent at the therapeutic dose is due to preservation of nephrin and podocin . Specifically, chronic administration of everolimus at high therapeutic doses to normal rats did not induce renal injury as expressed by the lack of adverse effects on glomerular nephrin / podocin abundance . However, the authors speculate that this high - dose effect may be due to a decline of glomerular filtration rate and to the hypoalbuminemia seen in these rats . These potential beneficial results achieved in experimental studies are now expanding towards a progressive model of human mesangioproliferative nephropathy, an important cause of end - stage kidney disease worldwide [2, 3]. However, clinical studies with sirolimus are scant and showed controversial results with other causes of glomerulonephritis . For example, while some studies reported a rapid decline in renal function with worsening proteinuria in patients with primary focal and segmental glomerulosclerosis [55, 56], others showed beneficial anti - proteinuric effects in this disease [39, 40]. However, with respect to mesangioproliferative glomerulonephritis and low - dose rapamycin, an interesting and provocative manuscript has recently been published . In this clinical study which included 25 subjects (15 on rapamycin), it has been shown that low - dose rapamycin plus angiotensin - converting enzyme inhibition (enalapril 5 mg / day) and statins (atorvastatin 10 mg / day) stabilized renal function and reduced glomerular proliferation in subjects with stage 3 chronic kidney disease measured with cr - edta technique due to iga nephropathy with proteinuria> 1 g / day . At 1 year, according to oxford classification rapamycin treatment was associated with a significant reduction of mesangial and endocapillary proliferation . Moreover, patients receiving only angiotensin - converting enzyme inhibition and statins lost 8 ml / min/1.73 m, whereas those under rapamycin improved by 5 ml / min/1.73 m (p = 0.03). However, sclerosis, chronic biopsy lesions, and proteinuria decreased similarly in both study groups . With respect to proteinuria, baseline values dropped from 2.9 1.8 to 2.0 0.9 g / day at one year, compared with the respective decrease in the control group from 3.7 1.6 to 2.8 1.4 g / day . The dose of rapamycin employed was 1 mg / day with through levels between 4 and 8 ng / ml, as it is usually used in renal transplantation . Nevertheless, authors consider this rapamycin approach as a low - dose regime, as they compare it with a previous work by fervenza et al . In which different classes of glomerulonephritis with proteinuria> 1 g / day and creatinine clearance> 20 ml / min were treated with rapamycin 5 mg / day to seek through levels between 7 and 10 ng / ml . However, in this work renal function was measured with cockcroft - gault equation, only 5 of the 11 subjects included had iga nephropathy, 6 developed acute renal failure presumably due to not - adjusted rapamycin levels according to renal function, and no data regarding initial or final proteinuria are offered . Therefore, we believe both studies are not comparable, and the human low - dose finally, mtori are not recommended in the transplanted patient when proteinuria exceeds approximately 800 mg / day . However, proteinuric mechanisms in this setting are not related to mesangial proliferation, which is the main culprit in mesangioproliferative glomerulonephritis . In addition, low dose of everolimus or rapamycin in human is to be determined . We believe that rapamycin and everolimus must not be considered indistinctly as therapeutic alternatives in glomerular diseases . Human doses have not been established, and randomized trials in humans are required before recommendations are made . Whether preferentially early versus late, low - versus - high doses of mtori effects on proteinuria in mesangioproliferative gns are due to vegf reduced expression, to podocin - nephrin protection, and/or to interventions in the adiponectin - pdgf binomium, among many other possibilities, is a novel, interesting, and a promising field of research to assess treatment of acute mesangioproliferative glomerulonephritis, for which no specific immunosuppressive standardized therapy exists.
Primary pulmonary angiosarcoma (ppa) is a rare neoplasm originating from endothelial cells of small vessels of the lung . The highest incidence of the disease occurs in the fifth and sixth decade of life . Chest computed tomography (ct) demonstrates solitary or multifocal lesions occasionally accompanied by ground - glass opacities or pleural effusion [24]. Diffuse alveolar haemorrhage with concomitant haemothorax is an extremely rare manifestation of primary angiosarcoma of the lung . The diagnosis is based on histological findings complemented by immunohistochemical stainings typical for endothelial markers . We present a case of rapid progression of ppa manifested as bilateral pulmonary opacities and haemothorax . A 65-year - old smoking woman presented a four - month history of haemoptysis, cough, and dyspnoea . The patient's medical history was significant for chronic obstructive pulmonary disease (copd), permanent atrial fibrillation (af) under continuous anticoagulation treatment, hypertension, and diabetes . Due to severe haemoptysis, she reduced the dose of anticoagulant by 50% without medical consultation . Chest ct performed one month prior to hospitalisation revealed bilateral interstitial opacities with air bronchogram and ground - glass attenuations . The radiological findings suggested interstitial lung disease, and the patient was referred to our department . On admission physical examination showed obesity (bmi 47.5), tachypnoea (30 per minute), tachycardia (105 per minute), and oedema of the ankles . On auscultation, the respiratory sounds over the lower right lobe were diminished, and crackles over the middle right lobe and the whole left lung were detected . The patient had respiratory insufficiency (pao2 50 mmhg, paco2 33 mmhg, ph 7.48). Laboratory tests revealed an elevated level of c - reactive protein (26.5 mg / dl), d - dimer (3991 ng / ml) and anaemia (haemoglobin 9 g / dl, haematocrit 29.7%). Chest x - ray demonstrated right - sided opacity corresponding to pleural fluid, scattered pulmonary lesions, and moderately enlarged hila (fig . 1). Computed tomography scans of the chest showed progression of bilateral ground - glass opacities of different shape and size with peripheral predilection, small nodules (including one peripheral left lung nodule with slight cavitation), right - sided pleural effusion, and enlargement of the heart (fig . 2 and 3]. There were no radiological signs of pulmonary embolism in large branches of pulmonary arteries, but a suggestion that small vessels could have been filled with thrombotic material was made . Echocardiography showed enlargement of the right ventricle and both atria, and elevated pulmonary artery pressure at 42 mmhg . The values of tumour markers (cancer antigen ca 15 - 3, ca 19 - 9, ca 125, carcinoembryonic antigen), anti - neutrophil cytoplasmic antibody (anca), and anti - nuclear antibody (ana) were in normal range . Bronchoscopy revealed a bronchi field with a significant amount of fresh blood without any visible point of origin . The haematocrit of the effusion was 19.8% and it was higher than 50% of the haematocrit of peripheral blood, which met the criteria of true haemothorax . On suspicion of immunologically - induced intra - alveolar haemorrhage, 80 mg of prednisone was administrated . After a brief stabilisation, intra - operative biopsy for frozen section examination did not reveal any neoplasmatic cells . During the next two days after the surgery chest radiograph shows right - sided opacity corresponding to pleural fluid; diffuse pulmonary lesions focally confluent, forming bigger opacities within left lung; hila moderately enlarged computed tomography scan shows a large right pleural effusion high - resolution computed tomography (hrct) scans: multiple ground - glass opacities, predominantly subpleural; some small nodules bilaterally microscopic examination of pleural samples revealed that the areas of slit spaces were filled with erythrocytes and surrounded by epithelioid cells . Immunohistochemical reactions showed diffuse reactivity with anti - cd31 (lc70, cell marque) antibody (fig . 4) and focal anti - cd34 (qbend/10, cell marque) staining . Reactions with cytokeratins (ae1ae3, roche) and calretinin (sp65, roche) were negative . In the lung specimen, cohesive and the lesions were composed of groups of loosely packed epithelioid cells mixed with fibrin and erythrocytes . Adjacent alveolar spaces were filled with red blood cells and haemosiderin - laden macrophages (fig . Epithelioid cells revealed diffuse reactivity with anti - cd31 antibody (cd31, magnification 200) epithelioid angiosarcoma . Low- and medium - power magnification of a pulmonary lesion composed of epithelioid cells, haemorrhages, and fibrin deposits surrounded by hyperaemic lung parenchyma with aggregations of haemosiderin - laden macrophages (he staining, magnification 200) typically, angiosarcomas occur as skin and subcutaneous tissue neoplasms of the head, neck, and lower and upper extremities, or involve the heart and extrathoracic organs [3, 4] some reports suggest a correlation between radiotherapy, chemotherapy, past surgical interventions, environmental carcinogens, or chronic tuberculosis pyothorax [1, 3, 6, 7]. Primary pulmonary angiosarcoma patients complain of haemoptysis, dyspnoea, cough, weight loss, fatigue, pleuritic chest pain, and sometimes fever [3, 8]. Nevertheless, due to nonspecific complaints, continuous anticoagulant therapy, history of heart disease, misleading radiological features, and rapid progression, the diagnosis was made in a very advanced and metastatic stadium . In the presented case the haematocrit of the fluid was higher than 50% of the haematocrit of peripheral blood, which met the criteria of true haemothorax . There are no differences between ppa and metastatic angiosarcoma of the lung in radiological manifestation . In both cases ct demonstrates solitary or multifocal lesions, sometimes associated with ground - glass opacities or pleural effusion . Usually at the time of diagnosis, the neoplasm presents extensive local and metastatic invasion [14]. Images obtained on admission revealed bilateral pulmonary opacities with ground - glass attenuations, a small number of nodules, and pleural effusion . The histological examination of epithelioid angiosarcomas reveals single or multifocal tumours composed of sheets of atypical epithelioid cells, focal vasoformative areas, and necrosis . Haematoxylin - eosin stained sections show irregularly anastomosing vessels, cells with nuclear atypia, and often a high mitotic count [4, 6]. Factor viii, cd 31, cd34, fli-1, ulex europaeus agglutinin 1, and vimentin are typical endothelial markers [4, 7, 8]. The biopsy specimen of our patient showed positive reaction for cd 31 and cd 34 . The other stains, including cytokeratin (ae1/ae3) for epithelial and calretinin for mesothelial proliferations, were negative . It is suggested that at least two markers should be present in order to confirm the endothelial origin . There have been reports summarising poor prognostic factors for angiosarcomas, such as age (> 70 years), tumour size (> 5 cm), metastases at presentation, grade, and mitotic count, but they are still under debate [7, 10]. The presented case is a rare manifestation of primary pulmonary angiosarcoma with diffuse pulmonary haemorrhage and haemothorax . Non - distinctive clinical and radiological symptoms and a rapidly progressive course make this type of neoplasm a considerable challenge for clinicians . Our case is a reminder of the necessity to include ppa in differential diagnosis of diffuse alveolar haemorrhage and haemothorax.
Voltage - gated k channels (vkcs) constitute a structurally related family of intrinsic membrane proteins that respond to changes in transmembrane potential by opening and closing an ion - selective permeation pathway for k ions (1). The sensitivity to the membrane potential and the kinetics of the response to changes in potential vary substantially between the different vkc proteins, which means that cells expressing different vkcs repolarize at different rates and at different parts of an action potential . As such, vkcs are the primary agents in shaping action potentials in excitable cells of the eumetazoa . Vkcs are tetramers, each subunit of which comprises a core structural domain consisting of six transmembrane helices and a re - entrant loop that forms the ion - selective channel (figure 1) and highly variable c- and n - terminal domains that play a role in appropriate assembly of newly synthesized tetrameric channels (2), transport to the appropriate cell compartment (usually the plasma membrane) (3) and in modulating the core functionality of the channel (4). The core structural domain is sufficiently conserved that robust multiple alignments between vkcs of single subfamilies can be obtained based on sequence, and alignments between families can be obtained based on a combination of sequence and structural similarity . The n- and c - terminal domains are usually specific to a given subfamily, and thus give robust multiple alignments within subfamilies but not between subfamilies . Figure 1.schematic drawing of the conserved functional core of vkcs . The dotted lines represent the lipid bilayer of the membrane, with the extracellular compartment at the top of the drawing, intracellular at the bottom . The functional pore consists of the s5 and s6 transmembrane helices supporting the re - entrant loop that joins them and that forms the ion selective pore in the assembled tetramer . The array of positive charges every third residue in the s4 helix is the primary sensor of the voltage, with the other three helices forming a supporting scaffold around the s4 helix . The cytoplasmic n- and c - terminal domains (not shown in this schematic) are much more variable than the core structure . The dotted lines represent the lipid bilayer of the membrane, with the extracellular compartment at the top of the drawing, intracellular at the bottom . The functional pore consists of the s5 and s6 transmembrane helices supporting the re - entrant loop that joins them and that forms the ion selective pore in the assembled tetramer . The array of positive charges every third residue in the s4 helix is the primary sensor of the voltage, with the other three helices forming a supporting scaffold around the s4 helix . The cytoplasmic n- and c - terminal domains (not shown in this schematic) are much more variable than the core structure . The existence of a diverse cohort of vkc paralogs within individual species of metazoa and of divergent orthologs between species indicates that the functional evolution of this family of proteins has been a significant factor in the evolution of electrophysiological excitability in the animal kingdom . The original vkcdb (5) has been updated and expanded to provide support for evolutionary and comparative studies of the relationships between vkc sequence, electrophysiological characteristics of the individual channel proteins and ultimately the complex electrophysiological behavior of neurons and muscles in animals . Content update of vkcdb consists of two phases that are automated to run at quarterly intervals . The first is update of the information for existing records . For each record, the last update date of the record in vkcdb is compared to the last update date of the corresponding genbank record . If the genbank record has been replaced, the replacement record is parsed to update the vkcdb entry . If the genbank record has only had new information added to it (for example, additional bibliographic references or new sequence annotations), the full record is parsed and the new information is written into the vkcdb record along with a new date - of - last - update . If the genbank record has been removed, the vkcdb record is flagged as no longer being a recognized channel sequence, but it is left in the database, and the replacement entry (if any) is added to the database . The second phase is addition of new records for vkcs that were added to genbank after the last vkcdb update . Protein sequences for the bacterial vkcs, archaeal vkcs and each of the eukaryotic subfamilies are aligned (6) using muscle v3.8 (http://www.drive5.com/muscle/) used to create separate profiles (7) using hmmbuild from hmmer v3 (http://hmmer.janelia.org/). These profiles are then used to search the most recent genbank non - redundant protein database (downloaded in fasta format and searched locally) using hmmsearch (from hmmer) to identify potential new entries . Each unique new record is tagged with name of the subfamily whose profile gives the highest full - sequence hmmer score and the results are then sorted based on this provisional subfamily designation followed by sorting on the basis of the hmmer score . This allows for fairly easy manual evaluation of cutoffs that distinguish between real vkc sequences and other, more distantly related sequences . The gi numbers of the manually selected set of new entries from the hmmer search are then used to retrieve the relevant genbank records and create new entries in vkcdb . For the bacterial domain, the archaeal domain and each of the eukaryotic subfamilies, all previous entries of substantial length and all new entries are then subjected to a large multiple alignment to identify which of the new entries span a substantial portion of the core vkc structure (coded as small fragmentary records [those that are gapped in substantial areas of compact alignment of the core region, s1s6 (figure 1)] are flagged as not of sufficient length, thus providing the user with the option of selecting either nearly full length, fragmentary, or both in the standard web access . The remaining protein sequences are then realigned, the multiple alignment is pruned to remove any sites with> 5% gaps, and the resulting data matrix is used for a bayesian search (8) to generate a phylogenetic tree for each subfamily . This tree is used to check subfamily assignment made on the basis of the hmmer searches . Table 1 gives the number of channel entries that have a substantial (fullish_length = y) amount of protein sequence for channels in each distinct phylogenetic subfamily . Table 1.table of different vkc families in current release of vkcdbchannel familynumber of entries (fullish length)kv1 270kv2 71kv3 180kv4 132kv5 21kv6 78kv7 191kv8 20kv8.2 18kv9 40kv10 99kv11 147kv12 107kv13 19bk 151archaea 18bacteria 477kcnh (unicellular) 24total 2063these family designations are based on hmmer searches using profiles generated from well characterized, channel sequences . The kcnh family includes the kv10, kv11 and kv12 families from metazoa, but these families arose after the origin of metazoa, so the unicellular kcnh channels do not fall into any of these families . Table of different vkc families in current release of vkcdb these family designations are based on hmmer searches using profiles generated from well characterized, channel sequences . The kcnh family includes the kv10, kv11 and kv12 families from metazoa, but these families arose after the origin of metazoa, so the unicellular kcnh channels do not fall into any of these families . Utilizing a customized lamp (linux, apache, mysql and php) setup to ensure stability, maintainability and future scaling needs, we have revised the web interface to vkcdb to provide a finer level of selection, detail and usability than the previous version . Corresponding sets of protein and nucleotide sequence data are now available for download from any viewed record on any page . There are three options for searching vkcdb, accessible from links at the top of every web page . Search database allows for searching on the contents of various fields (figure 2). This is designed provide users the ability to find entries for which they already have some identifying information, including the vkc i d number, the genbank i d number, accession number or authors of the paper reporting the sequence . Figure 2.screen capture of results of a search for a particular channel based on its vkc i d number . To select any entry that has been returned by a search it is necessary to check the box at the left side of the entry and choose either protein sequence or nucleotide sequence before clicking on the download button . Screen capture of results of a search for a particular channel based on its vkc i d number . To select any entry that has been returned by a search it is necessary to check the box at the left side of the entry and choose either protein sequence or nucleotide sequence before clicking on the download button . Browse database is designed to allow comprehensive retrieval of sets of vkc sequences that are of general use in comparative and phylogenetic analyses . The browse database section is divided into three subsections: by family, by organism and by electrophysiology. The by organism page allows all channels from a single organism to be retrieved with a single query (figure 3). Note that this can return multiple alternatively spliced transcripts from a single gene, or occasionally different variant sequences . The only entries that are flagged as duplicates in vkcdb are those with identical amino acid sequences from the same organism . Figure 3.screen capture of top of results page for a search for all channels from callithrix jacchus, the common marmoset . This search requires (a) prefiltering the search for eukaryotes, (b) choosing long, fragmentary or both records for retrieval and then (c) selection of species from a pull - down menu . Screen capture of top of results page for a search for all channels from callithrix jacchus, the common marmoset . This search requires (a) prefiltering the search for eukaryotes, (b) choosing long, fragmentary or both records for retrieval and then (c) selection of species from a pull - down menu . Alternatively, all members of a particular family of channels can be selected and downloaded (figure 4) from the by subfamily page, or all sequences for which quantitative functional parameters (half - activation voltage, half - inactivation voltage and activation threshold) are identified in the database . Figure 4. (a) screen capture of top of search page for bk family with download options set to retrieve protein sequence with the genbank gi number, genbank accession number, definition line from genbank record and the channel subfamily name as part of the fasta header and with all the entries checked for retrieval . (b) top of the text file that was retrieved with the above settings . Note that the sequence is on one unbroken line, so this figure has truncated the right - hand side of the image . (a) screen capture of top of search page for bk family with download options set to retrieve protein sequence with the genbank gi number, genbank accession number, definition line from genbank record and the channel subfamily name as part of the fasta header and with all the entries checked for retrieval . (b) top of the text file that was retrieved with the above settings . Note that the sequence is on one unbroken line, so this figure has truncated the right - hand side of the image . In all cases the amino acid sequence or the nucleic acid sequence can be retrieved in the same order with the same identifiers, to facilitate a variety of evolutionary analyses by making it straightforward to align nucleic acid sequences against a pre - existing protein sequence alignment . All downloaded sequences are in plain text fasta format, so combining multiple sets into a single file can be accomplished by simple concatenation of the individual output files . The identifier line for the fasta - formatted data always begins with the vkc i d number, which is the primary key for protein sequences, and can be configured to also include the gi number, the accession number, the definition line, and the channel subfamily (kv1 through kv13 and bk) (figure 4). The third search method is vkcdb - blast, which is simply the blast+ search tools blastp and blastn (9) implemented over all vkcdb entries (either protein or nucleic acid) that have been confirmed as potassium channels . This allows for rapid searches using query sequences that are potential potassium channels and a rapid first - order determination of possible affinities to other vkcs . The full vkcdb database, including entries that have been annotated as invalid or obsolete, is available in xml or sql format, downloaded from the the main enhancements planned over the next year are: addition of pre - aligned sequences for each of s1, s2, s3, s4 and the s5-pore - s6 module, to allow easy access to a standardized data set for phylogenetic and comparative analysis, andaddition of more functional electrophysiological parameters to provide a standardized set of data for structure / function analyses andrefinement of subfamily designations . Addition of pre - aligned sequences for each of s1, s2, s3, s4 and the s5-pore - s6 module, to allow easy access to a standardized data set for phylogenetic and comparative analysis, and addition of more functional electrophysiological parameters to provide a standardized set of data for structure / function analyses and refinement of subfamily designations . Natural sciences and engineering research council of canada (grant number 36402 - 2010 to w.j.g . ); canadian institutes for health research (grant number mop-184491 to w.j.g . ). Funding for open access charge: canadian institutes for health research operating grant, natural sciences and engineering research council of canada operating grant.
Gale et al . Studied a group of 16 patients who received class ii restorations at two different sessions . During one session a dentist interacted positively with the patient . During another session, patients ratings indicated that both dentists were perceived as equally competent but that the dentist who interacted with the patients was rated significantly better . It is possible that dentists will gain more satisfaction from their patients as they increase their interaction . Ter horst and de wit reviewed the behavioral research in dentistry published during 1987 - 1992 on dental anxiety, dentist - patient relationship, compliance and dental attendance . In this article they concluded that little progress has been made in the field of behavioral dentistry during those years and recommendations were made to improve future research efforts . The samples (n = 271) were from community health centers and private clinics in different parts of finland . Equal numbers of regular and irregular clients were invited to participate . Before the treatment procedure, each patient filled out a questionnaire with forty likertian statements dealing with their expectations of an ideal dentist, and nine about their own background, i.e., age, sex, regularity of dental visits, basic and professional education and occupation of the treatment subjects described their treating dentists behavior using similar statements . In the analyses first, factor analyses with orthogonal varimax rotation were conducted with the data about the ideal and actual dentist . For the ideal dentist, five factors were extracted: (1) mutual communication, (2) fair support, (3) personal appearance, (4) preferred type of practice, and (5) blaming; and for the actual dentist five factors were extracted: (1) mutual communication, (2) pain control, (3) fair support, (4) personal appearance, and (5) preferred type of practice . In patient - dentist relationship study mataki et al . Has discussed the scope of the review which has been confined to behavioral researches published mainly in the past two decades especially on patient - dentist relationship, dental anxiety, communication and patients satisfaction . In summary, they concluded that there was not so much progress during the period in the field of behavioral dentistry . Consequently, several recommendations are suggested for a future study of behavioral dentistry . In another study schouten et al . Examined the relations between patients and dentists communicative behavior and their satisfaction with the dental encounter . Dentists behavior was coded by means of the communication in dental setting scale, scores for patients behavior included among other things, the number of questions asked during the consultation . Concluded that not only patients satisfaction is positively related to the communicative behavior of dentists, but the principle of informed consent requires dentists also to inform their patients adequately enough for them to reach a well - informed decision about the treatment . This paper describes the results of a pilot study regarding the influence of dentists communication styles on patient satisfaction . The results of this study indicated that dentists communication styles were somewhat associated with patient satisfaction . It was suggested that dentists should not only give information to patients adequately, but should also pay attention to their personal communication style . In another study, yamalik has discussed that, besides technical expertise, the success of dental care depends on the behavioral patterns of the dentist and the patient and the way they interact with each other . Since communication is involved in the process of care, in many ways it is a key concept of this interaction . As patient satisfaction and quality care are closely related with the dentist s positive attitudes and communicative skills, dentists need to focus on patients as individuals and have real communication with them . In another study rozier et al . Conducted a national survey to determine the communication techniques that dentists use routinely and variations in their use . American dental association survey centre staff members mailed an 86-item questionnaire to a random sample of 6,300 u.s . Participants reported routine use (most of the time or always) during a typical week of 18 communication techniques, of which seven are basic techniques . The authors used analysis of variance and ordinary least squares regression models to test the association of communication, provider and practice characteristics with the number of techniques . Finally concluded routine use of all of the communication techniques is low among dentists, including some techniques thought to be most effective with patients with low literacy skills . Professional education is needed to improve knowledge about communication techniques and to ensure that they are used effectively . A firm foundation for these efforts requires evelopment . In another study ukra et al . Has discussed that the orthodontist - patient relationship may have a significant impact on treatment outcome and patient satisfaction, thus improving the overall quality of care . Effective communication is crucial and unfortunately, it is often underestimated in a busy clinical practice . Aim of part one of this article is to review the psychological aspects that are relevant to a number of treatment variables in clinical orthodontics, including compliance with treatment, oral hygiene, management of orthodontic pain and discomfort, and oral habits . Due to the complex nature of the psychology of orthodontic treatment, it is difficult to determine the extent of the influence that the orthodontist - patient relationship may have on these variables, with effective communication and an awareness of the psychological issues playing an important role in enhancing the orthodontist - patient relationship . In another study, the purposes of this study were to evaluate the effectiveness of a shortened explanation of an established consent method and whether customized slide shows improve the understanding of the risks and limitations of orthodontic treatment . In this slide shows for each of the 80 subject - parent pairs included the most common core elements, up to 4 patient - specific custom elements, and other general elements . All subjects read the consent form, viewed the customized slide show, and completed an interview with structured questions, literacy tests, and a questionnaire . These groups were compared with a previous study group, group c, which received the modified consent and the standard slide show . Finally he has concluded that this study suggested little advantage of a verbal review of the consent (except for patients for risk) when other means of review such as the customized slide show were included . Regression analysis suggested that patients understood best the elements presented first in the informed consent slide show . Consequently, the most important information should be presented first to patients, and any information provided beyond the first 7 points should be given as supplemental take - home material . In another study ukra et al . Has discussed that the orthodontists tend to treat see their patients on a systematic, recurrent basis, often during crucial stages of psychological development . Therefore, they have a pivotal role in identifying a number of psychological as well as of psychiatric disorders . Effective communication is crucial and unfortunately, it is often underestimated in a busy clinical practice . Author reviewed the role clinical orthodontics and the orthodontist - patient relationship have on the patients psychosocial wellbeing, including effects on self - esteem, bullying and harassment by peers, and even several psychiatric disorders, such as anorexia / bulimia nervosa, and attention deficit hyperactivity disorders . Due to the complexity and importance of these issues, the orthodontist may play a dynamic role, not only in the management of dental malocclusions, but at times, as psychologist and a counselor to the patient . In ethics in orthodontics in managing situation of potential conflict, the patients, the parents, and all providers involved need to know a straight forward, accurate, and bias - free account of what has occurred . This communication is the first step in re - establishing trust as well as defining the patient as a person rather than as a procedure or a subject . All our patients especially adults, must be provided with opportunity to express their autonomy in treatment planning . Discussions involving the difference between removable and fixed appliance therapy, extraction versus non extraction comparison, surgical and non - surgical plans, and so on should all be approached by frank discussions elucidating the scope of pros and cons of each treatment option . It has been shown that 65% of adult orthodontic patients require dual or multiple provider groups in collaborative management . Hence, therapist needs to provide sufficient information in treatment planning to ensure that the patient is offered maximum autonomy in making treatment decisions . The orthodontist should verify that this has occurred when multiple providers are involved in treatment . Robin wright has given the skills that is necessary for the improvement of dentist patient relationship . Build rapport with patients.encourage patients to take an active role in their dental care.listen effectively to patients.respond to difficult patient questions.explain dental conditions and treatment needs.manage financial discussions.communicate effectively with other team members.convince patients to accept treatment recommendations.speak to patients with confidence and assertiveness.resolve conflicts with team members . Goldsmith et al . Have given suggestions to the dentist, patient and the governing body of dentistry[table 13 . Suggestions for action the dentist may take suggestions for action the patient may take suggestions for action the governing bodies of dentistry may take the world of communication has changed greatly over the centuries of mankind from sounds, sign languages, speech, development of language and in modern times using machines such us the computer, mobile and internet . Over the past five decades, similarly positive patient communication is always necessary to build patient confidence, increased rapport and co - operation and minimizes misunderstanding . Returning the patient in our field, promotes the patient for further preventive care and reviewing and using them as a positive tool helping us as an ambassador of the growth of our health care unit . In the very first appointment, one should converse with a new patient in caring and concerned manner and build confidence and explain the problems and the treatment measures . Communication should bring ideas for us regarding the family, education, job, financial background and personal history of the patient . This will also give more bond to know the personality of the patient, whether the patient is suited for a particular dental procedure . This will help us in handling the patient for a couple of years actively and throughout the life for reviewing . Some children who started orthodontic patients come back to the same center for the treatment, for their children . This shows the profound confidence and bond the patient exhibits with the dentist or orthodontist . There was an instance in our practice when an orthodontic patient was non - cooperative and this was identified by the sibling who accompanied . Many mothers may not reveal the non - cooperation for losing the image of the kid or the family . With the positive interaction with the dentist and the orthodontist, patients improve their knowledge, positive behavior for their future interactions, ideas of education and new environment is known . Some kids who accompany their siblings for orthodontic treatment it is always better to educate the patient about the disease and treatment planning.better to be transparent and truthful with the patient.give the utmost dental care and show great concern.gaining confidence and maintaining the confidence.listening to the patient, alleviating fear, misconception and misunderstanding about the disease.understanding the psychology of the patient, family and friends.speaking in the regional languages and dialects.proper reviewing of the disease and treatment planning and motivation.use of specialist knowledge in a given situation.give positive new ideas for overcoming the disease and give innovative in - puts for a given dental situation.motivating the health care team to have a same attitude as that of the operator towards patient and family . Understanding the psychology of the patient, family and friends . Speaking in the regional languages and dialects . . Give positive new ideas for overcoming the disease and give innovative in - puts for a given dental situation . Motivating the health care team to have a same attitude as that of the operator towards patient and family.
Innate immunity is the first line of defense of the body, present throughout evolution from lower (invertebrate) to more complex organisms (vertebrate) (1). In order to rapidly protect the host against infectious or stressful events, the innate immune cells initiate triggers an inflammatory response . When not properly regulated or in excess, inflammation may contribute to many and different pathological conditions, from autoimmune and chronic inflammatory diseases to atherosclerosis and cancer (234567). They play a pivotal role in the immune response to pathogens, by generating and then resolving the inflammatory reaction . But they also have a central role in tissue development (by shaping the tissue architecture), and in surveillance and monitoring of tissue changes (by acting as sentinel and effector cells). Especially, they are important in maintening tissue homeostasis, by clearing apoptotic or senescent cells, and by repairing and remodeling structural and functional integrity of the tissue soon after a damage . In 1893, elie metchnikoff first described the phagocytosis of pathogens by macrophages (" the big eaters " in greek), observing starfish challenged with rose thorns (8). Macrophages were identified as tissue resident cells able to eat and kill infectious agents . In 1924, macrophages were defined by aeschoff as cells of the reticulo - endothelial system (res). This implied that macrophages originate from, and reside and renew within, that tissue, which comprises the kupffer cells of the liver, the cells lining the sinuses of spleen, lymph nodes, bone marrow, and the endothelial cells of various organs (9). In the late 1960s, ralph van furth proposed the existence of the mononuclear phagocyte system . Within this system, all macrophages, including tissue macrophages and inflammatory cells (macrophages recruited during inflammation, also meaning the monocyte - derived macrophages), are terminally differentiated cells derived from blood monocytes (10). However, in 1984 van furth together with diesselhoff - den dulk (11) suggested that not all macrophages derive from blood monocytes . In the same years it was observed that macrophages were not terminally differentiated (1213) and were persistent in tissues (14). It has now become clear that tissue - resident macrophages may arise independently of monocyte input (see below), originating prenatally from c - myb - independent hematopoiesis (15) prior to the establishment of definitive hematopoiesis . Accordingly, there is now a consensus that some macrophages may proliferate, although it is not clear whether this takes place through self - renewal or through the proliferation of local progenitors (1617). Thus, in light of the monocyte - independent origin of macrophages, other aspects of macrophage biology need reassessment, including macrophages heterogeneity, the role of environment in the tissue - specific specialization, and macrophage polarization into different functional phenotypes during inflammation . In this review several questions are still open on differences, similarities, and development lineage relationship between monocyte - derived macrophages and tissue macrophages . These are discussed in depth elsewhere (18). Finally, we will briefly report on the recently renewed interest for innate immune memory . Tissue macrophages are heterogeneous and versatile cells found in virtually all tissues of adult mammals, where they can represent up to 10~15% of the total cell number in quiescent conditions . The functional specialization of macrophages in unique tissue microenvironments explains their heterogeneity (1920). Thus, macrophages take different names according to their tissue location, such as osteoclasts (bone), alveolar macrophages (lung), microglial cells (brain), histiocytes (connective tissue), kupffer cells (liver), langerhans cells (lc) (skin), etc . If on the one hand tissue macrophages acquire specific morphological and functional phenotypes according to the microenvironment in which they reside, on the other hand some functions of macrophages are the same in all tissues, such as the surveillance that maintains tissue homeostasis (recognizing and removing anomalous and senescent cells), and the protective function (reaction to infections and tissue damage by initiating, developing and resolving an inflammatory response). As mentioned above, it recently became evident the existence of a myb - independent hematopoietic stem cell (hsc)-independent lineage of tissue macrophages . Fate - mapping experiments showed that tissue - resident macrophages in multiple organs, including the liver (kupffer cells), epidermis (lc), and brain (microglia), originate from the yolk sac (ys) or fetal liver (fl) (1521). Overviews of all the experiments demonstrating myb - independent macrophage origin are critically reviewed in (22). Primitive hematopoiesis that takes place in ys and gives rise to macrophages without going through a monocytic progenitor (myb - independent); 2 . Definitive hematopoiesis that takes place in the fl (myb - dependent), which is initially seeded by hematopoietic progenitors from the ys and subsequently by hematopoietic stem cells from endothelium of the aorta - gonads - mesonephros (23). The relative contribution of ys progenitors to the circulating definitive hematopoietic progenitor cell pool that seeds the fl (and that then replenishes macrophages of peripheral organs) remains controversial . Ys- and fl - derived macrophages have been considered distinct so far, but a recent work identified an erythro - myeloid progenitor population that originates in the ys and later migrates to the liver (24). Thus, a common origin in the ys for both ys- and fl - derived macrophages is a reasonable hypothesis . During embryogenesis, the fl subsequently becomes the source of definitive hematopoiesis that generates all major hematopoietic lineages, including circulating monocytes . Fl monocytes populate most peripheral tissues (e.g., lung, spleen, dermis, liver), except the brain, and give rise to tissue macrophages, which generally coexist with, but can progressively displace, ys - derived tissue macrophages . After birth, upon bone formation blood monocyte precursors originate in the bone marrow, and blood monocytes constantly replenish resident macrophages in various organs, such as intestine and dermis (252627). Together with these monocyte - derived tissue resident macrophages, the tissues may encompass monocyte - derived macrophages that developed from inflammatory monocytes recruited during an infection or damage of the tissue (1828). Macrophages that prenatally reside the tissues then proliferate to repopulate the expanding tissue with tissue resident macrophages . This proliferative potential or self - renewal capacity has been recently observed in microglia, in peritoneal, pleural and alveolar macrophages, in macrophages of adipose tissue and atherosclerotic plaques, and in cardiac macrophages (16). Nevertheless, tissue macrophages of embryonic origin can be replaced by monocytes - derived macrophages after severe inflammation (18), or in the aging heart (29). 30) have recently reviewed the current knowledge on resident macrophage development and their functional specialization in the tissue, while dey et al . We refer the reader to these two reviews for deeper and detailed information on these aspects of macrophage biology . The macrophage functional specialization / differentiation defines the presence of morphologically distinct macrophages with tissue - specific functions in homeostatic conditions . On the other hand, macrophage polarization describes the capacity of macrophages to modify their function in a plastic manner during the inflammatory reaction . Both tissue macrophages and monocyte - derived macrophages have a high level of plasticity, although their relative contribution to the progression and resolution of inflammation is not fully demonstrated . The relationship between tissue macrophages and monocyte - derived macrophages and their role in steady state conditions and during inflammation has been extensively reviewed in (18) and, with a focus on brain, adipose tissue and liver, in (31). Macrophage polarization occurs through different activation programs, by which macrophages carry out their defense functions . In this way, macrophages become able to respond with appropriate functions in distinct contexts, and functional diversity becomes the key feature of these cells . Essentially, macrophages can modify their functions from a heal / growth promoting setting (m2 or alternative macrophages), to a killing / inhibitory capacity (m1 or classical macrophages) (32). In vitro, macrophages are activated towards an m1 functional program by microorganism - related molecules (e.g., the gram - negative lipopolysaccharide, lps) and by the inflammation - related cytokines tnf- or ifn-, alone or in combination . M1 macrophages are efficient producers of toxic effector molecules (such as reactive oxygen / nitrogen species, and inflammatory cytokines), participate as inducers and effector cells in polarized th1 responses, and mediate resistance against intracellular parasites and tumors (33). Conversely, m2-like polarization has been observed in vitro in response to the th2-related cytokines il-4 or il-13, to the concomitant triggering of fc receptors and toll - like receptors (tlr), to immune complexes, and to anti - inflammatory molecules such as il-10, tgf-, and glucocorticoids (3435). M2 macrophages take part in polarized th2 responses, allergy, parasite clearance, dampening of inflammation, tissue remodeling, angiogenesis, immunoregulation, and tumor promotion (36). M2 is the normal " default " program adopted by resident macrophages (37). In addition to functional differences, m1 and m2 macrophages have distinct features in terms of chemokine production profiles (38) and metabolism (39). The main distinction in terms of metabolism is that in m2 macrophages the arginine metabolism is shifted to ornithine and polyamines, which are important in the would healing process . Conversely, in m1 cells such metabolism is shifted to no, which plays a key role in the intracellular killing of pathogens (40). The m1/m2 classification is useful to understand the plasticity of macrophages but is just a limited attempt to capture the complexity and plasticity of these cells . In fact, this macrophage taxonomy does not fully mirror what really happens in the tissue during inflammation . In vivo the sequence of changing scenarios / signals presumably induces macrophages to adopt a variety of functional phenotypes during the course of an inflammatory reaction . Therefore, the m1/m2 polarization of macrophage functions may be taken as a simplified conceptual framework describing a continuum of diverse functional states, of which m1 and m2 activation states are not ontogenically defined subsets but represent the extremes of the functional continuum (41). As suggested by martinez and gordon (42), recently, murray and coworkers attempted a re - classification of polarized macrophage in response to a range of stimuli (43). Furthermore, this issue has been recently addressed by network modeling analyses of hundreds of macrophage transcriptomes triggered by a diverse set of stimuli (44). This analysis revealed at least nine distinct macrophage activation programs, thus extending the dual m1/m2 macrophage polarization to a spectrum model . Moreover, knowing that local environment controls macrophage phenotypes, and given that many experiments with human cells are performed in vitro, we should redefine the in vitro culture conditions to closely match those occurring in a specific tissue microenvironment (4546) or in the course of an inflammatory reaction (47). An important issue of macrophage polarization is whether polarized macrophage populations can switch one to the other in response to different conditions . Data from in vitro studies demonstrate that human monocytes can acquire the phenotype of polarized m1 macrophages and then mature into m2 repair macrophages upon exposure in culture to sequential changes in the microenvironmental conditions (47). A related open question is whether both tissue - resident macrophages and monocyte - derived macrophages can polarize in m1 or / and m2 functional phenotypes . Here we just want to highlight the major role of microenvironmental signals in the functional phenotype switching of monocytes and macrophages by mentioning two severe pathological conditions: obesity and cancer . The metabolic syndrome can lead to a switch in the phenotype of adipose tissue macrophages from m2/wound healing (as in healthy non - obese humans) to classically activated macrophages (48). In cancer, tumor - infiltrating classically activated macrophages have the potential to contribute to the earliest stages of neoplasia, and then, as the tumor progresses, can progressively differentiate to a regulatory phenotype and eventually become cells that share the characteristics of both regulatory and wound - healing macrophages (49). In both cases, signals present in the surrounding environment at a given time drive the changes in the functional phenotype of adipose tissue macrophages and tumor - associated macrophages at given stage of the disease . As previously discussed, innate immune cells have two peculiarities, diversity / heterogeneity and plasticity (50). Steady state hematopoietic differentiation programs may generate diverse subsets of monocytes (e.g., cd14 cd16 or classical monocytes, cd14cd16 or intermediate monocytes, cd14cd16 or non - classical monocytes) (51), and distinct tissue - resident macrophages (e.g., kupffer cells, microglia, lc, etc . ). Thus, tissue - resident macrophages may be exposed to endogenous signals from the tissue during development or steady state conditions, in order to develop tissue specialization, whereas both tissue - resident macrophages and monocyte subpopulations (once in the tissue, monocyte - derived macrophages) may be subsequently activated by microbial or danger signals during inflammation or tissue damage . Thus, in the presence of diverse microenvironmental stimuli, each subset modifies its activation state in a plastic manner depending on the nature of the stimulus . Phenotypic, transcriptional and epigenetics mechanisms underlie both diversity and plasticity, inducing functional specialization in different cells and in the same cells in different microenvironmental contexts . We want to underline that heterogeneity, maintenance and specific function of resident macrophages are firmly under tissue control during homeostasis and in inflammatory conditions . It is evident that the expression of different transcription factor is required for specific functions in macrophages (5253). Several examples of transcription factors that dictate tissue - specific transcription programs in macrophages have been reported . For examples: the heme - induced transcription factor spic is required for the development of red pulp macrophages (54), and nr1h3 is needed for the development of all macrophages of the marginal zone (55). Gata6 is a regulator of a tissue - specific gene expression program in peritoneal macrophages, and retinoic acid released in the tissue is a signal that regulates reversibly the induction of gata6 (46). Induction of ppar- by gm - csf is critical for the development of alveolar macrophages from fetal monocytes (56). Transcription factors such as stat1, stat6, c / ebpb, irf-4, irf5, and ppar- have been shown to regulate transcription programs that control m1/m2 macrophage polarization (57). Two recent studies that have employed rna - seq have demonstrated the main role of the microenvironment in determining the macrophage phenotype reprogramming (5859). Authors concluded that tissue macrophages shared with other myeloid cells the epigenetic structure and gene expression (regulated by the master transcription factor pu.1), and in addition that each tissue has its own unique gene expression profile controlled by changes in enhancer landscapes . Moreover, tissue - specific reprogramming was evident by transferring macrophages from a tissue to another, showing that transferred cells lost most of the old tissue programming, acquiring a new one according to their new tissue microenvironment). The same was evident upon lethal irradiation of embryonic tissue macrophages and replacement with macrophages derived from transplanted healthy bone marrow . Within a tissue, macrophages sense the microenvironmental changes through a series of sensors, such as prr, scavenger receptors, cytokines receptors, and adhesion molecules, and are susceptible to silencing programs dictated by the tissue . Indeed, the tissue sets tissue - specific thresholds for the timing and extent of macrophage activation depending on the type and intensity of the stimulus . The exact nature of these silencing circuits differs between tissues and includes innate inherent suppression, as well as acquired deactivation induced activating stimuli (34). Intestinal gut macrophages express the il-10 receptor, and in order to prevent severe inflammation they must be exposed to homeostatic t regulatory cell - derived il-10 (60). On the other hand, microglia is probably silenced by tgf- (61) and maintained into a down - regulated phenotype by neural - derived cx3cr1 and cd200 (6263). Local tissue - derived signals are thought to control the development of the tissue - specific phenotypes of resident macrophages, proving the critical role of tissue environment . However, for most tissues the identity of these signals remains largely unknown (with some exceptions, see microglia, 61, and bone, 64). In conclusion, the environment may reprogram macrophages in a tissue - specific manner in order to tailor their functions based on the tissue needs, or may polarize macrophages conferring a differently reactive phenotypes (classical vs. alternative vs. deactivated). Moreover, it is unknown whether functional heterogeneity and polarization are the result of irreversible lineage - specific differentiation or a consequence of continuous but reversible induction of diverse functional programs . It was recently suggested to classify monocyte / macrophage primarily by their ontogeny and only secondarily by their location, function and phenotype (65). However, which is the effect of origin on macrophage function is not yet fully known . Considering the new insights in macrophage biology, it is worth mentioning the recent reassessment of the innate immune memory, an old concept that is currently raising a renewed interest in the scientific community . Indeed, revisited old knowledge on the repeated stimulation of the innate immune responses (see for instance 6667) has reintroduced the old concept of innate immune memory (68). Evidence in both plants and invertebrates (that do not possess adaptive immunity and classical memory) indicates that phagocytes can respond much better to a challenge if they have been pre - stimulated with the same or with another agent (69). Thus, innate immunity can have a memory, although different from acquired immune memory . A very interesting notion is that the innate memory is apparently at least in part non - specific, which implies that cells pre - challenged with (almost) any kind of agents can attain an improved defensive response to a subsequent challenge . Another very interesting concept is that of the exquisitely local dimension of phagocyte memory . In higher vertebrates such as man, however, in the case of external challenges (e.g., an infectious agent), they can initiate an immediate defensive inflammatory response . It is very interesting to observe that macrophages, after a challenge, can develop a memory and react to a second challenge in different ways: they become less reactive to some challenges to avoid extensive tissue damage or they display an enhanced response to improve tissue surveillance, e.g., against tumors . These two different responses of innate immune memory are known as " tolerance " and " trained immunity ", respectively . Lps activates macrophages into a disruptive inflammatory reaction that also damages the surrounding tissue . Upon a second challenge, macrophages react much less because they aim at avoiding an excessive response that would destroy the tissue integrity . On the other hand, challenge with fungal components (implying a long - term slow infection with tissue debilitation) induces an innate memory that results in enhanced reactivity to subsequent stimuli, necessary for the adequate defense of a weakened tissue . The molecular mechanisms responsible for shifting macrophages toward a memory status have not yet been elucidated . Putative mechanisms may involve different recruitment of different monocyte / macrophage subpopulation (i.e., cd14 and cd16) (68), or changes in the expression of lectin receptors on cell membrane (70), or in the functional phenotype (e.g., phagocytosis or protein production). In any case, all of these changes are probably due to epigenetic reprogramming that regulates gene expression by inducing dynamic alterations in the chromatin structure, through modification of dna, post - translational modifications of histones (methylation), or microrna (717273). Another interesting aspects of innate memory are changes in metabolic processes, as already observed in macrophage polarization (3974). Whether monocyte - derived macrophages or tissue macrophages or both retain a memory of past challenge we preliminarily observed (unpublished observation) that a mild microbial stimulus could induce different immunological programming in monocyte - derived macrophages vs. tissue macrophages . Indeed, in vitro monocyte - derived macrophages and tissue macrophages primed with microbial agents (e.g., lps, -glucan) produce a substantially different profile of inflammatory cytokines upon re - exposure, demonstrating the capacity of adapting their response to an evolving situation (such as multiple or chronic infections). Notably, the type of innate memory induced by pre - challenge may be different (decrease vs. increase vs. no effect) depending on the inflammatory endpoint (e.g., production of tnf- or il-1 or il-8) and the type of mononuclear phagocyte, with inflammatory monocytes being more reactive than tissue macrophages . The increased understanding of the properties of innate memory is changing our awareness of host defense and immune memory, and could lead to defining new classes of vaccines and adjuvants . Efficacy of many vaccines probably implies the induction of non - specific macrophage memory that contributes to the increased resistance to infections . Research in the field of memory macrophages needs a thorough reassessment of a large body of old evidence accumulated in the past decades in the areas of macrophage activation and of adjuvanticity . Given the important role of macrophages in acute and chronic inflammation and in other severe diseases (artherosclerosis, neurodegeneration and cancer), it is not surprising the growing interest for their proprieties and for their potential clinical applications . In a recent review, martinez and gordon address the issue of translating the new knowledge of macrophage biology into clinical practice (75). They describe a selection of the potential functional targets in macrophages, such as macrophage recruitment, activation, and memory, which are being considered for potential therapeutic / clinical application by using ad hoc inhibitors . Moreover they indicate new application areas that are likely to develop in the near future, thanks to our new understanding of macrophage biology, including cell therapy, diagnosis and prognosis . We agree with martinez and gordon especially on the following key needs: more studies on humans to close the gap between the bench and the clinic; and use of standardized and improved methods to investigate macrophages heterogeneity and to measure genes, proteins and metabolites in situ . The common view is that macrophage diversity and plasticity are driven by cues in the tissue microenvironment, which can include cytokines, growth factors and microorganism - associated molecular patterns . These signals are believed to dictate a transcriptional response that shapes the phenotype and function of macrophages based on the physiological or pathological context . Progress has been made in defining the molecular mechanism underlying macrophage biology, but the data are still incomplete and far from being systematic . Thus, we need to increase our knowledge of the mechanistic basis of macrophage heterogeneity / diversity and plasticity, and how to pharmacologically manipulate them . Considering that various in vitro models currently used do not adequately reflect the heterogeneity and plasticity of tissue macrophages, we conclude by suggesting that future studies should be conducted on macrophages isolated directly from tissues in different homeostatic and pathological conditions (in steady state condition and in response to a changing environment). Single - cell transcriptomic and epigenetic analysis (76) might help to molecularly identify the macrophage functional states and their changes driven by changing tissue conditions.
Cardiac perforation is a dreaded complication of transvenous pacemaker, cardiac resynchronization therapy defibrillator (crt - d), and implantable cardioverter - defibrillator (icd) lead placement because of the potential for critical morbidity and mortality . We report the case of a 45-year - old woman affected by severe dilated cardiomyopathy who was admitted to our cardiology department for an upgrade of a previously implanted pacemaker . The patient received a vvi pacemaker implant for complete atrioventricular block 22 years earlier and an upgrade (ddd mode) 11 years later . Leads were inserted through the left subclavian vein: (a) an active fixation double catheter in the right ventricle, (b) a bipolar active fixation lead in the right auricle (fig . 1), and (c) a bipolar lead introduced from the coronary sinus into the antero - lateral vein . The previously implanted pacemaker and one atrial lead were removed (the old unipolar lead was left in the right ventricle) and a crt device was connected to the new implanted leads . After satisfactory r - wave sensing (> 5 mv) and pacing thresholds (<1.0 v at 0.5-ms pulse width) had been demonstrated, the patient underwent defibrillation threshold testing (dft) to ensure proper device function . Sustained ventricular tachycardia and ventricular fibrillation were induced to make certain that the device was able to constantly sense, detect, and terminate arrhythmias with a shock at 25 j. during skin closure, the patient went into cardiac arrest with pulseless electrical activity . Cardiopulmonary resuscitation maneuvers were performed immediately and echocardiography showed intrapericardial effusion that was partially drained . After 1 h, pulseless electrical activity persisted, the patient was declared dead, and resuscitation attempts were halted . The unexpected fatal outcome resulted in an allegation of medical negligence against the operating cardiologists . A board of physicians consisting of a forensic doctor and a heart surgeon conducted a post - mortem examination and analysis of the medical records . At autopsy, approximately 180 cm of blood and clots were found inside the pericardial cavity . Careful inspection of the aorta showed a deep lesion, 2 mm in length, on the antero - lateral aspect of the vessel (fig . 1) 2 cm above the valvular plane (fig . The lead metal extremity was implanted at the base of the auricle on the medial wall . The right atrium was very thin, with an average thickness of 2 mm . Histology showed abundant adipose tissue in its context, endocardial fibrosis, and numerous foci of inflammatory infiltration by various elements including lymphocytes and monocytes as well numerous plasma cells and eosinophils, clearly indicating myocarditis that was not recent . The ascending aorta was incised and approximately 2 cm above the noncoronary cusp, a pinpoint injury related to the lesion described on the aortic adventia (fig . The pathogenetic mechanism underlying this patients death can be explained in the following manner: the active lead (fig . 1), positioned in the right atrium medial aspect, perforated the thin atrial wall and the lateral aspect of the aortic wall . After aortic perforation, the lead initially remained inside its wall, which explains why the device interrogation revealed satisfactory r - wave sensing (> 5 mv) and pacing thresholds (<1.0 v at 0.5-ms pulse width). The patient eventually underwent dft to guarantee proper device function . At this point, the active lead, positioned inside the aorta like a cork, slipped out, causing cardiac tamponade . In a review of relevant literature, we identified only five cases,,,, of atrial damage by a pacemaker lead with concomitant aortic wall perforation, as shown in table 1 . However, not all reports indicate whether the lead responsible for the cardiac laceration was active or passive . A board of physicians conducted a post - mortem examination and their findings did not support a direct allegation of medical negligence against the operating cardiologists who performed the icd implant . The board analyzed the guidelines for cardiac pacing and cardiac resynchronization therapy and considered the indications for the procedure performed on the patient to be correct . The increased heart size shifted the right atrial appendage closer to the adjacent lateral aspect of the aorta . At the same time, the remarkable thinness of the right atrium was conducive to wall perforation . The perforation was not necessarily a result of malpractice in electrode positioning, but was also caused by other factors such as the pressure exerted during cardiac contraction . Moreover, since she was bearing a pacemaker, the patient could not undergo magnetic resonance imaging before the procedure to highlight the thicknesses of the cardiac wall . In addition, her pre - existing myocarditis undoubtedly reduced the chances of successful resuscitation . Antonino m. grande, affirms on behalf of all co - authors that we have no conflicts of interest in connection with this article.
Heterologous expression involves identification of genes and transfer of the corresponding dna fragments to hosts other than the original source for synthesis of the encoded proteins . Protein isolation, especially from plant sources, can be costly, cumbersome and lengthy, and heterologous expression provides a convenient alternative . This methodology allows large - scale production of plant proteins in microorganisms to study their biochemical and biophysical features . Foreign hosts may also provide a simpler system for studies on functions of proteins and for elucidation of their roles in complex mechanisms such as metabolic reactions and membrane transport . Recombinant plant proteins and peptides produced by heterologous expression are also used in industrial applications . Examples are provided by the synthesis of a medicinal peptide from ginseng as potential drug against diabetes or production of plant lectins in both cases in yeast . The present review covers the recent literature on plant gene expression in bacteria, yeast, insect cells and xenopus oocytes and presents the comparative advantages and disadvantages of each system . It also provides a survey of recent examples of application of heterologous expression technology to plant proteins . Factors influencing the choice of hosts, including the stability and folding characteristics of the protein, requirement for posttranslational modifications, efficiency of the expression system, as well as simplicity and cost are discussed in the following sections . The choice of the expression system and vector is a critical step in this procedure and, as indicated, advantages and disadvantages of several factors have to be considered . Expression systems are selected depending on whether the purpose of study is production of large quantities of protein or investigation of functional features of the cloned protein . A general review of frequently used expression systems is provided by yin et al . . The most commonly used vectors are fusion systems that link additional amino acid sequences (tags) to the protein through a recognition site for a specific protease . Tags may consist of a short peptide sequence or a full protein which can be cleaved from the protein when desired . Presence of tag sequences facilitates solubility, purification, quantification, identification, localization, and assaying of the expressed protein . Frequently used fusion partners include glutathione - s - transferease (gst), his - tag (poly - histidines), maltose binding protein (mbp), thioredoxin (trxa), flag epitope - tag, c - myc epitope - tag, disulfide isomerase i (dsba), polyarginine - tag (arg - tag), calmodulin - binding peptide, cellulose - binding domain, poly - histidine affinity tag (hat - tag), n - utilizing substance - a (nusa), s - tag, streptavidin - binding peptide (sbp - tag), strep - tag, fluorescent proteins (e.g., green fluorescent protein (gfp)) and ubiquitin . Mbp is considered to be much more effective for enhancing solubility than gst and thioredoxin . The major disadvantages of fusion protein systems are the requirement of expensive proteases for cleavage from the recombinant protein and the low yield of cleavage reactions . Depending on the host system, vectors for transient or stable expression can be chosen as indicated below . Escherichia coli (e. coli) is the first and most extensively used prokaryotic expression system for heterologous protein production . It remains generally the first choice due to its simplicity, rapid growth rate, and relatively low cost . Almost all commercially available inducible cloning vectors are compatible with e. coli and extensive biochemical and genetic information is available . One of the disadvantages of using e. coli as an expression host arises from its inability to perform post - translational modifications, which are often required for correct folding and functional activity of the recombinant protein . Another disadvantage is that e. coli is generally not suitable for proteins which contain many disulfide bonds or require glycosylation, proline cis / trans isomerization, disulfide isomerization, lipidation, sulphation, or phosphorylation . Some eukaryotic proteins that retain their full biological activity in the nonglycosylated form have, however, been produced in e. coli . The unglycosylated human growth hormone (hgh) binding protein secreted from e.coli retains the same binding affinity and specificity as the wild - type hgh binding protein suggesting that recombinant protein is properly folded and glycosylation is not required for binding . Production of proteins that are stabilized by disulfide bonds in e.coli often results in proteolytic degradation or misfolding and formation of inclusion bodies . One strategy developed to improve this situation is to target these proteins to the periplasm where the nonreducing environment allows formation of disulfide bonds [10, 11]. In addition, the e.coli periplasm contains chaperone - like disulfide - binding proteins (dsba, dsbb, dsbc, and dsbd), folding catalysts, and peptidyl - prolyl isomerases (sura, rota, fklb, and fkpa) that support disulfide bond formation and are important for correct folding of periplasmic proteins [1214]. Disulfide bond formation is achieved via fusion to dsba or dsbc [15, 16] and periplasmic secretion results in the functional production of a variety of recombinant proteins . In a recent study, the rescue of unstable lipase b from pseudozyma antarctica (palb), with periplasmic folding factors was demonstrated . Another strategy involves the use of the trxb gor double mutant lacking thioredoxin reductase and glutathione reductase genes [19, 20]. This double mutant was used for heterologous expression of barley oxalate oxidase (hvoxo) in e.coli . The gene for an osmotin - like cryoprotective protein from solanum dulcamara was expressed in e.coli and directed to periplasmic localization using an expression vector containing the pelb signal sequence . This resulted in high concentrations of soluble protein with cryoprotective activity, whereas expression in the bacterial cytoplasm only yielded large amounts of insoluble and aggregated protein . Some of the plant proteins accumulated in insoluble inclusion bodies in e.coli can be solubilized and refolded to restore activity after purification from the host . Examples include arabidopsis thaumatin - like protein (atlp3) which was purified from inclusion bodies and the refolded form displayed activity against some pathogenic fungi . To validate the potential antifungal activity of solanum nigrum osmotin - like protein (snolp) was overexpressed in e.coli and the recombinant protein was refolded using reduced: oxidized gluthatione redox buffer and its in vitro activity was demonstrated . The soybean rhg1-lrr domain protein was solubilized from inclusion bodies using urea and refolded by removing the urea in the presence of arginine and reduced / oxidized glutathione . Many plant enzymes are expressed in insoluble inclusion bodies but it is still possible to obtain high yields of active forms for structural studies . The mature polypeptide of fatb thioesterase from the developing seed tissues of madhuca butyracea was characterized by heterologous expression in e.coli . The functionality of the mbfatb in the heterologous system was revealed by the altered growth behavior and cell morphology of the bacteria due to the changes in the fatty acid profile . Della proteins from both arabidopsis and malus domestica, which are involved in regulation of plant growth in response to phytohormonal signals, were isolated and expressed in e. coli . Examples of functional expression of plant proteins in e.coli are provided mostly by studies on membrane proteins . A mutant with very low k uptake was used as host for studies on the k transporters akt2, atkup1 - 2, athkt1 from arabidopsis and echkt1 and echkt2 from eucalyptus camaldulensis . In another example, e.coli c43 strain, which is suitable for expression of membrane proteins was used for functional characterization of chloroplast atp / adp transporter from arabidopsis . The seagrass hak k transporters, cnhak1 and cnhak2 were also overexpressed in e.coli and it was found that cnhak1, but not cnhak2, mediated very rapid k or rb influxes . Using a dicarboxylate uptake - deficient e.coli mutant, a peptide transporter, agdcat1 from alder, was shown to be a dicarboxylate, including malate, succinate, fumarate, and oxaloacetate, transporter . E.coli has also been used for expression of small plant proteins with a fusion partner . Metallothioneins (mts), which are difficult to purify from natural sources because of their small molecular weight (7 kd), unusual amino acid sequences containing a large number of cysteins and their proteolytic susceptibility belong to this class . Several mts including a cd binding type 1 durum wheat metallothionein (dmt), fava bean type 1 and type 2 mts, arabidopsis mt1, mt2 and mt3 proteins, type 3 mt3-a from the oil palm, type 2 mt, qsmt from quercus suber have been produced in e.coli mainly for structural analyses . Since the fusion constructs of durum mt with gst (gstdmt) can be purified in well - defined oligomeric states they are used as model systems for studies on metal - binding and for structural analyses . Figure 2 illustrates that cd - binding to gstdmt can be detected by uv - visible spectroscopy . The metal content of gstdmt was shown to be the same as that expected from dmt alone . An example of the shape models generated from x - ray solution scattering data for gstdmt is shown in figure 3, together with the fit to experimental data . The models support a fold for dmt similar to that expected for the free molecule [42, 43]. These results are in agreement with earlier work suggesting independent folding of gst and its fusion components and indicate that recombinant fusion complexes are useful as model systems for structural studies . Eukaryotic expression systems offer the possibility of posttranslational modifications and are often used for investigations of protein function . Processing reactions such as o - and n - linked glycosylation, tyrosine, serine, and threonine phosphorylation, addition of fatty acid chains, processing of signal sequences, disulfide bond formation, and correct folding can all be readily performed in eukaryotic hosts . The most commonly used eukaryotic systems are yeast, insect, mammalian, and plant cells . As a single cell eukaryotic organism, yeast has molecular, genetic, and biochemical characteristics which are similar to those of higher eukaryotes, and is useful for heterelogous protein production . Yeast cells can grow rapidly with high cell densities, and are easy to manipulate and yeast cultures are cost effective . The two most commonly used organisms are saccharomyces cerevisiae (s. cerevisiae) and pichia pastoris (p. pastoris). Saccharomyces cerevisiaebaker's yeast, s. cerevisiae, is widely used as a host organism for heterologous expression of proteins . Its genetics and physiology are well documented and proteins are posttranslationally modified through the mechanisms similar to those found in plants . The limitations of this host system are low yields, cell stress due to the presence of the foreign gene and hyperglycosylation of secreted foreign proteins . Earlier work on heterelogous expression for screening of plant cdna libraries by complementation in s. cerevisiae null mutants was reviewed by frommer and ninnemann . The s. cerevisiae mutants provide a convenient system for functional and kinetic studies of transporters . The electrophysiological properties of membrane transporters, h - amino acid symporter and k channel, kat1 and phosphate transporters; atpt1 and atpt2 of arabidopsis were characterized using s. cerevisiae . Recently, functional expression of transporters such as an hvhaki from barley, atkt1 and atkt2, and atkup1 from arabidopsis also utilized s. cerevisiae mutants . Another k transporter characterized in this system is hkt1 from wheat [52, 53]. Kinetic uptake analyses of tomato sulfate transporters, lest1 - 1 and lest1 - 2 were carried out using the s. cerevisiae sulfate transporter mutant . The five members of the copper transporter family copt15 from arabidopsis were characterized using a copper transport null mutant . A peptide transporter atptr1 gene from arabidopsis was isolated and complemented in a peptide transport - deficient mutant . A putative k / h antiporter, atchx17 was heterologously expressed and characterized in an s. cerevisiae kha1 deletion mutant . To test their functional activity, the grapevine hexose transporters vvht3, vvht4, and vvht5 were expressed in the s. cerevisiae mutant eby.vw4000, which is deficient in glucose transport due to concurrent knock - out of 20 endogenous transporter genes . Growth - based complementation assays were used to demonstrate function of the transporters but resulted in inadequate rates of glucose uptake . A more sensitive assay based on direct measurement of radioactively labelled glucose uptake revealed that this mutant expressing vvht4 and vvht5 accumulated labelled glucose at higher rates than yeast transformed with the empty vector, demonstrating the functionality of the glucose transporters . Although vvht3:gfp (green fluorescent protein) fusion protein was targeted to the plasma membrane in plant cells, vvht3 was found not to be functional in the yeast system .yeast expression studies were, in several instances, complemented by studies in other organisms to verify functional and kinetic properties of recombinant proteins . The plasma membrane - localized h / inositol symporter atint2 of arabidopsis was studied by expression in an inositol uptake / inositol biosynthesis double mutant in s. cerevisiae and in xenopus oocytes . In this study, the amount of atint2 protein in yeast plasma membrane was sufficient for complementation, but not for functional and kinetic analyses . In oocytes, however, it was possible to show that atint2 mediated the symport of h . Expression and functional characterization of arabidopsis atgat1 in s. cerevisiae and xenopus oocytes revealed that atgat1 mediates h - dependent, high affinity transport of high affinity -aminobutyric acid (gaba) and gaba - related compounds . Heterologous expression of attip2;1 and attip2;3 from arabidopsis in both ammonium uptake - defective yeast and oocytes indicated that these tips transport both ammonium and methyl - ammonium in addition to water and urea . The kinetic characteristics of the sorbitol transporters, pmplt1, and pmplt2 from common plantain (plantago major) were investigated by functional expression in s. cerevisiae and in xenopus oocytess . In the yeast system, both proteins were characterized as low - affinity and low - specificity polyol symporters . These data were confirmed in the xenopus system, where pmplt1 was analyzed in detail and characterized as an h symporter . The major disadvantages of using s. cerevisiae mutants in transporter studies are the hyperpolarization of the membrane, mislocalization of membrane proteins and recruitment of non - k - transporters into k - transporters . Baker's yeast, s. cerevisiae, is widely used as a host organism for heterologous expression of proteins . Its genetics and physiology are well documented and proteins are posttranslationally modified through the mechanisms similar to those found in plants . The limitations of this host system are low yields, cell stress due to the presence of the foreign gene and hyperglycosylation of secreted foreign proteins . Earlier work on heterelogous expression for screening of plant cdna libraries by complementation in s. cerevisiae null mutants was reviewed by frommer and ninnemann . The s. cerevisiae mutants provide a convenient system for functional and kinetic studies of transporters . The electrophysiological properties of membrane transporters, h - amino acid symporter and k channel, kat1 and phosphate transporters; atpt1 and atpt2 of arabidopsis were characterized using s. cerevisiae . Recently, functional expression of transporters such as an hvhaki from barley, atkt1 and atkt2, and atkup1 from arabidopsis also utilized s. cerevisiae mutants . Another k transporter characterized in this system is hkt1 from wheat [52, 53]. Kinetic uptake analyses of tomato sulfate transporters, lest1 - 1 and lest1 - 2 were carried out using the s. cerevisiae sulfate transporter mutant . The five members of the copper transporter family copt15 from arabidopsis were characterized using a copper transport null mutant . A peptide transporter atptr1 gene from arabidopsis was isolated and complemented in a peptide transport - deficient mutant . A putative k / h antiporter, atchx17 was heterologously expressed and characterized in an s. cerevisiae kha1 deletion mutant . To test their functional activity, the grapevine hexose transporters vvht3, vvht4, and vvht5 were expressed in the s. cerevisiae mutant eby.vw4000, which is deficient in glucose transport due to concurrent knock - out of 20 endogenous transporter genes . Growth - based complementation assays were used to demonstrate function of the transporters but resulted in inadequate rates of glucose uptake . A more sensitive assay based on direct measurement of radioactively labelled glucose uptake revealed that this mutant expressing vvht4 and vvht5 accumulated labelled glucose at higher rates than yeast transformed with the empty vector, demonstrating the functionality of the glucose transporters . Although vvht3:gfp (green fluorescent protein) fusion protein was targeted to the plasma membrane in plant cells, vvht3 was found not to be functional in the yeast system .yeast expression studies were, in several instances, complemented by studies in other organisms to verify functional and kinetic properties of recombinant proteins . The plasma membrane - localized h / inositol symporter atint2 of arabidopsis was studied by expression in an inositol uptake / inositol biosynthesis double mutant in s. cerevisiae and in xenopus oocytes . In this study, the amount of atint2 protein in yeast plasma membrane was sufficient for complementation, but not for functional and kinetic analyses . In oocytes, however, it was possible to show that atint2 mediated the symport of h . Expression and functional characterization of arabidopsis atgat1 in s. cerevisiae and xenopus oocytes revealed that atgat1 mediates h - dependent, high affinity transport of high affinity -aminobutyric acid (gaba) and gaba - related compounds . Properties of this protein could be examined in more detail in xenopus oocytes . Heterologous expression of attip2;1 and attip2;3 from arabidopsis in both ammonium uptake - defective yeast and oocytes indicated that these tips transport both ammonium and methyl - ammonium in addition to water and urea . The kinetic characteristics of the sorbitol transporters, pmplt1, and pmplt2 from common plantain (plantago major) were investigated by functional expression in s. cerevisiae and in xenopus oocytess . In the yeast system, both proteins were characterized as low - affinity and low - specificity polyol symporters . These data were confirmed in the xenopus system, where pmplt1 was analyzed in detail and characterized as an h symporter . The major disadvantages of using s. cerevisiae mutants in transporter studies are the hyperpolarization of the membrane, mislocalization of membrane proteins and recruitment of non - k - transporters into k - transporters . Pichia pastoris p. pastoris, methylotrophic yeast, is considered a valuable tool for high yield heterologous expression of various proteins . The possibility of obtaining posttranslational modifications, high level expression of foreign proteins in either intracellular or extracellular forms, simplicity of genetic manipulations, and availability of various p. molecular manipulations such as gene targeting, high frequency dna transformation, and cloning for functional complementation are similar to those in s. cerevisiae . Tightly regulated promoters, easy integration of heterologous dna into the host chromosome and the capacity to generate more posttranslational modifications make p. pastoris the preferred system compared to s. cerevisiae.the wide use of p. pastoris expression system for recombinant plant proteins can be seen from recent reviews [64, 65]. Pastoris is particularly well suited for studying plant enzymes since glycosylation of the foreign proteins is expected to be closer to that in plants [66, 67] and glycosylated proteins have shorter glycosyl chains in p. pastoris than in s. cerevisiae . This expression system has the potential to produce high levels of recombinant proteins, up to 400 mg / l of culture . Two examples are cytosolic expression of nitrate reductase from spinach and corn at high levels needed for detailed biochemical studies and expression of a sweet potato invertase in milligram quantities . Enzymatic activity of the membrane - bound 1,6-galactosyltransferase was shown through overexpression in p. pastoris . The hypothesis that -xylosyltransferase is involved in xyloglucan biosynthesis was tested by overexpressing the corresponding genes and identifying the gene product that displayed activity . P. pastoris has been used for production of a number of glycosyltransferases involved in the biosynthesis of n- and o - linked oligosaccharides . To confirm that osfruct3 from rice encoded a vacuolar type -d - fructofuranosidase, the osfruct3 cdna was expressed in this host . A recombinant potato apyrase was expressed and purified in the hyperglycosylated form at 1 mg / l protein concentration . The catalytically active barley oxalate oxidase, hvoxo was produced with a yield of 50 mg / l culture and biochemically characterized . High - level expression of wheat germin / oxalate oxidase was achieved in p. pastoris as an -mating factor signal peptide fusion to increase secretion of the protein of interest into the culture medium . Approximately 1 g (4 10 u) of taoxo was produced in 5 l fermentation cultures following 8 days of methanol induction, demonstrating the possibility of large - scale production of oxalate oxidase for biotechnological applications . Another application using p. pastoris is the expression of the -subunit of heterotrimeric g - proteins, gpa1, from arabidopsis . Several attempts had previously failed to produce this protein in e. coli, whereas in the yeast system the protein could be expressed with a his6-tag and purified by affinity chromatography with a yield up to 20 mg from 700 ml culture . Several allergens including, cyn d 1 from bermuda grass, bla g 4 from german cockroach, amb a 6 from ambrosia artemisiifolia, and ole e 1 from olea europaea have also been produced in p. pastoris (see list in 64).this system was also used for the expression of a number of plant lectins such as canavalia brasiliensis lectin (conbr) and the nicotiana tabacum lectin . In a recent study, the low - affinity cation transporter (lct1) from wheat was also expressed and functionally characterized using p. pastoris . P. pastoris, methylotrophic yeast, is considered a valuable tool for high yield heterologous expression of various proteins . The possibility of obtaining posttranslational modifications, high level expression of foreign proteins in either intracellular or extracellular forms, simplicity of genetic manipulations, and availability of various p. pastoris strains and vectors make this expression system highly popular . Molecular manipulations such as gene targeting, high frequency dna transformation, and cloning for functional complementation are similar to those in s. cerevisiae . Tightly regulated promoters, easy integration of heterologous dna into the host chromosome and the capacity to generate more posttranslational modifications make p. pastoris the preferred system compared to s. cerevisiae . The wide use of p. pastoris expression system for recombinant plant proteins can be seen from recent reviews [64, 65]. Pastoris is particularly well suited for studying plant enzymes since glycosylation of the foreign proteins is expected to be closer to that in plants [66, 67] and glycosylated proteins have shorter glycosyl chains in p. pastoris than in s. cerevisiae . This expression system has the potential to produce high levels of recombinant proteins, up to 400 mg / l of culture . Two examples are cytosolic expression of nitrate reductase from spinach and corn at high levels needed for detailed biochemical studies and expression of a sweet potato invertase in milligram quantities . Enzymatic activity of the membrane - bound 1,6-galactosyltransferase was shown through overexpression in p. pastoris . The hypothesis that -xylosyltransferase is involved in xyloglucan biosynthesis was tested by overexpressing the corresponding genes and identifying the gene product that displayed activity . P. pastoris has been used for production of a number of glycosyltransferases involved in the biosynthesis of n- and o - linked oligosaccharides . To confirm that osfruct3 from rice encoded a vacuolar type -d - fructofuranosidase, a recombinant potato apyrase was expressed and purified in the hyperglycosylated form at 1 mg / l protein concentration . The catalytically active barley oxalate oxidase, hvoxo was produced with a yield of 50 mg / l culture and biochemically characterized . High - level expression of wheat germin / oxalate oxidase was achieved in p. pastoris as an -mating factor signal peptide fusion to increase secretion of the protein of interest into the culture medium . Approximately 1 g (4 10 u) of taoxo was produced in 5 l fermentation cultures following 8 days of methanol induction, demonstrating the possibility of large - scale production of oxalate oxidase for biotechnological applications . Another application using p. pastoris is the expression of the -subunit of heterotrimeric g - proteins, gpa1, from arabidopsis . Several attempts had previously failed to produce this protein in e. coli, whereas in the yeast system the protein could be expressed with a his6-tag and purified by affinity chromatography with a yield up to 20 mg from 700 ml culture . Several allergens including, cyn d 1 from bermuda grass, bla g 4 from german cockroach, amb a 6 from ambrosia artemisiifolia, and ole e 1 from olea europaea have also been produced in p. pastoris (see list in 64). This system was also used for the expression of a number of plant lectins such as canavalia brasiliensis lectin (conbr) and the nicotiana tabacum lectin . In a recent study, the low - affinity cation transporter (lct1) from wheat was also expressed and functionally characterized using p. pastoris . Baculoviruses have been used for the synthesis of a wide variety of eukaryotic recombinant proteins in insect cells . In this expression system one of the nonessential viral genes the resulting recombinant baculovirus is used to infect cultured insect cells and the heterologous genes can be expressed under the control of the extremely strong ppolh, polyhedron promoter in the late phase of infection . The most common baculovirus used for expression studies is autographa californica multiple capsid nucleopolyhedrovirus (acmnpv) and the most frequently used host insects are spodoptera frugiperda and trichoplusia ni . This expression system produces high levels of recombinant proteins which are soluble, post - translationally modified, biologically active, and functional . The main drawback of this system over the bacterial and yeast systems lies in the noncontinuous expression of the heterologous gene; every round of protein production needs reinfection . The most recent examples include the arabidopsis reductase isoforms, ar1 and ar2, peroxisomal short - chain acyl - coa oxidase a, cyclin - dependent kinase a, nadh - cytochrome b5 reductase, geranylgeranyltransferase - i, acyl - coa synthetase, homogentisate phytyltransferase, (+) -abscisic acid 8-hydroxylase, 1,2-xylosyltransferase, tobacco ethylene - inducing xylanase, and barley adp - glucose pyrophoshorylase . The overall yield of heterelogous proteins obtained with this system is usually lower than with p. pastoris . Baculovirus - infected insect cells have been used as an alternative system to xenopus oocytes for expression and characterization of plant channel proteins . Several channel proteins which were not functional in oocytes could be characterized in baculovirus - infected insect cells such as the k channel proteins akt1, kat1, kco1 from arabidopsis, and kst1 and skt1 from potato . To investigate the interaction between aux1 and its transport substrate indole-3-acetic acid (iaa) from arabidopsis, an epitope - tagged version of aux1 was expressed at high levels in a baculovirus expression system and suitable membrane fragments were prepared from baculovirus - infected insect cells for direct measurement of iaa binding to aux1 . Aux1-iaa interactions were determined using a radio - ligand binding assay to confirm that aux1 was able to bind iaa with an affinity (kd) of 2.6 mm, comparable with estimates of the km for iaa transport . The main disadvantages of using baculovirus - infected insect cells are difficulties in constructing the expression vectors, requirements for more complex laboratory facilities and skills, and the short expression periods after infection . The oocytes of the south african clawed frog, xenopus laevis, are also used for heterelogous expression of eukaryotic genes . The mrna for the target protein, introduced by microinjection into the cytoplasm, is translated and the protein is posttranslationally modified by the oocyte . Direct injections of dna into the nucleus are also possible, but the manipulations are difficult as the nucleus can easily be damaged in the process . Investigations on membrane transport proteins can be readily performed on oocytes where techniques for electrophysiological measurements are well established . Although, a high proportion of cells express the foreign gene after injection variations in the quality of oocytes and in the ability of individual cells to produce the heterelogous protein can cause problems . Oocytes are not suitable for preparing large quantities of proteins and the short expression period often leads to technical difficulties . The system can also not be sustained over long periods of time and is not suitable for stable expression [99, 100]. Xenopus oocytes have, however, provided a powerful heterologous expression system for animal as well as plant genes . The possibility of using xenopus oocytes as heterologous expression systems for the identification of plant transporters was first demonstrated by the expression of the h / glucose transporter stp1 from arabidopsis . It has, since, been mainly used for production of transporters including potassium channels, h / hexose cotransporters, aquaporins, and chloride channels . In addition, functional expression of a nitrate transporter, a k / na transporter [39, 103, 104], ammonium transporters [105, 106], sucrose transporters [107109], al - activated malate transporters [110, 111], polyol transporters [112, 113], inositol transporters [114, 115], an amino acid transporter, a cation cl - cotransporter, and an anion - selective transporter in xenopus oocytes were investigated . These include the k channels akt1 from arabidopsis [93, 119, 120], taakt1 from wheat, dkt1 from carrot, and osakt1 from rice . The causes for the lack of function of these recombinant proteins are not clear . Several studies have used expression of a wild type and its mutant forms in xenopus oocytes to confirm the in vivo functions of plant proteins, especially transporters and plasma membrane intrinsic proteins (pips or aquaporins). To demonstrate whether or not the plant k channels form multimers, the wild type and a mutant coexpression of tomato ammonium transporter (leamt1;1) and its mutant in xenopus oocytes inhibited ammonium transport, suggesting homooligomerization . In another study, the role of phosphorylation in the water channel activity of wild - type and mutant zmpip2;1 was studied in xenopus oocytes . In recent studies, the xenopus oocyte expression system was used to investigate structure - function relationships . In one example, differences in the function of two cation transporters, wheat hkt1 and arabidopsis athkt1, were investigated using a series of athkt1/hkt1 chimeras with point mutations . Heterologous expression of plant genes in other host organisms has two main applications: (1) overexpression of the encoded protein, for biochemical and biophysical characterization and (2) expression of foreign genes for determination of the function of the encoded protein by complementing in a mutant host . Overexpression of recombinant proteins is usually carried out with a cleavable tag to simplify purification in large quantities . In contrast, complementation studies are carried out in null mutants to restore a missing activity in vivo . Decisions on which expression vectors to use and the choice of the expression host depend on the particular application . In general e.coli is the first choice as host because of its simplicity, availability of expression vectors, cost effectiveness, and availability of extensive genetic information on this host . Alternative expression systems are used only if the recombinant protein is inactive due to lack of essential posttranslational modifications and when detailed studies on the recombinant protein function are planned . S. cerevisiae has been extensively used for functional complementation, biochemical, and electrophysiolagical characterization of plant membrane and transporter proteins . Baculovirus - mediated insect cell expression offers the possibility for detailed investigations of plant enzymes and transporters . The oocyte from xenopus laevis is often used for monitoring activity and biochemical and electrophysiological characterization of plant plasma membrane transporter and pump proteins . Heterologous expression is a powerful tool for functional and biochemical analyses of genes and gene families isolated from various organisms . Its limitations, however, should be kept in mind, especially when interpreting the results in terms of the native structure and function of proteins . Strategies developed to avoid misfolding of recombinant proteins include expression in periplasmic space, expression with a tag, and utilization of different hosts . Mislocalization, on the other hand, may occur because the recombinant protein may take over the function of the missing host protein . Conclusions on function need to be tested in alternative hosts and eventually in the plant itself.
The establishment of the state of israel problematizes a single definition of jewishness; the state was founded on secular socialist principles, relies on religious jewish law, and was built by waves of diverse jewish immigrants from europe, north africa, and the middle east, with varying levels of jewish religious practice . Maintaining a steady stream of jewish immigrants is crucial to israeli state - building, facilitating the integration of world jewry, and fulfilling the state's mission as homeland and refuge for all jews . But, the authenticity of jewish immigrants for israeli state - building has been judged (often simultaneously) in both religious and bioethnic terms. The population registry law 57251965 requires residents to enter both their le'oum (nationality or ethnic group) and religion in the registry . A recent israeli supreme court case affirmed an earlier precedent and distinguished le'oum or nationality, from secular citizenship . Israeli under the nationality rubric on their identity documents, to reflect their citizenship and belonging to the israeli state, rather than immigration of jews in israel is governed by israel's law of return 57101950, which provides: every jew has the right to come to this country as an oleh [jewish immigrant]. [i]n conjunction with the citizenship law, it enables every jew to become a citizen of the state, almost automatically. For the first twenty years, the law did not define who was a jew, and thus who had the right to immigrate . In 1970, the law was amended to include a definition of jew: for the purposes of this law, means a person who was born of a jewish mother or has become converted to judaism and who is not a member of another religion. The 1970 amendment also expanded citizenship rights to family members of eligible jews: the rights of a jew under this law as well as the rights of an oleh under any other enactment, are also vested in a child and a grandchild of a jew, the spouse of a jew, the spouse of a child of a jew and the spouse of a grandchild of a jew, except for a person who has been a jew and has voluntarily changed his religion . The amendment adopted the religious definition of a jew someone with a jewish mother or someone who has converted to judaism . However, the amendment extended citizenship rights to those who are referred to as seed of israelanyone either born to a non - jewish mother and a jewish father, or having at least one jewish grandparent. Thus, the law grants citizenship rights both to those who are religiously jewish but would not have jewish biological links, such as jews who converted, as well as those who do not have religious or biological connections to jewishness, such as spouses of jews . The 1970 amendment was a response to a controversial israeli supreme court case, shalit v. minister of the interior, which permitted children of a jewish father and non - jewish mother to register as part of the jewish le'oum or ethnic group in the population registry . [t]he amended law overruled the shalit case by adopting the religious law test of defining who is considered jewish, but the law saved the spirit of the shalit decision by granting non - jewish family members the right to immigrate under the law of return . Since the law was amended, and especially in the wake of the fall of the soviet union in the 1990s, jews from the fsu have arrived to israel en masse . Many had assimilated and secularized in the fsu and intermarried with non - jewish russians . Thus, although many russian immigrants are jewish by descent, and are entitled to citizenship, their jewishness is questioned by the ministry of interior, and they are often required to show additional proof . These individuals face even more skepticism by rabbinic authorities, as many are not considered jews under orthodox jewish law . The discrepancy between eligibility for israeli citizenship and classification as part of the jewish nation creates challenges for israeli citizens who are not considered religiously jewish . Israel is governed by a dual legal system, where both civil and religious courts have jurisdiction over various areas of the law . The laws governing personal status, such as marriage and divorce, are part of the exclusive jurisdiction of the religious courts . Only jews who are halakhically (under religious jewish law) jewish are eligible to marry in the religious courts, belong to synagogues, or be buried in jewish cemeteries; there is no civil marriage in israel . One of the main functions of the rabbinic courts is to provide judicial rulings on whether a person is jewish . The number of immigrants who are eligible to immigrate under the law of return, but are not religiously jewish is quite staggering . Demographer sergio della pergola suggested that by a religious definition there are roughly 14 million jews around the world, but over 23 million people eligible for citizenship under the law of return . Eligible for immigration and citizenship but ineligible to legally marry and participate as full members of society . The move to mandate genetic tests of jewishness as a requirement for immigration threatens to increase this divide because it cannot grant jewish status recognized by the rabbis . The prime minister's office attempted to distinguish the purpose of the dna test as a secular immigration regulation rather than a marker of religious identity . We're talking about a test to determine a family bond that entitles [the child to] aliyah. The prime minister's office thus emphasized the line between secular citizenship and religious belonging in the jewish nation . While racial divisions are classically ideological, high - tech science has entered the arena, and has further complexified the borders of jewish identity and ethnicity . Molecular genetic tests can now be used to measure individuals whole genomes, and scientific research has begun to describe the genetic basis for a common ancestry of the whole of the jewish population . There are three key ways in which jewishness has moved to the molecular realm, with genes being defined as jewish: population genetics; genetic testing for both disease and jewish identity; and human ova and sperm donation, as in the field of assisted conception . In these different conceptual arenas, jewish genes and inheritance are defined in different ways, opening up a wider space of ambiguity around jewish identity and definition . With population genetics or tracing jewish history through dna, these types of studies attempt to trace jewish history through genetics, and elucidate a common historical origin of the jewish people in the biblical land of israel . Here, jewishness is determined by genomic analysis as statistical probabilities that dna haplotypes will be more prevalent within identified groups . But the presence of a certain haplotype within an individual is not a guarantee that the individual is jewish or not . Moreover, the historical claims that are entangled with these scientific studies are heavily debated . The cohanim modal haplotype (cmh), the jewish genetic marker that has received the most attention, was first publicized in the journal nature in a study that identified six differences in the dna sequence of male jews that identified as cohens or cohanim (jewish priests). Some scientists think that the cohanim signature could represent the inheritance of over 100 generations from the founder of the patrilineal genetic line . The signature is traced to a date over 3000 years ago, in accordance with the oral tradition that the cohens maintain a line of patrilineal descent from aaron, the first jewish priest . In the second domain of jewish genetics, inheritable diseases common in jewish groups, dna mutations can be read to indicate a higher likelihood of developing a specific disease . Consequently, there has been a move to test individuals for genetic markers of disease before they form partnerships and have children together . The third sphere of jewish genetics is in assisted conception, which resonates with the jewish tradition and its emphasis on fruitful reproduction . Accordingly, kahn found that the orthodox jewish community has been receptive to the use of technologies to assist with fertility and has developed approaches to reconcile the genetic realities with jewish law . Many rabbis will permit married couples to use non - jewish genetic donor material when no other measures exist to solve infertility challenges, and since jewishness is halakhically passed from mother to child, non - jewish sperm can create a jewish child if the mother is jewish . However, the inheritance of jewishness is problematized when a surrogate mother carries a baby . This begs the question of whether a baby who has genetically jewish parents, i.e. Who donate the egg and sperm, but who is carried by a non - jewish surrogate, will be deemed jewish . In a recent case with those facts, a rabbi opined that the baby technically had three parents, and because the surrogate was not jewish, the child was not jewish . Although most rabbis believe that the mother is determined by gestation and birth, some recognize both the genetic and birth mothers as having maternal status. A minority believe that if jewish parents contribute genetic material the child's status should follow that of the genetic / intended social mother. The dna tests described by the prime minister's office and brought to light by yakerson's case suggest a policy decision to enshrine jewishness at the level of dna, render jewish genes legally legible by the state, and make dna signatures a basis for basic rights and citizenship . In practical terms, for example, non - jewish donor sperm and ova can be used in assisted conception clinics to produce babies that are legally jewish in the eyes of the state, though only if the gestating womb is jewish . Dna markers that could be read as jewish on an individual level, however, need not be identified in these individuals . Conversely, a child could have jewish genetic material, but without a jewish mother would not be considered jewish . These varying possibilities point to the ambiguity or outright contradictions across the field of jewish genetics and the rabbinical sphere . In fact, the religious orthodox community has had a mixed response to the increase in genetic technology among jewish definition and reproduction . In general, they have embraced the genetic tests, and have relied on them to ensure safe and healthy reproduction . However, when it comes to genetics as a means of testing jewishness, many rabbis remain skeptical . Dangerous eugenic overtones. Alternatively, genetic tests offer the possibility to legitimize those whose jewishness is often questioned . For example, an eastern european woman in israel sought rabbinic permission to marry . To bolster her claim for a marriage license, [she] had her dna analyzed. The dna test tipped the balance in her favor and the rabbi granted her a marriage license as a bona fide jew. Further, underserved jewish communities in israel, whose jewishness is questioned, could benefit from proof of authentic jewishness . For example, the lemba people of southern africa not only claim descent from a tribe of israel with descent passed from father to son, and maintain some jewish traditions such as a kosher diet, but [t]he cmh appears in the lemba with a frequency similar to that in the general jewish population (in just under one out of every ten men). This adds support to their demands to be treated as equals . Although arguably claims for equality should stand on their own, and not depend on proof of jewish lineage, the marginalized groups of the beta israel of ethiopia, the kuki - chin - mizo from northeast india, or the lemba, could all likely benefit from scientifically certifiable jewishness to support their campaigns toward equal rights . Regardless of the indexical power or validity of these genetic tests, when they are recognized by the state, the reality of jewishness as a measurable biological category can implicate access to basic rights and citizenship in israel . Kahn thus argues that genetic studies must be read within the larger sociopolitical context where the meaning of claiming jewish identity can make a direct impact in terms of access to rights and resources . In light of the ambiguity of the meaning and importance of jewish genes, coupled with the prospect that they may become a criterion for citizenship in israel, it is not yet clear: why genes? Why now? And why the move to control the borders of the nation in this new genetic way? The development of jewish genetics can be seen as a golden example of a hybrid fusion of statecraft and technoscience, or what philosopher michel foucault and others describe as the management of populations through biopolitics, the governance of life itself . The prospect of genetic tests to determine jewishness in israel raises concerns over a reinscription of ethnic essentialisms, entailing a project that could foster a new regime of biopower at the level of an individual's genes, with potential for governments cataloging the biological citizen at the molecular level . Crucially, however, the legitimacy of the diverse manifestations of jewish genetics hinges on its utility as a regulatory technique in managing israel's population . Similarly, barbara prainsack argues that israel's permissive laws regarding the use of artificial reproductive technologies can be traced to their utility in tackling israel's demographic problem, that is in maintaining a jewish majority . Moreover, she finds that israel's pro - natalist culture rests on a notion of risk to the population that serves to bolster the state's mandate to reproduce the nation at the level of individuals . Genetic jewishness may thus offer possibilities for a demographic boost. Genetic legitimation might only be meaningful, however, if it is recognized by the rabbis or others in power as a verifiable source of knowledge . In the unlikely eventuality that genetic tests are routinely used to determine rights to citizenship in israel, the foregrounding of jewish genes as the basis of israeli citizenship would be a novel form of governmentality . We would be seeing the management and administration of populations and citizens by their states through ethnic genetics . The yakerson case revealed that the state of israel may rely on genetic tests as proof of jewishness . A genetic definition of jewishness, however, breaks with traditional halakhic law and reconfigures the terms of authentic belonging in the jewish state . Although dna testing may offer the possibility of legitimation, for yakerson, genetic testing was used as a barrier to prevent access for someone who meets the expansive definition laid out in the law of return, but still was not jewish enough. Although masha was ultimately denied access to the 10-day birthright trip to israel, her older sister, dina, reportedly immigrated to israel as an oleh in 1990 . In this case, the turn to genetics failed to provide an accurate measure of familial connections . There are several ways to interpret the israeli government's increasing reliance on genetic testing to determine eligibility for citizenship or other rights . It could be a trend toward more restrictive immigration policies that seek to guard access to state resources . Advocates have seen similarly restrictive policies advanced to require jewish verification from those seeking temporary student or work visas . One rabbi, who helps potential immigrants navigate the rabbinic bureaucracy, explained this as xenophobia: it manifests itself in the way we treat people born jewish who don't fit the description of what a jew should look like. The tests may also become a means to expand the pool of potential new jewish immigrants who have verifiable ancestral ties . Jewish genetic tests could become a way to recognize different and broader articulations of jewish identity and thereby expand the limits of who is deemed to have legitimate connections . The potential move to legally recognize genetic tests for jewishness could equally shift some of the authority away from the rabbis, and toward scientists, who may recognize secular manifestations of jewish identity . Although genetic tests for jewishness may have been intended to increase certainty and validate jewish identity, they may provoke more confusion by adding another layer of definitional uncertainty . On the one hand, the existence of jewish dna could verify jewish connections and provide the requisite proof to grant certain individuals access to citizenship and its associated benefits . On the other hand, it is worth paying attention to who might be excluded those who claim belonging within the jewish community but do not have genetic links to prove this biological connection, as well as those who will be granted limited access via citizenship but who will not be recognized as equal members of the jewish nation . It remains to be seen how this new categorization will bear on notions of belonging and legitimacy within the jewish community . In the area of jewish identity already fraught with definitional ambiguity this attempt to concretize what it means to be a jew in genetic terms adds another layer of contestation and confusion . Crucially, the latest efforts to define jewishness in genetic terms have not yielded the certainty that the state seeks over how to determine who is a jew.
Surgery for inguinal hernias has undergone constant modification in surgeons' quest to achieve a perfect result . The evolution of minimally invasive surgery has instigated a redefinition of the end points of an acceptable hernia repair with a special emphasis on comfort, cost, and cosmesis, in addition to the traditional outcome measures, namely groin pain and recurrence . Thus, laparoscopic herniorraphy, with advantages related to postoperative pain, earlier return to work and normal activities, and an improved quality of life in the postoperative period has emerged as an effective alternative to open repairs . With comparable recurrence rates and complications in experienced hands, cost concerns remain the main caveat in extending its benefits unhindered to the general population . Conventionally, in a laparoscopic hernia repair, staples or tacks are used to fix the mesh to avoid mesh migration and consequent recurrence . It avoids the complications associated with stapling and has attractive economic logistics, because a significant bulk of the cost consumed in laparoscopic repairs is reflected in the need for a stapler . Although isolated studies have proven the effectiveness of unstapled laparoscopic hernia repairs with the total extraperitoneal technique (tep), literature pertaining to this issue is meager and the incidence of recurrence remains the main concern . The present study compares the results of stapled and unstapled laparoscopic totally extraperitoneal herniorraphy with the reference to postoperative complications, chronic groin pain, and early recurrence . Patients with incomplete, reducible inguinal hernias who consented to participate in the study were randomized into 2 groups by using the sealed envelope technique as follows: group 1 (stapled) and group 2 (unstapled). Patients with irreducible hernias, previous lower abdominal surgery, and recurrent hernias were excluded from the study . The results of our study are based on our observations in 50 patients (25 in each group) who have completed a minimum follow - up of 12 months . We used reusable cannulas, working ports, and instruments in all cases . A polypropylene mesh 15 11-cm to 15 13-cm, depending on the patient's body habitus, was introduced and unrolled in the preperitoneal space . The mesh was positioned to cover the entire myopectineal orifice from symphysis pubis in the midline to anterior superior iliac spine laterally . Patients found to have bilateral hernias at operation underwent repair of the opposite side simultaneously . Two pieces of mesh, one on each side overlapping in the midline, were used for this purpose . Dissection of the opposite side to search for incipient hernias was not done routinely in all cases . Patients were observed in the hospital for 1 day to 2 days initially, and subsequently in the later part of the study, the procedure was done on an outpatient basis . Non - narcotic injectable analgesia (diclofenac sodium, 50 mg every 8 hours) was given routinely to all patients in the immediate postoperative period and converted to oral as per demand dosage on the next morning . Patients were reassessed on postoperative day 7, at 1 month, and at 3 monthly intervals thereafter . The following parameters were evaluated: pain was evaluated with the visual analog score and by the number of cases requiring analgesics for more than 1 week . Chronic groin pain was defined as pain lasting for more than 8 weeks that occurred in the vicinity of repair or along the endangered nerve territory and required analgesia or hindered physical activity . Patients were examined preoperatively and postoperatively; pain sensations, numbness, and parasthesias were assessed to rule out nerve injury;seromas and hematomas were assessed by clinical examination and noted;routine activity was defined as normal daily activities like walking, climbing stairs, bathing and other such activities;recurrence was evaluated at regular intervals by clinical examination . Pain was evaluated with the visual analog score and by the number of cases requiring analgesics for more than 1 week . Chronic groin pain was defined as pain lasting for more than 8 weeks that occurred in the vicinity of repair or along the endangered nerve territory and required analgesia or hindered physical activity . Patients were examined preoperatively and postoperatively; pain sensations, numbness, and parasthesias were assessed to rule out nerve injury; seromas and hematomas were assessed by clinical examination and noted; routine activity was defined as normal daily activities like walking, climbing stairs, bathing and other such activities; recurrence was evaluated at regular intervals by clinical examination . Our data were not normally distributed, so analysis was done using nonparametric tests for 2 independent samples (wilcoxon rank sum test) and the chi - square test . We used reusable cannulas, working ports, and instruments in all cases . A polypropylene mesh 15 11-cm to 15 13-cm, depending on the patient's body habitus, was introduced and unrolled in the preperitoneal space . The mesh was positioned to cover the entire myopectineal orifice from symphysis pubis in the midline to anterior superior iliac spine laterally . Patients found to have bilateral hernias at operation underwent repair of the opposite side simultaneously . Two pieces of mesh, one on each side overlapping in the midline, were used for this purpose . Dissection of the opposite side to search for incipient hernias was not done routinely in all cases . Patients were observed in the hospital for 1 day to 2 days initially, and subsequently in the later part of the study, the procedure was done on an outpatient basis . Non - narcotic injectable analgesia (diclofenac sodium, 50 mg every 8 hours) was given routinely to all patients in the immediate postoperative period and converted to oral as per demand dosage on the next morning . Patients were reassessed on postoperative day 7, at 1 month, and at 3 monthly intervals thereafter . The following parameters were evaluated: pain was evaluated with the visual analog score and by the number of cases requiring analgesics for more than 1 week . Chronic groin pain was defined as pain lasting for more than 8 weeks that occurred in the vicinity of repair or along the endangered nerve territory and required analgesia or hindered physical activity . Patients were examined preoperatively and postoperatively; pain sensations, numbness, and parasthesias were assessed to rule out nerve injury;seromas and hematomas were assessed by clinical examination and noted;routine activity was defined as normal daily activities like walking, climbing stairs, bathing and other such activities;recurrence was evaluated at regular intervals by clinical examination . Pain was evaluated with the visual analog score and by the number of cases requiring analgesics for more than 1 week . Chronic groin pain was defined as pain lasting for more than 8 weeks that occurred in the vicinity of repair or along the endangered nerve territory and required analgesia or hindered physical activity . Patients were examined preoperatively and postoperatively; pain sensations, numbness, and parasthesias were assessed to rule out nerve injury; seromas and hematomas were assessed by clinical examination and noted; routine activity was defined as normal daily activities like walking, climbing stairs, bathing and other such activities; recurrence was evaluated at regular intervals by clinical examination . Our data were not normally distributed, so analysis was done using nonparametric tests for 2 independent samples (wilcoxon rank sum test) and the chi - square test . Nine patients underwent bilateral hernia repair in the stapled group, and 4 in the unstapled group . Of the 9 bilateral stapled repairs, 2 patients diagnosed with unilateral hernias initially were discovered as having small contralateral hernias after insufflation of co2 . Both patients had been previously randomized to undergo stapled repair and underwent simultaneous repair of the contralateral hernia . We did not have any major intraoperative complications; however, minor complications included 2 peritoneal tears sutured intraoperatively and rupture of the balloon during initial dissection that occurred in 2 patients with the balloon being retrieved through the port under direct vision . Two patients developed subcutaneous emphysema, one in each group, which resolved spontaneously after a few hours . One patient incurred an accidental urethral injury as a consequence of dislodgment of the urinary catheter during transportation . No significant difference existed in the postoperative pain scores, pain trends, and duration of analgesics required, return to activity or hospital stay . Four patients (3 in the unstapled and 1 in the stapled group) developed seromas . No recurrences were noted at a mean follow - up of 25.76 months (median, 23.29.3). The median follow - up was 27.46 months in the stapled group and 20.3 months in the unstapled group, whereas the mean follow - ups were 27.478.64 and 23.989.9, respectively, with no significant difference . One patient expired 2 years after hernia repair due to myocardial infarction, and another was lost to follow - up early in the study (after 3 months) both in groups 2 . One patient in the stapled group developed a contralateral hernia 2 years after the initial operation . Comparative analysis of mean values of parameters in the 2 groups and their significance one patient in the unstapled group was lost to follow - up 3 months after the operation . Mesh fixation in the laparoscopic preperitoneal repair of inguinal hernias is currently a debatable issue . In most reported trials, surgeons have unquestionably adhered to the principle of fixing the mesh on the premise that good fixation of the mesh is critical for preventing mesh migration and early recurrence . However, their judgment is based on evidence in noncomparative retrospective analyses . But staplers are expensive and have been cited as a source of distressing and at times serious complications like nerve injuries, osteitis pubis, and other such anamolies . Moreover, consensus regarding the number of staples and the ideal sites for their placement is lacking . The transversalis fascia, rectus muscle, cooper's ligament, and the pubic bone have emerged as the traditional safe points of fixation with avoidance of infero - medial and infero - lateral anchorage that is fraught with dangerous complications . Others have reported lack of fixation at inferior lateral and medial sites as a prime cause of recurrence . Adhesive glues and fibrin sealants have been tried as alternatives to stapling but the efficacy of these procedures remains to be established . The justification stems from the observation that a large mesh that satisfactorily overlaps the entire myopectineal orifice and all potential sites of herniation does not require fixation as it retains its position in the preperitoneal space by virtue of the higher intraabdominal pressure at the end of the operation . So, laparoscopic repairs need not be different . In an endeavor to establish the fate of an unfixed mesh in the preperito - neal space in a patient undergoing transabdominal preperitoneal repairs (tapp), irving et al demonstrated that a nonfixed mesh radiologically marked with clips did not appreciably migrate in follow - up x - rays even after 3 months . The first published reference to the unstapled laparoscopic technique for inguinal hernia can be traced to as early as 1994 . Thereafter, the technique has been rarely investigated, and literature pertaining to the procedure is sparse . Based on evidence in the existing retrospective and noncomparative trials, unstapled tep repairs have been thought to have a low incidence of recurrence and complications . The only published randomized study comparing stapled and unstapled tep repairs found no difference in recurrence rates in either group after a median 12-month follow - up . In our study, although the mean early pain scores and duration of analgesic intake was marginally higher in the stapled group, the difference was not statistically significant . Adverse long - term outcomes, namely chronic groin pain, were not seen in either group . Although khajanchee et al reported an increased risk of neuropathic complications in the stapled group, other authors have not reported any significant increase in the incidence of such complications . As increased chronic pain after stapled repairs is usually due to improper placement of staples or tacks, care should be taken during placement of staples to avoid these complications . It has emerged from the available literature that recurrence after laparoscopic totally extraperitoneal hernia repair is most likely because of a failure in surgical technique, and causes other than fixation, such as an incomplete dissection of the myopectineal orifice or mesh size, may be important determinants . Whereas a small mesh can contribute to recurrence due to incomplete coverage of the myopectineal orifice, a large mesh in an inadequately dissected space can get furled or wrinkled and result in a similar consequences . It merits consideration that inadequate mesh size might have been the prime contributor to recurrences in studies where lack of mesh fixation has been thought to be the cause of recurrence . Experimental studies have suggested that an overlap of 3 or more centimeters is essential in preventing recurrences . A mesh size of 1015 cm is recommended in laparoscopic repairs without fixation . In our series, a standard of 1511-cm or 1513-cm prolene mesh was used depending on the body habitus, which ensured a wide overlap of the myopectineal orifice . Inadequate follow - up has been the criticism voiced against these studies, and it has been emphasized that results of laparoscopic hernia repair should be reviewed after reports of adequate long - term follow - up are available . However, unlike the tissue repairs where recurrences are reported equally in subsequent years, virtually all laparoscopic recurrences occur early, (ie, in the first year) and are due to surgeon - related factors . This is reasonable if one is to consider mesh migration or displacement as the cause for recurrence . The cost of the stapler is the major deterrent in extending the benefits of laparoscopic hernia repair unhindered to the general population . The results of our study are encouraging and can have an important impact on the use of laparoscopic procedures for hernia repair in a developing country like ours where most of our patients come from the lower socioeconomic strata and are often unable to bear the cost of a stapler . Unstapled laparoscopic totally extraperitoneal inguinal hernia repair yields equivalent results in terms of complications and early recurrence when compared with results with the stapled technique, and the unstapled procedure merits evaluation in a larger study population.
Since the hybridoma technology was established for preparation and production of monoclonal antibody (mab) in 1975, a large variety and quantity of antibodies have been produced and widely used in biological researches, medical diagnoses, and therapies . The production of mab from ascites by culturing hybridomas in the peritoneum of a living mouse makes a high yield of antibody; however, it is not only restricted by animal protection laws, but also involved in some problems of the antibody purity and practicability in human therapies . Many efforts have been made to improve the production of mab at high titer in consideration of the economical effectivity . Aside from conventional t - flask culture, a variety of methods of hybridoma cell culture in vitro have been developed, such as roller bottles (or spinner flasks, one - mouthed), hollow fibre bioreactors, dialysis tubing, and macroporous microcarrier beads [2, 3, 4, 5, 6]. The process to raise mab with both high yield and quality is still highly interesting, and processing of the resultant hybridoma cell culture in vitro needs further investigating and improving . Rotated cell culture system (rccs) by simulating microgravity was developed on the basis of clinostat equipment (us patent). It was first used by plant physiologists more than 100 years ago to study gravitational biological effects on plants . Recently, it has been used to study mammalian cell growth, differentiation, and morphogenesis in response to alterations in gravitational conditions [10, 11, 12, 13]. It was strongly recommended that clinostat experiments should first be investigated before a biology object was proposed for a space - flight experiment . In this cultural system, when the radius and the revolution speed of a rotating bottle are on a certain scale, the centrifuge force is therefore closely equal to the gravity on cells . Under this condition, it allows the cells to grow in three dimensions, which could be, in some sense, simulated to the parent tissue condition in vivo, such as some cultures for liver cells and cartilage cells . Applying rccs, various cell lines were successfully cultured, including breast and prostate cancer cells that were difficult to culture under the conventional culture conditions . A new type of dmrb (double - mouthed rolling bottle), derived from conventional rotated bottle, has been designed (chinese patent). It is operated conveniently with a better gas - exchanging efficiency and a lower cost . Furthermore, a large scale of mab can be produced by laying more dmrbs on the rollers of the rolling cell culture system (chinese patent). In this paper, hybridoma cell growth and mab productivity cultured in dmrbs and t - flasks reagents and cell culture apparatus . Dmem cell culture medium with a low glucose concentration, fetal calf serum (fcs), and trypsin were from sigma chem co (st louis, mo, usa). Microcarriers beads (cytodex 3) were from pharmacia biotech (uppsala, sweden). The volume of the bottle is 50100 ml and the diameter is 45 cm . During cell cultivation, the two mouths of the bottle were covered with a piece of foil or a lid and the bottle was placed on the rolled - spindles of the cell culture system, by the curved surface . The rolling cell culture system generally includes rolling machine with rolled - spindles and a special electric device to control revolution speed . The dmrb was allowed to rotate in the direction either clockwise or anticlockwise . The bottles and rolling machine were installed in the humidified incubator containing 5% co2 at 37c . The cured surface of the bottle touches on the rolling spindles horizontally and rotates at a suitable revolution speed . The hybridoma cell line (3e8) was established resulting from fusion of murine p3-x63 ag 8.653 myeloma cells with mouse balb / c b - lymphocytes immunized against human chorionic gonadotropin (hcg) as described . The dmem medium was supplemented with 50 m gentamycin, at ph 7.4 (adjusted with 7.4% nahco3 when necessary). Viable cells were seeded at a density of 1.52 10/ml for both t - flasks (50 ml, 25 cm containing 10 ml of medium) and dmrbs (also containing 10 ml of medium). Cells were allowed to grow in dmem medium with 1%, 5%, and 10% fcs, respectively . For rotating dmrb culture, three bottles, at least, were not rotated as static control . To enhance productivity by increasing the surface area to a given medium volume, the hybridoma cells were cultured in the presence of microcarriers . In the experiment silicone was dissolved in 5% chloroform, then the silicochloroform solution was poured into glassware and poured out when the wall was immersed equably . The glassware was dried and autoclaved prior to use . Dry cytodex microcarriers (800 cm/50 ml) were hydrated with calcium- and magnesium - free phosphate - buffered saline (ca- and mg - free pbs) in a siliconized spinner flask on a shaker overnight . The microcarriers were washed twice with ca- and mg - free pbs and then autoclaved for 15 minutes at 115c, 15 psi . Residual ca- and mg - free pbs was removed and the microcarriers were washed and resuspended in warm media before use . Usually, 100 ml medium contained 0.3 g of microcarriers . Cell concentrations were determined by counting a cell suspension diluted 1:1 (v / v) with 0.2% trypan blue by a hemacytometer . Visual analysis of the cultures revealed an admixture of live (trypan - blue negative) and dead (trypan - blue positive) cells under each experimental condition . Antibody levels in the supernatants of hybridoma cultures were determined by an enzyme - linked immunoassay (elisa). Maxi - sorp f96 plates were coated with hcg (20 g / ml in pbs, 100 l / well) and incubated at 4c overnight, and the wells were blocked with pbs containing 1% bsa for 2 hours at 37c (200 l / well). Then the wells were washed three times with pbs containing 0.5% triton x-100 (200 l / well). The samples, negative control (medium) and positive control (ascites of the mice with hybridomas), were added (50 l / well) and incubated for 1 hour at 37c . The wells were then washed for three times with pbs containing 0.5% triton x-100 and 1% bsa (100 l / well), and incubated for 1 hour with alkaline - phosphatase - conjugated goat anti - mouse igg at they were washed three times with pbs containing 0.5% triton x-100 and twice with double distilled water (200 l / well). Then 3,3,5,5-tetramethylbenzidine (tmb, in pb buffer, ph 6.0) chromogen - substrate was added (100 l / well) and incubated in dark . The chromogenic reaction was stopped after 1530 minutes with 0.5 m h2so4 and the absorbance of each well was detected at 492 nm in a spectrophotometer (bio - rad model 3550 microplate reader jp41). Microcarrier beads (0.3 g/100 ml medium) were added in the media containing fcs (1%, 5%, and 10%) in both dmrb and t - flask (figure 2b). In static culture, cells can perch on the microcarriers and occupy the most surface of the beads (90%95%), growing in a three - dimensional manner in dmrb (figure 2a). For t - flask, however, 40%50% of hybridoma cells perch and grow on the beads under the same conditions . The higher cell - perching ratio onto the microcarriers in dmrb may be resulted from a better ventilation of the two opposite necks, which are helpful to gas exchanging . The dmem medium was supplemented with 50 m gentamycin, at ph 7.4 (adjusted with 7.4% nahco3 when necessary). Viable cells were seeded at a density of 1.52 10/ml for both t - flasks (50 ml, 25 cm containing 10 ml of medium) and dmrbs (containing 10 ml of medium). Microcarrier beads (0.3 g/100 ml medium) were added to the medium and cells were allowed to grow in dmem medium (5% co2, at 37c) with 1%, 5%, and 10% fcs, respectively . Cells growing in t - flask were as control (bar = 0.1 mm). For rotating dmrb culture (supplemented with 10% fcs), cells were under a revolution speed of 2 turns / min for 72 hours . For each experiment, three bottles, at least, were as a group . Under a rotating condition (210 rpm), the hybridoma cells on the beads are subjected to an increase in shearing force . The faster the revolution, the higher the shearing force and the more cells shorn off the beads . Only 1%3% cells can perch on the beads when revolution speed gets to 10 rpm . This is to say, the number of cells perching on the beads is directly related to the revolution of dmrb . Therefore, it is important to use a suitable revolution speed to have a low shearing force on cells . On the basis of our experiments, a suitable revolution speed should be about 2 rpm, under which cell perching ratio can keep at 40%50% (figure 2c). Figure 3 shows total (left) and viable (right) numbers of hybridoma cells cultured in both dmrbs and t - flasks . Total (left) and viable (right) numbers of hybridoma cells cultured in both dmrbs and t - flasks in medium containing 10% (a), 5% (b), and 1% (c) fcs, respectively . The black curve represents cell number in dmrbs and the red curve represents cell number in t - flasks . The maximum densities of cells cultured in rotating dmrbs are observably higher than those in t - flasks, in all the media containing 1%, 5%, and 10% fcs . The total number of cells reaches approximately 1.5 10/ml around 72 hours while cells are cultured in the medium containing 10 fcs in rotating dmrbs . However, it is approximately 1.0 10/ml while cells are cultured in t - flasks . Experiments also show that cells densities in rotating dmrbs are higher than those in static dmrbs (data not shown), suggesting that the clinonational rotation plays an important role in a rotating dmrb culture . Aliquots were daily taken from the culturing media to measure the mab concentration during the culture . Changes in mab concentrations in the medium supplemented with 5% fcs are shown in figure 4 . As indicated, both accumulated (a) and daily (b) mab production of cells cultured in rotating dmrbs are distinguishably higher than those of cells cultured in t - flasks . Interestingly, for dmrbs, the highest production rate is achieved on the first day . The first three - day mab production accounts for over 95% of the total yield during the five - day culture . It suggests that the antibody should be harvested in 72 hours, to have a high yield of antibody, saving time and materials . Statistically, the final production of a rotating dmrb is approximately 42.5% higher than that of a t - flask . This result indicates that rotation plays a significant role, not only in cell growth, but also in mab production . The mab concentrations are measured in the medium supplemented with 5% fcs in both dmrbs and t - flasks . Cell growth and mab production in dmrb groups and t - flask groups within 72 hours are shown in table 1 . Increase in production rate of mab is highly correlated with the viable cell number . It indicates that the increasing mab production is largely resulted from an increase of the viable cell number . In other words, a further possibility for enhancing mab productivity is considered with the increase in the surface area by the microcarriers on which cells grow and perch . Consequently, the cell density per culture volume may be improved by means of the microcarriers [20, 21]. For our experiments, cytodex 3 is used as the microcarriers, which are macroporous matrix based on polyethylene and weighted by silica . These microcarriers, alkali and acid resistant, are steamily sterilizable at 121c (1 bar) and are not swollen up on hydration . Cytoline-3 microcarriers provide both an external surface and an interior space with pore size between 10 and 400 m, which can be populated also by cells grown in suspension and used in stirred cultures . However, cells inhabiting inside the pores could not be observed during the culture . Comparison of dmrb groups with t - flask group; p<.1, p<.05 . Cell growth density, mab production, and reasonable cost are important criteria to evaluate alternative methods to conventional t - flask . The method using dmrb to culture hybridoma cells has some significant advantages: (1) to produce higher mab at a low cost, (2) easily to handle in lab, (3) conveniently to process and investigate the optimal conditions for different mab, and (4) readily to produce a larger - scale mab when necessary . Furthermore, the method makes it possible to produce mab as a putative process on an industrial scale, and to have obvious advantages, such as a high yield and a low cost . Microcarrier beads (0.3 g/100 ml medium) were added in the media containing fcs (1%, 5%, and 10%) in both dmrb and t - flask (figure 2b). In static culture, cells can perch on the microcarriers and occupy the most surface of the beads (90%95%), growing in a three - dimensional manner in dmrb (figure 2a). For t - flask, however, 40%50% of hybridoma cells perch and grow on the beads under the same conditions . The higher cell - perching ratio onto the microcarriers in dmrb may be resulted from a better ventilation of the two opposite necks, which are helpful to gas exchanging . The dmem medium was supplemented with 50 m gentamycin, at ph 7.4 (adjusted with 7.4% nahco3 when necessary). Viable cells were seeded at a density of 1.52 10/ml for both t - flasks (50 ml, 25 cm containing 10 ml of medium) and dmrbs (containing 10 ml of medium). Microcarrier beads (0.3 g/100 ml medium) were added to the medium and cells were allowed to grow in dmem medium (5% co2, at 37c) with 1%, 5%, and 10% fcs, respectively . Cells growing in t - flask were as control (bar = 0.1 mm). For rotating dmrb culture (supplemented with 10% fcs), cells were under a revolution speed of 2 turns / min for 72 hours . For each experiment, three bottles, at least, were as a group . Under a rotating condition (210 rpm), the hybridoma cells on the beads are subjected to an increase in shearing force . The faster the revolution, the higher the shearing force and the more cells shorn off the beads . Only 1%3% cells can perch on the beads when revolution speed gets to 10 rpm . This is to say, the number of cells perching on the beads is directly related to the revolution of dmrb . Therefore, it is important to use a suitable revolution speed to have a low shearing force on cells . On the basis of our experiments, a suitable revolution speed should be about 2 rpm, under which cell perching ratio can keep at 40%50% (figure 2c). Figure 3 shows total (left) and viable (right) numbers of hybridoma cells cultured in both dmrbs and t - flasks . Total (left) and viable (right) numbers of hybridoma cells cultured in both dmrbs and t - flasks in medium containing 10% (a), 5% (b), and 1% (c) fcs, respectively . The black curve represents cell number in dmrbs and the red curve represents cell number in t - flasks . . The maximum densities of cells cultured in rotating dmrbs are observably higher than those in t - flasks, in all the media containing 1%, 5%, and 10% fcs . The total number of cells reaches approximately 1.5 10/ml around 72 hours while cells are cultured in the medium containing 10 fcs in rotating dmrbs . However, it is approximately 1.0 10/ml while cells are cultured in t - flasks . Experiments also show that cells densities in rotating dmrbs are higher than those in static dmrbs (data not shown), suggesting that the clinonational rotation plays an important role in a rotating dmrb culture . Aliquots were daily taken from the culturing media to measure the mab concentration during the culture . Changes in mab concentrations in the medium supplemented with 5% fcs are shown in figure 4 . As indicated, both accumulated (a) and daily (b) mab production of cells cultured in rotating dmrbs are distinguishably higher than those of cells cultured in t - flasks . Interestingly, for dmrbs, the highest production rate is achieved on the first day . The first three - day mab production accounts for over 95% of the total yield during the five - day culture . It suggests that the antibody should be harvested in 72 hours, to have a high yield of antibody, saving time and materials . Statistically, the final production of a rotating dmrb is approximately 42.5% higher than that of a t - flask . This result indicates that rotation plays a significant role, not only in cell growth, but also in mab production . The mab concentrations are measured in the medium supplemented with 5% fcs in both dmrbs and t - flasks . Cell growth and mab production in dmrb groups and t - flask groups within 72 hours are shown in table 1 . Increase in production rate of mab is highly correlated with the viable cell number . It indicates that the increasing mab production is largely resulted from an increase of the viable cell number . In other words, the synthesis rate of mab increased proportionally to the cell number . A further possibility for enhancing mab productivity is considered with the increase in the surface area by the microcarriers on which cells grow and perch . Consequently, the cell density per culture volume may be improved by means of the microcarriers [20, 21]. For our experiments, cytodex 3 is used as the microcarriers, which are macroporous matrix based on polyethylene and weighted by silica . These microcarriers, alkali and acid resistant, are steamily sterilizable at 121c (1 bar) and are not swollen up on hydration . Cytoline-3 microcarriers provide both an external surface and an interior space with pore size between 10 and 400 m, which can be populated also by cells grown in suspension and used in stirred cultures . However, cells inhabiting inside the pores could not be observed during the culture . Comparison of dmrb groups with t - flask group; p<.1, p<.05 . Cell growth density, mab production, and reasonable cost are important criteria to evaluate alternative methods to conventional t - flask . The method using dmrb to culture hybridoma cells has some significant advantages: (1) to produce higher mab at a low cost, (2) easily to handle in lab, (3) conveniently to process and investigate the optimal conditions for different mab, and (4) readily to produce a larger - scale mab when necessary . Furthermore, the method makes it possible to produce mab as a putative process on an industrial scale, and to have obvious advantages, such as a high yield and a low cost.
Tobacco use is the leading cause of preventable death worldwide . Globally, each year, smoking kills nearly 6 million people and causes hundreds of billions of dollars of economic losses . A disproportionately higher number of individuals who succumb to the adverse effects of tobacco use reside in low and middle - income countries and this disparity is expected to widen further over the next several decades . Tobacco products contain the dried, processed leaves of the tobacco plant nicotiana rustica or nicotania tabacum, which is harmful to human health . Smoking costs over a lifetime for a man and for a woman have been reported as $106,000 and $220,000, respectively . Thus, the cost of cigarettes is an economic burden, not only to society, but also to the individual smoker and his / her family . Smoking causes coronary heart diseases, blood vessel constriction, and the nicotine there in stimulates adrenal epinephrine secretion, which increases blood pressure and heart rate . In addition, smoking is a leading cause of respiratory diseases such as emphysema, bronchitis, pneumonia and chronic airway obstruction by damaging the airways and alveoli of the lung . There is a direct relationship between the number of years of smoking and lung cancer . Tobacco users are at risk for several other types of cancers such as carcinoma of the upper respiratory tract, cervix, throat, larynx, mouth, pancreas, kidney, bladder and acute myeloid leukemia . In developed countries, mean smoking prevalence has been reported as 42% in men and 24% in women, while in less developed nations, an average of 48% of men and 7% of women smoke . In the u.s ., smoking prevalence is estimated at 28% and 23% for men and women, respectively . Forty percent of cubans smoke, as do 37% of kuwaitis, chileans, russians, belarusians and bangladeshis while only 6% of nigerians, 8% of salvadorans, and 8% of ghanaians smoke . High smoking rates have been recorded in the former soviet countries in the commonwealth of independent states (cis) (29%), central europe (29%), and the european union (28%). According to the 2001 national household survey on drug abuse, about 66.5 million americans reported past month use of a tobacco product, of which, 24.9% smoked cigarettes, while 5.4% used cigars, 1.0% smoked pipes, and 3.2% used smokeless tobacco . Data analyzed from the 1999 and 2000 national youth tobacco survey, which was conducted across u.s . One investigation conducted in tehran, iran, showed that the mean prevalence of smoking was 11.9%, of which 20.6% of the male and 2.9% of the female participants were smokers . These percentages increased significantly until age 54 . Additionally, married people, and individuals with higher education levels smoked more . Similarly, a subsequent report of adult smoking in tehran found that 21.3% of males and 3.4% of females were current smokers . According to a study done on a sample of 1,964 students from public and private universities in beirut, lebanon, most smoked narghile only (21.1%), while 7.6% smoked only cigarettes and 11.3% were dual users of both cigarettes and narghile . Smoking rates between iranian university students ranged from 7 - 52% with much higher usage among male students . For example, a study of 950 university students in kerman, iran revealed that approximately 40% of male students and 5.8% of the female students were smokers . Male gender, higher income, lower average exam scores, and a close friend's smoking were factors associated with increased likelihood of smoking cigarettes . The aim of this study was to compare the level of knowledge, the attitudes, and practices with regards to tobacco use between iranian engineering students at a pbu and an iau . This cross - sectional study was performed during 2011 . Considering the engineering student population at the two universities (iau, 6000 students; pbu, 2000 students). As the number of students at the iau was three times greater than that of the pbu, we randomly selected 150 students from the public university and 450 students from the iau using simple random sampling . Then we randomly selected students of different engineering disciplines to participate in the survey . A 57-item survey instrument originally developed by researchers at the indiana university school of dentistry to assess the tobacco knowledge, the survey questionnaire was composed of two sections; the first section included 33 tobacco knowledge and attitude items, while the second section included 28 questions about the demographic characteristics and the smoking history of the participants . The first 16 survey items related to tobacco knowledge; responses for these items were based on a 5-point scale (strongly agree, agree, neither agree nor disagree, disagree and strongly disagree). The second six questions represented attitude items; response choices were low, moderate and high . Other responses were coded as zero, so the maximum attitude score was 6, while the minimum was 0 . The demographic items (questions 35 - 37) included age, sex, and health status (self - explanatory). Between the remaining questions, because they had the same weighting, seven questions with dichotomous response choices were selected to represent the tobacco practices of respondents . The questionnaire was translated into persian and then translated into english and retranslated into persian by another group and the content validity of the questionnaire was confirmed . The reliability coefficient for the knowledge items using kuder richardson test for reliability was 0.706 and for attitude and practice items using cronbach's internal consistency coefficient were 0.702 and 0.735, respectively . This study was approved by research deputy of shiraz university of medical sciences . After obtaining oral informed consent research team members briefly introduced the survey, explained that the survey responses were voluntary and confidential, answered inquiries and distributed the surveys . The collected data were recorded by spss version 15 software and then it underwent statistical analysis using descriptive statistics and anova to compare the difference between means of knowledge, attitude and practice scores, also logistic regression analysis using a multivariable regression model to the data on tobacco smoking status, separately for pbu and iau students . In this study, in this study, 600 engineering students were participated and because of the replacement of potential participants who did not choose to complete the survey (by going to the next his / her classmate), response rate was 100% . The mean age of participants was 21 years in the iau and 23 years in the pbu . Demographic characteristics of study participants from engineering programs at two iranian universities among the engineering students, there were 33 (10%) out of 327 students who reported being daily smokers; of these, 84% were from the iau and 16% from pbu [table 2]. Totally, among the smokers, 61 (57%) and 29 (27.1%) of 107 were water pipe and cigarettes smokers, respectively [table 2]. Comparison of tobacco use by engineering students at a public and islamic azad universities of students reporting that they smoked at least 100 cigarettes in their lifetime, 10 (6.8%, n = 146) were from pbu and 49 (10.9%, n = 425) from iau students . Among the cigarette smoking students, 7 iau students smoked more than 31 cigarettes per day, while no pbu students reported smoking that much . At the other end of the spectrum, 36 (63.2%) out of 57 of iau students and 8 (66.7%) out of 12 of pbu students reported smoking less than 10 cigarettes per day [table 2]. Of those reporting water pipe smoking, the primary location for doing so was reported by 5.6% (34) of students as a teahouse, while 4.6% said a friend's residence was the primary location, 3.8% indicated hookah smoking at a relatives house, and 11.6% of students said that they smoked hookah primarily at locations other than these . The mean of knowledge, attitude and practices of the students according to the age group, health status and the residence categories is summarized in table 3 . The anova analysis indicated a significant difference regarding the mean of knowledge, attitude and practice according to the residence categories in the iau students (p <0.05). Comparing the mean scores of knowledge, attitude and practice scores between engineering students in both a public and islamic azad universities out of all respondents, ninety - three iau students (21.7%) and 30 pbu students (20.7%) reported smoking during the past 30 days . Only 60 iau students (20%, n = 299) and 16 pbu students (12.9%, n = 124) indicated an intention to quit smoking . Only 20 iau students (22.7%, n = 88) and 3 pbu students (15.7%, n = 19) indicated that they intend to quit smoking during the next 6 months . However, 41 iau students (19%, n = 215) and 7 pbu students (12.5%, n = 56) responded that they have tried to quit smoking during the last 2 years . One (6.7%) out of 15 pbu students and 10 (12.8%) out of 78 iau students reported that quitting smoking was s very difficult [table 2]. Table 4 shows the predictors of smoking status based on logistic regression model in the public university . Based upon logistic regression analysis, table 5 describes the predictors of smoking in engineering students at the iau in shiraz . Logistic regression analysis of smoking usage and predictors among engineering students of a public university logistic regression analysis of smoking usage and predictors among engineering students in azad islamic university compared to students who described their health status as excellent, smoking in 30 past days was 74 times greater in students describing their health status as poor . Compared to students who reported having no smoking friends, smoking at least 100 cigarettes in their lifetime was nearly 8 times greater for students who indicated that half of their friends smoke and 17 times greater for students who reported that most of their friends smoke . Compared with students who reported excellent health status, good, fair, and poor health status were predictors of smoking at least 100 cigarettes in their lifetime with odds 3, 6 and 36 times greater, respectively . Interestingly, among students who live in their own home away from their family, the odds of attempting to quit smoking during the 2 past years was nearly 3 times greater than for students who live in their hometown and with their family . Reported use of a water pipe at least twenty times was 10 times greater in students with poor health status and 3 times greater in students who lived in their own home away from their family . Reported difficulty in quitting among students who live in their hometown apart from their family was over 29 times greater than among students living with their family . Several investigations were conducted in different countries regarding the smoking behaviors and attitude among students in different fields of study . In the current study, we found that the prevalence of current tobacco consumption was approximately 21.5% and that tobacco use was more prevalent in men . Additionally, a study which was conducted with public and private university students in beirut, lebanon, revealed that the overall prevalence of smoking was 40%, and research from eskiehir, turkey found the prevalence of smoking was 42.5% . In 1993, a kuwaiti study was conducted concerning the age of smoking initiation among randomly selected male university students . The results showed that almost one tenth of the students initiated cigarette smoking between ages 16 and 17 with the rate of initiation increasing rapidly thereafter and reaching 30% by age 20 and nearly 50% by age 24 . In that study, the most important environmental risk factor positively associated with smoking initiation was sibling smoking . Compared to the medical and engineering students, students in other fields of study had a higher risk of smoking initiation; this differs from the current study in which the peak age of smoking initiation was between 16 and 20 years . This may be because at this age the curiosity, opposition of parents, presentation and transmission of sexual and physical maturation from childhood to youth is greater, so smoking is greater . Study, the highest prevalence of tobacco use in the current study was associated with water pipe (hookah) use . This was not surprising due to its ease of access and availability in nearly every teahouse . As there are few if any educational programs on the risks of tobacco use and available cessation methods in university engineering programs, as found in the current study, there is a tendency for this group of students to have higher levels of tobacco use . Knowledge score was almost a little higher than 50%, but attitude and behavior scores were almost 50%, which shows that despite a higher awareness of social programs in the media and other areas discussing the disadvantages of smoking, it did not affect the practices and attitude of students . The mean of the knowledge scores between the students was approximately equal in the female and male students in both universities . The attitude score was higher for males of the pbu than of the iau, while that of females was higher for females of the pbu than females of the iau . The approximately equal knowledge mean and attitude scores between the students of the two universities indicates that the governmental and social laws may be the most effective way of enhancing smoking knowledge and shaping attitudes among the iranian student population . Perhaps this is because for many iranian student smokers, smoking is more of a habit rather than a true addiction . This may also be due in part to the islamic culture and laws that discourage smoking because of its harmful effects on the body . Compared with male students at both universities, female students were less likely to report smoking or use of a water pipe . Among students of iau, smoking by friends and poor health status were predictors for current smoking or smoking at least 100 cigarettes in their lifetime; this finding was similar to other studies of this issue . However, in pbu, smoking by students in the past 30 days, or use of a water pipe at least twenty times was greater in students who allow visitors to smoke in their home . In iau, the predictors of use of water pipe use were poor health status and living in one's own home away from family . This study has several limitations; the design of this study was cross - sectional, so it limited the demonstration of risk factors for smoking . In addition, other factors likely affected respondents smoking such as: parental education, parental tobacco use, and psychological and socioeconomic factors, none of which were assessed in the survey . Another limitation is that, this study was conducted with university students so the results may not be generalizable to all youth in the community . Because data was obtained by self - report, there is a likelihood of under - reporting and social desirability bias . As a result of this study, some recommendations may be suggested for policy makers and future research . For example, future studies should assess the factors affecting smoking initiation, as well as effective techniques for the prevention of smoking initiation and substance abuse in iranian adolescents and young adults and on college campuses.
This injury is commonly associated with multiple lesions such as acetabular fractures, nerve palsy and femoral head fractures, due to its high energy trauma mechanism . Bilateral hip dislocation is an extremely rare finding, with very few cases reported in literature [2, 3]. Most are related to acetabular or proximal femoral fractures, consisting of complex lesions, and are rarely are pure ligamentous injuries . In the diagnosis of a dislocated hip, prompt reduction must follow to prevent future complications like avascular necrosis (avn) [1, 3]. The following case report consists in the presentation of a traumatic bilateral posterior hip dislocation without associated injuries . The patient is a 23-year - old female, with no comorbidities, who sustained bilateral hip pain after an automobile accident . At the time of the accident patient was driving her vehicle and the accident happened while the patient was driving and had her hips and knees in a flexed position, thus transmitting loads to the posterior aspect of the hips and forcing dislocation . Only mild head trauma and severe hip pain was reported by paramedics at the time she was primarily attended . She was referred to the emergency room unable to move her legs and had slight hip flexion with internal rotation . Physical examination revealed 20 hip flexion with 30 internal rotation, sensitivity and muscular strength were intact, pain was intensified when passive or active limb motion was attempted . Antero - posterior radiographs were taken, diagnosing bilateral posterior hip dislocation with no evidence of associated fractures (fig . 1). Computed tomography was realized to evaluate fractures and articular fragments and none were found (fig . An hour after initial evaluation, the patient was admitted to the operating room, under general anesthesia, and closed reduction of both hips was performed without incidents . Stability and range of motion was assessed, with normal findings; control x - rays showed concentric hip reduction of both femoral heads (fig . Physical therapy was initiated the first week with quadriceps and gluteal muscles isometric exercises and passive hip movements . At second week after 6 weeks follow - up the patient achieved a complete hip range of motion and walked without assistance . Figure1: patient with hip flexion and internal rotation and x - ray with traumatic bilateral posterior hip dislocation.figure 2:ct - scan show bilateral posterior hip dislocation without evidence of fracture or articular fragments.figure 3:after closed reduction - hip abduction and external rotation . 1: patient with hip flexion and internal rotation and x - ray with traumatic bilateral posterior hip dislocation . Ct - scan show bilateral posterior hip dislocation without evidence of fracture or articular fragments . After closed reduction - hip abduction and external rotation . The classification of traumatic hip dislocation is based of dislocation and the degree of joint disruption including any associated joint fracture . Three commonly used classifications systems are: the epstein classification of anterior hip dislocation, pipkin sub - classification an the thompson - epstein classification of posterior dislocation as in this case report . Simple injuries are dislocations without associated fractures, whereas complex injuries include either acetabular or proximal femoral fractures . Posterior dislocations represent the majority of these injuries, occurring due to an axial load of the femur, with the hip flexed and adducted . Usually, the axial load is transmitted through a flexed knee, as in dashboard injuries [3, 5, 6]. Anterior dislocations, in contrast, occur with the hip in abduction and external rotation, and the position of the femoral head can be either inferior or superior to the acetabulum . Motor vehicle accidents are the leading cause of hip dislocations, followed by falls from significant heights; sports related injuries have also been reported in literature [6, 7]. Bilateral simultaneous hip dislocations are an extremely rare injury, a reported 1.25% of all hip dislocations [3, 68]. These injuries are rarely present as isolated dislocations, and often associate fractures, usually of the acetabulum . These acetabular fractures frequently relate to the type of dislocation, posterior dislocation with posterior wall and column fractures and anterior dislocation with anterior wall fractures [1, 5, 7]. A patient with a dislocated hip usually presents acute pain and evident deformity, with an inability to tolerate active or passive range of motion . Of all, 95% of these patients have associated injuries, and for this reason an adequate trauma emergency evaluation must be realized in the moment of arrival, following the atls sequence of patient evaluation . A ct scan is also important, presence of intra - articular fragments needs to be discarded; this imaging also functions as means of postoperative follow up [3, 7, 8]. Soft tissue injuries such as avulsions of the labrum may be assessed by magnetic resonance imaging, but are not requested routinely . Heterotopic calcifications, avascular necrosis and osteoarthritis can also be evaluated with magnetic resonance imaging as part of the patient follow up . Treatment of hip dislocations can be either operative or nonoperative, but emergent reduction of the joint is of upmost importance . Delay in reduction of dislocated hip results in avascular necrosis in around 26% of patients . Early mobilization results in a prompt return to weight bearing, but the outcome and relationship with complications such as avascular necrosis is largely debated . Closed reduction of a posteriorly dislocated hip implies general anesthesia and an adequate positioning of the patient . Several techniques have been described, all of which include traction and counter - traction as part of the maneuver . Post reduction imaging studies must be performed to assess the quality of the reduction and presence of associated injuries that may have been neglected initially . Open reduction is performed in the case of an irreducible dislocation, a delayed presentation or articular fragments that make a concentric reduction impossible.
Several neuroimaging studies have investigated neural responses to art, aesthetic judgment and beauty (cela - conde et al ., 2004; kawabata and zeki, 2004; vartanian and goel, 2004). On the contrary, little is known about neuronal circuits engaged during observation of implied motion (i m) in a work of art . Recent studies using transcranial magnetic stimulation (tms) demonstrated that observation of i m in visual images and works of art, alongside with the activation of movement processing mt / v5 areas (david and senior, 2000; kourtzi and kanwisher, 2000), modulates primary motor cortex (m1) excitability as well as related intracortical inhibitory and excitatory circuits (battaglia et al ., 2011). It has been proposed that similar circuits encode implied and real motion processing in the onlooker . Consequently, the activation of the mirror neuron system has been indicated as a mechanism allowing an individual to extract dynamic information from a still image with i m (battaglia et al ., 2011; sbriscia - fioretti et al ., 2013; mirror neurons, first discovered in macaque monkey premotor and parietal cortices (gallese et al ., 1996), fire during both action observation and execution . Subsequently, brain stimulation and neuroimaging studies demonstrated a similar pattern of activation (mirror neuron - like activity) in the human brain (buccino et al . Recently, evidence has been presented supporting the facilitatory effects of action observation on congruent motor execution, motor learning (brass et al ., 2000) and cortical long - term potentiation (ltp)-like plasticity (lepage et al ., 2012; sale and mattingley, 2013). On the whole, these data support the hypothesis that action observation training might be used to augment traditional rehabilitation paradigms and speed the recovery of motor functioning (mulder, 2007). A recent meta - analysis suggests that the dorsal part of the premotor cortex, rather than the posterior inferior frontal gyrus and adjacent ventral premotor cortex, is consistently activated in functional magnetic resonance imaging studies of imitation (molenberghs et al ., 2009). Thus, it is conceivable that frontal regions which extend beyond the classical mirror neuron network are crucial for imitation . In healthy subjects, repetitive tms (rtms) studies have been used to investigate functional connectivity and plasticity between pmd and primary motor cortex (m1) (bumer et al . No studies have explored the effects of observation of i m in artistic images on the strength of pmd m1 connections . Since its first description in 1945 (adrian, 1945) art therapy has been shown to improve physical, mental health and social functioning in a variety of medical conditions (miller and hou, 2004; secker et al ., 2007). Therefore, the effects of art as a valuable adjunct to conventional rehabilitation should be evaluated with rigorous experiments . Given that current rehabilitation treatments are capable of changing brain connectivity and inducing functional reorganization (dimyan and cohen, 2011), the present study aims to provide evidence that observation of i m in a works of art can modulate neuroplasticity in fundamental motor circuits . This will further our understanding of the foundation underlying the use of art in rehabilitation . We studied 12 healthy volunteers (mean agestandard deviation, 328 years; 5 females). All participants were right - handed according to the edinburgh inventory 2550 (oldfield, 1971) and gave written informed consent to participate in the experiment according to the declaration of helsinki . The study was approved by the local ethics committees (new york college of podiatric medicine). During the experiment subjects were seated comfortably in an armchair with both arms relaxed and were instructed to keep their eyes open in front of a computer monitor . The electrophysiological experiments were performed either during the observation of a painting with i m or during observation of a static stimuli were presented on a computer monitor using the presentation software (neurobehavioral systems inc ., first the participants were instructed to focus their attention on the computer monitor (appearance of a plus sign in the center of the monitor). The videos of the paintings started after 5 sec and the images were presented continuously throughout the tms paradigms . For the i m condition we selected michelangelo s expulsion from paradise (sistine chapel, 15081512), with its depiction of the gesture which adam makes with his extended right hand to keep the sword - bearing angel at bay . For the no - im condition we selected michelangelo s creation of adam in which adam leans on his right forearm in a clearly static posture (sistine chapel, 15081512) (fig . The experiments were block randomized and there was an interval of 5 days between the blocks . Surface electromyography (emg) was recorded from the right extensor carpi radialis (ecr) muscle with disposable adhesive disk electrodes placed in a tendon - belly arrangement on the skin overlying the ecr muscle . The signal was amplified, filtered (bandpass 2 hz to 5 khz), digitized (micro 1401, cambridge electronics design, cambridge, uk) and stored in a laboratory computer for off - line analysis . Tms was performed with a standard figure - of - eight coil and magstim 200 stimulators (magstim co., whitland, uk). The coil was placed at the optimal position for eliciting meps from the right ecr muscle (hot spot). The coil was held tangentially to the skull with the handle pointing backwards and laterally at an angle of 45 to the sagittal plane . Thus, the electrical current induced in the brain was approximately perpendicular to the central sulcus . This orientation of the induced electrical field is thought to produce a predominantly transsynaptic activation of the corticospinal neurons (rothwell et al ., 1999). During the experiments emg activity was continuously monitored by visual (oscilloscope) and auditory (speakers) feedback to ensure complete relaxation . Resting motor threshold (rmt) was determined as the minimum stimulator intensity (to the nearest 1%) to produce an mep of 50 v in five of 10 trials . Mean peak - to - peak mep amplitudes were determined with 20 monophasic magnetic stimuli delivered to the motor hot spot of the ecr muscle at rate of 0.1 hz at a stimulation intensity of 120% rmt . Tms parameters were tested according to published guidelines for the use of tms in clinical neurophysiology (rothwell et al ., 1999). High and low frequency pmd were performed according to a previous described methodology (rizzo et al ., 2004). In brief, rtms was delivered using a standard figure - of - eight coil connected to a magstim rapid stimulator (magstim co.). First, we searched for the optimum site for stimulating the ecr motor hot spot and determined individual active motor threshold (amt). Amt was defined as the minimum stimulus intensity that produced a liminal motor evoked response (about 100 v in 50% of 10 trials). For pmd stimulation the 5-hz rtms session consisted of five trains of 300 stimuli separated by an intertrain interval of 1 min (10 min in total). The 1-hz rtms session consisted of five trains over the left pmd, 300 stimuli each, with a pause of 1 min between train . The intensity of premotor rtms was set at 90% of amt because this is the optimum intensity to modulate cortical excitability in ipsilateral m1 (gerschlager et al ., 2001). The stimulation intensity was matched during the two experimental conditions in order to obtain an mep of 0.40.5 mv . We recorded ten meps at baseline, 15, and 30 min after conditioning (t15 and t30). In an additional experiment subjects were required to observe the movement for 20 min; we then tested the effect of 5-hz pmd conditioning protocol on mep amplitude . In this way the stimulation protocols were in accordance with published safety guidelines for rtms (wassermann, 1998). Rmt, amt, and mep amplitude recorded during observation of i m and no - im were analyzed with analysis of variance (anova) (main effects condition). The effects of 5- and 1-hz rtms conditioning on pmd m1 connectivity and plasticity were assessed using a mixed model repeated - measure design with main effect time as within subject (three levels t0, t15, t30); main effect stimulation (two levels, 5- and 1-hz rtms) and condition (two levels, i m and no - im) as between subjects factors . A greenhouse geisser correction was used when appropriate . When an f value was significant, post hoc paired - sample t - tests were performed . We studied 12 healthy volunteers (mean agestandard deviation, 328 years; 5 females). All participants were right - handed according to the edinburgh inventory 2550 (oldfield, 1971) and gave written informed consent to participate in the experiment according to the declaration of helsinki . The study was approved by the local ethics committees (new york college of podiatric medicine). During the experiment subjects were seated comfortably in an armchair with both arms relaxed and were instructed to keep their eyes open in front of a computer monitor . The electrophysiological experiments were performed either during the observation of a painting with i m or during observation of a static stimuli were presented on a computer monitor using the presentation software (neurobehavioral systems inc ., first the participants were instructed to focus their attention on the computer monitor (appearance of a plus sign in the center of the monitor). The videos of the paintings started after 5 sec and the images were presented continuously throughout the tms paradigms . For the i m condition we selected michelangelo s expulsion from paradise (sistine chapel, 15081512), with its depiction of the gesture which adam makes with his extended right hand to keep the sword - bearing angel at bay . For the no - im condition we selected michelangelo s creation of adam in which adam leans on his right forearm in a clearly static posture (sistine chapel, 15081512) (fig . The experiments were block randomized and there was an interval of 5 days between the blocks . Surface electromyography (emg) was recorded from the right extensor carpi radialis (ecr) muscle with disposable adhesive disk electrodes placed in a tendon - belly arrangement on the skin overlying the ecr muscle . The signal was amplified, filtered (bandpass 2 hz to 5 khz), digitized (micro 1401, cambridge electronics design, cambridge, uk) and stored in a laboratory computer for off - line analysis . Tms was performed with a standard figure - of - eight coil and magstim 200 stimulators (magstim co., whitland, uk). The coil was placed at the optimal position for eliciting meps from the right ecr muscle (hot spot). The coil was held tangentially to the skull with the handle pointing backwards and laterally at an angle of 45 to the sagittal plane . Thus, the electrical current induced in the brain was approximately perpendicular to the central sulcus . This orientation of the induced electrical field is thought to produce a predominantly transsynaptic activation of the corticospinal neurons (rothwell et al ., 1999). During the experiments emg activity was continuously monitored by visual (oscilloscope) and auditory (speakers) feedback to ensure complete relaxation . Resting motor threshold (rmt) was determined as the minimum stimulator intensity (to the nearest 1%) to produce an mep of 50 v in five of 10 trials . Mean peak - to - peak mep amplitudes were determined with 20 monophasic magnetic stimuli delivered to the motor hot spot of the ecr muscle at rate of 0.1 hz at a stimulation intensity of 120% rmt . Tms parameters were tested according to published guidelines for the use of tms in clinical neurophysiology (rothwell et al ., 1999). High and low frequency pmd were performed according to a previous described methodology (rizzo et al ., 2004). In brief, rtms was delivered using a standard figure - of - eight coil connected to a magstim rapid stimulator (magstim co.). First, we searched for the optimum site for stimulating the ecr motor hot spot and determined individual active motor threshold (amt). Amt was defined as the minimum stimulus intensity that produced a liminal motor evoked response (about 100 v in 50% of 10 trials). For pmd stimulation the 5-hz rtms session consisted of five trains of 300 stimuli separated by an intertrain interval of 1 min (10 min in total). The 1-hz rtms session consisted of five trains over the left pmd, 300 stimuli each, with a pause of 1 min between train . The intensity of premotor rtms was set at 90% of amt because this is the optimum intensity to modulate cortical excitability in ipsilateral m1 (gerschlager et al ., 2001). The stimulation intensity was matched during the two experimental conditions in order to obtain an mep of 0.40.5 mv . We recorded ten meps at baseline, 15, and 30 min after conditioning (t15 and t30). In an additional experiment subjects were required to observe the movement for 20 min; we then tested the effect of 5-hz pmd conditioning protocol on mep amplitude . In this way the stimulation protocols were in accordance with published safety guidelines for rtms (wassermann, 1998). Rmt, amt, and mep amplitude recorded during observation of i m and no - im were analyzed with analysis of variance (anova) (main effects the effects of 5- and 1-hz rtms conditioning on pmd m1 connectivity and plasticity were assessed using a mixed model repeated - measure design with main effect time as within subject (three levels t0, t15, t30); main effect stimulation (two levels, 5- and 1-hz rtms) and condition (two levels, i m and no - im) as between subjects factors . A greenhouse geisser correction was used when appropriate . When an f value was significant, post hoc paired - sample t - tests were performed . Rmt and amt recorded in the right ecr muscle did not differ between conditions (rmt: i m, 41%3.6%; no - im, 40.1% 2.8%, f [1, 22]=0.9, p=0.8; amt: i m, 32.2%2.7%; no - im, 33.7%3.2%; f [1, 22]=1.1; p=0.9). Observation of the picture with i m induced an increase in mep size (i m, 0.820.04 mv; no - im, 0.610.038 mv; f [1, 22]=7.2; p=0.006) (data not showed). Regarding the pmd m1 connectivity and plasticity paradigm, three - way repeated measure anova yielded a significant main effect of stimulation (f [1, 44]=7.4, p<0.009) and time (f [1, 44]=7.5, p<0.001) without a stimulation x condition x time interaction (f [2, 88]=2.5, p<0.08). The assumption of sphericity was not violated . Post hoc analysis indicated that meps recorded 15 and 30 min after pmd conditioning were significantly different from baseline (p=0.005 and p=0.0004, respectively). We then performed paired samples t - tests follow - up analysis to ascertain the effect of 5- and 1-hz rtms pmd on meps recorded during observation of i m and no - im . The 5-hz rtms paradigm increased meps amplitude during both i m and no - im condition compared to t0 (i m: t15 [p=0.00 02], t30 [p=0.001]; no - im: t15 [p=0.001], t30 [p=0.004]). Furthermore, there was no difference in baseline mep amplitude between the two condition (f [1, 22]=1.1, p=0.3) (fig . Similar results were obtained in a control experiment using a longer exposure to the conditions (total duration 25 min) (i m: to, 0.78 0.03 mv; t15, 1.360.05 mv; t30, 1.120.05 mv; no - im: to, 0.820.04 mv; t15, 1.290.05 mv; t30, 1.360.04 mv (main effect condition f [2, 28]=28.2, p<0.0001; condition x time interaction: f [2, 44]= 2.01, p=0.31) (data not showed). On the contrary, the 1-hz rtms conditioning decreased meps amplitude only during the i m condition compared to t0 (i m; t15 [p=0.01], t30 [p=0.008]; no - im: t15 [p=0.8], t30 [p= 0.4]) (fig . 3). On the whole, the data indicate that observation of i m in a work of art modulated connectivity and plasticity of pmd m1 inhibitory circuits . In this study we investigated whether i m information from a static image of a painting affects cortical excitability, connectivity and plasticity . Our results demonstrated that observation of an image with i m increases mep size . Furthermore, using rtms, we showed that i m in a work of art modulates pmd first we replicated earlier findings indicating that mep amplitude increases upon observation of pictures with i m (battaglia et al ., 2011; urgesi et al ., 2006). This suggests that motor resonance to i m in paintings might be due to the activation of mirror neuron / action observation - execution and motor imagery networks (battaglia et al ., 2011). Furthermore, using a well - characterized paradigm to explore functional connectivity and plasticity (mnchau et al ., 2002; passingham, 1985; rizzo et al ., 2004), our results revealed that long - term decrease in mep amplitude induced by 1-hz rtms pmd conditioning are prevented during observation of a painting with i m . Thus, i m observation facilitates pmd m1 functional connectivity through a specific effects on inhibitory connections . Pmd is not considered part of the mirror system in humans and primates (rizzolatti and craighero, 2004). Furthermore, pmd neurons play a pivotal role in externally cued arm movements (wise, 1985) and exhibits similar activity patterns during both action observation, motor imagery and performance (cisek and kalaska, 2004; szameitat et al ., 2007). In addition, single - unit activity within both m1 and pmd is similar during observation and execution of a familiar task (tkach et al ., 2007). It is noteworthy that our findings do not imply the presence of classical mirror neurons in pmd but rather illustrate a modulation of the pmd . However, some words of caution are required when interpreting the proposed sequence of effective connectivity networks during processing of i m in a painting . Pmd is part of a rather large frontoparietal network that transforms sensory information into actions (chouinard et al ., 2003; it has been reported that 1-hz rtms of the left pmd induces compensatory excitatory activity in both contralateral and ipsilateral hemisphere (oshea et al ., 2007). It is thus conceivable that plastic changes induced by observation of a painting with i m might take place in a more extensive connectivity network still to be investigated . Our results are in accordance with previous findings reporting modulation of premotor - motor connectivity during movement observation . Observation of whole hand grasp and precision grip modulate ventral - premotor m1 connectivity probed with a paired - pulse paradigm (davare et al ., 2008; koch et al ., 2010). By using a different paradigm we showed that observation of i m in a work of art induces a similar modulation in a different subregion of premotor cortex . It has been suggested that it may be related either to long - term depression / ltp (chen et al ., 1997) and/or changes of cortical excitability (touge and takeuchi, 2001). It is likely that the after - effects induced by pmd rtms conditioning are linked to long - lasting changes in synaptic efficacy rather that changes in membrane resting potential (rizzo et al ., 2004). M1 connectivity is particularly relevant for motor recovery and residual motor output after stroke (fridman et al ., 2004; johansen - berg et al ., 2002) and successful rehabilitative treatments are associated with strengthening of these connections (rehme et al ., 2012). Hence, our results further point toward the use of art with i m as plasticity - based intervention in rehabilitation . Future studies are needed to investigate whether observation of paintings with i m movements induces a similar modulation in intrinsic m1 inhibitory circuits recruited with m1 1-hz rtms conditioning . We would be the first to acknowledge that factors such as expertise in art, prior exposure, individual temperament and particular psychological traits can influence the aesthetic and emotional responses to the artwork . Moreover, it is clear that the extraction of dynamic information from still images entails visual perception, association of the represented form with an action and mental imagery . Thus, individual mental imagery abilities and personal memories of the execution of an action might have affected neural responses to i m (mizokami et al ., 2014). Limitations like these will need to be addressed in future studies in order to ascertain the degree to which our finding might be generalized to other forms of dynamic art (abstract vs. figurative art, different artists and periods, stylistic and structural properties, emotional content). The fact that our results highlight a complex modulation of premotor - motor networks during observation of a painting with i m support the hypothesis that observation of art might be used to augment traditional rehabilitation paradigms and speed the recovery of motor functioning.
The conventional methods used in clinical practice for guiding contact selection during occlusal adjustment are using articulation paper, impression waxes and shim - stock foil, which are all often combined with the patient's occlusal " feel " feedback . None of these listed static dental materials' methods has demonstrated the capability to quantify occlusal forces . The use of articulation paper is the most commonly used method to determine excessive force in differing occlusal contacts . Patients occlude upon strips of articulation paper that leave behind various ink markings on the tooth surface . Published studies about articulation paper are analyses of physical properties themselves (thickness, composition, ink substrate and plastic deformation).1 - 3 but, no scientific evidence that shows articulation paper mark size, or mark appearance characteristics, can accurately describe varying occlusal loads exists.4,5 additionally, " subjective interpretation " is required by the operator, to determine which contacts are forceful and which are not.6,7 studies conducted on mounted epoxy casts that were subjected to varying applied occlusal loads, suggested that there is no direct relationship between paper mark area (size) and applied occlusal load.4,5 additionally, when articulating paper is employed intraorally, it is subject to fragmentation and perforation during patient intercuspations, showing that its' marking repeatability is poor.8 despite this lack of scientific evidence, it has been repeatedly advocated in textbooks on occlusion that mark area is representative of the load contained within the mark.9 - 14 alternatively, digital occlusal analysis has been shown to consistently measure relative occlusal forces in highly repeatable fashion.15 the t - scan iii computerized occlusal analysis system (software version 7.0, tekscan inc . South boston, ma, usa) uses an electronically - charged, mylar - encased recording sensor (high - definition generation iv sensor, tekscan inc . S. boston, ma, usa) that is scanned in 0.003 second time - increments, to acquire occlusal contact relative force variances, excessively forceful tooth contacts, and occlusal contact timing sequences.16,17 the recording sensor is placed intraorally between the dental arches, to capture real - time occlusal force and time - sequence data, when a subject intercuspates, or makes excursive movements, across its' recording surface . The software processes the occlusal data of any recorded occlusal event for graphical display in 2 and 3 dimensions (fig . 1). The recorded occlusal force data offers the operator improved information about occlusal contact locations that demonstrate excessive occlusal force, when compared to the highly subjective method of " judging " paper mark size appearance characteristics . The purpose of this in - vivo study was to determine whether a direct relationship exists between the size of articulation paper marks and the degree of applied occlusal force percentage observed on the same tooth . The study examined how frequently the largest, the most prominent paper mark observed in a quadrant of paper markings, described the most forceful tooth . Sixty intra oral photographs of dental articulating paper marks made in the maxillary posterior quadrants of 30 female dental hygienists, age 20 - 25 years old, were compared to corresponding patient t - scan iii multi - bite occlusal contact force data recordings . The institutional review board at korea university guro hospital approved this study protocol . Prior to an individual subject's participation, each subject was given instructions that explained the study protocol, and had the opportunity to ask questions about the protocol, so as to accept or reject their participation in the study . The inclusion criteria for the subjects were: class i angles' classification with normal occlusal relationspresence of existing anterior tooth contactpresence of healthy non - crowned premolars in the maxillary arch with contacting lower counterpartspresence of healthy first and second non - crowned molars in the maxillary arch with contacting lower counterparts class i angles' classification with normal occlusal relations presence of existing anterior tooth contact presence of healthy non - crowned premolars in the maxillary arch with contacting lower counterparts presence of healthy first and second non - crowned molars in the maxillary arch with contacting lower counterparts exclusion criteria were: presence of an anterior open occlusionpresence of a class ii and iii malocclusionpresence of a deep overbitepresence of chronic bruxismpresence of tmd symptomotologypresence of healthy non - crowned premolars present in the maxillary archabsence of healthy first and second non - crowned molar present in the maxillary archabsence of contacting lower molar and premolar counterpartspresence of orthodontic appliances presence of an anterior open occlusion presence of a class ii and iii malocclusion presence of a deep overbite presence of chronic bruxism presence of tmd symptomotology presence of healthy non - crowned premolars present in the maxillary arch absence of healthy first and second non - crowned molar present in the maxillary arch absence of contacting lower molar and premolar counterparts presence of orthodontic appliances the presence or absence of third molar was not a criteria considered in the study . Edgewood, ny, usa) was smeared with a thin layer of petroleum jelly (vaseline petroleum jelly, johnson and johnson, langhorne, pa, usa) prior to its' use so as to improve the visualization of the markings of the contact points that existed in a subject's intercuspal position . The articulating paper was held intraorally with miller forceps while the subject tapped their teeth together firmly through the articulation paper 5 times in succession . Each subject was instructed to attempt to generate their perceived maximum occlusal force while tapping thrrough the articulation strips . Standardized photographs were taken of the markings for later comparison to the occlusal force data obtained from the same subject's t - scan iii multi - bite recordings . All photographs were taken with a digital slr camera (nikon d700, nikon inc ., melville, ny, usa) in manual mode, with a fixed focal length of 105 mm, an aperture of f14, and a shutter speed of 1/125 second . The camera sat on a tripod placed 210 cm away from an intraoral mirror that was positioned parallel to the maxillary teeth, with dental chair consistently set maximum vertically down, and fully reclined to the near horizontal . This procedure repeatedly aligned the photographic mirror with camera, such that the photographic technique used between all subjects was standardized . A freehand sketcher (adobe photoshop cs4, san jose, ca, usa) was used to magnify and calculate the paper mark surface area in photographic pixels, of the largest and most prominent articulation paper mark found in a marked quadrant . The software was used to magnify the markings so that the freehand sketcher could be used to trace the boundry of the paper mark . The largest mark was outlined using the software outline sketcher command, which accessed the number of pixel count within the enclosed boundry (the freehand sketcher automatically calculates the number of pixels enclosed within the outlined area). The tooth and the contact location of the largest paper mark in a quadrant were recorded in a spreadsheet for future data analysis (microsoft office excel 2003, microsoft corp . The central incisor width of each subject was measured utilizing a digital caliper, so as to customize the graphical dental arch to properly mimic the subject's dental arch dimensions . Other relevant tooth details (the presence of crowns, bridges and presence or absence of 3 molar) were included within each subject's custom arch, as well . As per the manufacturer's recommendation, prior to any occlusal force data being acquired from each subject, the recording sensitivity level was adjusted to fit the bite force of the patient . This was accomplished by increasing or decreasing the amount of the electric charge supplied to the sensor . Proper sensitivity is selected by limiting the number of red / pink high - force columns / contacts observed in the graphical display, to a maximum of 3 during pre - recording test conditions . Each subject was then asked to occlude into and through the recording sensor once again, to hold their teeth firmly intercuspated together for 1 - 2 seconds, before twice more repeating that same firm intercuspation twice more followed by a 1 - 2 second intercuspated hold . These " multi - bite recordings " contained 3 intercuspations, made in succession . This 3-closure recording technique insures that at least one maximum force closure was obtained from each subject . Within the force versus time graph (fig . 2), the most forceful closure was chosen from where in the recording, the total force curve (the rising black line visualized over the red and green lines) reached near - maximum occlusal force percentage . In fig . 3, the first closure of the 3 " bites " contained the most total force . The total force curve of the second and third closures reached only 60% of the total force that closure #1 generated . The vertical " time cursor " was then placed at the 100% point of the total force curve . This determined the corresponding force distribution present within the 2-dimensional force playback window representing the intercuspated, 100% point . The posterior tooth force percentage distribution was then compared to the paper mark photograph of the same subjects' corresponding articulating paper marks (fig . Data analysis was accomplished by placing the relative occlusal force distribution data side - by - side with the counterpart photograph of the articulating paper marks (fig . When the largest paper mark (measured in surface area of pixels) demonstrated the highest relative force on the same tooth in that quadrant, it was considered to be a " match " . When the tooth with the largest paper mark did not demonstrate the largest force on that same tooth, it was considered to be a " no match " . An example of how this matching procedure was performed, can be seen in fig . 4 . The largest paper mark in right posterior quadrant is on iso tooth #15 (universal tooth #4) with the force percentage totaling 6% . Here, the largest mark and highest force percentage did not match, because iso tooth #17 (universal tooth #2) demonstrates 21% of the force . Alternatively, the largest mark in second quadrant is on iso tooth #26 (universal tooth #14), while the highest force in the quadrant can be observed on the same tooth (27%). In this case, the largest mark did match the tooth with highest force . The " matches " and " no matches " were then tabulated for statistical analysis assessing the frequency of the matches to the no matches . A regression analysis was performed, using the jmp 5.0.1 software (sas institute, usa) which revealed a bivariant fit of force percentage per tooth . Edgewood, ny, usa) was smeared with a thin layer of petroleum jelly (vaseline petroleum jelly, johnson and johnson, langhorne, pa, usa) prior to its' use so as to improve the visualization of the markings of the contact points that existed in a subject's intercuspal position . The articulating paper was held intraorally with miller forceps while the subject tapped their teeth together firmly through the articulation paper 5 times in succession . Each subject was instructed to attempt to generate their perceived maximum occlusal force while tapping thrrough the articulation strips . Standardized photographs were taken of the markings for later comparison to the occlusal force data obtained from the same subject's t - scan iii multi - bite recordings . All photographs were taken with a digital slr camera (nikon d700, nikon inc ., melville, ny, usa) in manual mode, with a fixed focal length of 105 mm, an aperture of f14, and a shutter speed of 1/125 second . The camera sat on a tripod placed 210 cm away from an intraoral mirror that was positioned parallel to the maxillary teeth, with dental chair consistently set maximum vertically down, and fully reclined to the near horizontal . This procedure repeatedly aligned the photographic mirror with camera, such that the photographic technique used between all subjects was standardized . A freehand sketcher (adobe photoshop cs4, san jose, ca, usa) was used to magnify and calculate the paper mark surface area in photographic pixels, of the largest and most prominent articulation paper mark found in a marked quadrant . The software was used to magnify the markings so that the freehand sketcher could be used to trace the boundry of the paper mark . The largest mark was outlined using the software outline sketcher command, which accessed the number of pixel count within the enclosed boundry (the freehand sketcher automatically calculates the number of pixels enclosed within the outlined area). The tooth and the contact location of the largest paper mark in a quadrant were recorded in a spreadsheet for future data analysis (microsoft office excel 2003, microsoft corp . The central incisor width of each subject was measured utilizing a digital caliper, so as to customize the graphical dental arch to properly mimic the subject's dental arch dimensions . Other relevant tooth details (the presence of crowns, bridges and presence or absence of 3 molar) were included within each subject's custom arch, as well . As per the manufacturer's recommendation, prior to any occlusal force data being acquired from each subject, the recording sensitivity level was adjusted to fit the bite force of the patient . This was accomplished by increasing or decreasing the amount of the electric charge supplied to the sensor . Proper sensitivity is selected by limiting the number of red / pink high - force columns / contacts observed in the graphical display, to a maximum of 3 during pre - recording test conditions . Each subject was then asked to occlude into and through the recording sensor once again, to hold their teeth firmly intercuspated together for 1 - 2 seconds, before twice more repeating that same firm intercuspation twice more followed by a 1 - 2 second intercuspated hold . This 3-closure recording technique insures that at least one maximum force closure was obtained from each subject . Within the force versus time graph (fig . 2), the most forceful closure was chosen from where in the recording, the total force curve (the rising black line visualized over the red and green lines) reached near - maximum occlusal force percentage . In fig . 3, the first closure of the 3 " bites " contained the most total force . The total force curve of the second and third closures reached only 60% of the total force that closure #1 generated . The vertical " time cursor " was then placed at the 100% point of the total force curve . This determined the corresponding force distribution present within the 2-dimensional force playback window representing the intercuspated, 100% point . The posterior tooth force percentage distribution was then compared to the paper mark photograph of the same subjects' corresponding articulating paper marks (fig . Data analysis was accomplished by placing the relative occlusal force distribution data side - by - side with the counterpart photograph of the articulating paper marks (fig . When the largest paper mark (measured in surface area of pixels) demonstrated the highest relative force on the same tooth in that quadrant, it was considered to be a " match " . When the tooth with the largest paper mark did not demonstrate the largest force on that same tooth, it was considered to be a " no match " . An example of how this matching procedure was performed, can be seen in fig . 4 . The largest paper mark in right posterior quadrant is on iso tooth #15 (universal tooth #4) with the force percentage totaling 6% . Here, the largest mark and highest force percentage did not match, because iso tooth #17 (universal tooth #2) demonstrates 21% of the force . Alternatively, the largest mark in second quadrant is on iso tooth #26 (universal tooth #14), while the highest force in the quadrant can be observed on the same tooth (27%). In this case, the " matches " and " no matches " were then tabulated for statistical analysis assessing the frequency of the matches to the no matches . A regression analysis was performed, using the jmp 5.0.1 software (sas institute, usa) which revealed a bivariant fit of force percentage per tooth . The results showed that largest paper mark in each quadrant was matched with the highest force tooth in the quadrant only 38.3% of time . Regression analysis showed a bivariate fit of force% on tooth by pixels, with p value of 0.0063 (p<.05) (fig . When relating the largest paper mark per quadrant (t = 240), the correlation coefficient between the mark area and the percentage of force was calculated as 0.259, which indicates a low positive correlation between the occlusal force percentage and the mark's surface area . Squaring the correlation coefficient produces the coefficient of determination (r = 0.067) between the surface area and force . The amount of the applied force that actually contributed to the observed mark area in this study was only 6 2/3%, which means only about 7% of the paper mark area can be explained by force . The findings of this study are in accordance with the findings of other studies that previously attempted to correlate occlusal force to paper mark size.4,5 it has been repeatedly shown that the characteristics of paper mark appearance do not describe the amount of occlusal force present on a given tooth . 5 graphs the " mark area versus relative force, " which includes the regression line . The wide dispersion of the data illustrates the low value of the coefficient of determination . Very few points are on top of, or near the regression line, with most points being far away from it . If a high correlation between mark area and relative force had been observed, the data points would all have been be clustered around the regression line . Additionally, with most of the points being randomly distributed above and below the regression line, this graph suggests that a higher order correlation is unlikely . Out of a possible 240 posterior teeth analyzed, the largest paper mark and occlusal force corresponded 23 times, with the highest relative force on that same tooth . These findings illustrate a low correlation of 38.3% between the mark surface area and force percentage, and a causative relationship of 6 2/3% when using the coefficient of determination (r = 0.067). The remaining 93% of the paper mark surface area that is made when articulating paper labels tooth contacts most likely results from occlusal surface morphology . When large flat surfaces oppose each other (like in areas of wear faceting) large marks are likely to appear because of the broad surface contact the opposing occlusal surfaces share . Conversely, when a sharp pointy surface opposes a flat surface, or another sharp pointy surface, a small mark is likely to result . Tooth morphology then, is likely the overriding factor in what forms the actual paper mark surface area; not the applied occlusal force . This can explain why a large mark can have a low force associated with it, and a small mark can have a much higher force associated with it . These findings have significant clinical implications because, if an operator assumes that the largest paper mark is representing the most occlusal force during an occlusal adjustment procedure, the operator will likely choose the wrong tooth to treat for most of the time . Under the study conditions where 4 teeth were marked and measured per quadrant, a random relationship should produce a value of 25%, where the largest mark and the most force percentage should occur on the same tooth 25% of the time, purely by chance . The finding of 38.3% agreement is not much better than what would occur by chance alone . This low agreement suggests that operators require a high force contact selection method that is more reliable than is the observing the size of paper markings . With the overwhelming evidence present in the dental literature that the characteristics of paper mark appearance do not reliably indicate occlusal force,1 - 8 for dental medicine educators and authors to continue to teach and/or publish that mark appearance does indicate occlusal force, is clearly problematic for patient care . Evidence - based practice requires that operators use sound, scientifically - based procedures to properly implement patient care . Choosing forceful tooth contacts utilizing paper mark appearance as a guide is, at best not evidence - based, and at worst, highly error - prone . Operators routinely " judge " articulating paper mark appearance characteristics to select forceful contacts for corrective treatment . With the largest mark indicating the most forceful tooth only 38% of the time, a dentist would be choosing the wrong tooth at least 62% of the time . Clearly, a better method of clinical occlusal force measurement is warranted for the quality of patient care for the human condition because the findings of this study suggest that if the operator uses the largest articulation paper mark as a guide to select the most forceful tooth, it will be an inaccurate method of making occlusal adjustments . It is the opinion of this author, that enough studies exist which contradict the longstanding paper mark force " myths " related to paper mark size, that educators and authors should cease to perpetuate these myths . Although the subjects were instructed to intercuspate vertically during both the paper marking, and the occlusal force recording procedures, angular occlusal forces may also have been present, that would elevate the force level above what the measured largest mark alone, contributed . Additionally, the tooth with highest relative force percentage often had multiple contacts, elevating its force percentage above the level of the tooth which may have had the largest single paper mark . These differing conditions could conceivably partially cancel each other out during measurement, despite both being present within the same quadrant . The findings of this study indicate that size of articulation paper mark is not an accurate indicator to employ in the selection of tooth contacts for occlusal adjustment treatment . If an operator assumes that the largest paper mark represents the most forceful contact, he / she may likely choose the wrong teeth to adjust, a significant majority of the time . However, employing a non - subjective, quantifying occlusal indicator like computerized occlusal analysis, to guide the selection of tooth contacts for occlusal adjustment treatment, may produce more comprehensive and evidence - based results.
Fc gamma receptor iib (fcriib), which is expressed on b cells, as well as other antigen (ag) presenting cells (apc), is the only fc gamma receptor (fcr) known to negatively regulate the immune response and play an important role in b - cell regulation and antibody (ab) production [17]. Ag - specific ab generated in response to infection, immunization, or the administration of fcr - targeted vaccines, when complexed with ag, has the potential to interact with fcriib and significantly downmodulate immunity and protection against infectious agents . Importantly, fcriib is also expressed on dendritic cells (dcs) and macrophages and can negatively regulate cellular as well as humoral immunity [13, 6, 8]. Consistent with the regulation of cellular immunity, it has been demonstrated that utilizing a mycobacterium tuberculosis (mtb) model in which nave wildtype (wt) and fcriib knockout (ko) mice received an aerosol challenge of mtb, fcriib ko mice exhibited an enhanced cellular immune response compared to their wt counterparts, which included increased ifn- production . In another study, following staphylococcus aureus (sa) infection, nave fcriib ko mice were better protected against a primary intravenous infection with sa . However, in contrast to the above results using nave mice, if fcriib ko mice were first immunized with a pneumococcal vaccine and then challenged with high doses of streptococcus pneumoniae, mortality rates were increased above that of wt mice, correlating with increased proinflammatory cytokine production . Yet, in another study in which plasmodium berghei parasitemia was induced postimmunization, parasitemia was not impacted following intradermal immunization of fcriib ko versus wt mice with a plasmodium berghei vaccine . Thus, while enhanced immunity and/or protection against infection was observed in nave fcriib ko versus wt mice, the absence of fcriib had either negative or no impact on immunity and/or protection following immunization . To further clarify the role of fcriib in the generation of protective immunity against infection, we investigated the impact of fcriib on f. tularensis (ft) challenge before and after immunization with inactivated ft (ift) in wt versus fcriib ko mice . Ft is a gram - negative intracellular pathogen that in designated a category a biothreat agent due to its extreme virulence [1315]. Based on the published studies cited above using nave fcriib ko mice [911], we hypothesized that nave mice challenged with ft would be better protected in the absence of fcriib . In contrast, based on the published studies above using immunized fcriib ko mice [11, 12], we predicted a negative or very limited impact of the absence of fcriib on survival following ft - challenge of ift - immunized fcriib ko versus wt mice . In fact, the opposite was observed in the case of both nave and ift - immunized mice . Specifically, there was no difference in survival of nave fcriib ko versus wt mice challenged with ft . In contrast, in the case of ift - immunized fcriib ko versus wt mice, protection was significantly improved in fcriib ko mice . The latter correlated with enhanced ft - specific iga production in vivo, enhanced recall responses in the form of increased ifn- production by ex vivo splenocytes incubated with ift, and reduced in vivo proinflammatory cytokine production 5 days after challenge . Thus, these studies demonstrate for the first time that the presence of fcriib can significantly dampen immunity and protection against infection following immunization . These are also the first studies to suggest a role of fcriib in the regulation of ag - specific iga production . (manassas, va) into which was added 10% heat inactivated fetal bovine serum (fbs) (hyclone thermo scientific, south logan, utah), 1% pen / strep (hyclone thermo scientific, south logan, utah), 5 ml of 200 mm glutamine (100x) (cellgro mediatech inc ., manassas, va), 5 ml of 100 mm sodium pyruvate (100x) (gibco invitrogen, grand island, ny), 5 ml nonessential amino acids (aa) (100x) (cellgro mediatech inc ., manassas, va), and 250 l of 0.1 m 2-mercaptoethanol (2-me) (bio - rad, hercules, ca). Media was then filter sterilized with a 0.22 m filter and stored at 4c . Ft - live vaccine strain (lvs) was utilized in these studies and was cultured in mueller hinton broth (mhb) medium consisting of 490 ml of distilled, deionized cell culture grade water (cellgro mediatech inc ., manassas, va), 10.5 g mhb (becton dickinson, sparks, maryland), 0.069 g anhydrous calcium chloride (acros organics, nj), 0.105 g hydrous magnesium chloride (hexahydrate) (mp biomedicals, solon, oh), 5 ml of glucose (sigma - aldrich, st . Louis, missouri), 5 ml of ferric pyrophosphate (sigma - aldrich, st . Louis, missouri), and 10 ml isovitalex (becton dickinson, sparks, maryland). Mhb media was adjusted to a ph of 6.8, filtered (0.22 m), and stored at 4c for up to two weeks . Red blood cell (rbc) lysis buffer contained 4.13 g of ammonium chloride (sigma - aldrich, st . Louis, missouri), 0.5 g of potassium bicarbonate (sigma - aldrich, st . Louis, missouri), and 18.5 mg of edta (sigma - aldrich, st . The ph of the solution was adjusted to 7.2, after which the solution was filter - sterilized using a 0.22 m filter and stored at 4c . Spleens were isolated from mice and passed through a 70 m cell strainer (fisherbrand, houston, tx). The single cell suspension was collected in a sterile petri dish containing approximately 3 to 5 ml of media . The cell suspension was washed and rbcs were lysed using a rbc lysis buffer . The cell suspension was then passed through a second 70 m cell strainer (fisherbrand, houston, tx) and collected in a 50 ml conical centrifuge tube containing approximately 10 ml of media . Cells were spun for 5 minutes at 1500 revolutions per minute (rpm) and resuspended in rbc lysis buffer . After 3 to 5 minutes (min), the reaction was quenched through the addition of 20 to 40 ml of media . Following resuspension, any residual tissue was removed via pipet or by again passing the splenocyte suspension through a 70 m filter (fisherbrand, houston, tx). Breeding pairs of fcriib ko mice (b6; 129s4-fcgr2b / j) on a c57bl background were obtained from jackson laboratories and bred in the animal resources facility at albany medical college . Mice of 615 weeks old were used in order to identify significant differences under conditions that include a relatively broad range of ages . All animals were housed and cared for according to guidelines approved by the institutional animal care and use committee . Briefly, ft - lvs organisms were grown in mhb medium (becton dickinson, sparks, maryland) at 37c to a density of 0.51 10 cfu / ml . 1 10 cfu / ml live bacteria were then incubated in 1 ml of sterile pbs (cellgro, manassas, virginia) containing 2% paraformaldehyde (sigma - aldrich, st . Inactivation was verified by culturing a 100 l sample (~1 10 ift - organisms) on chocolate agar plates (becton, sparks, maryland) for 7 to 10 days . Joseph, missouri) plus 5% xylazine (lloyd, shenandoah, iowa) diluted in sterile cell culture grade water (cellgro, manassas, virginia). Mice were subsequently administered i.n . Either 20 l of pbs (vehicle) or 2 10 ift - organisms in 20 l of pbs . Unless otherwise indicated, mice were immunized on day 0 and boosted on day 21 . Immunized mice were then challenged on day 35 i.n . With either 4 ld50 or 16 ld50 of live ft - lvs and subsequently monitored for survival for a minimum of 21 days . Mice were immunized and subsequently challenged with a sublethal dose (approximately 0.4 ld50) of live ft - lvs . Diluted tissue samples were plated on chocolate agar and cfu colonies were enumerated approximately 72 hours later . Kits were purchased (immunology consultants laboratory, portland, or) and the manufacturers protocol was followed . Samples and standards were serially diluted and 100 l / well were added to plates precoated with anti - igm, anti - igg, or anti - iga abs . Following the incubation, plates were aspirated and washed, and 100 l of the appropriate enzyme - ab conjugate was added to each well . The reaction was stopped after 10 minutes with stop solution and the plates were read at 450 nm using a microplate reader (versamax, molecular devices, sunnyvale, california). Elisa plates (corning, corning, new york) were coated with 50 l / well of live ft - lvs (5 10 cfu / ml in carbonate buffer containing 2.15 g sodium bicarbonate and 2.62 g sodium carbonate (sigma - aldrich, st . Louis, missouri) diluted in 500 ml of sterile cell culture grade water (cellgro, manassas, virginia) at ph 9.69.8), overnight at 4c . The plates were then washed three times with 200 l / well of pbs containing 0.5% bovine serum albumin (bsa) (baxter healthcare, deerfield, illinois) and 0.002% sodium azide (sigma - aldrich, st . Plates were then blocked at 4c for 2 hours with 200 l / well of pbs containing 5% bsa and 0.02% sodium azide . Plates were again washed and serial dilutions of sera or bronchoalveolar lavage fluids (balf) were added to the plates (50 l / well) and incubated for 2 hours at 4c . After washing, alkaline phosphatase conjugated anti - mouse ab specific for total mouse ab (sigma - aldrich, st . Louis, missouri), igg1 (southern biotech, birmingham, al), igg2c (abcam, cambridge, ma), or igm (sigma - aldrich, st . Plates were washed and then 100 l / well of alkaline phosphatase substrate (sigma, st . All samples were read at 405 nm using a microplate reader (versamax, molecular devices, sunnyvale, california) following a 5-second (sec) shake . Clotted blood samples were then spun at 8000 rpm for 10 minutes and serum was harvested and pooled . Following heat (complement) inactivation at 55c for 30 minutes, serum was spun at 4000 rpm for 10 minutes, aliquoted, and frozen at 20c until use . For adoptive transfer experiments, 250 l of pbs (vehicle), serum from pbs immunized mice, or serum ift - immunized mice . Mice were then anesthetized and challenged with the indicated dose of ft - lvs 24 hours after adoptive transfer ., spleen cells were harvested and diluted in medium to a concentration of 5 10 spleen cells / ml . 1000 l of cells was added to wells of a 24-well plate (costar corning, corning, ny) plate, each well containing an equivalent number of ift - organisms . Alternatively 100 l of cells was added to wells of a u - bottom 96-well plate (falcon bd, franklin lakes, nj) that contained a concentration range between 2.5 and 20 ift per splenocyte . Plates were incubated at 37c for up to 7 days in a humidity chamber to prevent medium evaporation . Supernatants were collected at 1, 3, 5, and 7 days and frozen at 20c until they were analyzed . Samples were analyzed for cytokines via cytometric bead array (cba) multiplex assay (bd biosciences - bd pharmingen, sparks, maryland). Data was acquired on a facsarray instrument and analyzed using cba software version 1.0.1 (bd immunocytometry systems, sparks, maryland). Wt and fcriib ko mice were immunized i.n . And on day 35 mice were given a sublethal challenge i.n . With approximately 0.4 ld50 of ft - lvs . Luminex assay was performed on tissue supernatants to determine in vivo cytokine levels and to assess inflammation . The luminex assay is a multiplex system for quantitation and detection of multiple cytokines in a single sample . The method of statistical analysis for each figure is described in the respective figure legends . Given the key role ab plays in initiating fcriib - mediated downmodulation of the immune response, we sought to verify prior studies demonstrating increased levels of total serum igg in fcriib ko versus wt mice . We also examined serum levels of total igm and total iga, as well as ft - specific igm and igg, since mice have propensity for low basal levels of natural ft - specific ab . As shown in table 1, we observed no difference in total igm levels between wt and fcriib ko mice . However, nave fcriib ko mice exhibited higher levels of total serum igg than their wt counterparts . Total iga also appeared somewhat elevated in fcriib ko versus wt mice . In regard to the presence of natural ft - specific igm and igg ab, there were no significant differences between fcriib ko versus wt mice, although the median titer for ft - specific igg was higher in fcriib ko mice (table 1). Based on published studies demonstrating a beneficial effect on the immunity and/or protection of nave fcriib ko versus wt mice following infectious disease challenge [10, 11], we expected that the absence of fcriib would enhance survival of nave fcriib ko mice challenged with ft - lvs . In fact, we observed no significant difference in survival between nave fcriib ko and wt mice at all challenge doses tested (figures 1(a)1(d)). Thus, the elevated median response levels of natural ft - specific serum igg ab in nave fcriib ko mice versus wt mice (table 1) had no impact on survival (figures 1(a)1(d)). A number of published studies have demonstrated that in the absence of fcriib, ag - specific igg production is enhanced upon immune stimulation [1820]. Thus, we examined the production of ft - specific ab, including igg, iga, and igm, in the serum and balf of fcriib ko versus wt mice immunized with ift . In some cases, the titers obtained were highly variable between individual mice, which likely reflects not only normal mouse - to - mouse variation but also differences in immune responsiveness due to differences in the age of the individual mice and its effects on b cell repertoires . Despite the latter, we did observe a significant increase in the production of total ft - specific serum ab in fcriib ko versus wt mice following ift - immunizations (figure 2(a)). While there were no significant differences in the levels of ft - specific serum igg, igg2c, igg1, or igm in the serum of these mice (figures 2(b), 2(c), 2(d), or 2(e), resp . ), ft - specific iga levels in serum were significantly increased (figure 2(f)). While there is not a dramatic increase in the median response in total anti - ft ab titer between pbs and ift - immunized fcriib ko mice (figure 2(a)), there is a significant increase in the median levels of igg2c in ift - immunized fcriib ko mice versus pbs - immunized fcriib ko mice (p <0.01) (figure 2(c)). This suggests that despite the former observation regarding total anti - ft ab, ift - immunized fcriib ko mice produce increased levels of potentially high affinity igg2c anti - ft ab . Lastly, there were no significant differences in the levels of ft - specific igg in the balf of these mice, while the levels of ft - specific iga in the balf of ift - immunized fcriib ko mice were significantly higher than that of wt mice (figure 2(h)). The presence of ft - specific abs in nave (table 1) or unimmunized mice has been previously observed in mouse and humans [22, 23] and is likely due to the presence of b1 cells producing natural antibodies stimulated in response to normal flora or self - ag [24, 25]. Given the integral role ag - specific igg plays in fcriib - mediated immune modulation and the absence of increased levels of ft - specific igg in ift - immunized fcriib ko versus wt mice (figure 2), we sought to determine whether there would be any impact of the presence versus absence of fcriib on protection of ift - immunized mice . Despite the lack of a significant increased ft - specific igg in fcriib ko versus wt mice and in contrast to studies using nave mice (figure 1), at a challenge dose of 4 ld50, the survival of ift - immunized fcriib ko mice was significantly better than that of wt mice (100% versus 50% resp .) (figure 3(a)). Similar to that observed in nave mice (figure 1), there was no significant difference in survival between fcriib ko and wt mice immunized with pbs (figure 3(a)). When the challenge dose was increased to 16 ld50 however, a slight increase in the survival of ift - immunized fcriib ko versus wt mice was still apparent (figure 3(b)). The increased survival also correlated with a reduction in the median bacterial burden in ift - immunized fcriib ko (figure 3(c)). We surmised that while there were no differences in ft - specific igg levels in ift - immunized fcriib ko versus wt mice (figure 2), the observed increases in ft - specific iga in the serum and balf of fcriib ko versus wt mice might be responsible for the increased protection observed (figure 3). To test this, we adoptively transferred serum from ift - immunized fcriib ko and wt mice into their naive counterparts, in an effort to recapitulate the difference in survival obtained in figure 3 . As demonstrated previously by others, adoptive transfer of serum to nave mice did increase protection against ft - lvs challenge . However, a significant increase in protection in nave fcriib ko mice receiving serum from ift - immunized fcriib ko mice versus that of wt mice was not observed (table 2). Given that ifn-, a th1 cytokine, has been shown to play an important role in protection against ft - infection [13, 2730] and that fcriib has been shown to downmodulate cellular immune responses, including th1 responses [9, 11], we examined the impact of fcriib's absence on the production of ifn- by splenocytes from ift - immunized fcriib ko versus wt mice restimulated ex vivo with ift . Consistent with the increased protection observed in ift - immunized fcriib ko versus wt mice (figure 3) and a critical role for ifn- in mediating protection against ft - infection, within three days following restimulation with ift, splenocytes from ift - immunized fcriib ko mice exhibited increased levels of ifn- compared to that of wt splenocytes (figure 4(a)). This remained the case at a series of ift / splenocyte ratios ranging between 2.5 and 20: 1 (figure 4(b)). Furthermore, in this same experiment, we also examined the production of il-10 and il-17, since il-10 restrains il-17-induced lung pathology following pulmonary ft - lvs infection . We demonstrate that ift - immunized fcriib ko mice produce increased levels of il-10 and lower levels of il-17a than ift - immunized wt mice, consistent with the ability of il-10 to limit il-17 induced pathology in fcriib ko mice (figures 4(c) and 4(d)), leading to increased survival (figure 3). Finally, we demonstrate that ift - immunized fcriib ko mice produce higher levels of tnf- compared to ift - immunized wt mice (figure 4(e)), another cytokine that also plays an essential role in survival against a primary ft - infection . We have previously observed that although immunization with ift initially stimulates increased production of inflammatory cytokines, including ifn-, on days 13, an overall reduction in such cytokines occurs in vivo between days 5 and 7 after challenge . Therefore, we also analyzed inflammatory cytokine levels in the lungs of ift - immunized fcriib ko versus wt 5-day mice after challenge . Consistent with our prior observations, significantly lower levels of ifn- and mcp-1 in the lungs and tnf- in the balf of ift - immunized fcriib ko versus wt mice were observed (figures 5(c), 5(e), and 5(h), resp . ). There were also reductions in the median cytokine levels for il-6 and tnf- in the lungs of these same mice (figures 5(a) and 5(g), resp . ), as well as il-6 (figure 5(b)), ifn- (figure 5(d)), and mcp-1 (figure 5(f)) in balf . A very limited number of studies thus far have focused on the role of fcriib in resolving primary infections [912]. Specifically, they suggest that, during primary infection, the absence of fcriib results in an improved immune response to infection, which can be beneficial to the host [911]. In contrast, other studies suggest that, following immunization, the absence of fcriib leads to an overproduction of cytokines and potential septic shock or no differences in immunity and/or protection [11, 12]. However, our studies using the ft - infectious disease model demonstrate that the absence of fcriib has little or no impact on the outcome of survival following primary infection, while its absence following vaccination and challenge increases the protective efficacy of the vaccine . A number of likely explanations exist for our observations . In regard to primary infection of nave mice, our studies and those of others have demonstrated fcriib deficient mice exhibit higher levels of total igg [6, 16]. Our studies also demonstrate that there is no significant difference in ft - specific igg or total iga abs in nave fcriib ko versus wt mice (table 1). The latter, in addition to the fact that the formation of ft - anti - ft ab complexes would be necessary to actively engage fcriib and impact immunity and protection, may explain a failure to see differences in protection between nave fcriib ko and wt mice . Furthermore, the generation of ft - specific igg in response to infection would not be expected to occur until approximately day 7 after infection, the same point at which mice generally succumb to infection (figure 1). In contrast to studies involving immunization against s. pneumoniae and subsequent challenge, ift - immunized mice are better protected when fcriib is absent (figure 3). This is also despite the lack of significant differences in the levels of ft - specific igg production in fcriib ko versus wt mice following ift - immunization (figure 2). Importantly, however, both igg and iga can mediate protection against ft - infection [13, 29, 30, 3438]. Thus, the significant increase in ft - specific iga production in ift - immunized fcriib ko versus wt mice (figure 2) could explain the increased protection observed with ift - immunized fcriib ko versus wt mice . Never the less, a role for ft - specific iga in mediating the increased protection observed (figure 3) is not supported by adoptive transfer studies . Specifically, no significant difference in protection was observed in nave recipient fcriib ko versus wt mice following adoptive transfer of sera from ift - immunized fcriib ko or wt donors, respectively (table 2). However, cellular immune responses can also play a crucial role in survival against a lethal ft - challenge [13, 2730, 3438]. In this regard, we do show splenocytes from ift - immunized fcriib ko mice incubated with ift ex vivo produce substantially more ifn-, il-10, and tnf- than their wt counterparts, while producing less il-17, which has been associated with increased pathology (figure 4). Thus, this observation more likely explains the enhanced protection observed in ift - immunized fcriib ko mice . However, a role for ft - specific iga cannot be totally excluded, in that our prior studies have demonstrated the requirement for both iga and ifn- in protection of ift - immunized mice following ft - lvs challenge [13, 33]. Lastly, our studies, and those of others, have demonstrated that a reduction in the levels of proinflammatory cytokines 57 days after challenge, correlates with increased protection in the ft - infectious disease model [13, 29, 33, 37, 39]. Accordingly, we also observed a significant reduction in proinflammatory cytokines in the lungs of ift - immunized fcriib ko versus wt mice 5 days after challenge (figure 5). Furthermore, this decrease in proinflammatory cytokines in lungs of ift - immunized fcriib ko versus wt mice at 5 days after challenge also correlated with a decrease in bacterial burden in the lungs of these animals, reflecting the ability of ift - immunized fcriib ko mice to better control ft - infection than their wt counterparts (figure 3). We have recently demonstrated that targeting ift to fc receptor (fcr) in the form of monoclonal ab- (mab-) ift complex administered i.n . However, a major concern regarding fcr - targeted vaccines, when utilizing fc to target vaccine ags, is their ability to bind to fcriib, as well as activating fcrs, which could potentially dampen the response to vaccination and thereby limit efficacy . Thus, fcr - targeted vaccines that bypass fcriib in favor of activating fcr, such as one recently developed in our laboratory, which targets the activating fcr (human fcri), could significantly increase the efficacy of such vaccines . Alternatively, as we have demonstrated in this paper, fcriib can also limit the stimulatory capacity of non - fcr - targeted vaccines . Thus, the use of fcriib antagonists as vaccine adjuvants could significantly enhance the efficacy of vaccines in general . This study is the first to demonstrate that (1) the absence of fcriib does not affect the susceptibility of mice to a primary infection with the intracellular category a mucosal pathogen f. tularensis; (2) that in the absence of fcriib, both humoral and cellular immunity are enhanced following immunization with the inactivated vaccine ift; (3) that the level of ag - specific iga produced in response to vaccination can be impacted by the presence / absence of fcriib; (4) that the enhanced immune responses observed (ft - specific iga and ifn- production) following ift - immunization correlate with increased protection of fcriib ko versus wt mice after lethal mucosal challenge with ft lvs . Thus, these studies further expand our knowledge regarding the role of fcriib plays in the immune response to infection, while also providing further impetus for developing vaccines geared toward modulating the inhibitory activities of this receptor.
Without appropriate management, herpes simplex encephalitis (hse) is a potentially fatal disease (1). The mortality and morbidity rates remain high, even when an early diagnosis is made based on the detection of the herpes simplex virus (hsv) in the cerebrospinal fluid (csf) by a polymerase chain reaction (pcr), and despite the advent of acyclovir therapy (2). In particular, the acute - phase mortality and long - term outcome in patients with severe hse remain major concerns (3). Although the severity and poor outcomes of hse are mostly associated with acute - phase complications (2,3), these important adverse events are not well understood because of the low frequency of the condition and the paucity of reported cases . This lack of understanding may contribute to a lack of awareness by clinicians and, consequently, to the poor outcomes of patients with hse . We herein report the case of a patient with hse that was complicated by cerebral hemorrhage (the diagnosis of which was delayed), which developed at the end of 2 weeks of acyclovir therapy . A 71-year - old woman was admitted to our hospital in a state of unconsciousness following fever and headache . She experienced epigastric discomfort and dizziness 8 days before admission and gradually lost her appetite . Two days later, she developed a fever of 38.2c, headache, and nausea . She was evaluated twice by the outpatient service of our hospital for fever and was prescribed acetaminophen both times . However, in addition to the persistence of fever and headache, there was an acute worsening of her state of consciousness on the day of admission, and she was transported to our emergency department by ambulance . The patient was placed under observation for 4 years at another hospital due to the presence of an unruptured aneurysm of the right middle cerebral artery . The patient was a non - smoker and did not regularly consume alcohol . On physical examination, her glasgow coma scale (gcs) score was e1v1m4, her body temperature was 38.8c, her blood pressure was 116/66 mmhg, her pulse rate was 80/min, and her respiratory rate was 16/min with an o2 saturation of 99% (with a flow rate of 3 l / min). Her pupils were round and equally dilated (size, 3 mm). A head and neck examination revealed no anemia, icterus, or other abnormalities . The results of a cardiovascular examination were normal, and auscultation revealed normal lung sounds . A neurological examination revealed no neck stiffness and normal deep tendon reflexes; however, slightly rigid muscle tone and bilateral pathological babinski reflexes were observed . Laboratory investigations revealed a normal white blood cell count (7,350/l), a slightly elevated c - reactive protein (0.36 mg / dl) level, elevated lactate dehydrogenase (313 iu / l) levels, hyponatremia (128 meq / l), hypokalemia (2.9 meq / l), hypochloremia (88 meq / l), and a normal blood glucose level (126 mg / dl). A urinalysis revealed no abnormal findings . A chest x - ray and electrocardiogram revealed no abnormalities . The right anterior medial temporal lobe and insular cortex displayed high signal intensity on t2-weighted and diffusion - weighted brain magnetic resonance imaging (fig . 1a - c), and the patient's aneurysm, which was already known to exist, was observed at the bifurcation of the distal m1 segment of the middle cerebral artery using magnetic resonance angiography (fig . 1d). A csf analysis detected moderate lymphocytic leukocytosis (170/l), a moderately increased protein level (77 mg / dl), and a slightly decreased glucose level (53 mg / dl). Gram staining of the patient's csf was negative, and blood and csf cultures showed no bacterial growth . A pcr of the csf to detect hsv-1 and hsv-2 revealed the presence of hsv-1 dna . Axial t2-weighted images (a, b) and an axial diffusion - weighted image (c) show an area of high signal intensity in the right anterior medial temporal lobe and insular cortex . Magnetic resonance angiography (d) shows an aneurysm at the bifurcation of the distal m1 segment of the right cerebral artery . The patient was treated with acyclovir (10 mg / kg, intravenously, three times per day [ideal body weight]), glycerol (200 ml, intravenously, twice a day), and additional supportive therapies . Although the patient vomited on the day of admission, her symptoms disappeared within the first 2 days . Her consciousness gradually recovered to gcs e4v4m6, and her temperature returned to 37.3c on day 11 after admission . However, she vomited during the night on day 12, and her gcs slightly worsened to e3v4m6, and she displayed a slightly elevated body temperature of 37.6c on day 13 . An exacerbation of hse was considered, and a csf analysis including a pcr for hsv-1 was performed, which revealed mild bloody fluid with moderate lymphocytic leukocytosis (178/l) and a markedly increased protein level (350 mg / dl). Brain computed tomography imaging performed on day 14 revealed cerebral hemorrhage in the right medial temporal lobe and right basal frontal area, with a right lateral ventricular rupture (fig . Although magnetic resonance angiography revealed an increase in the size of right cerebral arterial aneurysm (fig . 2d), no evidence of subarachnoid hemorrhage was observed by computed tomography or magnetic resonance imaging . Acyclovir therapy was terminated based on the results of the second pcr for hsv, which was negative . There was no recurrence of encephalitis or intracranial hemorrhage . Computed tomography and magnetic resonance imaging at the time of cerebral hemorrhage . Axial computed tomography shows acute cerebral hemorrhage in the right medial temporal lobe (a) and the right basal frontal area (b). A right lateral ventricular rupture magnetic resonance angiography (d) shows an increase in the size of the right cerebral arterial aneurysm at the bifurcation of the distal m1 segment of the right cerebral artery . We herein report a case of cerebral hemorrhage that developed in a patient who was undergoing acyclovir treatment for hse . Although the patient made a near - complete recovery, the diagnosis of the cerebral hemorrhage was delayed . Initially, an acute exacerbation of hse was considered, as intracranial vascular disease was not included in the differential diagnosis . This case suggests that acute - phase complications of hse need to be better understood to avoid missing the onset of adverse events that can be managed successfully if they are diagnosed early . The patient's cerebral hemorrhage appears to have been associated with hse due to the following reasons . First, the site of hemorrhage was consistent with the region in which hse - associated inflammation was observed . Second, the timing of the onset of hemorrhage was typical for hse - related cerebral hemorrhage (4). Although the precise cause of cerebral hemorrhage in hse patients remains unclear, based on the pathological findings in similar cases, we hypothesize that the rupture of the small vasculitic vessels of the brain due to hsv - induced inflammation was a possible mechanism of our patient's bleeding (5,6). In addition to cerebral hemorrhage (4), seizures (2,3), increased intracranial pressure (3,7 - 10), stroke (11,12), subarachnoid hemorrhage (13), and central diabetes insipidus (14) have been reported as complications during the acute phase of hse (this includes the period of acyclovir therapy). Although the prevalence of these complications is not well known, seizures and increased intracranial pressure, which have been reported in one in three and one in five hse cases, appear to be among the most common (2,3). Cerebral hemorrhage and increased intracranial pressure have mostly been observed during acyclovir therapy, within 2 weeks after admission (3,4,7 - 10); the condition of patients may decline in this period due to hse and not because of complications, which can pose a challenge for the differential diagnosis . Furthermore, the symptoms of these two complications, which include deteriorated consciousness, headache, hemiparesis, hemiplegia, and third nerve palsy, are similar to those of hse (3,4,7 - 10). Thus, the possibility of a diagnostic delay may be higher in patients with cerebral hemorrhage and increased intracranial hypertension than in those with other complications . However, these two complications frequently require surgical intervention (3,4,7 - 10). Because both complications can be detected by computed tomography (as in our case), clinicians should consider repeat computed tomography to allow for the early detection of these potential complications in patients who display a worsening clinical condition despite the administration of acyclovir treatment . Acute - phase complications in patients with herpes encephalitis . * in intensive care unit patients in conclusion, the diagnosis of cerebral hemorrhage during the early phase of hse may be delayed because of the similarity of its symptoms to the primary disease and due to the worsening of encephalitis . Clinicians should consider cerebral hemorrhage and other acute - phase complications and re - perform imaging studies in hse patients who do not show any improvement during acyclovir treatment.
One of the top priorities in therapeutics is pain control and in spite of the recent advances in clinical investigation of new therapeutic agents, pain relief is still a significant challenge . The reasons include difficulties of correctly evaluating pain, underestimation of patients pain, misconceptions about analgesic use and side effects, gaps in pain management process, and lack of acute pain service.1 local anesthetics (las) are among the different classes of pharmacological compounds used to eliminate pain . Las are small molecules that could be easily eluted from the site of administration, thus limiting the analgesic property . Cocaine is the first compound that was used as a numbing agent in the early 1500s . However, it is usually associated with the central nervous system and cardiovascular system toxicity . Presently, most of the synthetic las are structurally related to cocaine but with reduced toxicity . La works by cutting the signal of nerve impulses in nerve cell membranes through the shutting of voltage - gated na channels . The degree of numbness from a certain concentration will depend on how the nerve is stimulated and the resting membrane potential.2 clinical las belong to one of the two classes: amino esters (figure 1a) and amino amide (figure 1b). Ester - based las are hydrolyzed and inactivated by plasma esterase, primarily plasma cholinesterase . Therefore, they are always associated with low potency, slow onset, and short therapeutic duration.2 amino amide las became popular and many of this class of drugs were developed by 1970s . Amide - based las are degraded by hepatic endoplasmic reticulum, leading to a slower removal from the body and higher concentration in the plasma . With the introduction of bupivacaine, accidental overdose was often fatal and responded poorly to conventional resuscitation.2,3 this had led to a search for long - acting las with improved therapeutic margins and reduced toxicity . Trachez et al and zapata - sudo et al demonstrated that s() enantiomer of bupivacine is more potent4 and less toxic5 than r(+) enantiomer leading to the selection of s() enantiomers of ropivacine and levobupivacine as safer alternatives to bupivacine . High toxicity of la due to over dosage and strong clinical requirements have triggered the interest in the field on controlled release of la . One of the primary objectives in the design of a controlled release system is the controlled delivery of therapeutics to the site with an optimal release rate . From here, two major areas have evolved: (1) design of good carriers to protect and deliver the therapeutics to the site of action and (2) development of a sustained drug formulation for a slow and long lasting effect.6 the release of these drugs will be controlled by desorption, diffusion, erosion, or a combination of these factors.7 one approach to prolong the effect of analgesia is to complex the la with drug delivery vehicles . The larger carriers will remain at the injection site for a longer period of time with a gradual release of the la . Liposomes,811 cyclodextrins,12 microspheres,1315 hydrogels,16 and nanospheres6,1720 could encapsulate the la for controlled delivery, prolonged anesthetic effect, and reduced toxicity . From these various types of controlled delivery systems, depending on the end - use requirements, the most popular choice is nanospheres followed by microspheres and hydrogels.21 in this review, different methods of nanogel synthesis and an overview of drug release from nanogel - based delivery vehicles will be described and discussed . Current approaches used for the preparation of nanogels can be classified into four categories: (1) polymerization of monomers in a homogeneous phase or in a microscale or nanoscale heterogeneous environment; (2) physical self - assembly of interactive polymers; (3) cross - linking of preformed polymers; and (4) template - assisted nanofabrication of nanogel particles . In this section, we will discuss these methods, where the synthesis technique being employed is typically dictated by the desired application and types of study being performed . Surfactant - free emulsion polymerization or precipitation polymerization is a versatile technique for synthesizing stimuli - responsive nanogels . Nanogels synthesized by this method are formed by homogeneous nucleation of water - soluble monomers, which results in the formation of a colloidal suspension of the growing polymer, and the charge imparted by the initiator stabilizes the gels . This method is versatile from the standpoint of particle size control . To synthesize smaller nanogels, the precursor particles must be stabilized earlier in the reaction, where an ionic surfactant can be added to impart colloidal stability . Similarly, larger particles can be obtained by decreasing the surfactant concentration.22 peppas and coworkers23 synthesized a suspension of nanospheres composed of poly (ethylene glycol) (peg)-grafted poly (methacrylic acid) (pma) in water using the precipitation polymerization method . Thermoresponsive poly (n - isopropylacrylamide) (pnipam) nanogels with narrow size distribution were first synthesized by pelton and chibante,24,25 where all the monomers and cross - linker are dissolved in water . Precipitation polymerization is best for materials that are hydrophobic, so that they can readily attach to the collapsed precursor particle and is useful only for materials that are stable at high temperatures, and hence it cannot be used to incorporate biological macromolecules . Thus, if a hydrophilic comonomer is to be copolymerized, only a certain weight percentage can be incorporated.22 to overcome these drawbacks, inverse microemulsion polymerization is used, where an aqueous solution of all the monomers is added to an appropriate amount of oil and surfactant to produce a thermodynamically stable microemulsion . Various drugs, dna, and cells are physically incorporated into these aqueous microemulsions, which are then cross - linked with appropriate cross - linking agents . The resulting cross - linked nanogels are prepared by dispersion in organic solvents, and then purified by precipitation, centrifugation, washing (usually with organic solvents, such as isopropanol), and lyophilization . Several reports have demonstrated the synthesis of hydrophilic or water - soluble particles comprising of poly (2-hydroxyethyl methacrylate) (phema),26 polyacrylic acid (paa),27 polyacrylamide (paam),26 pnipam,2830 and polyaniline.31 these nanoparticles can be either hollow and zwitterionic or core labile bonds are frequently introduced into the nanogels during polymerization to make them degradable and facilitate drug release.3236 matyjaszewski and coworkers35,36 used the atom transfer radical polymerization (atrp) performed in an inverse microemulsion system to synthesize stable biodegradable nanogels comprising of water - soluble polymers with a disulfide - functionalized cross - linker . Nanogels can also be formed using the physical self - assembly of polymers involving a mixture of amphiphilic copolymer and a therapeutic agent in an organic solvent via membrane dialysis or from direct complexation between cationic copolymers and genes or proteins in an aqueous solution through noncovalent interactions, such as van der waals, hydrogen bonding, stereocomplexation, charge transfer, and polyelectrolyte complexation . During the self - assembly process, small molecular drugs and macromolecular therapeutics, such as genes and proteins, can be incorporated into the micellar nanostructures . The most widely used selfassociating polymers are amphiphilic block copolymers that possess hydrophobic and hydrophilic blocks that can self - assemble in selective solvents to form submicron - size micelles (nanogels). These amphiphilic polymers can be synthesized via living radical polymerization (lrp) techniques (eg, atrp, reversible addition fragmentation chain transfer [raft], and nitroxide - mediated polymerization [nmp]). The micellization of amphiphilic block copolymers can be tailored by changing the block nature, block lengths, composition, or architecture.3739 in addition, external parameters, ie, change in temperature or solvent or addition of additives, such as electrolytes and cosolvents, provide extra degrees of freedom to tune the micellar behavior of the amphiphilic block copolymers.4044 moreover, the chemistry of the surface can be manipulated for the conjugation of a targeting signal that can recognize specific tissues or cells . The functionalities of the core of nanogels can be tuned using specific chemical approaches to improve the drug - loading capacity . The molecular compositions of the copolymers used to form the nanogels can be controlled through lrp approaches to achieve nanostructures with narrow size distribution . In addition to the above two polymerization methods, covalent cross - linking of preformed polymer chains provides excellent opportunities for producing functional nanogels with large pore sizes for drug delivery.45 in particular, it was used to synthesize the first cross - linked cationic nanogel for polynucleotide delivery.46 in this case, a doubly activated peg was conjugated to a branched polyethylenimine (pei) in an oil in water emulsion (dichloromethane in water) followed by evaporation of the solvent in vacuo and maturation of the nanogel in an aqueous solution . Cationic pei containing nanogels of 80200 nm diameter were also obtained by the photo - fenton reaction in aqueous media.47,48 small (4045 nm), nontoxic cross - linked pullulan nanogels were prepared in the reverse micellar system (aerosol ot / hexane).49,50 the cross - links that connect the polymeric chains in such nanogels can be made degradable to reduce their toxicity . For example, a biodegradable segmented pei connected by disulfide linkers was used to prepare cationic nanogels for polynucleotide delivery,51 and hyaluronic acid (ha) nanogels containing biodegradable disulfide linkages were prepared by the inverse water in oil emulsion method.52 an interesting type of cross - linked nanogels containing dna was obtained by mixing thiol - functionalized 6-arm - branched peg and dna in dimethyl sulfoxide, which produced particles of 100 nm diameter and subsequently cross - linked by oxidation to obtain dna - loaded biodegradable nanogels.53 combining the controlled self - assembly of polymeric micelles and cross - linking techniques provided opportunities for the control of the spatial distribution of polymeric chains at the nanolength scale . For example, wooley and coworkers5458 have chemically cross - linked the shell layers of polymeric micelles to obtain various shell - cross - linked nanoparticles with morphologies, such as spheres, rods, and even toroids . In another study, pei was cross - linked to micelles of doubly activated pluronic triblock copolymer in aqueous solution to produce nanogels with a hydrophobic poly (p - phenylene oxide) (ppo) core surrounded by a swollen cross - linked pei and a peg shell.59 lee et al60 photo - cross - linked the polymeric micelles of poly(d, l - lactic acid)-b - peg - b - poly(d, l - lactic acid) with acrylate end groups, resulting in the formation of nanogels containing self - assembled hydrophobic domains of micelles with insoluble poly(d, l - lactic acid) cores, which could be loaded with a hydrophobic anticancer drug . Finally, desimone and coworkers61 developed a novel imprint photolithographic technique, particle replication in nonwetting templates (print), for the fabrication of nanogels . They used nonwetting elastomeric molds of a low - surface - energy perfluoropolyether network prepared on patterned silicon templates by photochemical cross - linking of dimethacrylate - functionalized perfluoropolyether oligomers . The nonwetting molds eliminate the formation of a residual interconnecting film between the molded objects, thus producing monodispersed, shape - specific nanoparticles from an extensive array of organic precursors . This method enables strict control over the particle size, shape, composition, and surface functionality and permits the loading of delicate cargos, including pharmaceutical drugs and biomacromolecules . For example, monodispersed 200-nm - diameter peg - based swellable particles were fabricated with the print method by uv - induced copolymerization of several vinyl monomers, such as peg triacrylate, peg monomethyl ether monomethacrylate, and p - hydroxystyrene.62 parenteral route is the only approach to administer drugs, as this will ensure the quickest onset of the therapeutic product . From the work of lee et al,63 injections made with nanogels are less painful when compared with cosolvent - based formulation . High blood circulation time could be achieved due to the size of the nanogels, which is very important to extend the therapeutic efficacy of the la . Nanogels exhibit excellent thermodynamic stability, high solubilization capacity, low viscosity, and ability to withstand sterilization techniques, and these properties make nanogels as interesting delivery systems.64 most importantly, after the encapsulation of la into the nanospheres, the toxicity effect is greatly reduced as shown by the work of moraes et al using poly(dl - lactide - co - glycolide) nanospheres encapsulated with either bupivacaine17 or ropivacaine.18 in both the cases, after encapsulation of the la, there was a significant improvement in the viability of 3t3 cells (figure 2). There are 2 goals that should be satisfied in the design of a delivery system:65 (1) efficient binding of drugs to the polymeric matrix and release of the drugs in a controlled manner and (2) ability to release through a local or externally applied trigger by changing the binding affinity between the drug and the polymeric matrix . Since most of the las possess secondary or tertiary amines, electrostatic interaction is the dominant driving force, depending on the ph of the solution and pka of the la . Therefore, a clear understanding on the interaction between the la and the nanogel is critical for the development of an efficient drug delivery system . Procaine hydrochloride (prhy; a la drug of the amino ester group) loaded into methacrylic acid ethyl acrylate (maa ea) nanogels through hydrophobic and hydrogen bonding (figure 3) showed a higher release at a higher ph (figure 4).66 at a higher ph, the acid on the nanogels will be deprotonated, thus increasing the osmotic pressure and swelling the nanogels . This will promote the release of prhy through the increase in porosity.20 different kinds of interactions will result in a different release profile, which will be important for the design of a delivery carrier, where drug release can be triggered by changing the ph . First, the results demonstrated the viability of tuning the release profiles of drug from a ph - responsive nanogel system . The proportion of drug released can be controlled by manipulating the ph of the environment . Hence, it is possible to design a ph - dependent gradient release drug delivery system, such that the active drugs could be released from the carrier in different regions of the physiological environment that possess different ph conditions . This will extend the therapeutic range of active drugs and ensure that the targeted areas receive the right dosage of drugs . Second, the interaction between the drug and delivery carriers controls the release profiles and the effective therapeutic range of drug carriers . Therefore, it is possible to design a drug delivery system with enhanced interaction in order to have a better control of release behavior.20 histological studies showed that particles with a size of 100 nm could diffuse through the submucosal layers, whereas larger - sized particles (500 nm10 m) were found to concentrate within the epithelial tissue linings.67 due to the high surface area - to - volume ratio, the release of hydrophilic la will be rapid, that is indicated by the initial burst release . High initial burst release has been observed for poly(dl - lactide - co - glycolide) nanopaticles,19,68 chitosan nanoparticles,69 and pnipam - co - acrylic acid hydrogels in the submicron range.70 a simple approach in addressing the problem of initial burst of nanogels was proposed by our group using the layer - by - layer (lbl) technique.71 lbl is a simple technique of coating alternating layers of oppositely charged polyelectrolyte onto a surface . However, the coating must not be too stable, as this will impact the effectiveness of the coated particles as a vehicle for drug delivery . Permeability will be reduced if the coating is too stable, resulting in a continuous slow release of the drugs.71 with more polyelectrolyte layers, the more accessible prhy molecules have to diffuse through the polyethylene (pe) layers, therefore mitigating the burst release phenomenon (figure 5).71 from the work of grner et al,6 it is shown that size and drug loading do have an effect on the mass of drugs released per milligram of nanospheres and the time to attain equilibrium release . Larger particles will result in higher mass of drugs released and longer time to achieve equilibrium . Tan et al66 have also shown that with a higher drug loading content of prhy, the rate and amount of drugs released will be greatly affected (figure 6). As a result, we have learned that the drug release rate of the encapsulated drugs is highly dependent on the state (crystalline or dispersed). There are 2 goals that should be satisfied in the design of a delivery system:65 (1) efficient binding of drugs to the polymeric matrix and release of the drugs in a controlled manner and (2) ability to release through a local or externally applied trigger by changing the binding affinity between the drug and the polymeric matrix . Since most of the las possess secondary or tertiary amines, electrostatic interaction is the dominant driving force, depending on the ph of the solution and pka of the la . Therefore, a clear understanding on the interaction between the la and the nanogel is critical for the development of an efficient drug delivery system . Procaine hydrochloride (prhy; a la drug of the amino ester group) loaded into methacrylic acid ethyl acrylate (maa ea) nanogels through hydrophobic and hydrogen bonding (figure 3) showed a higher release at a higher ph (figure 4).66 at a higher ph, the acid on the nanogels will be deprotonated, thus increasing the osmotic pressure and swelling the nanogels . This will promote the release of prhy through the increase in porosity.20 different kinds of interactions will result in a different release profile, which will be important for the design of a delivery carrier, where drug release can be triggered by changing the ph . First, the results demonstrated the viability of tuning the release profiles of drug from a ph - responsive nanogel system . The proportion of drug released can be controlled by manipulating the ph of the environment . Hence, it is possible to design a ph - dependent gradient release drug delivery system, such that the active drugs could be released from the carrier in different regions of the physiological environment that possess different ph conditions . This will extend the therapeutic range of active drugs and ensure that the targeted areas receive the right dosage of drugs . Second, the interaction between the drug and delivery carriers controls the release profiles and the effective therapeutic range of drug carriers . Therefore, it is possible to design a drug delivery system with enhanced interaction in order to have a better control of release behavior.20 histological studies showed that particles with a size of 100 nm could diffuse through the submucosal layers, whereas larger - sized particles (500 nm10 m) were found to concentrate within the epithelial tissue linings.67 due to the high surface area - to - volume ratio, the release of hydrophilic la will be rapid, that is indicated by the initial burst release . High initial burst release has been observed for poly(dl - lactide - co - glycolide) nanopaticles,19,68 chitosan nanoparticles,69 and pnipam - co - acrylic acid hydrogels in the submicron range.70 a simple approach in addressing the problem of initial burst of nanogels was proposed by our group using the layer - by - layer (lbl) technique.71 lbl is a simple technique of coating alternating layers of oppositely charged polyelectrolyte onto a surface . However, the coating must not be too stable, as this will impact the effectiveness of the coated particles as a vehicle for drug delivery . Permeability will be reduced if the coating is too stable, resulting in a continuous slow release of the drugs.71 with more polyelectrolyte layers, the more accessible prhy molecules have to diffuse through the polyethylene (pe) layers, therefore mitigating the burst release phenomenon (figure 5).71 from the work of grner et al,6 it is shown that size and drug loading do have an effect on the mass of drugs released per milligram of nanospheres and the time to attain equilibrium release . Larger particles will result in higher mass of drugs released and longer time to achieve equilibrium . Tan et al66 have also shown that with a higher drug loading content of prhy, the rate and amount of drugs released will be greatly affected (figure 6). As a result, we have learned that the drug release rate of the encapsulated drugs is highly dependent on the state (crystalline or dispersed). The use of la could be limited by the relatively short therapeutic action and systemic toxicity related to high drug plasma concentration as a result of fast systemic uptake . Improvement of regional administration of las could be achieved by incorporating them into drug delivery systems . Nanogels are probably one of the better candidates due to the lesser pain during injection and longer blood circulation time . However, designing a perfect candidate would require one to have a thorough knowledge of the interaction between the drug and the carrier and the effect of size and drug loading on drug release.
The radioactive gas radon is a decay product of uranium normally found in rock and soils . The short - lived daughters of radon release ionizing radiation during radioactive decay and alpha particles emitted are capable of damaging dna and increasing the risk of cancer . Studies of underground miners occupationally exposed to radon have demonstrated an increased risk of lung cancer among both smokers and nonsmokers [13], and the risk of exposure of miners has been found to be consistent with the risk of indoor exposure [46]. Radon can accumulate in buildings from ground leakage, which is the most common source of indoor radon . Radon - containing building materials, such as concrete and household water from deep - drilled wells, are other potential sources . Although the relationship between radon exposure in dwellings and lung cancer has occasionally been questioned, it is generally considered to be causal on an overall assessment of epidemiological studies, particularly in europe and north america, and also in china [810]. Residential exposure to radon is considered to be the second most important cause of lung cancer after smoking . Darby et al . Analyzed 13 european case control studies and found a linear dose the authors concluded that radon in homes accounts for about 9% of all deaths from lung cancer in europe . Population exposure to radon can be lowered in existing residences by reducing the influx of radon from the ground or by removing radon - emitting building materials . Preventive measures can also be taken during the city - planning process when new residences are built . Preventive measures may be expensive, however, at least for existing buildings, and would require estimates of the number of lung cancer cases prevented . The single previous study we found that report such estimates was conducted in ontario, canada . The aim of the present study was to estimate the number of lung cancer cases that would be prevented by reducing radon exposure in different scenarios in dwellings in sweden . Such an analysis requires data on the distribution of exposure in the population, the relationship between exposure and lung cancer risk, and time trends in the incidence rates . Measurements on indoor radon are available from two separate studies conducted in 1990 and 2008 . It included 1360 cases and 2847 controls living in any of 109 swedish municipalities selected for their assumed high or low radon levels in order to provide some contrast in residential radon levels . Radon was measured in all dwellings identified and available that had been occupied by study participants for at least 2 years since 1947 (a total of 8992 dwellings), covering almost all swedish municipalities (259). For 5636 dwellings, the distribution was approximately log - normal with an overall geometric mean of 61 bq / m and an arithmetic mean of 107 bq / m . We used data from those municipalities with at least 10 measurements (141 municipalities and 8217 dwellings), and for each municipality, the average radon exposure for each of the two house types (single - family house and apartment house) was estimated . For those municipalities that had less than 10 measurements, an estimated average exposure was used (82 bq / m for apartments and 132 bq / m for single - family houses).thereafter, the national average exposure per person was estimated as a weighted average, with the weights equal to the number of persons living in single - family houses and apartments in each municipality . The arithmetic means were used in the calculations since the cancer risk in populations is associated with the population dose, which is represented by the arithmetic mean level multiplied with the size of the population . The second study was conducted in 2008 by the national board of housing, using multiple - stage stratified sampling . Each of the municipalities in sweden was classified into one of seven strata, and 30 municipalities were selected for measurements . From each of the 30 municipalities, a sample of dwellings was drawn, both single - family houses and apartments (in total 1819 dwellings). Each dwelling in which radon measurements were taken was assumed to represent dwellings of approximately the same age, temperature zone, and type of municipality (e.g., urban, rural). Weighting was used to calculate an average radon exposure per dwelling for seven strata with two house types in each (14 subgroups). The average exposure per person was estimated as a weighted average, with the weights equal to the number of people living in each of the 14 subgroups . The distribution of radon exposure was also estimated using these weights . In the following analyses, the lung cancer risk was assumed to increase linearly by 16% by increase in indoor radon by 100 bq / m, taking measurement error into consideration . Estimates of future cases and of prevented cases of lung cancer use constant lung cancer incidence rates as well as changed rates over time, with the size of the population and age distribution assumed to be the same in different radon exposure classes and unchanged over time . The number of lung cancer cases in relation to radon exposure is calculated in several steps . All estimated cases are divided into different intervals of radon concentration.estimate the radon concentration in dwellings around 1990.estimate the mean number of lung cancer cases per year in the period 20082012.from (2), estimate the mean number of lung cancer cases per year in the period 20082012 had the radon concentration been 0 bq / m in 1990.estimate the expected number of lung cancer cases in the future without radon exposure.estimate the radon concentrations in dwellings in 2010 based on measurements in 2008.from (4) and (5), estimate the number of lung cancer cases in the future caused by the radon concentration in 2010.make assumptions about the magnitude of exposure after measures to reduce it.estimate the expected number of lung cancer cases in the future after this exposure reduction.estimate the prevented number of lung cancer cases from (8) minus (6). Estimate the radon concentration in dwellings around 1990 . Estimate the mean number of lung cancer cases per year in the period 20082012 . From (2), estimate the mean number of lung cancer cases per year in the period 20082012 had the radon concentration been 0 bq / m in 1990 . Estimate the expected number of lung cancer cases in the future without radon exposure . Estimate the radon concentrations in dwellings in 2010 based on measurements in 2008 . From (4) and (5), estimate the number of lung cancer cases in the future caused by the radon concentration in 2010 . Estimate the expected number of lung cancer cases in the future after this exposure reduction . Estimate the prevented number of lung cancer cases from (8) minus (6). The radon exposure in 1990 was estimated by multiplying the arithmetic mean in single - family homes and apartments in each municipality with the number of persons living in these types of dwelling in the municipalities . Measurements were not taken in 40 out of 284 municipalities, corresponding to 4.6% of the total population in sweden in 1990 . For these municipalities, the weighted mean values from municipalities with at least 10 measurements were used . The estimated population - weighted radon exposure in 1990 was 113 bq / m (arithmetic mean), and in 2008, it was 90 bq / m, where the exposure was 120 bq / m in single - family homes and 55 bq / m in apartments . The distribution of radon exposure categories in the population in 1990 and 2010 is shown in table 1 . Approximately 8% of the population live in houses where the exposure is> 200 bq / m.table 1estimate of population distribution in different categories of radon exposure in 1990 and 2010radon exposure (bq / m)% in 1990% in 2010<5027.653.85010026.821.210020038.016.510015034.79.81502003.36.72004004.95.5>4002.73.0 estimate of population distribution in different categories of radon exposure in 1990 and 2010 table 2 shows the radon concentration in dwellings and the estimated number of lung cancer cases caused by radon in different exposure categories based on exposure data in 1990 . The mean radon exposure per person is estimated as 113 bq / m (line a, all), corresponding to a risk increase of 18% (line b).table 2radon (rn) concentration in dwellings and estimated number of lung cancer cases caused by radon in different exposure categories based on exposure data in 1990radon exposure bq / m calculated mean number of cases in 20082012 caused by rn exposure in 1990411062373070107591the mean radon exposure per person is estimated as 113 bq / m (line a, all). The increase in risk per 100 bq / m is assumed to be 16%, which corresponds to 18% at 113 bq / m a = data from pershagen et al ., b = 16% a, c = data from table 1, e = 3283 (3874/1.18) distributed according to c, f = e b, g = f e radon (rn) concentration in dwellings and estimated number of lung cancer cases caused by radon in different exposure categories based on exposure data in 1990 the mean radon exposure per person is estimated as 113 bq / m (line a, all). The increase in risk per 100 bq / m is assumed to be 16%, which corresponds to 18% at 113 bq / m a = data from pershagen et al ., b = 16% a, c = data from table 1, e = 3283 (3874/1.18) distributed according to c, f = e b, g = f e during the period 20082012, the actual mean number of lung cancer cases per year was 3874 (line d). If the exposure in 1990 had been 0 bq / m, the expected mean number of cases in 20082012 would have been 3283 (line e, expected number of cases attributable to other causes). Thus, the estimated number of lung cancer cases attributable to indoor radon exposure in 1990 was 591 (line g), with the most cases in the radon interval 100150 bq / m . Table 3 shows the radon concentration in dwellings and the estimated number of lung cancer cases in the future caused by the current mean radon exposure per person is estimated as 90 bq / m (line a, all), corresponding to a risk increase of 14.4% . Assuming that the baseline number of cases (cases attributable to other causes than radon) is again 3283 (line d), the estimated number of cases in the future, given the risk increase associated with the current exposure of 90 bq / m (line b), is estimated as 3756 (line e).table 3radon concentration in dwellings and the calculated number of lung cancer cases in the future in different exposure categories based on exposure data from 2008 and the distribution of the population in 2010radon exposure bq / m had been 0 in 1990 and 20101766696322220181983283e . Expected mean number of future cases at rn conc . = 90 bq / m in 201018477733852782612123756f . Calculated mean number of future cases caused by radon exposure in 20108177635880114473the mean radon exposure per person is estimated to 90 bq / m a = data from national board of housing, b = 16% a, c = data from table 1, d = 3283 (3874/1.18) distributed according to c, e = d b, f = e d radon concentration in dwellings and the calculated number of lung cancer cases in the future in different exposure categories based on exposure data from 2008 and the distribution of the population in 2010 the mean radon exposure per person is estimated to 90 bq / m a = data from national board of housing, b = 16% a, c = data from table 1, d = 3283 (3874/1.18) distributed according to c, e = d b, f = e d the expected number of cases in the future, based on the exposure data from 2008 (90 bq / m), is 3756 . The calculations are made under the assumption of unchanged lung cancer incidence over time as well as unchanged population size in different age intervals and the same age distribution in all radon exposure categories . The expected mean number of future cases if the exposure in 2008 had been 0 bq / m was 3283, the same value as in table 2 . Thus, the estimated number of future lung cancer cases attributable to indoor radon was 473, with the largest number at> 400 bq / m . Table 4 shows the number of lung cancer cases that could be prevented if the mean radon concentration in the dwellings with the highest concentrations was lowered . In the first scenario, concentrations above 100 bq / m are lowered to 100 bq / m . In this scenario, the future mean number of cases caused by radon would be reduced from 473 to 290 . The number of prevented cases is thus 183, which is 39% of the radon attributed lung cancer cases . In the second scenario, concentrations above 100 bq / m are lowered to 69 bq / m, (the mean value in the interval 50100 bq / m) and the mean number of cases caused by radon is 248, a reduction of 225 (48%). In the third scenario, only concentrations> 200 bq / m are reduced to 140 bq / m (the mean value in the interval 100200 bq / m) and 131 future cases (28%) would be prevented every year.table 4number of lung cancer cases that could be prevented if mean radon concentrations above 100 bq / m were lowered to 100 or 69 bq / m, or if concentrations> 200 bq / m were lowered to 140 bq / m radon exposure bq / m <5050100100150150200200400>400alla . Calculated mean number of future cases caused by radon after reduction in exposure to 100 bq / m 817752352916290 g . Calculated mean number of prevented cases after reduction in exposure to 100 bq / m 0011235198183h . Calculated mean number of future cases caused by radon after reduction in exposure to 69 bq / m 817735242011248j . Calculated mean number of prevented cases after reduction in exposure to 69 bq / m 00283460103225k . Calculated mean number of future cases caused by radon after reduction in exposure> 200140 bq / m 817763584122342 m . Calculated mean number of prevented cases after reduction in exposure to 140 bq / m 00003992131a = data from table 1, b = 3283 (3874/1.18) distributed according to a, c = b risk increase (from b in table 3), d = c b, e = b 1.16 in radon intervals> 100 bq / m, f = e b, g = d f, h = b 1.11 (1.16 0.69) in radon intervals> 100 bq / m, i = h b, j = d i, k = b 1.224 (1.16 1.4) in radon intervals> 200 bq / m, l = k b, m = d l number of lung cancer cases that could be prevented if mean radon concentrations above 100 bq / m were lowered to 100 or 69 bq / m, or if concentrations> 200 bq / m were lowered to 140 bq / m a = data from table 1, b = 3283 (3874/1.18) distributed according to a, c = b risk increase (from b in table 3), d = c b, e = b 1.16 in radon intervals> 100 bq / m, f = e b, g = d f, h = b 1.11 (1.16 0.69) in radon intervals> 100 bq / m, i = h b, j = d i, k = b 1.224 (1.16 1.4) in radon intervals> 200 bq / m, l = k b, m = d l the attributable fraction of lung cancer caused by residential radon exposure has been estimated in several studies . That 9% of deaths in lung cancer in europe is caused by radon exposure, such calculations have been reported from the usa, canada, germany, england, romania, spain, france, the netherlands, and sweden . The estimated proportion of radon - caused lung cancer varied between 3% in england and 20% in sweden . One reason for the variation in attributable fraction in addition to different levels of exposure to radon may be differences in smoking habits . Available data in the literature suggest a strong interaction effect between radon exposure and smoking status, which mean that smokers are at a much higher risk of dying from radon - induced lung cancer than nonsmokers . The conclusion from the beir vi report was that there is a sub - multiplicative interaction between radon and smoking and that any risk assessment for indoor radon needs to address the effect of radon on never smokers and ever smokers . Such risk assessments for radon exposure in relation to smoking status are seen in many studies [16, 2027]. The attributable fraction of lung cancer caused by radon is estimated to be 34 times higher in nonsmokers than in smokers [16, 20]. Even so, the absolute risk in nonsmokers is small and, therefore, we have, in our calculation, assumed the same relative risk in smokers and nonsmokers . The increase in risk per 100 bq / m varies in different meta - analyses . Zhang et al . Found an increase in risk of 7% in a meta - analysis of 22 studies comprising 13,380 cases and 21,102 controls . Darby et al . Reported in a meta - analysis of 13 european studies with 7148 cases and 14,208 controls an increase in risk of 16% taking measurement error into consideration . We have chosen to use risk estimate from this study in the calculations of the number of radon - caused lung cancer cases in sweden . Because the 95% ci was quite wide (531), the true number of lung cancer cases caused by radon may thus differ substantially from the point estimate . As in the study by darby et al ., all age groups and all histological groups were included in our analysis . Darby s study shows that the strongest association between radon exposure and lung cancer is found for small cell lung cancers, but increased risk of squamous cell carcinoma does not appear to be associated with radon . Squamous cell carcinoma accounted for 35% of all lung cancers in darby s study, but only 18% of cases in sweden from 2008 to 2012 . This suggests that the number of radon - caused lung cancer cases may be underestimated if darby s increased risk of 16% per 100 bq / m is used as the basis for calculations in swedish data . Estimates of the proportion of the population in 1990 and 2010 residing in a given radon interval are based on the radon epidemiological study of pershagen et al . And measurements made by the national board of housing in 2008 [13, 14]. The standard error of the mean is 4 bq / m . In this study, 113 if we had used data from only the controls of the case control study, the mean would have been 111 bq / m, since the exposure among the cases was approximately 5% higher than that of the controls . The bias is, however, negligible, since the estimated number of radon - caused lung cancers would be 584 (instead of 591) at a 16% increased risk from a 100 bq / m concentration . The proportion of residents living in the range of 100200 bq / m has more than halved from 38 to 17%, and the percentage of residents with an exposure <50 bq / m has doubled . However, the percentage of people living in houses> 200 bq / m is relatively constant . Possible reasons for the decreasing trend include decrease in the proportion of single - family homes, improved ventilation, radon remediation, and new construction techniques that reduce the risk of exposure . The change in exposure over this 20-year period can be assumed to reduce the number of radon - caused lung cancer cases from 591 to 473 cases per year . It should be noted that home energy efficiency interventions may have an opposite impact on future attempts to further reduce the indoor exposure to radon . This study shows how many future lung cancer cases could be prevented by various alternative reductions in exposure . Because the mortality rate for lung cancer is close to the incidence rate, the number of lives saved from lung cancer approximates that of prevented cases . The population living in 8.5% of the housing (> 200 bq / m) represent 41% of radon - caused lung cancer cases . If all dwellings above 200 bq / m had their exposure lowered to 140 bq / m, 131 cases would be prevented each year and the proportion of radon - caused cases from exposure over 200 bq / m would be reduced to 18% . If all exposures over 100 bq / m were lowered to 100 bq / m, 183 cases would be prevented, and if all over 100 bq / m were lowered to 69 bq / m, 225 cases would be prevented . These calculations are based on several assumptions, one being that the lung cancer incidence rate is constant over time . A general decline in lung cancer incidence as a result of changes in smoking habits would mean that the number of prevented radon - related lung cancer cases will be lower than that the calculation shows . Lung cancer in sweden decreased slightly among men from around 45 cases per 100,000 in 1980 to about 40 in 2012 . Among women, during the same period, the incidence rate increased sharply, from about 10 cases per 100,000 to about 40 (the same as men) in 2012 . Since 2009, the incidence rate in women has begun to decline . The decrease in both men and women occurred first in the lower age groups; however, rates continue to increase in men aged over 74 and women aged over 64 . If current trends continue, the total lung cancer incidence rate will decrease by about 0.5 to 1% per year . In 20 years, therefore, the total number of lung cancer cases may be 1020% lower than that today, mainly because of changed smoking habits, but also due to lower exposure to radon . The number of prevented radon - caused lung cancer cases may be about 15% lower than that the calculations indicate . Due to the interaction effect between smoking and radon exposure, the impact of declining smoking is larger than remediation of high - radon houses on the radon - related lung cancer cases . Other factors that affect the expected number of cases prevented in the future are population size and age distribution, i.e., when large birth cohorts reach the age when cancer is more common . In sweden, in 2030 there will be 15,00020,000 more 65-year - olds than there were 10 years earlier, while the number of 75-year - olds will be lower than a few years earlier . Thus, the number of lung cancers will depend on these population changes and how age - specific incidence rates change over time . Chen (2013) estimated the relationship between age, duration of exposure, and lifetime risk of lung cancer at different exposure levels using data from canada . The increase in risk is relatively constant up to age 60 if the exposure starts during the first years of life . After 60 years of exposure, there is a flattening of the lifetime risk . Estimates of the number of radon - caused lung cancers that can be prevented in different exposure classes are based on the assumption that smoking behavior is similar among the different exposure classes . Darby et al . Found in the analysis of 13 european case control studies that the percentage of never smokers was highest in the exposure classes> 400 bq / m . If this is also true in sweden, the calculated number of radon - caused lung cancers in these groups is overestimated . Although there are some uncertainties in the estimates, approximately 25 to 30% of lung cancer cases attributable to radon exposure could be prevented if all residential radon concentrations over 200 bq / m were lowered to 140 bq / m; if all exposures above 100 bq / m were lowered to 100 bq / m, about 35 to 40% of these cases could be prevented.
Worldwide, the population with diabetes is currently estimated at 366 million and is expected to exceed half a billion by 2030 . Foot ulcers are the principal cause of severe complications and hospitalization among patients with diabetes, substantially increasing the costs with this disease . In the united states, the annual cost of foot ulcers is estimated at us$11 billion . In brazil, the population aged 30 years and over with type 2 diabetes is estimated at 6.5 million . Among these, roughly 323 000 cases of foot ulcers are reported annually, 97 000 of which require hospitalization . Adding to the costs of managing infection, patients with diabetes are confronted with the risk of limb amputation, with rates 30 to 40 times higher than in individuals without the disease . Studies have shown the incidence of diabetic foot to be on the order of 3% to 4%, accounting for roughly 11 million patients with this condition in 2014 [5, 6]. Peripheral neuropathy, ulceration, infection, and peripheral vascular disease are the principal factors for ulcer complications and loss of a lower limb in diabetic patients [7, 8]. Nonetheless, ambiguity remains as to which factors are most conducive to amputation outcomes and how strongly they affect these events . Structured healthcare is one of the most effective approaches to reducing the indicators for diabetic foot amputation, and studies have shown that these can be reduced by as much as 75% . Factors such as low socioeconomic status, smoking [10, 11], gender, renal impairment, ischemia, diabetic neuropathy, and high levels of glucose and triglycerides have been reported as importantly associated with the risk of foot amputation . This study evaluated the effect that clinical, biochemical, epidemiological, and patient - behavior - related predictors have on amputation outcomes in patients with diabetic foot . Knowledge of these factors and their influence on this outcome is critical to enable multidisciplinary teams to develop management and treatment plans for diabetic patients so as to prevent the need for foot amputation . This cross - sectional study comprised 100 patients with diabetic foot hospitalized at the vascular surgery clinic of the conjunto hospitalar de sorocaba, in sorocaba county, so paulo state, southeastern brazil . Inclusion criteria were minimum age of 18 years, diagnosis of diabetes, presence of infected ulcers on a lower limb, and agreement to participate (expressed by signing a consent form). The project was approved by the research ethics committee of the universidade de sorocaba (opinion 0028/10) and complied with the ethical standards laid down in the 1964 declaration of helsinki and its later amendments . The patients responded to a structured questionnaire about their sociodemographic status, knowledge of the disease, previous antibiotic use, and compliance with diabetes treatment . Data on the clinical characteristics and health status of patients were collected from medical records . The clinical and laboratory evaluations were performed at the laboratory for diabetes conjunto hospitalar de sorocaba . Comorbidities had been evaluated by a group of specialists, based on consensus and guidelines [1519]. Compliance with outpatient treatment for diabetes was evaluated using the morisky test, which consists of four simple questions . Sometimes, if you feel worse when you take you medication, do you stop taking it? The higher the score, the more adherent the patient . Given the high prevalence of limb amputation, we estimated prevalence ratios and their respective confidence intervals (95% ci) for the univariate analysis of the relationships between variables and outcomes, using shapiro - wilk test, student's t - test, or mann - whitney test . The variables with p values of less than 0.25 were selected for multivariate analysis using the cox regression model with robust variance . Table 1 shows that age of the patients (n = 100; 32 women, 68 men) ranged from 31.9 to 89.7 years (median: 62 years), with 55% of patients older than 60 . Most patients were male (68%), caucasian (78%), poorly educated (69%), nonsmokers (81%), and alcoholics (84%) and had type 2 diabetes (99%). Of the total, 22% had been diabetic for less than five years, 24% from five to 10 years, 17% from 10 to 15 years, 16% from 15 and 20 years, and 21% for more than 20 years . In most patients, most had attended annual medical appointments (73%) and, over the past year, had attended more than three appointments (67%) and tested for blood glucose levels (86%). Glucose levels at admission ranged from 4.10 to 28.7 mmol / l (mean: 12.43 5.03 mmol / l). The most frequent chronic complications were neuropathy (91%), hypertension (72%), vascular peripheral disease (63%), retinopathy (42%), dyslipidemia (41%), nephropathy (26%), coronary insufficiency (23%), and cerebrovascular insufficiency (16%). On admission, 75% of patients had grade 4 ulcers, while 20% had grade 3 and 5% had grade 2 ulcers . Less than half of the patients had undergone a prior conventional, nonsurgical procedure (debridement) (45%) or amputation (32%). For 74%, most, however, had an ulcer of less than 2 cm (84%), gangrene (76%), and a neuroischemic diabetic foot (86%). Most patients showed signs of inflammation (89%) and had osteomyelitis (52%), which was also present with the high incidence of grade 4 ulcers (75%). Compliance with treatment was poor in 72% of patients (score 2 for 35 individuals, score 3 for 15, and score 4 for 15), while 27 were considered compliant (score 0 for 23 patients and score 1 for five). No statistically significant differences were observed in the prevalence of diabetic foot amputation with regard to gender, ethnicity, schooling, monthly income, alcohol consumption, or smoking . No statistically significant differences in the prevalence of diabetic foot amputation were detected based on the occurrence of comorbidities . However, 75% of patients with two or three previous hospital admissions for chronic complications required foot amputation, whereas only 52.6% of those with one single admission experienced this outcome (p = 0.043; table 2). Table 3 shows that 78.6% of poor compliers (morisky scores 0 or 1) had a foot amputated, whereas only 54.2% of compliant patients (scores 24) did so (p = 0.012). Patients with a history of conservative procedures had a lower prevalence of amputation than those not subjected to this procedure (p <0.001). However, previous amputation was unrelated to an amputation outcome (p = 0.255). Also, amputations were more frequent in patients with osteomyelitis than those lacking this condition (p <0.001; table 4). To identify variables independently associated with progression to amputation, cox multiple regressions (with robust variance) the association between ulcer grade (wagner criteria) and treatment compliance score (morisky test) was statistically significant (p = 0.014, chi - squared test). The prevalence of gangrene in patients with higher treatment compliance was 68.1%, rising to 92.8% in less compliant individuals (morisky scores 0 or 1; wagner grade 4). Therefore, two models were found on multivariate analysis: one using the morisky test (table 5) and the other employing wagner criteria (table 6). Amputation outcomes proved independently associated with previous conservative procedures, previous use of antibiotics, and morisky test scores or wagner criteria (tables 5 and 6). The risk of foot amputation for patients who had received conservative treatment was 63% lower than for those with a previous amputation (p <0.001; table 5), while for individuals previously treated with antibiotics the risk of foot amputation was 42% higher than for patients not subjected to this drug therapy (p = 0.026). Considering wagner grades, the risk of foot amputation was 61% lower in individuals who had previously undergone conservative procedures than in those who had not (p <0.001), table 6 . Among those previously treated with antibiotics, this risk was 36% higher than for those without antibiotic therapy (p = 0.042). Furthermore, for each unit increment in wagner grade, there was a 65% increase in the risk of foot amputation in patients admitted with infectious complications in a lower limb (p = 0.018). In most subjects (81%), blood glucose levels ranged from 5.55 to 16.65 mmol / l . Glucose levels below 11.09 mmol / l at admission are associated with lower morbidity and mortality, and proper glycemic control is a critical factor for the infection eradication and ulcer healing . Chronic hyperglycemia is the most frequent etiological factor for complications of diabetes mellitus [2225]. Neuropathy was reported in 91% of patients, coinciding with published data indicating a high prevalence of neuropathy in diabetic patients hospitalized for foot injuries . Retinal impairment and nephropathy are the two most common microvascular complications, both of which were present in the study population (at 42% and 26%, resp . ). In patients with diabetes, nephropathy is a marker for generalized vascular disease, and these patients are probably more susceptible to developing peripheral vascular disease . Recent studies also suggest that the incidence of diabetic foot ulcers is more frequent in individuals with micro- and macroalbuminuria [2830]. Patients who reported prior use of antibiotics had a 42% higher risk of major amputation than those not receiving antibiotic therapy . Previous prolonged use of antibiotics selects for resistant microorganisms, making treatment more difficult and increasing the risk of amputation . The present data suggest an increased risk of amputation in patients less compliant with drug therapy . Adherence to the prescribed therapy has led to significant improvements in the health and quality of life of patients with diabetes [7, 3337]. Compliance with medication is essential in chronic diabetes, improving control of disease progression and attenuating the severity of chronic complications . Reinforcement of guidelines on diabetes care and the importance of medication, both of which can increase treatment compliance, are facilitated when patients have more than three medical appointments per year . In the present investigation, patients with a history of antibiotic use had an increased risk of progressing to amputation . Each unit increment in ulcer severity (measured in wagner grades) increased the risk of amputation . Similar results were found in a brazilian study that demonstrated a directly proportional relationship between wagner grade and risk of limb amputation . It is worth noting, however, that the morisky test was originally developed for hypertension but has been used to evaluate drug treatment in patients with diabetes, a feature that may constitute a limitation of the present study . Another limitation is that information on previous use of antibiotics was self - reported rather than collected from medical records . Studies evaluating the extent of problems related to diabetic foot can provide elements for intervention policies and prevention programs particularly in government - funded healthcare services involving multidisciplinary teams specialized in diabetic foot care, ultimately ensuring improved treatment with more efficient use of resources . The present findings highlight that antimicrobial therapy protocols for outpatients with diabetic foot need reviewing . Control of the disease before hospitalization can significantly reduce amputations in patients with diabetic foot . Knowledge of these factors and their influence on amputation outcomes is critical to allow multidisciplinary teams to develop management and treatment protocols for patients with diabetes . The present findings show that limb amputation outcomes were strongly lowered by conservative treatment and compliance with diabetes drug therapy . Implemented in a preventive manner, these two measures can significantly reduce lower limb amputation in patients with diabetes.
The prevalence of pterygium varies from country to country relative to proximity to the equator . The prevalence of pterygium is 2%7% in the us and 1.1% in australia.1,2 the beijing study showed the prevalence of pterygium to be 3%, while in tehran its prevalence is 1.3%.3,4 it has a prevalence of 19.6% in those aged 40 years in rural myanmar according to a population - based cross - sectional survey.5 however, in nepal, there is no exact population - based study showing the prevalence of pterygium . Pterygium is a degenerative ocular surface disorder with wing - shaped fibrovascular growth of the bulbar conjunctiva onto the cornea, which is strongly correlated with ultraviolet light exposure, dryness, exposure to wind, dust, and heat, and oncogenes or viruses . It is most common in the nasal site, suggesting possible light reflectivity from the nasal bridge over the pterygium site, but it can also occur in the temporal site . Destruction of bowman s layer by fibrovascular ingrowth, which causes mild inflammatory changes in the cornea as well as the conjunctiva, has been demonstrated . The epithelium may be normal, thick, or thin, but it may occasionally show dysplasia . Pterygium has a bimodal age distribution, occurring particularly in the young and the elderly.1,68 treatment of pterygium is surgical . In general, conservative therapy for pterygium is warranted unless one of the following is present: loss of visual acuity because of induced astigmatism or encroachment onto the visual axis, marked cosmetic deformity, marked discomfort and irritation unrelieved by medical management, limitation of ocular motility secondary to restriction, or documented progressive growth toward the visual axis so that ultimate loss of vision can reasonably be assumed . In such circumstances, the fact that numerous different techniques exist for the surgical treatment of pterygium underscores the point that no single approach is universally successful.9 susruta first described the surgical methods for pterygium in 1897 . Since then, many authors have described a considerable number of surgical techniques for its management . There are many surgical techniques, including pterygium excision with bare sclera, conjunctival autografting, amniotic membrane grafting, and adjuvant use of mitomycin c or thiotepa kenyon and colleagues reported the first use of free conjunctival autografting for pterygium surgery in 1985.11 several large multicenter studies have shown that conjunctival autografting has a low recurrence rate, and in all these studies the graft was taken from the superior bulbar conjunctiva.1018 however, there is limited information available regarding the efficacy of a graft taken from the inferior conjunctiva . The purpose of this study was to determine the outcome of surgery using inferior conjunctival autografting and to address the importance of preserving the glaucoma filtration site . This was a prospective, noncomparative, interventional case series study enrolling 50 eyes of 50 patients with pterygium between november 1, 2010 and october 30, 2011 at geta eye hospital, dhangadhi, nepal . The patients were informed about the design of the study and procedure, and written informed consent was obtained from all patients . Only primary pterygium cases were included . Patients with a major systemic or ocular surface disease or a history of earlier ocular surgery or trauma were excluded . Best - corrected snellen visual acuity, intraocular pressure, and details of slit - lamp and fundus examination were recorded before surgery . We categorized pterygium as grade 1 if <3.5 mm and grade 2 if> 3.5 mm in horizontal dimension . Indications for surgery were classified as symptomatic pterygium if causing redness or irritation on more than three occasions per year, visually threatening pterygium if very close to pupillary border, and cosmetic pterygium if small and the patient wanted surgery . All of the patients underwent our standard surgical technique of pterygium excision followed by inferior conjunctival autografting . Three ophthalmologists performed the surgery under retrobulbar block using 3 ml of 2% xylocaine + epinephrine 1:8000 + 1.5 ml of bupivacaine . After painting the lids and periocular area with 5% povidone iodine and draping, a lid speculum was applied . The head of the pterygium was dissected from the cornea using a no 11 blade, and its corpus and underlying tenon s capsule were trimmed using westcott scissors up to 5 mm away from the limbus . Subconjunctival fibrous tissue under the pterygium was excised much more widely than the area covered by the pterygium . The rough surface of the corneal bed was dissected with colibri, and smoothed with a 20-gauge bevel up crescent blade . We took a roughly appropriate - sized graft of bare sclera from the adjacent inferior bulbar conjunctiva after blunt dissection of the conjunctiva without the tenon s capsule . This graft was rotated over the excised area and sutured with 8/0 vicryl . The eye was patched and ocupol - d (chloramphenicol 10 mg + dexamethasone 1 mg / g) ointment was applied at the end of surgery . After surgery, biomicroscopic examination was performed on the first day, and topical pyrimon (chloramphenicol 1% + dexamethasone 0.1%) eye drops were administered as one drop four times a day for the first week and tapered until one month . Patients also received ocu - mycin (chloramphenicol 1%) ointment at bedtime for the first 2 weeks . On postoperative day 7, we removed residual sutures if present with plain forceps and vannas scissors under topical anesthesia using 4% xylocaine eye drops . If graft swelling was present at week 1 after surgery, suture removal was delayed until disappearance of the swelling . We also examined the patients at months 1, 3, and 6 postoperatively, and evaluated for graft retraction, graft necrosis, suture granuloma, tenon s cyst, and recurrence . We followed the definition of recurrence as growth of fibrovascular tissue encroaching towards the cornea from the limbus as described by sebban and hirst.19 the main outcome measures were recurrence of pterygium and complications . Data were entered into spss version 12 (spss inc, chicago, il), and were expressed as the frequency, percentage, mean, standard deviation, and range, as applicable . All of the patients underwent our standard surgical technique of pterygium excision followed by inferior conjunctival autografting . Three ophthalmologists performed the surgery under retrobulbar block using 3 ml of 2% xylocaine + epinephrine 1:8000 + 1.5 ml of bupivacaine . After painting the lids and periocular area with 5% povidone iodine and draping, a lid speculum was applied . The head of the pterygium was dissected from the cornea using a no 11 blade, and its corpus and underlying tenon s capsule were trimmed using westcott scissors up to 5 mm away from the limbus . Subconjunctival fibrous tissue under the pterygium was excised much more widely than the area covered by the pterygium . The rough surface of the corneal bed was dissected with colibri, and smoothed with a 20-gauge bevel up crescent blade . We took a roughly appropriate - sized graft of bare sclera from the adjacent inferior bulbar conjunctiva after blunt dissection of the conjunctiva without the tenon s capsule . The eye was patched and ocupol - d (chloramphenicol 10 mg + dexamethasone 1 mg / g) ointment was applied at the end of surgery . After surgery, biomicroscopic examination was performed on the first day, and topical pyrimon (chloramphenicol 1% + dexamethasone 0.1%) eye drops were administered as one drop four times a day for the first week and tapered until one month . Patients also received ocu - mycin (chloramphenicol 1%) ointment at bedtime for the first 2 weeks . On postoperative day 7, we removed residual sutures if present with plain forceps and vannas scissors under topical anesthesia using 4% xylocaine eye drops . If graft swelling was present at week 1 after surgery, suture removal was delayed until disappearance of the swelling . We also examined the patients at months 1, 3, and 6 postoperatively, and evaluated for graft retraction, graft necrosis, suture granuloma, tenon s cyst, and recurrence . We followed the definition of recurrence as growth of fibrovascular tissue encroaching towards the cornea from the limbus as described by sebban and hirst.19 the main outcome measures were recurrence of pterygium and complications . Data were entered into spss version 12 (spss inc, chicago, il), and were expressed as the frequency, percentage, mean, standard deviation, and range, as applicable . We performed surgery on 58 eyes from 58 patients, but eight patients were lost to follow - up . Hence, in this study, we enrolled only 50 eyes from the 50 patients who completed the six months of follow - up . Table 2 shows that patients in the younger age groups and those engaged in outdoor occupations had a tendency to recurrence of pterygium . We observed conjunctival scarring at the donor site in four eyes (8%); however, there was no symblepharon formation or restriction of upgaze . The diversity of techniques reflects the ongoing surgical challenge to devise the best method for treating pterygium . Our surgical technique aims to preserve the glaucoma filtration site and, unlike most of the other autoconjunctival techniques, the graft is taken from the inferior conjunctiva . In our study, most patients were farmers (50%) and laborers (34%) who have to work outside for long periods and are exposed to the hazardous effects of infrared and ultraviolet radiation present in sunlight . These findings are similar to those of most of the published studies.8,9,20 the indication for surgery in our study was mainly symptomatic pterygium . Nazzulah et al reported a similar indication.21 we detected recurrence in two (4%) of 50 eyes treated with inferior autografting in our series . In 1985, kenyon et al11 published a report describing conjunctival autografting as a promising technique in the treatment of pterygium . They documented a recurrence rate of 5.3% in the primary pterygium group . Since then, several papers on the success of conjunctival grafting have been published, with varying success rates.1218 possible reasons for the wide variation in success of conjunctival autografting in these studies include case selection bias by different surgeons, varying surgical techniques, and variation in ability on the part of individual surgeons . Syam et al have described the success of pterygium excision followed by inferior conjunctival autografting at a sussex hospital in the uk . Surgery was performed by an experienced surgeon in 23 patients and by trainees in the remaining four cases . There was no symblepharon formation.22 our study showed a recurrence rate of 4% and our findings were similar for minor complications . This could be due to our short follow - up period.22 complications resulting from inferior conjunctival autografting are not serious and pose no threat to vision . The procedure was performed by making a flap of the inferior conjunctiva after excision of the pterygium, and transposing it to make a covering for the bare sclera and donor site as a barrier to pterygium tissue . This method was used in 54 eyes from 50 patients of mean age 47 (range 1869) years with primary pterygium . During a mean follow - up period of 20 (range 1226) months, the pterygium recurred in three (5.6%) of the 54 eyes . The authors concluded that the inferior conjunctival transposition flap is a promising technique for treatment of primary pterygium.23 although our report shows a slightly better outcome in terms of recurrence than that report, we would need a more prolonged follow - up period to make a meaningful comparison of the results of these two studies . Koc et al24 demonstrated that autografting from superior or inferior sites in primary pterygium cases showed no significant difference in recurrence rate, but in the event of recurrent pterygia, autografting from the inferior site resulted in a significantly (p = 0.166) higher likelihood of recurrence . . Their analysis of survival curves showed that there was a 50% chance of recurrence within the first 120 days and a 97% chance that there would be a recurrence by 12 months after surgery . In contrast with these findings, ti et al25 reported that most recurrences following conjunctival autografting tend to occur within 6 months of surgery . Generally, recurrences of pterygium also occur during the first 6 months after surgery as observed by adamis et al.26 our study has the shortcoming of a follow - up period of only 6 months . A larger - scale, longer - term study will be needed to identify the optimal follow - up period . Guler et al reported a recurrence rate of 13.3% in patients under 40 years of age who were followed up after autograft transplantation.27 in contrast, the recurrence rate was reported to be highest (at 42.3%) in the 4050-year age group in another series, with no statistically significant difference between groups younger or older than 40 years.28 our study shows a tendency for pterygium recurrence in the younger age groups . There was a tendency for recurrence in patients younger than 40 years, but this was not statistically significant . It is a useful technique when it is not possible or desirable to use the superior conjunctiva as a donor source . In countries like nepal where there is a lack of public awareness about the devastating effects of glaucoma, attendance and regular follow - up in the early stages of the disease at eye centers is very unlikely . Patients may have glaucoma and pterygium together, and surgeons may miss glaucoma in the early stages . It is also true that patients with glaucoma usually present to hospital at a late stage, when glaucoma filtration may be the only option, and even when the patient presents early on, they may need glaucoma surgery if medical therapy is unsuccessful . We can use the inferior bulbar conjunctiva safely and effectively for grafting in pterygium surgery as a surgical alternative for preserving the glaucoma filtration site in the future . We recommend further investigations in larger numbers of patients and for longer periods of follow - up to make this surgical method universally applicable.
Neurofibromatosis type 2 (nf2) is an autosomal dominant disease consequent to mutation of both alleles of a suppressor tumor gene in the long arm of chromosome 221 2 . Progressive sensorineural hearing loss is almost certain, accompanied or not with dizziness and tinnitus . The first attempt at auditory restoration in a patient with nf2 and profound hearing loss was conducted by house and hitselberger in 19793 . Auditory brainstem implant (abi) has been the standard surgical treatment for these patients, to recover some degree of auditory capability and to enhance lip reading . In the 1990s, the promising idea of using a cochlear implant for auditory restoration became feasible . The aim of this study is to describe a ase of a nf2-deafened - patient who underwent to vestibular schwannoma resection via retrolabyrinthine approach, with cochlear nerve preservation and cochlear implantation through the round window, at the same surgical time . A 36-year - old woman with nf2 presented with a complaint of bilateral progressive sensorineural hearing loss for 10 years, which was similar in both ears . In 2009 she had undergone to partial tumor resection for facial nerve preservation on the left side at another institution . After surgery coronal magnetic resonance imaging of the temporal bone showing bilateral cerebellopontine angle tumors with homogeneous enhancement after gadolinium injection on t1-weighted sequence, measuring 1.5 cm on the right side and 3.0 cm on the left side . Due to the size of the tumor we believed it would be more convenient to attempt hearing preservation in the right ear and to try a cochlear implant . After counseling she agreed with and accepted surgery . In march 2010, the patient underwent retrolabyrinthine approach with complete tumor resection and anatomic preservation of the cochlear and facial nerves . The retrolabyrinthine approach was performed with the patient placed in the classic supine position with the head rotated away from the surgeon . A retroauricular incision was made three centimeters posterior to the auricular sulcus extending to the mastoid tip . A muscle flap was placed anteriorly, allowing for the posterior retraction of the periosteum in order to drill the place into which the receiver / stimulator was lodged . A wild mastoidectomy was performed, exposing the entire posterior fossa dura mater, the sigmoid sinus and the jugular bulb . The posterior semicircular canal was partially drilled and obliterated, and the meatal plane was skeletonized . The posterior dura was opened from the base of the iam to the anterior edge of the jugular bulb, extending to the edge of the sigmoid sinus . After cisternal drainage of cerebral spinal fluid the meatal plane was longitudinally opened and the tumor removed (figure 2a). Of the retrolabyrinthine approach with vestibular schwannoma being removed (arrow) (a). View of the posterior tympanotomy approach with electrode array inserted in the coclea via round windown (arrow head) (b). (mfd, middle fossa dura - mater; pfd, posterior fossa dura - mater; psc, posterior semi - circular canal; lsc, lateral semi - circular canal). The functional assessment of the cochlear nerve was evaluated through electrical promontory stimulation, which demonstrated present responses with poor morphology an unreliable reproducibility . Subsequently, cochlear implantation of a nucleus 24re contour advance (cochlear ltd ., lane cove, australia) through the round window was performed . The electrode array was partially inserted (6 active electrodes out) (figures 2b, 3). The patient had absent intraoperative neural response telemetry (nrt) in electrodes 1, 22, 11, 6 and 16 with 25s (figure 4a) and also in electrodes 11 and 15 with 50s (figure 4b). High - resolution coronal (a) and axial (b) ct scans of the temporal bones showing insertion of the electrode array into the middle and basal turns of the cochlea . Intra - operative nrt showing absent evoked potentials on electrodes 1, 22, 11, 6, and 16 at 25-s pulse width (a) and on electrodes 11 and 15 at 50-s pulse width (b). The cochlear implant was activated four weeks after surgery, with a freedom speech processor with hearing sensation in 5 electrodes with advanced combination encoders (ace) speech coding strategy 900hz of stimulation rate and 5 maxima, with 75s pulse width . Two months after activation she was referred to auditory training with a speech pathologist . With the increase in pulse width (150s), the mean tonal threshold was 46.2 dbhl . Despite the auditory training and the improvement in hearing thresholds, the patient could only detect environmental sounds and human voice but cannot discriminate vowels, words nor do sentences at 2 years of follow - up . Sound field hearing threshold before and 48 months after surgery with the cochlear implant in the right ear . Cueva et al.5 elicited auditory sensation through electrical promontory stimulation in 6 patients with nf2 who underwent tumor removal with cochlear nerve preservation . Since then, about 31 cases of cochlear implantation in nf2 patients have been reported in the literature6 7 8 9 10 11 12 13 14 15 16 . Regardless of the time of cochlear implantation or the approach used, these studies have reported a diverse range of speech perception outcomes, from no benefit to significantly better speech discrimination14 . The previously described approaches for ci in these patients were translabyrinthine, retrosigmoid or middle cranial fossa . The translabyrinthine approach for schwannoma removal is a highly destructive method, and degenerative changes in the cochlea such as fibrosis or ossification are more pronounced and occur in a short time13 . Thus, we hypothesized that the rla with simultaneous cochlear implantation could bring better results . It is also less technically demanding and reduces the risk of major complications16 . As an attempt to avoid the overall poor hearing results of abi and to limit the adverse effects of direct brainstem stimulation, cochlear implantation has been proposed and successfully performed in this case . Surgical tumor resection may result in mechanical or thermal injury to the cochlear nerve or labyrinthine artery and traction on the eighth nerve may cause avulsion of delicate auditory fibers at the habenula perforata16 . Nevertheless, more than 80% of such patients are left with an anatomically intact auditory nerve16 . Thus, although anatomic conservation of the cochlear nerve is fundamental, if the functional preservation is not achieved, the auditory results may be poor . The use of electrical promontory stimulation testing is controversial as positivity does not guarantee cochlear implant performance . Our patients test showed present responses and cochlear implant was performed with improvement in hearing thresholds, but she cannot discriminate speech . Cochlear implantation is a feasible auditory restoration option in nf2 when cochlear anatomic and functional nerve preservation is achieved . The rla approach was adequate for this purpose and presents an option for hearing preservation in nf2 patients.
Myocardial infarction (mi) remains a leading cause of morbidity and mortality, resulting in 12.8% of deaths worldwide (1, 2). Many therapeutic options, ranging from pharmaceutical therapeutics to mechanical procedures, are available for acute myocardial infarction (3). Reactive oxygen species (ros) play an important role in the pathogenesis of cardiovascular diseases . Many studies have reported an association between such diseases and oxidative damage to cardiac cells . This association might be caused by an increased rate of free radical formation and/or weakening of the antioxidant defense system (4,5). When the antioxidant defense system does not fully neutralize the effects of ros, ros can react with various cellular components, including phospholipids and proteins, resulting in lipid peroxidation and the oxidation of thiol groups . These oxidation reactions impair the normal functions of cell membranes and various cellular proteins, resulting in cardiac injury (due to inflammation, apoptosis, and cell death) (68). Cellular cardiomyoplasty is a new potential therapeutic approach that uses exogenous cells to repair regions of damaged myocardium . Improved heart function following the transplantation of mesenchymal stem cells (mscs) has been reported in animal models of acute mi as well as in clinical studies on patients with heart failure (9). Various favorable characteristics, such as multilineage differentiation potential, ability to evade the host immune system, immunomodulatory capacities, and ease of proliferation in vitro, make mscs particularly attractive for cell therapy (10). It has been well established that msc infusion improves the function of infarcted myocardium (11). Several mechanisms have been proposed to explain the ability of mscs to revive ischemic tissues . These mechanisms include the following: 1) secretion of antioxidant chemicals and free radical scavengers at the site of ischemia, 2) secretion of multiple angiogenic growth factors (e.g., vascular endothelial growth factor (vegf) and hepatocyte growth factor (hgf)) with the potential to induce endothelial growth, migration, and tube formation, and 3) differentiation of transplanted mscs into myocytes, smooth muscle cells, and endothelial cells (12). Despite the several advantages of mscs, they have not shown satisfactory outcomes in many investigations, mostly due to their poor survival rate after transplantation (1317). In fact, more than 99% of transplanted mscs die within one day after transplantation, there are no well - defined reasons for this low survival rate . However, it is worth noting that, during the isolation of mscs from their natural niche, they are inevitably exposed to harmful conditions, such as serum deprivation, hypoxia, and oxidative stress (18). However, due to radiotherapy, chemotherapy, inflammation, and expression of pro - apoptotic factors, the microenvironment of the damaged tissues of recipients is not favorable for the survival of transplanted mscs (19). Hence, to develop an effective therapeutic modality, it is necessary to strengthen mscs so they can withstand such stresses (20). It seems that higher survival rates of mscs can improve infarcted tissues through the secretion of protective factors and/or differentiation of the mscs . Novel strategies are being developed to improve the biological and functional properties of mscs, such as preparation of the cells in special bioscaffolds (21), preconditioning of the cells in cultures (14, 15), and genetic transformation (10). Nuclear factor e2-related factor 2 (nrf2) is a potent transcription factor that is critical for the protection of cells against oxidative stresses . Activation of nrf2 as a redox - sensor under stress conditions up - regulates the transcription of phase ii detoxification enzymes and antioxidant proteins, such as nad (p)h: quinone oxidoreductase (nqo1), glutathione s - transferases (gsts), glutamate - cysteine ligase, heme oxygenase-1(ho-1), thioredoxin, and ferritin (22, 23). Up - regulation of these factors in transplanted cells protects the cells against the ros produced in mi tissue . We recently showed that adenoviral - mediated nrf2 over - expression in mscs reduces oxidative stress - induced apoptosis and cytotoxicity . Also, we showed that over - expression of nrf2 had no deleterious effect on the differentiation capability of mscs . We hypothesized that over - expression of nrf2 in mscs (nrf2-mscs), can effectively improve the efficiency of the transplantation of mscs, thereby enhancing cellular cardiomyoplasty . Nrf2 over - expression can protect mscs against oxidative stresses encountered in the microenvironment of infarcted tissue . Activation of the nrf2 signaling pathway is an important mechanism for protecting cells against oxidative stresses (24). Under non - stimulated conditions, nrf2 is retained in cytoplasm via interaction with the anchor protein, kelch - like ech - associated protein-1 (keap1), where it is maintained at a very low level by the keap1-dependent ubiquitination and proteasomal degradation systems (2528). This interaction sequesters most of the nrf2 molecules in the cytoskeleton and keeps them away from the nucleus . The cysteine - rich surface of keap1 is oxidized in cases of oxidative and nitrosative stresses . This apparently produces a conformational change in keap1, resulting in dissociation of nrf2 from keap1 . Then, the released nrf2 is translocated to the nucleus, heterodimerizes with small maf proteins, and then binds to the antioxidant response element (are), a common regulatory element found in the 5-flanking regions of the antioxidant and detoxification enzymes (fig . 1) (2932). Further activation of nrf2 is mediated through phosphorylation of nrf2 by mitogen - activated protein kinases (mapks), protein kinase c (atypical isoform), and phosphoinositol-3-kinase (pi3k). Nrf2 effector genes that bear antioxidant response elements include a majority of the antioxidant proteins (e.g., gcl, ho-1, and thioredoxin) and phase ii detoxifying enzymes (e.g., nqo1 and gsts) (26). Theoretically, the survival rate of the mscs will increase in stressful, oxidative environment of the infarcted myocardium by over - expression of nrf2, resulting in higher potential of the mscs to repair the ischemic tissue . As mentioned earlier, we previously showed that over - expression of nrf2 in mscs protects them against various stresses . In addition, these engineered cells produce higher levels of antioxidants, such as sod and ho-1 . Also, the nrf2-mscs showed less apoptosis when exposed to oxidative stresses (10). Furthermore, over - expression of nrf2 probably confers some additional benefits to mscs after they are transplanted . It has been shown that nrf2 has a role in the formation of blood vessels through the induction of the expression of vegf and hif-1 target genes (33). The progression of angiogenesis is highly advantageous in the treatment of ischemic myocardium (34). We could find no study that had been performed to evaluate the effect of nrf2 over - expression on differentiation of mscs into myocytes, smooth muscle cells, and endothelial cells . Because of the importance of nrf2 signaling in anti - oxidative pathways, various studies have focused on the activation of nrf2 for cardio - protection . They have shown that the application of various factors, such as carbon monoxide, red wine, fumarate, hydrogen sulfide, and acute exercise, mediates cardio - protection through promotion of antioxidant mechanisms by activation of the nrf2 antioxidant pathway (3540). To evaluate these hypotheses, next, nrf2 must be over - expressed in the authenticated mscs, and it is suggested that this be performed with the adenoviral expression system for transient over - expression of nrf2, as described in our previous study (10). Then, after the evaluation of the safety concerns related to thenrf2 over - expression in mscs has been conducted, the mscs must be transplanted to the infarcted myocardium of mi patients via intramyocardial injection . Then, biochemical and histological analyses must be performed to evaluate the effects of nrf2 over - expression in mscs on cardiac function . Myocardial infarction (mi) remains a leading cause of morbidity and mortality, resulting in 12.8% of deaths worldwide (1, 2). Many therapeutic options, ranging from pharmaceutical therapeutics to mechanical procedures, are available for acute myocardial infarction (3). Reactive oxygen species (ros) play an important role in the pathogenesis of cardiovascular diseases . Many studies have reported an association between such diseases and oxidative damage to cardiac cells . This association might be caused by an increased rate of free radical formation and/or weakening of the antioxidant defense system (4,5). When the antioxidant defense system does not fully neutralize the effects of ros, ros can react with various cellular components, including phospholipids and proteins, resulting in lipid peroxidation and the oxidation of thiol groups . These oxidation reactions impair the normal functions of cell membranes and various cellular proteins, resulting in cardiac injury (due to inflammation, apoptosis, and cell death) (68). Cellular cardiomyoplasty is a new potential therapeutic approach that uses exogenous cells to repair regions of damaged myocardium . Improved heart function following the transplantation of mesenchymal stem cells (mscs) has been reported in animal models of acute mi as well as in clinical studies on patients with heart failure (9). Various favorable characteristics, such as multilineage differentiation potential, ability to evade the host immune system, immunomodulatory capacities, and ease of proliferation in vitro, make mscs particularly attractive for cell therapy (10). It has been well established that msc infusion improves the function of infarcted myocardium (11). Several mechanisms have been proposed to explain the ability of mscs to revive ischemic tissues . These mechanisms include the following: 1) secretion of antioxidant chemicals and free radical scavengers at the site of ischemia, 2) secretion of multiple angiogenic growth factors (e.g., vascular endothelial growth factor (vegf) and hepatocyte growth factor (hgf)) with the potential to induce endothelial growth, migration, and tube formation, and 3) differentiation of transplanted mscs into myocytes, smooth muscle cells, and endothelial cells (12). Despite the several advantages of mscs, they have not shown satisfactory outcomes in many investigations, mostly due to their poor survival rate after transplantation (1317). In fact, more than 99% of transplanted mscs die within one day after transplantation, there are no well - defined reasons for this low survival rate . However, it is worth noting that, during the isolation of mscs from their natural niche, they are inevitably exposed to harmful conditions, such as serum deprivation, hypoxia, and oxidative stress (18). However, due to radiotherapy, chemotherapy, inflammation, and expression of pro - apoptotic factors, the microenvironment of the damaged tissues of recipients is not favorable for the survival of transplanted mscs (19). Hence, to develop an effective therapeutic modality, it is necessary to strengthen mscs so they can withstand such stresses (20). It seems that higher survival rates of mscs can improve infarcted tissues through the secretion of protective factors and/or differentiation of the mscs . Novel strategies are being developed to improve the biological and functional properties of mscs, such as preparation of the cells in special bioscaffolds (21), preconditioning of the cells in cultures (14, 15), and genetic transformation (10). Nuclear factor e2-related factor 2 (nrf2) is a potent transcription factor that is critical for the protection of cells against oxidative stresses . Activation of nrf2 as a redox - sensor under stress conditions up - regulates the transcription of phase ii detoxification enzymes and antioxidant proteins, such as nad (p)h: quinone oxidoreductase (nqo1), glutathione s - transferases (gsts), glutamate - cysteine ligase, heme oxygenase-1(ho-1), thioredoxin, and ferritin (22, 23). Up - regulation of these factors in transplanted cells protects the cells against the ros produced in mi tissue . We recently showed that adenoviral - mediated nrf2 over - expression in mscs reduces oxidative stress - induced apoptosis and cytotoxicity . Also, we showed that over - expression of nrf2 had no deleterious effect on the differentiation capability of mscs . We hypothesized that over - expression of nrf2 in mscs (nrf2-mscs), can effectively improve the efficiency of the transplantation of mscs, thereby enhancing cellular cardiomyoplasty . Nrf2 over - expression can protect mscs against oxidative stresses encountered in the microenvironment of infarcted tissue . Activation of the nrf2 signaling pathway is an important mechanism for protecting cells against oxidative stresses (24). Under non - stimulated conditions, nrf2 is retained in cytoplasm via interaction with the anchor protein, kelch - like ech - associated protein-1 (keap1), where it is maintained at a very low level by the keap1-dependent ubiquitination and proteasomal degradation systems (2528). This interaction sequesters most of the nrf2 molecules in the cytoskeleton and keeps them away from the nucleus . The cysteine - rich surface of keap1 is oxidized in cases of oxidative and nitrosative stresses . This apparently produces a conformational change in keap1, resulting in dissociation of nrf2 from keap1 . Then, the released nrf2 is translocated to the nucleus, heterodimerizes with small maf proteins, and then binds to the antioxidant response element (are), a common regulatory element found in the 5-flanking regions of the antioxidant and detoxification enzymes (fig . 1) (2932). Further activation of nrf2 is mediated through phosphorylation of nrf2 by mitogen - activated protein kinases (mapks), protein kinase c (atypical isoform), and phosphoinositol-3-kinase (pi3k). Nrf2 effector genes that bear antioxidant response elements include a majority of the antioxidant proteins (e.g., gcl, ho-1, and thioredoxin) and phase ii detoxifying enzymes (e.g., nqo1 and gsts) (26). Theoretically, the survival rate of the mscs will increase in stressful, oxidative environment of the infarcted myocardium by over - expression of nrf2, resulting in higher potential of the mscs to repair the ischemic tissue . As mentioned earlier, we previously showed that over - expression of nrf2 in mscs protects them against various stresses . In addition, these engineered cells produce higher levels of antioxidants, such as sod and ho-1 . Also, the nrf2-mscs showed less apoptosis when exposed to oxidative stresses (10). Furthermore, over - expression of nrf2 probably confers some additional benefits to mscs after they are transplanted . It has been shown that nrf2 has a role in the formation of blood vessels through the induction of the expression of vegf and hif-1 target genes (33). The progression of angiogenesis is highly advantageous in the treatment of ischemic myocardium (34). We could find no study that had been performed to evaluate the effect of nrf2 over - expression on differentiation of mscs into myocytes, smooth muscle cells, and endothelial cells . Because of the importance of nrf2 signaling in anti - oxidative pathways, various studies have focused on the activation of nrf2 for cardio - protection . They have shown that the application of various factors, such as carbon monoxide, red wine, fumarate, hydrogen sulfide, and acute exercise, mediates cardio - protection through promotion of antioxidant mechanisms by activation of the nrf2 antioxidant pathway (3540). To evaluate these hypotheses, next, nrf2 must be over - expressed in the authenticated mscs, and it is suggested that this be performed with the adenoviral expression system for transient over - expression of nrf2, as described in our previous study (10). Then, after the evaluation of the safety concerns related to thenrf2 over - expression in mscs has been conducted, the mscs must be transplanted to the infarcted myocardium of mi patients via intramyocardial injection . Then, biochemical and histological analyses must be performed to evaluate the effects of nrf2 over - expression in mscs on cardiac function . It is expected that the over - expression of nrf2 in mscs will protect the mscs against the unfavorable conditions of the infarcted tissue (such as oxidative stresses), increase their survival rate in the infarcted tissue, and improve their function in repairing the injured tissue.
Diabetes mellitus (dm) is a group of disorders associated with a quantitative reduction in insulin production or a qualitative reduction in the action of insulin leading to changes in carbohydrate, protein, and lipid metabolism and accumulation of glucose in the bloodstream . The prevalence of type 2 diabetes for all age groups worldwide was 2.8% in 2000 and estimated to be 4.4% in 2030 . The prevalence rate of diabetes in india in urban areas is 9%, in rural areas also increased to 3% of the total population, and the ratio of patients with unknown to known diabetes is 1.8:1 . This can be primarily attributed to the fact that the condition is usually undetected in its early stages in most individuals, whereas in other individuals, the existing symptoms are often overlooked because of ignorance or negligence on the part of the patient . Clinical studies have established that periodontal diseases are more prevalent and of greater severity in patients with diabetes than in nondiabetic patients . Screening for diseases is to identify those who have an increased likelihood of developing a disease or experiencing an increase in disease severity as a first step in disease prevention and control . There will be a greater likelihood of a favorable prognosis when a disease is discovered while it is still relatively incipient . The early diagnosis of diabetes, however, might help to prevent its long - term complications that are responsible for the high morbidity and mortality of diabetes patients . To our knowledge, there are very limited studies on screening of undiagnosed diabetes with gingival blood in dental patients . Therefore, the aim of this study is screening of undiagnosed diabetes with gingival blood sample in patients attending to the dental hospital and to check the reliability with standard method . After receiving the approval of the ethical committee, rmdc and h, 550 patients age ranged from 30 to 50 years were randomly selected from the outpatient department of periodontics . Patients with no known previous history of diabetes and having any risk factors like family history of diabetes, hypertension, high cholesterol, overweight / obesity with at least one tooth that bleed on probing were included in the study . Patients with known diabetes, pregnancy, any other systemic diseases were excluded from the study . Patients either with known diabetes (n = 32) or with no gingival bleeding (n = 28) were excluded from the study . A special case history proforma was prepared for a systematic and methodical recording of all observations which included a detailed case history and clinical examination, along with the written consent of the patient for willingness to participate in the study . For all the 454 patients, a gingival blood sample was collected from bleeding site with the help of a small plastic syringe and analyzed with self - monitoring device . A minimum of 0.3 l of blood is required for assessment of blood glucose using self - monitoring device (one touch, johnson and johnson). In addition, all the patients were advised for the second visit with overnight 8 h fasting for fasting blood glucose assessment . Four patients who were found to be diabetic and eight patients who were found to be nondiabetic by chair side assessment failed to report for further assessment . Of those 442 (202-males, 240-females) patients returned for fasting blood glucose assessment in laboratory with (digital colorimeter, elico cl157) patients with abnormal blood glucose values were advised to consult a physician for appropriate care [figure 1]. Outline of study design blood glucose values of all the patients were subjected to descriptive statistical analysis with spss version 16 software (chicago, il, usa). Number of patients identified as prediabetes and diabetes were analyzed for both self - monitoring glucose meter assessment and laboratory blood glucose assessment . After receiving the approval of the ethical committee, rmdc and h, 550 patients age ranged from 30 to 50 years were randomly selected from the outpatient department of periodontics . Patients with no known previous history of diabetes and having any risk factors like family history of diabetes, hypertension, high cholesterol, overweight / obesity with at least one tooth that bleed on probing were included in the study . Patients with known diabetes, pregnancy, any other systemic diseases were excluded from the study . Patients either with known diabetes (n = 32) or with no gingival bleeding (n = 28) were excluded from the study . A special case history proforma was prepared for a systematic and methodical recording of all observations which included a detailed case history and clinical examination, along with the written consent of the patient for willingness to participate in the study . For all the 454 patients, a gingival blood sample was collected from bleeding site with the help of a small plastic syringe and analyzed with self - monitoring device . A minimum of 0.3 l of blood is required for assessment of blood glucose using self - monitoring device (one touch, johnson and johnson). In addition, all the patients were advised for the second visit with overnight 8 h fasting for fasting blood glucose assessment . Four patients who were found to be diabetic and eight patients who were found to be nondiabetic by chair side assessment failed to report for further assessment . Of those 442 (202-males, 240-females) patients returned for fasting blood glucose assessment in laboratory with (digital colorimeter, elico cl157) patients with abnormal blood glucose values were advised to consult a physician for appropriate care [figure 1]. Blood glucose values of all the patients were subjected to descriptive statistical analysis with spss version 16 software (chicago, il, usa). Number of patients identified as prediabetes and diabetes were analyzed for both self - monitoring glucose meter assessment and laboratory blood glucose assessment . Mean age of the patients investigated is 42.45 6.60 . In the 454 patients gingival blood glucose assessment with self - monitoring device, 64 patients showed 200 mg / dl which indicates diabetes, and the other 390 patients showed 200 mg / dl, which indicates patients are not diabetic . Whereas, the results of the laboratory blood glucose analysis, 24 (5.43%) patients showed 126 mg / dl which indicates diabetes, 36 (8.14%) (patients showed 100125 mg / dl which indicates prediabetic state and the other 382 patients are not diabetic (<100 mg / dl). Among the 240 male patients 13 patients were diabetic and 20 were in prediabetic status and in 202 female patients, 11 patients were diabetic and 16 were in prediabetic status [table 1]. When compared male and females in both methods, chi - square test values were not significant [table 2]. Table 3 shows the comparison of gingival blood sample measurement with laboratory blood glucose assessment . Comparison of gingival blood sample measurements obtained by glucometer with the blood sample assessed in the laboratory showed sensitivity 96.6% and specificity 99.47% [table 3]. Distribution and percentage of patients investigated as prediabetes, diabetes comparison of blood glucose assessment by two methods in male and females comparison of the gingival blood sample measurements obtained by glucometer with blood sample assessed in laboratory we also considered the risk factors for diabetes, 122 patients were with risk factors and 320 patients were without any risk factors . The prevalence of risk factors [figure 2] like hypertension, sedentary lifestyle, family history, and overweight was significantly higher in the patients with abnormal blood glucose levels . Early detection and treatment of dm may reduce the burden of diabetes and its complications . This is most important in a high - risk population . Screening for diabetes should start at 40 years of age and to be repeated every 3 years in persons without risk factors, and earlier and more often in those with risk factors for diabetes . Unfortunately, more than 50% of the diabetic subjects in india remain unaware of their diabetes status, which adds to the disease burden . This underscores the need for mass awareness and screening programs to identify and reduce the burden due to diabetes in india . The results of this study conducted to screen patients with diabetes in the dental hospital using gingival blood with self - monitoring device showed 64 (13.2%) patients were with abnormal blood glucose levels, which indicate as diabetic . When the same patients subjected to laboratory fasting blood glucose assessment, 60 patients were with abnormal blood glucose levels (8.14% showed prediabetic status and 5.43% is diabetic). Among the 202 male patients, 33 patients showed abnormal blood glucose levels suggestive of diabetes, whereas 240 female patients were screened for diabetes 27 patients were with abnormal glucose levels . This increase in the number of females with abnormal glucose levels may be due to greater psychological stress in asian women as suggested by the authors in their study . When the risk factors are taken into account, 122 patients were associated with risk factors and 320 patients were without any risk factors . Prevalence of diabetes is significantly associated with risk factors . In a study conducted by the authors, prevalence of risk factors in urban areas there is higher prevalence of risk factors such as smoking, obesity, hypertension dyslipidemia, sedentary habits and metabolic syndrome . In a longitudinal study from urban india smoking and sedentary habits the role of obesity in the pathogenesis of type 2 diabetes is complex and is confounded by many heterogeneous factors . In a study conducted in north india concluded that there was a strikingly high prevalence of abdominal obesity and generalized obesity as determined by body fat percentage in type 2 diabetic individuals . Primary disease prevention and control activities are meant to delay disease onset and control disease severity . There is a huge window of opportunity for prevention, considering the number of modifiable risk factors among the prediabetes group only when the prediabetic stage is identified at earlier, in which periodontist has a key role . Authors developed a clinical guidelines for dental care providers to identify patients with undiagnosed diabetes by means of a periodontal disease examination, as well as asking questions about self - reported or self - measured waist circumference, self - reported age, self - reported weight, self - reported oral health status, self - reported race or ethnicity and family history of diabetes . In view of the growing number of people with undiagnosed diabetes and the increased risk for periodontal patients, diabetes screening at the time of the dental visit seems to offer a promising approach . The limitation of the study includes as with most diagnostic tests, an abnormal result should be repeated to rule out laboratory error and should be coupled with an evaluation by a physician before a diagnosis can be made . The results of the present study showed blood obtained from periodontal pocket probing is a reliable sample to screen diabetes in periodontal disease population . Early diagnosis of diabetes in the dental hospitals can help improve the patient's oral health and overall health status by helping patients avoid or reduce complications from diabetes . However, the present study could also be carried out with a larger survey population for a more effective screening.
Cervical cancer is the fourth most common cancer affecting women worldwide (ferlay et al ., 2010). Over 85% of cases and 87% of deaths occur in low - resource countries (siegel et al ., 2015). Central and south america are among the regions with the highest incidence (ferlay et al ., 2010), and access to internationally accepted standards of care is often inadequate . In honduras, cervical cancer represents 36.4% of female cancers nationally, and is the principal cause of cancer death in women . In honduras, cervical cancer most commonly affects women aged 3069 years and patients are frequently diagnosed with locally advanced disease (registro hospitalario de cancer 1998 - 2003, 2004). In 2009, 23% of all cancer cases treated at the department of oncology at the hospital general san felipe (hgsf) were cervical cancer . Both surgery and radiotherapy (rt) may be offered as primary treatment in stage i - iia disease as both treatment options demonstrated similar cure rates in this patient population (landoni et al ., 1997). Standard treatment for patients with more advanced disease is concurrent chemotherapy and external beam rt (ebrt) followed by brachytherapy (eifel et al ., 2004, brachytherapy, a fundamental pillar of treatment for locally advanced cervical cancer, is not available at the national cancer center at the hospital of general san felipe in honduras . For this reason, these patients are recommended for ebrt with or without concurrent chemotherapy are utilized . Following treatment, those patients with a complete clinical response (ccr) undergo extrafascial hysterectomy in lieu of brachytherapy 46 weeks after completion of treatment . Our goal was to evaluate clinical response rates among patients treated in the department of oncology at the hospital general san felipe (hgsf), who received either ebrt alone or concurrent chemoradiation (ccrt) for locally advanced cervical cancer . After approval from the internal review board, a retrospective chart review was performed for 165 patients who received primary treatment with either ebrt or ccrt for a histologically confirmed diagnosis of cervical cancer at the hgsf from january 2008 to june 2011 . Patients older than the age of 20 and younger than the age of 70 were included . Seventy gray (gy) of ebrt with or without chemotherapy were given to all the patients . Patients were deemed to have a clinical complete response (ccr) to rt chemotherapy if there was no residual tumor on clinical physical examinations . These patients who had ccr underwent extrafascial hysterectomy 6 weeks after completion of radiation therapy . Data analysis included age, clinical stage, histologic types, size of tumor, date of diagnosis, duration and methods of treatment, and clinical response . The primary endpoint of this study was complete clinical response (ccr) upon completion of ebrt and ccrt . Comparisons of variables not normally distributed were made by the mann - whitney u test . P values are the result of 2-sided tests and p <0.05 was considered to indicate a statistically significant difference . Statistical analysis was performed with software (spss, version 19.0; ibm corp, armonk, ny). Patients were collected from january 2008 through june 2011, and 165 women were included in the study . Ninety patients (54.5%) received ebrt alone and 75 (45.5%) patients received ccrt . The median age, stage, tumor size, and histology were similar in both groups . The treatment duration was significantly longer in the patients who received non - platinum based chemotherapy (table 1). Complete clinical response (ccr) rates decreased with advanced stage (table 2). Stage iib was the most common stage at diagnosis in both groups with 44/90 (49%) patients in the ebrt group and 38/75 (51%) patients in the ccrt group respectively . The ccr was significantly lower among stage iib and iiib patients treated with ccrt when compared with ebrt . Patients with ib2 cervical cancer did equally well and all achieved ccr . Tumor size was> 4 cm in 142 (86.1%) of 165 patients . All patients with tumors <4 cm experienced ccr, compared to 72 (68.6%) in 142 patients with tumor size> 4 cm . Histologic subtype did not appear to be a prognostic indicator: 135 (81.8%) of tumors were squamous cell carcinomas, 30 (18.2%) were adenocarcinomas . Of the 30 cases with adenocarcinoma, 25 (83.3%) underwent treatment with ebrt and 5 (16.7%) received ccrt; of the 135 squamous cell carcinoma (scc) cases, 73 (54.1%) received ebrt and 62 (45.9%) received ccrt . Overall 76/135 patients with scc demonstrated 56.3% ccr rate, which was comparable to the ccr of 18/30 (60%) among adenocarcinoma cases . The ccr of 33.3% were significantly lower in both scc and adenocarcinoma patients who received ccrt comparing to the ccr of 76.7% for those who received ebrt (table 2). Overall, ccr was seen in 95 patients (57.6%) in both groups combined . Of the patients who were treated with ccrt, 23 patients (33.3%) were treated with cisplatin (40 mg / m weekly for 5 cycles) chemotherapy and the remaining 52 patients (66.7%) received 5-fluourouracil (700 mg / m day 14 every 3 weeks), capecitabine (1000 mg / m twice daily on days 1 to 14, every 3 weeks for 2 cycles) or gemcitabine (1000 mg / m on days 1 and 8, every 3 weeks for 2 cycles). Of the 90 patients who received ebrt alone, 70 patients had a ccr of 77.8% and underwent adjuvant hysterectomy . In the ccrt group, 25 patients (33%) had a ccr (fig . The 25 patients that received cisplatin based therapy demonstrated an 80% ccr rate (fig . Residual tumors were found in 50% of the patients who underwent hysterectomy in both groups . One hundred and fifteen (69.5%) of patients completed their treatments within 60 days . The treatment duration was significantly longer in the patients who received non - platinum based chemotherapy (table 1). Of the 23 patients who received ccrt with cisplatin, only 5 patients had their treatments extended beyond 60 days . The majority of the ccrt patients that had treatment longer than 60 days received other agents (5-fluorouracil, capecitabine and gemcitabine). There were no differences between the two groups in the incidence of grade 3 and 4 toxicities: 13% in the ebrt group and 19% in the ccrt groups (ns). The burden of cervical cancer continues to fall most heavily on low- and middle - income countries largely due to lack of screening and treatment modalities . In a high - resource setting, the standard of care for locally advanced cervical cancer is ccrt with cisplatin based chemotherapy followed by brachytherapy (eifel et al ., 2004, morris et al ., 1999, souhami et al ., 1991, tattersall et al ., 1995, rose et al ., 1999). Although it has previously been demonstrated that non - platinum based chemotherapy regimens are less effective (eifel et al ., 1999, whitney et al ., 1999), platinum - based chemotherapy may not be readily available in low - resource settings . This was the case in the patient population at hgsf in honduras, and as would be expected, patients who received non - platinum based therapy had lower response rates . Approximately two - thirds of the patients in this cohort received non - platinum based ccrt with only a 31% response rate . Among the patients in this study who received platinum based therapy, the response rates were comparable to those cited in the literature . This emphasizes the importance of platinum based regimens in the treatment of locally advanced cervical cancer . Brachytherapy following concurrent chemotherapy and ebrt is considered standard of care, but brachytherapy is not available at the hgsf and we therefore substituted adjuvant extrafascial hysterectomy for this modality . The role of adjuvant extrafascial hysterectomy has been explored by the gynecologic oncology group (gog) in patients with bulky figo stage ib invasive carcinoma of the cervix . They reported on a cohort of patients with tumors measuring> 4 cm who were randomized to extrafascial hysterectomy or observation following ebrt and brachytherapy (chemotherapy was not administered in either arm). In this cohort there was a lower rate of local relapse (14% vs. 27% at 5 years) in the hysterectomy group . However, overall survival outcomes were not statistically different between the two groups (keys et al ., 2003). Although our patients did not have brachytherapy available to them, we felt that this gog data supports the use of adjuvant extrafascial hysterectomy in these patients . Our study was not designed to assess survival, but this will be the subject of future analysis . Factors associated with treatment failure in patients with cervical cancer include large volume of disease and treatment prolongation . The best response was seen among smaller tumors at less advanced stages in our patient population . All patients with tumors measuring 4 cm or less had a favorable response . In comparison, only 50.7% of patients with tumors measuring> 4 cm had a clinical complete response . With regards to treatment time, it has been shown that a protracted treatment course can be deleterious to overall outcomes (fyles et al ., 1992, petereit et al ., 1995, perez et al ., 1995). One group demonstrated that survival and pelvic control at 5 years decreased 0.6% and 0.7%, respectively, for each additional day of treatment beyond 55 days (petereit et al ., 1995). In our patients treatment can be delayed for reasons including lack of financial resources, difficulty with transportation and various socioeconomic stressors . These treatment delays likely contribute to a reduction in the ccr and once radiotherapy is initiated every effort should be made not to delay treatment . Cervical cancer is the most commonly diagnosed cancer among women in honduras . To this end, these women deserve the opportunity to receive a therapy with the goal of achieving cure . Efforts should be made to treat women with locally advanced cervical cancer with cisplatin - based ccrt . Treatment should not be delayed once it has been initiated and if cisplatin is not available, radiotherapy should be offered rather than delay treatment while awaiting availability of chemotherapy agents.
The mitral valve is located far from midline sternotomy, but is very close to the interatrial groove . As our experience grew and we learned from embryology, we found that a more cental left atriotomy was advantageous, and possible by interatrial groove dissection using ultrasonic scalpel . Under general anesthesia, midline sternotomy is performed and the ascending aorta is cannulated for arterial inflow, and the superior vena cava and right atrial appendage are cannulated for venous outflow . The fad pad covering the interatrial groove is dissected under cardiopulmonary bypass by ultrasonic scalpel . The dissection is carried out in the exact groove of sondergaard until accessing beneath the thin atrial septum with careful attention paid to the coronary sinus vein (fig . The aorta is cross - clamped and a vertical incision is made onto the left atrium, leaving enough room for the atrial wall to close . Using a self - retaining retractor, atrial tissue above the anterior mitral annulus this makes a tractile and stretched wide view of the mitral valve possible because the left atrium wall hook - up is optimal . This is quite different from the right side left atriotomy, which usually leaves a redundant left atrial wall to be hooked up . Because the mitral valve is such a complex anatomic structure and the maneuvers involved in correcting a regurgitant valve may vary from the simple to the very complex, adequate exposure is an absolute requirement in every operative plan . The first critical step to standard valve repair is the complete and thorough development of the sondergaard plane reflecting the right atrium off the left atrium to the atrial septum . This was first described in the 1950s by the danish surgeon sondergaard to expose the atrial septum for noncardiopulmonary bypass treatment of atrial septal defects . Regardless of claims from previous procedures, it should always be possible to dissect out the groove without significant difficulty . The complete and full development of the groove is crucial for obtaining adequate exposure of the mitral valve . With this technique, via blunt and sharp dissection with ultrasonic scalpel, we had no need for any other incision for mitral valve repair or replacement, whether for primary surgery or reoperation . This incision brings the surgeon very close to the mitral valve even in the most difficult anatomic situations . Once the right atrium is dissected off the left atrium, a generous incision in the left atrium is made, avoiding the atrial septum . We have been adopting this incision and approach in 10 consecutive patients and have found that the aortic cross - clamp time decreased significantly from an average 75 minutes to 48 minutes compared to right - side left atriotomy patients . A more central incision onto the left atrium
Potassium (gik), when administered very early during the course of cardiac ischemia, reduces ischemia - induced arrhythmias and myocardial injury . Clinical trials in humans, however, have produced conflicting results [25] which have been postulated to be due to the variable delay in the administration of gik after the onset of ischemia . Supporting the importance of very early identification of suitable patients and treatment, the immediate (immediate myocardial metabolic enhancement during initial assessment and treatment in emergency care) trial, which studied very early administration of gik to patients with an acute coronary syndrome (acs) by emergency medical service (ems), showed reduction in the composite endpoint of cardiac arrest or in - hospital mortality in the study group, thereby supporting the importance of prompt identification of these patients . As treatment of acs has evolved, including early primary percutaneous coronary intervention (pci), there have been significant reductions in mortality . To maximize this impact, there is a need to identify patients with suspected acs who are at high risk for cardiac arrest or death very early in their clinical course, such as during initial evaluation by ems . This identification remains challenging, however . Among patients presenting with chest pain or other symptoms suggesting acs, only about a quarter truly have acs, and among those with acs, rapid identification of those at high risk is crucial in order to provide prompt treatment and allocation of valuable attention and resources . To address this need, using data from the immediate trial, we used logistic regression to develop a predictive model to stratify the risk of cardiac arrest or death among patients presenting with suspected acs . We then examined the degree of gik's treatment effect across risk groups defined by the predictive model . It was a randomized, placebo - controlled, double - blind, multicenter clinical effectiveness trial conducted across the united states that assessed the effect of intravenous gik infusion initiated by ems in the out - of - hospital setting for patients with suspected acs . Of its 871 randomized participants; for the development of the predictive model, we used only data from the control (placebo) group, to represent the clinical course of acs uninfluenced by gik . Screened patients included those transported by ems who were 30 years of age or older and had an out - of - hospital electrocardiogram (ecg) done for symptoms suggestive of acs . To be included, a patient's out - of - hospital ecg had to meet at least one of the following criteria: a 75% or higher prediction of acs by the acute ischemia time insensitive predictive instrument (aci - tipi), the generation by the thrombolytic predictive instrument (tpi) of a statement recognizing st elevation myocardial infarction (stemi), or a judgment by the paramedic that the ecg showed definite stemi using local standards . Excluded were patients who had a language barrier, impaired reasoning, were prisoners, pregnant, or had rales suggesting heart failure . Informed consent was obtained from each patient and the study protocol conforms to the ethical guidelines of the 1975 declaration of helsinki as reflected in a priori approval by the institution's human research committee . For analyses, these included age, sex, body mass index, time of initiation of study drug (gik or placebo) after the onset of ischemic symptoms, vital signs (pulse, and systolic and diastolic blood pressures) obtained out - of - hospital and in the emergency department (ed), medical history of coronary artery disease (myocardial infarction, coronary artery revascularization, heart failure, and stroke), cardiovascular risk factors (diabetes mellitus, hypertension, and hyper - lipidemia), history of hemodialysis, previous use of aspirin, and treatment with beta blocker . Electrocardiographic variables included st elevation, pr interval, qrs duration, corrected qt interval (qtc), and the axes of the p, t, and qrs waves . We also used the probability of acs computed by the aci - tipi and for the qtc variable, categories previously developed in a cardiac arrest model, and for heart rate and blood pressure, variables previously used in predictive models of cardiac arrest and in - hospital mortality [1113]. The outcome of interest was the composite of cardiac arrest or in - hospital mortality, as adjudicated for the immediate trial . Using data from the immediate trial control participants, we compared baseline characteristics of those with and without the cardiac arrest or mortality composite outcome . Between group differences variables that were significant at p <0.01 were included in the multivariable model building process to identify patients at highest risk for the composite outcome (who thereby might benefit most by early administration of gik). Collinearity was tested by examining the variance inflation factor (vif); if its square root was more than two, collinearity was suspected and the variable with lowest p value was used in further analyses . Stepwise multivariable logistic regression analysis was performed using the most promising variables from the univariate analyses . Clinical meaningfulness and the akaike information criteria (aic) were used in variable selection, resulting in the model with four variables described below . The final model was tested for predictive discrimination by c statistic (the equivalent of the area under the receiver - operating characteristic [roc] curve). Predicted values from the final model were calculated for all patients (gik and placebo treated), which were used to stratify patients into tertiles of risk . The observed event rates in each risk category were calculated and compared between the gik and placebo groups . We checked for interactions of gik with different covariates in the model and also with the different risk categories . Finally, we evaluated the clinical characteristics of patients in the highest risk group for consideration for early gik therapy . It was a randomized, placebo - controlled, double - blind, multicenter clinical effectiveness trial conducted across the united states that assessed the effect of intravenous gik infusion initiated by ems in the out - of - hospital setting for patients with suspected acs . Of its 871 randomized participants; for the development of the predictive model, we used only data from the control (placebo) group, to represent the clinical course of acs uninfluenced by gik . Screened patients included those transported by ems who were 30 years of age or older and had an out - of - hospital electrocardiogram (ecg) done for symptoms suggestive of acs . To be included, a patient's out - of - hospital ecg had to meet at least one of the following criteria: a 75% or higher prediction of acs by the acute ischemia time insensitive predictive instrument (aci - tipi), the generation by the thrombolytic predictive instrument (tpi) of a statement recognizing st elevation myocardial infarction (stemi), or a judgment by the paramedic that the ecg showed definite stemi using local standards . Excluded were patients who had a language barrier, impaired reasoning, were prisoners, pregnant, or had rales suggesting heart failure . Informed consent was obtained from each patient and the study protocol conforms to the ethical guidelines of the 1975 declaration of helsinki as reflected in a priori approval by the institution's human research committee . These included age, sex, body mass index, time of initiation of study drug (gik or placebo) after the onset of ischemic symptoms, vital signs (pulse, and systolic and diastolic blood pressures) obtained out - of - hospital and in the emergency department (ed), medical history of coronary artery disease (myocardial infarction, coronary artery revascularization, heart failure, and stroke), cardiovascular risk factors (diabetes mellitus, hypertension, and hyper - lipidemia), history of hemodialysis, previous use of aspirin, and treatment with beta blocker . Electrocardiographic variables included st elevation, pr interval, qrs duration, corrected qt interval (qtc), and the axes of the p, t, and qrs waves . We also used the probability of acs computed by the aci - tipi and for the qtc variable, categories previously developed in a cardiac arrest model, and for heart rate and blood pressure, variables previously used in predictive models of cardiac arrest and in - hospital mortality [1113]. The outcome of interest was the composite of cardiac arrest or in - hospital mortality, as adjudicated for the immediate trial . Using data from the immediate trial control participants, we compared baseline characteristics of those with and without the cardiac arrest or mortality composite outcome . Between group differences variables that were significant at p <0.01 were included in the multivariable model building process to identify patients at highest risk for the composite outcome (who thereby might benefit most by early administration of gik). Collinearity was tested by examining the variance inflation factor (vif); if its square root was more than two, collinearity was suspected and the variable with lowest p value was used in further analyses . Stepwise multivariable logistic regression analysis was performed using the most promising variables from the univariate analyses . Clinical meaningfulness and the akaike information criteria (aic) were used in variable selection, resulting in the model with four variables described below . The final model was tested for predictive discrimination by c statistic (the equivalent of the area under the receiver - operating characteristic [roc] curve). Predicted values from the final model were calculated for all patients (gik and placebo treated), which were used to stratify patients into tertiles of risk . The observed event rates in each risk category were calculated and compared between the gik and placebo groups . We checked for interactions of gik with different covariates in the model and also with the different risk categories . Finally, we evaluated the clinical characteristics of patients in the highest risk group for consideration for early gik therapy . Table 1 shows the baseline characteristics of the study sample and rates of cardiac arrest or in - hospital mortality . Of the 871 trial participants (411 given gik and 460 given placebo), 58 had an out- or in - hospital cardiac arrest or died during the index hospitalization . Forty occurred in the control group (29 cardiac arrests, 23 with in - hospital mortality, and 12 with both), and 18 in the gik group (15 cardiac arrests, 13 with in - hospital mortality, and 10 with both). To construct the risk predictive model of baseline risk as in table 1, when compared to the participants without any events, those with one of these events were slightly older and more likely women, presented later (but not significantly), had systolic blood pressures that were about 10 mm hg lower and pulse rates about 10 beats per minute higher, had more frequent histories of previous coronary artery disease, more often had st elevation on their presenting ecg, and had higher aci - tipi probabilities of having acs . These differences are consistent with those who have cardiac arrest, are of more advanced age, have lower systolic blood pressure, tachycardia, history of coronary artery disease, st elevation on presentation, and higher aci - tipi score, these were considered appropriate variables for the predictive model . Among 34 candidate variables, 11 were statistically significant and one borderline significant . Among demographic variables, age was significant and gender was not . Neither traditional cardiovascular risk factors, nor history of coronary artery disease, heart failure, stroke, use of aspirin, or beta blocker were significantly related to the outcome . Further characterization of age using restricted cubic spline demonstrated a nonlinear relationship of age with the outcome of interest . Two nodes were noted at 60 and 85 years of age . Graphically there was no obvious difference in the outcome rates below 60 and above 85 years of age . Thus, based on the data the age variable was truncated at 60 and 85 years, and ages between 60 and 85 years demonstrated a smooth pattern and was treated as a continuous variable . Univariate analyses of systolic blood pressure suggested a non - linear relationship; systolic blood pressure less than 105 mm hg was adversely related to the outcome . Time from onset of chest pain to presentation as a continuous linear variable was not predictive of the outcome . Based on clinical considerations and numbers of participants, the duration of symptoms was divided into two categories: early (within 1 h), and late (beyond 1 h). The odds of the outcome were four times higher in those treated (with placebo) within an hour of symptom onset compared to those presenting late, consistent with other analyses of cardiac arrest in acute infarction having a sharp drop - off after 1 h . As many of the interventional trials used two or 3 h as the duration of symptoms at presentation, a sensitivity analysis was performed to look for any difference . However, no significant difference was found in its predictive value when two or 3 h were used as the cutoff points in place of 1 h. previous investigators have suggested a predictive role of qtc as a function of time since onset of symptoms suggestive of acs, reflects myocardial injury and prolongation of qtc (and qt dispersion) [14, 15], potentially promoting ventricular arrhythmias and cardiac arrest . Although univariate analyses did not demonstrate significant predictive value of qtc or duration of symptoms, a composite variable of qtc with duration of chest pain since onset was created as described in the literature . This variable was tested in the multivariable model, and no improvement in model performance was found . We used both heart rate and systolic blood pressure to account for the hemodynamic state of the patient, including a composite variable found significant for predicting mortality from acs in another study . No improvement was noted in the model as measured by c statistic . In the out - of - hospital setting, systolic blood pressure was found to be a significant covariate and respiratory rate was of borderline significance . When vital signs recorded in the ed were analyzed, systolic and diastolic blood pressures, heart rate, and respiratory rate were significantly related to the outcome . Higher serum potassium level had a significant protective role, whereas glucose and c - reactive protein (crp) levels did not show predictive significance . However, blood tests were judged unattractive as presenting clinical variables and were not used for the predictive model . Among ecg - based variables, st elevation on the presenting ecg and a high aci - tipi score were significant predictors in the univariate models tested . Based on all these considerations, stepwise multivariable logistic regression selection resulted in a final model with four variables: age (truncated at 60 and 85 years), systolic blood pressure (dichotomized at 105 mm hg), presence of st elevation in the initial ecg, and duration of time from symptom onset until initiation of treatment (dichotomized at 1 h), in table 2 . 1 in the appendix shows the roc curve for the model's predictions; good discrimination is reflected by the c statistic (roc area) of 0.75, and calibration, in table 3, shows good agreement of predicted to actual outcomes . The c statistic for the gik group was 0.73 with a 95% confidence interval of 0.610.85 . 2 in the appendix shows the roc curve for the treatment group while the adjoining table 1 and fig . Based on the final model, we calculated a predicted risk score as a continuous 0100% variable . For potential clinical use, tertiles of risk categories were created and event rates calculated for each risk category . Among the placebo group participants, the event rate was 3.4% in the low risk category, 5.6% in the moderate risk category, and 17.6% in high - risk category (table 4). Finally, we applied the model to the entire immediate trial dataset (placebo and gik arms) and examined the effect of gik on the different risk categories by introducing an interaction term . A significant interaction was not found across all the risk categories . In the entire cohort, the odds of the composite outcome cardiac arrest or in - hospital mortality related to gik was 0.45 (ci 0.24, 0.83, p = 0.01). Assuming a constant odds ratio across the spectrum of calculated risk, the predicted absolute risk reduction was much more pronounced for the high - risk group compared to the low - risk group (8.6% vs. 0.8%), with corresponding numbers needed to treat (nnt) of 12 and 125 respectively . A constant odds ratio was used as there was no interaction noted between gik and the risk categories . We studied the clinical profile of the patients in different risk groups among the immediate trial participants . The high - risk group is about four years older than the entire cohort, has a mean systolic blood pressure on presentation about 11 mm hg lower, with a much higher proportion of patients having systolic blood pressure below 105 mm hg . More often patients in the high - risk group presented within 1 h of ischemic symptom onset, and twice as often had st elevation on their initial ecg . The presence of these clinical characteristics in high - risk patients is consistent with our predictive model and with the objective of expediting treatment of the most at - risk patients . For potentially easier use in the field by the first responder ems we developed a simple scoring system based on the rounding to the integer scores of the coefficients of the four variables in our final model . In this scoring system, henceforth called immediate score, age below 60 years has been assigned a score of 0 and the age group above 60 and less than or equal to 65 years has been assigned a score of 1, with each 5-year increment increasing the score by 1 to a maximum of 6 for age 85 years . Presence of st elevation in the presenting ecg gives a score of 5, low systolic blood pressure (<105 mm hg) at the first assessment by the ems gives a score of 3 and presentation within 1 h of symptom onset gives a score of 2 . Absence of st elevation, systolic blood pressure more than 105 mm hg and presentation later than 1 h from the onset of symptoms each gives a score of zero in this scale . Table 2 in the appendix illustrates the scale with the estimated probabilities of death or cardiac arrest for each possible score . Reasonably maintains the power of discrimination demonstrated by the predictive model with a c statistic of 0.70 (95% ci: 0.63 to 0.77) compared to the c statistic of 0.75 in the final model . Although the c statistic and the corresponding area under the roc curve (fig . 5 in the appendix) for the scoring system is found to be marginally less than that of the final full model, this difference was not statistically significant . For each model subjects were categorized into 3 risk groups using two methods, first into 3 groups of equal size and second into groups of equal risk ranges . We assessed the degree of reclassification using predictable package in r. no significant difference was noted between the two models by either approach as measured by categorical net reclassification improvement (nri) or integrated discrimination improvement (idi) (table 3 in the appendix) apparent reclassification in favor of the lower risk categories (table 4) and its effect on arr and nnt (arr 2.9% and nnt 35 in both moderate and high risk categories) while an equal number of patients are used to create risk tertiles is possibly explained by varying weights of different predictors and rounding to the nearest integer in the simple risk scoring model in addition to the small number of events in different risk groups . Although taking higher integers to represent the coefficients of the model may reduce this shift and maintain rigor in the predictive value of the variables, they may be difficult to use at the bedside . We encourage a computer based use of the predictive model to estimate the probability of cardiac arrest or death . Nevertheless, this simple and easy to use risk scoring system can be utilized by the ems to identify patients at higher risk without any significant loss of discrimination power of the original model . This may expedite important treatment decisions and use of valuable resources, more so in areas where access to computer based risk stratification is not readily available . For potentially easier use in the field by the first responder ems we developed a simple scoring system based on the rounding to the integer scores of the coefficients of the four variables in our final model . In this scoring system, henceforth called immediate score, age below 60 years has been assigned a score of 0 and the age group above 60 and less than or equal to 65 years has been assigned a score of 1, with each 5-year increment increasing the score by 1 to a maximum of 6 for age 85 years . Presence of st elevation in the presenting ecg gives a score of 5, low systolic blood pressure (<105 mm hg) at the first assessment by the ems gives a score of 3 and presentation within 1 h of symptom onset gives a score of 2 . Absence of st elevation, systolic blood pressure more than 105 mm hg and presentation later than 1 h from the onset of symptoms each gives a score of zero in this scale . Table 2 in the appendix illustrates the scale with the estimated probabilities of death or cardiac arrest for each possible score . Reasonably maintains the power of discrimination demonstrated by the predictive model with a c statistic of 0.70 (95% ci: 0.63 to 0.77) compared to the c statistic of 0.75 in the final model . Although the c statistic and the corresponding area under the roc curve (fig . 5 in the appendix) for the scoring system is found to be marginally less than that of the final full model, this difference was not statistically significant . For each model subjects were categorized into 3 risk groups using two methods, first into 3 groups of equal size and second into groups of equal risk ranges . We assessed the degree of reclassification using predictable package in r. no significant difference was noted between the two models by either approach as measured by categorical net reclassification improvement (nri) or integrated discrimination improvement (idi) (table 3 in the appendix) apparent reclassification in favor of the lower risk categories (table 4) and its effect on arr and nnt (arr 2.9% and nnt 35 in both moderate and high risk categories) while an equal number of patients are used to create risk tertiles is possibly explained by varying weights of different predictors and rounding to the nearest integer in the simple risk scoring model in addition to the small number of events in different risk groups . Although taking higher integers to represent the coefficients of the model may reduce this shift and maintain rigor in the predictive value of the variables, they may be difficult to use at the bedside . We encourage a computer based use of the predictive model to estimate the probability of cardiac arrest or death . Nevertheless, this simple and easy to use risk scoring system can be utilized by the ems to identify patients at higher risk without any significant loss of discrimination power of the original model . This may expedite important treatment decisions and use of valuable resources, more so in areas where access to computer based risk stratification is not readily available . Based on patients with acs not receiving gik in the immediate trial, we developed a predictive model for the composite outcome of cardiac arrest or in - hospital mortality, based on four variables: age, systolic blood pressure, st elevation on the presenting ecg, and time from onset of ischemic symptoms . Applied to its development set, its predictive accuracy was good, reflected by a c statistic of 0.75, as was its calibration, represented by agreement between the predicted and actual outcome rates . When the model's predictions were used to create three equal - sized risk groups, there were noticeable differences between risk tertiles . These categories showed potential for identifying those patients with the most to gain from early treatment with gik . Whereas the overall odds ratio for gik's impact on the composite endpoint of cardiac arrest or mortality in the entire immediate trial cohort was 0.45 (p = 0.01) those in the high - risk group had an absolute risk reduction by gik of 8.6%, with a nnt of 12, versus in the low - risk group having an absolute risk reduction of 0.8% and a nnt of 125 . An apparent increase in the event rate in the intermediate risk category was possibly due to the statistical effect of the small number of events in this category . Treatment of acs has evolved substantially over the last three decades, resulting in significant reductions in morbidity and mortality, but early mortality remains high . To help address this, there have been efforts to develop predictive models and risk stratification methods [7,1721] to support evidence - based treatment that parallel advances in thrombolysis, antiplatelet therapy, and coronary interventions . To represent the underlying risk of patients with suspected acs for the composite outcome of cardiac arrest or mortality, we used data from the untreated (placebo) group of the immediate trial . Compared to previous models, ours is simpler, having just four variables that are clinically straight - forward and easily collected in ems and ed settings . Once validated on other data, the model should be applicable to use in the field . In such use, our findings suggest that it could assist identification of the high - risk patients who would benefit most from administration of gik by the ems and thus could help focus treatment on them . The overall effect of gik in the immediate trial on our study outcome, and confirmed in our analyses, was an odds ratio of 0.45 (p = 0.01). This is independent of other patient - level variables and is very encouraging, but in clinical settings, it is understood that there is heterogeneity of treatment effect, and being able to select those most likely to benefit is important . The utility of this is illustrated by the difference in potential benefit in the high versus the low risk groups: 8.6% compared to 0.8%, respectively . Thus avoiding cardiac arrest or mortality should be much more efficient in the high - risk group, for whom only 12 must be treated to prevent one outcome, versus 125 in the low - risk group . If validated in an independent group of patients, our model may help identify the high - risk patients who may be priori - tized for treatment with gik, and potentially other important treatments . For ease of use in resource limited areas where computer based risk stratification is not easily available we developed a simple integer version of the scoring system, the immediate score . By using this 16 point scoring system, the ems responders can estimate the risk of death or cardiac arrest for an individual patient in the appropriate clinical context and tailor clinical decisions accordingly . The strengths of our study come from data used for the analysis, the immediate trial, a double - blinded placebo - controlled nih - sponsored clinical effectiveness trial that used carefully adjudicated outcomes . Another strength is our model's use of few and readily recognizable clinical predictors (age, sbp, duration from symptom onset, and st elevation in ecg on presentation) and its very good predictive performance . Also, following further validation, it shows promise as being potentially attractive for identifying patients for treatment in varied ems and ed settings . The overall immediate trial with 871 participants had a total of 58 of the composite events, and for our model, using only the placebo group, we had only 40 events . Also, data were not collected for a few traditional cardiovascular risk factors such as smoking and family history of premature coronary artery disease and, from a practical perspective, reliable collection of these data was seen as challenging in the acute ems setting . It might be of interest to investigate laboratory parameters like crp, initial glucose level, and potassium levels, but only the relatively small immediate trial biological mechanism cohort had these data . Moreover, these tests are not uniformly and promptly available in the ems setting and thus were considered unattractive for this predictive model ultimately aimed at immediate use in ems and ed care . Finally, for validation of our findings and prior to general clinical use this also applies to the finding of the greater benefit from gik in the high - risk group, although such an effect is consistent with other studies of intervention that find more effect with higher risk patients . We encourage such testing on analogous data sets, understanding that extant data on very early treatment with gik in a placebo - controlled trial are still hard to find . The overall immediate trial with 871 participants had a total of 58 of the composite events, and for our model, using only the placebo group, we had only 40 events . Also, data were not collected for a few traditional cardiovascular risk factors such as smoking and family history of premature coronary artery disease and, from a practical perspective, reliable collection of these data was seen as challenging in the acute ems setting . It might be of interest to investigate laboratory parameters like crp, initial glucose level, and potassium levels, but only the relatively small immediate trial biological mechanism cohort had these data . Moreover, these tests are not uniformly and promptly available in the ems setting and thus were considered unattractive for this predictive model ultimately aimed at immediate use in ems and ed care . Finally, for validation of our findings and prior to general clinical use this also applies to the finding of the greater benefit from gik in the high - risk group, although such an effect is consistent with other studies of intervention that find more effect with higher risk patients . We encourage such testing on analogous data sets, understanding that extant data on very early treatment with gik in a placebo - controlled trial are still hard to find . This immediate trial - based predictive model appears to accurately identify patients with suspected acs who are at high risk of cardiac arrest or death and who could benefit most from gik . That the model's risk factors include earliness of treatment once the model has been validated in other datasets and in practice, it could be helpful in identifying patients most likely to deserve immediate attention and acute interventions for acs, including very early out - of - the - hospital gik.
Parkinson's disease (pd) is a movement disorder characterized by tremor at rest, rigidity, and bradykinesia and it is the second most common degenerative disorder followed by alzheimer's disease . Other motor symptoms manifested by patients with pd include postural instability, stooped posture, freezing of gait, decreased facial expression, hypophonic voice, loss of dexterity, and festinating gait . In addition, many patients have non - motor symptoms including: neuropsychiatric symptoms such as dementia, depression, and anxiety; sleep disorders such as insomnia, excessive daytime sleepiness, and rapid eye movement sleep disorder; autonomic nervous system symptoms such as orthostatic hypotension and micturition disorder; gastrointestinal symptoms such as constipation, difficulty in swallowing, and dyspepsia; and sensory symptoms such olfactory dysfunction, visual abnormality, and pain . The prevalence of pd increases with age and the incidence is reportedly 1 - 2% over the age of 60 years . A large number of clinical and basic studies have been performed to elucidate the pathogenesis of pd . Alpha - synuclein is a 140 amino acid protein that is encoded by the snca gene on human chromosome 4 . It is distributed predominantly in presynaptic terminals of synapses, and is found in neural tissues at high concentrations, making up as much as 1% of total proteins in the brain . Although alpha - synuclein is recognized as a critical protein in pd, it was initially named as a non - amyloid component of plaque (nacp), which was first found in senile plaque, a pathologic characteristic of alzheimer's disease . Considering its distribution in the synaptic terminal, alpha - synuclein probably takes crucial roles in synaptic plasticity, dynamics of vesicle, and in the synthesis and secretion of dopamine . The importance of alpha - synuclein in pd began to be recognized in the late 1990's . The discovery of two crucial findings during this period triggered the study of alpha - synuclein in pd . Reported the a53 t mutation of snca in a family with autosomal dominant familial pd . Through this finding, the relationship of alpha - synuclein and pd has been identified . The significance of alpha - synuclein in pd has been further supported by the findings of the other mutations of snca, including a30p and e46k in other families with inherited pd [4, 5]. The second important discovery was found in neuropathology . In 1997, spillantini et al . Revealed that alpha - synuclein is the primary structural component of lewy body, which is an intracytoplasmic inclusion characterizing pd . The finding of alpha - synuclein as the main component of lewy bodies has underscored the critical role of alpha - synuclein in the disease mechanism of pd . The aim of this paper is to review the clinical findings of recent studies on pd and alpha - synuclein from the perspectives of physicians . Results from animal studies or basic researches will not be covered in this review as they have been reviewed in recent literature . In terms of alpha - synuclein pathology, lewy bodies are found in several regions in the brains of patients with pd . Pathologically, the diagnostic criteria of pd are the death of dopaminergic neurons in the substantia nigra and the presence of lewy bodies . Apart from nigra, alpha - synuclein pathologies are observed in other brainstem nuclei, including the dorsal motor nucleus of vagus (dmx) of medulla, the locus ceruleus in the pons, and the raphe nucleus . Furthermore, alpha - synuclein pathology has been found to exist in the basal forebrain, hippocampus, insular cortex, cingulated gyrus, temporal gyrus, frontal cortex, and other parts of the brain . Most patients with alpha - synuclein pathology in the substantia nigra also have alpha - synuclein pathology in the medulla or pons . On the contrary, some cases with alpha - synuclein pathology in the medulla or pons do not have alpha - synuclein pathology in the midbrain . Based on these findings, braak et al . The alpha - synuclein pathology of pd begins in the dmx of the medulla and gradually spreads rostrally . Clinical symptoms of pd are manifested as alpha - synuclein pathology reaches substantia nigra and, as the disease progresses, alpha - synuclein pathology is found in the cerebral cortex . This hypothesis has attracted considerable attention and many pd investigators have aligned themselves with this hypothesis . Currently, the theory of braak et al . Has been established as the fundamental hypothesis explaining the pathogenesis and progression of pd . The more common alpha - synuclein pathology in the medulla or pons than in the midbrain does not necessarily imply transmission of alpha - synuclein pathology from the medulla to the midbrain . Furthermore, studies on the brain of patients with pd showed that more than 15% of brains exhibited the pattern of not following the order of braak stage progressions . Presented dual - hit hypothesis supporting their theory in 2007, suggesting that the alpha - synuclein pathology of pd is transmitted to the midbrain through two different paths . One path is from the olfactory bulb to the temporal cortex, and the other path is the transmission to dmx through the enteric nervous system . This hypothesis explains that the pathogenesis of pd is initiated by an external factor which directly generates the alpha - synuclein pathology in the olfactory bulb through the nose, or makes contact with the gastrointestinal tract by the swallowing of olfactory mucosal discharge . Autopsy findings of patients with pd have revealed the pathological findings of alpha - synuclein in the enteric nervous system of the stomach and esophagus [11, 12]. According to the outcomes of recent studies, colorectal biopsy revealed the findings of an alpha - synuclein pathology in pd patients . The most convincing evidence supporting the hypothesis that alpha - synuclein pathology is transmitted through the nervous system was simultaneously reported by two independent research teams in 2008: the brain autopsy of pd patients who received fetal midbrain transplants revealed alpha - synuclein pathology within transplanted neurons [14, 15]. While fetal midbrain transplants had been attempted as a treatment method of pd in the 1990's, in recent years, it is rarely performed due to unclear efficacy, the risk of adverse effects, and ethical problems of obtaining midbrain cells from the fetus . Autopsies were performed in patients who received fetal midbrain transplants and died after 10 years or more . Surprisingly, transplanted cells, which have aged 10 years or slightly more than 10 years, exhibited similar pathological findings of alpha - synuclein shown in host neurons . This finding implies that the alpha - synuclein pathology is transmitted from the surrounding host neurons to the transplanted neurons, as in prion diseases [16, 17]. On the other hand, other interpretations suggested that the occurrence of alpha - synuclein pathology in transplanted neurons is not due to transmission from surrounding host neurons but to the de novo intracellular alpha - synuclein pathology within the transplanted cells exposed to the alpha - synuclein pathology - promoting microenvironment which is shared by host cells . A large number of basic studies have also been carried out, supporting the transmission of alpha - synuclein pathology in pd . Additional studies will be proactively performed to further examine the mechanism of pd based on the new findings in clinical studies . As stated in the introduction, many genetic studies have been conducted to clarify the relationship between alpha - synuclein and pd after the discovery of the snca gene mutations in families with inherited pd . The three missense mutations of the snca gene are a53 t, a30p, and e46k . Although a recent study newly found another mutation, h50q, additional studies are needed . Although the finding of familial pd by snca missense mutation has led to clinical studies and basic studies on the pathological role of alpha - synuclein in pd, clinical features of these patients pd patients with snca missense mutation are characterized by early onset age, rapid progression of the disease, and a high association of dementia . Besides the alpha - synuclein pathology, the presence of tau pathology and tdp-43 inclusion in some patients raises questions whether these patients represent' usual' pd patients . Nevertheless, studies on the point mutation of snca have greatly contributed in understanding the mechanism of pd . More convincing genetic evidence proving the relationship between alpha - synuclein and pd is the multiplication of snca in patients with pd . Discovered the triplication of normal (wild - type) snca in familial pd in 2003 . These patients had two times more snca gene than normal individuals with three copies of snca gene on one chromosome . This implies that even normal alpha - synuclein without mutation could generate pd when it is expressed in a greater amount than normal individuals . An increase in the amount of snca mrna and alpha - synuclein protein was identified in serum, and brain tissue of these patients [20, 21]. Moreover, the duplication of the snca gene (1.5 times higher amount of snca gene than normal individuals) was detected in families with inherited pd in 2004 . This finding confirmed that over - expression of normal alpha - synuclein causes pd [22 - 25]. Pd with snca triplication is characterized by early onset age and rapid progression compared to usual pd . In contrast, pd with snca duplication is similar to the onset age and progression of usual pd . This suggests the gene dosage effect where the different severity of symptoms depends on the number of copies of the snca gene . However, an increase in alpha - synuclein in patients without genetic abnormality (most pd is not inherited and does not have obvious genetic abnormalities), especially in brain tissues, needs to be verified in order to establish the theory in which a greater amount of alpha - synuclein formation causes pd . Still, there is no definite evidence indicating the increased alpha - synuclein or snca mrna in the brain of patients with non - genetic pd . Some studies even reported the decrease in alpha - synuclein or snca mrna [26, 27]. Further studies are needed to resolve the potential methodological problems in analyzing the alpha - synuclein levels . Given that alpha - synuclein is the key molecule in the pathogenesis of pd, the presence of the alpha - synuclein pathology in the brain tissues of patients with pd by a genetic abnormality other than snca mutation needs to be scrutinized . Mutations or polymorphisms in several other genes have been identified as causing pd or affecting pd risk (table 1). Lrrk2 mutation is recognized as the most common genetic cause of pd and g2019s mutation is the most common form of lrrk2 mutation . Autopsy findings revealed that alpha - synuclein pathology accounts for about 80% of all g2019s mutant patients . However, the finding of alpha - synuclein pathology was discovered in about 43% of other lrrk2 mutant patients . A total of 10 cases of autopsy findings have been reported regarding pd resulting from mutations in the parkin gene . Among those a single case of the autopsy finding has been reported in the case of pink1 and this patient showed alpha - synuclein pathology ., alpha - synuclein appears to be involved in the pathogenesis of pd in cases of pd by other genetic abnormalities . However, more studies are needed to elucidate the relationship between alpha - synuclein and other pd - related genes, especially parkin . In recent years, many studies have attempted to clarify the relationship between pd and a certain single nucleotide polymorphism (snp) through a genome - wide association study (gwas). Numerous gwass have shown that several snps in snca increases the risk of pd, and this has been supported by results of functional studies . Of these, one of the most well studied examples is the length of dinucleotide repetition in the snca promoter of rep1 . A large number of clinical studies have repeatedly verified that the risk of pd increases as the repetitions of rep1 increase and the functional studies have shown that the number of rep1 repetitions actually increased the expression of the snca gene . Furthermore, the amount of alpha - synuclein in the serum of patients is known to increase as the number of rep1 increases . The association of pd with other snps of snca has been identified through gwas, and some snps of the 3' untranslated region (3'utr) have increased the risk of pd . Patients with a snp in 3'utr of snca, rs356219, reportedly exhibited a high concentration of alpha - synuclein in serum than in patients without snp . Recent studies have presented the relationship between dna methylation of the snca gene and pd . According to jowaed et al . And matsumoto et al ., a decrease in dna methylation status was observed in the snca promoter region of intron1 in patients with pd . However, no difference in the methylation status of the snca promoter was found in a study performed using dna from white blood cells (wbc) of pd patients therefore, additional studies are needed . A recent study suggested the association of pd and microrna, another mechanism regulating the expression of genes . Experimental studies have demonstrated that snca expression can be regulated by manipulating a microrna binding site in 3'utr of the snca gene [35, 36], and interestingly a recent study reported a variation in mir-153 binding site in 3'utr of the snca gene in a patient with parkinson disease . As studies have verified the pathological role of alpha - synuclein in patients with pd, other studies have attempted to apply this pathogenesis in the diagnosis and prognosis of pd . Until now radiological tests and laboratory findings are used only as supporting tools in diagnosing pd . In these circumstances, the development of a biological marker is crucial for a more precise diagnosis and the prediction of disease before the onset of symptoms . Several studies have verified an increase in alpha - synuclein in the blood of pd patients compared with normal individuals . However, alpha - synuclein is mostly present in rbcs that contain more than 95% of all alpha - synuclein in the blood . Thus, the alpha - synuclein level measured in the blood sample is inevitably influenced by the minimal difference in the degree of hemolysis and accordingly it is inappropriate to use the blood level of alpha - synuclein for diagnostic purposes . Increases in alpha - synuclein protein and snca mrna in wbcs from pd patients have been reported; however, others reported no difference . Along with the measurement of alpha - synuclein level in the peripheral blood, studies to measure alpha - synuclein level in cerebrospinal fluid (csf) are also being carried out . The advantage of measuring the alpha - synuclein level in csf is that it contains no or only a small amount of rbcs; however, again the contamination by hemolysis cannot be controlled completely . Despite these flaws, recent studies have identified a decrease of alpha - synuclein in the csf of pd patients compared with that of normal individuals [42, 43]. This outcome aligns with the finding of reduced amyloid protein levels in the csf of patients with alzheimer's disease and has drawn attention to the similarity of two proteins regarding the disease mechanism . In a model of neuron injury by alpha - synuclein, attempts have been made to measure the alpha - synuclein oligomer level in body fluids . Studies have shown that although the total alpha - synuclein level is decreased in the csf of pd patients, the alpha - synuclein oligomer level was higher than that of normal individuals . Some studies have attempted to diagnose pd through alpha - synuclein in other biological samples or tissue specimens . In addition, an increase of alpha - synuclein has been found in minor salivary gland biopsies [46, 47], tissues from skin biopsy [48, 49], stomach biopsy, and colonic biopsy, and in fibroblasts obtained from the skin . These findings are anticipated to aid the development of a premortem biomarker crucial in the diagnosis, clarification of the mechanism, and new treatment methods of pd.
As a diagnostic fluid, saliva has several advantages over blood [1, 2]. Saliva is inexpensive and easier to collect, and sufficient volume can be obtained to allow performance of a variety of analyses . For patients, particularly children, the noninvasive sample collection reduces anxiety and discomfort and simplifies procurement of repeated samples for time - series analyses . Saliva contains a wide array of proteins and peptides that are responsive to pathological conditions . Advanced instrumentation and refined analytical techniques have been successfully applied for discovering oncological, hormonal, immunological, and cardiovascular [7, 8] biomarkers that can be informative for early detection and assessment of progression of oral and systemic diseases . Of particular interest, saliva is known to contain detectable levels of endothelins, an important risk marker for cardiovascular disease . Endothelins are a family of potent vasoconstrictor peptides consisting of three distinct isoforms, endothelin-1 (et-1), endothelin-2 (et-2), and endothelin-3 (et-3) coded by distinct genes . The mature endothelins are produced through cleavage of the big endothelin (bet) precursors by endothelin - converting enzymes [11, 12]. Endothelin-1, the most studied isoform, has been implicated in several diseases, particularly in the progression of cardiovascular diseases [13, 14]. It has been known for two decades that et-1, et-2, and et-3 are present in saliva [15, 16]. However, only recently have levels of saliva et-1 been related to conditions such as chronic heart failure, upper gastrointestinal diseases, vibration - induced white finger, and oral cancer [20, 21]. The relationship between saliva and plasma et-2 and et-3 isoforms is comparatively less well understood . Because of the emerging significance of all three isoforms in health and disease, notably the role of et-2 in the cardiovascular system, in ovulation, immunology, and cancer, we sought to extend the data on the relationships between the three endothelin isoforms in concurrent saliva and plasma samples . Ethylenediaminetetraacetic acid (edta), trifluoroacetic acid (tfa), phenylmethyl sulfonyl fluoride (pmsf), 3,4-dichloroisocoumarin, molecular weight cut - off filters (30 kda), endothelin-1 (et-1, human), endothelin-2 (et-2, human), and endothelin-3 (et-3, human) were obtained from sigma aldrich (oakville, ontario). Big endothelin-1 (bet-1, human) was obtained from bachem bioscience (american inc ., acetonitrile, acetone, methanol, and hydrochloric acid were purchased from sigma aldrich (oakville, ontario). Amber glass vials and screwcaps with septa were purchased from chromatographic specialities (brockville, ontario). Deionized water was obtained from a super - q plus high purity water system (millipore corporation, bedford, ma). Compressed gaseous nitrogen was of uhp grade quality and was supplied by matheson gas products (whitby, ontario). Anonymous, paired human plasma and saliva samples (from males) certified free of hiv, hep - a, and hep - b were purchased commercially (innovative research inc . Both plasma and saliva samples were treated on site with pmsf (final, 1.7 mg / ml) and edta (final, 10 mg / ml) to stabilize endothelins, shipped to our laboratory in dry ice, and stored at 80c until further use . Thirty (30) sample pairs of good quality and in sufficient amounts for analysis were retained for this study . Briefly, plasma (250 l) and saliva (1 ml) samples were treated with ice - cold 3,4-dichloroisocumarin solution in isopropanol to prevent conversion of bet-1 to et-1 during the sample processing . The samples were deproteinized with ice - cold acid - acetone mix (acetone: 1 n hcl: water, 40: 1: 5) and centrifuged at 9000 g for 10 min, and the supernatants obtained were concentrated by evaporation under nitrogen flow . Deproteinization and concentration stages were repeated once more to ensure the removal of abundant proteins . Samples were then loaded onto 30 kda molecular weight cut - off filters (prewashed with deionised water) and centrifuged at 5000 g for 30 min . These filters were then washed with 50% methanol and centrifuged at 5000 g for 30 min . Filtrates were dried under nitrogen and reconstituted in 75 l of 30% acetonitrile in 0.2% tfa / h2o for hplc - fluorescence analysis . The hplc unit consisted of a gilson solvent delivery system (mandel scientific, guelph, on), a gilson autosampler (model 231 xl; middleton, wi), a supelcosil lc-318 reverse - phase column (25 cm length, 4.6 mm i d, 5 m particle size, and 300 pore dimension; supelco, oakville, on), and a rf 551 model fluorescence detector (shimadzu, japan). Endothelins (20 l injection volume) were separated using a gradient elution with acetonitrile / water mobile phase at a flow rate of 1 ml / min and detected at ex 280 nm and em 340 nm . Blanks were analyzed after each set of four samples in order to assess the extent of analyte carryover . Student's t - test or mann - whitney rank sum test was carried out as appropriate using sigmastat v 11.0 (spss inc ., correlation between different endothelin isoforms in plasma and saliva was tested using pearson's product moment correlation revealing p and r values . We used hplc - fluorescence to measure simultaneously the isoforms bet-1, et-1, et-2, and et-3 (figures 1(a)-1(b)) in time - matched plasma and saliva sample pairs (n = 30) obtained from anonymous individuals (table 1). Our results confirm and extend previous reports of the presence of endothelins in saliva [15, 16] and of a relationship between saliva and circulating endothelins [1719], and the correlated measurements provide additional insight into the relationship of et-2 to the other two isoforms . The recoveries, analytical precision, and accuracy of the hplc - fluorescence procedure are comparable to values reported by walczak et al . For hplc with electrospray tandem mass spectrometry detection: recoveries of endothelins from spiked plasma are between 60% (et-2) and 97% (et-1), depending on the endothelin isoforms; analytical precision is on the order of 4% for replicate peptide standards; analytical accuracy is 20% for replicate measurements of plasma samples; limit of detection is 0.20.5 pmol; and linearity is 1100 pmol on the column (20 l injection volume). Both methods detect the separated peptides directly (i.e., on the basis of autofluorescence of aromatic amino acids by hplc [23, 25] or from mass ion fingerprints in ms / ms), which is different from elisa detection of immunoreactive endothelin in total plasma [26, 27]. For this reason, we have verified identities of analytes by pulling down of et-1 and et-3 with monoclonal antibodies during sample processing, confirming the correspondence between immunoreactive endothelins in plasma and the peptides measured by direct autofluorescence detection after separation on column . It should be noted that the aim of our study was not to explore the physiological significance of variations of saliva and plasma endothelin levels, within and between individuals, and for this reason we have not requested any information on the health status, cardiovascular or buccal, of the donors . Salivary secretions and saliva volume will be affected by water and food uptake and by medication . These factors, together with the health status of subjects and sample quality, can contribute to the variance in observed saliva endothelin concentrations and relationship to plasma levels . Furthermore, sample collection procedures, sample preparation methods, matrix effects, and the analytical approach used are likely to impact the absolute values of estimates . Finally, because all samples analyzed for endothelin content in our small study were from male donors, our data do not address potential gender differences . Notwithstanding those limitations, our observations reveal that levels of all endothelin isoforms were significantly correlated between the saliva and plasma matrices in the subjects studied: bet-1 (r = 0.38, p = 0.041), et-1 (r = 0.53, p = 0.003), et-2 (r = 0.51, p = 0.004), and et-3 (r = 0.75, p <0.001) (table 1, figure 2). Our results indicate a slight increase in the ratios of endothelin levels in plasma versus saliva with age of the subjects (et-1, plasma / saliva ratio in 1840 years versus 4163 years, 6.11 2.16 versus 8.67 2.51, p = 0.006), which is potentially attributable to saliva osmolality changes with age [28, 29]. Endothelin levels varied on average by fivefold between individuals, and this applied to all four isoforms measured, in plasma as well as saliva (90th/10th percentiles). In general, high bet-1 and et-1 levels were predictive of high et-3 levels within an individual (table 2). Within plasma, a significant positive correlation was seen for bet-1 versus et-1 (r = 0.39, p = 0.033), bet-1 versus et-3 (r = 0.46, p = 0.011), and et-1 versus et-3 (r = 0.57, p = 0.001). Within saliva, a significant positive correlation was seen for bet-1 versus et-1 (r = 0.75, p <0.001). Correlations between bet-1 versus et-3 (r = 0.31, p = 0.091) and et-1 versus et-3 (r = 0.27, p = 0.144) in saliva were not significant . There were no significant correlations between et-2 and other isoforms in either plasma or saliva . Whole saliva contains secretions from the major parotid, submandibular and sublingual glands, the palate, buccal and labial mucosa, and so on . Expression of preproet-1 and preproet-3 as well as the eta and etb receptors has been detected by rt - pcr analyses of submandibular glands of rats . Endothelin-1 has also been detected in striated duct cells of human salivary glands by immunohistochemical analysis . However, serum molecules that are not part of the normal salivary secretory constituents, such as proteins, drugs, and hormones, can also reach saliva by passive diffusion [1, 2, 3436]. We have measured six- to eightfold higher concentrations of endothelins in plasma by comparison to saliva, and hence the concentration gradient may result in diffusion of the peptides from the capillaries of the mucosa into the salivary fluid . If the intercept of the linear regressions of saliva versus plasma endothelin concentrations is taken as an estimate of the contribution by salivary glands, then at least half (bet-1, et-1, and et-2) to two - thirds (et-3) of the salivary endothelins may originate from plasma (figure 2). Correlation among the different endothelin isoforms within individuals and the large variance of endothelin levels between individuals may be due to a number of factors, including common regulatory mechanisms, genetic polymorphisms, and physiological status . Correlation between bet-1 and et-1 should be expected because of the direct precursor - product relationship . Furthermore, endothelin converting enzyme-1, which cleaves bet-1 to et-1, shares some regulatory elements with the preproet-1 gene, such that when preproet-1 is transcriptionally activated, ece-1 tends to be activated as well . In healthy individuals, et-1 plays an important role in the modulation of vasomotor tone, in conjunction with nitric oxide, but also in regulating cellular proliferation and differentiation in tissues during growth, development, and repair [39, 40]. There is good evidence for coordinated regulation of et-1 and et-3 . In individuals with high basal et-1 production, activation of preproet-3 expression through a feedback control mechanism may compensate for the pressor effects of the high circulating levels of et-1 . Endothelin-3 stimulates nitric oxide synthase expression and no production through binding to the etb receptor, and increase of et-1 with a decrease of et-3, due to endothelial dysfunction, has been reported in patients with pulmonary arterial hypertension of various etiologies [42, 43]. It is also possible that high or low transcriptional activity of both preproet-1 and preproet-3 genes within an individual is determined by genetic polymorphism or epigenetic conditioning of transacting elements with common cis - acting regulatory sequences between the two genes, but this remains to be investigated . In our analyses, the strongest associations were seen between saliva et-3 and plasma et-3 (r = 0.75, p <0.001) and between saliva bet-1 and saliva et-1 (r = 0.75, p <0.001). An overall relationship between et-3 and bet-1 and its mature product et-1 was observed in plasma and saliva but was stronger in plasma (figure 3). The similar ratio of bet-1 to et-1 in plasma (3.35 versus 3.45 pmol / ml) and saliva (0.55 versus 0.52 pmol / ml) suggests a relative stability of the peptides during sampling and sample processing . However, although saliva et-2 correlated with plasma et-2 (r = 0.51, p = 0.004), the poor correlation between et-2 and the other endothelin isoforms, within plasma (positive, p> 0.05) and within saliva (negative, p> 0.05), is in line with the concept of et-2 regulatory pathways distinct from those of et-1 and et-3 . In conclusion, our data confirm an overall positive correlation between plasmatic and salivary bet-1, et-1, et-2, and et-3 levels and between the bet-1, et-1, and et-3 within each of the two compartments . The isoform et-2 correlates poorly with et-1 and et-3, within saliva and within plasma . Salivary et isoform profiles portray the plasmatic profiles and support the view of coordinated regulation of et-1 and et-3, but distinct regulatory pathways for et-2.
Classical understanding of skeleton is that bone functions as the structure scaffold in animals and contains three types of cells: osteoblast, osteocyte, and osteoclast . Osteoblasts come from mesenchymal stem cells and can differentiate to osteocytes, which stay in the bone matrix . Osteoblasts are responsible for bone formation, and its activity can be regulated by several pathways such as wnt signaling pathway . Osteoclasts are a type of bone cells, which resorb bone and derived from the fusion of mononuclear cells belonging to the monocyte / macrophage lineage . Osteocytes and osteoblasts can secrete some signaling factors, such as wnt, opg, and sost, in order to regulate the coupling function of osteoblast and osteoclast; in this way bone obtains the ability to model and remodel itself . Recent reports indicate that sost, a wnt antagonist, downregulates the wnt signaling activity by crosstalk with parathyroid hormone (pth) and bone morphogenetic protein (bmp) in order to regulate bone cell differentiation, proliferation, bone formation, and bone resorption activities [14]. Even though there are plenty of evidences indicating that bone can secrete protein factors in the circulation and regulate itself, all these secreted factors cannot be called hormones . However, in the past decades with the development of technology we found that skeleton can also be an endocrine organ, which regulates not only itself but also other organs . The most well known and studied two hormones secreted by skeleton are ocn and fibroblast growth factor 23 (fgf23) (figure 1). In this review we would focus on ocn, especially on its function as a hormone in metabolism homeostasis . Ocn is specially synthesized and secreted by cells of osteoblast lineage, such as osteoblast and osteocyte [6, 7]. In humans ocn is also known as bone -carboxyglutamic acid - containing protein (bgp) and it is one of the richest noncollagenous proteins in bone matrix . The most of ocn is found in bone matrix and only a small amount in blood, because it has strong affinity to bone matrix . The ocn gene has 4 exons and 3 introns, and more than 70% of the exon sequences are conserved both in human and in mice . The ocn protein contains 4650 amino acid residues (varying from different species), the synthesis process of which is a little complicated (figure 2). After the translation it is only preproosteocalcin, which contains 98 amino acid residues composed of three parts: a 23-residue signal protein, a 26-residue target propeptide, and a 49-residue mature protein . Proteolysis of the prepropeptide will form the mature ocn . At position 17, 21 and 24 of the 49-residue peptide second carboxyl groups (cooh) are added to form -carboxyglutamyl residues, which are essential for its activity regulation . According to the carboxylation level, ocn can be divided into two groups; one is called undercarboxylated osteocalcin (ucocn), and the other is carboxylated osteocalcin (cocn). The decarboxylated form ucocn is the active form of ocn as a hormone, which has little affinity to bone so that most of ucocn will circulate with the blood, while most of cocn will be stored in the bone matrix because of its strong affinity to bone matrix . Usually the concentration of ucocn is not controlled by the protein synthesis, but by the decarboxylation of ocn and its releasing from the bone matrix . There are evidences indicating that in ocn knocked out mice the total amount of insulin in serum is downregulated, and the ocn knocked out mice have so - called impaired glucose - stimulated insulin secretion (gsis) and poor glucose tolerance phenotype . At the same time the serum adiponectin, a protein hormone that modulates several metabolic processes such as glucose regulation and fatty acid oxidation, was also reduced . All these results suggest that ocn may target cells and insulin targeting tissue such as muscle, liver, and adipocyte in order to regulate both insulin secretion and sensitivity [11, 12]. Later studies show that the change of insulin sensitivity is probably mediated by adiponectin instead of direct interaction with ocn . This result indicates that adipocytes are probably one target of ucocn, and ucocn functions as the activity form of ocn in circulation . There are also many evidences indicating that ucocn can regulate cells in pancreatic islets . Not only insulin 1 and insulin 2 can be upregulated by ucocn but also the proliferation of cells . Further research indicates that cyclind1, cyclind2, and cdk4 in cells can also be regulated by ucocn, and in this way it is not difficult to understand why ucocn can stimulate cell proliferation [9, 12, 14]. Cells proliferation and insulin secretion can be significantly affected at low concentrations of ucocn (660 pm). The mice lacking osteoblasts have not only problems on bone density and strength but also impaired glucose metabolism, such as high blood glucose, low insulin secretion, and insulin resistance . . However, administration of ocn can restore glucose and insulin level in circulation but only partially insulin sensitivity . Although more and more evidences show that ocn can regulate cells and increase the insulin sensitivity of insulin targeting cells, the receptor of ocn or more correctly ucocn has not been identified yet . What is more, we do not even know how ocn regulates the insulin sensitivity . There are only evidences indicating adiponectin mediates the insulin sensitivity regulation of ocn . Whether some other mechanisms involved in this progress is still not clear . Some in vitro studies indicated that cocn could regulate bone formation and resorption; however, in the ocn knocked out mice no negative bone effects were observed [1719]. These were observed from the experimental studies on esp and ocn knocked out mice . With or without ocn, mice with high ocn activity (the esp knocked out mice) had increased testicular volume and sperm count . On the contrary, the ocn absent mice (the ocn knocked out mice) showed shriveled testes, epididymis, and seminal vesicles . However, the female in both esp and ocn knocked out groups did not show any defects in reproduction . This indicates that ocn secreted by skeleton regulates male reproduction activity as a hormone . And it is a g protein - coupled receptor (gpcr6a) and localized on the surface of the leydig cell . This 7-transmembrane protein was found because the gpcr6a knocked out mice copy the metabolic syndrome of the ocn knocked out mice [21, 22]. In the past decades it was demonstrated that gonadal hormone (estrogen) can regulate bone formation [23, 24], and now we know that bone can also regulate testicle and testosterone secretion . This discovery suggested that there may be a novel mechanism regulating bone formation in some special stage, such as teenage time, in which rapid bone formation is associated with androgen secretion changing . In general, ocn, particularly ucocn (released during bone resorption) targets directly cells and stimulates insulin synthesis and secretion . At the same time it affects adipocytes and enhances adiponectin secretion . Interestingly, ocn also targets leydig cells and regulates testosterone production and male reproductive activity (figure 3). Vitamin d is a kind of fat - soluble secosteroids which plays an essential role in absorption of calcium, phosphorus, iron, zinc, and their metabolism . In humans and mice recent studies showed that the ocn expression in osteoblasts can be partly stimulated by vitamin d3 . More interestingly fibroblast growth factor 23 (fgf23), another bone secreted hormone, can affect kidney and inhibit vitamin d synthesis . This loop suggested a feedback loop, in which bone can partly regulate its own hormone secretion . Studies showed that accumulation of osteocalcin in the ecm of human osteoblastic cultures stimulated by 1,25-dihydroxyvitamin d3 is inhibited by warfarin (antagonist of vitamin k), while vitamin k2 enhanced the 1,25-dihydroxyvitamin d3 effect, and 1,25-dihydroxyvitamin d3 stimulated mineralization was significantly augmented by warfarin . The biological active form of ocn is ucocn, while the cocn has a strong affinity to bone matrix and binds tightly to hydroxyapatite, as a result little cocn could be found in the serum . Vitamin k is a cofactor for the glutamate carboxylase, which is required for carboxylation . In the absence of vitamin, high level of vitamin k can reduce ucocn level, which had been proved by vitamin k administration in daily diet . Generally speaking, there are two ways controlling ocn signaling, one is on the transcription level and the other is on the posttranslational level . The product of esp is an osteotesticular protein tyrosine phosphatase (ost - ptp), which is found in embryonic cells, sertoli cells, and osteoblast . Karsenty et al . Found esp knocked out mice have the opposite phenotype compared with the ocn knocked out group (table 1). The phenotypes of the esp knocked out mice are as follows: hypoglycemia, high glucose - stimulated insulin secretion, glucose tolerance, pancreatic insulin content, and cell proliferation . Esp deletion (either totally knocked out or selectively knocked out in osteoblasts) resulted in the exact opposite phenotype as found in the ocn knocked out mice . And esp can rescue the phenotype of the high fat diet and gold thioglucose - induced obesity and diabetes, which mimics the phenotype of ucocn treated mice [9, 12]. Indeed lacking one allele of ocn in the esp knocked out mice rescued the metabolic abnormality of the esp absent mice . As the total ocn gene expression did not change in esp knocked out mice, ferron et al . Suggested that ost - ptp was involved in the osteoclast - dependent ucocn formation and releasing . In the recent years the molecular mechanism of esp regulation was revealed (figure 4). Two transcription factors, forkhead box protein o1 (foxo1) and cyclic amp - dependent transcription factor (atf-4), are involved in the regulation of the total ocn . Foxo1 is a conservative modulator of glucose metabolism in many organs, as well as insulin synthesis in cells, and atf4 regulates expression of many genes which mostly are important for adult bone formation and development [33, 34]. Osteoblast specific foxo1 knocked out mice have low blood glucose level and high glucose tolerance, which is similar to the mice with high ucocn level . Molecular experimental studies showed that foxo1 could bind to a cognate foxo1 binding site in the esp promoter area and stimulate the expression of the downstream esp; then ost - ptp would activate the carboxylation of ocn or ucocn . The new formed cocn would bind to hydroxyapatite and stay in bone matrix, and as a result the ucocn would be downregulated . Now it is not surprising that atf4 can suppress obesity in mice and involve in the glucose homeostasis in human [3638]. In fact even though atf4 is mainly expressed in osteoblast, it functions quite similar to foxo1 . Via stimulating ost - ptp transcription atf4 suppress the activity of ocn, in this way suppressing insulin secretion and insulin sensitivity [39, 40]. More details of ocn regulation are still unknown, and the endocrine regulation of ocn will be discussed in the later section of this review . As mentioned in the sections above, in the ocn knocked out mice the blood glucose concentration was higher than that of the wild type . Serum insulin in the knocked out mice would be downregulated and the mice tended to be obesity . All these indicate that ocn may be essential in energy metabolism, especially in glucose metabolism . With administration of ocn or deletion of esp (ost - ptp increases ucocn, the active form of ocn), the mice achieved higher activity of insulin, lower blood glucose, higher glucose tolerance, and higher insulin sensitivity with normal glucagon levels . This abnormality is mainly caused by the increased number or mass of pancreatic islets and cells . This means that ocn can increase insulin secretion and insulin sensitivity in some tissues such as muscles and adipose tissue . The increasing sensitivity of insulin is probably mediated by adiponectin, which can be upregulated by ucocn [9, 12, 41]. Cocn would be stored in the bone matrix and released during bone resorption [10, 42]. Osteoclasts would secret protons and decrease the ph value during resorption; this would facilitate the decarboxylation of cocn and by the way the active form ucocn would enter the circulation to stimulate cells proliferation and insulin secretion [31, 43]. However, more details of the mechanism need to be revealed . Insulin, synthesized and modified in cells in pancreas, is an essential protein hormone in almost all vertebrates . Through clinical observation insulin receptor (insr) is required for osteoblast survival, proliferation, and differentiation [44, 45]. Studies showed that the expression of runx2 was decreased in osteoblasts lacking insr [45, 46]. Instead, insulin downregulates twist2, an inhibitor of runx2 activity, to suppress the activity of runx2 . Insulin signaling can decrease osteoprotegerin (opg) expression in osteoblasts via binding to insr . Opg, a key regulator of osteoclasts, together with receptor activator of nuclear factor- ligand (rankl) via receptor activator of nuclear factor- (rnak) regulates the differentiation and activity of osteoclasts [2, 47, 48]. During bone resorption in turn ucocn increases cells proliferation, insulin secretion, and insulin sensitivity [16, 49]. Thus, insulin signaling and ocn form a feed - forward loop, in which insulin affects osteoblasts and in turn increases its own secretion and sensitivity via ucocn . Insr is downstream molecule of ost - ptp, which inhibits phosphorylation of insr and stops insulin signaling in osteoblasts [50, 51]. This feed - forward model explains why the osteoblastic insr knocked out mice have low serum insulin level and high insulin resistance . As mentioned above, the relationship between ocn and insulin is not a feedback relationship, so there must be some other signaling pathways to regulate the ost - ptp activity . If not, the serum insulin concentration cannot stay in a certain level with only the feed - forward loop between bone and pancreatic islets . Some studies suggested that sympathetic nervous system (sns) may control the expression of esp via leptin, a hormone secreted by adipocytes . The main function of leptin is regulating the amount of fat stored in the body . It inactivates the 5-hydroxylase 2 (tph2), which is known as the rate - limiting enzyme of serotonin synthesis . Tph2 knocked out mice have osteoporotic and anorectic phenotype, indicating this source of serotonin can regulate osteoblasts . Have proved that leptin - dependent regulation of ocn carboxylation appeared to be through the hypothalamus [53, 54]. The sns acts through 2-adrenergic receptors (adrb2) in osteoblasts to upregulate the esp expression, and in so doing the activity of ucocn would be suppressed . The esp gene in human is a so - called pseudogene which does not have a functional product . Years ago a study showed that in human dephosphorylation of insr can be achieved by protein - tyrosine phosphatase 1b (ptp1b) instead of ost - ptp . So it seems that the mechanism of ocn regulation in human is different from that in mice . In human the concentration of ocn will arrive at its peak in the early morning and its lowest point in the afternoon, while the mice will have a high level of ocn in the day and the level of ocn reaches its lowest point at night during sleep . In the older studies the researchers could only test the concentration of total ocn, now there are several ways to test the level of ucocn, such as ucocn specific elisa and hydroxyapatite (hap) binding assay [19, 57]. With these technological development, recent studies showed that the ratio of ucocn / ocn usually did not change, while the total amount of ucocn in circulation had the similar changes as the circadian rhythm of ocn [8, 5862]. In clinical studies the data were mostly focused on the effects of ocn on bone formation and metabolism . Children and adolescents, who have the need to increase bone formation, usually have higher levels of ocn and ucocn and this may facilitate the utilization of glucose in bone . Clinical studies also showed that bone loss was associated with high level of ucocn in human, and in older people high ocn level predicted increased fracture risk or lower bone density [64, 65]. The phenomenon can be explained by studies in mice that bone resorption facilitates decarboxylation of ocn and releases ocn from bone matrix to the blood . However, whether ocn has effects on skeleton or not is still not clear; the ocn knocked out mice seem quite normal . The minor differences between the knocked out and wild type mice suggest that ocn may play some roles in regulation of bone mineralization . Only in recent years many studies are focused on the hormone functions of ucocn and ocn in energy metabolism . Patients who suffer from type 1 or type 2 diabetes mellitus have lower level of ocn than healthy people [6669]. Patients with obesity also show lower level of ocn [70, 71]. However, studies showed in male patients with type 2 diabetes adiponectin was associated with ucocn / ocn ratio instead of the concentration of ucocn, while in female patients it was correlated with ocn, but not ucocn . It is now very clear that ocn regulates testicular function and does not have such function on female gonad . Whether it has something to do with the differences between male and female diabetic patients is still unknown anyway, more studies need to be done to reveal the mechanism of this phenomenon . Studies in animal models showed that ucocn targets cells in the pancreas to directly regulate insulin synthesis and regulates insulin sensitivity through adiponectin . And experiments in mice showed that ucocn may be a potential therapy for diabetic patients . One of the regulators of ocn is ost - ptp, which promotes the carboxylation of ocn and reduces the concentration of ucocn or the ratio of ucocn / ocn . There are also many clinical evidences indicating that ocn or probably ucocn is associated with fasting glucose and insulin sensitivity . However, ost - ptp is not a functional protein in human, and the exact role which ocn plays in human still needs to be studied . Anyway all these studies suggest us skeleton can behave not only as a structure scaffold but also as an endocrine organ, which regulates energy metabolism, even though all the studies are mostly done in mice and only partially confirmed in human . Therefore, more investigations are needed to reveal the total functions of ocn as a hormone in energy metabolism.
Participants included in this analysis were from the sacramento area latino study on aging (salsa), a cohort study of community - dwelling older mexican americans in the sacramento area of california designed to evaluate the effects of metabolic and cardiovascular risk factors on dementia in this understudied ethnic group . Recruits were eligible to participate in this study if they were 60 years of age or older at enrollment in 19981999, resided in a six - county area in the sacramento valley (sacramento, yolo, sutter, solano, san joaquin, and placer counties), and self - identified as latino . A detailed description of study sampling and procedures has been published elsewhere (24). A total of 1,789 participants enrolled between 1998 and 1999 were interviewed in their homes every 1215 months for up to seven study visits ending in 2007 . Every 6 months between home visits, a 10-min phone call was made to update contact information, health status, and medication changes . Salsa has been approved annually by the institutional review boards of the university of california at san francisco and davis and the university of michigan . At each study visit, diabetes classification was based on fasting glucose level 126 mg / dl, antidiabetic medication use, or self - reports of a physician diagnosis at any study visit prior to dementia / cind, death, or last study visit . Diabetic medications were recorded at every study visit by direct visual inspection of medications and classified using the centers for disease control and prevention ambulatory care drug database (http://www2.cdc.gov/drugs/). Given the advanced age of the cohort, most, if not all, cases were probably type 2 diabetes (16). The classifications of dementia and cind were determined at all home visits by a multistage assessment protocol, which has been described extensively elsewhere (24). In brief, at each visit, two cognitive screening tests were used to determine the need for further neuropsychological evaluation: the modified mini - mental state exam (3mse) (25), a global cognitive function test, and a delayed word recall trial from the spanish english verbal learning test (sevlt) (26), a word list learning and memory test . At baseline, a participant was referred for further evaluation if his or her score on either test fell below the 20th percentile . At follow - up, a participant was referred for a neuropsychological test battery and a standard neuropsychological examination by a geriatrician if his or her follow - up score declined from the baseline score by more than eight points on 3mse or more than three points on sevlt and the score fell below the 20th percentile . A team of neurologists and a neuropsychologist reviewed all potential dementia and cind cases and classified participants as demented, cind, or cognitively normal . Standard diagnostic criteria were applied for dementia (dsm - iv) (27), alzheimer disease (national institute of neurological and communicative disorders and stroke alzheimer's disease and related disorders association) (28), and vascular dementia (california alzheimer s disease diagnostic and treatment centers) (29). Dementia and cind cases were referred for magnetic resonance imaging . For participants who died during the study period without a previous diagnosis of dementia or cind, dementia diagnoses were also ascertained from death certificates based on the following causes of death listed anywhere on the death certificate: dementia in alzheimer disease, vascular dementia, other dementia, or unspecified dementia . For this analysis, dementia and cind mortality ascertainment included interviews with family members to track participants who could not be reached for annual study visits or interim 6-month phone calls, online surveillance of death notices, and review of the social security death index, the national death index, and vital statistics data files from the state of california . Mortality surveillance is ongoing, but this analysis is limited to deaths that occurred during active follow - up for dementia / cind (19982007). We had complete or partial social security numbers on most (80%) of the deceased and obtained death certificates and cause of death for 93.1% of deceased participants . We classified cause of death using icd-10 . At the baseline interview, participants reported their age, sex, years of education, country of birth, whether or not they had a regular medical doctor (as a marker of access to medical care), smoking status, and any alcohol use . As a marker of physical activity, participants were asked to classify their usual outdoor walking pace as never walks outdoors / unable to walk, easy pace, or brisk pace . Depressive symptoms were measured by the center for epidemiologic studies depression scale, a widely used scale (range 060) (30). Fasting glucose was measured with the cobas mira chemistry analyzer (roche diagnostics corporation, indianapolis, in). Fasting insulin was measured using a double - antibody radioimmunoassay using i - labeled human insulin tracer (linco research, st . Charles, mo), a guinea pig antiporcine insulin first antibody (michigan diabetes research and training center, ann arbor, mi), and a goat anti guinea pig -globulin (antibodies incorporated, davis, ca) and standardized against the human insulin international reference preparation for insulin . Sitting systolic and diastolic blood pressure measurements were taken with an automatic digital blood pressure monitor twice at a 10-min interval and averaged . Hypertension was based on measured systolic blood pressure (140 mmhg), self - report of a physician diagnosis, and/or antihypertensive medication use . Waist circumference was measured at the level of the umbilicus at midrespiration with the participant standing erect . History of stroke was based on self - report of a physician diagnosis and hospitalization . The objective of the analysis was to examine the association of diabetes with incidence of dementia / cind and to account for the competing risk of mortality . We first compared baseline descriptive characteristics by treated and untreated diabetes status (ever vs. never during study) with anova for continuous variables and tests for categorical variables . We evaluated the association of treated and untreated diabetes with incidence of dementia / cind using competing risk regression models with the method proposed by fine and gray (31). Participants were observed from study entry until the occurrence of dementia / cind (the event of interest), death (the competing event), or censoring (last date of contact). We used time - dependent diabetes as the exposure variable for all models to capture all diabetes cases that occurred prior to diagnosis of dementia, death, or censoring and time - dependent variables for covariates to reflect changes in values throughout the study period . Because of the strong association between dementia and age, for all models, we used age at diagnosis, death, or censoring as the timescale and adjusted for baseline age (32). Our competing risk regression approach accounts for the fact that individuals who die prior to developing dementia / cind will never develop dementia / cind . Thus, the association between diabetes and dementia / cind depends on the association between diabetes and death (3335). Like the standard cox regression model, this approach measures the association of diabetes with risk of dementia / cind with a hazard ratio (hr). Since previous studies of this issue have not accounted for the competing risk of death, we also specified cox regression models, where participants who died were censored at age at death, to examine how taking into account the competing risk of death influenced risk estimates . We examined the influence of covariates on the association of diabetes (time dependent) with risk of dementia / cind with a series of models . We evaluated whether dementia / cind incidence differed among those with diabetes who were taking antidiabetic medications from those with diabetes who were not taking antidiabetic medications using a three - level exposure variable (no diabetes, untreated diabetes, and treated diabetes). Model 1 was adjusted for age (as timescale), sex, and years of education . Model 2 further adjusted for waist circumference (time dependent) to control for central obesity as a potential confounder . Model 3 (fully adjusted model) added adjustment for (time dependent) stroke to model 2 to account for stroke as a potential intermediary variable between diabetes and dementia / cind . We assessed whether stroke modified the effect of diabetes on dementia / cind risk by adding a multiplicative interaction term between stroke and diabetes to model 3 . In analyses not reported here, we adjusted for hypertension, depressive symptoms, alcohol use, smoking status, outdoor walking pace, and having a regular medical doctor as potential confounders but did not include these variables in the final models because they did not substantially (i.e., 10%) alter the magnitude of the hrs for diabetes . We graphically displayed the estimated cumulative incidence of dementia / cind by diabetes status from the fully adjusted competing risk regression model (fig . We separately evaluated the association between dementia / cind or diabetes and death with cox regression models adjusted for the same covariates included in the models of the association of diabetes with risk of dementia / cind described above . Summary statistics were run using sas 9.2 (sas institute inc ., cary, nc). All regression models were run in stata 11 (statacorp, college station, tx). Competing risk regression models were estimated using stata command stcrreg, and cumulative incidence curves were estimated using stata command stcurve with option cif . Participants included in this analysis were from the sacramento area latino study on aging (salsa), a cohort study of community - dwelling older mexican americans in the sacramento area of california designed to evaluate the effects of metabolic and cardiovascular risk factors on dementia in this understudied ethnic group . Recruits were eligible to participate in this study if they were 60 years of age or older at enrollment in 19981999, resided in a six - county area in the sacramento valley (sacramento, yolo, sutter, solano, san joaquin, and placer counties), and self - identified as latino . A detailed description of study sampling and procedures has been published elsewhere (24). A total of 1,789 participants enrolled between 1998 and 1999 were interviewed in their homes every 1215 months for up to seven study visits ending in 2007 . Every 6 months between home visits, a 10-min phone call was made to update contact information, health status, and medication changes . Salsa has been approved annually by the institutional review boards of the university of california at san francisco and davis and the university of michigan . At each study visit, diabetes classification was based on fasting glucose level 126 mg / dl, antidiabetic medication use, or self - reports of a physician diagnosis at any study visit prior to dementia / cind, death, or last study visit . Diabetic medications were recorded at every study visit by direct visual inspection of medications and classified using the centers for disease control and prevention ambulatory care drug database (http://www2.cdc.gov/drugs/). Given the advanced age of the cohort, most, if not all, cases were probably type 2 diabetes (16). The classifications of dementia and cind were determined at all home visits by a multistage assessment protocol, which has been described extensively elsewhere (24). In brief, at each visit, two cognitive screening tests were used to determine the need for further neuropsychological evaluation: the modified mini - mental state exam (3mse) (25), a global cognitive function test, and a delayed word recall trial from the spanish english verbal learning test (sevlt) (26), a word list learning and memory test . At baseline, a participant was referred for further evaluation if his or her score on either test fell below the 20th percentile . At follow - up, a participant was referred for a neuropsychological test battery and a standard neuropsychological examination by a geriatrician if his or her follow - up score declined from the baseline score by more than eight points on 3mse or more than three points on sevlt and the score fell below the 20th percentile . A team of neurologists and a neuropsychologist reviewed all potential dementia and cind cases and classified participants as demented, cind, or cognitively normal . Standard diagnostic criteria were applied for dementia (dsm - iv) (27), alzheimer disease (national institute of neurological and communicative disorders and stroke alzheimer's disease and related disorders association) (28), and vascular dementia (california alzheimer s disease diagnostic and treatment centers) (29). Dementia and cind cases were referred for magnetic resonance imaging . For participants who died during the study period without a previous diagnosis of dementia or cind, dementia diagnoses were also ascertained from death certificates based on the following causes of death listed anywhere on the death certificate: dementia in alzheimer disease, vascular dementia, other dementia, or unspecified dementia . For this analysis, dementia and cind were combined into one outcome, dementia / cind . Mortality ascertainment included interviews with family members to track participants who could not be reached for annual study visits or interim 6-month phone calls, online surveillance of death notices, and review of the social security death index, the national death index, and vital statistics data files from the state of california . Mortality surveillance is ongoing, but this analysis is limited to deaths that occurred during active follow - up for dementia / cind (19982007). We had complete or partial social security numbers on most (80%) of the deceased and obtained death certificates and cause of death for 93.1% of deceased participants . At the baseline interview, participants reported their age, sex, years of education, country of birth, whether or not they had a regular medical doctor (as a marker of access to medical care), smoking status, and any alcohol use . As a marker of physical activity, participants were asked to classify their usual outdoor walking pace as never walks outdoors / unable to walk, easy pace, or brisk pace . Depressive symptoms were measured by the center for epidemiologic studies depression scale, a widely used scale (range 060) (30). Fasting glucose was measured with the cobas mira chemistry analyzer (roche diagnostics corporation, indianapolis, in). Fasting insulin was measured using a double - antibody radioimmunoassay using i - labeled human insulin tracer (linco research, st . Charles, mo), a guinea pig antiporcine insulin first antibody (michigan diabetes research and training center, ann arbor, mi), and a goat anti guinea pig -globulin (antibodies incorporated, davis, ca) and standardized against the human insulin international reference preparation for insulin . Sitting systolic and diastolic blood pressure measurements were taken with an automatic digital blood pressure monitor twice at a 10-min interval and averaged . Hypertension was based on measured systolic blood pressure (140 mmhg), self - report of a physician diagnosis, and/or antihypertensive medication use . Waist circumference was measured at the level of the umbilicus at midrespiration with the participant standing erect . History of stroke was based on self - report of a physician diagnosis and hospitalization . The objective of the analysis was to examine the association of diabetes with incidence of dementia / cind and to account for the competing risk of mortality . We first compared baseline descriptive characteristics by treated and untreated diabetes status (ever vs. never during study) with anova for continuous variables and tests for categorical variables . We evaluated the association of treated and untreated diabetes with incidence of dementia / cind using competing risk regression models with the method proposed by fine and gray (31). Participants were observed from study entry until the occurrence of dementia / cind (the event of interest), death (the competing event), or censoring (last date of contact). We used time - dependent diabetes as the exposure variable for all models to capture all diabetes cases that occurred prior to diagnosis of dementia, death, or censoring and time - dependent variables for covariates to reflect changes in values throughout the study period . Because of the strong association between dementia and age, for all models, we used age at diagnosis, death, or censoring as the timescale and adjusted for baseline age (32). Our competing risk regression approach accounts for the fact that individuals who die prior to developing dementia / cind will never develop dementia / cind . Thus, the association between diabetes and dementia / cind depends on the association between diabetes and death (3335). Like the standard cox regression model, this approach measures the association of diabetes with risk of dementia / cind with a hazard ratio (hr). Since previous studies of this issue have not accounted for the competing risk of death, we also specified cox regression models, where participants who died were censored at age at death, to examine how taking into account the competing risk of death influenced risk estimates . We examined the influence of covariates on the association of diabetes (time dependent) with risk of dementia / cind with a series of models . We evaluated whether dementia / cind incidence differed among those with diabetes who were taking antidiabetic medications from those with diabetes who were not taking antidiabetic medications using a three - level exposure variable (no diabetes, untreated diabetes, and treated diabetes). Model 1 was adjusted for age (as timescale), sex, and years of education . Model 2 further adjusted for waist circumference (time dependent) to control for central obesity as a potential confounder . Model 3 (fully adjusted model) added adjustment for (time dependent) stroke to model 2 to account for stroke as a potential intermediary variable between diabetes and dementia / cind . We assessed whether stroke modified the effect of diabetes on dementia / cind risk by adding a multiplicative interaction term between stroke and diabetes to model 3 . In analyses not reported here, we adjusted for hypertension, depressive symptoms, alcohol use, smoking status, outdoor walking pace, and having a regular medical doctor as potential confounders but did not include these variables in the final models because they did not substantially (i.e., 10%) alter the magnitude of the hrs for diabetes . We graphically displayed the estimated cumulative incidence of dementia / cind by diabetes status from the fully adjusted competing risk regression model (fig . We separately evaluated the association between dementia / cind or diabetes and death with cox regression models adjusted for the same covariates included in the models of the association of diabetes with risk of dementia / cind described above . All regression models were run in stata 11 (statacorp, college station, tx). Competing risk regression models were estimated using stata command stcrreg, and cumulative incidence curves were estimated using stata command stcurve with option cif . A total of 1,789 adults 60 years of age were enrolled in salsa in 19981999 . A total of 172 participants were excluded from this analysis: 115 had dementia / cind at the baseline visit and 57 did not participate in any follow - up visits . Out of the 1,617 participants, 677 (41.9%) had diabetes during the study (n = 513 baseline diabetes cases; n = 164 incident diabetes cases). The majority (77%) of participants with diabetes a total of 24 (15.1%) of the dementia / cind cases were ascertained only from death certificates . Of those, 83.3% (n = 20) had a cognitive test score below the cut point for dementia assessment . A total of 298 participants died during the study period without a diagnosis of dementia / cind . The remaining 1,160 participants were censored at the age of last contact with the study . In addition to the deaths that occurred among participants without dementia / cind, 63 participants with dementia / cind died during the study period, for a total of 361 deaths . Average nonmortality annual attrition due to refusals and loss to follow - up was 2.9% per year . Table 1 shows the baseline characteristics of the sample by treated and untreated diabetes status (ever vs. never) in the at - risk sample . On average, compared with those without diabetes, participants with diabetes were slightly younger, more likely to be born in the u.s ., and more likely to have a regular medical doctor, which may reflect better access to healthcare among those with diabetes . They were less likely to be current smokers but more likely to have a history of smoking . They were more likely to have hypertension, larger waist circumferences, higher fasting glucose and insulin, and a history of stroke, myocardial infarction, congestive heart failure, intermittent claudication, and kidney disease . Baseline characteristics of participants by diabetes status (ever vs. never) during study (n = 1,617) compared with those with treated diabetes, those with untreated diabetes were more often immigrants and had smaller waists, lower glucose and insulin, less hypertension, and fewer reports of stroke, myocardial infarction, intermittent claudication, and kidney disease . Among participants with diabetes, 62.2% met at least two criteria for diabetes in this study (elevated fasting glucose, antidiabetic medication use, or self - report) and 37.8% met one (13.3% fasting glucose, 3.4% antidiabetic medication use, and 21.1% self - report) (data not shown in tables). Among the participants who reported a physician diagnosis of diabetes at baseline, the median reported duration of diabetes sulfonylureas were the most common class (73%) of antidiabetic drugs (36). The proportion of patients taking antidiabetic medications remained relatively constant throughout follow - up (64.7% in year 1 up to 69% in year 7). More participants with diabetes died (n = 182, 26.9%) than participants without diabetes (n = 179, 19.0%). In a cox model, treated and untreated diabetes was associated with increased risk of death after adjustment for sex, education, time - dependent waist circumference, and time - dependent stroke (hr 2.15 [95% ci 1.582.95]; 2.12 [1.652.73]). There were more deaths among participants with incident dementia / cind (n = 63, 39.6%) than among those without dementia / cind (n = 298, 20.4%). Incident dementia / cind was associated with an increased risk of death in a cox model adjusted for the same covariates (2.48 [1.753.51]). Table 2 shows the hrs relating time - dependent diabetes to the incidence of dementia / cind from competing risk models and cox models . In both types of models, untreated diabetes was only associated with higher incidence of dementia / cind in cox models . Comparison of dementia / cind risk in treated to untreated diabetes was not significant (hr 1.32 [95% ci 0.802.19], p = 0.28). In model 2, adjustment for time - dependent waist circumference, a potential confounder of the association between diabetes and dementia / cind risk, increased the hrs for treated diabetes and untreated diabetes by 10 and 15%, respectively, compared with the base model (model 1), which adjusted for only age (as time scale), sex, and years of education . In model 3 (fully adjusted model), addition of time - dependent stroke modestly decreased the hr for treated diabetes by 9% and untreated diabetes by 10%, but the association with treated diabetes remained strong and statistically significant . Time - dependent stroke did not modify the association between diabetes and dementia / cind (interaction between stroke and diabetes p = 0.97; data not shown). Compared with the cox regression model 3, accounting for competing risk of death in model 3 attenuated the hr for treated diabetes by 14% and for untreated diabetes by 18% . Hrs (95% ci) from competing risk regression models relating diabetes and incidence of dementia / cind figure 2 displays the estimated cumulative incidence functions for dementia / cind by diabetes status from the fully adjusted competing risk regression model (model 3). The graph demonstrates that the incidence of dementia / cind was highest among those with treated diabetes, followed by people untreated for diabetes and then those without diabetes . Cumulative incidence functions for dementia / cind by diabetes status, accounting for the competing risk of death, from competing risk regression model adjusted for sex, years of education, waist circumference, and stroke . In this 10-year population - based study, we found that those with treated diabetes had a twofold increased risk of dementia / cind among older mexican americans, even after accounting for the competing risk of mortality and changes over time in risk factor exposures . Those with treated diabetes in our sample have higher glucose, insulin, and hypertension and more comorbid cardiovascular disease and may have more severe diabetes than those who were untreated . This may explain why their dementia risk is higher, given that the risk of death is similar in both groups . However, comparison of dementia / cind risk in treated to untreated diabetes was not statistically significant (hr treated vs. untreated: 1.32, p = 0.28). Standard cox models that do not incorporate adjustment for competing risk consistently provided a larger estimate of effect . Previous epidemiologic studies in non - hispanic white populations have also found that diabetes is associated with a twofold increased risk of dementia (213). Most research on the association between diabetes and dementia has been conducted in non - hispanic white populations, where diabetes burden is lower than among mexican americans (16). To our knowledge, this is the first study to evaluate the association between diabetes and dementia or cind among older mexican americans . In addition to studying a different ethnic group, the current study differs from previous studies because the analysis takes into account the competing risk of death . It is well established that diabetes is associated with higher mortality rates (16), and previous studies have also shown that cognitive decline (22,23) is associated with an increased risk of death . Diabetes - related mortality differentially influences the number of dementia / cind cases that occur . Since diabetes is associated with death, a standard cox model, which ignores the competing risk of death, may result in an overestimation of the effect of diabetes on incidence of dementia / cind (34,37). Although the cox model treats deaths as censored observations and removes individuals from the denominator for the hazard rate at death, the competing risk model treats death as a competing risk by retaining those who die without dementia in the denominator for the hazard rate . In effect, this approach models these individuals as no longer at risk for dementia / cind . The competing risk regression model produces estimates that reflect the actual incidence of dementia / cind among people with diabetes compared with those without diabetes . This approach may be useful for clinical predictions and for predictions of future dementia / cind incidence in the population . In this population, accounting for the competing risk of death altered the fully adjusted risk estimates for treated and untreated diabetes by 14 and 18%, respectively . This change is large enough (10%) to be considered an important confounder by conventional confounder identification criteria (38). These findings have important implications for prediction of future dementia incidence among mexican americans and other racial / ethnic groups . It is important to consider how future changes in mortality rates among people with diabetes may affect dementia rates . A recent publication from the national health interview survey reported that mortality rates among adults with diabetes declined by 23% between 1997 and 2006 (20). This trend was observed in the overall population as well as across age and racial / ethnic subgroups; the decline was greatest among hispanics (38%). The authors point out that the change in death rates is likely due to multiple factors, including improved diabetes medical care, treatments, and self - management behaviors . In fact, results from the national health and nutrition examination survey 19992008 (39) suggest that blood pressure, glycemic control, ldl cholesterol, and hba1c have improved in mexican americans as well as other groups . These improvements may propel the decline in mortality rates observed over the same period . These changes have important public health implications for future incidence of dementia / cind in the population . The potential impact on dementia / cind incidence among people with diabetes will depend on the factors causing the decline in the mortality rate . If mortality rates among those with diabetes decline due to earlier screening and improved management and therefore decreases in disease progression and severity, dementia / cind rates among people with diabetes might also decrease . If mortality rates decline among those with diabetes without reducing disease severity, and if more severe diabetes influences dementia risk, dementia / cind rates among people with diabetes could potentially increase . The sample is representative of older latinos residing in the sacramento area in california in 19981999 (24). The risk estimates from this study are generalizable to populations with similar characteristics, including similar mortality rates . In this population, mortality associated with diabetes is slightly higher in our population than in two recent nationally representative studies: the national health interview survey (20) and the cancer prevention study - ii (21). In both of these studies, a major strength of this study is the large sample and population - based longitudinal design, which enabled us to study incident dementia / cind over a long time period in an understudied ethnic group with a high burden of diabetes . This is the only population - based study of clinically assessed dementia in mexican americans . Because our analysis accounted for the competing risk of death, our results can be interpreted as the absolute risk of dementia / cind among people with diabetes compared with those without, making our results relevant for clinical decision making and public health predictions . This study also has some limitations . As for any study of older adults, individuals had to survive at least to 60 years of age to participate in this study . Selection due to premature mortality among people with diabetes before 60 years of age may have occurred and affected the risk estimate in our sample . Participants with diabetes and participants experiencing symptoms of dementia / cind may have been more likely to drop out of the study than healthier participants, which could have biased our results toward the null . Stroke was measured by self - report of a physician diagnosis, which is likely to underestimate the presence of strokes, especially silent strokes . This would tend to attenuate the association between stroke and dementia because undiagnosed strokes are included in the nonstroke category . To the extent to which stroke is on the pathway between diabetes and dementia, such misclassification may reduce the influence of adjustment for stroke on that association . Physical activity was estimated by self - reported outdoor walking speed, which may underestimate physical activity levels . As in all observational studies, we cannot rule out the possibility of residual confounding, particularly from unmeasured behavioral factors . In conclusion, we found that treated type 2 diabetes is associated with a twofold increased incidence of dementia / cind in older mexican americans, even after accounting for the competing risk of mortality . Screening and treatment for diabetes that change survival among those with type 2 diabetes may influence future dementia incidence rates . Cognitive screening in those with diabetes is warranted by the preponderance of evidence supporting a robust link between diabetes and dementia.
Over the last ten years, biomass - based liquid transportation fuels, known collectively as biofuels, have increasingly become part of the world s planned energy mix . In the united states, 36 billion gallons of biofuels are slated to be in use by 2022, which will represent approximately 11% of the country s transportation fuel demand . Energy information administration 2010 annual energy outlook reference case projection, see table 2 (http://www.eia.gov/oiaf/archive/aeo10/aeoref_tab.html). This assumes that 36 billion gallons will consist of 31 and 5 billion gallons of ethanol and biodiesel, respectively, and adjusts energy content of both fuels relative to gasoline .) Ten percent of the fuel consumed for transportation by 2020 must be from renewable sources in the european union, while brazil retains a long - standing 2025% ethanol mandate . Biofuels are commonly touted as a dual solution to the problems of dependence on foreign energy sources and climate change, but their impacts are not confined to these two areas . Energy production and use is one of the most intensive human enterprises, with numerous economic and societal benefits, as well as societal and environmental drawbacks . Any policy that seeks to significantly alter the form and method of energy exploitation raises the specter of unintended or misjudged consequences . The goal of greenhouse gas (ghg) savings was challenged after indirect land use change, resulting from displaced food and feed production, was included in the estimation of emissions . Though estimates of indirect land use change attributed to biofuels policies continue to be debated in the literature, such attention to the unintended consequences of biofuel production and use has stimulated discussion of other potential economic, social, and environmental impacts, including effects on food security, environmental justice, and biodiversity conservation . Many international groups are now proposing to measure, track, and rank forms of renewable energy, including but not limited to biofuels, based on their ability to meet environmental criteria that may not have been previously considered . The capability of decision - makers to evaluate the total impacts of biofuels, including their environmental and economic trade - offs, and the accuracy of those evaluations depend on the availability of robust data and analyses . Here, we ask: does the published, peer - reviewed literature present a full portrait of biofuels and their potential impacts and trade - offs? Confidence in incipient policies governing biofuels that aspire to be environmentally, economically, and socially conscious, would be enhanced by an affirmative finding . To answer the above question, we analyzed 1622 biofuels - related articles published between 2000 and 2009 across a range of social, environmental, and technical topics . We also examined geographic trends . Finally, we examined the frequency of interdisciplinary research as an index of our understanding of the complex interactions and feedbacks possible under global biofuel production scenarios . Such an approach has previously been used to visualize connections between concepts in the scientific literature and to identify logical gaps in study . Rather, our primary goal was to ascertain the structure of biofuels research efforts in the past decade in order to stimulate discussion of its utility to a range of stakeholders . We first defined three major areas of research (termed themes hereafter): environment and human well - being (eh), economics (ec), and production - distribution technology and infrastructure (pti). We also included geography as a fourth theme, to assess the degree to which other topics had been discussed in different regional contexts around the world . Number of articles has been adjusted by a relevancy ratio as described in the text . Percentages add up to more than 100% because some articles address more than one topic . For each of the topics, we generated an initial set of search terms, or keywords, utilizing both our own knowledge of the biofuels research field and the knowledge of a group of elicited experts . Generating search terms a priori rather than deriving them from the literature allowed us to describe patterns in expert - identified, emerging topics in biofuels research in addition to established topics, as well as the relationships between them . We put the keywords through an objective two - step vetting process using isi web of knowledge to ensure their appropriateness / specificity (defined generally as whether the keyword pertained unambiguously to biofuels in the context of liquid transportation fuels), and redundancy (defined as whether the keyword failed to access a unique subset of the literature). Biofuel * and keyword, selected 10 articles at random from the search output, and read the abstracts . We retained the keyword if 2 articles were deemed relevant to the topic with which the keyword was associated . If the combination did not produce more results than either search individually, we only retained the keyword with more results . Keywords for geographic regions consisted of the name of the geographic region itself plus the names of the top 20 countries by population (1 million people) in the year 2009 . One exception was africa, where we used zambia instead of niger, because of ambiguity with the microbe aspergillus niger used for biosynthesis of enzymes for biofuel feedstock catalysis . Our geographic search sought to describe the regions that were the subject or field location of biofuels research, not the nationality of the authors or funding bodies . We used isi web of knowledge (including the science and social science citation indexes) to search peer - reviewed full - length articles and reviews, as well as shorter - form letters, published between 2000 and 2009 . For each topic for example, the search for trade consisted of: biofuel * and (trade or import or export or tariff). This process resulted in 23 individual topic searches . To examine the connectedness of literature between topics, we searched all pairwise combinations, except pairs of regions . For individual topic searches, we randomly selected 20 abstracts (or all abstracts if fewer than 20 articles were retrieved) and read each to evaluate if the article was relevant to the topic . An acceptance rate was determined and multiplied by the raw number of retrieved articles to produce an adjusted acceptance rates ranged from 0.15 to 0.80, with an average of 0.52 . For simplicity, when adjusting paired searches, we multiplied the average acceptance rate for all topics by the raw number of articles retrieved to produce the adjusted number of articles . We checked a random subsample of relevance ratios for topic - pairs and found no systematic trends or bias . Briefly, we arranged all of our topical areas, except for regions, as nodes on the perimeter of a circle . Lines, or edges, connecting nodes were drawn between all topics where we found evidence for literature that addressed both . Line thickness was adjusted to categorically reflect the number of articles that addressed a given pair of topics . We found a wide range of research activity on the themes and topics examined in this analysis (table 1). The number of peer - reviewed articles addressing the economic (ec) aspects of biofuels was approximately half that of either environment and human well - being (eh) or production - distribution technology and infrastructure (pti) articles . The most common topics in the literature were fuel production technologies, ghg emissions, and feedstock production / agronomics, each with over 300 articles . The least studied topics, excluding geographical categories, were human health, trade, and biodiversity, which retrieved 129 articles combined . Human health and trade, in particular, were represented by a very limited number of articles (15 and 34, respectively). Analyses by region revealed substantial heterogeneity in total research effort and in topical emphasis . Overall, asia and north / latin america received the most attention in the literature, oceania and africa the least, and south america and europe received intermediate attention (table 1, figure 1a). We also calculated the relative effort per topic for each geographic area to get a picture of the differing emphases between regions . This was calculated as the ratio of the number of adjusted articles in a particular topic within a region over the average for all topics within that region . Ghg s, land use / land change (lulc), and feedstock production had strong representation in the literature across regions, while other topics, including biodiversity and human health, showed consistent lack of literature across regions (figure 1b). The number of water resources articles was equal to the average for asia and north / latin america, and was comparatively underrepresented for the rest of the world, europe in particular . Articles on food security were above average for africa and oceania, and below average for all other regions . Air quality showed some of the largest differences among regions, overrepresented in asia and africa (though low in total effort in the latter) and underrepresented elsewhere . There were few studies in africa, an already understudied region, on the trade and market potential for biofuels . (b) ratio of the number of articles per topic for a region to the average number of articles per topic for that region . Eh = environment and human well - being, pti = production - distribution technology and infrastructure, ec = economy . The dotted line indicates where topical emphasis for a region is equal to the average for that region . Numbers of articles in both panels have been adjusted by a relevancy ratio as described in the text . (c) raw number of articles retrieved per year from 2000 to 2010, unadjusted by a relevancy ratio . Our network analysis revealed strong asymmetry in the connectedness of different research topics in the biofuels literature . Among the 23 topics we examined, ghg emissions was the most well - connected, sharing at least 50 articles with 11 other topics (figure 2). Land use / land cover, feedstock production / agronomics, fuel production technology, and costs of production were also well - connected to other topics, including topics outside of their respective thematic areas . Not surprisingly, the same topics with the fewest numbers of articles were also the most isolated . Human health, trade, biodiversity, and feedstock logistics tended to be loosely associated or unassociated with articles in other disciplines . Noticeably scarce were studies on how economic policy, market factors, and trade might influence how biodiversity is impacted by biofuels . Although the lack of connections appeared to be a function of the small number of articles in the case of human health and trade, it was not exclusively so for biodiversity . Averaging the proportion of articles connected to each topic, biodiversity articles addressed another topic only 15% of the time versus, for example, 27% of the time for ghg articles . Network diagram showing the number of articles in common between all pairs of topics in the analysis except geographic regions . Eh = environment and human well - being, pti = production - distribution technology and infrastructure, and ec = economy . Numbers of articles have been adjusted by a relevancy ratio as described in the text . Our analysis reveals substantial heterogeneity in the amount of research on the numerous critical topics relevant to an industry with as wide - reaching effects as biofuels . This holds for individual topical areas and geographic regions, as well as for cross - topic linkages . It is debatable whether this asymmetry is appropriate and whether the current body of literature is mature enough to effectively support the informed development of this international industry; or whether the research gaps we have identified indicate substantial risk of unanticipated, unintended consequences . In either case, we argue that there is enough uncertainty to warrant caution, especially in several understudied topics and regions . The paucity of studies addressing human health, trade, and biodiversity has several implications . With the escalation of biofuel production and use locally and globally, a renewed examination of risks and hazards for human populations facing chemical exposures is certainly warranted . The u.s . Environmental protection agency s regulatory impact analysis of the 2007 revised renewable fuel standard program found that increasing biofuel production and use would lead to increases in particulate matter and ozone, leading to net negative impacts on several measures of human health . Exposure of humans to chemicals via other routes, including surface water and groundwater, were not assessed in the aforementioned analysis . Additionally, trade and trade policy will play an increasingly important role in how and where feedstocks and biofuels are produced worldwide . In 2007, approximately 27% of europe s mandated renewable transportation fuel use was being met by imported biodiesel and ethanol . Meanwhile, the u.s . Continues to promote domestic production through the use of import tariffs on ethanol from countries like brazil . The elimination of this tariff could increase ethanol imports to the u.s . In 2015 by as much as 87% over projected volumes under current policies . Of note, such a change in trade policy coupled with the elimination of the ethanol tax credit passed in the u.s . Senate in the summer of 2011 . Finally, large - scale production and use of biofuels is likely to modify several of the stressors that already threaten regional biodiversity, including land use change, climate change, air pollution, and biological invasions, e.g., refs (10a10c). Despite recognition of this in some scientific circles, a lack of research on the effect of biofuels on biodiversity was also identified by a recent report by the national research council . To put this into context, a similar isi search using biodiversity and climate change yielded many more retrieved articles: 2657 published between 2000 and 2009 . Regionally, the same pattern holds; adding south america or asia keywords to the above biodiversity - climate change search yielded 95 and 141 articles, respectively easily surpassing the 5 (south america) and 6 (asia) articles at the nexus of biofuels, biodiversity, and these regions . Though the number of climate change biodiversity articles was not adjusted per our analysis, they nevertheless exceed those of biofuels by over an order of magnitude . Our results strongly imply that empirical data or modeling efforts on the effects of biofuels, explicitly using biodiversity as a dependent variable, are sorely needed . The need may be greatest in countries such as brazil, indonesia, and malaysia, which contain biodiversity hotspots of global importance and are already centers of biofuel production . An under - representation of developing regions in the biofuels literature was found across topic areas . This raises questions about impacts of the industry in places where large - scale development of biofuels could either reap great rewards if done sustainably, or lead to widespread environmental degradation if done irresponsibly . Exploring the data set further, we also found a country bias within these regions . For instance, roughly 95% of the asia articles were from china and india, almost 80% of the south america articles exclusively addressed brazil, and roughly 75% of the north america / latin america articles focused on the u.s . Thus, vast areas of the world remain virtually unstudied, potentially creating lags to implementation of international monitoring and standards for sustainable biofuel development . Furthermore, our analysis of topics according to region revealed some important geographic gaps in research effort . Erosion in asia has long been an environmental problem, in particular from the vast agricultural regions of the loess plateau in china covering over 600000 km, yet little attention has been paid to examining how biofuels production may impact this sensitive area . Surprisingly, market factors and trade were just as underrepresented in asia (mostly china) as they were in north / latin america (mostly u.s . ). For europe, many of the economic topics were well - represented, perhaps at the expense of important environmental topics such as water resources which have recently been of intense interest for biofuel feedstocks such as giant miscanthus . Such trends do not necessarily point to problems in the distribution of literature within regions, but the patterns are worth discussion in the context of the needs of decision - makers and stakeholders in different parts of the world . Increasingly, organizations and governments are relying on systems approaches to understand the consequences of particular policy decisions . These are often interdisciplinary analyses to try and capture the complexities and feedbacks associated with increasing biofuel production, across the stages of the production chain, for multiple environmental and economic impact domains and from local to global scales . Common approaches include life cycle analyses (lcas), and general and partial equilibrium models (e.g., global trade analysis project [gtap] and others). Although promising, these approaches are often hampered by the large amounts of input data required, as well as fundamental uncertainties in model processes such as market elasticities and local land management practices . We found that some topics such as ghg emissions and land use / land cover are commonly discussed in an interdisciplinary fashion . Whether this is in a substantive enough way to inform modeling efforts and/or policy decisions remains unanswered . On the other hand, many topics appeared relatively isolated, clouding the prospects for an integrated analysis on the impacts of biofuel production across multiple nations . First, we describe trends only for recent peer - reviewed literature from journals indexed by isi web of knowledge . Clearly, research published before 2000 or after 2009 and in the gray literature such as in government and industry reports will also be important to understanding the impacts of biofuels . And while use of additional online databases of peer - review research might have augmented the literature in our analysis, over the last five years, thompson reuters has greatly expanded and evened their indexing of high - quality social science and international journals (testa, j. 2011 . Thus, use of other databases could have altered our results, though likely not substantially given the broad journal coverage of the isi web of knowledge . Furthermore, it is unlikely that this literature - based approach captures all the relevant information on research effort; it could be augmented with other approaches such as interviews and tracking grants awarded by governmental and nongovernmental institutions, among others . We also note that biofuels research is a rapidly expanding field that may be only beginning to show signs of slowing (figure 1c). Second, we had no expectation that the categories representing our topics of interest would be equally covered or connected in the literature . This is because some categories may be inherently broader (for example, water resources versus the narrower feedstock logistics), more important, or overlap more than others . However, our approach for a network analysis on a priori selected keywords and the visualization of connections between topics in the literature is a procedure that has been used many times in social, ecological, and computer sciences (6,17) and is rooted in the mathematical and physical domains of network theory . Despite the methodological and epistemological limitations of our approach, we hope this assessment will provide direction to the research community toward understudied topics and regions, and stimulate greater integration of often disparate fields . Agriculture is already the most intensive land use globally, comprising over a third of the global land area (http://faostat.fao.org/site/291/default.aspx) and 70% of freshwater use, while contributing to massive changes in earth s biogeochemical cycles . Biofuels have the capacity to alter global land use patterns, underscoring the importance of augmenting understudied areas and topics in this rapidly developing industry . The optimal mix of scientific effort to support its sustainable development is unknown, and likely depends on several objective and subjective criteria . For instance, industrialized nations have more often emphasized understanding the environmental consequences of biofuel production and use, while several countries in africa and international bodies have prioritized food security or socio - economic impacts . Our intent is, by exposing the structure of recent biofuels research efforts, to raise awareness about scientific and economic areas still relatively unexplored and promote the discussion of their applicability to a range of stakeholders . Such an approach increases the likelihood of accurately anticipating the direct and indirect impacts of biofuels policies, while reducing the impacts of unintended consequences.
Rhabdomyomas (rms) are rare lesions of striated muscle origin that can be found in cardiac and in extracardiac locations . Of these two, in the head and neck, the adult type is more common . Laryngeal rms are extremely rare, with only 40 cases being reported worldwide.1 adult - type rms show an absolutely benign behavior and never metastasize.2 the treatment is excision . Histologically, these tumors are subcategorized into adult and fetal forms according to their degree of cellular differentiation and maturity . Adult - type tumors are confined to the head and neck region and usually originate from musculature of the pharynx, oral cavity, or less commonly the larynx . The reported ages of affected patients have ranged from 16 to 76 years.3 most reported cases of extracardiac rm have involved solitary masses . Approximately 3 to 10% of adult rms may be multiple.4 rm virtually has no malignant potential . They frequently are asymptomatic solitary lesions but progressive hoarseness, a foreign - body sensation, and airway obstruction may occur . The radiologic features are usually those typical of benign neoplasms, with well - circumscribed margins with no invasion of surrounding tissue.1 in a few cases, computed tomography (ct) findings may mimic the appearance of the malignant lesions with indistinct borders and blending with adjacent isodense muscle tissue . The differential diagnosis for laryngeal masses includes cysts, laryngoceles, malignant neoplasms such as squamous cell carcinoma and rhabdomyosarcoma, as well as benign neoplasms such as hemangiomas, lipomas, amyloidomas, neurofibromas, and granular cell tumors.5 histologic analysis is essential for diagnosis . Adult rm have been confused with many other benign tumors as hibernoma, oncocytoma, tumor of salivary glands, paraganglioma, and others,6 but mainly with granular cell tumor.1 microscopically the adult rm is characterized by large, closely packed, elongated to polygonal cells with pink to bright eosinophilic and finely granular cytoplasm . The nuclei are round to oval, vesicular, usually peripherally located, but may be centrally located . Cross - striations are characteristic but are not an obligatory feature in light microscopic evaluation.2 they are more easily seen with phosphotungstic acid hematoxylin staining . The diagnosis of rm is histopathologic and can generally be well defined, but some cases can cause difficulties . The ihc features of rm are identical to those of normal skeletal muscle cells because it shows positivity to msa (muscle - specific actin), desmin, and myoglobin.6 the positivity of these muscular markers is consistent with rm, as well as the positivity for vimentin, a marker of mesenchymal tissues.2 the main lesion to be differentiated from rm is the granular cell tumor that morphologically consists mainly of smaller cells, has no cross - striations, and is consistently positive for s-100 protein but negative for all myogenous markers ihc preparations.2 rm treatment is surgical resection . The 35-year - old white man complained of progressive hoarseness during a 1-year period . On indirect examination of the larynx, a large submucosal mass was noted in the left supra glottic larynx (fig . 1). The contrast - enhanced ct of the neck revealed a well - demarcated diffusely hyperattenuating submucosal mass on the left supraglottic space (fig . 2). The laryngeal bulky lesion . Computed tomography revealed a well - demarcated diffusely hyperattenuating submucosal mass . Markers for epithelium membrane tumors and s-100 protein for neuroectoderm tumors were negative, thus changing the diagnosis to rm adult type . At a careful revision of the slides, the hematoxylin and eosin sections revealed neoplastic closely packed polygonal cells with deeply eosinophilic vacuolated cytoplasm (fig . Cross - striations, not noted before, were present in few cells (fig . 5). (hematoxylin and eosin, 400 .) Scarcely seen cross - striations . Certainly the adult - type rm of the larynx is an extremely rare benign tumor of myoblastic origin . A literature review allows us to say that only 40 well - documented cases have been reported until today worldwide . In the past, this confusion is due to granular eosinophilic cytoplasm that is common to both diagnoses, although they have a completely different histogenesis . Another important observation of the histologic point of view is that the rm should not be confused with rhabdomyosarcoma, which has a completely different prognosis . The histologic diagnosis should be no problem if adequately prepared slides are available, but as these tumors are very rare and many pathologists are not familiar with this type of tumor, there are reports of substantial difficulties to diagnose them on the first try . We present another case of laryngeal rm in a patient whose diagnosis was not initially set . Although the clinical and pathologic findings should be taken into consideration, we emphasize that ihc plays an important role in the differential diagnosis . Symptoms of laryngeal rm do not differ from those caused by other benign tumors of the larynx, but one should keep in mind the possibility of local airway obstruction when the patient complains of breathing difficulties . The tumor is usually described as a submucosal mass with a smooth surface that can resemble the appearance of a cyst . Laryngoscopy and imaging exams help locate and define the limits of the tumor, but the definitive diagnosis will always depend on the histopathologic studies . The clinical outcome of laryngeal rm adult type is benign and no evidence of metastasis was reported in the literature . Treatment should always be surgical removal, via either endoscopic or external approach, but always preserving the adjacent structures such as the vocal folds and the swallowing apparatus . Although muscle tumors of the larynx are very rare, the rm should be considered when there is a submucosal mass in the larynx . Because the establishment of definitive diagnosis can be difficult with routine histopathology, it is important to consider the realization of ihc studies.
Keloid is a cutaneous fibrous scar that represents disequilibrium in the dermal wound healing process . Pressure therapy is used in the management of keloids, generally in combination with other therapies . This clinical report presents use of pressure through customized appliances for therapy and prophylaxis of the ear keloids in a young female patient . A 26-year - old female patient was referred from the department of plastic surgery for the fabrication of ear clip for ear keloid . There was history of first ear piercing of lobe of the ears at the age of 10 years without any swelling following piercing . Additional ear piercing was done at the age of 24 years at the helix of both ears . A small swelling appeared on the superior aspect of helix of ears bilaterally after 3 - 4 months of piercing, which gradually increased in size and continued to grow until it reached the present size on the right ear in 1 year duration . Surgical excision of keloid on the left ear was done 1 week back . On examination, a small, oval, sessile, non - tender, smooth - surfaced swelling was present on the upper part of helix of the right ear, measuring 8 mm superoinferiorly and 6 mm anteroposteriorly . On the left ear, there was a healed scar on the superior aspect of the helix . There was no pain, pruritus, or other adverse accompanying symptoms except that it caused emotional stress due to impaired esthetics . It was planned to use pressure therapy to reduce the size of the growth on right ear and to prevent recurrence on the left ear . Custom - made methyl methacrylate pressure appliances were planned to be used for presurgical compression of the keloid on the right ear and passive methyl methacrylate pressure appliance for preventing recurrence on the left ear . Patient's skin over the right ear and keloid was lubricated with petroleum jelly and external auditory meatus was blocked . Impression compound (dpi pinnacle; dpi, india) was used to make beading around the auricle for the confinement of the impression material [figure 1]. Then thin mix of irreversible hydrocolloid impression material (zelgan 2002; dentsply, india) was poured within the confinement of the beading with patient's head tilted opposite to the side for which impression was being made . Bell pins were placed in the partially set hydrocolloid for the retention of backing material . Thin mix of plaster of paris (kaldent; kalabhai karson pvt ltd, mumbai, india) was poured over the irreversible hydrocolloid as the backing material . The impression was poured in dental stone (kalstone; kalabhai karson pvt ltd) with adequate land area to make the cast [figure 2]. A spring was designed using 21 gauze stainless steel wire that was made as a v - shaped loop with a helix at its apex and adapted over the growth on the cast . A custom - made pressure appliance was fabricated incorporating this loop in clear methyl methacrylate and characterization was done to make the appliance more esthetically acceptable and unnoticeable to others [figure 3]. Care was taken to ensure adequate space for acrylic resin between the wire loop and the skin to avoid direct contact of the stainless steel wire with the skin . The design of the appliance involved covering the whole of the surface of the growth with gap between the two almost equal halves to permit activation in order to ensure sustained pressure, thus allowing adjustments to accommodate the reduced size and negating the need for fabrication of a new appliance . Impression compound beading around the right auricle with blocked meatus master cast of right auricle showing keloid on helix custom - made pressure appliance with spring on the right ear helix the master cast for the left ear was obtained following the same procedure as that for lubrication, blocking, and impression of the right ear [figure 4]. A custom - made passive pressure appliance was planned with incorporation of magnets for retention . It was fabricated by adapting methyl methacrylate without any spacer, around the scar over the helix . Two pairs of 2 2 mm magnets (tt magnets, mumbai, india) were incorporated in the acrylic resin with two similar poles of magnets in each half [figures 5 and 6]. As there was no gap planned between the two halves of the appliance, it did not put any active pressure on the scar that could cause soreness . However, it would prevent any growth above the surface by confinement of the soft tissue to the internal dimensions of the appliance . Post - excisional scar on the left ear helix prophylactic appliance on the scar on the left ear helix two - part prophylactic appliance incorporating magnets the appliances were finished, polished, and adjusted to remove any sore spots . These were delivered and patient was instructed to wear them all the time . She was also instructed about their use, maintenance of hygiene, and regular follow - up . Patient was counseled about any probable post - surgical nodule and close monitoring for recurrence . The periodic activation of the active pressure appliance was done by closing the coil of the spring . Patient was monitored for use of the appliances regularly . During follow - up, a 1 mm reduction in overall size of the right keloid was achieved after 3 months and the growth appeared shrunken in appearance [figure 7]. No other complication was observed during treatment . Reduced and shrunken keloid on the right ear helix healed scar on the left ear helix patient's skin over the right ear and keloid was lubricated with petroleum jelly and external auditory meatus was blocked . Impression compound (dpi pinnacle; dpi, india) was used to make beading around the auricle for the confinement of the impression material [figure 1]. Then thin mix of irreversible hydrocolloid impression material (zelgan 2002; dentsply, india) was poured within the confinement of the beading with patient's head tilted opposite to the side for which impression was being made . Bell pins were placed in the partially set hydrocolloid for the retention of backing material . Thin mix of plaster of paris (kaldent; kalabhai karson pvt ltd, mumbai, india) was poured over the irreversible hydrocolloid as the backing material . The impression was poured in dental stone (kalstone; kalabhai karson pvt ltd) with adequate land area to make the cast [figure 2]. A spring was designed using 21 gauze stainless steel wire that was made as a v - shaped loop with a helix at its apex and adapted over the growth on the cast . A custom - made pressure appliance was fabricated incorporating this loop in clear methyl methacrylate and characterization was done to make the appliance more esthetically acceptable and unnoticeable to others [figure 3]. Care was taken to ensure adequate space for acrylic resin between the wire loop and the skin to avoid direct contact of the stainless steel wire with the skin . The design of the appliance involved covering the whole of the surface of the growth with gap between the two almost equal halves to permit activation in order to ensure sustained pressure, thus allowing adjustments to accommodate the reduced size and negating the need for fabrication of a new appliance . Impression compound beading around the right auricle with blocked meatus master cast of right auricle showing keloid on helix custom - made pressure appliance with spring on the right ear helix the master cast for the left ear was obtained following the same procedure as that for lubrication, blocking, and impression of the right ear [figure 4]. A custom - made passive pressure appliance was planned with incorporation of magnets for retention . It was fabricated by adapting methyl methacrylate without any spacer, around the scar over the helix . Two pairs of 2 2 mm magnets (tt magnets, mumbai, india) were incorporated in the acrylic resin with two similar poles of magnets in each half [figures 5 and 6]. As there was no gap planned between the two halves of the appliance, it did not put any active pressure on the scar that could cause soreness . However, it would prevent any growth above the surface by confinement of the soft tissue to the internal dimensions of the appliance . Post - excisional scar on the left ear helix prophylactic appliance on the scar on the left ear helix two - part prophylactic appliance incorporating magnets the appliances were finished, polished, and adjusted to remove any sore spots . She was also instructed about their use, maintenance of hygiene, and regular follow - up . Patient was counseled about any probable post - surgical nodule and close monitoring for recurrence . The periodic activation of the active pressure appliance was done by closing the coil of the spring . Patient was monitored for use of the appliances regularly . During follow - up, a 1 mm reduction in overall size of the right keloid was achieved after 3 months and the growth appeared shrunken in appearance [figure 7]. No other complication was observed during treatment . Reduced and shrunken keloid on the right ear helix healed scar on the left ear helix keloid represents an exuberant reparative process clinically appearing as elevated nodular growth that generally does not regress spontaneously . Postoperative radiation therapy is a safe and effective therapy in reducing the recurrence of keloids after excision surgery . Better patient compliance has been observed with radiation therapy as compared to postoperative corticosteroid injections . They are effective for prevention and treatment of keloids, especially the newer keloids, but atrophy, telangiectasias, and hypopigmentation have been the common adverse effects . Pressure therapy is used in the management of keloid scars, generally in combination with other forms of therapy . This form of therapy was popularized after the beneficial effects of pressure stockings were observed in healing of burn scars . Pressure appliances such as various springs are used for maintaining pressure after surgical removal and to prevent post - surgical recurrence . Pressure clip is used as in conservative treatment and is an essential adjuvant for early maturation of the scar tissue and prevents the recurrence of keloid . In order to control the pressure and avoid soreness, it is mandatory to fabricate custom - made clip or stent . The appliances described involve simplified design and use of small magnets that makes them highly retentive and stable and do not cause any pressure simultaneously . The materials used for fabrication include acrylic resin, stainless steel wire, and commonly available magnets, making it a low - cost alternative . This article describes a clinical report of a young female patient with ear keloid for which simple and logical therapeutic and prophylactic appliances were fabricated . The described pressure appliance is active for the sustained compression of the keloid and passive for the prophylaxis of recurrence in surgically removed ear keloid.
The diabetic subjects were recruited from type 2 diabetic patients who regularly visited the outpatient clinic of the department of medicine, shiga university of medical science, in 20062007 . Patients were clinically diagnosed with type 2 diabetes in accordance with the criteria of the world health organization . Patients were excluded based on the following criteria: complicating cancer, liver disease, infectious disease, collagen disease, nondiabetic kidney disease confirmed by renal biopsy, intake of nonsteroidal anti - inflammatory drugs within the previous 2 weeks, and intake of antiplatelet drugs with the exception of aspirin . Thirty healthy volunteers were also enrolled as the healthy control group to confirm the results of our previous study (17 male and 13 female, aged 60 7 years [mean sd], bmi 23.1 2.9 kg / m, systolic blood pressure 131 9 mmhg, total cholesterol 199 20 mg / dl, triglycerides 109.8 26.4 mg / dl, and taking no medication). Each individual provided a blood sample for biochemical analysis and detection of platelet microaggregation under fasting conditions and underwent standard physical examinations; brachial - ankle pulse - wave velocity (bapwv) was also measured . Aer was determined by an immunoturbidimetry assay (hitachi 7070e; hitachi high - technologies, tokyo, japan) in a single 24-h urine sample collected on the same day as the blood sample was collected . Aer <20 g / min was considered normoalbuminuria, and aer 20 was classified as albuminuria . The group with albuminuria comprised 120 patients with microalbuminuria (20 g / min aer <200 g / min) and 29 patients with overt proteinuria (200 g / min aer). Apwv was measured by an automatic device (bp-203rpe; colin, komaki, japan). The estimated glomerular filtration rate (egfr) was calculated using the simplified prediction equation proposed by the japanese society of nephrology: egfr (milliliters per minute per 1.73 m) = 194 (age [years]) (serum creatinine [milligrams per deciliter]) 0.739 (if female). The study protocol and informed consent procedure were approved by the ethics committee of shiga university of medical science . Platelet - rich plasma was obtained from blood collected into sodium citrate (14 mol / l) by immediate centrifugation at 155 g for 12 min at room temperature . The platelet - rich plasma was removed and centrifuged at 1,750 g for 10 min at room temperature in the presence of prostaglandin i2 (20 mol / l). The resultant platelets were washed with hepes - tyrode buffer and resuspended to 4 10 cells / ml . In this platelet suspension, platelets did not form the microaggregates without stirring force or any exogenous agonists . Platelet microaggregation was determined by measuring the light - scattering intensity (13) on a pa-200 aggregometer (kowa, tokyo, japan). Smap was observed under low shear stress conditions at a stirring speed of 1,000 rpm (26 dyn / cm) without stimulation with an exogenous agonist . This degree of low shear stress is considered to be the same degree of shear stress occurring in the arterial stream, suggesting that this system provides a condition that mimicked the state of platelets in the artery . The data were recorded as a two - dimensional graph showing the change in total light intensity over time, expressed as a cumulative summation at 10-s intervals of scattered light intensity (ii) and the number of particles corresponding to that intensity (ni) in terms of particle size (intensity) (iini) (volts counts per second). The degree of smap was described by measurement of the area under the curve (auc) of each detection line for 5 min . The mean values of two auc measurements as the degree of smap in each individual were used for the analysis to minimize the variability . The platelet surface expression levels of gpiib / iiia and p - selectin were assessed by whole - blood flow cytometry using a fluorescein isothiocyanate - conjugated pac-1 antibody and a phycoerythrin - conjugated cd62p antibody, as described previously (14,15). In brief, a saturating antibody concentration in 50 l was added to 50 l of whole blood . The samples were incubated for 15 min at room temperature and then were analyzed within 2 h by flow cytometry . The platelets were identified based on particle size and complexity using a peridimin - chlorophyll - conjugated cd61 antibody . Categorical variables were compared between the two groups using tests, an unpaired student t test was used for normally distributed variables, and the mann - whitney u test was used for nonnormally distributed variables . For the nonparametric comparison among four groups, a kruskal - wallis test was first performed to find a measure of the aggregate degree to which the group means differed and then the mann - whitney u test with bonferroni correction was used to compare the differences between groups . A spearman correlation coefficient was used to analyze the association between two variables . A multivariate logistic regression model was applied to evaluate the independence of factors that were significantly different between the groups, using logarithmic transformed values of nonnormally distributed variables . All data were analyzed using the spss software package (version 11; spss, chicago, il). Platelet - rich plasma was obtained from blood collected into sodium citrate (14 mol / l) by immediate centrifugation at 155 g for 12 min at room temperature . The platelet - rich plasma was removed and centrifuged at 1,750 g for 10 min at room temperature in the presence of prostaglandin i2 (20 mol / l). The resultant platelets were washed with hepes - tyrode buffer and resuspended to 4 10 cells / ml . In this platelet suspension, platelets did not form the microaggregates without stirring force or any exogenous agonists . Platelet microaggregation was determined by measuring the light - scattering intensity (13) on a pa-200 aggregometer (kowa, tokyo, japan). Smap was observed under low shear stress conditions at a stirring speed of 1,000 rpm (26 dyn / cm) without stimulation with an exogenous agonist . This degree of low shear stress is considered to be the same degree of shear stress occurring in the arterial stream, suggesting that this system provides a condition that mimicked the state of platelets in the artery . The data were recorded as a two - dimensional graph showing the change in total light intensity over time, expressed as a cumulative summation at 10-s intervals of scattered light intensity (ii) and the number of particles corresponding to that intensity (ni) in terms of particle size (intensity) (iini) (volts counts per second). The degree of smap was described by measurement of the area under the curve (auc) of each detection line for 5 min . The mean values of two auc measurements as the degree of smap in each individual were used for the analysis to minimize the variability . The platelet surface expression levels of gpiib / iiia and p - selectin were assessed by whole - blood flow cytometry using a fluorescein isothiocyanate - conjugated pac-1 antibody and a phycoerythrin - conjugated cd62p antibody, as described previously (14,15). In brief, a saturating antibody concentration in 50 l was added to 50 l of whole blood . The samples were incubated for 15 min at room temperature and then were analyzed within 2 h by flow cytometry . The platelets were identified based on particle size and complexity using a peridimin - chlorophyll - conjugated cd61 antibody . Categorical variables were compared between the two groups using tests, an unpaired student t test was used for normally distributed variables, and the mann - whitney u test was used for nonnormally distributed variables . For the nonparametric comparison among four groups, a kruskal - wallis test was first performed to find a measure of the aggregate degree to which the group means differed and then the mann - whitney u test with bonferroni correction was used to compare the differences between groups . A multivariate logistic regression model was applied to evaluate the independence of factors that were significantly different between the groups, using logarithmic transformed values of nonnormally distributed variables . All data were analyzed using the spss software package (version 11; spss, chicago, il). Smap was detected in 211 (52.6%) of 401 patients with type 2 diabetes (fig . 1a) but not in any of the 30 healthy volunteers tested here (fig . The diabetic patients with smap showed an abnormal and irreversible pattern of platelet microaggregation, even after stimulation by a low dose of adp (fig . 1c), whereas a normal reversible pattern was observed in patients without smap and in all healthy volunteers (fig . Table 1 provides details of the clinical characteristics of the diabetic subgroups according to the formation of smap . Waist - to - hip ratios, the frequency of taking renin - angiotensin system inhibitors, urinary aer, egfr, and bapwv were significantly different between diabetic patients with smap and those without such events . Multiple logistic regression analysis including these factors identified the levels of aer (odds ratio 3.4 [95% ci 2.25.3], p <0.001) and bapwv (15.3 [1.1227.5], p <0.05) as independent factors associated with smap detection . Typical patterns of smap and reversibility of platelet microaggregation by low - dose adp, measured by a laser light - scattering system . The spontaneous formation of microaggregated platelets under low shear stress alone without any exogenous agonists was observed in 52.6% of diabetic patients (a), whereas it was not observed in 47.4% of diabetic patients and in any healthy volunteers (b). Mol / l) (c), whereas the others showed the typical reversible pattern of platelet microaggregation within 5 min (d). Clinical characteristics of the study subjects according to the formation of smap data are means sd for normally distributed continuous variables or medians (25th75th interquartiles) for skewed continuous variables next, the frequency and degree of smap were analyzed according to albuminuria status (> 20 g / min). The frequency of the formation of smap in diabetic patients with albuminuria was significantly higher than in those with normoalbuminuria (75% of 149 patients with albuminuria vs. 39% of 252 patients with normoalbuminuria, p <0.001). Similarly, the degree of smap evaluated by auc was significantly higher in those with albuminuria than in those with normoalbuminuria (0.52 [interquartile range 0.011.46] vs. 0.00 [0.000.16], p <0.001). In addition, the degree of smap was significantly correlated with the levels of urinary aer as continuous variables (spearman = 0.43, p <0.001). Regardless of the status of albuminuria, the platelet microaggregates in all patients with smap showed the irreversible pattern after stimulation by a low dose of adp, and those in the patients without smap were reversible . Of the diabetic patients, 163 (41%) were prescribed 100 mg / day aspirin . Patients with albuminuria and aspirin intake had a significantly lower frequency of smap than those without it (50 of 76 patients taking aspirin vs. 62 of 73 patients not given aspirin), whereas the smap rates were similar in the two subgroups in patients with normoalbuminuria (37 of 87 patients taking aspirin vs. 62 of 165 patients without aspirin intake). The degree of smap among the patients with albuminuria was similarly significantly lower with than without aspirin (0.33 [0.001.27] vs. 0.88 [0.171.76]), whereas patients with normoalbuminuria showed no such difference according to aspirin intake (0.00 [0.000.14] vs. 0.00 [0.000.21]) (fig . The strong correlation between the degree of smap and the levels of urinary aer as continuous variables was investigated in the patients without aspirin intake (= 0.53, p <0.001), whereas the weak association between them was found in those with aspirin intake (= 0.27, p <0.001). Box - and - whisker plots of smap assessed by auc in diabetic patients with normoalbuminuria and albuminuria, treated with or without aspirin . In these plots, lines within the boxes represent median values; the upper and lower lines of the boxes represent the 25th and 75th percentiles, respectively; and the upper and lower bars outside the boxes represent the 90th and 10th percentiles, respectively . Kruskal - wallis test: p <0.001, * p <0.001 vs. normoalbuminuric patients treated with and without aspirin, p = 0.01 vs. albuminuric patients without aspirin (mann - whitney u test). To further evaluate the active state of smap, we quantitated the expression levels of active gpiib / iiia and p - selectin on the platelets . The expression levels of active gpiib / iiia were higher in diabetic patients with smap than in those without smap (29.9% [interquartile range 19.342.2] vs. 15.5% [11.721.9]). Similarly, the expression levels of p - selectin were higher in diabetic patients with detectable smap than those without it (8.1% [5.116.0] vs. 4.4% [3.25.6]). The expression levels of both markers correlated significantly with the degree of smap (spearman = 0.59 for active gpiib / iiia and = 0.55 for p - selectin). Finally, we investigated the relationship between the expression levels of these surface markers and urinary aer in the subgroups based on aspirin intake . In patients not taking aspirin, the expression level of each surface marker correlated significantly with urinary aer (spearman = 0.60 for active gpiib / iiia and = 0.57 for p - selectin) (fig . Similar correlations were also observed in patients taking aspirin, albeit with a slightly weaker coefficient of correlation (spearman = 0.51 for active gpiib / iiia and = 0.34 for p - selectin, fig . Correlation between urinary albumin excretion rate and expression of platelet surface markers, active gpiib / iiia, and p - selectin . The patients were divided into two subgroups based on aspirin intake: for active gpiib / iiia, those not taking aspirin (a) (= 0.60; p <0.001) and those taking aspirin (b) (= 0.51; p <0.001), and for p - selectin, those not taking aspirin (c) (= 0.57; p <0.001) and those taking aspirin (d) (= 0.34; p <0.001). Smap was detected in 211 (52.6%) of 401 patients with type 2 diabetes (fig . 1a) but not in any of the 30 healthy volunteers tested here (fig . The diabetic patients with smap showed an abnormal and irreversible pattern of platelet microaggregation, even after stimulation by a low dose of adp (fig . 1c), whereas a normal reversible pattern was observed in patients without smap and in all healthy volunteers (fig . Table 1 provides details of the clinical characteristics of the diabetic subgroups according to the formation of smap . Waist - to - hip ratios, the frequency of taking renin - angiotensin system inhibitors, urinary aer, egfr, and bapwv were significantly different between diabetic patients with smap and those without such events . Multiple logistic regression analysis including these factors identified the levels of aer (odds ratio 3.4 [95% ci 2.25.3], p <0.001) and bapwv (15.3 [1.1227.5], p <0.05) as independent factors associated with smap detection . Typical patterns of smap and reversibility of platelet microaggregation by low - dose adp, measured by a laser light - scattering system . The spontaneous formation of microaggregated platelets under low shear stress alone without any exogenous agonists was observed in 52.6% of diabetic patients (a), whereas it was not observed in 47.4% of diabetic patients and in any healthy volunteers (b). Mol / l) (c), whereas the others showed the typical reversible pattern of platelet microaggregation within 5 min (d). Clinical characteristics of the study subjects according to the formation of smap data are means sd for normally distributed continuous variables or medians (25th75th interquartiles) for skewed continuous variables next, the frequency and degree of smap were analyzed according to albuminuria status (> 20 g / min). The frequency of the formation of smap in diabetic patients with albuminuria was significantly higher than in those with normoalbuminuria (75% of 149 patients with albuminuria vs. 39% of 252 patients with normoalbuminuria, p <0.001). Similarly, the degree of smap evaluated by auc was significantly higher in those with albuminuria than in those with normoalbuminuria (0.52 [interquartile range 0.011.46] vs. 0.00 [0.000.16], p <0.001). In addition, the degree of smap was significantly correlated with the levels of urinary aer as continuous variables (spearman = 0.43, p <0.001). Regardless of the status of albuminuria, the platelet microaggregates in all patients with smap showed the irreversible pattern after stimulation by a low dose of adp, and those in the patients without smap were reversible . Of the diabetic patients, 163 (41%) were prescribed 100 mg / day aspirin . Patients with albuminuria and aspirin intake had a significantly lower frequency of smap than those without it (50 of 76 patients taking aspirin vs. 62 of 73 patients not given aspirin), whereas the smap rates were similar in the two subgroups in patients with normoalbuminuria (37 of 87 patients taking aspirin vs. 62 of 165 patients without aspirin intake). The degree of smap among the patients with albuminuria was similarly significantly lower with than without aspirin (0.33 [0.001.27] vs. 0.88 [0.171.76]), whereas patients with normoalbuminuria showed no such difference according to aspirin intake (0.00 [0.000.14] vs. 0.00 [0.000.21]) (fig . 2). In addition, the strong correlation between the degree of smap and the levels of urinary aer as continuous variables was investigated in the patients without aspirin intake (= 0.53, p <0.001), whereas the weak association between them was found in those with aspirin intake (= 0.27, p <0.001). Box - and - whisker plots of smap assessed by auc in diabetic patients with normoalbuminuria and albuminuria, treated with or without aspirin . In these plots, lines within the boxes represent median values; the upper and lower lines of the boxes represent the 25th and 75th percentiles, respectively; and the upper and lower bars outside the boxes represent the 90th and 10th percentiles, respectively . Kruskal - wallis test: p <0.001, * p <0.001 vs. normoalbuminuric patients treated with and without aspirin, p = 0.01 vs. albuminuric patients without aspirin (mann - whitney u test). To further evaluate the active state of smap, we quantitated the expression levels of active gpiib / iiia and p - selectin on the platelets . The expression levels of active gpiib / iiia were higher in diabetic patients with smap than in those without smap (29.9% [interquartile range 19.342.2] vs. 15.5% [11.721.9]). Similarly, the expression levels of p - selectin were higher in diabetic patients with detectable smap than those without it (8.1% [5.116.0] vs. 4.4% [3.25.6]). The expression levels of both markers correlated significantly with the degree of smap (spearman = 0.59 for active gpiib / iiia and = 0.55 for p - selectin). Finally, we investigated the relationship between the expression levels of these surface markers and urinary aer in the subgroups based on aspirin intake . In patients not taking aspirin, the expression level of each surface marker correlated significantly with urinary aer (spearman = 0.60 for active gpiib / iiia and = 0.57 for p - selectin) (fig . Similar correlations were also observed in patients taking aspirin, albeit with a slightly weaker coefficient of correlation (spearman = 0.51 for active gpiib / iiia and = 0.34 for p - selectin, fig . Correlation between urinary albumin excretion rate and expression of platelet surface markers, active gpiib / iiia, and p - selectin . The patients were divided into two subgroups based on aspirin intake: for active gpiib / iiia, those not taking aspirin (a) (= 0.60; p <0.001) and those taking aspirin (b) (= 0.51; p <0.001), and for p - selectin, those not taking aspirin (c) (= 0.57; p <0.001) and those taking aspirin (d) (= 0.34; p <0.001). The present study provided new evidence that both increased aer and bapwv are independent factors associated with the abnormal formation of smap in type 2 diabetic patients . Furthermore, the patients with smap showed an irreversible pattern of platelet microaggregation by adp, and the degree of smap correlated with the enhanced expression of active gp iib / iiia and p - selectin, indicating that smap is pathophysiologically active . These early - activated platelet profiles were significantly inhibited in albuminuric patients with aspirin intake, although the effect was incomplete . Assessment of inappropriate platelet activation is one way to risk - stratify patients who are at high risk of atherosclerosis and atherothrombosis . The microaggregates produced in the early phase of platelet activation are now considered to potentially aggravate thrombus formation (7). Under normal conditions, these platelet microaggregates dissolve within a few minutes, as shown in this study (fig . In the present study, 53% of type 2 diabetic patients showed smap and abnormal irreversibility of the microaggregation after low - dose adp . This high proportion of diabetic patients with abnormal platelet hyperaggregability is in agreement with the result from a cohort studied previously (12). The smap formation was observed under a low - shear stress that mimicked the state of the arterial bloodstream without the stimulation of exogenous agonists . In addition, the degree of smap was associated with enhanced expression of active gpiib / iiia and p - selectin . Thus, the formation of smap is considered to show the abnormal activated state of platelets in diabetic patients, which is enhanced according to the increase of albuminuria . In the present study,, other investigators reported that high levels of platelet microaggregation were associated with adverse outcomes in patients with cardiovascular disease (16) and the ankle - brachial index in patients with peripheral arterial disease (17). In addition, diabetic patients with smap showed overexpression of platelet surface markers, active gpiib / iiia, and p - selectin . Such upregulation of these molecules has also been associated with the development of atherogenesis (18). Taken together, the early platelet activation in type 2 diabetic patients may be a risk factor for cardiovascular disease . A recent guideline of the american diabetes association recommended prophylactic use of antithrombotic agents, with low - dose aspirin, for diabetic subjects, especially those with albuminuria (19). However, di minno and violi (20) indicated that aspirin alone is insufficient to prevent thrombosis in diabetic patients with angiopathy . In the present study, smap formation was inhibited in albuminuric patients taking aspirin compared with those not taking it . However, smap formation was still associated with albuminuria, even in patients taking aspirin, suggesting that the inhibitory effect of aspirin may be insufficient in diabetic patients with albuminuria . Further follow - up and intervention studies are required to investigate whether the incomplete inhibition of early - activated platelet profiles is a cardiovascular risk . (21) proposed in the steno hypothesis that excess leakage of albumin into urine reflects widespread vascular (endothelial) damage . This endothelial dysfunction is considered a common feature of cardiorenal interactions (22); it leads to platelet activation, adhesion, and subsequent platelet aggregate formation . Platelets are also a rich source of chemokines and cytokines, released within seconds of platelet activation (23). Thus, the formation of smap in diabetic patients with albuminuria might either cause or reflect systemic vascular endothelial dysfunction . An alternative explanation is that any pathophysiological alteration in a diabetic kidney could directly affect platelet activation . Glomerular hypertension, which induces mechanical shear stress (24), and excess renal production of type iv collagen in the kidney (25), a powerful activator of platelets, might induce activation of platelets that circulate into the kidney . It was not possible to ascertain whether the early - activated platelet profile was a cause or consequence of the increased urinary albumin excretion because of the nature of the cross - sectional study . The present study also could not address whether the incidence of future cardiovascular disease is higher in patients with smap and whether the inhibitory effect of aspirin on the degree of smap would be sufficient to prevent the development of cardiovascular disease . In summary, the majority of type 2 diabetic patients with albuminuria showed an altered profile of early platelet activation including smap events . Given the growing concern over cardiovascular consequences in type 2 diabetic patients, further follow - up and intervention studies are needed to establish whether the inhibition of smap is a therapeutic target to prevent cardiovascular complications in type 2 diabetic patients.
Gastric volvulus is characterized by a rotation of the stomach along its axis in variable degrees and may present either acutely or chronically . It may cause a complete gastric outlet obstruction and strangulation, leading to ischemic necrosis and perforation with a mortality rate of 3050% . Primary gastric volvulus results from abnormalities of the four gastric ligaments that restrict rotation: gastrocolic, gastrophrenic, gastrosplenic and hepatogastric . We report a case of a gastric volvulus in a patient with a history of a diaphragmatic hernia . An emergent laparoscopic diaphragmatic hernia mesh repair and gastropexy was performed, resulting in a complete recovery . A 49-year - old woman presented to our emergency department with a 2-week history of epigastric pain and vomiting with no prior trauma . Her past medical history included hypertension, iron deficiency anemia, laparoscopic cholecystectomy and an open uterine myomectomy . Upon arrival to the emergency department, she had a pulse of 135 beats per minute, a blood pressure of 110/90 mmhg, a respiratory rate of 20/min, a body temperature of 37.6c and an oxygen saturation of 98% on room air . Her clinical examination revealed tenderness over the epigastric region, and her bowel sounds were hyperactive . She had decreased air entry at the left basal region of the chest . The initial laboratory results were white blood cell count 22.1 10/l (neutrophilic), blood urea nitrogen 7.8 mmol / l, creatinine 121 umol / l and normal liver function tests, amylase and lipase . A chest radiograph demonstrated a significant air - fluid level near the left lung base (fig . 1). Figure 1:chest x - ray showing an elevated air - fluid left in the left basal lung region . Chest x - ray showing an elevated air - fluid left in the left basal lung region . Two days prior to her admission, she had undergone upper gastrointestinal endoscopy for the same complaint in another center that revealed a dilated gastric lumen with herniation of the distal stomach, pylorus and first part of the duodenum into the left hemi - thorax (fig . 2). Resuscitation was commenced with immediate nasogastric decompression, intravenous hydration and analgesia, proton - pump inhibitors and electrolyte replacement . A double contrast - enhanced computed tomography (ct) scan of the chest and the abdomen demonstrated a large diaphragmatic defect (7 7 cm) and a left diaphragmatic hernia containing a dilated stomach, suggestive of a gastric outlet obstruction (fig . 3). A water - soluble gastrografin meal was performed, showing an intra - thoracic, mesentero - axial gastric volvulus (fig . Figure 2:flexible upper endoscopy showing herniation of the distal stomach, the pylorus and the first part of the duodenum into the left hemi - thorax . Figure 3:different views of a double contrast - enhanced ct scan showing a left diaphragmatic hernia with an acute dilated stomach . Figure 4:water - soluble gastrografin meal showing an intra - thoracic mesentero - axial volvulus . Flexible upper endoscopy showing herniation of the distal stomach, the pylorus and the first part of the duodenum into the left hemi - thorax . Different views of a double contrast - enhanced ct scan showing a left diaphragmatic hernia with an acute dilated stomach . Water - soluble gastrografin meal showing an intra - thoracic mesentero - axial volvulus . The patient was listed emergently, underwent general anesthesia and was placed in a 30-degree split - leg reverse trendelenburg position . A four - port approach was used after verres pneumoperitoneum was achieved . On inspection of the peritoneal cavity, the stomach and the first part of the duodenum were incarcerated in the peritoneal sac in the left hemi - diaphragm (fig . The rotated stomach and the first part of the duodenum were completely reduced from the thoracic cavity into the abdomen . Once the dissection of the sac was complete, we confirmed that there was no visceral injury and proceeded to repair of the 7 7 cm diaphragmatic hernia (fig . A gore bio - a tissue reinforcement absorbable mesh (15 12 cm) was selected to encourage the formation of vascularized neotissue . It was fixed in place using ethicon securestrap absorbable strap fixation device (fig . A gastropexy was then performed to the anterior abdominal wall using a 2 - 0 polypropylene suture . Figure 5:laparoscopic view showing the incarcerated content in the peritoneal sac with a twisted stomach . Figure 6:laparoscopic view showing a large (size 7 7 cm) diaphragmatic defect . Figure 7:laparoscopic view showing the primary closure of the diaphragmatic defect using an interrupted pds ii suture . Figure 8:laparoscopic view showing bio - a tissue reinforcement absorbable mesh (size 15 12 cm) fixed intraperitoneally below the defect . Laparoscopic view showing the primary closure of the diaphragmatic defect using an interrupted pds ii suture . Laparoscopic view showing bio - a tissue reinforcement absorbable mesh (size 15 12 cm) fixed intraperitoneally below the defect . On the first post - operative day, a water - soluble meal study was repeated and revealed a marked regression of the stomach size and a normal intra - abdominal position of the stomach and the first part of the duodenum with no evidence of obstruction (fig . The patient had an unremarkable recovery and was discharged on post - operative day 3 . She was followed up in clinic 2 weeks post - operatively, and a follow - up upper gastrointestinal endoscopy was performed, which showed normal anatomy to the second part of the duodenum (fig . Figure 9:water - soluble gastrografin meal showing normal intra - abdominal position of the stomach . A detailed history of the risk factors associated with gastric volvulus including previous surgical procedures, gastro - oesophageal reflux disease or history of trauma should be obtained . The initial management includes nasogastric decompression (endoscopically if necessary), fluid resuscitation and correction of electrolyte imbalances [1, 6]. Endoscopic decompression, de - rotation and percutaneous endoscopic gastrostomy (peg) fixation of the stomach to the posterior abdominal wall are the first - line management for cases of primary gastric volvulus . It is also employed in cases of secondary gastric volvulus who are unfit for surgical repair under anesthesia . The use of two peg tubes is optimal as the stomach may still rotate over a single peg . Surgical intervention is the treatment of secondary gastric volvulus and cases of volvulus in which an endoscopic or nasogastric decompression and de - rotation have failed . There are no randomized control trials available; however, observational studies support laparoscopy for its benefits of reduced inpatient stays and improved post - operative morbidity . A recurrence rate of 42 vs. 15% post laparoscopic and open gastropexy, respectively, has been described in one study . However, it is important to stress that this is for gastric fixation alone and does not compare recurrence rates after hernia repair . The laparoscopic approach is defined by the need to de - rotate and reduce the gastric contents into the abdominal cavity.
Microsatellites are simple sequence repeats (ssrs) that exhibit complex patterns in their frequency of occurrence, genomic distribution, mutability, function and evolution . Apart from being the source of informative genetic markers, microsatellites per se have attracted a lot of attention with respect to their origin, distribution, expansion, mutation and disintegration (17). Questions are also asked about the functional role of microsatellites in particular and biological significance of the microsatellites in general (4,812). Genetic studies and whole genome sequence analysis have established non - random distribution, variability and high mutability as characteristics of microsatellites . Evidences are accruing, which support the role of microsatellites in gene regulation, transcription and protein function (13). Existence of qualitative and quantitative differences between microsatellites of different genomes and their role in adaptive evolution have also been theorized (2,8). However, such studies require information on type (mono to hexa), motif (gc%), abundance (motif preferences), frequency, distribution (linkage group - wise and chromosomal position), location (exon, intron, regulatory element and transposon), nature (perfect, imperfect and compound) and copy number (existence of paralogs) of microsatellites not only on a whole genome basis but also as a comparative analysis of multiple genomes that are related by phylogeny (for instance, fully sequenced primate genomes or fungal genomes or insect genomes) to draw functional conclusions . Whole genome sequences of insects have lived up to the reputation of diversity and have thrown immense variability in size and organization of their genomes . Among others, there are five fully sequenced insect genomes: drosophila melanogaster (as a model organism it provides maximum annotated data), anopheles gambiae (another dipteran but economically highly important as malarial vector), tribolium castaneum (relatively early insect order of coleoptera), apis mellifera (hymenoptera, relatively a recent insect order) and bombyx mori (economically important as silk - producing member of lepidoptera, members of which are crop pests; also significant as a model for insect development). Researchers attempting to understand the biology and evolution of microsatellites are often faced with the following questions: (i) do microsatellites occur everywhere in the genome? (ii) (v) does the gc content of the motif affect the length, repeat units or mutation rate of microsatellites? (viii) do microsatellites occur as families of common flanking sequences in the genomes (paralogs)? Insatdb, unlike many other microsatellite databases that cater to only the needs of microsatellites as markers, allows users to address the above - mentioned questions by accessing qualitative and quantitative genome level microsatellites profile of a single insect or to carry out comparative genomic analysis using all the five genomes . T.castaneum sequences were downloaded from genbank () and bombyx mori sequences were downloaded from . Repeats were extracted employing tandem repeat finder version 4 (14). To ensure that the extracted repeat sequences were real microsatellites, those with less than five repeat units and shorter than 15 bp in length were excluded . Tandem repeat finder does not employ minimal alignment score for detecting microsatellites; rather a probabilistic model of random repeat sequences specified by per cent identity and frequency of insertions and deletions . This includes calculation of average per cent identity between the copies (pm) and average percentage of insertions and deletions (pi). The algorithm has a pair of matching probability and indel probability values (pm = 0.80, pi = 0.10) as default to cover most divergent copies at every locus . We used two sets of alignment parameters (match, mismatch, gap), (+ 2, 3, 5) and (+ 2, 5, 7) to score the matches . All the microsatellites with a minimum alignment score of 30 are reported in the database, which means that both perfect and imperfect microsatellites are listed . Smit, r. hubley and p. green, unpublished data;) to obtain indices marking the occurrence of simple repeats, tandem repeats, segmental duplications, interspersed repeats including sines, dna transposons, retrotransposons, lines, etc . Further, sequences were analysed for the delineation of exons and introns using genscan (15). Flanking sequences of microsatellites were aligned to catalogue paralogous microsatellites that exhibit identical origin and hence considered belonging to the same microsatellite family . Occurrence of two or more microsatellites contiguously with intervening non - repeat sequence of 70 bp were separately categorized as compound repeats . It stores microsatellites from all the five insect genomes separately as well as carries complete annotations of these microsatellites . The database also provides basic information on each of the five insects and important links to obtain further knowledge, and contains a tutorial page and a glossary page . End users with adequate computational capabilities can batch download full complement of microsatellites (insect - wise), microsatellite sequences, compound microsatellites and full list of microsatellite loci existing as families . These data are made available as csv files, which are compatible with spreadsheet programmes such as ms excel . Alternatively, details of the microsatellites with highly specific characteristics may be queried using a multi - option query sheet (figure 2). The options include insect (one at a time); location (intron, exon, i.e. Boundary, upstream, intergenic, repeat elements single or in combination); repeat type (motif size, mono- to hexa - nucleotide) or actual repeat motif (by essentially entering up to five repeat motifs); gc% (fixed value or range); repeat size in either base pairs or number of units (fixed value or range); repeat kind (perfect or imperfect). Once insect and location options the output is primarily a list of microsatellites annotated for all options of the query sheet and the output table is generated as a hierarchical pre - sorted list . Each microsatellite is given a unique i d that also carries genomic sequence i d and corresponding indices . If the number of microsatellites selected based on the options of the query sheet exceeds 500, the output is split into sets of 500 microsatellites . In addition, a csv file containing total output is also made available for downloading . If the query options do not select any microsatellite, a message indicating zero output is displayed and a back button is provided to refine the options . Ssr motif and 100 bp each of the left and right flanking sequences are given for each microsatellite entry, which allows users to carry out sequence analysis of microsatellite vis - - vis locus . In addition, users can select individual microsatellites to convert them into locus - specific markers . This is facilitated by automatic uploading of repeat and flanking sequences of the selected microsatellite into primer3 query form (16). Screen shots of (a) insatdb homepage, (b) multi - option query sheet, (c) output table and (d) analysis page . Our analysis showed that microsatellite content of five fully sequenced insect genomes is independent of both genome size and gc content (table 1). The database consists of a dedicated section (analysis) that describes the types of analysis that can be carried out using the data obtained from insatdb . Some of the quick observations and inferences from a comparative genomic analysis are given in this section . Microsatellite content of insect genomes preponderance of di- and tri - nucleotide repeats is observed in drosophila and anopheles, whereas tri- and tetra - nucleotide repeats are abundant in bombyx and tribolium . On the whole, shorter microsatellites are abundant in the five insect genomes; as the length of the microsatellite increases their number decreases logarithmically typified by bombyx and drosophila microsatellites (> 90% of the microsatellites <50 bp); on the other hand, anopheles and tribolium have longer microsatellites in a relatively high frequency . Shorter microsatellites not only predominate microsatellite population in the five insect genomes, but also seem to possess higher number of imperfect repeat units . On the other hand, microsatellites spanning> 100 bp consisted of perfect, rather than imperfect repeats . Interruptions, if at all, occur mainly in the middle region of the repeat sequence and the ends seem to be selected against decomposition . On the whole, there is no linear correlation between gc content and the average number of repeat units . Average length of the microsatellite across gc range is 37 9 bp and between 0 and 5% gc content, microsatellites tend to be longer than 60 bp . Compound microsatellites account for nearly 3.2% in the insect genomes analysed; owing to high density of microsatellites, apis has higher number of compound loci (6.12%). Anopheles and apis genomes have as many as 50 and 60% of the total microsatellites in coding region, respectively . Bombyx genome has only 10% of the microsatellites in regions spanning exons, introns and their boundary . More than 70% of the microsatellites present in exons are trinucleotide repeats except in apis, where 50% tri- and 25% dinucleotide repeats are present in exonic regions . Microsatellites in insects are at rich (on an average 23.4% gc); however, they exist within regions that are not always at rich . Incorporation of microsatellite data from additional insects, query facility for better comparative genomic analysis such as gene - based microsatellite extraction and conservation analysis are planned . Additionally, based on users' feedback, supplementary features will be added to make insatdb a single window system for insect genome analyses using microsatellite tools.
Sertoliform endometrioid carcinoma of the ovary (sec) is an uncommon variant that bears histologic similarity to sertoli and sertoli - leydig cell tumors (slts). Recognition of this tumor is important as it is a well - differentiated, low - grade malignancy that displays a good prognosis when confined to the ovary . A 55-year - old postmenopausal female patient presented with mass per abdomen since 2 years and pain for 2 days . Ultrasonography showed multicystic lesion measuring 12 cm 11 cm in the left ovary [figure 1]. Ultrasonography showing multicystic lesion measuring 12 cm 11 cm in the left ovary on gross examination, ovary weighed 550 g, measured 13 cm 11 cm 7 cm, showed solid and cystic areas on cut section [figure 2]. Microscopy showed round to solid tubules lined by pseudostratified columnar epithelium with elongated nuclei resembling sertoli tumor - like pattern along with conventional endometrioid tumor [figures 35]. Inset: outer surface showing blackish areas due to torsion microphotograph showing sertoliform endometrioid carcinoma showing tubules and tightly packed nests of tumor cells separated by fibrous stroma . Individual tumor cells having vesicular nuclei, prominent nucleoli, and moderate cytoplasm (h and e, 400) microphotograph showing foci of conventional endometrioid carcinoma (h and e, 400) microphotograph showing foci of conventional endometrioid carcinoma and sertoli cell tumor - like pattern (h and e, 200) immunohistochemistry (ihc) showed tumor cells strongly immunoreactive for epithelial membrane antigen (ema), cytokeratin (ck) but negative for inhibin [figures 68], thus confirming the diagnosis of sec of left ovary . Sertoliform endometrioid carcinoma showing cytokeratin positivity (immunohistochemistry, 200) sertoliform endometrioid carcinoma showing epithelial membrane antigen positivity (immunohistochemistry, 400) sertoliform endometrioid carcinoma showing inhibin negativity (immunohistochemistry, 400) endometrioid carcinoma of ovary resembling sex cord - stromal tumor is a rare variant of endometrioid adenocarcinoma that focally looks like a sex cord - stromal tumor with sertoli, leydig, or granulosa cells . Ordi et al ., in their study, reported that sec typically demonstrates the following characteristics, while slts do not: (1) presence of areas with usual pattern of endometrioid carcinoma, (2) presence of mucin at the apical borders of the tumor cells . Other factors that may favor sec would include squamous or squamoid areas, well - developed cilia, the presence of endometriosis, or a concomitant adenocarcinoma of the endometrium . Immunostains for alpha - inhibin is positive in most neoplastic sertoli cells but negative in the cells of endometrioid carcinoma, while positive ema and ck immunostains favor sec . Despite histologic similarity misir and sur in their study report that in slts, the patient age tends to be younger, with an average age of 25 years and clinically, up to 50% of slt patients may exhibit endocrine manifestations . In contrast, sec occurs almost exclusively in postmenopausal women with an average age of 68 years . Virilizing symptoms, though uncommon in endometrioid carcinoma, may be encountered in the sertoliform variant, thus compounding the diagnostic difficulty . In our case, usually, solid portion of endometrioid adenocarcinoma is considered as grade 3 according to the international federation of obstetrics and gynecologists grading system . Sec should be considered as grade 1 (well - differentiated), despite the presence of solid, sex cord - like proliferation as it carries good prognosis when confined to ovary . According to these suggestions, our case is graded as well - differentiated (grade 1) based on the histological features of foci of conventional endometrioid carcinoma . The case is presented for its rarity . In view of relatively good prognosis of sec as compared to endometrioid tumor, identifying this variant by an extensive sampling of the specimen is mandatory.
Aneuploid strains were generated by sporulation of the above polyploid strains, followed by karyotype stability tests and determination as described in fig . Qpcr assays were designed with primers in non - coding regions on each chromosome arm (supplementary table 1 lists primer sequences). Dna samples were prepared by alkaline lysis, and qpcr reactions were performed in 384-well plates using a biomek fx (beckman coulter) to assemble 10 l reactions and an abi 7900ht (applied biosystems) for cycling . Equal amounts (od600) of aneuploid and euploid control cultures were spotted, using the biomek fx robot, onto omnitrays containing various solid media and grown under conditions listed in supplementary table 2 . Omnitrays representing three biological replicates of each tested condition were scanned on an hp scanjet 4070 desktop scanner . Whole - cell lysates were prepared from 50 ml cycling yeast cultures by bead - beating . The ms / ms datasets were searched using sequest23 against a database of 11,986 sequences, consisting of 5,816 s. cerevisiae non - redundant proteins (ncbi), 177 contaminants and 5,993 decoy sequences . All statistical analyses were performed in the r environment25 using standard packages and custom scripts . Aneuploid strains were generated by sporulation of the above polyploid strains, followed by karyotype stability tests and determination as described in fig . Qpcr assays were designed with primers in non - coding regions on each chromosome arm (supplementary table 1 lists primer sequences). Dna samples were prepared by alkaline lysis, and qpcr reactions were performed in 384-well plates using a biomek fx (beckman coulter) to assemble 10 l reactions and an abi 7900ht (applied biosystems) for cycling . Equal amounts (od600) of aneuploid and euploid control cultures were spotted, using the biomek fx robot, onto omnitrays containing various solid media and grown under conditions listed in supplementary table 2 . Omnitrays representing three biological replicates of each tested condition were scanned on an hp scanjet 4070 desktop scanner . Whole - cell lysates were prepared from 50 ml cycling yeast cultures by bead - beating . The ms / ms datasets were searched using sequest23 against a database of 11,986 sequences, consisting of 5,816 s. cerevisiae non - redundant proteins (ncbi), 177 contaminants and 5,993 decoy sequences . All statistical analyses were performed in the r environment25 using standard packages and custom scripts.
Antiphospholipid syndrome (aps) may predispose the patient to deep vein thrombosis (dvt), pulmonary thromboembolism (pte), pulmonary hypertension and pulmonary infarction, and occasionally progress to pulmonary cavitations . Corticosteroid and immunosuppressive therapy directed at reducing antibody are not advised routinely . In a special situation, recognized as catastrophic apl syndrome with recurrent pte along with anticoagulant therapy, the recommendations is to start therapy with immunosuppressive agents . However, treatment with corticosteroid and other immunosuppressive agents predispose the patients to diabetes mellitus and opportunistic infections such as fungal infection . Opportunistic fungal infection such as mucormycosis and invasive aspergilosis are almost always reported in patients with major risk factors such as diabetic ketoacidosis, long term neutropenia, post transplantation, and high dose long term corticosteroid treatment . These infections are aggressive, rapidly progressive, angioinvasive, and life threatening diseases . Pulmonary mucormycosis has a rapid progressive course and result in lung cavitations with high a mortality rate . Some less common condition resulting in catastrophic condition are surgical procedures, anticoagulation withdrawal, medications, obstetric complications, neoplasia and systemic lopus erythmatosus (sle) flares . The present case is one of the unique presentations of apl syndrome complicated with catastrophic flare up in a young woman, who died after a possible of fungal infection and immunosuppressive withdrawal . A 35-year - old woman presented to respiratory clinic because of acute onset of fever, dyspnea exacerbation, hemoptesis, and aggravated bilateral lower limbs edema . She had two significant episodes of dvt 12 and 10 years earlier after each childbearing . Her first infant suffered from congenital heart disease, and died at the age of 5 months . Afterwards, her condition progressed to pulmonary hypertension and right sided heart failure gradually in the last years . In spite of conventional treatment for dvt and pulmonary thromboembolism, her condition had developed to severe pulmonary hypertension, severe dyspnea and severe lower limb edema . She had high serum concentration of antiphospholipid antibodies (igg: 22 gpl, igm: 17 mpl) and anticardiolipine antibody (igg: 25gpl, igm: 21mpl), but normal rheumatologic tests including antinuclear antibody (ana), rheumatoid factor (rf), and anti - neutrophil cytoplasmic antibodies (anca). Perfusion lung scanning demonstrated perfusion defects, which was interpreted as high probability of pulmonary thromboembolism (figure 1). Perfusion lung scan: multiple segmental perfusion defects compatible with the presence of pulmonary thromboembolism . She started receiving warfarin aiming at an international normalized ratio (inr) of 3 to 4 . The measurement of serum levels of antiphospholipid antibodies was repeated on the occasion of deciding about immunosuppressive therapy . Assuming the presence of multiple deep vein thrombosis, pulmonary thromboembolism, progressive pulmonary hypertension and positive antiphospholipid antibodies, prednisolone (60 mg / day) and azathioprine (50 mg twice a day) started hoping to prevent more catastrophic events . She was on treatment with warfarine, azathioprine and prednisolon for 12 months, after which corticosteroid was tapered and discontinued because of hyperglycemia . The patient then continued to receive azathioprine, warfarine and oral glucose lowering agents, and felt well until recently . Last year, she suffered from several attacks of paroxsismal atrial tachycardia; therefore, she was admitted to the hospital . Because of poor compliance, glycemic control was poor . There was no history of any serious infection during the last four years, and serial assays for complete blood count was normal . At the last presentation, the laboratory findings were as follows: urea; 55 mg / dl, creatinine; 1.1 mg / dl, glucose; 350 mg / dl, prothromobine time; 25 seconds, inr; 4.4, wbc; 10000/l / with 75% segment and 20% lymphocyte . Microscopic examination of urine showed: wbc; 4 - 5/high power field, rbc; 4 - 5/high power field and negative for bacteria . Chest computer tomography (ct) scan showed cavity in the medial segment of left lower lobe and a cavity in the apical segment of right lower lobe (figure 3). Blood culture for bacterial infections, and sputum smear for acid fast bacillus (afb) were negative . The patient was in poor condition, and semi invasive or invasive procedures were not performed . Liposomal amphotricine was not available; therefore, amphotricin b started empirically for possible invasive fungal infection of lung, and azathioprine was discontinued . Blood glucose remained in an acceptable range by regular insulin therapy . At the end of the first week, the patient continued to be much better, and blood sugar, urea and creatinine were remained in acceptable range . After two weeks of treatment, the patient was discharged and amphotricine was replaced by oral itraconasol . Because of recurrent paroxysmal atrial tachycardia, the patient was readmitted on day 7 after discharge . At this admission, the patient succumbed to severe dyspnea, increased urea (192 mg / dl) and creatinine (4.4 mg / dl), state of confusion, and was transferred to icu on the day 5 of the admission . The portable chest radiography was not remarkable for complications such as pneumothorax or new infection . The patient failed to improve, and died on the second day of icu care with multi organ failure and homodynamic instability . Chest computed tomography showing a cavity in the medial segment of left lower lobe and a cavity in the apical segment of right lower lobe (arrows). The patients did have the criteria for apl syndrome such as recurrent venous thrombosis, pte, pulmonary hypertension, and pregnancy morbidity as well as the presence of high serum levels of antiphospholipid antibody and anticardiolipine . As it occurred in the present case, pulmonary thromboembolism accompanied by dvt anticoagulant therapies with heparin followed by life - long warfarine is the optimal prophylactic treatment . Since apl syndrome was not suspected in the present patient, anticoagulant was discontinued at the end of 6 month; therefore, subsequent multiple thromboembolic events resulted in pulmonary hypertension . As this case illustrates, apl syndrome can be associated with chronic thromboembolic pulmonary hypertension . The prevalence of pulmonary hypertension in patient with apl syndrome is estimated to be 2 to 4% . On the other hand, the prevalence of apl in patients with chronic thromboembolic pulmonary hypertension is around 10 to 20% . Primary non - thromboembolic pulmonary hypertension was also reported in patients with primary apl syndrome . However, the prevalence of apl has been reported more frequently in thrombembolic type than in primary non - thromboembolic type of pulmonary hypertension . There is also evidence that apl may contribute to the pathogenesis of pulmonary hypertension in patients with connective tissue diseases . Some cases of apl syndrome fall into a catastrophic situation, which is characterized by overwhelming small vessel occlusive disease simultaneously affecting many organs in a short period of time . The catastrophic situation represents less than 1% of all patients with apl syndrome, and is usually life - threatening with a 50% mortality rate . Cerebral and cardiac involvements are the main causes of death in catastrophic variant of the syndrome, followed by bacterial and fungal infections . Because of highly - suspected fungal infection in the present case, azathioprine was discontinued . This might have predisposed the patient to flare up of catastrophic syndrome, which was presented as stupor, hemodynamic instability and renal failure after an initial improvement in the condition of patient due to amphotricine therapy . Infections (22%) and surgical procedures (10%) are the most common precipitating factors of catastrophic syndrome reported in catastrophic antiphospholipid syndrome registry followed by anticoagulation withdrawal or low inr (8%), medications (7%), obstetric complications (7%), neoplasia (5%) and sle flare up (3%). In the present case, pulmonary cavitations in patients with apl syndrome are rare, and there are only few case reports of the condition caused by pulmonary embolism and infarction followed by cavitations . It might be important to mention that the lung cavitations in the present case could not be due to microthrombosis, which is one of the major features of catastrophic syndrome . However constellation of long term uncontrolled hyperglycemia state, immunosuppressive therapy, and severely decompensated pulmonary circulation, could be predisposing the patient into opportunistic angioinvasive fungal infection such as mucurmycosis . Pulmonary mucormycosis is most often encountered in patients with diabetic ketoacidosis, uncontrolled diabetes, hematological malignancy, severe burn, and after solid organ transplantation . The definite diagnosis of pulmonary mucormycosis is usually difficult and ante - mortem diagnosis has been made infrequently . Because of ill and decompensated condition in the present case, invasive diagnostic procedures such as bronchoscopy either percutaneous or open lung biopsy, were not possible . The signs and symptoms of the present case might suggest that physicians should be aware of flare up of a catastrophic situation in patients with apl syndrome, if they decide to taper or discontinue the immunosuppressive or corticosteroid regimens . Besides, as the infection may be a possible cause of flare up or relapse, close observation of any infectious condition must be considered.
Both tues and rcn - ube support the community to catalyze change within undergraduate biology education and, in effect, act synergistically . Tues supports change in the way courses are taught, development of new materials (including new assessment materials to support these approaches), and research into undergraduate education in general . Tues funds can be used to support course development by funding faculty time and other resources, including some funds for initial purchase of instrumentation essential to the development and implementation of transformative changes in student laboratories and/or lecture classes . Tues funds also may be used for faculty development activities that prepare other faculty to incorporate these new ideas into their own teaching (nsf, 2006). Tues also supports evaluation, webinars, conferences, and a project information portal (american association for the advancement of science [aaas], 2011). The current (fy2013) program has tracks ranging from small pilot projects with funding caps of $200,000 to large national projects with funding caps of $6 million . The rcn - ube program focuses on forming alliances of faculty, professional societies, and institutions active in developing, among other things, learning in emerging technologies in the biology curriculum, strategies and approaches for engaging biology faculty in professional development, incorporating emerging subdisciplines into the biology curriculum, improving assessment of student learning, improving the transition of students from 2-yr to 4-yr institutions, and incorporating authentic research experience into undergraduate laboratory courses (nsf, 2012b). The coordination efforts may include holding workshops, generating websites, or other appropriate means of developing a community of practice . The rcn - ube program has two tracks, a full proposal track that funds projects up to $500,000 and an incubator track that funds projects up to $50,000 . The incubator track accepts proposals that request support for the initial development of networks that will catalyze positive changes in biology undergraduate education . About a half - dozen incubator awards while the number of proposals submitted to the program has declined, the funding rates have remained high (table 1). (the average funding rate across the 5 yr of the program is 41.8%; this is nearly double the average nsf funding rate [nsf, 2012a].) Yearly distribution of proposals and awards within the rcn - ube program data from nsf report server . Www.nsf.gov / awardsearch/. A glance at the recently funded projects within these programs (see the supplemental material) should help the reader understand the scope of these two programs and how they relate to one another . Principal investigators do not need to have an ongoing project in one program in order to apply to the other, but may apply to both programs, as appropriate . Tues serves all science, technology, engineering, and mathematics (stem) disciplines, as well as projects that involve interdisciplinary approaches, research on undergraduate stem education, assessment of student learning, and evaluation of teaching approaches . Biology proposals are handled by one of the nine teams (biology, chemistry, computer science, engineering, geology, mathematics, physics, interdisciplinary, and research and assessment) within the program . In 2012, 1007 proposals were submitted to the program . Of these, only 97 (10%) focused on biology education (table 2). Table 2 also shows that 41% of all stem graduates in the united states are biology majors, and 22% of all u.s . If we compare these data with the results for engineering, which has 24% of all stem graduates each year and 14% of the stem faculty, we see a great disparity in the degree to which faculty in these two disciplines seek funding for instructional changes in their classrooms . Fully 28% of the tues proposals submitted in 2012 were submitted by engineering faculty, while only 10% were submitted by biology faculty . Distribution of tues type 1 proposals submitted during fy 2012 and the number of majors and faculty members in the united states in the stem disciplines data from nsf report server . We chose to compare engineering and biology undergraduate education because both are undergoing major reorganization; engineering due to the pressures from the accreditation board for engineering and technology, and biology due to the pressures of the association of american medical colleges / howard hughes medical institute report scientific foundations for future physicians (aamc / hhmi, 2009), as well as the vision and change initiative (aaas, 2011). The reasons for these strikingly disproportionate proposal submissions, despite similar demands for change in engineering and biology, are not apparent . It is our hope that articles such as this, along with frequent presentations by nsf staff at professional societies annual and regional meetings, will encourage the community of life sciences faculty to seek funding from this versatile program, which encourages a range of projects from small pilots to test new ideas through large multi - institutional collaborations designed to disseminate effective practices more broadly (singer et al ., 2012). Because rcn - ube is a relatively new program, its impact on undergraduate biology education is only beginning to emerge . Designed specifically to develop communities of people who are working on similar projects, but who otherwise may be unaware of others with similar interests, it generated a flurry of proposals in the first 3 yr, but this was followed by a dramatic decrease in the number of submissions . We are hopeful that the increase in the number of proposals between 2011 and 2012 represents an appreciation of the value of this program to build and strengthen current or future collaborative efforts, as well as an awareness of the program within the community . It is certainly a program that can serve a crucial role in the development and dissemination of ideas generated to support the vision and change initiative call for action . The number of proposals funded within any program depends not only on the number of proposals submitted but also on the quality of the proposals received . Writing a proposal for an educational initiative is essentially the same as writing a research proposal . It is important to: be sure the proposal is being submitted to the appropriate program;clarify the subject matter to be addressed in the instructional materials or practices;establish the evidence for the effectiveness of the instructional practices that the project builds on and intends to adds to;describe outcomes from any preliminary work you have done to test the potential of the approach;present implementation plans succinctly, so panelists can easily understand them and judge their potential for success;state the outcomes expected and how they will be determined and documented; andindicate the level of support and/or interest either by colleagues within the department or elsewhere . Be sure the proposal is being submitted to the appropriate program; clarify the subject matter to be addressed in the instructional materials or practices; establish the evidence for the effectiveness of the instructional practices that the project builds on and intends to adds to; describe outcomes from any preliminary work you have done to test the potential of the approach; present implementation plans succinctly, so panelists can easily understand them and judge their potential for success; state the outcomes expected and how they will be determined and documented; and indicate the level of support and/or interest either by colleagues within the department or elsewhere . For example, to determine whether the project is appropriate for a particular program, read the program solicitation carefully; program officers are always available via email or telephone to answer specific questions . The program solicitation provides the names of program officers associated with the program, as well as links to recent awards . The evidence base for instructional best practices can be found in journals such as this one, as well as in publications such as vision and change in undergraduate biology education: a call to action (aaas, 2011) and discipline - based education research: understanding and improving learning in undergraduate science and engineering (singer et al ., 2012). This literature provides information on instructional best practices that inform the project being proposed and ground it in that research base . In addition to the tues and rcn - ube programs within nsf, there are a variety of other funding opportunities for faculty and students in the life sciences, including the following: the hhmi science education alliance helps bring good ideas in science education to a broader audience by offering educators models of research - based curricula developed to engage college students in true scientific discovery as early as possible in their academic careers (www.hhmi.org/grants/sea/index.html).the nih has internship, scholarship, and fellowship programs for undergraduates (www.training.nih.gov/programs).the nih institutional research and academic career development awards help postdoctoral students develop teaching skills and pedagogical knowledge as they work with established faculty in minority - serving institutions, with the aim of facilitating the progress of postdoctoral candidates toward research and teaching careers in academia (http://grants.nih.gov/grants/guide/pa-files/par-12-245.html).the u.s . Department of agriculture (usda) offers different pathway opportunities for students and recent graduates to work in agriculture, science, technology, math, environmental, management, business, and many other fields . The usda offers internships to students and recent graduates to help them to excel in their chosen fields (www.dm.usda.gov/employ/student/index.htm). Bring good ideas in science education to a broader audience by offering educators models of research - based curricula developed to engage college students in true scientific discovery as early as possible in their academic careers the nih has internship, scholarship, and fellowship programs for undergraduates (www.training.nih.gov/programs). The nih institutional research and academic career development awards help postdoctoral students develop teaching skills and pedagogical knowledge as they work with established faculty in minority - serving institutions, with the aim of facilitating the progress of postdoctoral candidates toward research and teaching careers in academia (http://grants.nih.gov/grants/guide/pa-files/par-12-245.html). The u.s . Department of agriculture (usda) offers different pathway opportunities for students and recent graduates to work in agriculture, science, technology, math, environmental, management, business, and many other fields . The usda offers internships to students and recent graduates to help them to excel in their chosen fields (www.dm.usda.gov/employ/student/index.htm). The biology staff of the division of undergraduate education has compiled a resource for those seeking information on the nsf programs that support improvement of undergraduate education in biology . This document includes helpful information on proposal preparation, insights into the review process, and post - award management . While the information is useful for faculty in any discipline, the examples and advice given are oriented to the needs of biologists . The document is updated in august of each year and can be obtained electronically by contacting helen vasaly (hvasaly@nsf.gov). The program officers and staff members at the nsf are looking forward to receiving your tues and rcn - ube proposals.
It occurs, most often, in patients receiving anticoagulation therapy or in patients with either inherited or acquired clotting disorders11). It has also been reported to occur following trauma, harvesting an anterior iliac crest bone graft and hip arthroplasy4,8,14). It can occur even in a healthy patient who is not undergoing anticoagulant treatment or suffering from a clotting disorder6). It can cause severe pain in the affected groin, hip and thigh, and it can cause quadriceps weakness . Other associated findings may include a fall in the hematocrit, tachycardia, hypotension, abdominal pain and a palpable mass, depending on the severity of hemorrhgage11). Because of the rareness of this condition, the optimal treatment of iliacus muscle hematoma with associated femoral neuropathy remains controversial . We report here on a rare case of a spontaneous iliacus muscle hematoma that caused femoral neuropathy in a patient who was taking warfarin for occlusive vascular disease with the discussion of the treatment . A 55-year - old male presented with severe pain and numbness in the groin that radiated to the left anterior thigh . After the sudden onset of the pain, weakness on the left lower extremity developed and this had worsened for one week . He had a previous history of a thrombectomy in the left femoral artery two years before and in the left external iliac artery one month before . His prothrombin time international normalized ratio was 1.6, the hemoglobin was 9.7 g / dl and the platelet count was 22310/l . Physical examination revealed paresis of the left quadriceps muscle with strength of 4/5 and a diminished knee jerk reflex . The femoral, popliteal and dorsalis pedis pulses were palpable but slightly weak and no change in the skin color was found . He kept the left knee flexed and complained of aggravated pain when he extended the knee . But computed tomography (ct) angiography and doppler ultrasonography revealed patent proximal arteries and intact flows on the lower extremities . 1). Because the left psoas muscle was compressed and displaced by the hematoma compared with right psoas muscle and the femoral nerve runs between the psoas tendon and the iliacus muscle, compression or displacement of the left femoral nerve was suspected . The warfarin was immediately discontinued and he was managed with pain control and regular neurological assessment . Electromyography and nerve conduction study showed left femoral neuropathy . After confirming the normalization of his coagulation parameters, percutaneous catheter insertion was performed under ultrasonographic guidance for aspiration and drainage of the hematoma . However, only a small amount of the hematoma was drained and then surgical evacuation of the hematoma via the left retroperitoneal approach was performed . Soon after making the incision on the iliacus fascia, old blood clot gushed out . The hematoma was gently evacuated with the suction and forceps and irrigated, and a jackson pratt drain was placed for continued drainage . Abdominal ct scan showed a decreased amount of the hematoma one month after the surgery (fig . 2). He demonstrated recovery of his femoral nerve function, with an improvement of the quadriceps strength to grade 4/5 at the 1-year - follow - up examination, but limping in his left leg remained . The femoral nerve develops within the body of the psoas muscle from the posterior division of l2-l4 . The femoral nerve then runs between the psoas tendon and the iliacus muscle beneath the iliacus fascia to the femoral canal, under the inguinal ligament11). Anatomic studies have revealed that the fascia overlying the iliacus muscle and the femoral nerve is strong and not easily stretched in the presence of underlying hematoma formation10). As a result, femoral nerve compression occurs along the iliopsoas gutter, where it is also at the most risk for ischemia due to the poor vascular supply to this region of the nerve . In addition, the hematoma may track down the iliacus muscle into the femoral canal and compress the femoral nerve against the rigid inguinal ligament, resulting in further ischemia and resultant neuropathy10,11). Goodfellow et al.3) demonstrated that a hematoma that is responsible for femoral nerve palsy is necessarily situated in the iliacus muscle and not in the psoas muscle . Fluid injected into the iliacus muscle or fascial sheath produces high pressure, and this compresses the femoral nerve against the psoas muscle tendon and induces an ischemic femoral neuropathy . An iliacus muscle hematoma never drains spontaneously, rather, it persists for a long period of time and induces chronic compression of the femoral nerve and then the hematoma becomes organized16). In the present case, the hematoma was found within the iliacus muscle and not in the psoas muscle . It might have stretched the iliacus fascia, and compressed and displaced the femoral nerve . Although hematoma of the iliacus muscle has been reported to occur following trauma, harvesting an anterior iliac crest graft, hip arthroplasy, and even in a normal patient, it has been reported primarily in patients suffering from hemophilia and those receiving heparin or oral anticoagulant therapies4,6,8,11,14). The incidence of retroperitoneal hemorrhage has been reported at 1.3 - 6.6% of the patients undergoing therapeutic anticoagulation and at 5.5% and 10.4% of the patients with hemophilia1,2,11). Therapeutic anticoagulation is a frequently utilized treatment for a number of conditions, including atrial fibrillation, deep vein thrombosis, pulmonary embolism and so on . As the number of patients undergoing anticoagulation therapy increases the treatment of iliacus muscle hematoma with associated femoral neuropathy remains controversial because of the rareness of this condition . Treatment depends on the speed of onset, the volume and the degree of neurological impairment6). A conservative approach is justified for hemodynamically stable patients with smaller hematomas, moderate neurological symptoms and there is no active bleeding6,11,14). In the case of active bleeding advocated that because of its lower morbidity, transarterial embolization should be considered instead of surgery13). For large haematomas with severe motor function inhibition, if the lesion progresses or there is evidence of neurological worsening, then surgical treatment is mandatory by decompression and drainage5,11,16). Parmer et al.11) suggested when surgical hematoma evacuation was performed at the first identification of neuropathy, a full return of function is more likely to occur, and those patients who are treated conservatively for an extended period despite the presence of femoral neuropathy continue to have prolonged neurological deficit despite eventual intervention . In one series, all the patients who had a femoral motor deficit and who were conservatively treated or underwent surgical drainage after 48 hours had a permanent femoral nerve distribution paresis16). They reasoned that early fasciotomy with or without hematoma evacuation should be considered in order to provide rapid decompression and to minimize the chance of permanent nerve injury . Nevertheless, they did not provide any specific information regarding the hematoma volume and management decisions12). In the present case, the patient's pain and motor weakness became worse despite of initial conservative management, and surgical evacuation of the hematoma was performed two weeks after the onset of pain and weakness . Although there was improvement in the quadriceps power after the surgery, he still walked with a limp in his left leg . An alternative to open surgical treatment is percutaneous decompression . Merrick et al.7) reported the return of nerve function by percutaneous decompression of a retroperitoneal hematoma and they suggested that percutaneous drainage may represent a reasonable alternative to or the first step in surgical treatment . Of note, this treatment can be used only for liquid hematomas and it would not be useful for patients whose diagnosis is delayed until they already have organized hematomas14). In the present case, at the time two weeks after the onset of symptoms, the organized hematoma made percutaneous aspiration or drainage impossible, and this led us to perform open surgical treatment . Spontaneous iliacus muscle hematoma should be considered in the differential diagnosis of leg pain in a patient who is on anticoagulation therapy . Although there is no clear consensus for the treatment of femoral neuropathy associated with iliacus muscle hematoma, the development of associated femoral neuropathy mandates early operative intervention . Delays in the surgical evacuation of a hematoma for decompressing the femoral nerve can lead to a prolonged or permanent disability.
Intimate partner violence (ipv) is an entrenched public health and social problem across both developed and developing nations . Behaviour within an intimate relationship that causes physical, sexual or psychological harm, including acts of physical aggression, sexual coercion, psychological abuse and controlling behaviours [1, page 11]. There is a growing recognition and understanding of the potential health consequences of ipv both in relation to acute and chronic health impacts beyond the physical trauma cases seen in emergency departments of acute care hospitals and primary care settings . In the past two decades, a growing body of literature has focused on associations between ipv and physical and mental health across a wide range of disciplines . This is reflected in the increasing volume of research articles that deal with psychological consequences and correlates of ipv, including ptsd and other related psychological conditions . Since the adoption of the 1993 united nations general assembly resolution convention on the elimination of all forms of discrimination against women (cedaw), acceptance of ipv as a cross - cultural human rights issue affecting women across the globe has led to international agencies beginning to fund research studies [37]. There is now a much broader recognition of the public health implications of ipv, taking it from a personal and family issue related to the legal and justice system to an issue that needs to be acknowledged and addressed at a societal level . Further, increasing evidence suggests that the impact of ipv is not exclusively concurrent with the experience of abuse and may last long after the violence has ceased . The sheer volume of literature in the ipv area, even when confined to health issues, can create confusion around identifying the most likely correlates and consequences of ipv . This is further complicated by the difficulties researchers face when attempting to assess the health of this population . Studies are frequently confined to drawing samples of convenience (from shelters, clinics, etc .) And where community samples are drawn there are concerns over underreporting all of which limit generalisability . In addition, the varying ways in which ipv is assessed leads to inconsistency in outcomes across studies . The purpose of this review paper is to provide an overview of recent research literature that has examined ipv and health . The review synthesizes literature from a broad range of studies to map patterns and trends of health consequences and correlates of ipv . Literature searches of three major online databases (scopus, sage premier, and proquest) were undertaken, covering literature published during the time period of january 2006 to june 2012 . This time period allowed capture of the most recent papers in the field whilst maintaining the body of reviewed literature to a manageable size . To ensure that papers using a slightly different terminology for ipv were not inadvertently excluded, the search terms used included both domestic violence and intimate partner violence . As this paper is concerned with the link between violence and health, the terms physical health and mental health searches were conducted within the title, abstract, and keyword lists of each database . Articles were firstly assessed on the basis of title and abstract in order to ascertain their relevance for this review . Following this, full - text copies of studies for possible inclusion in the review, were accessed in order to conduct a more thorough evaluation of their relevance . In determining relevant studies for this review, the following inclusion criteria were used.the article reported on an original study, either from primary research or original secondary data analysis.physical and/or mental health consequences or correlates of intimate partner violence were the main foci of the research.the research focused on intimate partner violence against women, experienced at any point in adulthood, except during the antenatal or immediate postnatal period.the violence defined within the study was restricted to violence against women from a current or previous intimate partner . The full text of the research article had to be available in english.the article had been published in a peer reviewed journal between january 2006 and june 2012 . The article reported on an original study, either from primary research or original secondary data analysis . Physical and/or mental health consequences or correlates of intimate partner violence were the main foci of the research . The research focused on intimate partner violence against women, experienced at any point in adulthood, except during the antenatal or immediate postnatal period . The violence defined within the study the article had been published in a peer reviewed journal between january 2006 and june 2012 . Studies that reported on health effects of intimate partner violence for both men and women were included within this review only if the results were stratified by gender, so that the health implications of partner violence on women could be clearly identified . Articles focused on clinical samples were excluded where the specific clinical issues might have compromised generalisability of the results, including samples where ipv occurred during pregnancy or in the immediate postnatal period, studies that focused exclusively on women with specific health condition (e.g., hiv - positive women) and women with specific exposure to additional traumatic events (e.g., military veterans). Studies specifically involving adolescents and high school students were also excluded, since abuse in adolescence was beyond the scope of this review, as were articles relating to health economics . As illustrated in figure 1, initial search of the various databases using specified key terms, yielded 1077 articles . These articles were reviewed on the basis of their titles and abstracts using the inclusion and exclusion criteria specified above . This phase of the review removed 866 articles, leaving 211 articles for further consideration . Full - text articles were accessed for each of these studies in order to carry out a more detailed review of their relevance . After application of the specified inclusion and exclusion criteria, the number of articles for review was further reduced to 98 studies . Each of these studies was read and analysed to extract and summarise relevant findings . In this process, an additional 24 papers were removed from the review and one paper was added . Upon completion of the review selection process, there were 75 studies which form the basis for the findings presented in this review . Setting of reviewed studies and ipv prevalence the study settings for reviewed articles are summarised in table 1 . Just over 30% of the studies utilized a population - based sample and about 19% of the studies collected data from domestic violence shelters . Studies based in medical settings were represented by primary healthcare (13.3%), mental health settings (6.7%), emergency departments (5.3%), and health maintenance organizations (2.7%). The lifetime prevalence of intimate partner violence reported in the studies varied widely, as indicated in table 1 . In population studies, prevalence ranged from 0.98% to 70.9%, whereas in community samples the range was from 11.4% to 44% . The highest reported incidence (78.8%) was from a sample of undergraduate university students reporting on dating violence . Studies that recruited women from domestic violence shelters, or crisis centres for women who had experienced ipv, were reported as a prevalence of 100% as were studies that recruited women who were pursuing protection orders against abusive partners through the court system . Of the 75 reviewed papers, 55 reported on studies conducted in developed countries and the remaining 20 studies reported on findings from developing countries . The vast majority of studies (n = 70) were quantitative in nature, three studies used qualitative methodology and reporting and two studies used a combination of qualitative and quantitative techniques . The majority of studies reported findings around the mental health implications of intimate partner violence . Of the 75 studies reviewed, 38 (50%) dealt exclusively with mental health issues, 24 studies (32%) reported on both mental and physical health outcomes, 9 studies (13%) reported on physical health outcomes only, and 4 studies (5%) reported exclusively on sleep problems . In this section, we describe our synthesis of findings sequentially, beginning with mental health outcomes, including depression, ptsd, anxiety, suicidality and self - harm, self - perceived mental health and psychological distress, and impact of intimate partner violence on quality of sleep and sleep disorders . The second section of the review covers findings of intimate partner violence on physical health outcomes including functional health, self - perceived physical health impact, and chronic health conditions . From the articles included within the review, 66 studies reported on aspects of mental health in relation to intimate partner violence . Depression was the most commonly researched aspect of mental health in relation to intimate partner violence, being reported on in 42 of the reviewed articles [10, 1353]. The high relative importance of depression in its impact on health, as a result of ipv, is shown by the burden of disease figures given in the study by vos et al . Who found that 34.7% of the total ipv disease burden was attributable to depression . This is in comparison to 27.3% attributable to anxiety, 10.7% to suicide, and only 0.6% of the burden of disease attributed to physical injuries as a result of ipv . Reported that the incidence of major depression during the past 12 months was 51.4% from their sample of women's shelter residents . This compared to the national average for the general us female population of just 2.4% reporting depression in the previous 12 months . Of all the studies that investigated the link between depression and ipv history, only one study, conducted in 2008 by fedovskiy et al . This study of american latino women (n = 105) from a primary care clinical setting found that women endorsing a history of ipv had a higher odds ratio of having a major depressive disorder (or 1.68) compared to women with no history of ipv that was not statistically significant (p = 0.22). Note that their nonsignificant finding is contrary to the findings of previous studies and postulate that the high baseline levels of depressive disorder in their study sample could be a potential confounder that masks any significant effects . All the remaining reviewed studies consistently reported significant associations between a history of ipv and depressive symptoms . Several studies indicated that severity or chronicity of violence was associated with more severe depressive symptoms [13, 14, 16, 17, 40, 50]. . Indicated that subjective appraisals of the stressfulness of an ipv event may have a stronger impact on women's depressive symptoms than more many studies reported on ipv as a single overarching construct; however, other studies broke down their findings to report on individual categories of violence, most commonly: physical, sexual, and psychological / emotional abuse . Experiencing more than one type of abuse increased the probability of having depressive symptoms as well as the severity of those symptoms [19, 21, 27, 37]. The results reported in the majority of studies indicated that women usually reported more than one type of violence in their history of abuse . Of those studies reporting on depression that did present findings on distinct abuse categories, pico - alfonso et al . Found psychological ipv to be as detrimental as physical ipv in terms of depressive symptoms in their study sample of spanish women . Wong et al . Found psychological abuse to be the significant predictor of higher levels of ipv - related depression in their study of chinese women . In this study, it was found that the more frequent the psychological abuse, the higher the level of depression experienced, but this significant result was not found to be present in relation to the frequency of physical abuse . The results reported by chen et al ., in their us - based study of hispanic women, indicated that women who had experienced sexual abuse from their intimate partner were at far higher odds (or 42.60, 95% ci: 2.39758.61) of developing depression than women with either a history of physical (or 10.28, 95% ci: 1.5468.77) or psychological abuse (or 5.83, 95% ci: 2.1116.16) when compared with nonabused women . The wide fluctuations of the 95% ci for sexual abuse and physical abuse are due to the very small number of respondents in each category, indicating that these results should be viewed with caution . The us - based study by zlotnick et al . Reported on patterns of recovery in mental health status in women with a history of ipv followed across a five - year timeframe . They concluded that women reporting ipv at the commencement of their study were still significantly more likely to experience a greater degree of depressive symptoms and functional impairment with lower self - esteem and life satisfaction at the 5-year followup, compared to women without ipv . They did not find any evidence to suggest that women remaining in an abusive relationship were worse off, in terms of psychosocial difficulties, than women who left those relationships . Thus, they concluded that women who have experienced ipv are at risk of a range of long - term mental health concerns, irrespective of whether or not they stay or leave the abusive relationship . Within this review, 14 studies related to the incidence of posttraumatic stress disorder (ptsd) in abused women [15, 18, 21, 23, 25, 27, 30, 32, 33, 36, 37, 5456]. All studies agreed on the fact that a history of intimate partner violence was positively associated with the increased incidence of ptsd symptoms and ptsd diagnoses . Estimated that women with a history of ipv were 2.3 times more likely to develop ptsd compared to never - abused women after controlling for race, marital status, and income . Two other studies [23, 33] reported that women with ipv histories had approximately three times the odds of meeting criteria for ptsd as compared to women who did not report a history of ipv . Within the reviewed studies, the reported prevalence rates of ptsd varied widely . Chandra et al . Reported, in their indian study involving female psychiatric outpatients, that of all the women reporting ipv, 14% met the criteria for ptsd . The rate of ptsd reported from a sample of women from domestic violence shelters in usa was reported as 16.2% by helfrich et al . . Yet, in a similar sample of abused women from crisis shelters and the general community in usa, sampled by woods et al ., the rate of women who met the criteria for clinical diagnosis of ptsd was much higher at 92.4% . Another us study of women from a health maintenance organisation (hmo) found that 30.9% of women with a history of ipv had symptoms consistent with ptsd, compared with 13.7% of women who did not have a history of ipv . Similar to the trend for depression, it was reported that women experiencing more severe and more sustained abuse generally exhibited higher levels of ptsd symptoms [18, 27, 56]. Also, the experience of more than one form of abuse led to greater levels of ptsd symptomology [21, 27]. Reported that the relative risk of experiencing ptsd symptoms rose with the number of abuse types experienced . Women who had experienced three types of abuse were more than nine times as likely to develop ptsd as a woman who had no history of abuse . A woman experiencing only one type of abuse was just over two times as likely to develop ptsd compared to a nonabused woman . Pico - alfonso et al . Stated that, in their study, the occurrence of ptsd alone was rare, with most women exhibiting comorbidity of ptsd along with depressive symptoms . This appears to be the case in several other ptsd studies as well [15, 18, 23, 36]. This link between ptsd symptoms and depressive symptoms is noted by fedovskiy et al . Who report that women with ptsd were ten times more likely to also have high depression scores (ces - d scores of> 15) and they suggest that ptsd and major depressive disorder comorbidity in their study may be a result of symptom overlap, especially the symptoms of anhedonia, sleep disturbance, and concentration difficulties ., anxiety was investigated as a part of sixteen studies [1315, 20, 22, 25, 28, 31, 37, 39, 40, 43, 46, 50, 51, 53], but it was not the exclusive focus of any of these studies, usually being reported along with other common mental disorders, most often depression . In the study on burden of disease associated with ipv, vos et al . Found that 27.3% of the total ipv burden of disease was attributable to anxiety, making it the second highest contributing factor, with only depression having a higher percentage score . In their us - based study of women from a domestic violence shelter, helfrich et al . Reported that 77% of women from the shelter sample reported anxiety during the previous 12 months, compared to a reported national average of 6.1% for females from a national health survey . All sixteen reviewed studies on anxiety reported finding a positive association between a history of intimate partner violence and increased levels of anxiety in women . This relationship existed even after demographic variables such as age, education, and income were taken into account [22, 40, 43]. Pico - alfonso et al . Reported a link between severity of anxiety symptoms and comorbidity with depression, observing that the severity of state anxiety was higher in abused women with depressive symptoms . There was also a dose - response trend apparent, with a greater severity of anxiety symptoms being present in abused women when the abuse experienced was more frequent, more intense, or more severe [13, 40, 50]. From the reviewed articles, six studies reported on suicide attempts [9, 26, 39, 43, 45, 57] and twelve studies on suicidal ideation or thoughts [21, 26, 28, 37, 43, 45, 47, 48, 5760] in relation to a history of intimate partner violence . All of these studies reported an association between the lifetime experience of abuse and increased suicidal ideation and suicide attempts in women . Results from the multi - country study by the world health organisation on women's health and domestic violence relating to suicide were presented in three separate reports [9, 57, 58]. The paper by devries et al . Dealt specifically with suicide attempts and reported that the experience of ipv was significantly associated with suicide attempts in every one of their thirteen study sites across nine different countries . Ellsberg et al . Reported that the pooled analysis, across all of their fifteen sites in ten countries, showed that women who had experienced physical or sexual violence, or both, were three times more likely to have thought about ending their lives and almost four times more likely to have attempted on one or more occasions to have ended their lives, when compared to women who had never experienced partner violence . The reported adjusted odds ratios from a study of south asian immigrant women resident in the us were even higher, with abused women being seven times more likely to exhibit suicidal ideation than nonabused women from this study sample . In their study of urban indian women, vachher and sharma reported that 22.3% of the study subjects had ever thought of suicide, 12.0% reported suicidal thoughts in the past month, and 3.4% of the women had tried to commit suicide . Suicidal tendencies were considerably more common in women with a history of partner violence, compared to those who had not experienced violence, and these differences were statistically highly significant . The effects of different types of violence in relation to suicidal ideation were reported by ishida et al . From a population - based study of women from paraguay . They found that, for abuse in the past 12 months, physical and sexual violence were more important risk factors for suicidal ideation than emotional abuse . For abuse experienced more than 12 months ago, sexual violence had the largest adverse effect, indicating that sexual abuse had a longer lasting negative effect than either of the other two forms of abuse . This is in contrast to the results from bangladesh, reported by naved and akhtar, who found that sexual violence by a husband was not associated with suicidal ideation in either rural or urban study sites . They found emotional violence and severe physical violence to be the major determinants of suicidal ideation amongst their sample of bangladeshi women . The authors also observed a dose - response effect in suicidal ideation in women exposed to a number of forms of violence . Women exposed to no violence, or a single form of violence, had the lowest reporting of suicidal ideation during the previous 4 weeks . An increase in the number of forms of violence, experienced by women in the study, led to an increase in the rate of suicidal ideation reported during the reference period . Self - harm was the subject of two reviewed articles [61, 62]. Sansone et al . Found that a history of domestic violence was a statistically significant predictor of bodily self - harm in their study of psychiatric inpatients in the usa . A qualitative study of self - harm in victims of intimate partner violence in china revealed that victims considered self - harm to be a method for airing painful emotions caused by abuse, or a last resort to escape by dying when they saw no other option and were no longer able to endure the violence . The general categories of self - perceived mental health and psychological distress were utilized in nineteen studies . These studies used a range of measurement instruments to report on generalized mental health status and functioning . The medical outcomes study 36-item short form health survey (sf-36) mental health component score was used in five studies [16, 19, 31, 63, 64] and the shorter sf-12 form in two other studies [65, 66]. Other tools used to measure self - reported mental health status were the who developed self - reporting questionnaire (srq-20) used in three studies [45, 57, 60], the 12-item general health questionnaire (ghq-12) used in three studies [8, 12, 67] and a development of author's own questions [13, 38] or the use of a range of questions extracted from several survey instruments . A consistent finding of all these studies is that women who had experienced ipv (physical, sexual, or psychological) had lower mental health and social functioning scores than women who had not experienced ipv . . Reported on data from a us population - based survey using the kessler-6 (k6) instrument to measure the degree of serious psychological distress (spd) experienced in the last thirty days . The risk of spd was highest among women who reported experiencing both physical and sexual ipv during their lifetime, the prevalence of spd for this group of women was 15.4% . Among women with no lifetime history of ipv, the prevalence of serious psychological distress was 2.1% . In a canadian study on ipv in young couples, fortin et al . It was found for women in the study that a history of psychological violence gave a significant prediction of distress; however, there was no significant prediction of distress in women experiencing physical abuse . It should be noted, however, that the reported prevalence rate of psychological abuse for women in this study (80%) was much higher than the reported rate for physical violence (27%). Amongst the reviewed articles, four studies [11, 7072] focused solely on sleep disturbance as a consequence of intimate partner violence and several others [13, 39, 41, 50] reported on insomnia and other sleep disturbances in the context of broader physical or mental health outcomes . All of the sleep studies support the finding that intimate partner violence has the capacity to impact negatively on both the quality and quantity of sleep in women with experience of ipv . The main mediating pathways between intimate partner violence and poor sleep were reported as depression [11, 70] and ptsd . A qualitative study, reporting on a british focus groups of survivors of partner abuse, highlights the dangers of living with a perpetrator of violence and the impacts that this had on their sleep habits . The women stated that being asleep while the perpetrator was awake was seen as extremely risky . For some male perpetrators, their female partner being asleep was sufficient reason for violence, and for others enforcing sleep deprivation was another method of control . Living with a constant anticipation of violence meant that these women felt that they needed to remain vigilant at all times . This could continue long after separation from their violent partner, in some cases 5 or 6 years earlier . As well as disturbed and little sleep, women from the focus group reported problems of aching limbs or teeth grinding, which they related to sleeping tightly following the abuse . There were also recurrent bad dreams, including hearing or seeing their ex - partner . Most of the women reported that they had spent considerable periods of time with the quality and quantity of their sleep restricted, and they felt the impact on their health and wellbeing had been significant . The authors concede that it is difficult to make direct links between the women's lack of sleep and physical problems, but the women all felt that their lack of sleep had led to a range of physical health problems . Symptoms reported included being run down; aching all over; having migraines and/or headaches, raised blood pressure, chronic fatigue and digestive problems; being more susceptible to other illnesses, such as flu . Sleep deprivation was also reported to dramatically reduce the women's ability to cope with the violence they were experiencing . For the purpose of this review, a study was considered to report functional physical health if it reported on measures of physical functioning and role limitation from the medical outcomes study 36-item short form health survey (sf-36) [16, 19, 63, 64] or the shorter 12-item version (sf-12) [65, 66, 73] measures, the patient health questionnaire tool (phq-15) tool or studies that incorporated their own questions relating to physical health function, injury and illness disability, and difficulty walking or in performing daily activities [57, 60]. All of the above - mentioned scales are validated tools for measuring physical health . For all but two of the reviewed studies, women with a history of ipv had significantly lower levels of physical functioning than either nonabused women within the same study, or the female national norm value for health function scores . Two studies did not report an association between ipv and functional physical health . In the first, results from a us study by chen et al . Still showed this trend; however, the differences were not statistically significant . The second study, by helfrich et al . Reported that there were no significant differences between their study sample of women from a domestic violence shelter and national norm data on physical symptoms or the effects of those symptoms on function . Detailed data on the physical function of their sample of abused women was not provided in the reviewed article . Recovery of physical health function after leaving an abusive partner was the subject of one review study . In this norwegian study, when women were resurveyed 12 months after leaving an abusive partner, it was found that all the sf-36 quality of life domains relating to physical health of the abused women were still significantly lower than the norwegian female national population of the same age . This suggests that physical functioning levels of abused women are still significantly affected, even after 12 months away from their abusive partners . Self - perceived physical health status, as reported by participants, was included as a health indicator in eight of the reviewed studies . Self - perceived poor health status was significantly associated with intimate partner violence in seven of these studies [17, 26, 33, 38, 60, 66, 67]. As well as physical abuse, nonphysical forms of violence in the form of emotional [60, 67] and psychological [38, 66] abuse were also implicated with lowered levels of perceived physical health . The only study reporting no significant association between the presence of partner violence and lowered levels of reported physical health was chen et al ., as mentioned previously . A history of ipv has been frequently reported to be associated with a range of chronic health conditions . Of the studies included in this review, seventeen studies included consideration of what have been categorized as chronic conditions . These studies and chronic pain was reported as being significantly associated with a history of ipv in nine reviewed studies [8, 33, 34, 41, 47, 53, 56, 74, 75] and investigated, but reported as nonsignificant in four additional studies [19, 26, 60, 76]. . Reported that pain had one of the highest associations with ipv of all the studied physical symptoms . In a canadian study of wuest et al ., 35% of the surveyed women reported experiencing high levels of disabling pain even though they had been separated from abusive partners for an average of 20 months . This was significantly higher than the reported canadian national level of 18% of women reporting debilitating pain . On average, women from the study reported experiencing pain in more than three sites and the authors particularly noted the high prevalence of women (43.2%) reporting swollen and painful joints . Other studies have reported pain as an ongoing health problem for women with a history of ipv, experienced as chronic back ache [8, 56], neck pain, stomach cramps [41, 56], and chronic headache . The use of pain medication by women with a history of ipv has been reported by several studies [17, 53, 60]. With significantly higher rates of reported chronic pain amongst ipv survivors, it would be expected that the use of analgesics would also be significantly higher amongst these women . However, this was not the case observed in two of the three reviewed studies that dealt specifically with pain medication . . Found no association between ipv and the use of pain medication, but this study also reported no significant increase in the level of pain reported by the abused women in their japanese population - based sample that was part of the who multi - country study . This finding is contrary to the previously mentioned study of wuest et al . Which found significantly higher pain levels in their community based study sample . Wuest et al ., in an allied study on medication use, reported that even though this sample of abused women reported high levels of back pain, headaches, and swollen painful joints, they were less likely to be taking over - the - counter nonsteroidal anti - inflammatory drugs (nsaids) and analgesics, and no more likely to be taking opioids than canadian women in general, even though the incidence of chronic pain was significantly higher . Other chronic health problems that have been associated with the experience of partner violence include cardiovascular and/or circulatory problems (including heart attack, heart disease, hypertension, thrombosis, and stroke) [8, 43, 67, 74, 77]; fatigue, allergies and hearing and sight problems; respiratory problems (including asthma, emphysema, and bronchitis) [42, 74, 77]; bone and muscle conditions (including osteoporosis, arthritis, and other joint problems) [53, 56, 74, 75]; diabetes [67, 74, 77]; low iron [74, 78]; malnutrition and low weight and gastrointestinal conditions [26, 56, 74]. Somatoform disorders and psychosomatic complaints were reported in four studies [14, 33, 40, 41]. Scheffer lingren and renck report that the women interviewed in their swedish study suffered various physical symptoms as a result of psychological abuse, including weight loss, weight gain, stomach pain, and pains in every bone of my body . Avdibegovi and sinanovi also reported a higher incidence of symptoms of somatization among women victims of all categories of ipv in bosnia and herzegovina . In a norwegian study, nerien and schei reported that psychosomatic complaints were more common among women reporting partner violence, with 28% of abused women reporting these complaints compared to 14% of nonabused women . The complaints reported included stomach pain, headache, dizziness, and muscular pain . Gynaecological symptoms were reported to be associated with a history of intimate partner violence by women in studies from both developing nations [57, 79] and developed countries [33, 56, 73, 74]. A study by stephenson et al . Found that gynaecological symptoms were significantly related to the reporting of sexual violence, the most common symptom being bleeding after sexual intercourse during times other than menstruation, followed by abnormal vaginal discharge, pain or burning during urination, and pain during intercourse . The incidence of abnormal pap smear results and higher rates of cervical cancer have also been positively associated with a history of ipv [46, 74], as has the occurrence of sexually transmissible infections (other than hiv / aids) [43, 46, 80]. Among the reviewed articles, three studies dealt specifically with the association of intimate partner abuse with hiv / aids [8082]. In the population - based rwandan study conducted by dude, it was found that women who experienced any type of ipv were more likely to report non - hiv stis, but women who had specifically experienced sexual and emotional abuse were more likely to test positive for hiv compared to nonabused women . Conducted a two - year study to follow the incidence of new cases of hiv infection among rural south african women . There were a statistically significant higher number of hiv cases reported by women with a history of partner violence (physical or sexual ipv) compared to nonabused women . This was the case both at baseline and also for the newly acquired cases of hiv observed throughout the study period . The hiv risk associated with being in a violent intimate relationship was investigated by josephs and abel in a community - based sample of african - american women . They reported that, in their study sample, there was a high correlation between the frequency of physical abuse and sexual coercion . They also showed that violence perpetrated against women by their intimate partners impacted negatively on the women's sexual decision - making and free choice, including the ability to negotiate condom use . The who multi - country study on women's health and domestic violence against women is a broad ranging study of the prevalence and health impact of ipv, commissioned by the who in 1997 . It involved the collection of data from over 24,000 women at fifteen sites in ten countries: bangladesh, brazil, ethiopia, japan, namibia, peru, samoa, serbia and montenegro, thailand, and the united republic of tanzania . Memory loss, problems with concentration, and dizziness were screened for in the world health organization questionnaires . Memory loss and problems with concentration were significantly associated with lifetime experiences of partner violence across all study sites in the who multi - country study as well as in japan and vietnam . Dizziness was also reported as a condition associated with ipv history across several individual studies [33, 56, 57] along with reported neurological complaints . This review has added to current literature by identifying those areas of health most consistently related to experiences of ipv across a wide range of samples, cultures, and ages . By systematically identifying relevant articles and synthesizing the results, it is possible to see that women who have lived with violent partners are more likely than other women to experience a range of psychological and physical symptoms and illnesses, particularly depression, ptsd, anxiety, suicidal ideation, self - harm, insomnia, pain, respiratory conditions, musculoskeletal conditions, cardiovascular disorders, diabetes, and gastrointestinal symptoms . In addition, generally speaking, the more severe and/or the more frequent the experience of ipv, the more severe the symptomatology appears to be, suggesting a dose - response relationship between ipv and depression, ptsd, anxiety, and suicidal ideation . The inclusion of papers from a range of settings has allowed a broad picture of health outcomes and ipv prevalence to be drawn . Clinical settings, by the nature of the participants, can be expected to report elevated rates of health problems, but the fact that extensive health problems were also consistently reported from a wide range of community and population - based studies attests to the generalisability of results . Studies conducted in health care settings also tended to report higher prevalence rates of ipv than population - based samples . However, many population - based studies had rates of ipv equivalent to or higher than any of the clinical samples, especially those reported from some developing countries within the who studies . The scope of papers included within the review could, thus, be seen to reflect a wide range of contexts for ipv, thus portraying a picture of ipv that expands beyond the possible biases of individual study contexts . Despite the differences in the ways that ipv and health issues were measured and the inclusion of papers that utilised population, shelter and clinical samples from a wide range of cultures, the consistency of findings gives credence to the position that ipv represents a major health and human rights issue . The findings from multi - country studies using standardized questionnaires, as in the two rounds of the who multi - country studies as well as standardized modules in the demographic and health surveys (dhs) by many national governments in asia, africa, and south america provide similar findings [4, 5]. In almost every country in the world, violence against women is considered a legal crime, yet women may be subject to ipv for many years . There are many reasons why women might remain in violent relationships, including fear, lack of access to legal recourse, lack of resources, cultural norms, and proscription among many others . This review supports the notion that ending violence might lead to increased health and wellbeing, at least for measured scales of vitality and physical function; however, even with this improvement, women with a history of abuse still reported health levels below the national average . However, health deficits related to ipv were also found to last for many years, particularly for psychological conditions such as anxiety, depression, ptsd, and sleep disorders . For other health issues, whilst there are methodological limitations in inferring causality from cross - sectional data, the literature on association of ipv and poor health now includes a range of methodological enquiries including longitudinal studies . The presence of a number of longitudinal studies within this review lends a broader perspective to the issue of ipv across the lifespan and helps strengthen confidence in the applicability of findings from cross - sectional studies . Longitudinal studies have indicated similar trends in health outcomes to those found in cross - sectional studies, and this concurrence in findings across methods is striking and provides considerable evidence to support the thesis that a history of ipv precedes poor mental health outcomes that may persist even after the violence has ended . In the current review, eight studies were longitudinal and these allowed for temporal pathways to be shown between ipv and somatic symptoms, poor sleep patterns, hiv infection, and aspects of mental health including depression, anxiety, and ptsd . Less is known about other conditions and this demonstrates a serious gap in the literature . Similarly, results for poor physical health outcomes were consistent across methods . In almost all of the available studies, women's functional health status was poorer and chronic health problems more prevalent compared with other women . These findings point to chronic physical disease mediated through high levels of stress, reduced practice of healthy behaviours, and limited agency in deciding on lifestyle choices . The reported findings from the included qualitative research adds a richness and a personal perspective to the understanding of the experiences of women who have had to live with intimate partner violence . Firstly, there is a known bias towards publication of papers that show significant results rather than those that support the null hypothesis . The current review relied upon published papers, so the degree of contrary evidence, where perhaps results did not show associations between ipv and health is not known . However, the consistency within studies that measured more than one facet of health and the consistency in findings between studies offers strong evidence supporting associations between ipv and poorer health . Causal implications cannot be made from any of the studies examined, although some temporal associations have been found . Again, the review offers a weight of evidence that points to a large population of women who are experiencing poorer health associated with and consequential to ipv . This review utilized three large electronic databases to search for relevant articles for inclusion; however, it is acknowledged that other relevant papers, particularly grey literature, may have been missed in this search process . The limiting of the review to english - language - based articles may also have excluded some pertinent papers, especially publications from developing countries which may be more likely to be published in local languages and languages other than english, this is recognized as a limitation to the review process . The findings of studies included in the present review show that women with a history of ipv experience significantly poorer health including depression, anxiety, ptsd, and reduced measures in both functional and somatic physical health domains . The review also highlighted the need for more methodological clarity in future studies on a number of issues . These include availability of more data on the long - term mental and physical health consequences following ipv through longitudinal studies using standardised definitions and validated scales . There is also a need to better understand the long - term implications of (a) different forms of ipv, (b) the cumulative impact of experiencing multiple types of ipv, and (c) cumulative intensity / severity of ipv . The availability of high - quality cross - cultural qualitative research studies on women's subjective experiences is also of value to allow better triangulation of the data on ipv and adverse health impacts . Future studies also need to focus on the pathways to recovery from abusive experiences and how health services, particularly primary care clinicians, can play a role in this rehabilitative journey . Despite these gaps in current knowledge, it is clear that ipv has serious and long lasting detrimental consequences for women's health and wellbeing . The accumulated findings of the papers within this review underscore the classification of ipv as a public health problem as well as a legal and social issue.
Many rnas function as folded, structured molecules rather than as protein - encoding messengers . In fact, highly conserved, structured non - coding rnas (ncrnas) essential to basic cellular processes represent the majority of a cell's rna . Such ncrnas are responsible for translation, pre - mrna splicing, histone mrna maturation, guiding rna modifications, and other essential cellular processes . Recent genome - wide transcriptome analyses in multiple organisms indicate that many regions of the genome are transcribed into ncrnas, leading to discoveries of low - abundance, functional rnas that were previously missed . Several new classes have emerged in the last decade, such as micrornas, large intergenic non - coding rnas (lincrnas), and promoter- or termini - associated short rnas . The functions of most of these ncrnas remain undiscovered . Because many abundant ncrnas function as folded structures, it is likely that some of these less abundant ncrnas also fold to perform their cognate functions . Determination of rna structure is largely performed by biochemical experiments that probe one rna sequence in solution . Chemical agents or nucleases that react with rna bases depending on their structural context can help distinguish between bases that participate in base pairing and other stabilizing interactions versus bases that do not . Recent advances in probing by selective 2-hydroxyl acylation analyzed by primer extension (shape) enable faster, higher - quality probing, but still focus on just one rna sequence per experiment . In contrast, computational structure prediction methods allow rapid, large - scale analyses of many rna sequences . In addition to methods rooted in comparative sequence analysis, which require several rna sequences with a conserved structure, there exist methods that predict structure from a single sequence and are useful for rnas for which structural homologs are not known or that undergo lineage - specific structure changes and thus lack structure conservation . Such methods provide theoretical folds for a rna sequence, usually using thermodynamic models . While generally powerful, they often suffer from ambiguity since they can predict several different structures for a sequence, necessitating biochemical data to choose amongst candidate folds . To draw on both the speed of computational methods and the quality of rna probing experiments, we developed fragseq (fragmentation sequencing), a method that uses a nuclease specific for single stranded rna on a complex rna mixture followed by high - throughput sequencing and bioinformatic analysis to deduce cut sites (phosphate backbone scissions). This analysis provides an rna accessibility profile, akin to dnase hypersensitivity assays on chromatin . We apply fragseq to naked rnas from the mouse nuclear transcriptome and deduce structure data for known and novel ncrnas . We chose nuclear rna from undifferentiated mouse embryonic stem cells (undiff) or cells differentiated into neural precursors (d5np) to assess whether our method gave reproducible results for rnas present in both samples . The nucleus contains many rnas in the 70 - 300 nucleotide range; nuclease treatment yielded fragments in the 20 - 100 nucleotide range required for the high - throughput sequencing protocol used (fig . To specifically clone rna fragments derived from nuclease cuts and not those derived from random hydrolysis, we used endonuclease p1 (ec 3.1.30.1), which has preference for single - stranded dna and rna and yields 5 monophosphate and 3 oh products . In our buffer conditions, p1 specifically cut single - stranded regions of well - characterized rnas (u1a snrna and 5s rrna). Importantly, we tested whether addition of mouse total nuclear rna to u1a or 5s rrna in vitro transcripts would influence the pattern of digestion, implying trans interactions . When performing the reactions at dilute rna concentrations, both rnas had an identical pattern of digestion whether probed in homogenous or complex mixture (supplementary fig . 1). We either gel - isolated intact nuclear rnas of 20 - 100 nucleotides directly or first performed a limited p1 nuclease digestion before gel isolation . The control treatment without nuclease digestion allowed us to estimate the occurrence of fragments with an endogenous 5 phosphate, as opposed to fragments with a 5 phosphate produced by nuclease cleavage . Additionally, we treated an equal mass of input 20 - 100 nucleotide rnas with polynucleotide kinase (pnk treatment) and atp, catalyzing 5 phosphorylation and 3 cyclic phosphate removal, which allowed us to examine endogenous breaks that do not leave a 5 phosphate and 3 oh . After gel isolation of these three parallel treatments, adapters were ligated directly to rna fragments in a manner requiring both a 5 phosphate and 3 oh on each rna, thus preserving orientation information for each fragment . After subsequent reverse transcription, the libraries were individually barcoded during pcr, pooled and sequenced using the abi solid3 platform, then mapped to the mouse genome using the abi small rna analysis pipeline (http://solidsoftwaretools.com). Sequencing summary statistics of the barcoded samples (supplementary table 1) 2) and the coverage of individual rnas in nuclease versus control treatment (supplementary fig . 3) are consistent with our experimental design and show that we obtained good coverage of ncrnas . Most known ncrnas longer than 100 bases have higher coverage in the nuclease sample than in the control because their native form is too long to sequence and does not contain an endogenous 5 phosphate; whereas a single nuclease cleavage creates the 5 phosphate required for cloning and brings the rna into sequencing size range (supplementary fig . The exceptions are short c / d box snornas, which tend to have native 5 phosphates and fall within our sequencing size range; indeed, they occupy a greater fraction of read mappings in the control sample than in the nuclease or pnk samples, indicating we are correctly enriching for 5 phosphate products . 1b) takes genome - mapped reads from the nuclease and control treatments, as well as a set of transcript coordinates, and outputs cutting scores for each site within each transcript . A site is the phosphate backbone between two adjacent bases where scissions can occur; a cutting score is a value (greater than zero) that reflects the preference of the nuclease for catalyzing scissions at that site relative to other sites in the same rna . Briefly, the cutting score is the log ratio of probabilities of observing a break in the nuclease treatment versus the control treatment, after correcting for abundance differences and missing / low - valued data (see supplementary note 1 for the exact algorithm definition and supplementary note 2 for design rationale). Because p1 cuts 3 of an unpaired base, a high cutting score at a site indicates that the upstream base is unlikely to be involved in base pairing or tertiary interactions . These cutting scores form the basis of our subsequent analysis (see also supplementary discussion). We show the flow of data through the algorithm, from genome - mapped reads to cutting scores, for the example rna u1a (fig . For each site along the transcript, we counted how many reads begin there, and how many trim reads (defined in supplementary notes 1 and 2) end there, summing them to get counts of observed breaks in each sample (fig . 4). We corrected these counts for missing data and normalized to get probabilities of observing breaks at each site in each rna in each sample (fig . 2d), which are used to compute cutting scores for each site (fig . High cutting scores tend to occur only in regions of single - stranded rna (figs . 2e) with pearson correlation coefficients of 0.889, 0.813, and 0.817 for u1a, c / d box snorna u3b, and spliceosomal snrna u5, respectively (supplementary fig . 5). This indicates that our method obtains similar structure data in biological samples with different transcriptional profiles . Fragseq cutting scores are in good agreement with known secondary structures of u1a (fig . 3), as well as several other ncrnas whose secondary structures have been examined (fig . Our method is particularly good at locating stem - loops and hinge regions, producing consecutive high cutting scores in those areas . This is expected, as p1 has been shown to prefer a minimum of 3 consecutive ssdna bases to catalyze scission, but operates most optimally on runs of 4 - 6 bases of ssdna, and likely has the same preference for ssrna . We occasionally observe weak cutting scores in regions believed to be dsrna, but this signal is generally not above the spurious level of other probing agents observed in conventional probing experiments . We examined whether the extent of p1 cutting as inferred by our assay correlates with susceptibility to ssrna probing chemicals and enzymes in previous studies, to show that fragseq can capture information about the susceptibility of a site uncovered by conventional methods, but in a high - throughput manner . We compared our cutting scores to probing performed on human u3 and human u5 which are sufficiently similar to the mouse homologues (u3b: 87% identity, u5: 95% identity). Like our study, these studies probed naked rna in solution after purification from cell lysate, so they contained endogenous base editing and modifications . For u3, we focused on the mouse u3b homolog, which has 3.3 to 5.4 times more reads than homolog u3a across our samples and treatments . We find that for both rnas, previously determined regions of high reactivity towards probes specific for unpaired bases (fig . 3a for u3b, 3c for u5) correlate with high fragseq cutting scores (fig . Stem - loops sl1 and sl2 and the hinge region in u3b and stem - loop sl1 in u5 have strong reactivity in all studies including ours . For large interior loops, moderate to strong reactivity in prior studies is also seen in our studies, except for il5 in u3b; however, it contains b and c boxes that may form base - pairs and non - canonical k - turn interactions that could prevent cleavage by p1 . It should also be mentioned that p1 is a far larger enzyme (45 - 50 kda) than other single stranded ribonucleases like rnase a and t1 (14 and 11 kda, respectively). This difference could account for reactivity at certain internal sites where steric clashes may play a role . We wanted to validate fragseq results on previously unprobed rnas using conventional techniques to ensure that our algorithm was not over - fit towards rnas with previously known structures . Unlike canonical c / d box snornas that guide 2-o - methylation in a rnp complex and are therefore thought to lack structure in the absence of protein partners, the long c / d box snornas u3 (fig . The boxes, guides, and other features of a canonical c / d box snorna generally do not comprise more than 80 bases, so it is unclear what structural role the remaining sequence performs in uncharacterized long snornas . We examined cutting scores for all c / d box snornas over 120 bases (fig . 4b), and selected u15b which has a predicted 2-o - methylation target, u22, required for processing of 18s rrna by an unknown mechanism, and u97, which has no predicted target, for follow - up probing with conventional methods . These examples also span a wide range of read coverage in our data, which allowed us to examine how well fragseq performs at different coverage levels . We carried out enzymatic probing of these rnas, transcribed in vitro, with rnases v1, which prefers stacked bases, and t1, a, and p1, which prefer ssrna (supplementary fig . 6). 8a) that regions that behave as ssrna on the fragseq assay also tend to behave as ssrna in our follow - up probing, indicating that moderate to high cutting scores are accurate evidence of ssrna (supplementary note 3). When compared to follow - up probing, u15b and u22 have more reliable cutting scores than u97, probably because the coverage for u97 is the lowest (see supplementary discussion). For example, we did not detect breaks at u15b bases 116 to 126 in any samples (data not shown), although they are highly reactive in follow - up probing . This is probably because cuts in that region would produce fragments that are outside of the 20 - 100 base size selection range . We constructed structure models for these three snornas using computational methods, phylogeny information, and data from our follow - up probing (fig . 5b, supplementary fig . 8b, supplementary note 3). Superimposing the cutting scores on these secondary structure models (fig 8c) shows that fragseq data agrees with models derived using conventional techniques because high cutting scores tend to occur in ssrna regions . We chose nuclear rna from undifferentiated mouse embryonic stem cells (undiff) or cells differentiated into neural precursors (d5np) to assess whether our method gave reproducible results for rnas present in both samples . The nucleus contains many rnas in the 70 - 300 nucleotide range; nuclease treatment yielded fragments in the 20 - 100 nucleotide range required for the high - throughput sequencing protocol used (fig . To specifically clone rna fragments derived from nuclease cuts and not those derived from random hydrolysis, we used endonuclease p1 (ec 3.1.30.1), which has preference for single - stranded dna and rna and yields 5 monophosphate and 3 oh products . In our buffer conditions, p1 specifically cut single - stranded regions of well - characterized rnas (u1a snrna and 5s rrna). Importantly, we tested whether addition of mouse total nuclear rna to u1a or 5s rrna in vitro transcripts would influence the pattern of digestion, implying trans interactions . When performing the reactions at dilute rna concentrations, both rnas had an identical pattern of digestion whether probed in homogenous or complex mixture (supplementary fig . 1). We either gel - isolated intact nuclear rnas of 20 - 100 nucleotides directly or first performed a limited p1 nuclease digestion before gel isolation . The control treatment without nuclease digestion allowed us to estimate the occurrence of fragments with an endogenous 5 phosphate, as opposed to fragments with a 5 phosphate produced by nuclease cleavage . Additionally, we treated an equal mass of input 20 - 100 nucleotide rnas with polynucleotide kinase (pnk treatment) and atp, catalyzing 5 phosphorylation and 3 cyclic phosphate removal, which allowed us to examine endogenous breaks that do not leave a 5 phosphate and 3 oh . After gel isolation of these three parallel treatments, adapters were ligated directly to rna fragments in a manner requiring both a 5 phosphate and 3 oh on each rna, thus preserving orientation information for each fragment . After subsequent reverse transcription, the libraries were individually barcoded during pcr, pooled and sequenced using the abi solid3 platform, then mapped to the mouse genome using the abi small rna analysis pipeline (http://solidsoftwaretools.com). Sequencing summary statistics of the barcoded samples (supplementary table 1) 2) and the coverage of individual rnas in nuclease versus control treatment (supplementary fig . 3) are consistent with our experimental design and show that we obtained good coverage of ncrnas . Most known ncrnas longer than 100 bases have higher coverage in the nuclease sample than in the control because their native form is too long to sequence and does not contain an endogenous 5 phosphate; whereas a single nuclease cleavage creates the 5 phosphate required for cloning and brings the rna into sequencing size range (supplementary fig . The exceptions are short c / d box snornas, which tend to have native 5 phosphates and fall within our sequencing size range; indeed, they occupy a greater fraction of read mappings in the control sample than in the nuclease or pnk samples, indicating we are correctly enriching for 5 phosphate products . 1b) takes genome - mapped reads from the nuclease and control treatments, as well as a set of transcript coordinates, and outputs cutting scores for each site within each transcript . A site is the phosphate backbone between two adjacent bases where scissions can occur; a cutting score is a value (greater than zero) that reflects the preference of the nuclease for catalyzing scissions at that site relative to other sites in the same rna . Briefly, the cutting score is the log ratio of probabilities of observing a break in the nuclease treatment versus the control treatment, after correcting for abundance differences and missing / low - valued data (see supplementary note 1 for the exact algorithm definition and supplementary note 2 for design rationale). Because p1 cuts 3 of an unpaired base, a high cutting score at a site indicates that the upstream base is unlikely to be involved in base pairing or tertiary interactions . These cutting scores form the basis of our subsequent analysis (see also supplementary discussion). We show the flow of data through the algorithm, from genome - mapped reads to cutting scores, for the example rna u1a (fig . For each site along the transcript, we counted how many reads begin there, and how many trim reads (defined in supplementary notes 1 and 2) end there, summing them to get counts of observed breaks in each sample (fig . 2c, supplementary fig . We corrected these counts for missing data and normalized to get probabilities of observing breaks at each site in each rna in each sample (fig . 2d), which are used to compute cutting scores for each site (fig . High cutting scores tend to occur only in regions of single - stranded rna (figs . 2e) with pearson correlation coefficients of 0.889, 0.813, and 0.817 for u1a, c / d box snorna u3b, and spliceosomal snrna u5, respectively (supplementary fig . 5). This indicates that our method obtains similar structure data in biological samples with different transcriptional profiles . Fragseq cutting scores are in good agreement with known secondary structures of u1a (fig . 3), as well as several other ncrnas whose secondary structures have been examined (fig . Our method is particularly good at locating stem - loops and hinge regions, producing consecutive high cutting scores in those areas . This is expected, as p1 has been shown to prefer a minimum of 3 consecutive ssdna bases to catalyze scission, but operates most optimally on runs of 4 - 6 bases of ssdna, and likely has the same preference for ssrna . We occasionally observe weak cutting scores in regions believed to be dsrna, but this signal is generally not above the spurious level of other probing agents observed in conventional probing experiments . We examined whether the extent of p1 cutting as inferred by our assay correlates with susceptibility to ssrna probing chemicals and enzymes in previous studies, to show that fragseq can capture information about the susceptibility of a site uncovered by conventional methods, but in a high - throughput manner . We compared our cutting scores to probing performed on human u3 and human u5 which are sufficiently similar to the mouse homologues (u3b: 87% identity, u5: 95% identity). Like our study, these studies probed naked rna in solution after purification from cell lysate, so they contained endogenous base editing and modifications . For u3, we focused on the mouse u3b homolog, which has 3.3 to 5.4 times more reads than homolog u3a across our samples and treatments . We find that for both rnas, previously determined regions of high reactivity towards probes specific for unpaired bases (fig . 3a for u3b, 3c for u5) correlate with high fragseq cutting scores (fig . Stem - loops sl1 and sl2 and the hinge region in u3b and stem - loop sl1 in u5 have strong reactivity in all studies including ours . For large interior loops, moderate to strong reactivity in prior studies is also seen in our studies, except for il5 in u3b; however, it contains b and c boxes that may form base - pairs and non - canonical k - turn interactions that could prevent cleavage by p1 . It should also be mentioned that p1 is a far larger enzyme (45 - 50 kda) than other single stranded ribonucleases like rnase a and t1 (14 and 11 kda, respectively). This difference could account for reactivity at certain internal sites where steric clashes may play a role . We wanted to validate fragseq results on previously unprobed rnas using conventional techniques to ensure that our algorithm was not over - fit towards rnas with previously known structures . Unlike canonical c / d box snornas that guide 2-o - methylation in a rnp complex and are therefore thought to lack structure in the absence of protein partners, the long c / d box snornas u3 (fig . The boxes, guides, and other features of a canonical c / d box snorna generally do not comprise more than 80 bases, so it is unclear what structural role the remaining sequence performs in uncharacterized long snornas . We examined cutting scores for all c / d box snornas over 120 bases (fig . 4b), and selected u15b which has a predicted 2-o - methylation target, u22, required for processing of 18s rrna by an unknown mechanism, and u97, which has no predicted target, for follow - up probing with conventional methods . These examples also span a wide range of read coverage in our data, which allowed us to examine how well fragseq performs at different coverage levels . We carried out enzymatic probing of these rnas, transcribed in vitro, with rnases v1, which prefers stacked bases, and t1, a, and p1, which prefer ssrna (supplementary fig . 6). 8a) that regions that behave as ssrna on the fragseq assay also tend to behave as ssrna in our follow - up probing, indicating that moderate to high cutting scores are accurate evidence of ssrna (supplementary note 3). When compared to follow - up probing, u15b and u22 have more reliable cutting scores than u97, probably because the coverage for u97 is the lowest (see supplementary discussion). For example, we did not detect breaks at u15b bases 116 to 126 in any samples (data not shown), although they are highly reactive in follow - up probing . This is probably because cuts in that region would produce fragments that are outside of the 20 - 100 base size selection range . We constructed structure models for these three snornas using computational methods, phylogeny information, and data from our follow - up probing (fig . 5b, supplementary fig . 8b, supplementary note 3). Superimposing the cutting scores on these secondary structure models (fig 8c) shows that fragseq data agrees with models derived using conventional techniques because high cutting scores tend to occur in ssrna regions . Due to read length limitations, most rna - seq studies turn to random hydrolysis of the sample before sequencing . Instead, we fragmented rna in a structure - specific manner, reporting on nuclease susceptibility along each transcript . Fragseq will not generate the uniform coverage across a transcript needed for accurate abundance estimates or alternative splicing characterization . Instead, quantitative comparisons along each transcript, expressed as cutting scores, are made between enzyme - treated samples versus control samples, yielding information about rna structure . For analysis of a novel transcriptome, the fragseq preparation can be done in parallel with other preparations that quantify abundance, barcoding the samples for analysis in a single sequencing run . By using nuclease p1, we were able to specifically enrich for its products and avoid products of spontaneous or canonical rnase degradation . Using the parallel pnk treatment where these latter products were converted to clonable rnas showed how sequencing multiple treatments yields insights into naturally labile sites . In parallel with this manuscript, a similar technique for high - throughput rna structure probing was introduced . That study utilized nuclease s1, which has similar properties to p1, and rnase v1, which cleaves stacked bases . Their readout of structure is reported as a ratio of susceptibilities of each rna site to the two nucleases, whereas fragseq monitors one nuclease with respect to a control run without nuclease . We favor cutting scores that are log ratios of data from nuclease versus control treatments because they describe, for each site, its nuclease susceptibility relative to its natural degradation susceptibility in the cell or during the preparation . Cut counts per site in the nuclease - treated sample alone do not provide data as informative as cutting scores (compare fig . We provide configurable software to compute cutting scores from mapped sequencing reads, outputting them and intermediate analysis data in formats compatible with the ucsc genome browser (http://genome.ucsc.edu), allowing visualization of structure data in a genomic context . We also modified the well - established rnastructure software to allow input of fragseq data to guide computational structure prediction (supplementary discussion). We do not observe single - hit kinetics for which probing studies generally aim, as many ncrna reads do not contain the native 3 ends of the rna from which they originate (supplementary fig . 9). We also do not observe native 5 ends for those rnas, but that is due to the trimethylguanosine cap blocking adapter ligation . We have not determined whether multiple cuts by p1 in solution are indeed the general case, or whether our size selection step enriches for products of multiple hits . Perhaps calibrating p1 for single - hit kinetics on in vitro transcribed test rnas did not translate to single - hit kinetics in the nuclear transcriptome where many ncrnas are highly modified . In addition, the test rnas in our probing experiment were all intact at the beginning of digestion, whereas a portion of the ncrnas in the nuclear sample may be partially degraded . In any case, it is clear that reads produced by multiple cuts are providing reliable structure data . This is likely because p1 prefers to cut in stem - loops or hinge regions and these cuts are unlikely to cause the closing helix to denature under our salt conditions, so the original structure may not change before subsequent cuts . As hinge regions often connect domains that fold separately, cuts there would not lead to refolding of those independent domains . This may not be true for larger structured rnas with long - range tertiary interactions, but these rnas fall outside of the scope of our current method . Rather than comparing to conventional single - hit probing, it is more fitting to liken fragseq nuclease data to dnase hypersensitivity assays on chromatin in that it gives a global perspective of rna structure (e.g. Stem - loop positions) rather than fine details (e.g. Bulges in a helix). We envision several areas of rna biology where refinement of a fragseq protocol might prove fruitful . One topic of particular interest is riboswitches, rna molecules that change structure upon the binding of a metabolite ligand . Using parallel sequencing runs with and without the ligand of interest could yield a differential pattern of cutting scores along such rnas that would serve as a signature of a conformational change . Additionally, nuclease protection assays could be scaled up to whole transcriptomes by performing parallel nuclease digestions with and without an rna - binding protein pre - incubated with the whole - cell rna . Identifying differentially protected regions would hone in on the rna binding protein's specificity for sequence or structural context . Likewise, such digestions could be carried out on whole cell or nuclear extracts with proteins still bound . Nuclease p1 would be a good candidate for these digestions since the buffer conditions for extracts are usually similar to the relatively physiological ph and salt concentrations used in this study . Nuclease p1 is also stable at high temperatures so we envision that fragseq could be another way to monitor thermal denaturation of rna domains . By parallel sequencing from nuclease reactions performed at different temperatures, the single - stranded character of a given transcript could be monitored and act as a proxy for unfolding . Though we focused on one enzyme here, our experimental pipeline and software could be easily adapted to other enzymatic or chemical probes, so long as a proper control is carried out in parallel . Fragseq, combined with methods developed in previous rna - seq studies, enables researchers to take high - throughput transcriptome analysis beyond one - dimensional sequence to reveal structural features of rnas and provide clues to their underlying biology.
The chromosome number in the donkey (equus asinus) is 2n= 62, but 2n= 64 in the horse (equus caballus). In fact, a certain level of bidirectional sex genome compatibility does exist: when a male donkey and a female horse mate, they produce a mule, and when a stallion mates with a female donkey, a hinny is produced . Both are usually sterile, but in some cases a certain level of genome compatibility is found and female mules get pregnant, although embryo loss is quite frequent . Among the different dna sequences making up a eukaryotic genome, highly repetitive dna sequences are considered good evolutionary markers, due to their capacity to change rapidly as compared to single gene sequences . These dnas are commonly associated with satellite dna fractions (sat - dna) and are usually localized in constitutive heterochromatin regions . Their ability to rapidly alter their base composition can produce rapid divergence in equivalent chromosome domains . This divergence can easily be observed, both within species and among closely related species . This is the case, for example, with alphoid dna sequences in humans and other primates . During the last few years, our research group has developed a method, whole comparative genomic hybridization (w - cgh), which allows the identification of chromosomal polymorphisms related to sat - dnas localized in constitutive heterochromatin . W - cgh acts by detecting polymorphisms on the basis of competition between two different genomic dnas in the experimental conditions of in situ hybridization, without subtraction of highly repetitive dna sequences . This technique has been used in several related species and/or individuals or populations belonging to the same species . These differences are easily assessed when the y chromosome in boar is targeted . On the contrary, this differentiation was not noticeable when different ram breeds were compared . Given the genetically - imposed lack of homologous recombination on y chromosomes, the rate of sequence evolution within these chromosomes is usually higher than that in autosomes . Furthermore, the y chromosome tends to be unusually rich in repetitive dnas, due to both transposable elements and tandem arrays of sat - dna sequences . The aim of this preliminary work was to characterize donkey and horse y chromosome highly repetitive dna sequences, to understand resemblances and differences between the two y chromosomes isolated approximately 2 my ago . Whole genomic dna was obtained from the peripheral blood of one stallion and one male donkey . The stallion was a pure spanish breed and the donkey a spanish breed (zamorano - leons) in danger of extinction . Peripheral blood lymphocytes were extracted and cultured for 72h in rpmi 1640 (gibco, invitrogen corporation, carlsbad, ca, usa). This medium was supplemented with 1.5% phytohaemagglutinin, 10% fetal calf serum and antibiotics . Chromosomes were obtained using cells arrested at metaphase with colcemid (10 mg / ml) for 90 minutes . Chromosome slides were prepared by exposing the cell suspension to 0.075 m kcl for 20 minutes and rapidly fixing it in fresh fixative (methanol - acetic 3:1). To obtain metaphase cells, fixed lymphocytes were spread onto clean slides and allowed to dry . For the w - cgh experiment, stallion and donkey dnas the final concentration of each dna sample was carefully measured using a dna - spectrophotometer (amersham - pharmacia biotech, piscataway, nj, usa). Two dna samples of equivalent concentration were labelled with biotin-14-dutp (h: horse) and digoxigenin-11-dutp (d: donkey), employing a commercial nick translation kit (roche diagnostics corporation, indianapolis, in, usa). After dna labelling, probe size fragments were tested to be in the range of 6002000 bp in a 1% agarose gel . Both dna probes were mixed at equal concentrations and the resulting mixed probe was precipitated with ethanol . After air drying, the probe was dissolved in hybridization buffer (50% formamide-2xssc/10% dextran sulphate-2xssc, vol / vol; ph 7) to a final concentration of 20 ng/l, denatured at 70c for 10 minutes and placed on ice for 5 minutes . For fish, metaphase slides were incubated in 2xssc at 37c for 60 minutes and dehydrated in 70%, 85% and 100% ethanol . After air drying, slides were denatured in 70% formamide/ 2xssc ph 7 at 70c for 2 minutes and dehydrated again . In this experimental approach, the dna probe was applied to the slides and hybridized at 37c in a moist chamber overnight . After hybridization, slides were washed in 50% formamide at 42c for 15 minutes and in 2xssc at 37c for 8 minutes . A non - specific antibody blocking solution [bsa 10% (wt / vol)/tween 20, 0.05% (vol / vol)/ 2xssc, ph 7] was applied for 5 minutes at 37c . Slides were then incubated for 25 minutes at 37c in the antibody solution, with a single layer of fitc - avidin and rhodamine anti - digoxigenin antibodies (appligene- oncor, illkirch, france), for simultaneous localization of the two probes in green (g) and red (r), respectively (stallion probe + donkey probe). Fish experiment samples were counterstained with dapi (4, 6-diamidino-2-phenylindole) (100 ng/l). Dapi counterstaining blocks yellow fluorescence produced by a similar contribution of both dna probes on the chromosome arms, but its use is advisable, as it enhances contrast with constitutive heterochromatin labelling . Slides were analyzed using a leica dmlb fluorescence microscope equipped with a charge - coupled device camera (leica dfc350 fx, leica microsystems) with three independent green, red and blue filters . Files were merged using using adobe - photoshop cs3 (adobe systems incorporated, usa). When w - cgh was carried out on stallion chromosomes using an equimolar genomic dna probe obtained from horse and donkey, all chromosomes showed varying quantities of green fluorescence in the constitutive heterochromatin of each autosome . This is the result expected, given that the chromosomal strip for dna probe landing was stallion chromosomes . In some autosomes, there was only a green signal (arrows in figure 1a), while in others the green signal co - localized with a red signal (contribution of expanded dna sequences in donkey; arrowhead in figure 1a). Interestingly, after w - cgh, the y chromosome split into three different chromosome domains (figure 1a). This region resembles the chromosome domain related to kinetochore activity, and for this reason was identified as the proper centromeric region (h - cr; figure 1b). H - cr is small as compared to the rest of the y chromosome and, in this case, showed only intense green fluorescence . Additionally, an interstitial, highly expanded and pericentromeric region (h - pr; figure 1b), showing red fluorescence, was present . Finally, a distal region (h - dr; figure 1b) which fluoresces in blue because of the counterstaining effect was observed . H - dr before dapi counterstaining showed yellow fluorescence due to the equivalent contribution of both dna probes . In the w - cgh environment, this is the normal staining response in chromosomal arms . In short, the y chromosome in this stallion is principally compartmentalized in three different chromosome domains, where h - cr is mainly constructed with specific dna families from the horse, while h - pr reveals a massive presence of highly - expanded donkey dna sequences which are also present in the stallion, although at lower intensity . This chromosome compartmentalization evident in the stallion chromosome is very similar to the gtg - banded y chromosome in donkey, as represented by raudsepp et al . Figure 1panel 1a shows metaphase chromosomes of stallion after hybridization with an equimolar genomic dna probe obtained using whole stallion (labelled in green) and donkey genomic dna (labelled in red). Note that all autosomes reveal fish signal corresponding to the stallion dna labelling colour (green, see standard arrows), while red (donkey) is present in some autosomes (arrowhead) and the y chromosome . A diagram showing the possible expansion and divergence among centromeric and pericentromeric dna subfamilies panel 1a shows metaphase chromosomes of stallion after hybridization with an equimolar genomic dna probe obtained using whole stallion (labelled in green) and donkey genomic dna note that all autosomes reveal fish signal corresponding to the stallion dna labelling colour (green, see standard arrows), while red (donkey) is present in some autosomes (arrowhead) and the y chromosome . A diagram showing the possible expansion and divergence among centromeric and pericentromeric dna subfamilies results obtained in the present preliminary study clearly show that the stallion and donkey still share some highly repetitive dna families, although the expansion level of specific sub - chromosomal domains varies and is characteristic for each species . This tendency is observed in most autosomes, but in the particular case of the stallion y - chromosome, some peculiar dna arrangements (h - pr) are conserved, while appearing to have greatly expanded during the evolution of the donkey y - chromosome (d - pr; figure 1b). An alternative explanation is that dna arrangements in h - pr, equivalent to those in d - pr, were partially lost during evolutionary processes regarding the y - chromosome . In both cases, the absence of legitimate recombination would facilitate this process of differential dna expansion or contraction . The results showing differential expansion of highly repetitive satellite dna families are congruent with the library hypothesis postulated by fry and salser, which suggested that major sat - dnas found in a group of extant species with any degree of phylogenetic relationship were already present in a common ancestor . These dna sequences formed a pool of sat - dna sequences at low copy number, as a primordial sat - dna library . This idea is depicted for the stallion and donkey y - chromosome in the diagram shown in figure 1b . In the case of the y chromosome in stallion and donkey (sub - chromosomal regions h - cr or d - cr), however, in the case of h - pr and d - pr, these species - specific sat - dna profiles can be obtained by a change in the copy number of sat - dnas, without major variation in their sequence or obvious quantitative change . Alternatively, as in the majority of cases, the same situation can occur as a consequence of simultaneous change in both parameters . For instance, w - cgh performed using two closely related grasshoppers, produces results on some autosomes similar to those reported here for the y chromosome . The results obtained in grasshoppers were identical irrespective of the species employed as the chromosomal strip for probe landing . This fact suggested that, in addition to heterochromatic compartmentalization on constitutive heterochromatin, variation in sat - dna family copy number, rather than sequence divergence, may account for the differential presence of dna families in the species compared . In addition to the genome macro - variations concerning chromosome number and morphology described for horse and donkey, it is interesting to stress that eight centromere repositioning episodes occurred when the karyotypes of zebra, horse and stallion were compared . This phenomenon presupposes the inactivation of old centromeric regions, accompanied by the rapid loss of centromeric satellite dna and by the dispersal of pericentromeric duplications over a relatively wide area of the chromosome . This scheme of genome re - patterning is congruent with our observations regarding sat - dna expansion and contraction in the y, as well as other autosomes and the w - cgh, and could probably be used as a quick test to study this phenomenon . Finally, the differences in sat - dna found in some autosomes must be taken into account in explaining the sterility observed when hybrids are produced . Horse - donkey hybrids (mules and hinnies) exhibit massive meiotic dysfunction at the primary spermatocyte stage, and a large part of this dysfunction is caused by the incompatibility of synaptonemal pairing between paternal and maternal chromosomes, resulting in the total arrest of spermatogenesis . This aspect is of interest, as it is known that differences in heterochromatin content in pericentromeric or distal chromosome regions, even within the same species, cause chiasma redistribution due to misleading chromosome pairing.
The concept of burnout syndrome (bs) was first described in 1970 as a reaction to interpersonal stressors at the workplace (1). Many professions are in constant uncertainty due to the global economic crisis, fear for their jobs, frustrations and pressures at work by business owners or supervisors, because of increased efficiency and, consequently, higher earnings . This consequently leads to an increase in the number of those exposed to bs, that is because of its frequency by the who declared as global epidemic . In short, the bs indicates the simultaneous presence of multiple stressors at work and long - term exposure to them, consequently, leads to burnout syndrome . Bs is often associated with the appearance of symptoms of anxiety and depression among workers . Today, the stress associated with the job is the most common trigger in which, work factors interact with the worker by hanging its psychological and physiological state and start the disease . Basically this occurs due to the mismatch between the demands of the working environment (owner of the company or superiors) and the real employee s possibilities . Those exposed to bs are in constant vicious circle: soul - stress - job - environment- body, permanent exposure which final result is the collapse of psychophysical strength and sinking into depression or occurrence of organic diseases (2 - 8). In summary, today s pace of life and work of employees as at the production line, exposure to stress and frustration in the workplace, disturbed interpersonal relationships, mobbing at work will eventually lead to physical - mental exhaustion of the organism, described as bs . Burn - out syndrome is particularly acute in the professions with high physical - mental strain, especially in doctors, nurses, educators, firefighters, pilots, police officers and a number of other professions that are exposed to everyday stress and frustrations (9). By definition (girdin, everly and dusek, 1996), burn - out syndrome is a state of mental and/or physical exhaustion caused by excessive and prolonged stress (10). These authors distinguish three levels of burnout: i level - the initial stage, the tension stressii level - reactive compensation to stress with the conservation of energyiii level level of burnout i level - the initial stage, the tension stress ii level - reactive compensation to stress with the conservation of energy iii level level of burnout in the initial stage, the tension stress causes the psychological and physiological reactions: constant irritability, anxiety, periods with high blood pressure, teeth grinding during sleep, insomnia, forgetfulness, heart palpitations, abnormal arrhythmia, concentration problems, digestive problems and acute gastrointestinal symptoms . In this stage a person does not perceive its work no longer as a pleasure . In most cases the first phase is not recognized, masked by a complex job requirement, threatened people and the environment and is not recognized as the beginning of the bs . However, with the occurrence of at least two of these symptoms, with great certainty we can say that this is the first stage of exposure to stress . In the second phase person saves energy to compensate for stress, coming late for work, delaying operations and is reluctant to accept new tasks, lengthening work breaks, have decreased sexual desire, feelings of fatigue and isolation from friends and family, with increased cynicism, bitterness, excessive smoking, drinking coffee, and often alcohol drinking, person is trying to solve problems by taking drugs and psychoactive substances, until the appearance of apathy . This phase is characterized by the need of the person to retreat, calm and conserve energy as much as possible . Environment observes changes in behavior and functioning and ignoring symptoms which leads to the third stage . The appearance of any two of the pervious symptoms indicating the existence of the burnout syndrome second stage . In the third stage of exhaustion majority of people can see that there is something wrong . Work is being seen as a load, appears chronic depression, decrease resistance to permanent morbidity, chronic stomach and intestinal disorders, chronic mental and physical fatigue, chronic headaches or migraines, the desire to escape from society and going from family, leaving friends and frequent suicidal afterthoughts . The emergence of any two of these symptoms is a certain sign of the third phase of bs (11,12). In addition to these studies, there are is number of other research in this area and numerous scales that in a practical way can help vulnerable working populations, in order to forestall the bs on time (13). Some of these scales are primarily components of the measurement of mental status, others have prevailing physical components in the scale . It seems that the combination of physical - mental component scale for scoring is closest to the exact definition of the of burnout syndrome degree (14 - 17). By definition, educator / teacher is the qualified person who carried out the educational program of the preschool children, independently creates the educational process in its education group (18). He / she timely plan the program and evaluate educational work in all stages of its execution . Teacher obtains, creates and maintains resources for work with children, taking care of the aesthetic and functional arrangement of space to perform different activities . It estimates does each child follows mental and physical development, creates individual development tasks and encourages the development of each child according to its abilities . Neatly keep all supporting documents for children and work and meet professional requirements in organizing and improving the educational process . Teacher works closely with parents, professionals and professional team, with the director of the kindergarten as well as other participants in the upbringing and education of preschool children in the local community . Teacher is responsible for the implementation of the program of work with children as well as for equipment and teaching aids used (19). Pre - school teachers working in kindergartens in jobs care, upbringing and education, social and health protection and care of children from the first year of life, and to enrolling in primary school . In addition to a regular program of education and other care for preschool children in kindergartens and special exercise programs for children with special needs, for gifted children and children of ethnic and national communities and minorities, as well as special programs of learning foreign languages and other programs artistic, cultural, religious and sports facilities . The specific programs also include the so - called pre - school programs . In this respect, children are usually divided into nursery population (by the end of the third year of life) and kindergarten population (from three years to pre - primary school), within which still differ younger and older groups . In accordance with the development opportunities specific groups of children, educators perform the following tasks: train children for self - fulfillment of basic needs in terms of dressing, using eating utensils, personal hygiene and similar habits; organize and conduct with the children proper physical exercise (sports and playgrounds) in order to develop their functional physical ability and health condition; organize receptive and creative games that develop certain cognitive skills and in which is especially pronounced for children creativity; organize activities in which children are exposed to certain aesthetic experiences, for example, art workshops, theater games, music activities, etc . ; take children to get to know the environment, with special emphasis on the development of environmental awareness and the development of environmental practices; organize and encourage social activities and games in which children develop their own identity and also develop as social beings; participate in shaping the overall material space in which children in kindergarten live, so that they can satisfy their individual needs in the physical, cognitive, creative, emotional and social development . With close cooperation with other experts in kindergarten (nurse, psychologist, pedagogue, doctor, etc . ), a very important segment of the pre - school teachers job is active cooperation with parents, while the parents participate in the selection and implementation of the educational work with children . This cooperation comes to the fore when preparing children over kindergarten age to go to school . In this regard, the cooperation with the primary school in which the children move from kindergarten would be very helpful to many children already in kindergarten meet their future teachers . Based on the annual plan and program of kindergarten, elaborated quarterly and micro - programs for smaller periods and keep diaries of work in which the allegations of planned incentives are recorded and realized activities at individual and group level . At the end of the educational period work in the institution of preschool education is a very complex, sensitive and responsible, requires maximum engagement with intensive physical and mental strain, and also the teachers are exposed more to infectious diseases, diseases of the musculoskeletal system and speech organs . Because every day psychological stress, frustration at work, fear for the children entrusted to them for safekeeping, with (not) rare misunderstandings with the environment, parents, sometimes with colleagues at work, bs is common among employees in preschool institutions (21 - 28). By definition, educator / teacher is the qualified person who carried out the educational program of the preschool children, independently creates the educational process in its education group (18). He / she timely plan the program and evaluate educational work in all stages of its execution . Teacher obtains, creates and maintains resources for work with children, taking care of the aesthetic and functional arrangement of space to perform different activities . It estimates does each child follows mental and physical development, creates individual development tasks and encourages the development of each child according to its abilities . Neatly keep all supporting documents for children and work and meet professional requirements in organizing and improving the educational process . Teacher works closely with parents, professionals and professional team, with the director of the kindergarten as well as other participants in the upbringing and education of preschool children in the local community . Teacher is responsible for the implementation of the program of work with children as well as for equipment and teaching aids used (19). Pre - school teachers working in kindergartens in jobs care, upbringing and education, social and health protection and care of children from the first year of life, and to enrolling in primary school . In addition to a regular program of education and other care for preschool children in kindergartens and special exercise programs for children with special needs, for gifted children and children of ethnic and national communities and minorities, as well as special programs of learning foreign languages and other programs artistic, cultural, religious and sports facilities . The specific programs also include the so - called pre - school programs . In this respect, children are usually divided into nursery population (by the end of the third year of life) and kindergarten population (from three years to pre - primary school), within which still differ younger and older groups . In accordance with the development opportunities specific groups of children, educators perform the following tasks: train children for self - fulfillment of basic needs in terms of dressing, using eating utensils, personal hygiene and similar habits; organize and conduct with the children proper physical exercise (sports and playgrounds) in order to develop their functional physical ability and health condition; organize receptive and creative games that develop certain cognitive skills and in which is especially pronounced for children creativity; organize activities in which children are exposed to certain aesthetic experiences, for example, art workshops, theater games, music activities, etc . ; take children to get to know the environment, with special emphasis on the development of environmental awareness and the development of environmental practices; organize and encourage social activities and games in which children develop their own identity and also develop as social beings; participate in shaping the overall material space in which children in kindergarten live, so that they can satisfy their individual needs in the physical, cognitive, creative, emotional and social development . With close cooperation with other experts in kindergarten (nurse, psychologist, pedagogue, doctor, etc . ), a very important segment of the pre - school teachers job is active cooperation with parents, while the parents participate in the selection and implementation of the educational work with children . This cooperation comes to the fore when preparing children over kindergarten age to go to school . In this regard, the cooperation with the primary school in which the children move from kindergarten would be very helpful to many children already in kindergarten meet their future teachers . Based on the annual plan and program of kindergarten, elaborated quarterly and micro - programs for smaller periods and keep diaries of work in which the allegations of planned incentives are recorded and realized activities at individual and group level . At the end of the educational period work in the institution of preschool education is a very complex, sensitive and responsible, requires maximum engagement with intensive physical and mental strain, and also the teachers are exposed more to infectious diseases, diseases of the musculoskeletal system and speech organs . Because every day psychological stress, frustration at work, fear for the children entrusted to them for safekeeping, with (not) rare misunderstandings with the environment, parents, sometimes with colleagues at work, bs is common among employees in preschool institutions (21 - 28). During the 2014 is carried out a survey of 100 educators from kindergarten radost, out of which 88, aged from 20 to 65 years, adequately filled out the survey . Also performed is the research of work experience and absenteeism among teachers, as well as indirect indicators of stress . In order to assess the level of stress was used modified scale by girdin, everly and dusek . Because of the daily obligations you have too little time for rest and entertainment?do you feel that you have enough support and help at work?do you lack time to effectively finish your work?do you have trouble sleeping because of the excess problem?many people simply expect too much from you?do you have a sense of devastation?do you notice that you are forgetful and undecided because you are overworked?do you feel that you are under a lot of pressure?do you feel that you have too many responsibilities?do you feel worn down at the end of the day?to study the level of burnout syndrome is used modified scale by freudenberger . Because of the daily obligations you have too little time for rest and entertainment? Do you feel that you have enough support and help at work? Do you feel worn down at the end of the day? To study the level of burnout syndrome is used modified scale by freudenberger . (insert number of next to the question) do you getting tired easily and you feel exhausted?youre upset when someone tells you that lately you do not look good?are you working more and more, and you feel that you have not done anything?is that why you are sarcastic and more disappointed with the world around you?do you feel sad and do not know why?do you forgetting, do not go to the agreed or visit often lose something?are you grumpy, explosive, you get tired of people that surround you?do you spend less time with friends and family?you have no time for common needs (phone, pc, letter etc. ).do you feel always ill or permanently sick?do you feel distracted at the end of the day?do you have difficulty in achieving a sense of happiness and satisfaction?are you able to laugh at or joke at your expense?are you burdened more with marriage and have more problems than usual?do you feel that you have very little to say to people? Are you working more and more, and you feel that you have not done anything? Is that why you are sarcastic and more disappointed with the world around you? Do you feel sad and do not know why? Do you forgetting, do not go to the agreed or visit often lose something? Are you grumpy, explosive, you get tired of people that surround you? Do you spend less time with friends and family? You have no time for common needs (phone, pc, letter etc . ). Do you feel always ill or permanently sick? Do you feel distracted at the end of the day? Assessment of test results was performed as follows: girdin, everly and dusek, 1996, test evaluation: a) almost always - 4 points: a) often - 3 points: c) rarely - 2 points: d) almost never -1 pointthe total number of points from 25 - 40 points imply high levels of stress that can cause mental and physical exhaustion . 15 questions drawn up by freudenberg scale of burnout, where each answer is scored according to the strength of feeling in a scale from 1 to 5 points girdin, everly and dusek, 1996, test evaluation: a) almost always - 4 points: a) often - 3 points: c) rarely - 2 points: d) almost never -1 pointthe total number of points from 25 - 40 points imply high levels of stress that can cause mental and physical exhaustion . Evaluation: a) almost always - 4 points: a) often - 3 points: c) rarely - 2 points: d) almost never -1 point the total number of points from 25 - 40 points imply high levels of stress that can cause mental and physical exhaustion . 15 questions drawn up by freudenberg scale of burnout, where each answer is scored according to the strength of feeling in a scale from 1 to 5 points because of the daily obligations you have too little time for rest and entertainment?do you feel that you have enough support and help at work?do you lack time to effectively finish your work?do you have trouble sleeping because of the excess problem?many people simply expect too much from you?do you have a sense of devastation?do you notice that you are forgetful and undecided because you are overworked?do you feel that you are under a lot of pressure?do you feel that you have too many responsibilities?do you feel worn down at the end of the day?to study the level of burnout syndrome is used modified scale by freudenberger . Because of the daily obligations you have too little time for rest and entertainment? Do you feel that you have enough support and help at work? Do you feel worn down at the end of the day? To study the level of burnout syndrome is used modified scale by freudenberger . Assessment: scale: 1 to 5! (insert number of next to the question) do you getting tired easily and you feel exhausted?youre upset when someone tells you that lately you do not look good?are you working more and more, and you feel that you have not done anything?is that why you are sarcastic and more disappointed with the world around you?do you feel sad and do not know why?do you forgetting, do not go to the agreed or visit often lose something?are you grumpy, explosive, you get tired of people that surround you?do you spend less time with friends and family?you have no time for common needs (phone, pc, letter etc. ).do you feel always ill or permanently sick?do you feel distracted at the end of the day?do you have difficulty in achieving a sense of happiness and satisfaction?are you able to laugh at or joke at your expense?are you burdened more with marriage and have more problems than usual?do you feel that you have very little to say to people? Do you getting tired easily and you feel exhausted? You re upset when someone tells you that lately you do not look good? Are you working more and more, and you feel that you have not done anything? Is that why you are sarcastic and more disappointed with the world around you? Do you feel sad and do not know why? Do you forgetting, do not go to the agreed or visit often lose something? Are you grumpy, explosive, you get tired of people that surround you? Do you spend less time with friends and family? You have no time for common needs (phone, pc, letter etc . ). Do you feel always ill or permanently sick? Do you feel distracted at the end of the day? Assessment of test results was performed as follows: girdin, everly and dusek, 1996, test evaluation: a) almost always - 4 points: a) often - 3 points: c) rarely - 2 points: d) almost never -1 pointthe total number of points from 25 - 40 points imply high levels of stress that can cause mental and physical exhaustion . 15 questions drawn up by freudenberg scale of burnout, where each answer is scored according to the strength of feeling in a scale from 1 to 5 points girdin, everly and dusek, 1996, test evaluation: a) almost always - 4 points: a) often - 3 points: c) rarely - 2 points: d) almost never -1 pointthe total number of points from 25 - 40 points imply high levels of stress that can cause mental and physical exhaustion . Evaluation: a) almost always - 4 points: a) often - 3 points: c) rarely - 2 points: d) almost never -1 point the total number of points from 25 - 40 points imply high levels of stress that can cause mental and physical exhaustion . 15 questions drawn up by freudenberg scale of burnout, where each answer is scored according to the strength of feeling in a scale from 1 to 5 points radost of which 88, aged from 20 to 65 years, duly filled out the survey . The one respondent at age of 20 years is joined to the category of 31 - 40 years in which there were 23 (26%) of respondents . In the category of 41 - 50 years in the category of 51 - 60 years was 39 (44%) and in the category of 61 - 65 years were 8 (9.1%) subjects, which in the further analysis, because of the small sample, will be joined to the group of 51 - 65 years . Also, in order to evaluate the health status are examined absenteeism educators: the table shows that older population is particularly vulnerable of which 58, or 50%, was on sick leave . It is expected regarding the age group educators, high morbidity and threat of burnout syndrome . In the women s team is usually more frequent sick leave an employee because of pregnancy, maternity and sick children . Also evaluated is the teacher s age: overview of age and work age of employees by type of work burn - out syndrome in teachers by girdin, everly and dusek arithmetic mean of the score is 25.115.0 (median: 25; min - max: 11 - 42). According to freudenberger scale mean of scores is 30.352.10 (median: 29; min - max: 15 - 60). By girdin, everly and dusek there is no statistically significant difference between the number of educators who feel good and those that are under significant level of stress (2=1.04; p=0.307). By freudenberg educators are classified into 3 categories and distribution of educators by the groups is almost uniform (2=2.76; p=0.250). This means that a third teacher in good condition, a third is in the area of risk of burn - out syndrome, while a third candidate for this syndrome . If we compare the educators in good condition compared to other (at risk and those who are candidates for the burn - out syndrome) we get that to 1.5 times those at risk and candidates for this syndrome than the healthy (2=4.5; p=0.033). Teacher job is extremely stressful, and according to the literature data, after doctors, firefighters, police officers, teachers are among the top people at risk of burnout syndrome (9,21 - 28). For this reason, we have also examined indirect indicators of bs, the rate of absenteeism (sick leave) and work experience . It is evident that teachers, because of the specifics of the job having the highest rate of sick leave, compared to other groups of workers in pre - school institutions, with a relatively lower length of service and younger age . Regarding the burnout syndrome, there are many scales which determine its intensity, especially the psychological characteristics (e.g. Maslach scale) or the intensity of stress (girdin, everly and dusek), and final measurement of the level of burnout syndrome (scale according to freudenberg). In this case, in our study we used two scales by using data from the questionnaire, scale by girdin, everly and dusek and scale by freudenberg, which have their specific features . Both scales taken into account more components which by summing produce results which were scored on a scale . As for the results of our study, they are very similar to the results of other authors indicating that the teacher s job is extremely stressful, because many years of work in kindergartens, with constant exposure glitter, without preventing bs (periodic examinations of workers to specific, leading to burnout syndrome (9, 12 - 28). According to our study and the scale of girdin, everly and duseksman sum of scores is 25.115.0 (median: 25; min - max: 11 - 42), and by the freudenberg scale mean of the sum of scores is 30.352.10 (median: 29; min - max: 15 - 60). Thus, according to the results of the first scale, by girdin, everly and dusek there is no statistically significant difference between the number of teachers who feel good and those that are under significant levels of stress, in other words half of the educators has signs of burnout syndrome (2=1.04; p=0.307). According to freudenberger teachers are classified into 3 categories, and distribution of teachers by the groups is almost uniform (2=2.76; p=0.250). This means that a third of teacher is in good condition, a third under the risk of burn - out syndrome, while a third are the candidates for the syndrome . If we compare the educators in good condition compared to other (that are at risk and those who are candidates for the burn - out syndrome) we get that 1.5 times more risk and a candidate for burnout syndrome than in healthy (2=4.5; p=0.033). This confirms the hypothesis that the work nursery school teacher one of the most stressful because of the great responsibility and everyday frustrations at work . It also confirms that the communication patterns within the internal public, within the kindergarten, hampered mainly because almost half (on a scale girdin, everly and dusek and scale by freudenberger) teachers are predisposed to burnout syndrome . According to this study, the appearance of signs of burnout syndrome is very high for the group of educators in pre - school and is located in approximately half of the educators . For this purpose, it is necessary to organize regular medical check - ups with particular reference to bs and signs of the syndrome to prevent its further development.
Its morphological features resemble undifferentiated neoplasm . Due to severe metastasis development and to the rapid fatal course radiotherapy and chemotherapy are also not very effective . It has been suggested that those standard therapies are ineffective because they are not able to efficiently target a subpopulation of atc cells, called the cancer - initiating cells or cancer stem cells (cscs). It has been proposed that cscs possess stem - cell - like features, are at the core of the development of many tumours, especially undifferentiated ones like atc, are responsible for the recurrence of the tumour and metastasis formation, and usually are very resistant to classical therapies . Despite many controversies regarding the cancer stem cell model, it has the potential to drive the discovery of innovative treatments that may eradicate the very chemoresistant core of cancer . In this connection, the csc model is the sum of many hypotheses that have arisen to explain the most vexing aspects of cancer: metastasis, relapse, and therapeutic resistance . In this perspective, csc research holds out promise for improved treatment outcomes, in particular, as regards overcoming resistance to chemotherapy on solid tumours . The most accepted csc model makes use of a new paradigm of cellular differentiation, in which cancer cells can dedifferentiate toward more primitive, stem - like phenotypes . The dedifferentiation seems to be highly heterogeneous, giving an explanation to the observed discontinuous behaviour of many cancers . Alternatively, cscs might arise from transformed stem cells in the stem niche [1, 2]. Similar to normal stem cells, cscs have the ability both to self - renew and to give rise to differentiated tumour cells, are responsible for the organization of a tumour mass, and are tumorigenic when transplanted into an animal host . Cscs have been identified in a wide range of human tumours . At the molecular level, cscs are usually enriched in cell surface markers such as cd44, cd24, and cd133, while wnt/-catenin, notch, and hedgehog signalling pathways seem to have key roles in csc properties . Specific microrna signatures have been identified in many cscs that seem to play a role in the epithelial - mesenchymal transition . Regarding atc, it has been hypothesized that the tumour initiates from transformed thyroid stem cells, rather than from differentiated thyrocytes undergoing a conventional multistep carcinogenesis model [57]. The rarity and rapid fatal nature of atc has led to limited ex vivo studies . Here we describe an in vitro study on a well - validated atc cell line: sw1736 . The sw1736 cell line is characterized by a high percentage of population with stem cell - like properties and high expression of several stem markers (sox2, oct4, nanog, c - myc, ssea4, and the abcg2 transporter). Interestingly, sox2 silencing downregulates in trans the expression of other stem cell markers and sensitizes atc cells to treatment with classical chemotherapeutics such as cisplatin and doxorubicin . This suggests that the stem cell factor sox2 could have a preeminent hierarchical role in determining the characteristics of stem cells in sw1736 atc cell line . Therefore, in order to further investigate the role of sox2 in atc, a bioinformatic analysis of the functional network of sox2 was performed . In detail, this kind of analysis is able to predict genes functionally correlated with the bait gene rather than physically associated with it [9, 10]. The cerna hypothesis is based on the rationale that rna molecules can regulate one another via micrornas [9, 10]. Cernas are rnas that share mirna recognition elements, thereby regulating each other by influencing the available level of mirna [9, 10]. In the past, cerna analysis made it possible to isolate several genes and functional networks related to cancer development, ageing, and homeostasis [1119]. Mirwalk is a comprehensive database that provides information on mirna from humans, mice, and rats on their predicted as well as validated binding sites on their target genes . Using the mirwalk data and embedded tools, we collected the micrornas that have been reported in the literature to regulate the main transcript from the sox2 locus (table 1). This set of mirnas was inserted into the mirwalk analysis tool to collect any human mrna that has been reported to be regulated by them . Then the genes collected were organized in a hierarchical order for the number of validated microrna hits (table 2). The more micrornas are shared between the bait sox2 gene and the candidate genes, the higher the possibility that the candidate gene transcripts can act as sox2 cernas . Arbitrarily, the top 6 genes together with sox2 were analysed using the genemania tool that helps to predict the functions of a set of genes and to predict in which gene ontology (go) functions the set of genes might be involved (figure 1) (table 3). The sw1736, 8505c, c643, fro, bcpap, tpc-1, and wro cell lines were cultured in dulbecco's modified eagle's medium high glucose medium supplemented with 10% fetal bovine serum and 5% glutamine . Sirna transfection in sw1736 cells was performed using interferin transfection agent (polyplus - transfection, illkirch, france), according to the manufacturer's instructions . Briefly, the transfection agent and the sirna complex were added to the cells and incubated for 72 hours for rna extraction and analysis . Sox2 was silenced using stealth sirna sox2 hss144045 (invitrogen, milan, italy). Sicontrol stealth sirna negative control was used as a control (invitrogen, milan). The vector used was taken from addgen (http://www.addgene.org/) (plasmid 26817): pcdna3.3_sox2; and transformation into sw1736 cells was performed using xfect transfection agent (clontech laboratories, inc . A takara bio company) according to the manufacturer's instructions . The transfection agent and plasmid were added to the cells and incubated for 72 hours for rna extraction and analysis . The vector was synthesized in service by eurofins genomics (https://www.eurofinsgenomics.eu) using a pcdna 3.1 backbone and a chemically synthesized 3utr (as reported in http://mybioinfo.info/exon_display.php?tax_id=9606&gene_id=geneid: 6657) (table 4). Total rna was extracted from cells using the rneasy mini kit (qiagen, milan, italy), including a digestion step with dnase i. rna quantity and quality were assessed using the nanodrop 2000 (thermo scientific, wilmington, usa). The rna extracted was reverse - transcribed with random hexamers (applied biosystems, darmstadt, germany) and improm ii reverse transcriptase (promega italia, milan, italy), according to the manufacturer's protocol . The reactions were performed as follows: 5 at 94c, 30 cycles (30 at 94c, 30 at 55c, 30 at 72c), 5 at 72c, and stocked at 4c . The only exception was the amplification of the sox2 3utr, for which the following was done: 5 at 94c, 30 cycles (30 at 94c, 30 at 55c, 90 at 72c), 5 at 72c, and stocked at 4c . Expression was analyzed by real - time quantitative pcr (qrt - pcr) using quantitect sybr green pcr kit (qiagen, milan, italy). All reactions were performed using a rotor - gene q instrument (qiagen, milan, italy). A pool of rna from normal thyroid tissue specimens was used, as described in . A pool of rna from limbal stem cells specimens was used, as described in . Peripheral blood samples of a healthy volunteer were collected in tubes containing ethylenediaminetetraacetic acid (edta, 1 mg / ml) after 8 hours' fasting . Lymphocytes were isolated by lympholyte (cedarlane, burlington, ontario, canada), according to the manufacturer's instructions . We used the spss 13 software, windows edition, for all our statistical analyses . Correlations were determined using spearman's test (nonparametric equivalent for pearson's test). Previous data suggested that the stem cell factor sox2 possesses a preeminent hierarchical role in determining stemness characteristics in the sw1736 atc cell line . With the final aim of investigating the role of sox2 in atc, a bioinformatic cerna analysis [9, 10] of the functional network of sox2, we collected the micrornas that have been reported in the literature to regulate the main transcript from the sox2 locus (table 1). This set of mirnas was inserted into the mirwalk analysis tool to collect any human mrna that has been reported to be regulated by them . Then the collected genes were organized in a hierarchical order for the number of validated microrna hits (table 2). The more micrornas are shared between sox2 and the candidate genes, the stronger the putative competitive effect that is at the core of the cerna hypothesis . The top level sox2 interactors in this cerna analysis are dicer1, eif2c2, and rnasen, involved in mirna biogenesis and functions; the most studied antioncogene tp53, worthy of note because of its suggested role in stemness; the nuclear - coded mitochondrial cytochrome c oxidase subunit viiia cox8a; and ccnd1, the cyclin d coding gene . Amongst the lesser interactors reported in table 2, other genes might be worth studying in the future, especially for their involvement in oncogenesis (such as myc, bcl2, pten, kras, jun, and many others). This study aimed to analyse whether a relationship might exist between the 6 top level interactors (dicer1, eif2c2, rnasen, tp53, cox8a, and ccnd1) and sox2 in the atc cell line sw1736 . With this purpose in mind, the six interactors together with sox2 were analysed by genemania software to verify whether their putative network (figure 1) might be enriched in some go annotations . Unsurprisingly, the analysis revealed a statistically significant enrichment of mirna - mediated, posttranscriptional gene silencing activities (table 3). Then we tried to establish in the sw1736 atc cell line whether perturbations in the transcriptional state of sox2 might alter in trans the transcriptional state of the cernas identified . When we knocked down sox2 transcripts via specific sirna, all the cernas were coherently downregulated in trans in rt - pcr analyses, as expected . The effect of the downregulation varied from one cerna to another but was always statistically significant (figure 2(a)) (table 6). To further investigate whether the effect could be mediated by the impaired transcriptional factor activity of the protein coded by sox2, we evaluated whether the overexpression of the coding sequence of sox2 could have some in trans effects on cernas . The coding sequence lacks the 3 untranslated region (3utr) that mainly bears the regulation mediated by mirnas . Our data indicate that no such effect occurs (figure 2(b)) (table 7), so the trans effect highlighted in (figure 2(a)) is likely to be due to the endogenous mirna competition, as in our hypothesis, rather than a classical interaction mediated by the proteic transcriptional factor sox2 . Finally, we investigated whether the overexpression of sox2 3utr might have any effects in trans in the sw1736 atc cell line . The effects were very modest, if present at all, but in line with the modulation that occurs during the competing events [9, 10]. The most notable effect was the positive correlation, as expected, with the expression of eif2c2 and sox2 itself (figure 2(c)) (table 8). The experiments previously described looked into the effects of perturbation of the expression of sox2 on the expression of cerna genes in an atc cell line . We then endeavoured to see whether any correlation might exist between the basal expression of sox2 and the cerna genes in different specimens . In detail, we analysed by rt - pcr the relative expression of sox2 and sox2 cernas compared to -actin expression in sw1736 atc cell line, in 8505c atc cell line, c643 atc cell line, fro atc cell line, bcpap papillary thyroid carcinoma (ptc) cell line, tpc-1 ptc cell line, wro follicular thyroid carcinoma, and a pool of normal thyroid tissues present in the laboratory from previous experiments, a pool of limbal stem cells, and isolated lymphocytes from a male donor of 36 years old (see supplementary table 1 in supplementary material available online at http://dx.doi.org/10.1155/2014/439370). Interestingly, this analysis suggested a correlation in the basal expression of dicer1, rnasen, and eif2c2 (table 9), as can be expected of genes whose functions are strictly coregulated in the biogenesis and function of microrna, but surprisingly their basal expression seemed also to be somehow related to the basal expression of tp53 (table 9), suggesting interesting scenarios that will be discussed shortly . The cerna bioinformatics analysis pointed to a list of genes that could be functionally coregulated with the stem transcriptional factor sox2 by a crosstalk mediated by several mirnas . In our analysis, we used interactions reported in the literature instead of bioinformatically predicted ones as done in the past [1719]. This approach makes it possible to harvest more solid and reliable data, though it is easier to collect genes that have been previously analysed . Our experiments were pursued in an atc cell line that has previously been demonstrated to constitutively express sox2 that functionally possesses a preeminent hierarchical role on many other stem cell factors, suggesting a leading role in the maintenance of the stemness feature in this cell line . Atc represents a very good candidate for a cancer highly enriched in cscs, which probably are at the core of its unfavourable outcome [17]. For these reasons, it is both important to understand the regulatory network that underlies the functions of sox2 in atc, and at the same time an atc cell line is a very good candidate for studying the sox2 network . Looking at the cross - regulation between sox2 and the most probable cernas that we isolated, many if not all the cernas analysed seem to be responsive to alterations in the transcriptional state of sox2 transcripts, independently of the coded protein, suggesting a regulatory network strictly based on noncoding - rnas (ncrnas). The most striking evidence is the effect of sirna - mediated silencing on sox2, where all the cernas are accordingly downregulated (figure 1(a)) (table 6). By contrast, the overexpression of the sox2 cds alone seems to have almost no effect at all (figure 1(b)) (table 7). In contrast, the overexpression of the 3utr of the sox2 transcripts seems to have an upregulation effect in trans, even if not to a great degree (figure 1(c)) (table 8). The 3utr of transcripts is the portion of messengers that is likely to bear the vast majority of regulation mediated by micrornas . The data reported here are consistent with our hypothesis, so it is reasonable to point to the cernas isolated as potential functional interactors with sox2, at least in the sw1736 atc cell line . The interactors isolated pointed to a central role of microrna biogenesis and functions in sox2 activities (table 3) and hence in stemness, as other authors have recently suggested . Here we report that probably the transcription of sox2 stem factors and of dicer (dicer1), ago2 (eif2c2), and drosha (rnasen) is coregulated by a microrna network . In detail, drosha is a rna - specific endoribonuclease that is involved in the initial nuclear step of microrna biogenesis . Dicer is a cytoplasmic endoribonuclease that plays a central role in the production of short interfering rnas (sirna) and mature micrornas . Sirnas and micrornas serve as a guide to directing the rna - induced silencing complex (risc) to complementary rnas to degrade them or prevent their translation . Overall, the mirna pathway is a means to specifically regulate the expression of target genes that seem to directly and indirectly affect tumorigenesis . The sox2 cerna tp53 gene codes for p53, one of the most studied genes in relation to cancer development . Nevertheless, even a mutated form, if transcribed, can still exert its regulatory functions via its transcript (e.g., its 3utr). In this perspective, homozygous deletion of the locus or full silencing of the gene perturbs the network differently from a null mutation, which still permits transcription from the locus . In the authors' opinion it is interesting to note that some authors have suggested a role of p53 in homoeostasis of the stem niche and in microrna biogenesis, setting it at a crossroads between cancer, stemness, and microrna biogenesis and functions . Our data are in support of this interpretation, all the more so because the basal transcription of tp53 seems to be correlated with the basal transcription of dicer1, eif2c2, and rnasen in the specimens that we analysed, many of them from atc and other thyroid cell lines (table 9). The sox2 cerna ccnd1 codes for cyclin d1, the regulatory subunit that promotes g1/s cell - cycle progression and is involved in oncogenesis . It has been reported that cyclin d1 induces dicer expression in vitro and in vivo and vice versa and their expression significantly correlates each other (at least in some subtypes of human breast cancer). It has been suggested that cyclin d1 induction of dicer coordinates microrna biogenesis [28, 35]. Our data are in line with the previous results and add a new level of possible crosstalk between dicer1 and ccnd1, suggesting novel actors in the network previously isolated, such as sox2 or tp53 . It is likely that cross - regulation between cyclin d1 and dicer might occur in other cancers, especially in atc, which are enriched in sox2 producing cells, which we suggest is part of the network . The protein encoded by this gene is the terminal enzyme of the respiratory chain that leads to the production of the electrochemical gradient across the inner mitochondrial membrane . Recent discoveries suggest central roles of mitochondria in the maintenance of pluripotency, differentiation, reprogramming, and ageing . Our data suggest possible crosstalk between a crucial nuclear coded mitochondrial factor and cell fate determinants such as sox2 and tp53 . The sw1736 atc cell line was used to investigate functional sox2 interactors isolated by a novel bioinformatics analysis . Because sox2 seems to have a central role in the maintenance of stem features in the sw1736 atc cell line, the interactors are likely to play a role in stemness regulation . The analysis pointed to dicer1, eif2c2, rnasen, tp53, cox8a, and ccnd1 genes, suggesting that stemness, microrna biogenesis and functions, p53 regulatory network, cyclin d1, and cell cycle control, together with mitochondrial activity, might be coregulated as a whole in their functions . Our data and previous data from the literature indicate that those functions are strictly interlinked and that deregulation of them might lead to cancer transformation, especially in cancers such as atc that possess an undifferentiated nature suggestive of cancer stem cell enrichment.
The anterior vaginal repair was the most popular primary procedure for stress incontinence till the 1970s, but over the last 20 years the operation has been criticised for high recurrence rates . The pubo - vaginal sling procedure was first described by von giordano in 1907 using the gracilis muscle to encircle the urethra . By 1942, aldridge used rectus sheath strips and reported the technique in one woman, describing it as a salvage - type operation in women failing other treatments . As advised by guideline 35 of the royal college of obstetricians and gynaecologists, numerous other materials are now available for use in suburethral slings with autologous material associated with a greater continence rate and fewer complications than either cadaveric or synthetic materials . The authors state that, in general, with all of these materials, the overall risk of vaginal erosion ranges from 0 to 16%, urethral erosion from 0 to 5%, de novo detrusor overactivity from 3.7 to 66% and procedures requiring sling revision or removal from 1.8 to 35% . 10.8% have some voiding disorder post - op, and long - term self - catheterisation is reported in 2% of females . When compared to colposuspension procedures the college also highlights how the second international consultation on incontinence concluded that suburethral slings represented an effective procedure for genuine stress incontinence in the presence of previous failed surgery . The prolene (ethicon) tension - free vaginal tape (tvt), a relatively new anti - incontinence surgical technique, was first described by ulmsten in 1996 . It has since become one of the most frequently performed operations for sui and is the recommended surgical management according to nice (nice clinical guideline 40, 2006). New minimally invasive techniques are, however, accompanied by a new set of complications including intraoperative perforation of the bladder with the trocar occurring in 5.8% [4, 5]. Lack of familiarity with the cystoscope, not using 70 optics and insufficient distension of the bladder that might hide an injury due to folds of mucosa can cause an occult bladder perforation to be missed . Devices that utilize mesh / slings are also at risk of mesh / tape misplacement, migration and erosion into the bladder, urethra, or vagina . The contact of an intravesical foreign body with urine can often lead to encrustation and usually goes with recurrent or persistent urinary tract infection (uti). Present the third case in the literature of a urethral diverticulum after a tvt procedure . Other complications include peritoneal perforation, acute bowel injury, and denovo presentation for small bowel obstruction where laparotomy revealed a tvt tape violating the peritoneum causing the distal ileum to adhere to the pelvic sidewall . Optimal techniques for postcomplication mesh and suture removal have not yet been determined and therefore still remain an operative challenge . The literature regarding the management of iatrogenic foreign body in the bladder or urethra, and especially mesh erosion, is sparse . We further searched the literature for newly published techniques and suggest ways of tackling this problem . As mentioned, to date there is no consensus about the best approach for treating intravesical tape erosion . Management options of iatrogenic foreign bodies in the lower urinary tract include endoscopic or open techniques . The literature on the intravesical use of holmium laser excision of mesh / suture is again very limited . The holmium laser has established an important role in urology with renewed interest in the use of lasers for minimally invasive treatment of urological disease . The holmium - yag laser is a solid - state, pulsed laser that emits light at 2100 nm . This wavelength is strongly absorbed by water and thus laser energy is contained superficially to provide excellent tissue cutting and ablation properties . This provides not only sharp incisions but also simultaneous haemostasis [13, 15]. In general two main uses of laser in this context describe three case histories in which patients previously underwent either a tvt, burch colposuspension, or stamey vesicopexy . Patients presented with a range of symptoms such as haematuria, recurrent urinary tract infection (uti), frequency, urgeny, and incontinence . Upon investigation they were subsequently all found to have eroded nonabsorbable intravesical material . In their series a 365 um holmium laser fiber was inserted through the working channel of a flexible cystoscope and sutures / tape successfully excised using a laser output of 1.0 j per pulse at a rate of 10 hz . Concluded that holmium laser excision is a minimally invasive solution to the problem of undetected accidental perforation or erosion following anti - incontinence procedures . Hodroff et al . Describe three females presenting 1-, 2-, and 6 months post sparc (american medical systems, in ., minnetonka, minn, usa) slingplasty with similarly varied complaints . Cystoscopy (flexible cystoscopy and a variety of lens angles with rigid cystoscope) and holmium laser ablation of the intravesical sling was performed . Laser settings of 0.58 j at 520 hz were used to divide the mesh at the entrance and exit points . In all cases ablation was performed slightly deeper than the mucosa to allow the mucosa to grow over the puncture site . The authors state the obvious advantage of this technique being less invasive as well as preserving the potential for continued continence . Describe a 48-year - old female presenting four years after a tvt operation on which cystoscopy revealed encrustation and stone formation over a tvt entering the bladder at 4 o'clock, exiting at the 1 o'clock position . A 365 um laser fibre for holmium - yag laser through an operating cystoscope was used to fragment the encrustation and cut the exposed tape flush with the bladder wall . The authors conclude that endoscopic holmium laser for fragmentation of encrustation and excision of tape seems to be a safe, effective, and minimally invasive treatment . To our knowledge these are the only case series available in the literature using holmium laser as a method of excision after tvt complications . State that the open suprapubic approach with cystotomy is recommended for removal of tvt tape . State, based on the data presented, that their preference for managing mesh within the bladder is also via open cystorrhaphy . To enable complete removal the mesh out through the bladder wall or perform a small urethroplasty . In keeping with other reports of early success with endoscopic excision, frenkl et al . Have produced a treatment algorithm for management of iatrogenic foreign bodies in the bladder . They suggest that all patients with a history of recurrent utis after surgery for incontinence should undergo careful cystoscopy with a 70 angle lens for the bladder and 030 for the urethra . Those with a suture or <2 staples / screws identified in accessible positions should have an attempt at endoscopic removal . Should this fail or there are either multiple screws / staples or a mesh, then open cystorrhaphy is suggested as the better option . Use of a suprapubic laparoscopic port in conjunction with transurethral nephroscope has also been described but visibility of mesh located close to the bladder neck was suboptimal . Kielb and clemens described a technique which uses laparoscopic scissors via a suprapubic trocar and a cystoscope to visualise and grasp the tape . An intraperitoneal approach was used to enter the retropubic space and remove the sling in their case series of 5 patients . Dissection was completed with a harmonic scalpel blade as well as blunt dissection to identify the mesh sling retropubically . Have, in 2010, completed a single centre series that claims a complete four - port laparoscopic resection of the tvt . They describe a stepwise technique that initially opens the retropubic space to identify the two ends of the tape . Describe the role of a concomitant vaginal procedure in instances where the tape is not dislodged using laparoscopy alone . From a series of 38 female patients, the operative time for this ranged from 50 to 240 mins, average 110 mins . They conclude that the technique is safe and feasible but obviate the need for other incontinence procedures for these patients . Chang and sokol propose a novel minimally invasive technique using the suture passer of the carter - thomason closesure system for suprapubic assistance during cystoscopic removal of tvt from the bladder . This approach also avoids the need for an open incision or a larger accessory port placed through the bladder . Report the first series of five patients with intravesical tape erosion completely removed by standard video - assisted transurethral resection (tur) under regional anaesthesia . Any mesh encrustation was mobilised with endoscopic forceps and the entire penetrating portion removed by the resectoscope loop . Standard electric current, 120 w for cutting and 70 w for coagulation, was in place . Mesh and calcifications were extracted with grasping forceps through the cystoscope . In view of complete healing of the bladder mucosa apparent at followup, consider the transurethral approach a reliable and efficient treatment option for mesh removal from the bladder . Iatrogenic foreign bodies in the lower urinary tract can be an early or late complication of female pelvic surgery . Urologists and gynaecologists should exercise caution concerning cases with persisting symptoms resulting from lower urinary tract infection following tvt surgery . It is important for urologists who attempt to remove foreign bodies to be familiar with endoscopic and open techniques for removal, as well as with reconstructive urethroplasties . The endoscopic method can be considered a good alternative for the treatment of late diagnosed vesical transfixion due to synthetic tapes or urethral erosion . The holmium - yag laser being a multipurpose, multispecialty surgical laser has been shown to be safe and effective for use in the urinary tract . The holmium laser light, carried through small flexible quartz fibres, can also be used with a flexible cystoscope rendering it fast, effective and versatile . In light of the vast number of successful techniques employed for the intravesical removal of tvt, the use of newer endoscopic, minimally invasive techniques undoubtedly offers advantages in terms of post - op recovery and hospital stay, but the use of open techniques for challenging access or large mesh encrustation can certainly not be overlooked . Overall it is important to highlight the diversity of presenting symptoms and therefore have a low threshold for diagnostic cystoscopy in women who have undergone pelvic surgery.
Mitral valve disease with pulmonary arterial hypertension (pah) is characterized by a progressive increase in pulmonary vascular resistance leading to right ventricular (rv) failure and mortality . The goal of long - term therapy is to reduce pulmonary vasoconstriction, cause regression of vascular remodeling, and prevent thrombosis . Pulmonary vascular resistance can be lowered by enhancing cyclic adenosine monophosphate (camp) using -agonist or with the phosphodiesterase type iii inhibitor, milrinone . Vascular resistance can also be lowered with nitroso vasodilators (nitroglycerine (gtn), sodium nitroprusside, and inhaled nitric oxide). Although inhaled nitric oxide is extremely efficacious, its use is complicated by the requirement for an inhaled delivery system and rebound pulmonary hypertension upon its withdrawal . Oral sildenafil phosphodiesterase type 5 (pde5) inhibitor increases cyclic guanosine monophosphate (cgmp) levels and has been shown to be effective for primary pulmonary hypertension . It has been shown that sildenafil can be used to manage secondary pulmonary hypertension in perioperative period in patients undergoing cardiac surgeries . This prospective double - blind randomized control study was planned to evaluate the efficacy of oral sildenafil preoperatively in patients with severe pulmonary hypertension undergoing mitral valve replacement surgeries . The patients were enrolled for the study after approval from institutional ethics committee after obtaining written consent . A total of 40 patients who were scheduled for mitral valve replacement surgery with severe pah, rv systolic pressure (rvsp) 50mmhg, as measured by preoperative transthoracic echocardiography, were included in the study . The patients were randomly allocated to either sildenafil (in routine hospital supply) or placebo (multivitamin tablets similar in appearance to sildenafil were used in placebo group, as no other effective oral alternative is available to treat pah) using a computerized randomization table . Patients with associated cardiac disease (coronary artery occlusive disease, aortic valve disease, tricuspid regurgitation requiring tricuspid repair, and left ventricular systolic dysfunction ejection fraction <50%), previous cardiac operation, lung disease, liver disease, and renal disease were excluded . Patients in group s (sildenafil, in routine hospital supply) and group c (control group) were administered oral sildenafil 25 mg (penegra, zydus healthcare, india) three times a day in 24 h preoperative period and placebo in the same fashion, respectively . Nursing staff who were administering the drugs to the patients were blinded during the study . All the patients were administered tablet alprazolam 0.25 mg and tablet pantoprazole 40 mg the night before surgery . On the day of surgery after arrival to preparation room, patients received 4 - 5 l of oxygen with mask . Vital parameters were monitored with ecg (electrocardiogram), nibp (non - invasive blood pressure), and pulse oximeter . After infiltration of local anesthesia (2% lidocaine), a peripheral venous cannula (16 or 18 g) and 20 g arterial cannula in the radial artery of nondominant hand were inserted . Injection clonidine 1 g / kg and injection midazolam 0.03 mg / kg intravenously were administered 20 min before surgery as a premedication in all patients . Anesthesia was induced with injection midazolam (0.1 mg / kg), fentanyl (7 - 10 g / kg), and injection vecuronium (0.08 - 0.12 mg / kg) and maintained with intermittent bolus doses of fentanyl (2 g / kg) and vecuronium (0.04 mg / kg) with sevoflurane (1 - 2%). After induction of anesthesia, the lungs were ventilated with tidal volume of 8 ml / kg at a rate of 12 breaths / min in 50% oxygen - air mixture . After that, ventilatory parameters were adjusted to maintain pao2 between 150 - 250 mmhg, paco2 between 33 - 38 mmhg, and ph 7.35 - 7.45 . After induction of anesthesia and under all aseptic and antiseptic precautions, pulmonary artery catheter (pac) (edwards lifescience, irvine, ca, usa) was inserted in the right internal jugular vein to monitor pulmonary artery pressure, pulmonary capillary wedge pressure (pcwp) and cardiac indices (cis), svri (systemic vascular resistance index), and pvri (pulmonary vascular resistance index). Cpb (cardio pulmonary bypass) was performed with stockert pump (germany), using membrane oxygenator with standard institutional protocol . During weaning from cpb, gtn and dobutamine (5 - 10 g / kg / min) was administered in all patients after achieving body temperature greater than 36c and normalizing acid - base and electrolyte balance . After 10 min of weaning from cpb, inotropes were titrated according to map (mean arterial pressure) and spap (systolic pulmonary artery pressure). Hemodynamic variables were measured 20 min after insertion of pac under anesthesia (t1), 20 min after weaning from cpb (t2), 1, 2, and 6 h after transferring the patient to postoperative recovery period (t3, t4, t5). Heart rate (hr), map, systolic pulmonary arterial pressure (spap), mean pulmonary artery pressure (mpap), pcwp, cardiac index (ci), systolic vascular resistance index (svri), and pvri were measured at each interval . The statistical analysis was performed using statistical package for the social sciences (spss) version 20.0 . Hemodynamic variables were measured 20 min after insertion of pac under anesthesia (t1), 20 min after weaning from cpb (t2), 1, 2, and 6 h after transferring the patient to postoperative recovery period (t3, t4, t5). Heart rate (hr), map, systolic pulmonary arterial pressure (spap), mean pulmonary artery pressure (mpap), pcwp, cardiac index (ci), systolic vascular resistance index (svri), and pvri were measured at each interval . The statistical analysis was performed using statistical package for the social sciences (spss) version 20.0 . Hemodynamic variables were measured 20 min after insertion of pac under anesthesia (t1), 20 min after weaning from cpb (t2), 1, 2, and 6 h after transferring the patient to postoperative recovery period (t3, t4, t5). Heart rate (hr), map, systolic pulmonary arterial pressure (spap), mean pulmonary artery pressure (mpap), pcwp, cardiac index (ci), systolic vascular resistance index (svri), and pvri were measured at each interval . The statistical analysis was performed using statistical package for the social sciences (spss) version 20.0 . A total of 40 patients were included in the study, 20 patients in each group . Other parameters like preoperative rvsp, cpb time, and cross - clamp time were similar in both groups (p = 0.936, p = 0.932, p = 0.902, respectively) [table 1]. Characteristics of patients with mitral valve disease and pulmonary hypertension treated with sildenafil versus placebo hemodynamic parameters, i. e. hr, map, and pcwp were similar in both groups after induction, after weaning from cpb, and in the postoperative period [table 2]. Spap and mpap were significantly lower (p <0.0001) during t1-t5 times in sildenafil group as compared with the control group [table 2]. Hemodynamic parameters during mitral valve replacement surgery in sildenafil versus control groups on comparison of ci and svri there was no statistical significance between the two groups . Pvri was significantly lower in sildenafil group after induction, after weaning from cpb, and in the postoperative period [table 2]. During the period of weaning from cpb, the number of patients who required dobutamine infusion was lower in s group (p <0.01), whereas the number of patients requiring norepinephrine infusion was not significantly different between the two groups (p <0.23; table 3]. Postoperative parameters like ventilation time and postoperative icu (intensive care unit) stay time was significantly lower in sildenafil group (p = 0.011) as compared with control group [table 3]. During study, there was one mortality due to low output noted in control group on second postoperative day . Perioperative parameters during mitral valve replacement surgery in sildenafil and control group of patients (n=20) in this prospective double - blind randomized controlled study, oral sildenafil 25 mg three times over 24 h before surgery produced significant pulmonary vasodilatation without any significant systemic effects . Sildenafil has a favorable effect like lowering pulmonary vascular resistance after induction of anesthesia that extended into postoperative period . Spap, mpap, and pvri were significantly lower in sildenafil group (p <0.0001) as compared with controlled group during the intraoperative period as well as in postoperative period . Cardiac surgery in patients with valvular heart disease with severe pah is often complicated with rv failure with an adverse consequence on its prognosis . Right ventricle is susceptible to ischemic injury, as cpb exacerbates pah, this necessitates perioperative strategy to manage pah and rv dysfunction . The final messenger for vascular smooth muscle relaxation, cgmp, is metabolized by pde5 . Among the various phosphodiesterase, pde5 is the predominant type in the normal pulmonary vasculature that may be upregulated after cpb . The inhibition of pde5 is therefore a logical step to increase the bioavailability of cgmp and support endogenous vasodilation in patient with pah . Pde5 is selectively inhibited by sildenafil, vardenafil, and tadalafil and less selectively by zaprinast and dipyridamole . Oral sildenafil is widely used in treatment of patients with erectile dysfunction and shows an excellent cardiovascular safety profile . It is emerging as an effective and safe pulmonary vasodilator in primary pulmonary hypertension as well as secondary pulmonary hypertension . Pde5 is abundant in lung tissue; hence sildenafil selectively inhibits it and preferentially dilates pulmonary vascular beds . Oral sildenafil selectively reduced pulmonary hypertension without any adverse systemic effects . In the present study, 25 mg of oral sildenafil was administered three times a day for 24 h with the last dose administered 3 h prior to surgery ., demonstrated that the maximal hemodynamic effects of sildenafil on pulmonary circulation could be achieved with a dose as low as 25 mg . We used three doses over 24 h to reduce pulmonary hypertension and improve rv function prior to surgery . Sildenafil has a half - life of about 4 h; it is rapidly absorbed via the stomach and its plasma levels peaks within 30 - 120 min after ingestion . Considering these facts, the last dose of sildenafil was administered 3 h prior to surgery . In this study, spap, mpap, and pvri were significantly lower (p <0.0001) after induction of anesthesia, after weaning from cpb, and in immediate postoperative period in sildenafil group as compared with control group . But map, pcwp and ci, and svri were no significantly differing between two groups . During weaning from cpb, we started gtn infusion and dobutamine infusion in all patients . Inotropes, dobutamine infusion (5 - 10 g / kg / min) continued when map was lower than 60 mmhg and also norepinephrine infusion (0.05 - 0.1 g / kg / min) was added whenever required . In sildenafil group, six (30%) patients required dobutamine infusion, of these two (33.3%) patients required norepinephrine infusion . In the control group, ventilation time and postoperative recovery room times were significantly lower (p = 0.001) in sildenafil group as compared with control group . Preoperative oral sildenafil reduces pulmonary artery pressure in the perioperative period in patients with severe pulmonary hypertension secondary to mitral valve disease undergoing mitral valve replacement . Because of the predominant selective activity of sildenafil in management of pulmonary hypertension and improvement of rv function without compromising the systemic blood pressure, the use of this drug in cardiac surgical patients should be considered . Elaborate studies of oral sildenafil in secondary pah in larger populations will help validate the results of this study.
An 81-year - old diabetic male came to our hospital to seek medical attention for 2 weeks of productive cough, fever and chills, and a 10 kg weight loss . Physical examination revealed a fatigued - looking man with mild respiratory distress . Except for bilateral crackles in both lungs, more on the right side; the remainder of the physical examination was unremarkable, including the oral cavity . Complete blood count revealed mild anemia, however, the patient did not have leukopenia / neutropenia . A chest x - ray showed a right lung infiltrate; thus, community - acquired pneumonia (cap) was suspected and the patient was admitted for treatment of cap . The patient was started on intravenous gatifloxacin 400 mg daily . However, the patient's symptoms continued to deteriorate while on gatifloxacin . A chest computed tomography (ct) done on hospital day 3, showed a right upper lobe cavitary lesion (figure 1). Because of the cavitary lesion, pulmonary diseases more complicated than cap (such as lung cancer or vasculitis involving the lung) were suspected . The patient underwent a bronchoscopy on hospital day 4, which was reported as unremarkable . The bronchial washing cytology examination did not reveal malignant cells, but it showed scattered elongated bacilli (figure 2). Within 24 hours the bronchial washing culture grew the same gram - negative bacillus, methicillin - sensitive staphylococcus aureus, viridans streptococcus and group b streptococcus . The gram - negative bacillus was eventually identified as ls at the north dakota state laboratory (figure 3). Blood cultures were drawn - once before starting antibiotics and three more times during treatment; however, none of these cultures grew organisms . Because of the clinical unresponsiveness to gatifloxacin, on hospital day 6, the antibiotic was changed to intravenous vancomycin 1.5 g daily and piperacillin - tazobactam (pip - tazo) 3.375 g every 8 hours . Figure 1computed tomography - scan of the chest shows a cavitary lesion in the right upper lobe . Computed tomography - scan of the chest shows a cavitary lesion in the right upper lobe . Magnification 400. papanicolaou stain of the bronchial washing reveals the elongated bacilli (arrow). The pneumonia was suspected to be caused by one of the above gram positive cocci and the ls was considered an oral contaminant; therefore, after a 9-day course of vancomycin and pip - tazo, vancomycin was continued but pip - tazo was discontinued on hospital day 15 . On hospital day 19, after reconsidering ls a remotely possible pathogen of the pneumonia, we added oral amoxicillin 500 mg / clavulanate 125 mg every 8 hours to the vancomycin regimen . While on vancomycin and amoxicillin - clavulanate, the patient began to have spiked fever, rigors and increased dyspnea . On hospital day 23, a chest radiograph indicated worsening of the pneumonia . Pip - tazo was continued for 4 weeks, followed by 2 weeks of intravenous aqueous penicillin g 2 million units every 8 hours . The patient continued to do well and has had no recurrence of pneumonia to date . Ls is an anaerobic gram - negative bacillus that resides in the oral cavity and usually does not cause disease . Bacteremia, endocarditis, and hepatic abscess caused by leptotrichia buccalis have been reported in patients with neutropenia, hematologic malignancies and in bone marrow transplant recipients . Mucosal disruptions such as oral mucositis, esophageal ulcers, or diverticulitis are possible risk factors for infected patients . By gram stain alone, ls can be confused with other oral commensals, such as the elongated gram negative fusobacteria sp, capnocytophaga sp or even with the gram positive lactobacillus sp as ls can sometimes be gram - variable . The ls in this case report was identified by gram stain and phenotypic analysis, but not by gene sequencing because the north dakota state laboratory was not equipped to perform the test . One case is cavitary pneumonia with bacteremia caused by l. buccalis in an immunocompromised host . The other case is a severe pneumonia caused by ls in an apparently immunocompetent male patient . Our patient has type 2 diabetes mellitus, but he is not immunocompromised from other underlying diseases or from immunosuppressive agents; therefore, i believe this is the first case report of cavitary pneumonia caused by ls in an immunocompetent patient . Although the patient had good dental hygiene without dental caries, gingivitis, or oral mucosa lesions; the oral cavity could still be the portal of entry in this patient's pneumonia . Pneumonia caused by ls could be underreported because ls is usually considered a normal oral flora and is difficult to identify . Therefore; if ls grows from bronchoalveolar lavage or lung tissue, a clinician should consider it one of the etiologic agents causing pneumonia . Due to the rarity of human infection caused by ls, the duration of treatment for pneumonia caused by this bacterium is not clear . In our case, because the pneumonia recurred after we administered pip - tazo for only 9 days, we aggressively gave the patient 4 weeks of piptazo followed by 2 weeks of intravenous aqueous penicillin g. although there are no clinical and laboratory standards institute (clsi) breakpoints for ls, penicillins are considered the drugs of choice . Thus, the patient continued to be clinically stable while on either pip - tazo or penicillin g. we postulate that the pneumonia recurred while on amoxicillin - clavulanate was likely due to the oral agent at a subtherapeutic level in the lung tissue . Therefore, we do not advocate treating pneumonia caused by ls with an oral -lactam antibiotic.
Cluster headache (ch) is a primary headache syndrome that often does not respond satisfactorily to pharmacological treatment . Theories of ch pathophysiology posit activation of a positive feedback system involving a reflex arc with the trigeminal system as the afferent limb and parasympathetic nerves, mainly via the sphenopalatine ganglion (spg), as the efferent limb (1). In this reflex arc, the spg, localised in the sphenopalatine fossa, is the most available target for interventional treatment . Attempts to block the spg with topical agents in ch have a long history, the first by sluder in 1908 with a cocaine solution (2). Cocaine and short - acting local anaesthetics block na / k - channels with durations of one to eight hours . No one has convincingly shown that these intranasal topical applications actually reach and hence are able to block the spg, but several small, uncontrolled studies have explored the effect in ch mainly as acute treatment, and some indicate moderate but short - lasting effect (3). With a transnasal endoscopic technique first described by prasanna and murthy in 1993 (4), the pharmacological agents are injected directly into the sphenopalatine fossa to overcome the possible limitations of the topical administration methods described above . To further explore the potential of spg blocks, it is of importance to develop an accurate, easy and safe technique to target the spg, and preferentially with a long - lasting pharmacological agent . In the spg, pre - ganglionic parasympathetic fibres synapse with postganglionic fibres innervating intracranial vessels using acetylcholine (ach) as neurotransmitter . Onabotulinumtoxina (bta) causes a neural block by inhibiting ach release . In the autonomic system, based on studies on hyperhidrosis and frey s syndrome, the duration of such a block may last three to 12 months (5). The main object of this study was to investigate the safety of administering two different doses of bta towards the spg in 10 patients with intractable chronic ch with an open, uncontrolled design . Secondly, efficacy data were collected to provide an indication on whether future placebo - controlled studies should be performed . The study included a minimum two - week baseline period to register the attack frequency, and a 24-week follow - up . Ten patients with intractable chronic ch were recruited from the neurology department and by referrals from collaborating headache experts within norway . The term intractable has no standardised definition, but the term used in this study has been modified from a paper by silberstein et al . (6), failing at least two drugs and considered as moderate intractability . The exact limits of our definition are provided in the inclusion criteria . 2012/164) and the norwegian medicines agency (eudract nr: 2012 - 000248 - 91) and is registered at clinicaltrial.gov (nct02019017). The treatment was performed with a custom - made surgical navigation device under clinical testing (multiguide a safety study: ref . Inclusion criteria were age 18 to 65 years; chronic ch according to the international classification of headache disorders, third edition (ichd-3); and unsatisfactory effect, intolerable side effects or contraindications of at least two of the following medications: verapamil, lithium, gabapentin and corticosteroids . Exclusion criteria were change in dose of prophylactic treatment for ch four weeks prior to inclusion; use of antipsychotics four weeks prior to inclusion; known heart or lung disease; any disease that may complicate treatment or anaesthesia; psychiatric illness preventing full participation; pregnancy, nursing or inability to use contraceptives in fertile women; abuse of any pharmacological substance, narcotics or alcohol; hypersensitivity to short - acting anaesthetics, adrenalin or bta; and active treatment with pharmacological substances with possible interaction with the study medicament . Medical history, computed tomography (ct) and magnetic resonance imaging (mri) of the paranasal sinuses were obtained . Participants were instructed to keep headache diaries from 2 weeks before the treatment and through the study recording headache duration, intensity, autonomic symptoms, acute treatment and oxygen, days of sick leave, quality of life (headache impact test-6 (hit-6)) and adverse events (aes). Physician follow - up took place at weeks 4, 12 and 24 and weekly phone interviews were conducted by a study nurse for the first eight weeks, then every four weeks . A protocol violator was defined as a participant with less than 60% of diary days registered or change of medication, acute or prophylactic, during the study . Since there are no data available to determine the correct dosage of the proposed treatment, we decided to explore the safety of two different dosages, 25 iu and 50 iu bta (botox, allergan inc, irvine, ca, usa). Since bta is a substance with a low diffusion gradient (8), accurate administration is of paramount importance to reach the desired target . In addition, misplaced injections may cause aes . To perform the procedure, a custom - made injection device was developed, using a surgical navigation system to ensure accurate administration of the drug . A single treatment was performed under general anaesthesia using a transnasal approach aided by surgical navigation (brainlab vector vision and brainlab kick, version 1, brainlab ag, feldkirchen, germany). The first five patients received 25 iu bta, the last five received 50 iu . Pre - operative planning of ct and mri was performed with brainlab iplan 3.0 (brainlab ag, feldkirchen, germany). The spg on the symptomatic side was localised visually and marked on fused mri and ct scans . The nasal cavity was decongested with adrenalin nasal packing (0.5 ml adrenalin solution 0.1 mg / ml (takeda nycomed, drammen, norway) suspended in 4.5 ml isotonic saline) for 20 minutes . Aided by surgical navigation and a custom - made device (multiguide), 0.05 mg adrenalin in 5 ml isotonic saline was administered in the sphenopalatine fossa followed by 25 iu or 50 iu of bta towards the spg . Bta was suspended in 1 ml isotonic saline for the first three patients, and 0.5 ml for patients 410 . In patient number 7 the transnasal approach was impossible to perform because of a bony medial wall of the sphenopalatine fossa and a small sphenopalatine foramen; we therefore decided perioperatively to proceed with a percutaneous infrazygomatic (lateral) approach . Aes (primary outcome) were assessed through tabulation from the treatment procedure to the end of the study . Secondary outcomes were the mean change from baseline in frequency of ch attacks for weeks 3 and 4 (main efficacy outcome); ch intensity; duration of attacks; days with ch; presence of autonomic symptoms; attacks treated with triptans; doses of triptans; acceptability of treatment; and headache - related impact on quality of life measured by the hit-6 . For all efficacy outcomes, weeks 1 and 2 were not included in the analysis of month 1 (according to protocol) since it may take one to two weeks before the bta block is achieved . For efficacy outcomes we have performed two types of analyses: intention - to - treat (itt) analysis (n = 9) and per - protocol analysis (n = 7), both without imputing missing data . To better assess the therapeutic gain of the treatment, a responder analysis was performed for each month of the study period . A frequency responder (main efficacy outcome) was pre - defined as at least a 50% reduction of mean attack frequency between baseline and weeks 3 and 4 . Statistical software spss, version 21.0 (spss inc, chicago, il, usa) was used in the data analyses . Since the study is an exploratory safety study, no power calculation was performed prior to study start . For efficacy measures we used the study included a minimum two - week baseline period to register the attack frequency, and a 24-week follow - up . Ten patients with intractable chronic ch were recruited from the neurology department and by referrals from collaborating headache experts within norway . The term intractable has no standardised definition, but the term used in this study has been modified from a paper by silberstein et al . (6), failing at least two drugs and considered as moderate intractability . The exact limits of our definition are provided in the inclusion criteria . 2012/164) and the norwegian medicines agency (eudract nr: 2012 - 000248 - 91) and is registered at clinicaltrial.gov (nct02019017). The treatment was performed with a custom - made surgical navigation device under clinical testing (multiguide a safety study: ref . Inclusion criteria were age 18 to 65 years; chronic ch according to the international classification of headache disorders, third edition (ichd-3); and unsatisfactory effect, intolerable side effects or contraindications of at least two of the following medications: verapamil, lithium, gabapentin and corticosteroids . Exclusion criteria were change in dose of prophylactic treatment for ch four weeks prior to inclusion; use of antipsychotics four weeks prior to inclusion; known heart or lung disease; any disease that may complicate treatment or anaesthesia; psychiatric illness preventing full participation; pregnancy, nursing or inability to use contraceptives in fertile women; abuse of any pharmacological substance, narcotics or alcohol; hypersensitivity to short - acting anaesthetics, adrenalin or bta; and active treatment with pharmacological substances with possible interaction with the study medicament . Medical history, computed tomography (ct) and magnetic resonance imaging (mri) of the paranasal sinuses were obtained . Participants were instructed to keep headache diaries from 2 weeks before the treatment and through the study recording headache duration, intensity, autonomic symptoms, acute treatment and oxygen, days of sick leave, quality of life (headache impact test-6 (hit-6)) and adverse events (aes). Physician follow - up took place at weeks 4, 12 and 24 and weekly phone interviews were conducted by a study nurse for the first eight weeks, then every four weeks . A protocol violator was defined as a participant with less than 60% of diary days registered or change of medication, acute or prophylactic, during the study . Since there are no data available to determine the correct dosage of the proposed treatment, we decided to explore the safety of two different dosages, 25 iu and 50 iu bta (botox, allergan inc, irvine, ca, usa). Since bta is a substance with a low diffusion gradient (8), accurate administration is of paramount importance to reach the desired target . In addition, misplaced injections may cause aes . To perform the procedure, a custom - made injection device was developed, using a surgical navigation system to ensure accurate administration of the drug . A single treatment was performed under general anaesthesia using a transnasal approach aided by surgical navigation (brainlab vector vision and brainlab kick, version 1, brainlab ag, feldkirchen, germany). The first five patients received 25 iu bta, the last five received 50 iu . Pre - operative planning of ct and mri was performed with brainlab iplan 3.0 (brainlab ag, feldkirchen, germany). The spg on the symptomatic side was localised visually and marked on fused mri and ct scans . The nasal cavity was decongested with adrenalin nasal packing (0.5 ml adrenalin solution 0.1 mg / ml (takeda nycomed, drammen, norway) suspended in 4.5 ml isotonic saline) for 20 minutes . Aided by surgical navigation and a custom - made device (multiguide), 0.05 mg adrenalin in 5 ml isotonic saline was administered in the sphenopalatine fossa followed by 25 iu or 50 iu of bta towards the spg . Bta was suspended in 1 ml isotonic saline for the first three patients, and 0.5 ml for patients 410 . In patient number 7 the transnasal approach was impossible to perform because of a bony medial wall of the sphenopalatine fossa and a small sphenopalatine foramen; we therefore decided perioperatively to proceed with a percutaneous infrazygomatic (lateral) approach . Aes (primary outcome) were assessed through tabulation from the treatment procedure to the end of the study . Secondary outcomes were the mean change from baseline in frequency of ch attacks for weeks 3 and 4 (main efficacy outcome); ch intensity; duration of attacks; days with ch; presence of autonomic symptoms; attacks treated with triptans; doses of triptans; acceptability of treatment; and headache - related impact on quality of life measured by the hit-6 . For all efficacy outcomes, weeks 1 and 2 were not included in the analysis of month 1 (according to protocol) since it may take one to two weeks before the bta block is achieved . For efficacy outcomes we have performed two types of analyses: intention - to - treat (itt) analysis (n = 9) and per - protocol analysis (n = 7), both without imputing missing data . To better assess the therapeutic gain of the treatment, a responder analysis was performed for each month of the study period . A frequency responder (main efficacy outcome) was pre - defined as at least a 50% reduction of mean attack frequency between baseline and weeks 3 and 4 . Statistical software spss, version 21.0 (spss inc, chicago, il, usa) was used in the data analyses . Since the study is an exploratory safety study, no power calculation was performed prior to study start . For efficacy measures we used three patients were defined as protocol violators. Patient 9 did not deliver headache diaries at all with no reason given and was excluded from the efficacy data analysis . Patient 8 did not provide headache diary for weeks 524 with no reason given . Table 1.demographics and clinical characteristics.all patients (n = 10)number of females / males5/5median age, years (range)42 (2964)ch attack laterality, left dominant,% 70mean years since onset of ch (range)15 (335)number of preventive treatments failed (range)3,4 (36)concomitant migraine2arecommended preventive treatments (7) described for ch with unsatisfactory or intolerable side effects.bpatient 3 and patient 8.ch: cluster headache . Demographics and clinical characteristics . Recommended preventive treatments (7) described for ch with unsatisfactory or intolerable side effects . There was one severe adverse event (sae), observed four days in hospital after a perioperative posterior epistaxis treated with posterior nasal packing . Three patients reported accommodation problems on the ipsilateral eye and one patient reported chewing and gaping difficulties, all resolved within four weeks (range 128 days). Patient 5 received a misplaced injection in the mucosa of the nasal cavity due to misinterpretation of image guidance data during the procedure . Patient 8, with a history of encephalitis before developing ch, had prior to the study experienced sensory disturbances in ipsilateral limbs during cluster attacks, but during the first month after treatment she developed ipsilateral motor weakness of the lower limb, accommodation difficulties and chewing weakness during ch attacks . The accommodation difficulties and chewing weakness resolved within four weeks, but the ictal lower limb weakness was on - going at the end of the study . Due to the intermittent character of the symptoms, the motor symptoms appearing on the same side as the injection and no obvious relation with the study treatment, except for relation in time, the latter event was registered as an ae probably not related to the study treatment by the principal investigator and sponsor . Table 2.summary table including responder analysis and adverse event data after one single bta treatment of spg.efficacy outcome (attack frequency per week)interventionreduction in attack frequency from bl (%) adverse eventpatient numberapproachbta (iu)blm1m2m3m4m5m6resolved <4 weekson - going> 4 weeks1transnasal2530.2 57% 3%32% 53% 28%12%accommodation problems2transnasal2515.0 57% 67% 65% 82% 92% 93% none3transnasal2515.2 97% 97% 85% 20%+5%3%accommodation problems4transnasal2517.5 97% 99% 100% 100% 100% 97% none5transnasal253.5 + 43%+21%+42%+22%+57%+36%temporal headache, misplaced injection6transnasal504.5 78% 61% 56% 78% 61% 67% anterior epistaxis7lateral5014.323%18%35%18%38%25%none8transnasal5015.414%nananananaanterior epistaxis, accommodation and jaw problemsch attack- related weakness in one foot9transnasal50nananananananaanterior epistaxis10transnasal5042.621%nananananaposterior epistaxis50% improvement from baseline, depicted in bold.bta: onabotulinumtoxina; spg: sphenopalatine ganglion; ch: cluster headache; m: month; na: not available; bl: baseline . Summary table including responder analysis and adverse event data after one single bta treatment of spg . Bta: onabotulinumtoxina; spg: sphenopalatine ganglion; ch: cluster headache; m: month; na: not available; bl: baseline . Results on cluster attack frequency (main efficacy outcome) are given in figure 1 for the itt analysis (n = 9). In the pp analysis (n = 7) attack frequency per week was reduced from 14 9 in the baseline period to 5 5 (p = 0.028) in month 1; for months 26 mean values and significance levels were identical to the itt analysis . In the pp analysis the average attack reduction from baseline for months 13 and months 46 was respectively 55% (p = 0.028) and 45% (p = 0.028) (figure 2), and for the whole follow - up, months 16, 51% (p = 0.028). Mean cluster attack frequency per week for baseline and after one single bta treatment of spg, intention - to - treat analysis (n = 9).bta: onabotulinumtoxina; spg: sphenopalatine ganglion . Figure 2.number of attacks by intensity . Attacks graded mild or moderate and severe or unbearable . Per protocol participants (n = 7). Mean cluster attack frequency per week for baseline and after one single bta treatment of spg, intention - to - treat analysis (n = 9). Attacks graded mild or moderate and severe or unbearable . Per protocol participants (n = 7). Summary statistics for secondary efficacy outcomes for the pp analysis are provided in table 3 . A substantial numerical mean decrease from baseline was observed for all outcomes except mean duration per attack . Five patients were classified as responders for the main efficacy outcome (50% reduction of mean attack frequency vs. baseline). Frequency reduction for all months is provided in table 2 . Table 3.secondary efficacy measures for baseline and after one single bta treatment of spg . Per protocol analysis (n = 7).baselinemonth 1month 2month 3month 4month 5month 6mean intensity/ attack sd (p value)3.50 1.05 2.66 1.10 (0.043) 2.56 1.08 (0.043) 2.44 1.31 (0.043) 2.46 1.46 (0.043) 2.38 1.43 (0.028) 2.56 1.19 (0.043) mean duration sd (p value)1345 793422 691 (0.12)528 740 (0.12)550 882 (0.12)511 792 (0.12)666 969 (0.25)724 888 (0.50)mean duration per attack sd (p value)35.6 24.826.0 35.0 (0.25)30.5 43.9 (0.60)31.0 45.1 (0.89)32.1 47.2 (0.69)35.6 47.4 (0.89)36.2 47.5 (0.89)days without attacks sd (p value)4.2 5.9 14.6 10.6 (0.046) 14.3 11.2 (0.075)13.6 10.1 (0.063)12.3 10.9 (0.12)11.7 11.8 (0.25)12.1 11.6 (0.23)headache severity index sd (p value)10.4 14.0.98 1.21 (0.075)3.60 7.78 (0.075)1.78 2.77 (0.12)1.51 1.42 (0.17)3.38 3.83 (0.46)4.25 6.04 (0.46)mean number of attacks, intensity 3 or 4 sd (p value)50 38 13 16 (0.028) 11 11 (0.028) 10 8 (0.043) 17 20 (0.028) 18 23 (0.063) 19 21 (0.042) triptan doses sd (p value)91 4935 25 (0.068)56 64 (0.068)40 37 (0.068)42 23 (0.14)52 42 (0.14)60 54 (0.14)hit-6 sd (p value)65.1 2.73 51.9 7.76 (0.018) 56.9 8.86 (0.063)54.1 12.2 (0.075)p value for each month compared to baseline . Bta: onabotulinumtoxina; spg: sphenopalatine ganglion; hit-6: headache impact test-6.ain minutes.bduration (min) intensity frequency, 10.ccategorical intensity scale: grade 1; mild, grade 2; moderate, grade 3; severe, grade 4; unbearable . Secondary efficacy measures for baseline and after one single bta treatment of spg . Per protocol analysis categorical intensity scale: grade 1; mild, grade 2; moderate, grade 3; severe, grade 4; unbearable . An improvement of headache impact as measured by hit-6 was seen during the follow - up, with a mean decrease after four weeks of 13.2 points (p = 0.018), after eight weeks of 8.2 points (p = 0.064) and after 24 weeks of 11.0 points (p = 0.075) (table 3). There was one severe adverse event (sae), observed four days in hospital after a perioperative posterior epistaxis treated with posterior nasal packing . Three patients reported accommodation problems on the ipsilateral eye and one patient reported chewing and gaping difficulties, all resolved within four weeks (range 128 days). Patient 5 received a misplaced injection in the mucosa of the nasal cavity due to misinterpretation of image guidance data during the procedure . Patient 8, with a history of encephalitis before developing ch, had prior to the study experienced sensory disturbances in ipsilateral limbs during cluster attacks, but during the first month after treatment she developed ipsilateral motor weakness of the lower limb, accommodation difficulties and chewing weakness during ch attacks . The accommodation difficulties and chewing weakness resolved within four weeks, but the ictal lower limb weakness was on - going at the end of the study . Due to the intermittent character of the symptoms, the motor symptoms appearing on the same side as the injection and no obvious relation with the study treatment, except for relation in time, the latter event was registered as an ae probably not related to the study treatment by the principal investigator and sponsor . Table 2.summary table including responder analysis and adverse event data after one single bta treatment of spg.efficacy outcome (attack frequency per week)interventionreduction in attack frequency from bl (%) adverse eventpatient numberapproachbta (iu)blm1m2m3m4m5m6resolved <4 weekson - going> 4 weeks1transnasal2530.2 57% 3%32% 53% 28%12%accommodation problems2transnasal2515.0 57% 67% 65% 82% 92% 93% none3transnasal2515.2 97% 97% 85% 20%+5%3%accommodation problems4transnasal2517.5 97% 99% 100% 100% 100% 97% none5transnasal253.5 + 43%+21%+42%+22%+57%+36%temporal headache, misplaced injection6transnasal504.5 78% 61% 56% 78% 61% 67% anterior epistaxis7lateral5014.323%18%35%18%38%25%none8transnasal5015.414%nananananaanterior epistaxis, accommodation and jaw problemsch attack- related weakness in one foot9transnasal50nananananananaanterior epistaxis10transnasal5042.621%nananananaposterior epistaxis50% improvement from baseline, depicted in bold.bta: onabotulinumtoxina; spg: sphenopalatine ganglion; ch: cluster headache; m: month; na: not available; bl: baseline . Summary table including responder analysis and adverse event data after one single bta treatment of spg . Bta: onabotulinumtoxina; spg: sphenopalatine ganglion; ch: cluster headache; m: month; na: not available; bl: baseline . Results on cluster attack frequency (main efficacy outcome) are given in figure 1 for the itt analysis (n = 9). In the pp analysis (n = 7) attack frequency per week was reduced from 14 9 in the baseline period to 5 5 (p = 0.028) in month 1; for months 26 mean values and significance levels were identical to the itt analysis . In the pp analysis the average attack reduction from baseline for months 13 and months 46 was respectively 55% (p = 0.028) and 45% (p = 0.028) (figure 2), and for the whole follow - up, months 16, 51% (p = 0.028). Mean cluster attack frequency per week for baseline and after one single bta treatment of spg, intention - to - treat analysis (n = 9).bta: onabotulinumtoxina; spg: sphenopalatine ganglion . Attacks graded mild or moderate and severe or unbearable . Per protocol participants (n = 7). Main efficacy measure . Mean cluster attack frequency per week for baseline and after one single bta treatment of spg, intention - to - treat analysis (n = 9). Attacks graded mild or moderate and severe or unbearable . Per protocol participants (n = 7). Summary statistics for secondary efficacy outcomes for the pp analysis are provided in table 3 . A substantial numerical mean decrease from baseline was observed for all outcomes except mean duration per attack . Five patients were classified as responders for the main efficacy outcome (50% reduction of mean attack frequency vs. baseline). Frequency reduction for all months is provided in table 2 . Table 3.secondary efficacy measures for baseline and after one single bta treatment of spg . Per protocol analysis (n = 7).baselinemonth 1month 2month 3month 4month 5month 6mean intensity/ attack sd (p value)3.50 1.05 2.66 1.10 (0.043) 2.56 1.08 (0.043) 2.44 1.31 (0.043) 2.46 1.46 (0.043) 2.38 1.43 (0.028) 2.56 1.19 (0.043) mean duration sd (p value)1345 793422 691 (0.12)528 740 (0.12)550 882 (0.12)511 792 (0.12)666 969 (0.25)724 888 (0.50)mean duration per attack sd (p value)35.6 24.826.0 35.0 (0.25)30.5 43.9 (0.60)31.0 45.1 (0.89)32.1 47.2 (0.69)35.6 47.4 (0.89)36.2 47.5 (0.89)days without attacks sd (p value)4.2 5.9 14.6 10.6 (0.046) 14.3 11.2 (0.075)13.6 10.1 (0.063)12.3 10.9 (0.12)11.7 11.8 (0.25)12.1 11.6 (0.23)headache severity index sd (p value)10.4 14.0.98 1.21 (0.075)3.60 7.78 (0.075)1.78 2.77 (0.12)1.51 1.42 (0.17)3.38 3.83 (0.46)4.25 6.04 (0.46)mean number of attacks, intensity 3 or 4 sd (p value)50 38 13 16 (0.028) 11 11 (0.028) 10 8 (0.043) 17 20 (0.028) 18 23 (0.063) 19 21 (0.042) triptan doses sd (p value)91 4935 25 (0.068)56 64 (0.068)40 37 (0.068)42 23 (0.14)52 42 (0.14)60 54 (0.14)hit-6 sd (p value)65.1 2.73 51.9 7.76 (0.018) 56.9 8.86 (0.063)54.1 12.2 (0.075)p value for each month compared to baseline . Bta: onabotulinumtoxina; spg: sphenopalatine ganglion; hit-6: headache impact test-6.ain minutes.bduration (min) intensity frequency, 10.ccategorical intensity scale: grade 1; mild, grade 2; moderate, grade 3; severe, grade 4; unbearable . Secondary efficacy measures for baseline and after one single bta treatment of spg . Per protocol analysis categorical intensity scale: grade 1; mild, grade 2; moderate, grade 3; severe, grade 4; unbearable . An improvement of headache impact as measured by hit-6 was seen during the follow - up, with a mean decrease after four weeks of 13.2 points (p = 0.018), after eight weeks of 8.2 points (p = 0.064) and after 24 weeks of 11.0 points (p = 0.075) (table 3). Results on cluster attack frequency (main efficacy outcome) are given in figure 1 for the itt analysis (n = 9). In the pp analysis (n = 7) attack frequency per week was reduced from 14 9 in the baseline period to 5 5 (p = 0.028) in month 1; for months 26 mean values and significance levels were identical to the itt analysis . In the pp analysis the average attack reduction from baseline for months 13 and months 46 was respectively 55% (p = 0.028) and 45% (p = 0.028) (figure 2), and for the whole follow - up, months 16, 51% (p = 0.028). Mean cluster attack frequency per week for baseline and after one single bta treatment of spg, intention - to - treat analysis (n = 9).bta: onabotulinumtoxina; spg: sphenopalatine ganglion . Attacks graded mild or moderate and severe or unbearable . Per protocol participants (n = 7). Main efficacy measure . Mean cluster attack frequency per week for baseline and after one single bta treatment of spg, intention - to - treat analysis (n = 9). Attacks graded mild or moderate and severe or unbearable . Per protocol participants (n = 7). Summary statistics for secondary efficacy outcomes for the pp analysis are provided in table 3 . A substantial numerical mean five patients were classified as responders for the main efficacy outcome (50% reduction of mean attack frequency vs. baseline). Frequency reduction for all months is provided in table 2 . Table 3.secondary efficacy measures for baseline and after one single bta treatment of spg . Per protocol analysis (n = 7).baselinemonth 1month 2month 3month 4month 5month 6mean intensity/ attack sd (p value)3.50 1.05 2.66 1.10 (0.043) 2.56 1.08 (0.043) 2.44 1.31 (0.043) 2.46 1.46 (0.043) 2.38 1.43 (0.028) 2.56 1.19 (0.043) mean duration sd (p value)1345 793422 691 (0.12)528 740 (0.12)550 882 (0.12)511 792 (0.12)666 969 (0.25)724 888 (0.50)mean duration per attack sd (p value)35.6 24.826.0 35.0 (0.25)30.5 43.9 (0.60)31.0 45.1 (0.89)32.1 47.2 (0.69)35.6 47.4 (0.89)36.2 47.5 (0.89)days without attacks sd (p value)4.2 5.9 14.6 10.6 (0.046) 14.3 11.2 (0.075)13.6 10.1 (0.063)12.3 10.9 (0.12)11.7 11.8 (0.25)12.1 11.6 (0.23)headache severity index sd (p value)10.4 14.0.98 1.21 (0.075)3.60 7.78 (0.075)1.78 2.77 (0.12)1.51 1.42 (0.17)3.38 3.83 (0.46)4.25 6.04 (0.46)mean number of attacks, intensity 3 or 4 sd (p value)50 38 13 16 (0.028) 11 11 (0.028) 10 8 (0.043) 17 20 (0.028) 18 23 (0.063) 19 21 (0.042) triptan doses sd (p value)91 4935 25 (0.068)56 64 (0.068)40 37 (0.068)42 23 (0.14)52 42 (0.14)60 54 (0.14)hit-6 sd (p value)65.1 2.73 51.9 7.76 (0.018) 56.9 8.86 (0.063)54.1 12.2 (0.075)p value for each month compared to baseline . Bta: onabotulinumtoxina; spg: sphenopalatine ganglion; hit-6: headache impact test-6.ain minutes.bduration (min) intensity frequency, 10.ccategorical intensity scale: grade 1; mild, grade 2; moderate, grade 3; severe, grade 4; unbearable . Secondary efficacy measures for baseline and after one single bta treatment of spg . Per protocol analysis bta: onabotulinumtoxina; spg: sphenopalatine ganglion; hit-6: headache impact test-6 . Duration (min) intensity frequency, 10 . Categorical intensity scale: grade 1; mild, grade 2; moderate, grade 3; severe, grade 4; unbearable . An improvement of headache impact as measured by hit-6 was seen during the follow - up, with a mean decrease after four weeks of 13.2 points (p = 0.018), after eight weeks of 8.2 points (p = 0.064) and after 24 weeks of 11.0 points (p = 0.075) (table 3). Bta injection to the spg represents a novel approach for the treatment of intractable chronic ch and, to our knowledge, such treatment has not previously been performed . One patient with posterior epistaxis was reported (sae), which would be expected performing injections adjacent to the sphenopalatine artery . This could be due to diffusion of bta blocking the inferior rectus muscle of the orbit or the ciliary ganglion, but exhaustive ophthalmological examination could not disclose objective signs of any affliction . Diffusion of bta blocking the pterygoid muscles may explain the single event of ipsilateral weakened chewing force, but the interictal improvement is not easy to explain on the basis of the action of bta, and it was not confirmed on clinical examination . In both cases the symptoms lasted much less than expected for a bta block, and may be explained by local oedema . With the exception of one ae interpreted as not being associated with the treatment, all aes resolved within four weeks . The ae profile seems acceptable given the level of invalidity of this disorder . While data are scarce, there does not seem to be any clear difference of the ae profile of the group treated with 25 iu bta compared to the group treated with 50 iu (table 2). Due to small sample size, uncontrolled design, and 30% protocol violators, interpretation of efficacy outcomes must be performed with caution . A single intervention and a long follow - up with restriction on acute and preventive medication may explain the high share of protocol violators, also seen in earlier studies (9). Cluster attack frequency (figure 1) and attack intensity (table 3 and figure 2), were reduced compared to baseline, but there was no change in the mean duration of attacks (table 3). Five out of 10 were frequency responders for the main efficacy outcome with an average attack frequency reduction of 77%, responding on average 4.6 months . It seems unlikely that general anaesthesia, placebo or spontaneous remission could explain such long - term improvement after a single intervention in chronic ch that has not responded to any other type of treatment and that has lasted for a minimum of three years . Of the patients not responding in terms of frequency, patient 5 was a misplaced injection and as such did not receive the treatment; patient 10 had a posterior nasal bleeding during the procedure and it is unclear whether he received an effective spg block; patients 8 and 9 are protocol violators due to missing headache diaries, one claims to have had a 50% attack frequency reduction and the other claims to have had no effect . In neither patient 5 received a misplaced injection in this study, but responded to post - study treatment with 50% attack frequency reduction . Three patients are still frequency responders after> 12 months with only one treatment performed . Responders with remission after the first bta injection also seem to respond well to repetitive treatments . Based on previous experience with bta targeting autonomic neural structures, one may expect an effect of such treatment to the spg to last between three and nine months, so the development of a technique performed on an awake patient is warranted . The clinical effect mainly appeared in week 2 in responders, indicating that the treatment also might be suitable for the treatment of episodic ch if proven effective . While some non - pharmacological options for the treatment of intractable ch exist, they are all based on open studies of limited size, with the notable exception of two small sham - controlled studies . Deep brain stimulation in intractable ch by fontaine et al . Failed to show efficacy (10). One common feature of all neurostimulator regimens is the high cost of the treatment, and also there are no known predictors of effect (12). The proposed treatment in this study, if proven effective in intractable ch, may represent a low cost option compared to neurostimulator regimes, without long - lasting aes and consequently a low threshold for trying it out . Bta injection to the spg in intractable chronic ch seems to have an acceptable ae profile . The efficacy data indicate a significant reduction of cluster attack frequency post - treatment, and five out of 10 patients responded to the treatment for the main efficacy outcome with an average attack frequency reduction of 77% . Randomised, placebo - controlled studies are warranted to establish both safety and efficacy of this possible novel treatment of ch . In this pilot study sphenopalatine injection of onabotulinumtoxina in intractable chronic cluster headache seems to have an acceptable adverse event profile.efficacy data indicate a significant reduction of cluster attack frequency.randomised, placebo - controlled studies are warranted to establish both safety and efficacy . In this pilot study sphenopalatine injection of onabotulinumtoxina in intractable chronic cluster headache seems to have an acceptable adverse event profile . This work was supported by the liaison committee between the central norway regional health authority and norwegian university of science and technology (grant number 12/9996); joint research unit between st . Olavs hospital and norwegian university of science and technology (grant number 9885); and ntnu discovery (grant number 244278)., trondheim university hospital may benefit financially from a commercialisation of the proposed treatment through future possible intellectual properties; this may include financial benefits to authors of this article . Dr bratbak is co - inventor of the proposed treatment in this study and the intervention device used to perform the treatment, both inventions patent pending, and may benefit financially from a commercialisation of the proposed treatment through future possible intellectual properties . Dr nordgrd is co - inventor of the proposed treatment in this study and the intervention device used to perform the treatment, both inventions patent pending, and may benefit financially from a commercialisation of the proposed treatment through future possible intellectual properties . Dr tronvik reports a personal fee for one national advisory board meeting and reimbursement for scientific meetings from allergan; and may benefit financially from a commercialisation of the proposed treatment through future possible intellectual properties . Dr stovner reports personal fees from glaxosmithkline outside the submitted work . Drs linde, folvik and bugten declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Natural selection solidifies the most favorable alterations in our replicative processes to create brilliantly functional biochemical and cellular pathways . Hence, it is axiomatic that rare diseases, in addition to being coruscating curiosities, also serve as windows to the world s normal order . Among the women and men who address human mutations, clinicians provide care for those affected with rare maladies, and a special cadre of scientists investigates the causes of those disorders . The nih undiagnosed diseases program (udp), announced may 19, 2008, serves as a focal point for the synergistic interplay between clinical and basic science investigators (gahl and tifft, 2011; gahl et al ., 2011). The udp filters thousands of enquiries down to hundreds of nih clinical center inpatient admissions, and then chooses illustrative cases to pursue experimentally . Three years into its operation, the udp had reviewed more than 1800 thick medical records, accepted approximately 430 patients and admitted 350 of them . The program had performed close to 600 single nucleotide polymorphism (snp) arrays and analyzed approximately 230 whole exome sequences (wess) using dna from patients and their family members . Many specific cases warranted intense investigation, based on their compelling clinical presentations, the likelihood that the basic defects would be uncovered and the impact predicted to emanate from the new disease discovery. In the sections below, we recount examples that illustrate the process of disease discovery and how it can, in turn, provide new information about the role of genes and biological pathways in normal and impaired physiology . For example, udp clinical investigators ascertained a family of five adults from middle america with stunning arterial calcification and claudication confined to the lower extremities (st . Hilaire et al ., 2011). Intense clinical examinations verified that this was not atherosclerosis, that the coronaries were spared, and that the only additional sites of ectopic calcification involved the joint capsules of the hands and feet . The next step involved applying genetic methodologies to identify candidate genes causing this disease . In this case, the project benefited enormously from the fact that the parents of the five siblings were third cousins, unaffected, and readily available for study . The most appropriate genetic platform to employ was the million snp array, which detects copy number variants (deletions and duplications) and also identifies regions of homozygosity . In a product of a consanguineous mating, most homozygous areas derive from a common ancestor, and a single pathogenic mutation in a shared ancestral gene could cause a recessive disease . Hence, we were looking for a region of the human genome in which all five affected siblings were homozygous, but the parents were heterozygous . That area contained 92 genes; any one of them could have contained a homozygous mutation that caused the arterial calcifications . This was the third, and most crucial, step in discovering a new human disease, i.e. Identifying and connecting with a basic scientist whose lab possessed expertise in the field . In this case, hilaire of the national heart, lung and blood institute were authorities on vascular cell metabolism, and cell - based assays were extant in the boehm lab . Hilaire cultured an affected patient s fibroblasts and performed expression analysis of candidate genes in the inherited homozygous region . Only one gene, nt5e, which encodes the cd73 protein, was differentially expressed . Direct sequencing of nt5e identified null mutations that resulted in complete inactivation of cd73 protein in all affected siblings . This newly identified vascular disease was referred to as arterial calcification due to deficiency of cd73 (acdc). Cd73 is a membrane - bound enzyme that converts extracellular amp to adenosine and inorganic phosphate; this process was found to be severely impaired in fibroblasts from individuals with acdc . The failure to generate extracellular adenosine leads to an increase in tissue non - specific alkaline phosphatase (tnap), a key enzyme in tissue calcification in vitro and in vivo . Cultured fibroblasts of individuals with acdc not only contained increased tnap activity, but they also calcified . Finally, tnap activity and in vitro calcification could be reversed by genetic rescue with nt5e cdna or treatment with exogenous adenosine . The role of adenosine in inhibiting default calcification in vascular endothelial cells is a new concept that could have an enormous influence on our understanding of ectopic calcification in general . The pathway might also have implications for other specific disorders, including monckeberg s medial sclerosis and pseudoxanthoma elasticum (markello et al ., 2011). In addition, knowledge of the basic defect in acdc allows for consideration of treatment for affected individuals; besides the five siblings described above, four other acdc patients have been ascertained worldwide, and still more have come to our attention recently . Treatment with bisphosphonates (inhibitors of alkaline phosphatase) is a potential therapy; therefore, we have initiated a clinical protocol to test this . A second example of disease discovery emanating from the nih udp focused on a novel spastic ataxia - neuropathy syndrome in two brothers (pierson et al ., 2011). Phenotyping revealed spasticity, peripheral neuropathy, cerebellar ataxia, oculomotor apraxia, dystonia and myoclonic epilepsy . One of the brothers died at age 13; the other was deteriorating at age 14 . Again, consanguinity was involved, but this time in the form of a first cousin marriage . Whereas third cousins share 1/128 of their genes, first cousins share 1/8 of their genes, meaning that more than 10% of the human genome would be homozygous on snp array analysis . As a consequence, snp arrays would yield too many candidate genes to guess which ones would warrant further pursuit . Wes involves massively parallel sequencing of 40 million bases that constitute the <2% of the human genome (3.2 billion bases) encoding genes . Using a whole exome platform, not every gene is perfectly sequenced (i.e. Covered), but the breadth is so great that there is a good chance of detecting a causative variant . The problem is that non - pathogenic variants abound, so the exome sequences of other family members are required to reduce (filter) the total number of variants . In the case of the two brothers, a total of 120,469 variants were identified among the two parents and two affected brothers; this was reduced to 59,482 variants not found in the 1000 genomes database . Of these, 11 were homozygous and, of the 11, three were not present in dbsnp, a database of known polymorphisms . One homozygous missense mutation (c.1847g> a; p.y616c) in the afg3l2 gene was identified as the best candidate . Afg3l2 encodes a subunit of a mitochondrial aaa protease that removes damaged or misfolded proteins (koppen et al ., 2007). As in the case of acdc, we had a phenotype and a gene, but needed scientific expertise to demonstrate a functional deficit and a mechanism of disease . In this case, thomas langer and elena rugarli of the university of cologne in germany provided the basic research knowledge by using a yeast expression system to study afg3l2 . It was known that afg3l2 protein forms either a homo - oligomeric isoenzyme or a hetero - oligomeric complex with paraplegin . Group used yeast complementation assays to show that the mutant (y616c) afg3l2 protein is a hypomorphic variant with an impaired ability to form complexes with either itself or with paraplegin (pierson et al . This finding was well aligned with the clinical phenotype, because paraplegin was mutated in hereditary spastic paraplegia type 7 (spg7), and heterozygous afg3l2 mutations caused autosomal dominant spinocerebellar ataxia type 28 (sca28) (atorino et al ., 2003; koppen et al ., 2007). The specific homozygous y616c mutation in our patients produced a unique combination of the phenotypes of spg7 and sca28, along with other mitochondrial disease features such as oculomotor apraxia, extrapyramidal dysfunction and myoclonic epilepsy . This new disease discovery significantly broadened the phenotypes associated with both spinocerebellar ataxia and hereditary spastic paraplegia for the neurological community . The above examples employed a wide range of research modalities including cutting - edge medical procedures, state - of - the - art genetics, appropriate cell culture systems and model organisms to come to a final diagnosis . The nih udp has many other cases similar to those mentioned above, at different stages of maturation, as well as examples of extremely rare, known diseases . ., 2000) being investigated by immunologists, follicular hyperkeratosis being pursued by cell cycle experts and an autosomal dominant myopathy being studied by cell biologists . In every case, genetics ties the clinical investigator to the basic scientist, but some investigations lie fallow for want of bench researchers or experts in the disease . As our knowledge and data in genetics burgeon, we must engage the cognoscenti in a wide variety of fields to discover new diseases, new mechanisms of action and, ultimately, new therapeutic interventions . Only a union of clinical and basic researchers and an awareness of the rich resource that lies in the population of rare disease patients can achieve this . We hope that the udp can serve as a model for similar programs at major medical centers throughout the world.
Neurotrophins are a family of secreted proteins, including brain - derived neurotrophic factor (bdnf), nerve growth factor (ngf), neurotrophin-3, and neurotrophin-4, which have been recognized as important regulators of synaptic plasticity.14 these molecules have been shown to control the generation, survival, differentiation, and regeneration of neurons in the peripheral and central nervous systems.5 induction of bdnf in the peripheral nerve and muscle would be important to stimulate schwann cell differentiation and proliferation, a prerequisite for axonal regeneration . However, neurotrophins are now considered to be growth factors with a wide spectrum of functions outside the nervous system, including modulation and regulation of the immune function.6 ngf has been demonstrated to act as a cytokine - like factor in the development and function of the immune system, and the function of ngf on b cells, t cells, and macrophages has been well described.7 however, limited studies on the role of bdnf in the immune system, especially in transplant immunity, are available . Two distinct classes of cell surface receptors mediate the biological effects of bdnf, the high affinity receptor tyrosine kinase b (trkb) and the low affinity p75 neurotrophin receptor . In adult central nervous system, the most prominent expression of bdnf and its receptor, trkb, is found in structures associated with epilepsy and synaptic plasticity, such as the hippocampus, cerebellum, and neocortex, suggesting that bdnf may modify neuronal plasticity in adult animals . Indeed, accumulating evidence indicates that bdnf is involved in synaptic transmission, neuronal excitability, and the development and maintenance of neuronal plasticity in adult central nervous system . It has been shown that both t and b lymphocytes express trkb receptors on their surface.810 t cells, b cells, and other cells, including innate immune cells, have been demonstrated to play an essential role in the pathogenesis of rejection following organ transplantation . However, the role of bdnf in modulating the function of the immune cells following nerve transplantation has not been investigated . Therefore, in order to identify whether bdnf could prevent immune rejection after peripheral nerve xenotransplantation and facilitate the nerve regeneration, we performed nerve xenotransplantation from rats to mice and found a dramatic reduction of natural killer (nk) cells, b cells, type 1 t helper (th1) cells, and type 17 t helper (th17) cells, while a remarkable increase of natural killer t (nkt) lymphocytes, type 2 t helper (th2) cells, and regulatory t cells (tregs) was observed in the spleen of xenotransplanted mice treated with bdnf compared to that in mice receiving xenotransplantation only . In addition, serum concentrations of interleukin (il)-6, il-17, interferon (ifn-), and tnf- were significantly decreased, while il-4 and il-10 were significantly increased in the presence of bdnf following xenotransplantation . Adult male sprague dawley rats (6.00.1 weeks old and 1905 g weight in average) and adult male balb / c mice (70.10.2 weeks old and 20.20.5 g weight in average) were used as donors and recipients, respectively (at least five mice in each group). All animals were purchased from jilin university (changchun, people s republic of china). All surgical procedures and postoperative care of the animals were approved by the institutional animal ethics committee of jilin university . Rats were euthanized followed by exposing the sciatic nerve of the donor rat through an incision splitting the dorsal gluteal muscle . A segment (0.5 cm) of sciatic nerve was then harvested and used immediately . The recipient mouse was given 3.5% chloral hydrate (0.1 ml / kg) intraperitoneally . The skin over the mouse s right hind limb was incised, and the underneath muscle was bluntly dissected to expose the sciatic nerve . The rat sciatic nerve graft (0.5 cm) was interposed to the transected nerve and repaired with 11 - 0 nylon epineurial sutures . Mice in which the sciatic nerve was exposed without xenotransplantation were used as the sham control group . Bdnf (ebioscience, san diego, ca, usa) was diluted with physiological saline (500 g/50 l), and 10 l (total 100 g) was topically applied at the place of the transplanted nerve graft only once during the operation . Whole spleen was homogenized in pbs, and the cell suspension was filtered to remove the debris . After processing, 1210 cells / ml were stimulated with phorbol 12-myristate 13-acetate (pma; sigma chemicals, perth, australia) (50 ng / ml) plus 2 mg / ml of ionomycin for 6 hours . Brefeldin a (10 mg / ml) was then added 2 hours before the cells were collected and stained with antibodies . The cells were stained with antibodies against surface markers (antimouse cd3, cd4, cd25, and nk; ebioscience). Cells were then permeabilized with membrane - permeabilizing reagents (caltag, burlingame, ca, usa) and fixed using a fixing solution (caltag), following the manufacturer s instructions, followed by incubation with anti - il-4, anti - ifn-, anti - il-17, and anti - foxp3 (ebioscience), or isotope - matched control antibodies for 30 minutes . Flow cytometry (facscalibur; beckton dickinson, franklin lakes, nj, usa) was performed and data were analyzed using flowjo software . Blood was collected from the orbital sinus of the recipient mice . The concentration of serum cytokines (ifn-, tnf-, il-4, il-6, il-10, and il-17) was determined by cytometric bead array (cba), following the manufacturer s protocol (bd biosciences, san jose, ca, usa) with minor modifications . The concentration of serum cytokines was quantified using the cellquestpro and cba software (becton dickinson) on a facscalibur cytometry (bd biosciences). Difference of paired or unpaired groups was determined by the student s t - test for parametric data sets . All statistical analyses were performed using prism 4 (graphpad software, inc ., la jolla, ca, usa). Adult male sprague dawley rats (6.00.1 weeks old and 1905 g weight in average) and adult male balb / c mice (70.10.2 weeks old and 20.20.5 g weight in average) were used as donors and recipients, respectively (at least five mice in each group). All animals were purchased from jilin university (changchun, people s republic of china). All surgical procedures and postoperative care of the animals were approved by the institutional animal ethics committee of jilin university . Rats were euthanized followed by exposing the sciatic nerve of the donor rat through an incision splitting the dorsal gluteal muscle . A segment (0.5 cm) of sciatic nerve the recipient mouse was given 3.5% chloral hydrate (0.1 ml / kg) intraperitoneally . The skin over the mouse s right hind limb was incised, and the underneath muscle was bluntly dissected to expose the sciatic nerve . A 0.5 cm gap on the sciatic nerve was created . The rat sciatic nerve graft (0.5 cm) was interposed to the transected nerve and repaired with 11 - 0 nylon epineurial sutures . Mice in which the sciatic nerve was exposed without xenotransplantation were used as the sham control group . Bdnf (ebioscience, san diego, ca, usa) was diluted with physiological saline (500 g/50 l), and 10 l (total 100 g) was topically applied at the place of the transplanted nerve graft only once during the operation . Whole spleen was homogenized in pbs, and the cell suspension was filtered to remove the debris . After processing, 1210 cells / ml were stimulated with phorbol 12-myristate 13-acetate (pma; sigma chemicals, perth, australia) (50 ng / ml) plus 2 mg / ml of ionomycin for 6 hours . Brefeldin a (10 mg / ml) was then added 2 hours before the cells were collected and stained with antibodies . The cells were stained with antibodies against surface markers (antimouse cd3, cd4, cd25, and nk; ebioscience). Cells were then permeabilized with membrane - permeabilizing reagents (caltag, burlingame, ca, usa) and fixed using a fixing solution (caltag), following the manufacturer s instructions, followed by incubation with anti - il-4, anti - ifn-, anti - il-17, and anti - foxp3 (ebioscience), or isotope - matched control antibodies for 30 minutes . Flow cytometry (facscalibur; beckton dickinson, franklin lakes, nj, usa) was performed and data were analyzed using flowjo software . Blood was collected from the orbital sinus of the recipient mice . The concentration of serum cytokines (ifn-, tnf-, il-4, il-6, il-10, and il-17) was determined by cytometric bead array (cba), following the manufacturer s protocol (bd biosciences, san jose, ca, usa) with minor modifications . The concentration of serum cytokines was quantified using the cellquestpro and cba software (becton dickinson) on a facscalibur cytometry (bd biosciences). Difference of paired or unpaired groups was determined by the student s t - test for parametric data sets . All statistical analyses were performed using prism 4 (graphpad software, inc ., la jolla, ca, usa). The total cell number of splenic mononuclear cells was highest in the mice of xenotransplantation without bdnf treatment (xt only) group (2.680.3210 cells / ml), mildly high in the group of transplantation plus bdnf treatment (xt + bdnf, 2.520.4110 cells / ml), and least in the sham control group (2.410.3810 cells / ml). The number of splenic nk cells was further counted and characterized, and it was found to be significantly increased in the mice of xt only group (8.470.8810 cells / ml) than that in the sham control group (4.680.7810 cells / ml, p=0.0003, figure 1a). In contrast, the number of splenic nk cells in the mice of xt + bdnf treatment group (4.850.8710 cells / ml) was remarkably reduced, and it was significantly less than that in the group of xt only group (8.470.8810 cells / ml, p=0.0004). In addition, there was no significant difference between the xt + bdnf group and the sham control group (figure 1b, p=0.9728). The number of nkt cells was significantly increased in the spleen of mice receiving xt + bdnf (2.600.4210 cells / ml) compared to that in the sham control group (1.290.3110 cells / ml, p=0.0007) or the xt only mice (1.600.3210 cells / ml, p=0.0015, figure 1c). However, there was no significant difference in the number of nkt cells between the xt only group and the sham control mice (p=0.4551). As shown in figures 2 and 3, the percentage of t cell and its subgroup was analyzed in the splenic mononuclear cells . The number of cd3 + t cells (12.560.9410 cells / ml), cd3+cd4 + t cells (6.560.7410 cells / ml), cd3+cd4 t cells (3.150.3910 cells / ml), ifn--producing cd3+cd4 + t cells (7.510.9610 cells / ml), and il-17-producing cd3+cd4 + t cells (3.180.2010 cells / ml) was significantly increased in the spleen of xt only mice compared to that in the sham control group (cd3 + t cells: 6.00.5410 cells / ml, cd3+cd4 + t cells: 3.460.4210 cells / ml, cd3+cd4 t cells: 1.550.1610 cells / ml, ifn--producing cd3+cd4 + t cells: 1.760.0910 cells / ml, and il-17-producing cd3+cd4 + t cells: 0.510.0910 cells / ml, respectively, p<0.0001 in all paired comparison; figure 3a d, and f, respectively). However, in the presence of bdnf, the number of the aforementioned sub - group t cells was significantly reduced in the mice of xt + bdnf group (cd3 + t cells: 8.550.4310 cells / ml, cd3+cd4 + t cells: 4.360.3310 cells / ml, cd3+cd4 t cells: 2.160.1810 cells / ml, ifn--producing cd3+cd4 + t cells: 3.330.3010 cells / ml, and il-17-producing cd3+cd4 + t cells: 1.210.1510 cells / ml, respectively) compared to that in the group of xt only (p<0.01 in all paired comparison, figure 3a d, and f). In addition, the il-4-producing cd3+cd4 + t cells and cd3+cd4+cd25+foxp3 + t cells were significantly increased in the mice of xt + bdnf group (3.360.5410 cells / ml and 6.850.3410 cells / ml, respectively) compared to those in the mice of xt only group (1.840.3010 cells / ml and 3.580.3610 cells / ml, respectively, p<0.05, figure 3e and g). The number of cd3+cd19 + b cells was significantly decreased in the spleen of xt + bdnf group (6.010.5210 cells / ml) compared to that in the sham control group (7.470.3110 cells / ml, p<0.0001) or the xt only group (10.130.3410 cells / ml, p<0.0001, figure 4a and b). There was no significant difference in the number of cd3+cd19 + b cells between the xt only group and the sham control mice (p=0.1128). Compared to the sham control group, the following cytokines were significantly increased in the serum of xt only mice: il-6 (51.4917.19 pg / ml of control vs 152.7114.18 pg / ml of xt only, p<0.0001), il-17 (5.76 1.52 pg / ml of control vs 38.935.04 pg / ml of xt only, p<0.0001), ifn- (4.120.57 pg / ml of control vs 23.495.18 pg / ml of xt only, p<0.0001), and tnf- (7.151.85 pg / ml of control vs 34.743.05 pg / ml of xt only, p<0.0001). In contrast, il-4 and il-10 were significantly decreased in the serum of xt only mice (1.890.66 pg / ml and 45.6618.59 pg / ml, respectively) compared to those in the sham control mice (3.390.68 pg / ml, p=0.0076, and 43.2728.37 pg / ml, p=0.0002, respectively). Compared to xt only mice and xt + bdnf mice, the levels of il-6 (152.7114.18 pg / ml of xt only vs 84.787.84 pg / ml of xt + bdnf, p<0.0001), il-17 (38.935.04 pg / ml of xt only vs 24.161.44 pg / ml of xt + bdnf, p=0.0002), ifn- (23.495.18 pg / ml of xt only vs 15.343.11 pg / ml of xt + bdnf, p=0.0167), and tnf- (34.743.50 pg / ml of xt only vs 18.556.66 pg / ml of xt + bdnf, p=0.0013) were significantly decreased, while il-4 (1.890.66 pg / ml of xt only vs 24.732.13 pg / ml of xt + bdnf, p<0.0001) and il-10 (45.6618.59 pg / ml of xt only vs 375.0657.11 pg / ml of xt + bdnf, p<0.0001) were significantly increased (figure 5). The total cell number of splenic mononuclear cells was highest in the mice of xenotransplantation without bdnf treatment (xt only) group (2.680.3210 cells / ml), mildly high in the group of transplantation plus bdnf treatment (xt + bdnf, 2.520.4110 cells / ml), and least in the sham control group (2.410.3810 cells / ml). The number of splenic nk cells was further counted and characterized, and it was found to be significantly increased in the mice of xt only group (8.470.8810 cells / ml) than that in the sham control group (4.680.7810 cells / ml, p=0.0003, figure 1a). In contrast, the number of splenic nk cells in the mice of xt + bdnf treatment group (4.850.8710 cells / ml) was remarkably reduced, and it was significantly less than that in the group of xt only group (8.470.8810 cells / ml, p=0.0004). In addition, there was no significant difference between the xt + bdnf group and the sham control group (figure 1b, p=0.9728). The number of nkt cells was significantly increased in the spleen of mice receiving xt + bdnf (2.600.4210 cells / ml) compared to that in the sham control group (1.290.3110 cells / ml, p=0.0007) or the xt only mice (1.600.3210 cells / ml, p=0.0015, figure 1c). However, there was no significant difference in the number of nkt cells between the xt only group and the sham control mice (p=0.4551). As shown in figures 2 and 3, the percentage of t cell and its subgroup was analyzed in the splenic mononuclear cells . The number of cd3 + t cells (12.560.9410 cells / ml), cd3+cd4 + t cells (6.560.7410 cells / ml), cd3+cd4 t cells (3.150.3910 cells / ml), ifn--producing cd3+cd4 + t cells (7.510.9610 cells / ml), and il-17-producing cd3+cd4 + t cells (3.180.2010 cells / ml) was significantly increased in the spleen of xt only mice compared to that in the sham control group (cd3 + t cells: 6.00.5410 cells / ml, cd3+cd4 + t cells: 3.460.4210 cells / ml, cd3+cd4 t cells: 1.550.1610 cells / ml, ifn--producing cd3+cd4 + t cells: 1.760.0910 cells / ml, and il-17-producing cd3+cd4 + t cells: 0.510.0910 cells / ml, respectively, p<0.0001 in all paired comparison; figure 3a d, and f, respectively). However, in the presence of bdnf, the number of the aforementioned sub - group t cells was significantly reduced in the mice of xt + bdnf group (cd3 + t cells: 8.550.4310 cells / ml, cd3+cd4 + t cells: 4.360.3310 cells / ml, cd3+cd4 t cells: 2.160.1810 cells / ml, ifn--producing cd3+cd4 + t cells: 3.330.3010 cells / ml, and il-17-producing cd3+cd4 + t cells: 1.210.1510 cells / ml, respectively) compared to that in the group of xt only (p<0.01 in all paired comparison, figure 3a d, and f). In addition, the il-4-producing cd3+cd4 + t cells and cd3+cd4+cd25+foxp3 + t cells were significantly increased in the mice of xt + bdnf group (3.360.5410 cells / ml and 6.850.3410 cells / ml, respectively) compared to those in the mice of xt only group (1.840.3010 cells / ml and 3.580.3610 cells / ml, respectively, p<0.05, figure 3e and g). The number of cd3+cd19 + b cells was significantly decreased in the spleen of xt + bdnf group (6.010.5210 cells / ml) compared to that in the sham control group (7.470.3110 cells / ml, p<0.0001) or the xt only group (10.130.3410 cells / ml, p<0.0001, figure 4a and b). There was no significant difference in the number of cd3+cd19 + b cells between the xt only group and the sham control mice (p=0.1128). Compared to the sham control group, the following cytokines were significantly increased in the serum of xt only mice: il-6 (51.4917.19 pg / ml of control vs 152.7114.18 pg / ml of xt only, p<0.0001), il-17 (5.76 1.52 pg / ml of control vs 38.935.04 pg / ml of xt only, p<0.0001), ifn- (4.120.57 pg / ml of control vs 23.495.18 pg / ml of xt only, p<0.0001), and tnf- (7.151.85 pg / ml of control vs 34.743.05 pg / ml of xt only, p<0.0001). In contrast, il-4 and il-10 were significantly decreased in the serum of xt only mice (1.890.66 pg / ml and 45.6618.59 pg / ml, respectively) compared to those in the sham control mice (3.390.68 pg / ml, p=0.0076, and 43.2728.37 pg / ml, p=0.0002, respectively). Compared to xt only mice and xt + bdnf mice, the levels of il-6 (152.7114.18 pg / ml of xt only vs 84.787.84 pg / ml of xt + bdnf, p<0.0001), il-17 (38.935.04 pg / ml of xt only vs 24.161.44 pg / ml of xt + bdnf, p=0.0002), ifn- (23.495.18 pg / ml of xt only vs 15.343.11 pg / ml of xt + bdnf, p=0.0167), and tnf- (34.743.50 pg / ml of xt only vs 18.556.66 pg / ml of xt + bdnf, p=0.0013) were significantly decreased, while il-4 (1.890.66 pg / ml of xt only vs 24.732.13 pg / ml of xt + bdnf, p<0.0001) and il-10 (45.6618.59 pg / ml of xt only vs 375.0657.11 pg / ml of xt + bdnf, p<0.0001) were significantly increased (figure 5). This study investigated the effect of bdnf on the immune reaction following peripheral nerve xenotransplantation from rats to mice . It was found that the number of nk cells, t cells, cd3+cd4 + t cells, cd3+cd4 t cells, th1 cells, th17 cells, and b cells was significantly increased in the mice receiving xenotransplantation and that bdnf could significantly suppress upregulation of the aforementioned t cells and b cells in the xenotransplanted mice . Paradoxically, the number of nkt cells, th2 cells, and tregs was significantly decreased at the acute phase of peripheral nerve xenotransplantation in the mice, and bdnf could significantly upregulate nkt cells, th2 cells, and tregs in the mice receiving nerve xenotransplantation . Furthermore, serum levels of il-6, il-17, ifn-, and tnf- were significantly inhibited, whereas serum levels of il-4 and il-10 were significantly stimulated by bdnf in the xenotransplanted mice . As a member of the neurotrophin family, bdnf was initially identified as a target - derived factor that promotes the survival of several populations of central neurons.1114 both in vitro15 and in vivo,1618 it has been reported that application of bdnf was effective for motoneuron survival . Induction of bdnf in the peripheral nerve and muscle would be important to stimulate schwann cell differentiation and proliferation, a prerequisite for axonal regeneration . It has been reported that bdnf mrna and its trkb receptor mrna coexist in the same neuron,19,20 and antisense bdnf oligonucleotides21,22 or anti - bdnf antiserum23,24 could reduce the survival of cultured neurons, even as isolated single cells . Thus, bdnf may act as an autocrine factor for maintaining neuronal survival during target - independent stages of development.25 it has been reported that bdnf served as a self - amplifying autocrine factor in promoting axon formation in embryonic hippocampal neurons by triggering two - nested positive feedback mechanisms . First, bdnf elevates cytoplasmic cyclic adenosine monophosphate and protein kinase a activity, which triggers further secretion of bdnf and membrane insertion of its receptor trkb . Second, bdnf / trkb signaling activates pi3-kinase that promotes anterograde transport of trkb in the putative axon, further enhancing local bdnf / trkb signaling . Together, these self - amplifying bdnf actions ensure stable elevation of local cyclic adenosine monophosphate / protein kinase a activity that is critical for axon differentiation and growth . Nk cells are large granular cytotoxic lymphocytes that represent a fundamental component of the innate immune system . In transplantation, nk cells are perhaps best known for their ability to directly reject major histocompatibility complex - mismatched bone marrow allografts, as illustrated by recent studies.26,27 nk cells have the capacity to exacerbate multiple forms of allograft injury; in this regard, nk cells can induce cardiac, skin, and kidney allograft rejection.2833 in the current study, the number of nk cells after 3 days of peripheral nerve xenotransplantation was significantly higher than that in the sham control mice, indicating that nk cells may induce the acute rejection of peripheral nerve xenotransplantation . However, in the presence of bdnf, the number of nk cells in the xenotransplanted mice was significantly low, suggesting that bdnf inhibits the rejection of peripheral nerve xenotransplantation by decreasing the level of nk cells . Nkt cells are innate - like t cells that recognize lipid antigens presented by the nonpolymorphic major histocompatibility complex class i - like molecule cd1d . It has been demonstrated that nkt cells are required for the induction of tolerance of islet xenografts and cardiac allografts.34,35 in the current study, there was no significant difference in the number of nkt cells between the xt only mice and the sham control group, but it increased significantly in the mice of xt plus bdnf group, suggesting that bdnf enhances the effect of nkt cells in inducing peripheral nerve xenograft tolerance by increasing the number of nkt cells . Following the activation of innate immune cells, such as nk and nkt cells, adaptive immune cells, including t cells and b cells, are activated during the acute rejection of peripheral nerve xenotransplantation . In this context, it has been demonstrated that cellular immunity, especially t cells, plays a vital role during organ xenotransplant rejection.3639 in addition to direct killing activity by cytotoxic t lymphocytes, xenograft rejection can occur through t cell - mediated mechanisms, including cytokine production, recruitment and activation of other cytotoxic cells, and by providing help for b cells that produce xenoreactive antibodies.40 we demonstrated that both ifn-- and il-17-producing cd4 + and cd8 + t cells play a crucial role during the acute rejection of peripheral nerve xenotransplantation.41 we further showed that the number of cd3 + t cells, th1 cells, and th17 cells was suppressed by bdnf, while the subsets of th2 cells and tregs were upregulated by bdnf in the xenotransplanted mice . In addition, serum concentrations of il-6, il-17, tnf-, and ifn- were significantly inhibited by bdnf in the xenotransplanted mice . These results indicate that topical application of bdnf after peripheral nerve xenotransplantation results in the inhibition of th1 and th17 cells, but activation of th2 cells and tregs, and by using this mechanism, bdnf may inhibit the rejection of xenotransplanted peripheral nerve segment . Besides t cell and its subgroups, b cells also play a crucial role in transplant rejection such as in kidney and liver transplantation by secreting target - specific antibodies . In the present study, b cells were also significantly suppressed by bdnf in the xenotransplanted mice, indicating that bdnf regulates target - specific antibodies by suppressing b cells . In contrast to organ transplantation such as the kidney, heart, or liver transplantation, in which survival of the transplanted organs is crucial to have long - term organ function, the peripheral nerve xenograft functions for a limited time only . Thus, once the regenerative nerve can pass the nerve xenografts in a short period following the transplantation, the function of peripheral nerve xenografts is completed, regardless of the survival or death of the transplanted nerve . The current study demonstrated that bdnf plays an essential role in inhibiting the acute rejection of peripheral nerve xenotransplantation by modulating the immune reaction in the xenotranplanted nerves . In summary, the current study demonstrated that the number of nk cells, th1 cells, th17 cells, and b cells in the xenotransplated nerves was significantly reduced by bdnf, while the number of nkt, th2 cells, and tregs in the xenotransplanted spleen was significantly increased by bdnf . In addition, cytokines released by the aforementioned immune cells were also modulated by bdnf . These findings suggest that bdnf inhibits the peripheral nerve xenograft rejection by regulating the paradigm of nk / nkt and th1/th2/th17/tregs.
A number of investigators have proposed an association between periodontitis and psychosocial stress and the majority of studies in a systematic review found a positive relationship between stress / psychological factors and periodontal disease . However, the relationship between periodontitis and stress - related hormones in saliva is poorly understood . In general, the stress system consists of brain elements, of which the main components are the corticotropin - releasing hormone (crh) and locus ceruleus - norepinephrine / autonomic systems, as well as their peripheral effectors, the hypothalamic - pituitary - adrenal (hpa) axis, and sympatho - adrenomedullary system . A well - known stress - related hormone is cortisol, while its salivary level reliably reflects hpa activity and has long been used in human psychological studies as a biological marker of stress . Further, dhea is also known as an hpa - related steroid hormone and has a positive correlation with depression severity [4, 5]. Smoking is associated with elevated cortisol and dhea levels, as it increases the levels of adrenocorticotropin hormone (acth). In addition, smoking is also a major risk for periodontitis and considered likely to be a significant mediator in the relationship between stress - related disorders and the hpa axis . However, to date scant attention has been given to smoking regarding the association between those hormones and periodontal status . We hypothesized that measurement of these hormone levels would be useful for screening for periodontitis in patients who never smoked, since smoking is a stronger risk factor for periodontitis . In the present study, we investigated the associations between those levels and periodontitis in never - smokers and smokers . We also assessed cortisol and dhea as practical candidate biomarkers for screening of periodontal disease by using receiver operating characteristic (roc) analyses . The subjects in this cross - sectional study were recruited from members of two senior citizen colleges in kitakyushu city, japan . The study sample consisted of community - dwelling, independently living elderly people aged 60 years old and older who attended lectures once a week . These colleges are part of the adult educational system supported by the government of kitakyushu city, which enrolls students as volunteers for a period of one year . The course of study focused not only on health topics but also on other topics of interest to elderly people, such as finance and culture . The study population voluntarily participated in oral and systemic examinations and initially consisted of 231 subjects (116 males, 115 females) residing in fukuoka prefecture, japan . All of the subjects were independent in daily activities, with none hospitalized at the time of the study, as described previously . Exclusion criteria were as follows: (1) individuals who chronically used corticosteroids and/or immune suppressor drugs as well as those with immune suppressor diseases; (2) individuals with missing questionnaires or saliva data; (3) individuals who used antibiotics within the last 6 months, had symptoms of acute illness, or had any apparent oral infections; and (4) individuals with fewer than 3 natural teeth . As a result, we evaluated a total of 171 subjects (85 males, 86 females; mean age 68.4 4.46 years old) in the present study . We also assessed the differences between the 171 subjects who completed the study and the 60 subjects had been excluded earlier and found no significant differences regarding the tested variables . All subjects understood the nature of the research project and provided written informed consent . The study protocol was reviewed and approved by the ethics committee of kyushu dental college (no . Each subject was asked to respond to a survey conducted by a dental nurse that consisted of questions related to general medical condition, medication usage, lifestyle, oral health behavior, and oral hygiene habits, and each was also questioned verbally to obtain information regarding smoking status (never, past, or current). The subjects were classified as either never - smokers or smokers (i.e., past, current) on the basis of their answers . Furthermore, a method that used face - scale scores was used to evaluate self - rated health status . From those scores, the subjects were divided into three groups based on overall health (moderate, good, and very good). Saliva samples were collected from all subjects between 11:00 am and 1:00 pm to minimize any circadian rhythm effects, after they had refrained from oral intake for at least 2 hours prior to collection . The subjects were first asked to swallow all saliva in the mouth, then chew paraffin for 3 minutes at a constant pace of 60 times per minute, which was monitored with an electric metronome . Collected samples were placed on ice immediately and the salivary flow rate (ml / min) was estimated by measuring the volume of saliva collected in the tube . Thereafter, the saliva samples were frozen at 30c until further analysis . The concentration of cortisol in saliva (ng / ml) was measured using a salivary cortisol enzyme immunoassay kit (salimetrics, state college, pa), with a lower sensitivity limit of 0.07 ng / ml, while that of dhea (pg / ml) was determined using a salivary dhea enzyme immunoassay kit (salimetrics, state college, pa), with a lower sensitivity limit of 10 pg / ml . Periodontal status was evaluated using probing depth (pd), bleeding on probing (bop), and clinical attachment loss (cal). Periodontal examinations were conducted at two sites (mesio - buccal, mid - buccal) of all teeth examined, using a standard periodontal probe (hu - friedy, chicago, il .) That was inserted into the periodontal pocket parallel to the long axis of all teeth fully erupted in the mouth, according to a modified method described in the third national health and nutrition examination survey (nhanes iii), with some modifications . The intraclass correlation coefficients between examiners for assessment of pd and cal were 0.72 (95% confidence interval (ci) 0.560.82) and 0.74 (95% ci 0.600.84), respectively, while those for intraexaminer were 0.78 (95% ci 0.660.87) and 0.84 (95% ci 0.740.90), respectively . Severe periodontitis was defined as maximum pd 5 mm or maximum cal 6 mm using the mean value of each cutoff point . Further, in order to evaluate extensive periodontitis, we divided the subjects into three categories (none, low, and high) according to the number of teeth with maximum pd 5 mm or cal 6 mm, as described previously . Thus, for those with pd, the none group included subjects with no teeth with pd 5 mm, while the low group included those with less than 3 teeth with pd 5 mm, and the high group those with 3 or more teeth with pd 5 mm involved . As for cal, the none group included subjects with no teeth with cal 6 mm, while the low group included those with less than 3 teeth with cal 6 mm, and the high group those with 3 or more teeth with cal 6 mm involved . In order to assess differences among the groups, a chi - square test was used for categorized variables and a kruskal - wallis test or anova for continuous variables . If a normal distribution was not present according to the results of a kolomogorov - smirnov test, the former test was used . Receiver operating characteristics (rocs) analyses were performed to determine the optimum cutoff values for the concentrations of cortisol and dhea, which were used to screen for severe periodontal status . Subjects with severe periodontal status were dichotomized into periodontitis - negative (i.e., none = 0) and periodontitis - positive (i.e., low and high = 1), based on the pd and cal levels . This dichotomy was then used to calculate the sensitivity and specificity for the cutoff values of cortisol and dhea . Roc curves were plotted for cortisol and dhea with pd and cal and the area under the roc curve (auc) was calculated for each . The optimum sensitivity and corresponding specificity were determined from the point on the plot that was closest to the top left - hand corner of the axes . Tables 1 and 2 show subject characteristics of the 3 groups divided according to pd and cal stratified by smoking status, which were used to analyze the relationships of cortisol and dhea levels in saliva with periodontal health status . For pd in never - smokers, there were significant differences among the groups regarding age, bop, and self - rated health status (based on face - scale score), while there were also significant differences for the number of teeth, frequency of tooth brushing, and self - rated health status in the smokers group (table 1). As for cal there were significant differences regarding sex and bop in the never - smokers, while there were significant differences between age and self - rated health status in the smokers (table 2). As shown in tables 1 and 2, most of the smokers were male (approximately 96%). Among never - smokers, the median and 25th and 75th percentile values for cortisol were 1.87, 1.42, and 2.89 (ng / ml), respectively, while those for dhea were 59.79, 32.69, and 89.52 (pg / ml), respectively . In contrast, among smokers, the median and 25th and 75th percentile values for cortisol were 2.18, 1.41, and 3.01 (ng / ml), respectively, while those for dhea were 46.07, 30.07, and 89.77 (pg / ml), respectively . However, there were no significant differences regarding those hormone levels between smokers and never - smokers . We compared the levels of cortisol and dhea between the with and without extensive periodontitis groups, which were defined by the number of teeth with pd 5 mm or cal 6 mm . Table 3 shows the results of that comparison in the never - smokers, while table 4 shows the results for smokers . As for the levels of both in the never - smokers, significant differences were found among the three categories defined by pd and cal, and higher hormone levels were found in subjects with severe pd or cal . However, in smokers, no significant differences were found among the 3 categories defined by pd or cal . In contrast, in comparisons of salivary flow rate, there were no significant differences among the three categories for both pd and cal, irrespective of smoking status (tables 3 and 4). Next we evaluated the usefulness of measuring cortisol and dhea levels to screen for periodontitis in never - smokers with the above - mentioned associations . For that purpose, we performed roc analysis to discriminate between false - positive and true - positive diagnoses of severe periodontitis (i.e., low and high) at various cutoff levels . The area under the curve (auc) for pd was 0.68 (95% ci 0.580.78, p = .001) and 0.69 (95% ci 0.590.79, p <.001) for cortisol and dhea, respectively (figure 1). For cal, the auc was 0.71 (95% ci 0.620.81, p <.001) and 0.68 (95% ci 0.580.78, p = .002) for cortisol and dhea, respectively (figure 2). As shown in table 5, the optimal sensitivity and specificity of cortisol for pd were 0.63 and 0.71, respectively, while they were 0.67 and 0.66, respectively, for dhea, with cutoff values of 2.06 (ng / ml) for cortisol and 60.24 (pg / ml) for dhea, which indicated a corresponding level in the 55th and 51st percentile, respectively . As shown in table 6, the optimal sensitivity and specificity of cortisol for cal were 0.70 and 0.73, respectively, while they were 0.63 and 0.64, respectively, for dhea, with cutoff values of 2.12 (ng / ml) for cortisol and 61.78 (pg / ml) for dhea, which indicated a corresponding level in the 56th and 54th percentile, respectively . In the present cross - sectional study, we investigated cortisol and dhea levels and periodontal status in elderly subjects and found that levels of the salivary stress - related hormones cortisol and dhea were useful for screening for periodontitis in subjects who had never smoked . The association between periodontitis and stress - related hormones has been largely overlooked, with only two known human studies of the associations between cortisol in saliva and periodontitis reported . One of those was our own survey, while the other was a report by hilgert et al . . In the latter, the authors found a positive association between salivary cortisol and periodontitis, while hypercortisolemia was independently associated with the severity of periodontitis, as defined by cal (mean cal 4 mm versus <4 mm), and the extent of periodontitis, as defined by pd (26% versus <26% of sites with pd 4 mm) or cal (30% of sites with cal 5 mm versus <30%). However, smoking status was removed from the final model of logistic regression analysis in that report, while we did not treat smoking as a factor based on stratification of smoking status . In a recent study, treatment of smoking as a confounding factor resulted in a greatly underestimated magnitude of association . Smoking is known to be associated with elevated cortisol and dhea levels . In a recent report that compared cortisol profiles of smokers and nonsmokers over the day, cortisol levels were elevated in everyday life among smokers compared with nonsmokers, and the differences in values were quite substantial, averaging 35% or more on both working and weekend days . In the present study, cortisol levels were higher in smokers than never - smokers, though the differences were not significant (2.18 versus 1.87 ng / ml). Furthermore, salivary levels of cortisol and dhea were significantly elevated according to the severity of periodontitis, in our never - smoked subjects, whereas no significant association was observed in smokers . One possible explanation for these findings might be that the capability of those hormones to differentiate periodontally affected patients from periodontally healthy individuals is weaker than that of smoking . Conversely, since smoking itself is a stronger risk factor for periodontitis than other known risk factors, evaluation of smoking behavior may be a superior screening method for smokers . Measurement of biomarkers in saliva has many advantages, as the procedure is stress - free and noninvasive, and allows for frequent and rapid sampling, whereas diurnal rhythm, artificial changes due to food or drinking substances, and blood - contamination are some of the disadvantages . Thus, as described above in the methods section, the sampling method must be carefully performed . In order to minimize any circadian rhythm effects, we selected the period between 11:00 am and 1:00 pm for obtaining saliva samples, which has been reported to be stable in regard to daytime hormones levels in nonsmokers . A periodontal probe is generally used for periodontitis screening during community - based oral health check - ups, though several problems, including cost, burden on the subject, prevention of infection, and manpower needs, have been pointed out . Our analysis using roc curves showed acceptable sensitivity and specificity for periodontitis screening with both of the salivary hormones tested in the present study . On the other hand, progress is being made in the development of various screening tests for periodontitis using enzymes, cytokines, and antimicrobial proteins in saliva . We think that it would be better to combine several tests that reflect the multiple risk factors associated with periodontitis and not depend on results of a single test . On the other hand, it is important to consider the cost - effectiveness when promoting such screening tests for clinical use . A commercial test kit for cortisol costs approximately us$250 and can be used 50 subjects, that is, us$5.00 per test . However, additional costs must be added when considering the required manpower for the assay and other laboratory charges . In the near future, it is anticipated that screening tests used for a large population will be noninvasive and less burdensome for the subjects, with no requirements of specific devices or instruments, or for individual examinations by an expert as well as reasonable cost - effectiveness performance . A limitation of the present study is that our subjects were generally in good health and noninstitutionalized . In addition, the percentage of subjects with severely extensive periodontitis among all subjects analyzed was low . Thus, these findings may indicate that the association exists primarily in systemically and orally healthy elderly individuals . Furthermore, it is possible that the periodontal examination method that utilized two sites per tooth in this study, which was based on nhans iii, may underestimate the severity and extent of periodontitis . Additional investigations are necessary to validate and extend the findings using other ages or outpatients . Further, the usefulness of cortisol and dhea as predictors for periodontitis cannot be determined from our findings, and a longitudinal study is necessary to determine the relationships of those hormones to the progression of periodontitis . In summary, we found a significant association between the salivary steroid hormones cortisol and dhea and periodontitis severity in community - dwelling elderly subjects who had never smoked . These results indicate that these stress - related hormones are useful indicators of the risk for periodontitis, as they showed moderate levels of sensitivity and specificity for periodontitis . Within the study limitations regarding smoking status, the present method of determining cortisol and dhea levels may include a possibility as screening test for periodontal disease in the near future . Additional approaches to reveal a new type of screening test system for periodontitis as an alternative to the conventional probing method are required.
The present study is a retrospective cohort study, undertaken as part of the ongoing finndiane study (finnish diabetic nephropathy study), which has since 1997 collected comprehensive data from patients with type 1 diabetes at 92 centers throughout finland, including primary care as well as secondary and tertiary care hospitals with the aim of identifying genetic and environmental risk factors for diabetes complications . All adult patients with type 1 diabetes at these centers have been invited to participate in the finndiane study, and 78% have responded positively (10). The recruitment strategy is random because the only inclusion criterion is type 1 diabetes, and every patient at the recruiting centers has been invited . The finndiane study has to date recruited 4,800 patients with type 1 diabetes, and although it is not by strict definition a population - based study, the distribution of the patients closely follows the distribution of the general population in finland . Thus, there is no bias in the sampling procedure regarding the geographic location or selection of patients in the recruiting centers . The protocol is in accordance with the declaration of helsinki and was approved by the ethics committee of the helsinki university central hospital . Inclusion of patients in the present study was based on the ascending order of the finndiane patient identification numbers . Thus, the consecutively recruited patients from the very beginning of the finndiane study were the first to be included in this study . . First the sampling frame should be as random as possible with regard to ophthalmic status and the treatment of diabetes and its complications . Second, these patients had the longest duration of type 1 diabetes because they were the first ones to participate in the finndiane study . We obtained fundus photographs and/or records of fundus examinations performed by a specialist in ophthalmology for 1,117 consecutively recruited patients . These patients were required to have onset of diabetes at the age of 40 years, c - peptide 0.3 nmol / l (11), and insulin treatment initiated within 1 year of diagnosis . For 972 of 1,117 (87%) patients, c - peptide concentrations were <0.033 nmol / l, which represents the detection limit of the assay (human c - peptide ria kit, linco research ., records of fundus examinations by a specialist in ophthalmology were available for 917 of 1,117 (82%) patients, and fundus photographs were available for 851 of 1,117 (76%) patients . The patients who had fundus photographs available (n = 851) had been photographed a total of 2,792 times, on a median of 3 (interquartile range [iqr] 15) times per patient . All available data were used to score the severity and progression of retinopathy, a procedure handled by an ophthalmologist (k.h .) The early treatment of diabetic retinopathy study (etdrs)-grading scale was used, for which 10 represents no retinopathy, 61 represents proliferative retinopathy, and 8185 represents advanced retinopathy (12). The eye with the more severe retinopathy study laser treatment alone was not taken as evidence of proliferative retinopathy because severe nonproliferative retinopathy is also an indication for scatter laser photocoagulation . Data on medication, cardiovascular status, diabetes complications, hypertension, and cardiovascular disease were obtained using a standardized questionnaire, which was completed by the patient's attending physician . Blood pressure was measured twice in the sitting position using a mercury sphygmomanometer after a rest of at least 10 min . Mean arterial blood pressure was calculated according to the formula: mean arterial pressure = diastolic blood pressure + (systolic blood pressure diastolic blood pressure). Anthropometric data, such as height and weight were recorded, and blood was drawn for the laboratory measurements, including a1c . Data on all - cause mortality were obtained from a national registry maintained by the population register centre of finland . Data are presented as means (95% ci) for continuous, normally distributed variables and medians (iqr) for nonnormally distributed variables . Kaplan - meier survival analysis was used to estimate time without proliferative retinopathy and a mantel - cox log - rank test was used to compare survival distributions among different age - at - onset groups . The risk of proliferative retinopathy within the age - at - onset groups was estimated with a cox proportional hazards model, controlling for clinically significant covariates . One - way anova, adjusted for multiple comparisons (sidak), was used to compare the mean differences of these groups . Proportions were compared with a kruskal - wallis test . A previously published macro for sas statistical software (sas, cary, nc) was used to compute the cumulative incidence of proliferative retinopathy and cumulative mortality before the development of proliferative retinopathy accounting for competing events (13). All other statistical calculations were performed with spss 15.0 (spss, chicago, il, usa). Data are presented as means (95% ci) for continuous, normally distributed variables and medians (iqr) for nonnormally distributed variables . Kaplan - meier survival analysis was used to estimate time without proliferative retinopathy and a mantel - cox log - rank test was used to compare survival distributions among different age - at - onset groups . The risk of proliferative retinopathy within the age - at - onset groups was estimated with a cox proportional hazards model, controlling for clinically significant covariates . One - way anova, adjusted for multiple comparisons (sidak), was used to compare the mean differences of these groups . A previously published macro for sas statistical software (sas, cary, nc) was used to compute the cumulative incidence of proliferative retinopathy and cumulative mortality before the development of proliferative retinopathy accounting for competing events (13). All other statistical calculations were performed with spss 15.0 (spss, chicago, il, usa). Mean age at onset of type 1 diabetes was 13.7 (95% ci 13.114.1) years and the mean duration of diabetes was 25.0 (24.425.7) years (table 1). The highest proportion of patients with proliferative retinopathy was found in age - at - onset group 04 years (47.0% [95% ci 39.554.6]), the second highest in age - at - onset group 514 years (38.8% [34.7.542.9]), and the lowest in age - at - onset group 1540 years (18.9% [15.022.7]) (table 2). Ophthalmic follow - up data were available for a median of 10.8 (iqr 5.917.4) years after the diagnosis of proliferative retinopathy . Clinical characteristics of patients without any retinopathy compared with patients with nonproliferative and proliferative retinopathy data are means (95% ci) or n (%). Clinical characteristics of patients in different age - at - onset groups data are means (95% ci) unless indicated otherwise . Mean duration from onset of diabetes to proliferative retinopathy was 21.3 (95% ci 20.622.1) years in all patients . The longest duration to proliferative retinopathy was 24.3 (22.725.9) years in the 04 years group (n = 79), whereas the shortest was 20.1 (19.221.1) years in the 514 years group (n = 212). In the 1540 years group the duration to proliferative retinopathy was 21.6 (19.823.3) years (n = 76) (table 2). The mean se difference in the duration of diabetes to proliferative retinopathy between age - at - onset groups 04 and 514 years was statistically significant (4.2 0.9 years, p <0.001). However, the mean difference between the other two groups did not reach statistical significance . The youngest age - at - onset group had the longest duration of diabetes (31.12 [95% ci 29.532.7] years), highest a1c (8.8 [8.59.0]%), and the highest proportion of patients with c - peptide below the detection limit (96.4 [92.498.7]%) (table 2). Patients with proliferative retinopathy had the highest mortality (20.4%), the highest bmi (25.5 [25.125.9] kg / m), and the longest duration of diabetes (33.1 [32.234.0] years) (table 1). In the cox proportional hazards model, with potentially significant risk factors (a1c, blood pressure, sex, and bmi) as covariates, onset of diabetes between 5 and 14 years of age increased the risk of proliferative retinopathy the most (hazard ratio [hr] 1.90 [95% ci 1.452.48], p <0.001) as contrasted with age - at - onset group 1540 years (table 3). Similarly, patients with age at onset 04 years had a higher risk of proliferative retinopathy (1.61 [1.162.23], p = 0.002). As for the other covariates, the risk of proliferative retinopathy increased 15% with every unit increase in a1c percentage (1.15 [1.071.23], p <0.001) and 3% with every 1 mmhg increase in mean arterial blood pressure (1.03 [1.021.04], p <0.001). When age - at - onset group 04 years was compared with the age - at - onset group with the highest risk (514 years), the long - term risk of proliferative retinopathy, adjusted for the above - mentioned covariates, showed no difference (0.85 [0.651.10], p = 0.2). The worst prognosis seems to be in age - at - onset group 59 years . However, if compared with age at onset 1014 years, this difference did not reach statistical significance (1.29 [0.981.70], p = 0.07). Because the patients in groups 59 and 1014 years did not have a significantly different risk, they are presented as a combined age - at - onset group 514 years in this study . Risk of proliferative retinopathy in age - at - onset groups 04 years and 514 years compared with age - at - onset group 1540 years: cox proportional hazards model age - at - onset group 04 years, n = 164; age - at - onset group 514 years, n = 537; age - at - onset group 1540 years, n = 400 . The kaplan - meier survival analysis stratified by various age - at - onset groups illustrates the progression to proliferative retinopathy (fig . Median times without proliferative retinopathy were 28.9 (24.633.2), 29.2 (26.132.2), and 37.8 (32.343.4) years in age - at - onset groups 04 years, 514 years, and 1540 years, respectively (p <0.001, mantel - cox log - rank test) (fig . 1). Despite the initial delay in the progression to proliferative retinopathy in the youngest age - at - onset group, the long - term risk between age - at - onset groups 04 and 514 years was no different (p = 0.224, mantel - cox log - rank test) (fig . However, there was a significant difference when the patients were split into two groups according to age at onset before or after 15 years of age (p <0.001, mantel - cox log - rank test). Median times without proliferative retinopathy were 28.9 (95% ci 26.431.4) years for the patients with age at onset before 15 years and 37.8 (95% ci 32.343.4) years for the patients with age at onset after 15 years . The risk of proliferative retinopathy was significantly higher in those patients with age at onset before 15 years versus after 15 years, when adjusted for the above - mentioned covariates (hr 1.82 [95% ci 1.402.36], p <0.001). Kaplan - meier survival analysis of the cumulative proportion of patients without proliferative retinopathy (pdr) in 1,117 patients stratified into three groups according to age at onset (p <0.001, mantel - cox log - rank test). A total of 99 of the 1,117 patients (8.9%) had died during the follow - up . Of these 75 of 99 (75.8%) had proliferative retinopathy (table 1). This study shows that the patients with the youngest age at onset (04 years) have the longest mean duration of type 1 diabetes without proliferative retinopathy (24.3 [95% ci 22.725.9] years). This observation is in line with earlier findings regarding diabetic retinopathy and nephropathy (7,8,14). However, the long - term risk of proliferative retinopathy is no different between age - at - onset groups 04 and 514 years despite the initial advantage for those with earlier onset of diabetes . Ultimately, the survival curves for these two groups cross each other when the duration of diabetes approaches 30 years . The survival curve for those patients with age at onset of type 1 diabetes at 1540 years appears to be consistently better than that for patients with younger age of onset . It can be hypothesized that it may be easier to learn good self - care skills at a very young age compared with the prepubertal period (14). Learning good self - care skills may take a longer time in prepubertal children compared with young children, which would explain the delayed onset of proliferative retinopathy in the youngest patients . In addition to behavioral factors, hormonal changes in puberty may contribute to worse metabolic control (16). Furthermore, the initial advantage for the younger patients may be due to more stringent management of type 1 diabetes, because this has been shown to reduce the decline in insulin production (17). Diabetes onset at puberty has been linked to a less aggressive form of type 1 diabetes (18), and it has also been observed that -cells are better preserved when type 1 diabetes begins in the adulthood (19). We observed a longer time without proliferative retinopathy as well as a lower risk of proliferative retinopathy for age - at - onset group 1540 years . This finding could be explained by preservation of -cells as these patients also had the highest c - peptide concentrations . The diabetes control and complications trial data indicated that patients with any residual c - peptide secretion, but especially those with the highest stimulated concentrations, had a reduced incidence of retinopathy and nephropathy (20). The role of c - peptide has been somewhat controversial, because it has not been linked to retinopathy in other studies (3). In our study those patients with a higher c - peptide concentration had less proliferative retinopathy, later age at onset, and lower a1c (tables 1 and 2). The association of age at onset with the risk of diabetic retinopathy may not be limited to type 1 diabetes . It has recently been noted that a higher age at onset of diabetes reduces the risk of retinopathy in type 2 diabetic patients as well (21). An advantage of our study is that the timing of onset of proliferative retinopathy is robust, because it was based on several examinations and/or serial fundus photographs . Only in 19 of 367 (5.2%) thus, there were no available reference points for these patients before they had developed proliferative retinopathy . Because these 19 patients comprise only 5.2% of all the patients with proliferative retinopathy, the possible inaccuracy introduced by these patients was judged to be negligible, and they were kept in the study . All of the other patients (n = 348) had had at least one ophthalmic examination on a median of 0.7 (0.31.8) years before the diagnosis . In addition, records of treatment and follow - up were available for nearly all (364 of 367) patients with proliferative retinopathy . Retinal photography has been reported to be the most sensitive screening method for diabetic retinopathy . It provides good results in the hands of trained professionals such as ophthalmologists and diabetologists, especially when used in repeated examinations (22). In finland, the national guidelines for the screening of diabetic retinopathy were published already in 1992 and updated in 2006, along the european guidelines, which emphasize fundus photography as the preferable screening method (23). As a result, fundus photographs were available for as many as 851 of 1,117 (76%) patients . The generalizability of the present results may be limited by the fact that the finndiane study is not by strict definition a population - based study . In any case, a possible selection bias is unlikely because the geographic distribution of the finndiane patients closely follows the distribution of the general population, and the patient recruitment at the participating centers can be considered random . Furthermore, the diagnosis and treatment of diabetes and its complications are fairly uniform across finland . There has been only one population - based study on the prevalence of proliferative retinopathy among patients with type 1 diabetes in finland in a sample of 1,067 patients, and the results are comparable to ours (24). Accounting for the cumulative mortality by using a previously published sas macro (13) did not change the outcome of either kaplan - meier or cox regression analysis . Interestingly, 75 of 99 patients who had died during the follow - up had developed proliferative retinopathy . The ultimate long - term risk of proliferative retinopathy appears therefore to be roughly 75% for the finndiane study population . Finally, there may also be a confounding cohort effect in the present study, because the oldest patients may have a worse prognosis than the younger ones attributable to improvements in medical care of diabetes (25). The first way was to use the year of onset of diabetes as a continuous variable in the cox regression model . The other was to use the decade of onset of diabetes as a categorical variable . Both of these variables were statistically nonsignificant . In summary, our study shows a longer time free of proliferative retinopathy in the youngest patients . In contrast, those patients with age at onset of type 1 diabetes between 15 and 40 years may have a consistently better prognosis than any patient group with age at onset <15 years.
Qualitative and quantitative disturbances in the function of salivary glands are detrimental to the oral environment, adversely influencing patients quality of life.1, 2 three pairs of salivary glands, namely parotid, sublingual and submandibular glands, secrete saliva into the oral cavity through specific ducts . Salivary glands are extremely susceptible to radiation injuries with parotid glands being more susceptible than others . Serous acini are more susceptible to radiation compared to mucous acini.1, 2 clinical evaluations have demonstrated that subsequent to a single radiotherapy dose, serous acini are immediately destroyed; however, mucous acini demonstrate no acute histological changes . Therefore, immediately after radiotherapy is initiated, patients saliva becomes thicker . With the continuation of radiotherapy, mucous cells are also affected and salivary flow rate decreases, depending on the gland that is in the path of direct radiation rays.2, 3 the severity of xerostomia depends on the gland involved, radiation dose and dose rate (the intervals of radiations). The glands that are partially exposed to radiation demonstrate higher salivation compared to the glands that are completely exposed to radiation . Radiation exposure on one side may not completely affect glands on the other side; therefore, it may not result in severe xerostomia . However, directing rays to the nasopharynx exposes parotid glands to radiation on both sides, leading to severe xerostomia.2, 3, 4 xerostomia, the most common complication in patients with nasopharyngeal carcinomas following radiotherapy, makes mastication, deglutition and denture wearing difficult for patients . In addition to its constant effect on the patient s daily life, long - term xerostomia predisposes the patient to oral candidiasis . Subsequent to radiotherapy, these patients run a higher risk of dental caries, especially root surface caries . This higher risk is attributed to a decrease in saliva quality and quantity, a shift in the oral flora towards cariogenic microorganisms, and changes in diet . Therefore, it is critically important that dental practitioners have broad knowledge about potential oral complications following radiotherapy procedures in the head and neck region to be able to render efficacious treatment modalities and minimize or eliminate problems.2, 5 no definitive treatment modalities or preventive measures have been introduced for xerostomia to date . In our community no studies have been carried out about xerostomia; therefore, we decided to evaluate xerostomia in patients under radiotherapy before engaging in an interventional study and comparing various procedures and confounding variables . We decided to use the results of this preliminary study in the following interventional study to determine factors involved in decreasing xerostomia severity . Since, according to some studies, xerostomia and other concomitant complications of radiotherapy begin to manifest themselves approximately in the third week of the procedure we decided to compare the third week data with baseline records . The study was carried out in the radiotherapy department of tabriz imam khomeini hospital . All of the patients referring to the department of radiotherapy from 22 june 2005 to 21 june 2006, who had the following inclusion criteria, were included in the study: nasopharyngeal carcinomas with similar stages, i.e. Local and local advanced stages no history of surgical removal of salivary glands absence of any signs and symptoms of distant metastasis no history of saliva - reducing medications, such as anticholinergics and antidepressants absence of diabetes (evaluated with fbs test before the study) a questionnaire was filled out for each patient . The patients were asked to refrain form eating, drinking, brushing and smoking at least for two hours before sample collection . In addition, they were given identical hygienic and food regimens . During the study all removable prostheses were removed so that they could not function as foreign bodies which can act as impeding factors in salivation . All the samples were collected in one well - illuminated room while the patients were in a sitting position . The radiotherapy of these patients was an external procedure, in which the nasopharyax and lymph nodes of the neck received cobalt 60 (~6mv) radiation with two lateral fields, which consisted of an initial dose of 4400 - 4500 cgy in 25 sessions (fractions), comprising 180 - 200 cgy daily . Then, after a two - day interval, spinal cord was removed from the radiation field and the field was tailored . Based on the case involved, the patients received a booster dose, which is a procedure called conventional radiotherapy . Saliva samples were collected by spitting method three times, i.e. Before treatment, 3 weeks after the initiation of treatment and at the end of treatment . During sample collection, the patients evacuated their saliva into a glass every 60 seconds for 2 - 5 minutes and then the volume of the sample was measured with a graduated pipette and recorded in the patients questionnaires . One - way anova to test the significance of differences between means, paired sample t - test for the two - by - two comparison of means, independent sample t - test to compare the differences in the mean values between independent groups, and pearson s correlation coefficient to evaluate the relationship between quantitative variables were used . One - way anova to test the significance of differences between means, paired sample t - test for the two - by - two comparison of means, independent sample t - test to compare the differences in the mean values between independent groups, and pearson s correlation coefficient to evaluate the relationship between quantitative variables were used . A total of 30 subjects were studied, 63.3% being males and 36.7% females (19 males and 11 females). Mean age of the patients was 51.1715.44; mean age of females and males were 51.3614.88 and 51.0516.16, respectively . Mean values of salivation before radiotherapy in the study population, and in males and females separately, were 1.320.37 ml, 1.340.41 ml, and 1.250.30 ml in 5 minutes, respectively . Mean values of salivation in the third week after the initiation of treatment in the study population, in males and females separately were 0.840.35 ml, 0.850.38 ml and 0.800.90 ml in 5 minutes, respectively . Means of salivation at the end of treatment in the study population, in males and females separately were 0.420.31 ml, 0.440.33 ml and 0.380.28 ml in 5 minutes, respectively (table 1 & 2). Salivation 1: salivation before radiotherapy: all the subjects salivation 2: salivation 3 weeks after radiotherapy: males: females salivation 3: salivation at the end of radiotherapy:males compared to females pearson s correlation coefficient demonstrated the following: there was no statistical relationship between the decrease in salivary flow rate and all patients age (p = 0.76, n = 30, r = -0.057), males age (p = 0.96, n = 19, r = 0.011) and females age (p = 0.539, n = 11, r = -0.208). Despite great progress in cancer biology and radiotherapy techniques in recent decades, malfunction of salivary glands remains a major and ever - lasting problem subsequent to radiotherapy of head and neck malignancies . The majority of patients experience severe xerostomia, which adversely influences their quality of life . The patients salivary samples were collected by spitting at three intervals: before treatment, 3 weeks after radiotherapy was instituted, and at the end of treatment . The results demonstrated that differences in the means of salivation 3 weeks after the initiation of radiotherapy compared to baseline data, at the end of radiotherapy compared to baseline data, and at the end of treatment compared to 3 weeks after radiotherapy was initiated, were statically significant . However, there was no relationship between the decreases in the means of salivation and variables such as age and sex . The results of the present study are consistent with the results of studies carried out by jen yee - min et al, 2006; nagler, 2002; moller et al, 2004.1, 3, 8 yee - min attributed the decrease in salivary flow rate to the destruction of cells in serous acini and to the progression of an acute classic inflammatory process, which takes place 24 hours after receiving a 12.5-gy radiation dose . The histologic basis for a decrease in salivary flow rate has not been elucidated to data . However, recent molecular evaluations have demonstrated that pro - inflammatory cytokines such as tnf- result in a decrease in the release of aquaporin 5 (a group of membrane proteins responsible for the transportation of water through membranes), contributing to a decrease in the production of aqueous solution of saliva . Yee - min introduced the received radiation does as the most important factor involved in radiotherapy - induced xerostomia . Nagler reported that the complications of radiotherapy manifested in the salivary glands in the first weeks after the institution of radiotherapy are transient and secondary to oropharyngael syndrome . The syndrome consists of a transient severe mucositis, resulting in dehydration, malnutrition and inadequate chewing of food due to intense pain . Nagler introduced cell death through apoptosis as an important factor in early radiation - induced xerostomia; this cell death was attributed to injuries to membranes as a result of peroxidation of membrane lipids . In addition, long - term xerostomia was attributed to the damage to dna, which can be observed during cellular mitosis, and to a decrease in mitotic rate . Moller, consistent with nagler s report, attributed the noticeable decrease in salivation to the death of cells in serous acini through apoptosis in the early stages and to cellular necrosis in the late stage . In addition, moller believed the received dose by salivary glands was an important factor in determining the severity of xerostomia, pointing out that more than 2/3 of the baseline salivation is lost during radiotherapy . Considering the results of the above - mentioned studies and the almost identical doses used in those studies and our study (approximately 60 - 65 gy), we believe similar mechanisms were involved in our subjects . Although we have been unable to find a research study, thoroughly evaluating the effects of age and sex on radiation - induced xerostomia, the results of our study in terms of the influence of age and sex on salivary flow rate are consistent with the results of studies carried out by yee - min et al, 2006; liu et al, 1990; moller et al, 2004; shern et al, 1993; bretz et al, 2001; and fischer, 1990 . However, our results do not coincide with the results of a study carried out by fenoll - palomanes, 2004, who reported statistically significant relationship between sex and decrease in salivation and also between age and decrease in salivary flow rate . Percival attributes the lower rate of salivation in females compared to males, which is statistically significant, to the smaller size of salivary glands in women and hormonal differences . Postmenopausal females have a lower salivary flow rate but this lower rate cannot be attributed to a decrease in estrogen secretion and further comprehensive studies are required . Fenoll - palomares believes, in addition to the smaller size of salivary glands in females, higher rate of autoimmune diseases in females compated to males is involved in the lower salivary flow rate in females since autoimmune diseases are important factors involved in xerostomia . Percival attributes the disparity between the results of his study with the results of studies carried out by ben - aryeh et al, 1984, and heft and baun, 1984, to differences in sample collection methods . Ben - aryeh and heft and baun did not find any statistically significant differences between males and females . Percival collected his samples in a 10-minute period (contrary to 5-minute periods in the present study and other studies), which may have resulted in higher volumes of salvation and different results . We, too, attribute lack of significant differences between males and females, in the present study, to differences in the methods employed and recommend further extensive studies to elucidate the role of gender in radiotherapy - induced xerostomia . There is considerable controversy over the role of age in salivary flow rate and only limited studies have been carried out on the subject . Researchers have attributed the differences in results to differences in the methods used, differences in the criteria for case selection, differences in sample collection and finally inclusion of subjects who were taking medications which influence salivation . A study by scott in 1977 demonstrated histologic changes in human submandibular salivary glands due to senescence . Some researchers believe that unstimulated salivary flow rate decreases with age, which can be attributed to the destruction of the parenchyme of the glands due to senescence . On the contrary, some researchers such as fischer (1999) believe that healthy senile individuals have a salivary flow rate similar to healthy young people and attribute this similarity to the high reserve capacity of salivary glands, especially parotid, which has also been confirmed in the present study . The present study confirms that patients with nasopharyngeal carcinomas will experience severe xerostomia subsequent to radiotherapy, with no statistically significant differences between males and females.
Avibactam is a non--lactam--lactamase inhibitor with activity against class c enzymes, most class a enzymes (including kpcs), and some class d (oxa) carbapenemases . When ceftazidime is combined with avibactam, the spectrum of activity is expanded to include organisms producing these -lactamases [24]. This combination is currently in phase 3 clinical trials for the treatment of gram - negative infections . It is important to know if small variations from standard clinical laboratory standards institute (clsi) testing guidelines cause any significant changes in testing outcome . These variations can have effects on the mic when testing -lactams, including cephalosporins and -lactam--lactamase inhibitor combinations [57]. The effect of varying the broth microdilution in vitro testing parameters on the ceftazidime - avibactam mic of -lactamase positive and negative enterobacteriaceae and pseudomonas aeruginosa isolates was determined and compared with the effects on meropenem and piperacillin - tazobactam mics . Isolates were obtained from atcc (manassas, va), jmi laboratories (north liberty, ia), or the cerexa, inc . Culture collection . Mics were determined for ceftazidime - avibactam (ceftazidime: usp, avibactam: forest laboratories, inc . ), meropenem (usp), and piperacillin - tazobactam (piperacillin: sigma, tazobactam: usp) by broth microdilution assay according to clsi guidelines [8, 9]. The effects of the following parameters on the mic were determined: medium ph 5, 6, and 8 (standard ph 7.27.4); incubation with 5% co2 (standard incubation ambient air); the addition of 2.5% laked horse blood (lhb) to cation - adjusted mueller hinton broth (camhb) and testing in haemophilus test medium (htm) (standard medium camhb); testing in non - cation - adjusted media (mhb without added cations containing 2.95.9 mg / l calcium and 3.25.2 mg / l magnesium) and testing in 50 mg / l calcium in mhb (standard cation concentration 2025 mg / l calcium and 1012.5 mg / l magnesium); and inoculum densities of 5 10 cfu / ml and 5 10 cfu / ml (standard density 5 10 cfu / ml). Human serum and human serum albumin were previously shown to have no effect on ceftazidime - avibactam mics . In medium with acidic ph (ph 5 or 6), mics for ceftazidime - avibactam were increased by 4- to 16-fold for 6 of 9 enterobacteriaceae isolates and were decreased by 4-fold for 2 of 4 p. aeruginosa isolates (table 1). Acidic media caused increased piperacillin - tazobactam mics against 4 isolates and decreased mics against 3 isolates by 4-fold (table 2). Acidic media caused increased meropenem mics against 4 isolates and decreased meropenem mics against 3 isolates by 4- to 8-fold (table 3). Mic increases were observed at ph 5 against the reference strain e. coli atcc 25922 (-lactamase negative). Thus, the ph effect on mic appears to be related to the intrinsic antibacterial activity of the -lactams, rather than having an effect on the inhibition of -lactamases . The ceftazidime - avibactam mic for one e. coli isolate was increased by 4-fold when incubated in 5% co2 (table 1). Incubation in 5% co2 caused the piperacillin - tazobactam mics against 2 p. aeruginosa isolates to change by 4-fold (table 2). Testing in htm had no effect on mics with any drug except for one isolate that had 4-fold increased ceftazidime - avibactam mic (table 1). Addition of 2.5% lhb had no effect on ceftazidime - avibactam mics (table 1), caused a 4-fold decreased piperacillin - tazobactam mic against one isolate (table 2), and caused 8-fold and> 32-fold increased meropenem mics for 2 isolates (table 3). Ceftazidime - avibactam and piperacillin - tazobactam mics were unaffected by changes in calcium concentration of media (tables 1 and 2). In medium with trace calcium (mhb), mics of meropenem decreased by 4-fold against one isolate and increased by> 4-fold against another (table 3). Three isolates had ceftazidime - avibactam mics that were increased by 4- to 8-fold when the inoculum was increased 10-fold (5 10 cfu / ml) (table 1). Increased inoculum raised the mics 4- to 16-fold for piperacillin - tazobactam against 3 isolates, and lower inoculum (5 10 cfu / ml) resulted in a 4-fold decreased mic for one isolate (table 2). High inoculum density caused meropenem mics to increase by 4- to 64-fold for 7 isolates, while low inoculum density caused meropenem mics to decrease by 4- to 8-fold for 2 isolates (table 3). In summary, most of the variations in broth microdilution parameters had little effect on ceftazidime - avibactam mics . The two parameters that did have an effect were acidic media (6 isolates) and high inoculum density (3 isolates). To testing parameters only affected ceftazidime - avibactam mics for a single isolate by only 4-fold in each instance . It is possible that these individual cases are due to random variation rather than reproducible effects on mic . Piperacillin - tazobactam and meropenem mics were also affected by changes in ph and inoculum density indicating that these effects are not unique to the ceftazidime - avibactam combination . The magnitude of the changes in piperacillin - tazobactam mics was more difficult to assess due to the high mics of most isolates under standard testing conditions . The inoculum effects noted in this study with ceftazidime - avibactam mics are not surprising given that inoculum effects have been previously documented with ceftazidime mic testing, particularly against -lactamase producing strains [57]. An inoculum effect on other cephalosporin and carbapenem mics has also been previously documented; several studies have shown that mics for piperacillin - tazobactam, and to a lesser extent meropenem, are increased with higher inocula of -lactamase producing and nonproducing isolates [6, 7, 1113]. These findings indicate that slight variations in testing parameters during routine mic testing will likely have no significant effect on ceftazidime - avibactam mic values; however, special attention should be paid to closely follow clsi guidelines with respect to the ph of the media and the inoculum used . Since most laboratories use commercially prepared media, ph should not be an issue due to the buffering capacity of these media . Additionally, clsi recommends validating inoculum density on a weekly basis as part of standard quality control so any variations in inoculum should be easily identified . Therefore, if clsi guidelines and quality control recommendations are followed, there should not be any issues with routine ceftazidime - avibactam mic testing.
Systemic lupus erythematosus (sle) is a chronic autoimmune inflammatory disease that is characterized by involvement in multiple organs and the overproduction of autoantibodies . The serological symbol of sle is the redundant production of autoantibodies against the antigens that locate within the nucleus of cells, such as double - stranded dna (dsdna), which is the dominant antigen of sle . These autoantibodies are deposited within the capillaries of multiple organs with self - antigens and subsequently result in systemic disorders . Although the precise pathogenesis of sle remains unclear, abnormal immune tolerance and overactivation or hyperproliferation of t and b lymphocytes are considered to be some of the main causes . That b cells can produce multiple autoantibodies against autoantigens with help from t cells that have been verified by a number of studies in vivo or in vitro . To avoid the development of autoimmune disease, the tolerance to autoantigens should be established either before or after the initiation of an autoreactive response . An important mechanism of tolerance is anergy, which is the inability to react with some specific antigens (i.e., a state of unresponsiveness to a specific antigen under certain conditions). Another primary mechanism of tolerance is the suppression of excessive immune response among conventional t cells, such as regulatory cd4+cd25 + t cells (tregs). In addition to b cells and t cells, related cells of the innate immune system, such as nkt cells, can sense microbial pathogens by responding to conserved pathogen - associated molecular patterns . Recent studies demonstrated that nkt cells play a suppressive role in chronic inflammatory diseases, such as sle, rheumatoid arthritis (ra), sjgren's syndrome (ss), systemic sclerosis (ssc), psoriasis (psa), adult onset still's disease (aosd), and behcet's uveitis . Nkt lymphocytes are one subset of t lymphocytes that possess features of both natural killer (nk) cells and conventional t lymphocytes [12, 13]. The generation, differentiation, and progress of nkt lymphocytes occur in the thymus by positive selection, negative selection, and vdj recombination . Most nkt cells express an invariant t cell receptor (tcr) that is integrated by the combination of v14-j18 and v8.2/v7/v2 chains in mice and homologous v24-j18 and v11 chains in humans, unlike conventional adaptive cells, which express diverse tcrs [15, 16]. The first group is the conserved major histocompatibility complex (mhc) class i - like molecule cd1d - dependent which is called inkt cells or type i nkt cells, because there is invariant t cell receptor chain (tcr-) on the surface of the cells to recognize the cd1d molecules unlike conventional t cells . Another group is the cd1d - independent nkt - like cells called type ii nkt cells . Although these two kinds of nkt cells both express tcr-, the tcr repertoire is various, not invariant . And the diverse tcrs are not capable of recognizing the cd1d . The tcrs can recognize other antigens which may be not antigen specific [17, 18]. It has been identified as nkt17 cells due to production of il-17, the third subtype nkt cells . Type i nkt cells, that is, inkt cells, possess the features of innate immune cells and adaptive immune cells . Inkt cells are easy to be activated by endogenous or exogenous glycolipids via their tcrs . Therefore inkt cells play an important role in immune response [20, 21]. It has been assumed that inkt cells can bridge the innate and adaptive immune response; moreover there are some evidences confirming that inkt cells are involved in the inflammatory response . Even though type ii nkt cells and nkt17 cells are implicated, we reasonably think that inkt cells play an important role in immune response including autoimmune diseases . Some evidences confirmed that inkt cells migrate from cortex to medulla . During thymocyte development, the progenitors express high level of cd4 and lesser level of cd161, whereas differentiated inkt cells exhibit a downregulation of cd4 expression and an upregulation of cd161 expression . The differentiation of inkt cells is companied by the changes of molecular markers on the cells in the process of maturation . The different conditions result in different expression on these cells, which determine the specific subtype of nkt cells . Indeed, inkt cells rapidly exert effector functions during an immune response without the requirement for further activation . If inkt cells are further stimulated by glycolipid ligands, they can produce a burst of cytokines and chemokines that endow these cells with potent immunomodulatory activities . Inkt cells are able to secrete considerable immunoregulatory cytokines, such as il-2, il-4, il-6, il-10, il-13, il-17, il-21, ifn-, tgf-, tnf-, and gm - csf, which are implicated in a variety of different immune reactions . That nkt cells can interact with other immune cells, such as t cells, b cells, nk cells, and dendritic cells (dcs), has been confirmed . Although the interaction between nkt cells and other immune cells is mediated by cytokines, some studies indicated that they can be contacted by cell - to - cell [13, 27, 28]. Therefore, nkt cells can play a role by interaction with other immune cells in many immune responses, including inflammatory diseases . Although the regulatory effects of inkt cells have already been expounded in some diseases, these regulatory effects of these cells in sle have not been well summarized . This review focuses on the relationship between the inkt cell population and the development of sle, on how inkt cells are involved in the regulation of sle by shaping immune responses, and on potential applications of these cells in sle treatment . The number and proportion of inkt cells were shown to significantly decrease in both patients with sle and the mouse lupus models [5, 3032]. For example, cho et al . Found that not only the percentages but also the absolute numbers of inkt cells were obviously lower than that of normal by detection of the number of inkt cells in 128 sle patients . Although the decrease of the number of inkt cells in sle has been found, whether this decrease is a consequence of the disease or a primary trigger of the disease remains unclear . It has been shown that not only the numbers of inkt cells were decreased but also the deficiency of inkt cells correlated closely with the disease activity . The reduced number of inkt cells can be restored to the normal level when the patient is treated with corticosteroids or rituximab [31, 32]. Consistent with this finding, the correlation between the decrease of inkt cell numbers and the progression of the disease was observed in lupus murine models [33, 34]. The reduction in inkt cell numbers could be caused by a defect in their maintenance . The undesirable response of inkt cells to -galactosylceramide (-galcer), which is an effective stimulating agent for inkt cells, has been demonstrated in sle patients and animal models [30, 35]. When the peripheral blood mononuclear cells (pbmcs) from sle patients were collected and cocultured with -galcer, the proliferation of inkt cells was obviously lower in sle patients than in the normals . Another study showed that the inkt cells did not grow when the inkt cells from sle were cocultured with -galcer and normal monocytes, but inkt cells from the healthy controls expanded successfully under the same conditions . Consistent with this finding, cho et al . Observed that the apoptosis of inkt cells from sle patients was increased after incubation with -galcer for days, but inkt cells from normal controls did not change . This effect may also result from the observed reduction of inkt cell numbers in sle patients . The response defect of inkt cells to stimulus may be exacerbated by the compromised expression of costimulatory molecules . Cd26 is expressed on the surface of t and b lymphocytes as well as inkt cells as a costimulatory molecule and is required for connection with other cells . Wong and his colleagues found that cd26 expression was significantly reduced on nkt cells and cd4 + t cells but the expression was not obviously decreased on monocytes, b cells, and cd8 + lymphocytes in sle patients . Consistent with this finding, the percentage of both cd26 + nkt cells and cd26+cd4 + cells significantly decreased . Because cd26 can link to other cells and play role in activation as a costimulatory molecule, the reduction of nkt cells could result from a defect of costimulatory pathways . The reduced expression of cd26 could consequently hinder nkt cells activation and the proliferation of nkt cells in sle . Impaired activation could also influence the cytokines secreted by nkt cells and in turn contribute to the decrease of nkt cells in sle . The abnormality in the number and the activation of nkt cells in sle patients in the study indicated that nkt cells may be implicated in the progression of sle . Sle is triggered by autoantibodies aiming at dsdna and other antigens that ultimately lead to the development of multiorgan failure [38, 39]. The imbalance between th1 and th2 cytokines participates in the immunoregulation of sle [29, 40]. The reduced number of inkt cells is correlated with the imbalance of th1/th2 in sle patients . In mrl - fas mouse model, cd1d gene deletion reduced th2 cytokine production and failed to affect the production of th1 cytokines . Tupin and other scholars also found that -galcer induced th2 polarization in the aortas of apoe/ mice . Accordingly, animal models studies have revealed that inkt cells promote th2-type cytokine production and allergen - induced airway inflammation through acd1d - dependent mechanism [42, 43]. Therefore, inkt cells can regulate the balance of the immune response between th1 and th2 cells by secreting cytokines . Inkt cells secrete th2-biased cytokine production profiles under normal conditions, and, under such conditions, the number of th2 cells is dominant . Although inkt cells are considered to maintain the balance of th1/th2 cells, the associated regulatory mechanism is not certain . There are a few possible ways to explain how inkt cells might disturb the differentiation of th1 and th2 cells: (1) il-4 and il-13 secreted from inkt cells might directly induce the differentiation of th2 cells from th cells; (2) although il-10/tgf- secreted from inkt cells might inhibit both th1 cells and th2 cells activation, the deviation to th1 cells or th2 cells is different under different pathological circumstances; (3) ifn- might only cause anergy or apoptosis of th1 cells, leading to the imbalance of th1/th2 cells; (4) il-4, il-10, and gm - csf secreted from inkt cells boost the polarization towards th2 cells . The inclination may bring about the imbalance of th1/th2 cells; (5) some chemokines secreted from inkt cells promote the generation of dcs; the increased cds might break the balance of th1/th2 cells . Like other autoimmune diseases, a complex of cytokines is involved in sle development or pathology . Nkt cells can participate in the process in the sle by secreting cytokines such as il-17 and il-21 besides the il-2, il-4, il-6, il-10, and ifn- [45, 46]. This finding highlighted the complex of roles that nkt cells play by secreting il-17, il-2, and tgf- in sle . Some studies showed that the level of il-17 is significantly higher in sle than the healthy controls [48, 49]. It is well known that il-17 is secreted by cd4 t cells, namely, th17 cells . However, the current studies showed that inkt cell can secrete il-17 and other procytokines in inflammation disease including sle and ra [51, 52]. Additionally another subtype of nkt cells which can also secrete il-17 has been identified as il-17-producing inkt cells, which have been attracting the attention of more and more scholars since il-17 plays an important role in infection and tumor as well as inflammatory disease such as sle . Even il-17 production nkt cells are endowed with ability to produce the il-17; the results of many studies showed the capacity of il-17-producing inkt cells is dependent on a proinflammatory environment [19, 54]. Sle is mediated by autoantibodies and controlled by other regulatory lymphocytes cells, including nkt cells . It has been confirmed that the number of nkt cells and the production were decreased in sle by many studies . [5, 31, 32], and the number of nkt cells can be recovered after treatment with prednisone . These clinical experiments suggest that nkt cells may ameliorate the state of illness by regulating the level of igg in sle . Green et al . Identified 65 sle patients and 45 first - degree relatives of patients with sle . The result showed that the number of nkt cells was inversely correlated to the level of igg . The result suggested that nkt cells might control the production of igg in sle . On the other hand consistent with these findings, a number of studies in mouse models also showed that nkt cells possess the regulatory function in sle . In animal models, wermeling et al . Found a similar phenotype to sle patients the manifestations of these lupus - like models included the small number of nkt cells and the high level of igg . The production of autoantibodies was reduced dramatically when b lymphocytes were cultured with inkt cells or nk1.1+cd3 + cells were transferred from an mrl - lpr model in vitro . Observed the aged j18-deficient balb / c mice spontaneously displayed the manifestations of lupus - like models, including the proliferation of the splenic marginal zone b cells . The decrease of cd1d expression on the surface of b cells might cause the production of antibodies and suggested that a direct interaction exists between inkt cells and b cells . When b cells come into contact with inkt cells via cd1d, their capacity to proliferate and produce antibodies decreases . Inkt cells can regulate cd1d+ b cell autoreactivity and prompt production of circulating apoptotic cells; if this role is impaired, an sle - like phenotype appears . Most studies indicated that nkt cells can suppress the production of igg, even though some experiments have demonstrated converse conclusions about the relationship between nkt cells and igg production in humans and mouse models . These contradictory - like results showed that nkt cells have complex functions in the modulation of autoantibody production . More researches will be required to further confirm the influence of nkt cells on the production of autoantibodies . Dendritic cells (dcs) mainly consist of conventional dendritic cells (cdcs) and plasmacytoid dendritic cells (pdcs) in humans . Dcs are professional antigen presentation cells (apc) which process the antigen and then present to t cells . Dcs can capture autoantigens to t cells and make t cell anergy to the autoantigens in certain environment . It is postulated that dcs play an important role in the pathogenesis of sle due to its double capacity of immune response and immune tolerance . Many relative studies have been performed and the evidence confirmed that dcs contribute to the pathogenesis of sle . Found the capacity of activation to stimuli is damaged by comparing the dcs from sle patients and controls . They thought that there were some defects in the process of development and maturation in the dcs of sle . The consequent studies found the dysfunction of dcs was associated with irf4-dependent pathways in mouse model . Found the expression of gene dosage of the pdc - specific transcription factor e2 - 2 (tcf4) was abnormal . Fujii et al . Found the number of cdcs in the patients with sle was obviously decreased compared to the normals and there was correlation with disease activity in sle patients . The changed microenvironment and gene make dcs lose the ability of immune tolerance, which may trigger the occurrence of autoimmune response . It has been considered that the inkt cells play an important role as immune regulator cells . Inkt cells can reinforce the immune function of dcs by promoting the maturation of dcs and accelerate the ability of dcs to induce the differentiation of t cells by coculturing with dcs in the presence of antigens . The studies illustrated that inkt cells could affect the function of cds in certain circulation and strengthened the roles in the appearance of antigens . However, pilones et al . Reported that inkt cell can defer the action of antitumor t cells by controlling the population of dcs in tumors and draining lymph nodes . Inkt cells can enhance the protective immune response by modulating the function of dcs during chlamydia pneumoniae infection . Inkt cell may enhance the immune function of cds in inflammation or infection and reduce the immune response function of cds in cancer . We think inkt cells may arouse the capacity of stimulation of the cds in sle . The exogenous antigens trigger the inkt cells and aggravate the diseases in the environment of infection . The 5-year and 10-year survival rates have been significantly improved as per our knowledge about the pathology of sle . Although corticosteroids and immunosuppressive agents, such as cyclophosphamide (ctx), are currently the principal treatments, the clinical application of these drugs is limited by their significant side effects [68, 69]. It is necessary to find a therapeutic intervention that specifically targets important immune effector pathways . Nkt cells have emerged as a unique lymphocyte subset that is implicated in many aspects of sle, such as regulating the balance of different t helper cell populations and suppressing autoantibody production, as described above . Current knowledge supports the hypothesis that nkt cells might play a protective role during the progression of sle and may become a target for treatment in patients with sle . Some studies showed that anti - cd1d treatment ameliorated manifestations in (nzbnzw)f1 mice, but mrl / lpr mice treated with -galcer became exacerbation and shortened survival . The healthy models displayed lupus - like manifestations after healthy mice were transferred into inkt cells from diseased (nzbnzw)f1 mice . The different results obtained in these studies revealed the complex functions of nkt cells in the pathology of sle . Despite these concerns, a series of preliminary animal model experiments that aimed to investigate nkt cells in sle have already been performed . In these studies, -galcer was identified as a reagent that targets cd1 on nkt cells and is recognized by inkt cells from a variety of mammalian species, including mouse and humans [73, 74]. -galcer is considered to be the gold - standard for stimulatory ligands [75, 76]. A lupus model, mrl - lpr / lpr mice, exhibits a deficit in inkt cell numbers and dysfunction . After treatment with -galcer, the number deficiency was corrected, and inflammatory dermatitis was improved . Zeng et al . Reported that when nzb / wf1 mice were treated with anti - cd1d monoclonal antibodies, the titers of some kind of antibodies were decreased and lupus - like expression was ameliorated, but serum levels of ige were increased . The result showed that bwf1 mice exhibited a long - term improvement in renal expression and production of anti - dna antibodies after treating with -galcer injections for a few times . These data pieces showed that brief inkt activation can confer a prolonged protective effect in lupus models . If the lupus - like models were repeatedly treated with -galcer, the effect on lupus nephritis was poor . Even though some recent studies show promising results concerning the treatment with -galcer in human cancer patients, we found that the administration of -galcer can prevent disease, have no effect, or accelerate disease based on the described results from lupus models . It is necessary to perform more investigations into effects of -galcer - mediated inkt cell in sle . Although it is globally accepted that inkt cells might play a protective role in sle, some researches showed that these cells may also contribute to autoimmune pathogenesis and even aggravate the disease [71, 80]. Although there are many reasons for the different results obtained in lupus models after treatment with -galcer, the main reason may be the expression of cd1 on the surface of many lymphocytes besides nkt cells . This factor is expressed primarily on cells of hematopoietic origin, including thymocytes, b cells, macrophages, dcs, and other t cells . Much difficulty remains to be resolved concerning the treatment of sle with -galcer, particularly because we do not yet understand the precise mechanisms involved . Thus, -galcer may be an ideal therapeutic target in sle, but the use of -galcer to treat sle patients requires further study . As part of the innate immune system, inkt cells have attracted attention in the context of immunoregulation . Future advances will improve our comprehension of the function of nkt cells in the pathogenesis of sle . A few evidences revealed that inkt cells play an important protective role in the pathogenesis of sle, even though the mode of action of nkt cells in sle remains unclear . (1) inkt cells can secrete a various number of cytokines to maintain the balance of th1/th2 cells . Il-4 and il-13 may directly induce the differentiation of th2 cells; il-10 and tgf- might inhibit th1 cells in certain inflammation condition . (2) cytokines are directly implicated in the pathogenesis of sle, such as il-17-producing inkt cells . Changes in the number and differences in the subtypes of cytokines are bound to affect the disease . (3) nkt cells linking the innate and adaptive immune responses can suppress b cell proliferation, which results in reduced production of igg . (4) inkt cells can regulate the immune response by promoting the maturation of dcs . However, some evidences showed inkt cells affect the function of dcs depending on the different circulation . Therefore, full understanding of the behavior of nkt cells in sle will further improve the therapy strategy in future.