Split (1)

train · 133k rows

text stringlengths 0 868k
Several studies reported histophatological observations during influenza a / h1n1 2009 pneumonia: the major finding was diffuse alveolar damage (dad) [14]. Type ii pneumocytes were considered the main target of influenza a / h1n1 infection . A limited number of observations described in vivo samples, such as bronchoalveolar lavage (bal) [68]. Therefore, it may play a role in further understanding the pathogenesis of new viral strains . In this case series we present the results of bal performed in three patients with severe influenza a / h1n1 2009 pneumonia complicated by acute respiratory distress syndrome (ards). Between august and december 2009 we performed a bronchoscopy - guided bal of three patients admitted to the san gerardo hospital, monza, italy, for influenza a / h1n1 virus pneumonia with subsequent development of ards . All three patients required intensive care unit (icu) admission and received mechanical ventilation (mv) and extracorporeal respiratory support (ecmo). Influenza a / h1n1 diagnosis was confirmed by a / h1n1 virus rna detection on nasal swab samples using influenza a / h1n1 2009 rrt - pcr (real - time reverse - transcriptase - polymerase - chain - reaction) assay (genexpert). Bal differential cell count on cytocentrifugate was performed in the light microscopy (lm) by counting about 300 cells in random fields at 400x magnification . Demographics, comorbidities, severity on admission, microbiological isolations, and outcome for each patient are described in table 1 . Antiviral therapy with oseltamivir (150 mg twice daily) was started at hospital admission simultaneously with rrt - pcr assay and was continued until rrt - pcr assay on nasal swab turned negative . Large, atypical cells with plasmocytoid appearance were observed in all three specimens with similar percentages (8, 9, and 6%, resp . ). At lm, they appeared as large, plasmoblastic / plasmocytoid - like cells with eccentric nuclei and paranuclear vacuoles, high ratio nucleus / cytoplasm, and intensely basophilic cytoplasm . Immunocytochemical analysis on cytocentrifugate showed that these cells were negative for cd20 (b lymphocyte marker) and cd138 (plasma cell marker). Ultrastructural examinations at transmission em allowed us to observe multilamellar osmiophilic bodies in the cytoplasm of plasmoblastic / plasmocytoid - like cells . Em showed in these cells small round cytoplasmic inclusions with irregular surface and a diameter around 60 nm (figure 2). They also showed cytoplasmic vesicles with a diameter around 100 nm and an irregular electron - dense core (figure 3). The main characteristic of the bal of our patients with influenza a / h1n1 pneumonia associated with ards was the presence of large cells with a plasmoblastic / plasmocytoid - like appearance, identified at em as atypical type ii pneumocytes . The first hypothesis regards the reparative action that type ii pneumocytes may have in dad . In our cases, stanley described morphological atypias, such as increased nuclear - cytoplasmic ratio, in type ii pneumocytes found in bals during ards . These atypical pneumocytes are usually aggregated in clusters and are supposed to have a reparative role . All our patients developed ards and we observed pneumocytes aggregated in clusters in the bals performed earlier (cases numbers 2 and 3). According to this first hypothesis, the atypical cells we observed could be described as reactive immature type ii pneumocytes . Type ii pneumocytes have been described as the main target of influenza a / h1n1 2009 infection . Nakajima et al . In 2012 described four autopsy cases of influenza a / h1n1 with a histopathological pattern of acute dad who presented with influenza virus antigen - positive type ii pneumocytes, perhaps indicating a direct role of the virus - infected cells in the acute alveolar damage . No specific cytophatic effect or viral inclusion has been described so far at lm in lung tissue specimens during influenza pneumonia . Several observations have been performed via em on autopsy specimens . During the recent influenza pandemic, mauad et al . Found type ii pneumocytes with vesicles, approximately 100 nm in diameter, with an electron - dense center . Bal and colleagues described cytoplasmic inclusions in pneumocytes, which ranged in diameter from 74 to 82 nm and showed surface spikes characteristic of influenza virus . Em observations of our specimens revealed some atypical pneumocytes showing both small round cytoplasmic inclusions with an irregular surface and small vesicles (similar to those described by bal and mauad). According to this second hypothesis, atypical type ii pneumocytes could be a specific morphological marker of influenza virus infection . From the data collected so far, we cannot favor one explanation; in fact, they could coexist in cases of severe influenza a / h1n1 pneumonia associated with ards . Limitations of the present study include the following: first, the paucity of cases analyzed; second, we did not perform immunohistochemical staining for h1n1 antigens on bal samples . The description of bal in a control group of patients with ards not associated with h1n1 pneumonia is beyond the scope of this case series . However, other authors described bal cytology in non - h1n1 ards, and although they reported morphological atypias in type ii pneumocytes, they did not describe these peculiar plasmoblastic / plasmocytoid - like cells [10, 12, 13]. The collection of the airway specimens of patients number 2 and number 3, in which the nosocomial pathogens were isolated, took place after bal was performed . Therefore, these pathogens most likely did not affect the cellularity in bal . In conclusion, plasmoblastic / plasmocytoid - like type ii pneumocytes characterize the bal of our patients with influenza a / h1n1 2009 pneumonia associated with ards . They could represent a pathognomonic marker of influenza virus pneumonia as well as reparative cellular activation after dad . More observations of bal cytology in patients with influenza pneumonia are needed to understand their characteristics and role.
As a service to our authors and readers, this journal provides supporting information supplied by the authors . Such materials are peer reviewed and may be reorganized for online delivery, but are not copyedited or typeset . Technical support issues arising from supporting information (other than missing files) should be addressed to the authors.
Cyanobacterial lineages also contain a recognizable csk homolog, confirming the evolutionary origin of this chloroplast protein from cyanobacteria . 1), consistent with the secondary symbiotic origin of diatom and phaeophycean plastids from red algae . Interestingly, a csk ortholog is also found in chromatophoresin this context, cyanobacterial endosymbionts of the amoeboid eukaryote paulinella chromatophora . The symbiotic origin of paulinella chromatophores has an independent evolutionary history from the symbiotic event that gave rise to chloroplasts (nowack et al . Csk is present in all major plant and algal lineages and evolved from a cyanobacterial sensor histidine kinase . Bayesian posterior probabilities are shown above nodes, phyml 3.0 bootstrap values are shown below nodes . The name of each taxon is colored according to the major photosynthetic pigment characteristic of that group . The phylogenetic analysis presented in figure 1 and table 1 csk occurs as a canonical sensor histidine kinase in cyanobacteria, red algae, diatoms, and phaeophytes (table 1), whereas in green algae and plants, csk is a modified histidine kinase as the conserved histidine autophosphorylation site in csk has been lost in these lineages . Studies in cyanobacteria suggest that the narl - type response regulator ycf29 is the cognate partner of csk (sato et al . Csk seems to retain its cognate response regulator partner in cyanobacteria and in nongreen algae (table 1) but not in green algae and plants lineages in which csk occurs as a modified histidine kinase (table 1). The evolutionary loss of a bacterial - type response regulator from chloroplasts may therefore correlate with a modified kinase activity of csk (puthiyaveetil and allen 2009). Distribution of csk, ycf29, and ptk in photosynthetic organisms note.the plus (+) indicates the presence and the minus () indicates the absence of csk or ycf29 or ptk . The abbreviation nk indicates that the complete genome sequence for that taxon is not available, so the presence or absence of csk or ycf29 or ptk is not known . The subcategories n and p in the csk, ycf29, and ptk occurrence column stand for nuclear and plastid, respectively, and indicate the genetic compartment in which these proteins are encoded . For p. chromatophora, the accession numbers of c. punctiforme pcc 73102 csk and ycf29 homologs are acc82407 and acc80206, respectively; for c .sp . The taxonomic group viridiplantae means green plants, and includes green algae, lower, and higher plants . In order to investigate protein protein interactions between csk and its putative functional partners, we undertook a yeast two - hybrid analysis . Figure 2a shows growth of all bait prey combinations in a medium lacking leucine and tryptophan, confirming the successful transformation of yeast cells with both bait and prey plasmids . Figure 2b shows growth of yeast cells in a medium lacking leucine, tryptophan, and histidine . Growth on this latter medium reports on interactions of bait and prey proteins, which together activate the his reporter gene, enabling yeast cells to grow in a medium lacking histidine . Figure 2b shows that functional interactions occurred between the following pairs of bait and prey proteins: csk with csk; csk with sig-1; ptk with csk; ptk with sig-1; ferredoxin - nadp reductase (fnr) with ia2 . Fnr and ia2 are two chloroplast proteins that are known to interact (kuchler et al . 2002) and are therefore used as a positive control as in juric et al . Prey combination fnr/220 is used as a negative control as these chloroplast proteins do not interact (juric et al . 2009) and are thus unable to permit growth in a medium lacking histidine (fig . The combinations csk / pbd and ptk / pbd are additional negative controls designed to reveal self - activation of the bait proteins csk and ptk . Fnr/220, csk / pbd, and ptk / pbd are negative controls . Test combination of bait and prey proteins are csk / csk, csk / sig-1, csk / tcp34, ptk / csk, ptk / sig-1, and ptk / tcp34 . (a) yeast cells growing on synthetic sd media plates lacking leucine and tryptophan . The growth of all bait and prey combinations in this medium confirms successful transformation of yeast cells with both bait and prey plasmids . (b) growth of yeast cells in sd media plates without leucine, tryptophan, and histidine . The growth in his plates require the activation of the histidine biosynthetic gene (his reporter gene), which in turn requires the functional interaction between bait and prey proteins . Protein interactions inferred from the results in figure 2 by use of a second reporter gene, -galactosidase . This gene is under the control of a separate promoter from that of the his reporter gene, and its activation is therefore an independent measure of interaction . The results from the -galactosidase assay shown in figure 3 are also indicative of the relative strength of the different protein protein interactions . Among the test combinations, csk / csk shows the highest degree of interaction; followed by csk / ptk, with csk / sig-1 and ptk / sig-1 showing weaker and more or less equal interactions (fig . The results in figures 2 and 3 suggest clearly that tcp34 does not interact with csk or ptk . Our results therefore do not support the response regulator function of tcp34 in plant chloroplasts . Activation of the -galactosidase reporter gene (lacz gene), which is driven by a separate promoter from the his reporter gene, requires functional interaction between bait and prey proteins . -galactosidase activity is also a measure of the strength of interaction, with higher activity suggesting stronger interaction . One -gal unit hydrolyses 1 mol of o - nitrophenyl--d - galactopyranoside (onpg) to o - nitrophenol and galactose per minute at ph 7.5 and 37 c . Error bars indicate the standard error of the mean of 3 individual measurements, with each measurement representing a different sample . Arabidopsis knockout mutants of the csk gene are unable to repress photosystem i genes in photosystem i light and therefore cannot regulate the relative quantities of photosystem i and photosystem ii (puthiyaveetil et al . 2008). Sigma factors assist rna polymerase in promoter recognition and dna - melting, two processes that determine faithful and efficient transcription (wosten 1998). As many as six sigma factors are found in arabidopsis chloroplasts (lysenko 2007). Sig-1 has been shown to be phosphorylated under pq oxidizing conditions, when incident light favors photosystem i (light 1) (shimizu et al . 2010). Phosphorylated sig-1 represses transcription at psa (photosystem i reaction center) promoters while efficiently transcribing psb (photosystem ii) promoters (shimizu et al . 2010). Sig-1 phosphorylation is part of the control of gene expression involved in photosystem stoichiometry adjustments, but the identity of the sig-1 kinase is yet to be revealed (shimizu et al . First, csk function and sig-1 phosphorylation have the same gene expression phenotype, which is suppression of psa genes (puthiyaveetil et al . This identical gene - regulatory property of these two proteins suggests they are part of the same signal transduction pathway . Secondly, csk and sig-1 interact in vivo in yeast (figs . 2 and 3). Thirdly, oxidized pq, the signal for sigma factor phosphorylation, is also the signal that promotes the kinase activity of csk (ibrahim i m, puthiyaveetil s, allen jf, unpublished data). The high degree of interaction between csk monomers, as noted in our yeast two - hybrid assay (figs . 2 and 3), suggests that csk exists as a homodimer in its functional form . This property of csk is consistent with the proposed signal sensing function, as dimerization is well known in bacterial sensor kinases (wolanin et al . Ptk is a eukaryotic serine / threonine protein kinase of the casein kinase ii family (baginsky et al . Ptk is usually found associated with the plastid - encoded rna polymerase (pep), acting as a global regulator of chloroplast transcription (link 2003). In low light conditions, ptk keeps chloroplast transcription at a low level by phosphorylating pep phosphorylated pep transcribes chloroplast genes less effectively than unphosphorylated pep (baginsky et al . A single subunit of pep the 72 kda' subunit is usually found in its phosphorylated form in low light (baginsky et al . Ptk from mustard (sinapis alba l.) can also phosphorylate sig-1 in vitro (ogrzewalla et al . 2002). These observations, taken together with our yeast two - hybrid results (figs . 2 and 3), suggest that ptk nonspecifically suppresses chloroplast transcription in low light by phosphorylating pep structural (' subunit) and regulatory (sigma factor) subunits . Light 1 (photosystem i light) and light 2 (photosystem ii light) are selective for electron transport through photosystem i or photosystem ii only when light intensity is rate limiting for photosynthesis, and other factors, such as co2 concentration or temperature, are not . For selective transcriptional control of reaction center gene transcription in arabidopsis thaliana, conditions correspond to photon flux densities of the order of 12 e m s (puthiyaveetil and allen 2008). Because ptk - mediated suppression of chloroplast transcription occurs at low incident light intensity (baena - gonzalez et al . 2001), it is interesting to ask how might specific reaction center gene transcription be achieved in light 1 and 2? We suggest that, under these conditions, the activity of ptk is overridden by two regulatory proteins 4a and b). The proposed chloroplast signal transduction pathway coupling the redox state of the photosynthetic electron carrier plastoquinone in the chloroplast thylakoid membrane with initiation of transcription of chloroplast dna at the promoter regions of the genes psa (encoding reaction center proteins of photosystem i) and psb (encoding reaction center proteins of photosystem ii). (a) under light 1, a rate - limiting low light selective for photosystem i, electron flow through photosystem i (ps i) has a greater potential than that through photosystem ii (ps ii), and so pq pool is maintained in its oxidized form . Csk is autophosphorylated and active as a protein kinase using both sig-1 and ptk as substrates: sig-1 and ptk are thus maintained in their phosphorylated forms . Phospho - sig-1 represses transcription at the psa promoter while allowing transcription of psb genes . Phospho - ptk is inactive; therefore, it cannot suppress chloroplast transcription nonspecifically, and under this circumstance, only csk - mediated via phospho - sig-1specific repression of psa genes occurs . This differential reaction center gene transcription increases the stoichiometry of photosystem ii relative to photosystem i. (b) under light 2, a rate - limiting low light selective for photosystem ii, electron flow through photosystem i (ps i) has a lower potential than that through photosystem ii (ps ii), and so pq pool is maintained in its reduced form (pqh2). The repression of psa genes, occurred during light 1, is now relieved by the action of a pep phosphatase that catalyzes dephosphorylation of phospho - sig-1 . As a result, ps i transcription increases . Under this light condition however, the action of pep phosphatase overrides ptk activity by dephosphorylating both sig-1 as well as pep subunits so that nonspecific repression of reaction center genes is counteracted . The increase in photosystem i transcription in light 2, therefore, leads to an increase in photosystem i units relative to photosystem ii . We thus propose that in light 1, in order to bring about specific down - regulation of psa genes, ptk becomes inhibited (fig . Phosphorylation inhibits ptk (link 2003), and yet no ptk kinase has previously been identified . In the light of the strong interaction between csk and ptk found in our yeast two - hybrid assay (figs . 2 and 3), we here propose that csk acts as the ptk kinase, catalyzing phosphorylation and inactivation of ptk . Csk itself then catalyzes phosphorylation of sig-1, which has the effect of repressing only psa transcription . As discussed earlier, psb transcription is unaffected by sig-1 phosphorylation, thus the quantity of photosystem ii increases in light 1 relative to photosystem i (fig ., however, when photosystem i is rate limiting, sigma factors are predicted to become dephosphorylated to relieve the repression on psa genes (fig . The phospho - pep phosphatase can perform both of these functions by dephosphorylating sig-1 as well as the pep structural subunits (fig . 4b). Whether such a phospho - pep phosphatase is constitutively active or regulated by redox signals remains to be seen . We suggest that ptk, a eukaryotic - type protein kinase, displaced an analogous prokaryotic - type response regulator as the functional partner of csk in a two - component regulatory system . This proposal is supported by the distribution of csk, ycf29, and ptk between different eukaryotic lineages (table 1). Ptk seems to be present in lineages that have lost ycf29, thus supporting the notion of ptk replacing ycf29 as the functional partner of csk . We conclude that regulation of photosystem stoichiometry in chloroplasts (allen 1995, 2005; pfannschmidt, nilsson, and allen 1999) results from effects of the redox state of the plastoquinone pool on reversible phosphorylation of csk, ptk, and sig-1 . These proteins interact with each other and together comprise the redox signal transduction pathway that acts to regulate transcription of chloroplast reaction center genes in response to imbalance in rates of energy conversion in photosystems i and ii (pfannschmidt, nilsson, and allen 1999; pfannschmidt, nilsson, tullberg, et al . This genetic switch has been retained from the cyanobacterial ancestor of chloroplasts (puthiyaveetil and allen 2009) and is a transcriptional analog of posttranslational modification of the activity of photosystem i and ii by phosphorylation of chloroplast light - harvesting complex ii (allen et al . 1981; allen 1992). Redox control of transcription (allen 1993c) has been proposed as a necessary condition for the retention, in evolution, of the genetic systems of chloroplasts and mitochondria as extranuclear, cytoplasmic elements that produce non - mendelian inheritance of characters associated with photosynthesis and respiration in eukaryotic cells (allen 1993a, 1993b; race et al . The results described here are in agreement with corr and further resolve the mechanism by which a modified bacterial two - component system continues to operate in chloroplasts in order to secure a functionally intelligible adjustment of the stoichiometry of the chloroplast photosystems in response to changing light regimes . Multiple alignment of the amino acid sequence corresponding to the catalytic domain of csk and its homologs was generated across a representative selection of photosynthetic eukaryotes and cyanobacteria using clustalx and adjusted manually using jalview (clamp et al . Bayes 3.1 (ronquist and huelsenbeck 2003) from 2,000,000 generations divided between two parallel runs of 1,000,000, each with sampling every 1,000 generations . The substitution model was inferred using a mixed model of amino acid substitution, and rate across sites variation was modeled on a discrete gamma distribution approximated using 4 gamma categories and 1 category of invariable sites . Bootstraps were generated using phyml 3.0 (guindon and gascuel 2003) using the whelan and goldman substitution model and rate across sites variation modeled on an approximate gamma distribution using 4 gamma categories and one category of invariable sites . The yeast two - hybrid assay employed in our study is based on the gal4 system (stratagene). Bait proteins were fused to the activation domain (ad) and prey proteins to the binding domain (bd). Cdnas encoding bait proteins are therefore cloned into the pad - gal4 - 2.1 vector and prey cdnas into the pbd - gal4 vector . A cdna fragment encoding the kinase domain (q301-a611) of arabidopsis csk (product of gene at1g67840) was amplified (for primers, see supplementary table 1, supplementary material online) from a full - length csk cdna clone used in an earlier study (puthiyaveetil et al . This was then used as a bait protein . In order to study whether csk forms dimers, the same cdna region of csk the other prey proteins tested as candidates of csk s partner were sig-1 (product of gene at1g64860) and tcp34 (product of gene at3g26580). For sig-1, the cdna region encoding the mature arabidopsis protein (a81-n502) was amplified (primers, supplementary table 1, supplementary material online) from the full - length arabidopsis biological resource centre (abrc) clone u16526 . For tcp34, the cdna region encoding the mature arabidopsis protein without the c - terminal transmembrane anchor(l28-g324) was amplified (primers, supplementary table 1, supplementary material online) from the abrc clone u24715 . The cdna region encoding the mature ptk protein (product of gene at2g23070) was amplified (primers, supplementary table 1, supplementary material online) from the abrc clone u15758 . The prey proteins tested against the ptk bait were csk; sig-1; and tcp34 . The cdna regions cloned for these prey proteins were the same as those described above . In a negative control, the complete fnr protein was used as the bait against the 220 domain of the trol protein, essentially as described (juric et al . Csk and ptk bait proteins were tested for self - activation by using bd encoded by the pbd - gal4 vector as prey proteins . Ia2 domain of tic62 protein as prey, as described previously (juric et al . 2009). All bait and prey plasmid combinations were transformed using liac method into the yeast strain saccharomyces cerevisiae yf53 (mata ura352 his3200 ade2101 lys2801 trp1901 leu23,112 gal4542 gal80538, with his3 and lacz reporter gene constructs lys2::uasgal1tatagal1his3 and ura3::uasgal4 17 mers (x3)tatacyc1lacz). Yeast transformants were selected on synthetic dropout (sd) media without leucine and tryptophan . Protein interactions were detected by growth on sd media lacking leucine, tryptophan, and histidine and by the -galactosidase assay . All assays were performed in duplicates from three independent colonies in 0.5 ml of reaction buffer, and -galactosidase units were calculated as described (feilotter et al . Multiple alignment of the amino acid sequence corresponding to the catalytic domain of csk and its homologs was generated across a representative selection of photosynthetic eukaryotes and cyanobacteria using clustalx and adjusted manually using jalview (clamp et al . Bayes 3.1 (ronquist and huelsenbeck 2003) from 2,000,000 generations divided between two parallel runs of 1,000,000, each with sampling every 1,000 generations . The substitution model was inferred using a mixed model of amino acid substitution, and rate across sites variation was modeled on a discrete gamma distribution approximated using 4 gamma categories and 1 category of invariable sites . Bootstraps were generated using phyml 3.0 (guindon and gascuel 2003) using the whelan and goldman substitution model and rate across sites variation modeled on an approximate gamma distribution using 4 gamma categories and one category of invariable sites . The yeast two - hybrid assay employed in our study is based on the gal4 system (stratagene). Bait proteins were fused to the activation domain (ad) and prey proteins to the binding domain (bd). Cdnas encoding bait proteins are therefore cloned into the pad - gal4 - 2.1 vector and prey cdnas into the pbd - gal4 vector . A cdna fragment encoding the kinase domain (q301-a611) of arabidopsis csk (product of gene at1g67840) was amplified (for primers, see supplementary table 1, supplementary material online) from a full - length csk cdna clone used in an earlier study (puthiyaveetil et al . This was then used as a bait protein . In order to study whether csk forms dimers, the same cdna region of csk the other prey proteins tested as candidates of csk s partner were sig-1 (product of gene at1g64860) and tcp34 (product of gene at3g26580). For sig-1, the cdna region encoding the mature arabidopsis protein (a81-n502) was amplified (primers, supplementary table 1, supplementary material online) from the full - length arabidopsis biological resource centre (abrc) clone u16526 . For tcp34, the cdna region encoding the mature arabidopsis protein without the c - terminal transmembrane anchor(l28-g324) was amplified (primers, supplementary table 1, supplementary material online) from the abrc clone u24715 . The cdna region encoding the mature ptk protein (product of gene at2g23070) was amplified (primers, supplementary table 1, supplementary material online) from the abrc clone u15758 . The prey proteins tested against the ptk bait were csk; sig-1; and tcp34 . The cdna regions cloned for these prey proteins were the same as those described above . In a negative control, the complete fnr protein was used as the bait against the 220 domain of the trol protein, essentially as described (juric et al . Csk and ptk bait proteins were tested for self - activation by using bd encoded by the pbd - gal4 vector as prey proteins . The positive control uses the complete fnr protein as bait and the ia2 domain of tic62 protein as prey, as described previously (juric et al . All bait and prey plasmid combinations were transformed using liac method into the yeast strain saccharomyces cerevisiae yf53 (mata ura352 his3200 ade2101 lys2801 trp1901 leu23,112 gal4542 gal80538, with his3 and lacz reporter gene constructs lys2::uasgal1tatagal1his3 and ura3::uasgal4 17 mers (x3)tatacyc1lacz). Yeast transformants were selected on synthetic dropout (sd) media without leucine and tryptophan . Protein interactions were detected by growth on sd media lacking leucine, tryptophan, and histidine and by the -galactosidase assay . All assays were performed in duplicates from three independent colonies in 0.5 ml of reaction buffer, and -galactosidase units were calculated as described (feilotter et al.
Copd is a major cause of health burden throughout the world.1 copd often coexists with comorbidities such as cardiovascular diseases, osteoporosis, skeletal muscle dysfunction, depression, and anemia.2,3 the common ground for most of these extrapulmonary problems is the ongoing severe inflammation . Comorbidities have an influence on potentiating the overall morbidity of copd, leading to increased hospitalizations, health care costs, and eventually death . Anemia is a well - known comorbidity of copd with a prevalence ranging from 12.3 to 23%.35 previous studies also showed that the prevalence is much higher during exacerbations.68 anemia in copd is directly associated with adverse clinical outcomes, including death . Hemoglobin levels correlated with dyspnea scores, exercise capacity, and several inflammatory markers in copd.912 anemia has also been shown as an independent predictor of recurrent hospitalizations and survival in copd patients with chronic respiratory failure.13,14 it has been suggested that low hemoglobin levels may impair gas exchange and cardiorespiratory interaction in copd patients.4,11 this effect is expected to be more prominent in severe copd exacerbations presenting with acute respiratory failure in which the oxygen demand is supposed to be high due to increased respiratory workload . In this study, we sought to identify whether anemia is related with higher in - hospital deaths in severe copd exacerbations . Secondary end points were to evaluate the impact of anemia on noninvasive ventilation (niv) failure and long - term survival . This cohort study was conducted in a 14-bed medical intensive care unit (icu) of a tertiary reference hospital . The ethics committee of dkap yldrm beyazt education and research hospital approved the study (approval number: 10/29). Written informed consent was obtained to be included in this study from either the patient him / herself or patient s relatives . All consecutive copd exacerbation patients who developed acute respiratory failure were evaluated between april 2012 and september 2015 . Diagnosis of copd was confirmed, according to the global initiative for chronic obstructive lung disease (gold), from medical records, and if available pulmonary function tests (pfts) within the previous year.1 in patients for whom pfts were unavailable, copd diagnosis was confirmed with gold clinical criteria (age> 40 years,> 10 pack - year smoking or biomass history). The exclusion criteria were as follows: 1) suspected alternative / additional cause for respiratory failure such as pneumonia, pulmonary embolism, cardiogenic pulmonary edema, severe sepsis, acute respiratory distress syndrome, 2) presence of active bleeding, 3) presence of a disease / treatment possibly associated with bone marrow suppression (renal failure with glomerular filtration rate <30 ml / min/1.73 m, malignancy, hematologic disorders), and 4) recent operation or transfusion history . Demographic characteristics (age, sex, smoking history), recent pfts if available, presence of comorbidities, use of long - term oxygen therapy and domiciliary niv, duration of hospital stay prior to icu admission, severity scores of acute physiology and chronic health evaluation (apache) ii and glasgow coma scale (gcs) were recorded . Laboratory data for admission arterial blood gas analysis, complete blood cell count, and serum crp were collected . Anemia was defined as hemoglobin levels <12 gm / dl for female patients and <13 gm / dl for male patients according to the world health organization (who) anemia definition.15 all patients had acute respiratory failure due to an exacerbation and were supported by either invasive (mechanical ventilation with endotracheal intubation) ventilation or niv according to the degree of respiratory failure and the patient s clinical condition . Niv was performed by experienced icu staff using pressure support mode through an oronasal mask . Initial mechanical ventilation support type, failure in niv, total duration of mechanical ventilation support, the lengths of icu and hospital stays, and icu and hospital mortality were recorded . For survivors, mortality was evaluated from the national death database system on january 31, 2016 . The primary outcome of the study was whether the presence of anemia on admission is a risk factor for hospital mortality in severe copd exacerbations . Secondary outcomes were the effect of anemia on niv failure and long - term survival . The sample size (n=106) was calculated assuming an alpha error of 5% to reject the null hypothesis with a statistical power of 80% and anticipating 5% dropout rate.16 all categorical variables are expressed as numbers and percentages, and continuous variables were expressed as median and interquartile range . Categorical variables between groups were compared with chi - square or fisher s exact test, continuous variables were compared with mann the independent effect of anemia on hospital mortality was assessed with stepwise multivariate logistic regression analysis . To build the model, a purposeful selection method was used to select a subset of covariates that were considered to be clinically important, adjusting for confounders and statistical significance . An adjusted odds ratio (or) and a 95% confidence interval (ci) were reported for each independent factor . A two - tailed p - value of <0.05 was considered statistically significant . Statistical analysis was performed with spss (statistical package for the social sciences version 20; ibm corporation, armonk, ny, usa) program . This cohort study was conducted in a 14-bed medical intensive care unit (icu) of a tertiary reference hospital . The ethics committee of dkap yldrm beyazt education and research hospital approved the study (approval number: 10/29). Written informed consent was obtained to be included in this study from either the patient him / herself or patient s relatives . All consecutive copd exacerbation patients who developed acute respiratory failure were evaluated between april 2012 and september 2015 . Diagnosis of copd was confirmed, according to the global initiative for chronic obstructive lung disease (gold), from medical records, and if available pulmonary function tests (pfts) within the previous year.1 in patients for whom pfts were unavailable, copd diagnosis was confirmed with gold clinical criteria (age> 40 years,> 10 pack - year smoking or biomass history). The exclusion criteria were as follows: 1) suspected alternative / additional cause for respiratory failure such as pneumonia, pulmonary embolism, cardiogenic pulmonary edema, severe sepsis, acute respiratory distress syndrome, 2) presence of active bleeding, 3) presence of a disease / treatment possibly associated with bone marrow suppression (renal failure with glomerular filtration rate <30 ml / min/1.73 m, malignancy, hematologic disorders), and 4) recent operation or transfusion history . Demographic characteristics (age, sex, smoking history), recent pfts if available, presence of comorbidities, use of long - term oxygen therapy and domiciliary niv, duration of hospital stay prior to icu admission, severity scores of acute physiology and chronic health evaluation (apache) ii and glasgow coma scale (gcs) were recorded . Laboratory data for admission arterial blood gas analysis, complete blood cell count, and serum crp were collected . Anemia was defined as hemoglobin levels <12 gm / dl for female patients and <13 gm / dl for male patients according to the world health organization (who) anemia definition.15 all patients had acute respiratory failure due to an exacerbation and were supported by either invasive (mechanical ventilation with endotracheal intubation) ventilation or niv according to the degree of respiratory failure and the patient s clinical condition . Niv was performed by experienced icu staff using pressure support mode through an oronasal mask . Initial mechanical ventilation support type, failure in niv, total duration of mechanical ventilation support, the lengths of icu and hospital stays, and icu and hospital mortality were recorded . For survivors, mortality was evaluated from the national death database system on january 31, 2016 . The primary outcome of the study was whether the presence of anemia on admission is a risk factor for hospital mortality in severe copd exacerbations . Secondary outcomes were the effect of anemia on niv failure and long - term survival . The sample size (n=106) was calculated assuming an alpha error of 5% to reject the null hypothesis with a statistical power of 80% and anticipating 5% dropout rate.16 all categorical variables are expressed as numbers and percentages, and continuous variables were expressed as median and interquartile range . Categorical variables between groups were compared with chi - square or fisher s exact test, continuous variables were compared with mann the independent effect of anemia on hospital mortality was assessed with stepwise multivariate logistic regression analysis . To build the model, a purposeful selection method was used to select a subset of covariates that were considered to be clinically important, adjusting for confounders and statistical significance . An adjusted odds ratio (or) and a 95% confidence interval (ci) were reported for each independent factor . A two - tailed p - value of <0.05 was considered statistically significant . Statistical analysis was performed with spss (statistical package for the social sciences version 20; ibm corporation, armonk, ny, usa) program . A total of 124 patients were screened and 106 patients (78.3% male; median age 71 years) were included in the study . Pfts were available in 62 patients; the median (interquartile range) forced expiratory volume in 1 second (fev1)% predicted was 31.4% (20.5%40.2%). Thirty - seven (34.9%) patients were using long - term oxygen therapy and 15 (14.2%) patients were using niv at home . Hypertension and coronary artery disease were the most common comorbidities . On icu admission, the median apache ii and gcs scores were 23.0 (18.031.0) and 15.0 (8.015.0), respectively . The median ph and arterial partial pressure of co2 were 7.26 (7.187.31) and 75.8 (62.785.1) mmhg, respectively (table 2). Twenty - two patients had invasive mechanical ventilation at the time of icu admission, whereas 84 patients were first treated with niv . During follow - up, niv failure was observed in 38 patients with a median duration of 2.5 (0.310.0) days . The statistically significant factors between niv successful and failed patients are shown in table 3 . Hospital mortality was 65.8% in the niv failed group whereas there were no deaths in the niv successful group . The median hemoglobin level was 12.8 (11.615.0) gm / dl in the whole study population . Hemoglobin levels were negatively correlated with age (r=0.293, p=0.002) and positively correlated with fev1% predicted (r=0.388, p=0.011) (figure 2a and b). Anemia was present in half of the patients (n=53) and there was no difference between sex groups (49.4% [41/83] of male and 52.2% [12/23] of female patients were anemic; p=1.00). The median hemoglobin level in the anemic group was 11.6 (10.212.3) gm / dl whereas it was 15.0 (13.716.1) gm / dl in the nonanemic group (figure 3). Mean corpuscular volume did not differ between anemic and nonanemic patients (86.4 [79.991.4] and 88.7 [84.691.8] fl, respectively, p=0.245). Anemic patients were older, had lower fev1% predicted, and had higher apache ii score (table 4). Niv failure was observed more in the anemic patients when compared to the nonanemic group (49% vs 22.6%, respectively; p=0.001). Thirty - nine patients (36.8%) died during hospital stay (table 5). When compared, nonsurvivors had higher apache ii and lower gcs scores, had more domiciliary niv use, and low serum alb . Hospital mortality was 52.8% in the anemic group, whereas it was 20.8% in the nonanemic group (p=0.001). Logistic regression analysis for hospital mortality (table 6), showed presence of anemia and niv failure were independent predictors of hospital death with ors (95% ci) of 3.99 ([1.3911.40]; p=0.010) and 2.56 ([1.604.09]; p<0.001), respectively . When hemoglobin levels (continuous variable) were used instead of anemia (categorical variable) in the regression model, or for hospital mortality was 0.74 (0.590.94; p=0.014). Median follow - up time was 314 (47773) days . During this period, 26 patients died . Overall mortality was 38.7% (n=41) for 28 days, 50.9% (n=54) for 3 months, and 61.3% (n=65) for 1 year . The median ph and arterial partial pressure of co2 were 7.26 (7.187.31) and 75.8 (62.785.1) mmhg, respectively (table 2). Twenty - two patients had invasive mechanical ventilation at the time of icu admission, whereas 84 patients were first treated with niv . During follow - up, niv failure was observed in 38 patients with a median duration of 2.5 (0.310.0) days . The statistically significant factors between niv successful and failed patients are shown in table 3 . Hospital mortality was 65.8% in the niv failed group whereas there were no deaths in the niv successful group . The median hemoglobin level was 12.8 (11.615.0) gm / dl in the whole study population . Hemoglobin levels were negatively correlated with age (r=0.293, p=0.002) and positively correlated with fev1% predicted (r=0.388, p=0.011) (figure 2a and b). Anemia was present in half of the patients (n=53) and there was no difference between sex groups (49.4% [41/83] of male and 52.2% [12/23] of female patients were anemic; p=1.00). The median hemoglobin level in the anemic group was 11.6 (10.212.3) gm / dl whereas it was 15.0 (13.716.1) gm / dl in the nonanemic group (figure 3). Mean corpuscular volume did not differ between anemic and nonanemic patients (86.4 [79.991.4] and 88.7 [84.691.8] fl, respectively, p=0.245). Anemic patients were older, had lower fev1% predicted, and had higher apache ii score (table 4). Niv failure was observed more in the anemic patients when compared to the nonanemic group (49% vs 22.6%, respectively; p=0.001). Thirty - nine patients (36.8%) died during hospital stay (table 5). When compared, nonsurvivors had higher apache ii and lower gcs scores, had more domiciliary niv use, and low serum alb . Hospital mortality was 52.8% in the anemic group, whereas it was 20.8% in the nonanemic group (p=0.001). Logistic regression analysis for hospital mortality (table 6), showed presence of anemia and niv failure were independent predictors of hospital death with ors (95% ci) of 3.99 ([1.3911.40]; p=0.010) and 2.56 ([1.604.09]; p<0.001), respectively . When hemoglobin levels (continuous variable) were used instead of anemia (categorical variable) in the regression model, or for hospital mortality was 0.74 (0.590.94; p=0.014). Median follow - up time was 314 (47773) days . During this period, 26 patients died . Overall mortality was 38.7% (n=41) for 28 days, 50.9% (n=54) for 3 months, and 61.3% (n=65) for 1 year . Anemia of chronic disease is relatively common and an important factor in the natural history of copd . In this study, the presence of anemia was associated with increased hospital mortality in severe copd exacerbations requiring mechanical ventilation support . Anemia is a comorbidity of severe copd and responsible for increased disease burden.36 anemic patients experience more dyspnea and have decreased functional capacity which in turn results in deterioration in the quality of life.911 additionally these patients exacerbate more and have higher risk of death than nonanemic patients.6,17,18 it is also reported to be an independent negative predictor of the duration of hospitalizations and survival of copd patients receiving oxygen therapy.14 the prevalence of anemia is approximately 33%44% in patients hospitalized for an exacerbation.7,8,19 in the present study, anemia was detected in 50% of patients with exacerbations . This result is relatively higher than previously reported, possibly because the study population comprised patients with more severe copd . We have also found that hemoglobin levels were correlated with fev1% predicted and anemic patients had lower fev1 than nonanemic patients which is consistent with previously reported data.10,14 although the impact of anemia during stable phase of copd was reported in many longitudinal cohort studies, the effect of anemia on clinical outcomes for copd exacerbations, particularly in the icu setting, was studied less.2023 in this study, the presence of anemia is associated with an increased risk of death in severe copd exacerbations with an or of 3.99 . We propose anemia should be considered as a risk stratification factor for severe copd exacerbations in the icu . Anemia has been shown to be associated with increased mortality in copd - related acute respiratory failure.8,2023 rasmussen et al22 evaluated copd patients who needed invasive ventilation and found that 54.8% of anemic copd patients died within 30 days with a mortality risk ratio of 3.1 (95% ci 1.65.9). Another study reported that hemoglobin level was an independent predictor of hospital mortality (or: 0.63, 95% ci: 0.450.90; p=0.006).23 the impact of anemia on copd exacerbations was also evaluated in the emergency room setting; a multicenter study performed in canada showed anemia (hemoglobin <10 gm / dl) was the strongest predictor (or 4.9; 95% ci 2.111.7) of serious adverse events including death in patients admitted to the emergency room.24 all these data suggest that, besides being an important predictor of long - term survival, anemia should also be considered as a risk factor for short - term mortality in severe copd exacerbations . The mechanisms of the development of anemia in copd are complex and outside the scope of this article, nevertheless disease severity seems to be one of the most important factors.25 anemia was proposed as a marker for end - stage copd.22 copd is a systemic inflammatory disease in which many cytokines, including il-1, il-6, and tnf - alpha, play a role . These cytokines are also involved in inhibition of erythropoiesis at different steps of the erythropoietic pathway . In the presence of severe systemic inflammation, impairment of erythropoiesis becomes evident as anemia of chronic inflammation.5,25 in addition to chronic changes in the erythropoiesis, acute changes in hemoglobin levels were also reported during exacerbations . Markoulaki et al26 showed that a severe exacerbation itself caused transient changes in hemoglobin levels with a median decrease of 1.3 gm / dl . There was a negative correlation between hemoglobin and erythropoietin (epo) levels which points out increased epo resistance during exacerbations . It is already known that epo resistance is directly correlated with the levels of inflammatory cytokines and therefore the level of systemic inflammation . Repeated exacerbations could further inhibit erythropoiesis, and as a result a significant decrease in hemoglobin levels can occur in severe copd . Thus, anemia could be accepted as a surrogate of severe systemic inflammation and might be helpful in identifying sicker patients . Additionally, another important mechanism responsible for the development of anemia of chronic disease is the alteration in iron metabolism.5,7,27 increased levels of inflammatory cytokines and hepcidin, a peptide hormone that regulates iron homeostasis, also play a significant role in impaired iron utilization which causes functional iron deficiency . It has been shown that functional iron deficiency, even before the onset of anemia, is related to hypoxemia, more frequent self - reported exacerbations, decreased exercise tolerance, and limited response to pulmonary rehabilitation.27,28 recently, it was suggested that specific attention should be paid to iron deficiency even in the absence of anemia, and iron supplementation may be helpful in anemic copd patients.29 researches performed in other chronic inflammatory diseases and one study done in copd with renal impairment have shown improvement in patient outcomes with iron replacement.7,30 however, more data are needed to understand the importance of functional iron deficiency in copd and the beneficial effect of iron replacement needs to be confirmed with randomized controlled trials . On the other hand, copd patients might be more sensitive to anemia than we think . Copd patients were reported to have higher a mortality rate during gastrointestinal bleeding when compared to non - copd patients.31 in the second study, low hematocrit levels were associated with worse outcomes in copd patients after elective open abdominal aortic aneurysmectomy.32 the reason for this negative effect of anemia on outcomes is still unknown . However, from the physiological point of view, anemia causes a decrease in oxygen transport capacity of blood which could impair physiological and clinical parameters in copd.4 yuruk et al showed that low hemoglobin levels were associated with impaired tissue oxygen saturation in the microcirculation, and hemoglobin correction resulted in improvement in oxygen carrying capacity and tissue oxygen saturation.33,34 the negative effect of low hemoglobin levels on tissue oxygenation might be clinically important in severe copd, especially during exacerbations . Haja mydin et al8 looked for prognostic factors in hypercapnic respiratory failure and showed that anemia was related to increased risk of niv failure . A copd database study (n=132,424) showed anemic patients had not only more icu admissions but also needed more ventilatory support.35 anemia was also reported as a risk factor for extubation and weaning failure.36,37 depending on its severity, anemia is associated with increased work of breathing and reduced exercise tolerance in copd.4,9,11 it has been shown that the relationship between muscle oxygenation and peak oxygen consumption varies widely in copd, and oxygen consumption is highly influenced by blood oxygenation and oxygen utilization level.4,38 anemic copd patients also exhibit decreased diffusing capacity corrected for hemoglobin.19 all these changes in oxygen transport lead to decrease in aerobic capacity and therefore skeletal muscle dysfunction in severe copd during exercise . One can expect these changes to be more evident in patients with low hemoglobin levels, especially during exacerbations because of increased oxygen demand due to increased work of breathing and impaired cardiopulmonary interactions . A case series study done by schnhofer et al39 showed transfusion decreases minute ventilation and work of breathing in anemic copd patients . The same group also showed that transfusion helped successful weaning from ventilator in five patients.40 however, the relationship between anemia and ventilation is complex and more data are needed to understand the consequences of anemia on gas exchange and transport during pump failure in copd . The optimum threshold for hemoglobin in copd patients is still being debated . Usually a hemoglobin level of> 10 gm / dl is considered as a safe zone, however this may not be true for copd patients . The antadir study showed every 5% increase in hematocrit level was associated a relative risk of 0.86 (0.830.89) for 3-year mortality.14 kollert et al13 proposed hemoglobin values greater than 14.3 gm / dl for females and 15.1 gm / dl for males, which are much higher than who s definition, were associated with better outcomes in patients with chronic respiratory failure . Although hemoglobin levels between 79 gm / dl are considered as tolerated well in the icu setting, rasmussen et al22 reported a cutoff value of hemoglobin level <12 gm / dl was related to increased risk of death in intubated copd patients . Interestingly, stiell et al24 showed that patients with exacerbations who ended up with a serious adverse event (including icu admission, need for mechanical ventilation, and death within 30 days) had hemoglobin levels of 12.3 gm / dl which could be considered as normal . In regard to these findings, studies done in copd with chronic respiratory failure have shown the presence of anemia was associated with worse long - term survival, however, we were not able to show such an effect in our cohort.13,14,18 it should be kept in mind that the current study was designed and powered for the primary outcome (hospital mortality). Another important point to consider is study subjects had acute respiratory failure and only one third of the patients had chronic respiratory failure and were using oxygen at home . Finally, the follow - up period might have been too short to see a difference . When compared to previous reports, our median follow - up time was relatively shorter (36 vs 10.5 months, respectively).13 this study has several important limitations . First, it is a single - center study and the results may not be generalizable to other centers . Second, all patients did not have recent pfts; therefore, we were unable to assess disease severity according to the gold classification system in the whole cohort . Third, mortality in the critically ill patients may potentially have been influenced by many confounding factors . Although we have attempted to include a wide range of all possible confounders in the mortality analysis, there is still a lack of data on therapy and complications during icu stay . Another important point to consider is the etiology of anemia, including data for previous exacerbations and hospitalizations, was not evaluated in this study . Besides these limitations there is limited data about the impact of anemia on severe copd exacerbations requiring mechanical ventilatory support . Most of the studies done in the icu setting included not only patients with exacerbations but also patients with other diagnoses such as pneumonia and cardiogenic pulmonary edema.2023 we were meticulous to include only patients with exacerbations . Moreover, the study cohort consisted of patients with different degrees of acute respiratory failure treated with both niv and invasive ventilation; therefore, our results might apply to a greater percentage of patients for prediction of prognosis . Finally, comorbidities such as congestive heart failure are known to have an increased risk of death in the presence of anemia . For this reason, instead of using a comorbidity index, each comorbidity was assessed separately in order to understand its own relationship with anemia and mortality . Anemia is a comorbidity of severe copd and responsible for increased disease burden.36 anemic patients experience more dyspnea and have decreased functional capacity which in turn results in deterioration in the quality of life.911 additionally these patients exacerbate more and have higher risk of death than nonanemic patients.6,17,18 it is also reported to be an independent negative predictor of the duration of hospitalizations and survival of copd patients receiving oxygen therapy.14 the prevalence of anemia is approximately 33%44% in patients hospitalized for an exacerbation.7,8,19 in the present study, anemia was detected in 50% of patients with exacerbations . This result is relatively higher than previously reported, possibly because the study population comprised patients with more severe copd . We have also found that hemoglobin levels were correlated with fev1% predicted and anemic patients had lower fev1 than nonanemic patients which is consistent with previously reported data.10,14 although the impact of anemia during stable phase of copd was reported in many longitudinal cohort studies, the effect of anemia on clinical outcomes for copd exacerbations, particularly in the icu setting, was studied less.2023 in this study, the presence of anemia is associated with an increased risk of death in severe copd exacerbations with an or of 3.99 . We propose anemia should be considered as a risk stratification factor for severe copd exacerbations in the icu . Anemia has been shown to be associated with increased mortality in copd - related acute respiratory failure.8,2023 rasmussen et al22 evaluated copd patients who needed invasive ventilation and found that 54.8% of anemic copd patients died within 30 days with a mortality risk ratio of 3.1 (95% ci 1.65.9). Another study reported that hemoglobin level was an independent predictor of hospital mortality (or: 0.63, 95% ci: 0.450.90; p=0.006).23 the impact of anemia on copd exacerbations was also evaluated in the emergency room setting; a multicenter study performed in canada showed anemia (hemoglobin <10 gm / dl) was the strongest predictor (or 4.9; 95% ci 2.111.7) of serious adverse events including death in patients admitted to the emergency room.24 all these data suggest that, besides being an important predictor of long - term survival, anemia should also be considered as a risk factor for short - term mortality in severe copd exacerbations . The mechanisms of the development of anemia in copd are complex and outside the scope of this article, nevertheless disease severity seems to be one of the most important factors.25 anemia was proposed as a marker for end - stage copd.22 copd is a systemic inflammatory disease in which many cytokines, including il-1, il-6, and tnf - alpha, play a role . These cytokines are also involved in inhibition of erythropoiesis at different steps of the erythropoietic pathway . In the presence of severe systemic inflammation, impairment of erythropoiesis becomes evident as anemia of chronic inflammation.5,25 in addition to chronic changes in the erythropoiesis, acute changes in hemoglobin levels were also reported during exacerbations . Markoulaki et al26 showed that a severe exacerbation itself caused transient changes in hemoglobin levels with a median decrease of 1.3 gm / dl . There was a negative correlation between hemoglobin and erythropoietin (epo) levels which points out increased epo resistance during exacerbations . It is already known that epo resistance is directly correlated with the levels of inflammatory cytokines and therefore the level of systemic inflammation . Repeated exacerbations could further inhibit erythropoiesis, and as a result a significant decrease in hemoglobin levels can occur in severe copd . Thus, anemia could be accepted as a surrogate of severe systemic inflammation and might be helpful in identifying sicker patients . Additionally, another important mechanism responsible for the development of anemia of chronic disease is the alteration in iron metabolism.5,7,27 increased levels of inflammatory cytokines and hepcidin, a peptide hormone that regulates iron homeostasis, also play a significant role in impaired iron utilization which causes functional iron deficiency . It has been shown that functional iron deficiency, even before the onset of anemia, is related to hypoxemia, more frequent self - reported exacerbations, decreased exercise tolerance, and limited response to pulmonary rehabilitation.27,28 recently, it was suggested that specific attention should be paid to iron deficiency even in the absence of anemia, and iron supplementation may be helpful in anemic copd patients.29 researches performed in other chronic inflammatory diseases and one study done in copd with renal impairment have shown improvement in patient outcomes with iron replacement.7,30 however, more data are needed to understand the importance of functional iron deficiency in copd and the beneficial effect of iron replacement needs to be confirmed with randomized controlled trials . On the other hand, copd patients might be more sensitive to anemia than we think . Copd patients were reported to have higher a mortality rate during gastrointestinal bleeding when compared to non - copd patients.31 in the second study, low hematocrit levels were associated with worse outcomes in copd patients after elective open abdominal aortic aneurysmectomy.32 the reason for this negative effect of anemia on outcomes is still unknown . However, from the physiological point of view, anemia causes a decrease in oxygen transport capacity of blood which could impair physiological and clinical parameters in copd.4 yuruk et al showed that low hemoglobin levels were associated with impaired tissue oxygen saturation in the microcirculation, and hemoglobin correction resulted in improvement in oxygen carrying capacity and tissue oxygen saturation.33,34 the negative effect of low hemoglobin levels on tissue oxygenation might be clinically important in severe copd, especially during exacerbations . Haja mydin et al8 looked for prognostic factors in hypercapnic respiratory failure and showed that anemia was related to increased risk of niv failure . A copd database study (n=132,424) showed anemic patients had not only more icu admissions but also needed more ventilatory support.35 anemia was also reported as a risk factor for extubation and weaning failure.36,37 depending on its severity, anemia is associated with increased work of breathing and reduced exercise tolerance in copd.4,9,11 it has been shown that the relationship between muscle oxygenation and peak oxygen consumption varies widely in copd, and oxygen consumption is highly influenced by blood oxygenation and oxygen utilization level.4,38 anemic copd patients also exhibit decreased diffusing capacity corrected for hemoglobin.19 all these changes in oxygen transport lead to decrease in aerobic capacity and therefore skeletal muscle dysfunction in severe copd during exercise . One can expect these changes to be more evident in patients with low hemoglobin levels, especially during exacerbations because of increased oxygen demand due to increased work of breathing and impaired cardiopulmonary interactions . A case series study done by schnhofer et al39 showed transfusion decreases minute ventilation and work of breathing in anemic copd patients . The same group also showed that transfusion helped successful weaning from ventilator in five patients.40 however, the relationship between anemia and ventilation is complex and more data are needed to understand the consequences of anemia on gas exchange and transport during pump failure in copd . Usually a hemoglobin level of> 10 gm / dl is considered as a safe zone, however this may not be true for copd patients . The antadir study showed every 5% increase in hematocrit level was associated a relative risk of 0.86 (0.830.89) for 3-year mortality.14 kollert et al13 proposed hemoglobin values greater than 14.3 gm / dl for females and 15.1 gm / dl for males, which are much higher than who s definition, were associated with better outcomes in patients with chronic respiratory failure . Although hemoglobin levels between 79 gm / dl are considered as tolerated well in the icu setting, rasmussen et al22 reported a cutoff value of hemoglobin level <12 gm / dl was related to increased risk of death in intubated copd patients . Interestingly, stiell et al24 showed that patients with exacerbations who ended up with a serious adverse event (including icu admission, need for mechanical ventilation, and death within 30 days) had hemoglobin levels of 12.3 gm / dl which could be considered as normal . In regard to these findings, studies done in copd with chronic respiratory failure have shown the presence of anemia was associated with worse long - term survival, however, we were not able to show such an effect in our cohort.13,14,18 it should be kept in mind that the current study was designed and powered for the primary outcome (hospital mortality). Another important point to consider is study subjects had acute respiratory failure and only one third of the patients had chronic respiratory failure and were using oxygen at home . Finally, the follow - up period might have been too short to see a difference . When compared to previous reports, our median follow - up time was relatively shorter (36 vs 10.5 months, respectively).13 first, it is a single - center study and the results may not be generalizable to other centers . Second, all patients did not have recent pfts; therefore, we were unable to assess disease severity according to the gold classification system in the whole cohort . Third, mortality in the critically ill patients may potentially have been influenced by many confounding factors . Although we have attempted to include a wide range of all possible confounders in the mortality analysis, there is still a lack of data on therapy and complications during icu stay . Another important point to consider is the etiology of anemia, including data for previous exacerbations and hospitalizations, was not evaluated in this study . Besides these limitations there is limited data about the impact of anemia on severe copd exacerbations requiring mechanical ventilatory support . Most of the studies done in the icu setting included not only patients with exacerbations but also patients with other diagnoses such as pneumonia and cardiogenic pulmonary edema.2023 we were meticulous to include only patients with exacerbations . Moreover, the study cohort consisted of patients with different degrees of acute respiratory failure treated with both niv and invasive ventilation; therefore, our results might apply to a greater percentage of patients for prediction of prognosis . Finally, comorbidities such as congestive heart failure are known to have an increased risk of death in the presence of anemia . For this reason, instead of using a comorbidity index, each comorbidity was assessed separately in order to understand its own relationship with anemia and mortality . This study highlights two important results: first, anemia is related with increased risk of death in acute respiratory failure due to severe copd exacerbations . Further studies are needed to understand the physiological consequences of anemia in copd exacerbations and its impact on clinical outcomes . Whether correction of anemia has beneficial effects in copd is another challenging research question waiting to be answered.
Orbital metastasis can be defined as a metastatic lesion that occurs in the space between the eyeball and bony orbital walls.1 the orbit is an unusual site for metastatic cancer . It is believed to occur in approximately 2%3% of patients with systemic cancer.2,3 the incidence of orbital metastatic lesions varied from 1% to 13% of orbital tumors . This incidence has been noticed to be increasing in recent years.4 most ophthalmologists and oncologists have had little experience with orbital metastasis . Few studies with considerable numbers of patients have reported the clinical and imaging characteristics of this rare condition in different geographic regions.511 in this paper, we report the features of orbital metastatic lesions among patients in the delta region of egypt over the last 15 years . This was a retrospective study which included all patients who were histologically proven to have orbital metastatic lesions at tanta university eye hospital over the last 15 years (20002014). The study adhered to the principles of the declaration of helsinki and has been approved by tanta faculty of medicine ethical committee . The medical records of these patients were reviewed for patients age, sex, history of cancer, primary tumor site, presenting symptoms, and clinical signs . They were also reviewed for imaging criteria including tumor location and laterality, size, configuration, and bone changes . The study included 37 patients who were diagnosed through incision biopsy and histologically proven to have orbital metastatic lesions . The mean age (mean sd) of adult patients in the study was 54.910.1 years, and the mean age of children was 4.65.4 years . Breast carcinoma represented 21.6% of cases (eight patients), followed by hepatocellular carcinoma (hcc), which represented 16.2% (six patients). These two types of metastatic lesions represented 26.7% and 20.0% of adult patients, respectively . The next common primary tumor site was cutaneous malignant melanoma, which accounted for 13.5% of patients (five cases), followed by bronchogenic carcinoma, prostatic carcinoma, and thyroid adenocarcinoma, each of which accounted for 8.1% of patients (three cases of each type). The most common primary tumor in pediatric patients was neuroblastoma, with three cases (42.9% of pediatric patients and 8.1% of study patients). Nine patients (24.3%) were not known to be cancer patients, and the orbital lesion was the first presentation of the disease . On the other hand, 87.5% of patients with breast carcinoma (seven cases) gave a history of their primary tumor (table 1). In 20 cases (54.1%) the right orbit was involved, while the left orbit was involved in 15 cases (40.5%). Two cases had bilateral involvement (5.4%); one of these was a breast carcinoma case while the other was a neuroblastoma case . The clinical features and presenting symptoms varied between proptosis and/or globe displacement in 29 patients (78.4%), diplopia and limited ocular motility in 13 patients (35.1%), inflammatory manifestations (lid edema and conjunctival chemosis and injection) in four patients (10.8%), ptosis in two cases (5.4%), visual loss in two cases (5.4%), and enophthalmos in one case (2.7%) (table 2). The imaging studies (computed tomography [ct], magnetic resonance imaging [mri], or both) showed infiltrative lesions in 23 patients (62.2%), which were most commonly detected among breast carcinoma (seven cases). Mass lesion was found in eight patients (21.6%). In four patients (10.8%), the lesion was detected as an isolated muscle thickening; all of them were malignant melanoma . In two patients (5.4%) bone changes were detected in 15 patients (40.5%). In eleven cases (73.3%), the osteoclastic lesions were found among all patients with hcc (six cases). While in four cases (26.7%) osteoblastic lesions were detected, three of which were found among patients with prostatic carcinoma (figure 2). As regards lesion site, 54.1% (20 cases) were extraconal, 18.9% (seven cases) were extra- and intraconal, and 10.8% (four cases) were intraconal . In six cases the lesions were found as muscle thickening or bone lesions and could not be classified as intraconal or extraconal . The first case of orbital metastasis was described by horner in 1864, when he reported a case of a lung cancer metastasis to the orbit.4 since then multiple cases of orbital metastasis have been described in the literature . A metastasis to the orbit is rare and occurs less frequently than a uveal metastasis.4,12 the reported incidence of orbital metastatic lesions has been increasing . A number of factors may account for this increase: the improved treatment has led to an increase in the median survival of cancer patients, which in turn has increased the chances for development of metastatic lesions in unusual sites such as the orbit; advances in the diagnosis and application of serological and molecular diagnostic imaging techniques have led to the increased detection of such lesions; and an increased volume of medical literature on orbital metastasis has increased the awareness of these lesions.6,13,14 the actual incidence of orbital metastasis is believed to be higher than that described in the literature . Patients who have small orbital lesions may remain asymptomatic, and general debility in patients with widespread disease may mask the orbital symptoms leading to a low rate of referral to ophthalmologists.4,15 several authors have reported their experience with orbital metastasis . Breast carcinoma has been reported as the commonest primary tumor site with variable incidences.511 this was also noticed in this study, in which orbital metastasis from breast carcinoma represented 21.6% of all patients and 26.7% of adult patients . They reported prostate cancer as the second most common primary cancer (12%) followed by lung cancer (8%) and malignant melanoma (6%), which was also reported by other authors.5,7 henderson et al8 found bronchogenic carcinoma as the second most common tumor metastasizing to the orbit, while goldberg et al6 reported skin malignant melanoma as the second most common primary tumor . In a study done in australia, malignant melanoma was the second primary tumor (20%) followed by prostatic carcinoma (13%),10 while in another study done in the people s republic of china, the most common primary cancer that metastasized to the orbit was nasopharyngeal carcinoma (30.3%), followed by lung cancer (8.7%), liver cancer (6.5%), and breast carcinoma was the fourth (4.35%).11 these variations may be related to the different geographic areas of these different studies . The actual incidence of primary tumors metastasizing to the orbit is difficult to ascertain in a clinical series compared to autopsy series . For example, patients with bronchogenic carcinoma are usually markedly affected by their disease by the time an orbital metastasis has occurred . These patients can therefore be underrepresented in comparison with patients of breast cancer, who show a much slower disease course and may stay mobile and healthy enough to get an eye examination.16 in this study, hcc was found to be the second primary tumor site (16.2%) followed by cutaneous malignant melanoma (13.5%). This high incidence of orbital metastasis from hcc can be attributed to the rising incidence of hcc in egypt . The incidence of hcc noticeably increased from approximately 4.0% in 1993 to 7.3% in 2003.17 the rate of hcc in gharbiah (the province in which the study reported here was done) was found to be 3.5 times higher than that reported in the usa.18 it is known that chronic hepatitis c viral infection can lead to liver cirrhosis and hcc . Africa is reported to have the highest world health organization - estimated regional hepatitis c virus (hcv) prevalence (5.3%), and egypt has the highest prevalence of hcv in the world (17.5%).1921 diagnosis of orbital metastasis is a challenging task . Kuo et al noted that a cancer patient is a candidate for metastasis for the rest of their life.22 in 19%25% of cases, there may be no history of cancer, and thus the ophthalmologist may play a crucial role in the detection and staging of a previously unsuspected primary cancer.6,14 in this study, 24.3% were not known to be cancer patients . One - third of these patients were found to have hcc, which represented 50% of the cases with hcc in the study . Even known cancer patients may not give a history of cancer for various reasons including denial, embarrassment, or forgetfulness . Cancer may also be omitted from the history because patients may not think it is relevant to their ocular condition.6 goldberg and rootman classified the features of orbital metastasis into four categories: infiltrative with prominent motility restriction and sometimes enophthalmos; mass effect with proptosis and/or globe displacement; inflammatory, in which pain, chemosis, and erythema are experienced; and functional, in which there are cranial nerve findings that are out of proportion to the degree of orbital involvement . They reported that the infiltrative lesion is most common although mixed presentations exist as well.6,23 we found that proptosis and/or globe displacement was the most common feature, found in 78.4%, followed by motility restriction, which was found in 35.1% . Ct may be more beneficial in patients with prostatic carcinoma which has a tendency to metastasize to bone with development of osteoblastic orbital lesions.4,14 osteoclastic lesions can be found in metastasis from hcc which varies from bone notching and thinning to bone erosion.24 orbital metastatic lesions can be extraconal or intraconal . Enlargement of one or more of the extraocular muscles may be found in patients with metastatic cutaneous melanoma.4,25 the definitive diagnosis of an orbital metastasis requires tissue diagnosis . Fine needle aspiration biopsy has been advocated as a good diagnostic modality.26 there have, however, been reports of dissemination of tumor cells with the procedure, and there is a risk of globe injury, although the likelihood of these complications is low.6,26,27 incision biopsy of accessible lesion is a good diagnostic option, but in patients showing widespread metastatic disease and in who the diagnosis of cancer is established, an orbital biopsy may not be necessary and its inherent risks can be avoided as the diagnosis can be established on the basis of other findings.4 a high index of suspicion is required, as 24.3% did not have history of cancer in our study and orbital lesion was the first manifestation of the disease . A high incidence of orbital metastasis from hcc was found, which, as far as we are aware, has not been reported by any previous study; this can be explained on the basis of the increased incidence of hcc in the egyptian population.
Malaria is an infectious disease caused by parasites of the genus plasmodium and is a world health crisis of paramount urgency . Malaria was responsible for over 200 million cases and 1 million deaths in 2010 alone, primarily affecting developing countries and children under the age of 5 . Although five species of plasmodium parasite are known to infect humans, two species are responsible for the majority of morbidity and mortality: plasmodium falciparum (pf) and plasmodium vivax (pv). The current treatment for malaria is combination therapy, typically comprising artemisinin derivatives and a companion drug such as lumefantrine, mefloquine, or amodiaquine . These drugs (and the majority of antimalarials) target only the symptomatic blood - stage forms of the parasite; drugs that target additional life stages (such as asymptomatic liver stage parasites) are in high demand . Furthermore, resistance to chloroquine is long established and signs of artemisinin resistance have been detected along the eastern and western borders of thailand, compounding the urgent requirement for additional therapeutic agents targeting plasmodium parasites . Although there has been a great deal of funding and expertise directed toward antimalarial drug discovery over the past decade, the majority of therapeutics in clinical development are either elaborations of existing pharmacophores, reformulations / combinations of existing drugs, or novel molecules that function by unknown mechanisms of action . In order to combat resistance and achieve the goal of malaria eradication, a range of therapies targeting a variety of biological mechanisms and parasite life stages n - myristoylation is the covalent attachment of myristate, a saturated 14-carbon fatty acid, to the n - terminal glycine of target proteins from the acyl source myristoyl - coenzyme a (coa). This transformation is catalyzed by n - myristoyltransferase (nmt), a monomeric enzyme found ubiquitously in eukaryotes . Myristoylation is a widespread modification that occurs co- and post - translationally and has hundreds of putative substrates in vivo . Furthermore, myristoylation of proteins is known to modulate a variety of properties (such as protein localization and stability) and is implicated in a variety of critical biological pathways . In the specific context of malaria, several important parasitic proteins have been shown to require myristoylation in order to localize correctly and to carry out their biological functions, and the genetic essentiality of nmt in p. berghei (pb), the infectious species in the murine model of malaria, has been confirmed by conditional knockdown experiments . Furthermore, we recently reported the validation of nmt as an essential and chemically tractable drug target in p. falciparum . Using an integrated chemical biology approach, we identified the nmt substrate proteins in the blood stage of the parasite and demonstrated with small molecule tools that on - target inhibition of myristoylation disrupts the function of multiple specific downstream pathways, resulting in rapid cell death . Herein, we describe the development of a previously described series of benzo[b]thiophene inhibitors into 34c, a potent and selective parasite nmt inhibitor instrumental to the validation of this drug target . We also report further investigations into the utility of nmt inhibitors in drug - resistant cell lines and liver stage parasites . Previous work reported discovery of a series of benzo[b]thiophene - based inhibitors of p. falciparum (pf)nmt and p. vivax (pv)nmt, exemplified by 1 (figure 1).1 represents a promising starting point for hit to lead development but has only moderate enzyme affinity and high lipophilicity and contains a potentially metabolically labile ester group . Further development therefore focused on removal of this high - risk functionality combined with a 100-fold improvement in enzyme affinity, reduced lipophilicity, and controlled molecular weight . Little is currently known of the potential for toxicity resulting from mammalian nmt inhibition, and previous data have shown that a potent homo sapiens (hs)nmt inhibitor is not toxic to mice at high doses . Although selectivity over hsnmt is desirable, selectivity at the cellular level was considered the more critical determinant for progression . 2,3-substituted benzo[b]thiophene pfnmt and pvnmt inhibitor 1 and the target profile for the development of this series . Footnote a: ki values are quoted in place of ic50 values as a means of expressing the inhibitor affinity while correcting for differing michaelis constants (km) between enzymes . Enzyme ki values are calculated from the ic50 values using the cheng prusoff equation, the definition of which is given in the experimental section . Ic50 values are the mean value of two or more determinations, and standard deviation is within 20% of the ic50 . Footnote b: no significant difference in inhibition between hsnmt1 and hsnmt2 isoforms has been observed in this series; therefore, the hsnmt affinities reported in this work refer to hsnmt1 . Le = [log(ki)](1.374)/(no . Of heavy atoms), with clogp determined with chemaxon, which can be obtained from http://www.chemaxon.com / products / calculator - plugins / logp/. The metric ligand efficiency (le) has been used extensively in early stage drug development, and its utility has been well documented . The main criticism of le is the omission of any reference to the lipophilicity of the compound in question . Lipophilicity has been implicated as one of the most important properties of a potential drug molecule; it is critical to many related properties including solubility, permeability, and distribution . In vivo, highly lipophilic compounds will be more likely to partition from plasma to organic components such as membranes and proteins, increasing biological promiscuity (and in turn toxicity). Indeed, a recent review on metrics in drug discovery has stated optimizing le and lle (ligand lipophilic efficiency, pic50 log p) in concert is an important success factor for hit and lead optimization in drug discovery projects . Ligand efficiency dependent lipophilicity (clogp / le, lelp) has been proposed as a way to incorporate affinity, lipophilicity, and molecular size into a single metric for the triage of molecules and has been shown to be a strong predictor of druglikeness . It is proposed that a low lelp will reduce the chance of later stage failure due to nonspecific toxicity; marketed drugs have an average lelp of approximately 6, and desirable leads (le> 0.3, clogp <3) display lelp <10 . In order to control the lipophilicity and molecular weight of the current series, lelp was used to determine the druglikeness or physicochemical quality of the inhibitors tested . For clarity, consideration of the lelp of 1 (13.5, figure 1) emphasizes the requirement for significant improvement in the physicochemical profile of this series . Previous work showed that an appropriately placed 3-methoxyphenyl substituent can form and hydrogen bonding interactions with phe105 and ser319 of pvnmt, respectively . Attempts to replicate these interactions within the benzothiophene series yielded only a small affinity enhancement, but previously reported crystallographic evidence indicated that extension of the linker between the ester and methoxyphenyl moieties might result in improved interactions . A series of phenethyl esters and amides were therefore synthesized and assayed against a panel of nmts (scheme 1, table 1). Reagents and conditions: (a) 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide, hydroxybenzotriazole, n, n - diisopropylethylamine, mecn, rt, 18 h, 3657%; (b) benzotriazo-1-yl - oxytripyrrolidinophosphonium hexafluorophosphate, n, n - diisopropylethylamine, dcm, rt, 18 h, 6993%; (c) 10% tfa in dcm (v / v), rt, 2 h, 4297% . Ki values are the mean value of two or more determinations, and standard deviation is within 20% of the ki . This hypothesis was successfully validated, in that moving from 1 to 4b produced a 6-fold improvement in pfnmt affinity, retained the high pvnmt affinity, and pleasingly had little effect on hsnmt affinity . However, despite this improvement, the accompanying lipophilic methylene unit resulted in only a marginally improved lelp . Furthermore, the antiparasitic activity of 4b was reduced compared to 1 . Further sar mimicked that described previously for benzyl esters: adding a second hydrogen bond acceptor (4c) significantly improved affinity but removed all selectivity, resulting in a compound with high affinity against all three enzymes . Esters are strongly preferred over amides (4a vs 6a, 4d vs 6b, 4e vs 6c), and the active site for pvnmt appears to be more promiscuous than that of pfnmt and hsnmt . Intriguingly, increasing the linker length by a further methylene (4a vs 4d) reduced affinity for pfnmt, maintained affinity for pvnmt, and increased affinity for hsnmt . This reinforces the requirement for the ethyl spacer and indicates that selectivity is achievable through interactions with residues in this area of the enzyme . It is notable that the antiparasitic activity of these compounds is slightly reduced, with only the high affinity 4c displaying improved activity compared to 1 . It may be that the increased lipophilicity of this series has reduced the free fraction available for binding . 4c also displays the best lelp score of any analogues tested; further development shall continue to focus on targeting a lelp of <10 . The increased linker length between the phenyl moiety and the ester presented an excellent opportunity to investigate replacing the ester moiety with a heterocycle . In earlier analogues this modification was not explored, since it would have resulted in four contiguous aromatic rings, with likely deleterious effects on the solubility and toxicity profile . However, the incorporation of an extra methylene unit adds an extra degree of freedom and interrupts the -system, eliminating this potential issue . Crystallography suggested that the interactions of the ester with the enzyme were confined to long - distance -interactions with tyr211 and phe105 . In this scenario oxadiazoles are common bioisosteric replacements for methylene esters, displaying increased biological stability but with similar size and shape and increased potential for -interactions . Reagents and conditions: (a) nh2ohh2o, etoh, rt, 5 h, 9899%; (b) 2, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide, hydroxybenzotriazole, dmf, 140 c, 3 h, 1031%; (c) 10% tfa in dcm (v / v), rt, 2 h, 1399%; (d) bromoacetonitrile, t - buok, thf, 0 c to rt, 15 min, 88%; (e) tert - butyl 4-hydroxypiperidine-1-carboxylate, diisopropyl azodicarboxylate, pph3, thf, rt 1.5 h, 78%; (f) rch2co2h, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide, hydroxybenzotriazole, mecn, rt, 18 h; (g) 4 molecular sieves, toluene, 18 h, 110 c, 5468% over two steps . Replacement of the ester linker with a 1,2,4-oxadiazole produced an increase in affinity for all three enzymes, presumably due to -interactions within the active site and/or increased rigidification of the linker with respect to 4b . A single methylene between the oxadiazole linker and the phenyl moiety was preferred (9a vs 9b). Introduction of a m - methoxy substituent improved affinity, although only by a small degree (9a vs 9c, 14a vs 14b), and replacement of the methoxy group with a weakly hydrogen bonding and lipophilic chlorine reduced affinity for all three enzymes (9c vs 9d). Interestingly, in 4c addition of the second methoxy substituent produced an increase in affinity against pfnmt and hsnmt, whereas in 9e selectivity is improved with respect to 9c . Although this result was quite promising, the solubility of 9e is very low (data not shown), limiting the potential of this substitution pattern in further development . As with the ester extension, this optimization is accompanied by an increase in heavy atom count resulting in only a small increase in lelp, still above the target value of 10 . Nonetheless, both isomers of 1,2,4-oxadiazoles appear to be promising bioisosteres for the potentially problematic ester functionality . The developments detailed above improved enzyme affinity and removed a potentially labile ester group, making the compound series significantly more druglike . A consideration of lelp across the series highlights that the increase in enzyme affinity from 1 to 9c has been achieved at the expense of increased lipophilicity and molecular weight . This results in only a small improvement in lelp from 13.5 to 12.5, still substantially above the desired value of 10 for a promising lead . The optimization of biological potency at the expense of molecular properties is a common pitfall in drug development that has been associated with clinical attrition . The next stage in development therefore focused on improving the lelp of the series by improving affinity while reducing lipophilicity and molecular weight . Several strategies for lowering lipophilicity have been described in the recent literature; one of the most successful is matched molecular pairs analysis, the concept of replacing a moiety with a matched pair, a structural analogue that displays favorable physicochemical properties . One of the most studied (and striking) examples is the replacement of 1,2,4-oxadiazoles with the symmetrical 1,3,4-oxadiazole isomer . Because of the contrasting dipole moment of each heterocycle, 1,3,4-oxadiazoles display on average 10-fold lower lipophilicity and more favorable profiles with respect to metabolic stability, herg inhibition, and aqueous solubility . Switching to this matched pair thus represented an attractive opportunity to lower lipophilicity and improve physicochemical properties by making a minimal structural change to the series, crucially without adding molecular weight . The mixed hydrazide intermediate 17a / b was synthesized readily from ethyl ester 15, and this was converted into the 1,3,4-oxadiazole analogue 20a / b, and additionally the 1,2,4-triazole analogue 18 from 17a (scheme 3). Although less well studied than 1,3,4-oxadiazoles, 1,2,4-triazoles are known to have a lower log d than 1,2,4-oxadiazoles, as well as a higher aromatic stabilization energy . Reagents and conditions: (a) nh2nh2h2o, etoh, 78 c, 24 h, 75%; (b) rch2c(o)cl, n, n - diisopropylethylamine, dcm, rt, 15 min, 7591%; (c) pocl3, 100 c, 1 h; (d) ammonium acetate, acetic acid, 140 c, 1.5 h, 6% over two steps; (e) tscl, 1,2,2,6,6 pentamethylpiperidine, dcm, rt, 3 h, 4865%; (f) tfa, dcm, rt, 2 h, 5598% . Triazole 18 displayed a disappointing affinity profile, with no change in affinity for hsnmt but a decrease in affinity against the nmts of the two parasite species (9a, 14a vs 18, table 2). Nevertheless, an accompanying decrease in clogp resulted in a significant improvement in the lelp for 18, 9.5 compared to 12.4 and 12.8 for 9a and 14a, respectively . This scaffold is therefore likely to have improved aqueous solubility and druglike properties compared to the 1,2,4-oxadiazoles, which will need to be considered in the future development of this series . As might be expected from the small difference in affinity between the 1,2,4-oxadiazole regioisomers (for example, 9c vs 14b), moving to the 1,3,4-oxadiazole 20a / b had only a small effect on pf / pv nmt affinity (table 2). However, this modification unexpectedly decreased hsnmt affinity (20b vs 9c, 14b), resulting in a 13-fold selectivity window between pfnmt and hsnmt, 24-fold between pvnmt and hsnmt . In addition to the improved selectivity profile, 20a / b has a significantly lower clogp than 9a / c and 14a / b, resulting in a greatly improved lelp . Indeed, 18, 20a, and 20b all display lelp within the target range for promising lead compounds (lelp <10). Crystallography confirmed the binding mode of 20b in the peptide substrate pocket of pvnmt (figure 2a, pdb entry 4cae), showing that the methoxyphenyl moiety makes hydrophobic contacts with phe105 and a polar contact with ser319, in addition to the interactions observed previously for 1 . Furthermore, the oxadiazole is sandwiched between the aromatic residues phe105 and tyr211, potentially explaining the affinity improvement observed when the ester in 4b is replaced by an oxadiazole in 9c/14b (figure 2b). X - ray crystal structure of 20b (blue) bound to pvnmt (green). The 3-methoxyphenyl substituent forms the intended interactions with ser319 and phe105, in addition to the deeply buried hydrophobic scaffold and salt bridge interaction observed in 1 . (b) the oxadiazole linker is sandwiched between two aromatic residues, rationalizing the affinity enhancement in moving to an aromatic heterocycle from the ester linker in 4b . Dashed lines are drawn to highlight key interactions between the enzyme and the ligand . The crystal structure of 20b bound to pvnmt indicated that there was a voluminous solvent - filled pocket surrounding the methylene group to the methoxyphenyl, inviting the introduction of functionality that could either stabilize the water molecules in this pocket or displace water to the bulk solvent (figure 3). In addition, this position is a potential target for oxidative metabolism and blocking with alternative substituents may provide benefits during subsequent lead development . X - ray crystal structure of 20b (blue) bound to pvnmt (green). Further inspection of the water molecules within the active site shows that the benzylic ch2 occupies a heavily solvated pocket, indicating that substitution may result in more favorable energetics within the enzyme active site . Dashed lines indicate water molecules within 5 of the benzylic position . The abundance of readily available -substituted phenylacetic acids meant this strategy could be explored extensively, using previously developed chemistry: a variety of substitutions were introduced as shown in scheme 4 and table 3 . Reagents and conditions: (a) ph - cr1r2-co2h, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride, hydroxybenzotriazole, thf, dmf, rt, 18 h, 4899%; (b) tscl, 1,2,2,6,6pentamethylpiperidine, dcm, rt, 18 h; (c) 10% tfa in dcm (v / v), rt, 2 h, 440% over two steps . The results show that a wide variety of substitutions at this position produce only small changes in enzyme affinity, reinforcing the notion that there is flexibility in the binding pocket . Of the hydrophobic substituents, cyclopropyl results in the highest affinity: thus, 23c retains the activity of 20a but with a concomitant increase in lelp . The most significant result is 23 g, which is approximately equipotent to 23a with the addition of a polar hydroxyl group . This increases the hydrophilicity and decreases the lelp but increases the molecular complexity (with the addition of a stereocenter) and introduces a further hydrogen bond donor (which may adversely affect membrane permeability). Weighing these detriments against the moderate improvements these modifications provided, the decision was made to progress development with the unsubstituted template as in 20a / b with the knowledge that functionality could be reintroduced during future lead development should a solubilizing / metabolism blocking group be required . The next area of interest was modification of the methoxyphenyl portion of the molecule . The rationale for this change was twofold: (i) the methoxyphenyl portion contributes significantly to the lipophilicity of these molecules and, as such, presents a target for improvement of lelp; (ii) aryl ethers are notoriously poor h - bond acceptors, and so replacement may result in a stronger hydrogen bond with ser319 and an improvement in affinity . Brand et al . Previously described the development of a series of highly potent trypanosoma brucei nmt inhibitors that form a hydrogen bond to the conserved ser319 (ser330 in leishmania major nmt) residue, for example, via a 1,3,5-trimethylpyrazole moiety (pdb entry 2wsa). Building on this observation, we selected three distinct heterocycles to replace the methoxyphenyl substituent (scheme 5) on the basis that nitrogen atoms conjugated within -systems are typically excellent hydrogen bond acceptors, and these moieties would have reduced lipophilicity relative to the methoxyphenyl parent compound (table 4). The binding mode in pvnmt (figure 2) indicated that the heterocycles in molecules 34a c (bearing a methylene linker) would not make direct contacts to the desired residues . For this reason, compounds 35a c with an extended two - carbon linker were also synthesized in the expectation that this would place the heterocycle directly adjacent to ser319, albeit with the entropic and lipophilic penalty associated with a longer alkyl chain . Reagents and conditions: (a) nah, ethyl bromoacetate, thf, 0 c, 18 h, 78%; (b) methyl 3-bromopropionate, k2co3, dmf, 55 c, 18 h, 30%; (c) nh2nh2h2o, meoh, rt, 3 h, 8399%; (d) n = 1, nh2ohhcl, k2co3, etoh, 78 c, 3 h, 12%; n = 2, nh2ohhcl, h2o, meoh, 60 c, 18 h, 89%; (e) menhnh2, acoh, 3 h, rt, 7395%; (f) liohh2o, meoh, rt, 18 h, 5195%; (g) 16, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride, hydroxybenzotriazole, thf, dmf, rt, 18 h, 4899%; (h) tscl, 1,2,2,6,6-pentamethylpiperidine, dcm, rt, 18 h; (i) 10% tfa in dcm (v / v), rt, 2 h, 326% over two steps . The sar obtained across these analogues was unexpected: in all cases pvnmt and pfnmt had higher affinity for the methylene linked 34 series, although this was not always the case for hsnmt (34b vs 35b). Of the three heterocycles, isoxazoles (34b and 35b) and 1h - pyrazoles (34a and 35a) had decreased affinity compared to the methoxyphenyl parent 20b . Interestingly, 34a displays 30-fold selectivity between pfnmt and hsnmt, a significant improvement over the 8- to 9-fold observed in 34b/34c . Addition of the n - methyl group in 34c produces a marked increase in affinity against all enzymes, resulting in the highest affinity plasmodium spp . Furthermore, this compound displays nanomolar efficacy against the parasite, allowing further biological evaluation of this drug target (vide infra). The affinity enhancement imparted by the methylpyrazole is accompanied by a reduction in clogp (relative to methoxyphenyl 20b) resulting in an excellent lelp of 5.5, close to the reported average lelp of marketed drugs . Consequently, this compound has excellent druglike properties; we have previously reported the excellent aqueous solubility (> 8 mm) and in vitro pharmacokinetic properties of this molecule . Although the selectivity between pfnmt and hsnmt is 8-fold (30-fold vs pvnmt), comparison to 34a shows that significant changes in the selectivity profile may potentially be achieved by altering the interactions with this binding pocket . The binding mode of 34c was elucidated by crystallography, as briefly described previously (figure 4, pdb entry 2yne). As predicted during the compound design process, the pyrazole of 34c does not directly interact with the target ser319, indicating a subtler basis for the affinity improvement . The pyrazole n-2 interacts indirectly with ser319 via a water molecule, with the methyl groups occupying hydrophobic regions of the pocket (figure 4b). The improved enzyme affinity is likely a result of the strong pyrazole water hydrogen bond combined with fit complementarity within the binding site . In addition, the compound makes all the interactions observed with previous members of the series, including the salt bridge interaction with leu410/tyr107, a sandwiched oxadiazole linker, and deeply buried benzothiophene scaffold (figure 4a). (a) 34c (gold) bound to pvnmt (green), showing piperidine leu410 salt bridge interaction, deeply buried benzothiophene scaffold, and 1,3,5-trimethylpyrazole heterocycle bound within the ser319 hydrophobic pocket . (b) enlarged view of the 1,3,5-trimethylpyrazole of 34c (gold) with pvnmt (green). This shows the water - bridged interaction between the pyrazole and ser319, as well as multiple hydrophobic contacts between the heterocycle and the binding pocket . The binding mode of 34a in pvnmt was also determined by crystallography (figure 5a, pdb entry 4caf). This compound displays a 40-fold lower binding affinity to pvnmt than 34c; however, the binding modes of these two compounds are extremely similar (figure 5b). The only point of differentiation is the pyrazole heterocycle which forms a direct polar interaction with ser319 as opposed to the water - bridged interaction observed in figure 4b . Indeed, this water molecule is excluded from the pocket occupied by 34a, perhaps indicating that it is involved in stabilizing ser319 and therefore that its expulsion to the bulk solvent is energetically unfavorable . (a) 34a (pink) forms all previously observed interactions with the enzyme . (b) comparison of the binding modes of 34a and 34c reaffirms this similarity, showing that the only point of differentiation is in the phe105/ser319 binding site occupied by the pyrazole . (c) enlarged view of the 1,3,5-trimethylpyrazole of 34c (gold) and 3,5-dimethylpyrazole of 34a (pink) with pvnmt (green). The pyrazole of 34a forms a direct interaction with ser319 (3.2), and the water involved in the bridged interaction in figure 4b has been excluded from the pocket . 34c provides excellent enzyme affinity and lelp, and the cellular efficacy enabled further biological evaluation of this inhibitor . 34c was tested against a variety of parasites in vitro, including both drug - resistant cell lines and liver stage parasites, and for mammalian cell toxicity against human hepatocellular carcinoma cell line hepg2 . Activity was directly compared to chloroquine (36) and atovaquone (37) where relevant . Nf54, k1, and dd2 ec50 values are determined using a [h]hypoxanthine incorporation assay (performed by dr . Sergio wittlin and dr . Standard deviation is within 20% of the ld50 . 3d7 and nf54 are chloroquine - sensitive strains of the parasite, whereas k1 and dd2 are chloroquine - resistant strains, as evidenced by the greatly reduced potency of this drug against these strains (table 5). 34c was previously shown to act on - target in blood stage drug - sensitive (3d7) parasites . Pleasingly, 34c is active against an additional drug - sensitive line (nf54) and there is very little loss of potency for drug - resistant cell lines (less than 4-fold between nf54 and dd2), indicating that nmt inhibition may be an effective mechanism to target drug - resistant parasites in a clinical context . In addition, 34c was tested against a plasmodium berghei (pb) liver stage model to determine whether nmt is likely to be a viable drug target for clearance of liver stage parasites . The pbnmt enzyme affinity of 34c was determined at 14 nm, validating an approximate comparison with the pf blood stage models . 34c had a liver stage ec50 of 372 nm, which, although significantly lower than the atovaquone standard, is in excellent agreement with the blood stage results . This provides evidence that nmt inhibition is also a promising mechanism for targeting liver stage parasites and may therefore be an effective pathway for the disruption of multiple parasite life stages . Lastly, 34c displays up to 40-fold selectivity between parasitic and hepg2 cell lines (14-fold in the case of dd2). This represents an encouraging window for a compound with 10-fold enzyme selectivity: if hepg2 cytotoxicity is due to nmt inhibition, then a more selective compound will have a larger window, and if the lethality is nonspecific, then the cell potency and toxicity appear sufficiently decoupled to be optimized independently . The medicines for malaria venture dictates that validated hit compounds should display cellular selectivity of greater than 10-fold, whereas preclinical candidates should be> 100-fold selective . With this target in mind, 34c displays reasonable selectivity for a lead compound: a further 3-fold improvement in efficacy without accompanying toxicity will achieve the required window for a candidate molecule . Note that the moderate selectivity is a functional of low efficiacy rather than high toxicity; the ld50 for 34c is approximately the top concentration tested (10 m) for the antimalarial standards . The metric lelp was used to guide the development of this compound series, based on the hypothesis that compounds with a low lelp (ideally <10) will have fewer off - target effects and as a result are more druglike . In an attempt to assess if lelp is a useful metric in this regard, the cellular ec50 against the 3d7 parasite line was plotted against nmt affinity for all tested members of this series . (a) plot of cellular potency vs enzyme affinity for all members of this series tested in both assays . (b) plot of cellular potency vs enzyme affinity for all compounds with a lelp of> 10 . (c) plot of cellular potency vs enzyme affinity for all compounds with a lelp of <10 . An initial assessment of cellular potency vs enzyme affinity showed only a weak correlation (r = 0.47) between these two parameters (figure 6a) and a relatively flat gradient (0.40). However, when the compounds were separated into those with a leadlike lelp score (lelp <10) and those without (lelp> 10), a qualitative assessment showed an improved correlation for those compounds with a low lelp value (figure 6c vs figure 6b). Figure 6c shows that for those compounds with lelp <10 there is a strong correlation between cellular potency and enzyme affinity (r = 0.82) and a gradient significantly closer to 1 than in the full data set (0.75 vs 0.40). In contrast, for compounds with a lelp of> 10 there is a very weak correlation between ec50 and ki (r = 0.36) and a flat gradient (0.23), indicating that antiparasitic activity from these compounds derives predominantly from a mechanism independent of nmt inhibition . This observation is consistent with the hypothesis that high - lelp compounds (with relatively high lipophilicity and low le) are more promiscuous than low - lelp analogues and therefore may exhibit cytotoxic activity by a variety of nonspecific mechanisms . Low - lelp analogues are predicted to bind more specifically to the target enzyme, and this is supported by the improved correlation between nmt affinity and antiparasitic activity in this data set; although wary of correlation inflation, this analysis appears to provide a robust predictor of cell efficacy when applied to these models . It would be unwise to invoke lelp <10 as a rule rather than a guideline, as this is unlikely to be a binary boundary, with some compounds in either subset behaving not as predicted . Nevertheless, it provides encouraging evidence that lelp is a useful metric for guiding the hit - to - lead optimization process . Furthermore, this analysis highlights the danger of assuming that weakly active (le <0.3), lipophilic compounds (clogp> 3) function in cellular systems by the presumed mechanism of action, without further validation . Previously reported work described the discovery of 1 by a lead - hopping approach, as a ligand efficient inhibitor of plasmodial nmt . This work details lelp - guided development of this series, optimizing enzyme affinity while retaining selectivity over hsnmt to yield 34c, a high affinity druglike plasmodial nmt inhibitor . Development from 1 to 34c achieved a 100-fold improvement in enzyme affinity coupled with a 100-fold reduction in lipophilicity, at the expense of only two additional heavy atoms . This further demonstrates the utility of medicinal chemistry strategies such as matched molecular pairs analysis, bioisosterism, and metric - guided optimization in hit - to - lead development . 34c has antiparasitic activity in vitro, exhibiting similar potency over four parasite strains including two drug - resistant ones . In addition, this compound is equipotent against blood and liver stage parasites and displays selectivity over human liver host cells . It has been previously shown that this molecule exerts its antiparasitic activity via inhibition of nmt and moreover that it can reduce parasitemia in vivo . Taken together, this biological characterization shows that nmt is a highly promising target for the development of a new generation of antimalarial drugs . Further work will focus on optimization of cellular potency and in vivo pharmacokinetics, with the aim of producing a candidate series for the treatment of malaria . (gillingham, uk), acros organics (geel, belgium) and alfa aesar (heysham, uk) and used without further purification . Moisture sensitive reactions were performed under nitrogen atmosphere using dried glassware, anhydrous solvents, and standard syringe / septa techniques . Silica gel normal phase column chromatography was performed on an isolera (biotage, u.k .) Mobile phase consisted of n - hexane (solvent a) and ethyl acetate (solvent b), and standard gradient consisted of x% solvent b for 1 column volumes, x% to y% b for 10 column volumes, and then y% b for 2 column volumes . X and y are defined in the characterization section of the compound of interest . Final compounds were purified by one of two methods: either hplc or lc ms . Postchromatography, organic solvents were removed by partial evaporation under reduced pressure and then compounds were dried by lyophilization overnight . Hplc involved the following: gilson semipreparative reverse phase hplc system equipped with a hichrom c18 column (250 mm 21.2 mm), no . 306 pumps, and a gilson uv / vis detector, detecting at 220 nm . The mobile phase consisted of h2o + 0.1% formic acid (solvent a) and meoh + 0.1% formic acid (solvent b), with an elution method of 02 min 50% b, 230 min 5098% b, 3032 min 98%, 3232.5 min 2% b at a flow rate of 12 ml / min . Lc ms involved the following: rp - hplc / ms on a waters 2767 system equipped with a photodiode array and an esi mass spectrometer using a xbridge prep c18 (5 m, 19 mm 100 mm) column, equipped with an xbridge prep c18 guard column (5 m, 19 mm 10 mm). The following elution method was used: gradient of solvent a and solvent b (as above) of 010 min 5098% b, 1012 min 98% b, 1213 min 9850% b, 1317 min 50% b. flow rate was 20 ml / min . The purity of the title compounds was verified by reverse phase lc ms on a waters 2767 system equipped with a photodiode array and an esi mass spectrometer using a xbridge c18 (5 m, 4.6 mm 100 mm) column, equipped with an xbridge c18 guard column (5 m, 4.6 mm 20 mm). The following elution method was used: gradient of solvent a and solvent b (as above) of 010 min 598% b, 1012 min 98% b, 1213 min 985% b, 1317 min 5% b. flow rate was 1.2 ml / min . H and c nmr spectra were respectively recorded on 400 and 101 mhz bruker av instruments at room temperature unless specified otherwise . In these cases h and c nmr spectra were respectively recorded on 500 and 126 mhz bruker av instruments at room temperature and were referenced to residual solvent signals . Data are presented as follows: chemical shift in ppm, integration, multiplicity (br = broad, app = apparent, s = singlet, d = doublet, t = triplet, q = quartet, p = pentet, m = multiplet), and coupling constants in hz . Mass spectra were obtained from the mass spectrometry service of department of chemistry, imperial college london . 1 and 2 were prepared as described previously . To a solution of 2 (50 mg, 0.13 mmol) in dry acetonitrile (2 ml) were added hydroxybenzotriazole (27 mg, 0.20 mmol), n, n - diisopropylethylamine (26 l, 0.16 mmol), and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (30 mg, 0.16 mmol). 2-(3-methoxyphenyl)ethanol (22 l, 0.15 mmol) was then added and reaction mixture allowed to stir at room temperature for 18 h. the reaction mixture was concentrated under reduced pressure, dissolved in 10 ml of saturated ammonium chloride solution, and 3b was extracted with 3 10 ml ethyl acetate . Combined organic layers were then washed with brine (10 ml), dried over magnesium sulfate, concentrated under reduced pressure and crude product was purified by flash chromatography (10 g snap cartridge, 650% b, rf = 5.1 column volumes) to give 3b as a colorless oil (24 mg, 36%). H nmr (cdcl3,, ppm) 7.86 (1h, d, j = 8.0), 7.75 (1h, d, j = 8.2), 7.517.46 (1h, m), 7.437.37 (1h, m), 7.32 (1h, dd, j = 8.0, 7.8), 7.04 (1h, d, j = 7.8), 7.027.00 (1h, m), 6.90 (1h, dd, j = 8.0, 2.3), 5.35 (2h, s), 4.744.66 (1h, m), 3.943.86 (2h, m), 3.84 (3h, s), 3.072.98 (2h, m), 1.981.88 (2h, m), 1.851.73 (2h, m), 1.48 (9h, s). To a solution of 3b (23.0 mg, 0.05 mmol) in dichloromethane (1 ml) was added trifluoroacetic acid (100 l), and the solution was stirred at room temperature for 2 h. the reaction mixture was concentrated under reduced pressure and purified by hplc, yielding 4b as a colorless oil (5 mg, 18%). Tr = 12.3 min; h nmr (cdcl3,, ppm) 7.82 (1h, d, j = 8.0), 7.76 (1h, d, j = 8.1), 7.567.48 (1h, m), 7.477.40 (1h, m), 7.33 (1h, app t, j = 7.9), 7.04 (1h, d, j = 7.4), 7.016.98 (1h, m), 6.91 (1h, dd, j = 8.2, 2.4), 5.34 (2h, s), 4.884.81 (1h, m), 3.84 (3h, s), 3.543.44 (2h, m), 3.113.01 (2h, m), 2.222.11 (4h, m); c nmr (cdcl3,, ppm) 161.48, 159.84, 153.90, 138.23, 136.98, 134.06, 129.82, 128.39, 125.07, 123.14, 122.61, 120.34, 115.87, 113.81, 113.79, 76.10, 66.82, 55.29, 41.01, 28.07; esi hrms, found 398.1425 (c22h24no4s, [m + h], requires 398.1426). To a solution of 2 (40 mg, 0.11 mmol) in n, n - dimethylformamide (1 ml) were added hydroxybenzotriazole (16 mg, 0.12 mmol) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (22 mg, 0.12 mmol), and the reaction mixture was stirred at room temperature for 30 min . N-hydroxy-2-phenylacetimidamide was added (17.5 mg, 0.12 mmol), and the mixture was stirred at 140 c for 3 h. the reaction mixture was concentrated under reduced pressure, dissolved in 20 ml of saturated ammonium chloride solution, and 8a was extracted with 3 20 ml of ethyl acetate . The combined organic layers were washed with saturated potassium carbonate solution (20 ml), brine (20 ml), dried over magnesium sulfate, concentrated under reduced pressure and crude product was purified by flash chromatography (10 g snap cartridge, 650% b, rf = 7.5 column volumes) to give 8a as a clear yellow oil (16 mg, 31%). H nmr (cdcl3,, ppm) 7.87 (1h, d, j = 7.8 hz), 7.80 (1h, d, j = 8.0 hz), 7.50 (1h, ddd, j = 8.0, 7.1, 1.2 hz), 7.467.28 (6h, m), 4.634.54 (1h, m), 4.16 (2h, s), 3.983.87 (2h, m), 3.002.91 (2h, m), 2.011.93 (2h, m), 1.901.78 (2h, 9a was prepared as in 4b replacing 3b with 8a (16 mg, 0.03 mmol) and purified by lc tr = 4.22 min; h nmr (cdcl3,, ppm) 7.82 (2h, d, j = 8.1 hz), 7.52 (1h, dd, j = 8.1, 7.1 hz), 7.46 (1h, dd, j = 8.1, 7.1 hz), 7.407.28 (5h, m), 4.804.72 (1h, m), 4.16 (2h, s), 3.563.45 (2h, m), 3.042.95 (2h, m), 2.222.15 (4h, m); c nmr (cdcl3,, ppm) 170.28, 169.61, 152.34, 137.32, 135.57, 133.82, 129.29, 128.92, 128.37, 127.44, 125.57, 123.45, 122.72, 109.93, 76.97, 40.73, 32.49, 28.4l; esi hrms, found 392.1425 (c22h22n3o2s, [m + h], requires 392.1433). To a solution of methyl-2-mercaptobenzoate (1.64 ml, 11.9 mmol) and 2-bromoacetonitrile (0.92 ml, 13.1 mmol) in dry tetrahydrofuran (100 ml) at 0 c was added potassium tert - butoxide (5.14 g, 71.3 mmol) gradually over 2 min . The reaction mixture was stirred and allowed to warm to room temperature over 15 min, quenched with 2 m hydrochloric acid to ph 2, and diluted with 75 ml of water . The organic layers were combined, washed with 75 ml of brine, dried over magnesium sulfate, and concentrated under reduced pressure to give desired product 10 as a dark brown solid (2.03 g, 88%). H nmr (cdcl3,, ppm) 8.54 (1h, brs), 7.91 (1h, d, j = 8.1 hz), 7.73 (1h, d, j = 8.2 hz), 7.627.50 (1h, m), 7.517.40 (1h, m). To a solution of 10 (500 mg, 2.85 mmol) in tetrahydrofuran (7.5 ml) was added tert - butyl 4-hydroxypiperidine-1-carboxylate (1.15 g, 5.71 mmol) and triphenylphosphine (1.50 g, 5.71 mmol). The reaction mixture was stirred under nitrogen for 20 min and cooled to 0 c, and diisopropyl azodicarboxylate (1.12 ml, 5.71 mmol) in tetrahydrofuran (10 ml) was added dropwise over 5 min . Reaction mixture was allowed to warm to room temperature and stirred for 1.5 h, then concentrated under reduced pressure and the crude product purified by flash chromatography (100 g snap cartridge, 218% b, rf = 8.5 column volumes) to give 11 as a white solid (800 mg, 78%). H nmr (cdcl3,, ppm) 7.85 (1h, dd, j = 8.2, 0.9 hz), 7.72 (1h, d, j = 8.2 hz), 7.55 (1h, ddd, j = 8.2, 7.1, 1.1 hz), 7.44 (1h, ddd, j = 8.2, 7.2, 0.9 hz), 5.25 (1h, tt, j = 7.3, 3.6 hz), 3.853.74 (2h, m), 3.463.36 (2h, m), 2.182.07 (2h, m), 1.981.87 (2h, m), 1.49 (9h, s). To a solution of 11 (100 mg, 0.28 mmol) in ethanol (2 ml) was added hydroxylamine as 50% aqueous solution (170 l, 2.79 mmol), and reaction mixture was stirred under refluxing conditions for 4 h. reaction mixture was concentrated under reduced pressure to give 12 as a white solid (109 mg, 99%). H nmr (cdcl3,, ppm) 7.777.73 (1h, m), 7.727.67 (1h, m), 7.417.37 (2h, m), 6.25 (1h, brs), 5.55 (2h, brs), 4.504.41 (1h, m), 4.173.99 (2h, m), 2.87 (2h, ddd, j = 14.2, 11.7, 2.6 hz), 2.122.00 (2h, m), 1.871.74 (2h, m), 1.48 (9h, s). To a solution of 3-methoxyphenylacetic acid (31 mg, 0.19 mmol) in acetonitrile (1 ml) were added hydroxybenzotriazole (27.5 mg, 0.21 mmol) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (39 mg, 0.21 mmol), and reaction mixture was stirred at room temperature for 15 min . 12 was added (80 mg, 0.21 mmol) and the mixture stirred at room temperature for 18 h. the reaction mixture was diluted with 20 ml of 0.5 m naoh(aq) solution, and 13b was extracted with 3 20 ml of ethyl acetate . The combined organic layers were washed with saturated potassium carbonate solution (20 ml), brine (20 ml), dried over sodium sulfate, and concentrated under reduced pressure . Crude product (120 mg) and 4 molecular sieves (200 mg) were dissolved in toluene (3 ml), and reaction mixture was stirred at 110 c for 18 h. the reaction mixture was filtered, concentrated under reduced pressure and crude product purified by flash chromatography (10 g snap cartridge, 540% b, rf = 8.0 column volumes) to give 13b as a clear orange oil (66 mg, 68%). H nmr (cdcl3,, ppm) 7.84 (1h, dd, j = 7.1, 1.2 hz), 7.79 (1h, dd, j = 7.1, 1.2 hz), 7.43 (2h, dd, j = 7.1, 1.2 hz), 7.337.28 (1h, m), 6.97 (1h, d, j = 8.0 hz), 6.956.92 (1h, m), 6.87 (1h, dd, j = 8.0, 2.4 hz), 4.604.50 (1h, m), 4.28 (2h, s), 4.003.89 (2h, m), 3.83 (3h, s), 3.022.93 (2h, m), 2.011.92 (2h, m), 1.891.77 (2h, m), 1.48 (9h, s). 14b was prepared as in 4b replacing 3b with 13b (66 mg, 0.13 mmol) and purified by hplc, yielding 14b as a white solid (21 mg, 40%). Tr = 9.7 min; h nmr (cdcl3,, ppm) 8.03 (1h, dd, j = 7.0, 1.3 hz), 7.927.84 (1h, m), 7.587.47 (2h, m), 7.31 (1h, app t, j = 7.9 hz), 7.047.00 (1h, m), 6.996.94 (1h, m), 6.946.87 (1h, m), 4.66 (1h, tt, j = 7.7, 3.6 hz), 4.43 (2h, s), 3.76 (3h, s), 3.443.27 (2h, m), 3.032.90 (2h, m), 2.132.03 (2h, m), 2.011.89 (2h, m); c nmr (cdcl3,, ppm) 178.57, 162.84, 159.46, 149.67, 136.80, 135.25, 133.88, 129.86, 127.34, 125.28, 123.55, 122.15, 121.40, 115.13, 112.72, 112.35, 76.88, 55.09, 40.82, 31.85, 28.20; esi hrms, found 422.1534 (c23h24n3o3s, [m + h], requires 422.1538). To a solution of 15 (300 mg, 0.74 mmol) in ethanol (1 ml) was added hydrazine monohydrate (145 l, 2.96 mmol). The reaction mixture was heated under refluxing conditions for 24 h and then concentrated under reduced pressure, yielding 16 as a yellow oil (217 mg, 75%). H nmr (cdcl3,, ppm) 7.79 (1h, d, j = 7.6 hz), 7.74 (1h, d, j = 7.2 hz), 7.487.37 (2h, m), 4.58 (1h, tt, j = 9.8, 4.1 hz), 4.134.04 (2h, m), 2.952.82 (2h, m), 2.142.05 (2h, m), 1.921.78 (2h, m), 1.48 (9h, s). To a solution of 16 (48 mg, 0.12 mmol) in tetrahydrofuran / n, n - dimethylformamide (4:1 v / v, 0.6 ml) were added hydroxybenzotriazole (8 mg, 0.06 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (28 mg, 0.15 mmol) and 2-phenylpropanoic acid (20 l, 0.15 mmol). Reaction mixture was stirred at room temperature for 18 h and then diluted with 1.0 m naoh(aq) (4 ml). Combined organic layers were washed with brine (5 ml), dried over sodium sulfate, and concentrated under reduced pressure, yielding 21a as a colorless oil (63 mg, 98%). H nmr (cdcl3,, ppm) 7.827.76 (2h, m), 7.497.20 (7h, m), 4.68 (1h, tt, j = 10.0, 4.1 hz), 4.194.06 (2h, m), 3.85 (1h, q, j = 7.2 hz), 2.882.79 (2h, m), 2.162.05 (2h, m), 2.021.88 (2h, m), 1.60 (3h, d, j = 7.2 hz), 1.48 (9h, s). To a solution of 21a (63 mg, 0.12 mmol) and 1,2,2,6,6-pentamethylpiperidine (47 l, 0.26 mmol) in dichloromethane (1 ml) was added m - toluenesulfonyl chloride (25 mg, 0.13 mmol), and the reaction mixture was stirred at room temperature for 18 h. the reaction mixture was then diluted with a further 2 ml of dichloromethane, washed with water (2 ml), washed with 1.0 m naoh(aq) (2 ml), washed with brine (2 ml), dried over magnesium sulfate, and concentrated under reduced pressure . Crude reaction mixture was boc - deprotected without further purification as in 4b, replacing 3b with 22a (10 mg, 0.02 mmol), and purified by hplc yielding 23a as a yellow oil (7 mg, 14%). Tr = 11.0 min; h nmr (cdcl3,, ppm) 8.44 (1h, brs), 7.857.73 (2h, m), 7.547.30 (7h, m), 4.65 (1h, brs), 4.44 (1h, q, j = 6.6 hz), 3.533.35 (2h, m), 3.062.86 (2h, m), 2.202.01 (4h, m), 1.84 (3h, d, j = 6.6 hz); esi hrms, found 406.1587 (c23h24n3o2s, [m + h], requires 406.1589). To a solution of sodium hydride (576 mg, 24.0 mmol) in anhydrous tetrahydrofuran (30 ml) cooled to 0 c was added pentane-2,4-dione (2.05 ml, 20.0 mmol) in anhydrous tetrahydrofuran (40 ml), and the mixture was stirred for 1 h. ethyl bromoacetate (2.66 ml, 24.0 mmol) in anhydrous tetrahydrofuran (30 ml) was then added, and the reaction mixture was stirred for 18 h. the reaction mixture was then washed with saturated nh4cl(aq) (100 ml), and aqueous layer was back - extracted with etoac (100 ml). Combined organic layers were washed with brine (100 ml), dried over magnesium sulfate, and concentrated under reduced pressure, yielding 24 as a yellow oil (2.90 g, 78%). Mixture of diketone / enol tautomers 2:1 was observed by nmr in cdcl3 at room temperature . Diketone h nmr (cdcl3,, ppm) 4.204.12 (3h, m), 2.90 (2h, d, j = 7.3 hz), 2.29 (6h, s), 1.311.25 (3h, m); enol h nmr (cdcl3,, ppm) 4.224.08 (2h, m), 3.25 (2h, s), 2.17 (6h, s), 1.321.23 (3h, m). To a solution of 24 (400 mg, 2.15 mmol) in acetic acid (3 ml) was added methylhydrazine (125 l, 2.37 mmol) dropwise, and reaction mixture was stirred at room temperature for 3 h. reaction mixture was concentrated under reduced pressure, yielding 26c as a colorless oil (349 mg, 73%). H nmr (cdcl3,, ppm) 4.15 (2h, q, j = 7.1 hz), 3.74 (3h, s), 3.35 (2h, s), 2.22 (6h, s), 1.28 (3h, t, j = 7.1 hz). To a solution of 26c (300 mg, 1.53 mmol) in methanol (3 ml) was added lithium hydroxide monohydrate (642 mg, 15.3 mmol), and the mixture was stirred at room temperature for 18 h. reaction mixture was diluted with water (20 ml) and acidifed with 2.0 m hcl(aq) to ph 4 . Then 28c was extracted with etoac (3 20 ml). Combined organic layers were then dried over sodium sulfate and concentrated under reduced pressure, yielding 28c as a pink crystalline solid (130 mg, 51%). H nmr (cdcl3,, ppm) 3.80 (3h, s), 3.41 (2h, s), 2.24 (3h, s), 2.23 (3h, s). 30c was prepared as in 21a replacing 2-phenylpropanoic acid with 28c (25 mg, 0.15 mmol), yielding 30c as an orange oil (43 mg, 66%). H nmr (cdcl3,, ppm) 9.75 (1h, d, j = 6.2 hz), 7.897.72 (3h, m), 7.537.37 (2h, m), 4.754.65 (1h, m), 4.124.06 (2h, m), 3.76 (3h, s), 3.46 (2h, s), 2.862.82 (2h, m), 2.26 (6h, s), 2.142.09 (2h, m), 1.991.87 (2h, m), 1.48 (9h, s). 34c was prepared as in 23a replacing 21a with 30c (66 mg, 0.12 mmol) and purified by lc ms, yielding 34c as a yellow solid (9 mg, 17%). Tr = 7.1 min; h nmr (cd3od,, ppm) 8.47 (1h, brs), 7.997.88 (2h, m), 7.617.45 (2h, m), 4.81 (1h, tt, j = 7.2, 4.1 hz), 4.12 (2h, s), 3.72 (3h, s), 3.56 (2h, ddd, j = 12.1, 7.5, 4.1 hz), 3.11 (2h, ddd, j = 12.5, 7.5, 4.1 hz), 2.29 (3h, s), 2.22 (3h, s), 2.212.04 (4h, m); c nmr (cd3od,, ppm) 170.17, 160.26, 147.99, 134.99, 139.01, 134.93, 134.27, 128.98, 126.59, 124.49, 123.45, 120.38, 109.98, 77.73, 45.42, 42.37, 36.01, 29.56, 20.79, 9.52; esi hrms, found 424.1801 (c22h26n5o2s, [m + h], requires 424.1807). All ic50 determinations were carried out using a 7-diethylamino-3-(4-maleimidylphenyl)-4-methylcoumarin (cpm) fluorescence assay, as described previously for hsnmt1, pvnmt, and pfnmt . Ic50 values are the mean value of two or more determinations, and standard deviation is within 20% of the ic50 unless otherwise specified . Data were elaborated using microsoft office excel 2010, and ic50 values were determined using grafit 7.0 (erithacus software ltd ., u.k .) By nonlinear regression fitting, which were then quoted as ki as defined below . Ki values quoted are the ki calculated from the experimentally determined ic50 values, the substrate concentration ([s]), and the michaelis prusoff equation:1for example, 34c had an experimentally determined pfnmt ic50 of 0.017 0.002 m . The michaelis constant (km) was 3.64 m and the substrate concentration was 4.00 m, resulting in a ki of 0.008 m . Red blood cells used for the assay were centrifuged to remove the buffy coat and washed twice in roswell park memorial institute (rpmi) medium 1640 so that no white blood cells were present . The culture medium contained rpmi 1640 with 5 g / l albumax, 0.025 g / l gentamycin, and 0.292 sterile 96-well black tissue culture plates (costar) were used routinely for every assay . Drugs were diluted in culture medium and used in duplicate wells for each dilution of 10.0, 3.333, 1.111, 0.370, 0.123, 0.041, and 0.014 m in a final volume of 100 l per well . Chloroquine was used as a standard with 10 times reduced concentration range as above . Two sets of control were used in duplicate wells, one set with no added drugs (positive control) and one with uninfected red blood cells (negative control). The plates were incubated at 37 c for 48 h in a gas chamber flushed with 5% co2, 5% o2, and 90% n2 . After 48 h supernatants were taken from each well and replaced with fresh drug and incubated for a further 48 h in the same manner . At the end of the 96 h incubation, 25 l of sybr green i dye (sybr green i nucleic acid gel stain 10000, in dmso from invitrogen) in lysis buffer (1 l dye to 1 ml of lysis buffer) was added to each well and stored overnight at 20 c . The lysis buffer contained tris - hcl (20 mm, ph 8.0), edta (2 mm), saponin (0.16%), and triton x-100 (1.6% v / v). Plates were warmed to room temperature, and fluorescence intensity was measured with a fluostar omega microplate fluorescence reader (bmg labtech). Binding of sybr green is specific for parasite dna, as mature erythrocytes lack dna and rna . Fluorescence intensity unit was converted to percentage (%) of growth as follows: this assay was performed by dr . Christian scheurer at the swiss tropical and public health institute and is a modified version of the original hypoxanthine assay published by desjardins et al . : serial drug dilutions were prepared with a multichannel pipet, transferring 100 l in a 2-fold serial dilution . An amount of 100 l of infected blood (parasitemia of 0.3%, 2.5% hematocrit) was added to all wells with a multipipette . The plates were incubated in an incubation chamber at 37 c in an atmosphere containing 93% n2, 4% co2, 3% o2 . After 48 h, an amount of 50 l of [h]hypoxanthine (= 0.5 ci) solution was added to each well of the plate . The plates were incubated for another 24 h. the plates were then harvested with a betaplate cell harvester (wallac, zurich, switzerland). The dried filters were inserted into a plastic foil with 10 ml of scintillation fluid and counted in a betaplate liquid scintillation counter (wallac, zurich, switzerland). The results were recorded as counts per minute (cpm) per well at each drug concentration . Data were analyzed using a graphic program (e.g., excel) and expressed as percentage of the untreated controls . The 50% inhibitory concentration (ic50) value was evaluated by logit regression analysis . This assay is a slightly modified version of the assay previously described: hepg2-a16-cd81egfp cells stably transformed to express a gfp - cd81 fusion protein were cultured at 37 c in 5% co2 in dmem (invitrogen, carlsbad, ca, usa) supplemented with 10% fcs, 0.29 mg / ml glutamine, 100 units of penicillin, and 100 g / ml streptomycin . The cells were seeded 24 h prior to infection into 1536-well plates at 3000 cells / well . The cells were pretreated for 12 h with the drug in a 12-point dilution series, and the cells were then infected with freshly dissected p. berghei sporozoites expressing luciferase (1000 sporozoites / well). After 48 h of incubation, the viability of p. berghei exoerythrocytic forms (eef) was measured by bioluminescence . Ic50 values were obtained using the measured bioluminescence intensity and a nonlinear variable slope four - parameter regression curve fitting model in prism 6 (graphpad software inc . ). Measurement of the ability of 34c to kill human cells (hepg2, human hepatocellular carcinoma) was performed using a 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2h - tetrazolium, inner salt (mts), cell viability assay, modified from the promega corporation technical bulletin no . The cells were cultured in dulbecco s modified eagle medium (dmem) plus 10% fetal bovine serum (fbs) plus 1% penicillin / streptomycin, incubated at 37 c in humidified atmosphere with 5% co2 . Then 200 l of medium was added to wells 27 of a 12-well reservoir per replicate, along with 598 l of medium in well 1 . Compound was dissolved in dmso at a top concentration of 50 mm, and 1.8 l of this stock was added to column 1 . Well 1 was mixed thoroughly with a 1 ml pipet, and 200 l was transferred to well 2 and mixed thoroughly . Furthermore, a puromycin control was prepared by diluting 3 l of puromycin stock (1 mg / ml) in 1497 l of medium . Cells were added to a 96-well plate at a concentration of 5000 cells per well (50 l), excluding the exterior wells . To wells b2g2 and b11g11 is added 100 l of 0.2% dmso / medium (positive control wells). To wells b3g3 was added 100 l of puromycin / medium (negative control wells). To wells b4b10, c4c10, and d4d10 this was repeated with a second compound if required in wells e4e10, f4f10, and g4g10 . The plate was placed in an incubator at 37 c and cell growth / morphology inspected at 24, 48, and 72 h. at 72 h, 20 l of mts / pms solution (1.9 mg / ml mts, 43.8 g / ml pms) was added to each assay well, and the plate returned to the incubator for 4 h. fluorescence was then read at 490 nm on a spectramax m2e microplate reader from molecular devices . Data were elaborated using microsoft office excel 2011, and ld50 values were determined using grafit 7.0 (erithacus software ltd ., u.k .) By nonlinear regression fitting . Crystals of ternary complexes of pvnmt, a nonhydrolyzable myristoyl - coa analogue (nhm), and the inhibitors 20b and 34a were prepared as described previously . X - ray diffraction data were collected on synchrotron beamlines at the diamond light source, harwell, u.k ., and processed using xds and scala implemented within xia2 . Model refinement was by maximum likelihood methods implemented in refmac using the protein chains of 4a95.pdb as a starting model interspersed with cycles of model building and adjustment using coot.
Dual energy photon absorptiometry (dxa) has long been the standard for monitoring areal bmd (abmd). We have compared vbmd measured by high resolution peripheral computerized tomography (hr - pqct) with the results obtained by dxa (abmd) in a group of 49 of healthy premenopausal, normally menstruating women, aged 21 - 45, spanning a range of bmi (18.5 - 46.5). They were exercising less than 4 hours per week, and did not have conditions or medications known to affect bone; we wanted to see if the results of scanning with hr - pqct paralleled those of dxa in subjects with a wide range of bmi . The subjects gave informed consent and the study was approved by our institutional review board . Using data from 187 females between 18 and 45 yrs, the mean and standard deviation for the total body bone density by dxa are 1.2044 and 0.1107 . Using these results and assuming a correlation between the two measurements of bmd equal to 0.7, gives a standard deviation for the difference between two measurements equal to 0.0857 . A sample of size 45 has a power of 80% for detecting a difference between mean bmd of the two instruments equal to 0.0386 . This corresponds to detecting a difference equal to 3.2% of the mean areal bmd of all bones in all areas was measured by dxa (ge lunar idxa, hawaii, usa) in whole body mode . Participants were measured on the same densitometer with the same software, scan speed and technologist . The long term precision was 0.35%, and the least significant change for bmd measurements was 1.00% . The software provides values for the masses of muscle, fat, and bone for the whole body and specific regions . Structural bone parameters of the non - dominant distal radius and left distal tibia were assessed by hr - pqct (xtremect scanco medical ag, brutisellen, switzerland .) A stack of 110 slices with a nominal voxel size of 82 m was obtained with the most distal computerized tomographic (ct) slice placed 9.5 mm from the endplate of the radius or 22.5 mm from the endplate of the tibia . The coefficient of variation (cv) of a phantom containing hydroxyl - apatite (ha) rods embedded in resin (qem . The voi was automatically separated into a cortical area (ct ar) and trabecular area (tb ar). D100 is the average vbmd in a scanned region one scan of the distal radius was excluded because the subject was unable to control the shaking of her hand . Areal bmd of all bones in all areas was measured by dxa (ge lunar idxa, hawaii, usa) in whole body mode . Participants were measured on the same densitometer with the same software, scan speed and technologist . The long term precision was 0.35%, and the least significant change for bmd measurements was 1.00% . The software provides values for the masses of muscle, fat, and bone for the whole body and specific regions . Structural bone parameters of the non - dominant distal radius and left distal tibia were assessed by hr - pqct (xtremect scanco medical ag, brutisellen, switzerland .) A stack of 110 slices with a nominal voxel size of 82 m was obtained with the most distal computerized tomographic (ct) slice placed 9.5 mm from the endplate of the radius or 22.5 mm from the endplate of the tibia . The coefficient of variation (cv) of a phantom containing hydroxyl - apatite (ha) rods embedded in resin (qem . The voi was automatically separated into a cortical area (ct ar) and trabecular area (tb ar). D100 is the average vbmd in a scanned region one scan of the distal radius was excluded because the subject was unable to control the shaking of her hand . Table 1 shows that the average and compact bone density (hr - pqct) are both higher in the radius than in the tibia whereas dxa shows a higher bone density for the legs (weight bearing bone) compared to the arms . Slice area (which reflects cross sectional area) and cortical thickness are greater in the tibia than in the radius, and this difference in geometry makes it difficult to interpret the difference in volumetric bone density (hr - pqct); bone strength is dependent inter alia on cross sectional area and cortical thickness . Figure 1 shows that bmd arms is significantly correlated with% fat whereas d100 (average vbmd by hr - pqct), is non - significantly correlated with% fat . Table 2 shows that there is significant r between bmd (dxa) of legs and arms with bmi as well as w and% fat, whereas there is no significant r between d100 (hr - pqct) and these variables . There is no significant r between age and bmd or between age and d100 radius but there is a significant r between age and d100 tibia table 3 shows that sl area (cross sectional area) tibia is correlated with w, bmi,% fat, age . Adult bones expand in diameter throughout adult life, apparently in adaptation to changing mechanical demands seen by hr - pqct, but not by dxa . The increased bone cross sectional area should decrease bmd (dxa) with increased bmi, instead of the increase which we found . Figure 2 shows the r between d100 radius v% fat and bmd arms v% fat . The residuals of d100 (hr - pqct) / bmd (dxa) plotted against% fat have no significant r with the radius / arms (r = 0.186 ns) but for the tibia / legs, r=0.378 p<0.01 are shown in figure 3 . Bolotin et al showed that all soft tissue (fat and muscle) inhomogeneities could cause inaccuracies as large as 20 - 50% in bmd measured by dxa . They reported that the ratio of fat to lean, and the ratio of yellow to red bone marrow in the region of interest (roi) has a major effect on the measured bmd . We have shown in vitro that surrounding fat markedly alters the result of bmd measured by dxa . Bosy - westphal has shown that the configuration of fat and muscle around the bone and fat within the bone can markedly alter the measured bmd result . This is probably because dxa can distinguish only two components in one pixel using the attenuation ratio of two different x - ray energies, whereas the output actually consists of three components, bone, fat, and muscle . In pixels containing bone, the composition of the soft tissue cannot be measured, and so in those pixels, soft tissue has to be extrapolated from adjacent areas . This assumption is invalid if the composition of the soft tissue in front of or behind the bone or the bone marrow fat differs in composition from soft tissue next to the bone . An undetected loss of fat either in front of, behind, or within the bone leads to an increase in pixel density that may lead to an overestimation of bmd .. the difference in r between bmi and the bone parameters measured by hr - pqct and those measured by dxa may possibly be explained by a difference in the effect of fat on the absorption of x - rays causing an artifactual increase in bmd measured by dxa . The measurement of bmd by hr - pqct did not parallel those of dxa in subjects with increasing bmi . Our results by hr - pqct were obtained with scanco i which has a voxel size of 82 m . The results of scanco i partially depend on identification of bone obtained by the absorption of x - rays in the voi . This study should be repeated with scanco ii.which is a second generation hr - pqct scanner with a voxel size of 61 m . This will provide a geometric measurement of the amount of bone, the result of which does not depend on the absorption of x - rays . We have shown by radiogrammetry that geometric measurements of bone thickness are not altered by surrounding fat . The decreased dependence (with scanco ii) on absorption of x - rays, may permit a more accurate assessment of the ability of hr - pqct to measure bmd independently of the amount of surrounding fat . Hr - pqct shows that increasing bmi is associated with increased bone cross - section . This would tend to decrease measured bmd (dxa) as opposed to the increase which we observed with increasing bmi . Our study suggests that the increased bmd (dxa) found with increased bmi may partly be an artifact caused by absorption of x - rays by fat and muscle . It is important to validate the measurement of bmd by dxa in the context of obesity because of the large number of studies which depend on it.
In the year 2003 immunosuppressive therapy using mitoxantrone has been approved for treatment of patients with worsening relapsing - remitting or secondary progressive multiple sclerosis (ms) in germany . Due to potential side effects on the heart and bone marrow the cumulative dose of mitoxantrone was initially limited to 100 mg / m and later on extended to 140 mg / m in selected cases . However, systematic data on the course and incidence of cardiac toxicity following low - dose mitoxantrone are lacking . In the following, we report about serial cardiac evaluation in 30 consecutive patients before, during, and after mitoxantrone treatment in consecutive patients with ms . In the years 2006 and 2008, parts of the study have been published in german language in journals which are not indexed by pubmed [1, 2]. From january 2003 to july 2004, thirty consecutive patients with secondary progressive or worsening relapsing multiple sclerosis were treated with mitoxantrone at 3-month intervals . It was agreed among the participating physicians that termination of treatment due to cardiac reasons was limited to clinical heart failure only . Mitoxantrone infusion as well as cardiac evaluation before, during, and after treatment was performed by a cardiologist . All patients were treated ambulatory and received a pneumococcal vaccination before treatment was initiated . In the following we focus on the cardiac evaluation of mitoxantrone infusion . Prior to each treatment, all patients underwent a careful history taking, laboratory testing, a resting electrocardiogram (ecg), and a transthoracic cardiac ultrasound . On all occasions, mitoxantrone at a dose of 12 mg / m diluted in 250 ml saline was infused over a period of 30 minutes . The electrocardiogram was obtained by a digital 12-channel system (custo cardio 130, ottobrunn) in recumbent position . Cardiac imaging was performed using a digital ultrasound system (vivid 3, general electrics, solingen). Cardiac chamber measurements (mm), calculation of fractional shortening (fs%), and respective ejection fraction (ef%) were done on m - mode images only; values were determined as an average of three consecutive measurements . Global assessment of cardiac function and valvular disease was performed on two - dimensional views . The relation between ef, fs, lvedd, and heart rate with the cumulative mitoxantrone dose was analyzed using linear regression analysis with random coefficients (software sas 9.1, proc mixed). The course of each patient was linearly modeled and the population average (trend) estimated respecting age and gender . 30 consecutive patients (23 female, 7 male) with a mean age of 47 10 years were treated with mitoxantrone . No patient had received mitoxantrone, a mediastinal radiation, or any cancer treatment before the present mitoxantrone therapy . Three patients suffered from noninsulin - dependent diabetes (10%), 2 patients from essential hypertension (7%), and 4 patients from depression . Prior to mitoxantrone treatment 8 patients had been treated with interferon (27%), 3 with azathioprine (10%), 1 with glatiramer acetate (3%), 2 with interferon and azathioprine (7%), 1 with glatiramer acetate and interferon (3%), and 1 with immunoglobulins (3%). In 4/30 patients mitoxantrone therapy had been started during hospitalization elsewhere (9 courses) and continued mitoxantrone treatment as all other 26 patients ambulatory . All reported data refer to the data obtained in all 30 patients during ambulatory treatment only . Mitoxantrone was infused 222 times with a mean cumulative dosage of 83 37 mg / m (minimal dose 24 mg / m, maximal 156 mg / m). Treatment frequency ranged from 2 to 13 infusions per patient and extended over a mean period of 23 13 months (minimal 3, maximal 53 months). During therapy with mitoxantrone 3 patients (10%) experienced an acute episode of relapsing symptoms, one after the first course, one after the 4th, and one after the 5th course of mitoxantrone . In two of these 3 patients, an additional high - dose course of intravenous steroids was administered . At the terminal mitoxantrone infusion 5/30 (17%) reported about amelioration of ms symptoms as compared to symptoms at the start of therapy, 19/30 (63%) about no change, and 6/30 (20%) about worsening symptoms . Out of 30 treated patients a total of 19 patients (63%) had one or more cardiac exams following termination of mitoxantrone infusion . The followup extended over a mean period of 30 14 months (minimal 6, maximal 56 months). At the start of mitoxantrone therapy, history taking and a careful exam revealed no cardiac disease in any patient . During and after mitoxantrone treatment no patient developed cardiac failure or was hospitalized for any reason . Resting ecg was normal before, during, and after mitoxantrone treatment in all patients . Mean heart rate averaged 77 11 rpm before treatment and did not change significantly during and after mitoxantrone treatment (table 1). Whereas heart rate and left end diastolic dimension did not change significantly during and after therapy, fractional shortening (fs) as well as ejection fraction (ef) decreased continuously and statistically significantly during mitoxantrone treatment in the study population of 30 patients (table 1). During followup of 19 patients, cardiac pump function as determined by fs and ef did not recover (figures 1(a) and 1(b) for 19 patients during and after treatment). In contrast, 2d echocardiography did not reveal any visible deterioration of global left ventricular function . Apart from therapy - related acute leukemia, cardiac pump failure is considered as the most serious side effect [3, 4]. According to published reports mitoxantrone cardiotoxicity occurs infrequently; however, this problem has not been assessed systematically . In some studies cardiac function and respective ejection fraction have been evaluated by various different methods . In other smaller studies, cardiac function has been addressed only before and at the end of treatment leaving the results subject to alpha and beta errors . In the present study, cardiac function has been explored systematically and serially allowing for longitudinal intraindividual observations of cardiac function . In 30 patients treated with mitoxantrone at a mean dosage of 83 37 mg / m, left ventricular pump function decreased continuously without clinical signs of heart failure . Following termination of treatment, cardiac function did not recover, suggesting a long - lasting toxic effect of mitoxantrone on the heart . Our findings are supported by publications of avasarala et al . And pattoneri et al . But contrast with studies of de castro et al . And zingler et al . Who found no decline in left ventricular function during serial assessment using echocardiography . Based on numerous reports of early and late onset cardiotoxicity in individuals with low - dose mitoxantrone and our observations of dose - dependent effects on the heart, serial determination of cardiac function in each patient seems indicated . Although cardiac pump function and respective ejection fraction can be determined by various methods, transthoracic echocardiography is cost - effective and available everywhere; radionuclide studies or magnetic resonance imaging should be reserved to selected patients with questionable results . Whether ejection fraction is calculated linearily using m - mode echocardiograms or volumetrically using planimetry of monoplane or biplane projections in patients with suspected nonischemic cardiomyopathy is of minor importance as long as the reevaluation monitoring employs the same method throughout the course of chemotherapy and its followup . Apart from the evaluation of systolic cardiac pump function by echocardiography, repetitive careful history taking and the serial determination of brain natriuretic petide may guide the followup . Parameters of impaired relaxation and respective abnormalities in diastolic filling of the heart may precede reductions in systolic pump function and respective ejection fraction, in patients receiving chemotherapy . On the basis of the current paper, we suggest to inform the patient about the potential insidious nature of cardiac toxicity and to monitor cardiac function in every patient prior and, systematically, during mitoxantrone therapy . It seems that cardiac function does not deteriorate further when mitoxantrone therapy has stopped . In future studies, it should be tested by longitudinal serial analysis whether pretreatment with dexrazoxane will limit the slow decline of left ventricular function as has been reported by bernitsas et al . .
Dengue infection is the most rapidly spreading mosquito - borne viral disease in the world and an estimated 50 million dengue infections occur annually . Case fatality rates for the south - east asian region are 1%, but in india, indonesia and myanmar, focal outbreaks have reported rates of 3%-5% . Unusual manifestations involving liver and central nervous system in dengue infection have been reported, 3]. The degree of liver dysfunction in children with dengue infection varies from mild injury with elevation of transaminases to severe injury with jaundice and liver cell failure [47]. The incidence of hepatic dysfunction is more in dengue shock syndrome (dss) and dengue hemorrhagic fever (dhf) [2, 410]. Aminotransferase levels are useful in predicting the occurrence of hepatic dysfunction and spontaneous bleeding . In recent studies from india and thailand, dengue infection was the most important cause of acute hepatic failure in children contributing to 18.5% and 34.3% of the cases respectively [11, 12]. Hence early recognition and prompt initiation of appropriate supportive treatment can decrease the morbidity and mortality . Most of the data reported on abnormal liver functions in dengue are retrospective [2, 6, 8, 9]. Therefore this cross sectional study with new data was undertaken to assess the spectrum of hepatic involvement in children with dengue infection . This prospective study was conducted in the department of pediatrics, jss medical college hospital, mysore, india, from november 2008 to july 2010 . All clinically suspected dengue infection children as per the who guidelines between 2 months to 14 years of age were screened and only serologically confirmed cases by dengue igm capture elisa were included . Ethical approval was obtained from ethical committee of the jss medical college hospital, mysore and written informed consent was obtained from the parents . Malaria, enteric fever, hepatitis a and hepatitis b were excluded by history, examination and investigations . All the cases were subjected to following investigations: dengue igm capture elisa, hemoglobin (hb), total count (tc), differential leukocyte count (dlc), platelet count, hematocrit (hct), peripheral blood smear, serum bilirubin, alanine transaminase (alt), aspartate transaminase (ast), alkaline phosphatase (ap), serum albumin, serum globulin, total proteins, prothrombin time (pt) activated partial thrombo - plastin time (aptt), quantitative buffy coat for malarial parasite, blood culture, chest x - ray, widal test, igm anti hepatitis a virus, hbsag, ultrasound abdomen and thorax . Estimated minimal sample size required for this study was 100 cases of dengue infection . Statistical methods employed for data analysis are descriptive statistics, cross tabs, chi - square test for categorical outcomes and t - test for comparison of means . Comparison of multiple means / non parametric data was done using one way - anova . A total of 115 cases formed the study group out of which 5 were excluded because of associated other infections (hepatitis a=5). The study group included 110 children aged between 2-mo-14 years satisfying the who criteria for dengue fever after excluding malaria, enteric fever, hepatitis a and hepatitis b. all 110 children were grouped into dengue fever (df) (53.6%), dhf (23.6%) and dss (22.5%) according to who criteria . The majority (76%) were above 5 years . Fever (100%) was the chief complaint in all cases followed by body aches (57%), pain in abdomen (47%), vomiting (40%) facial puffiness (40%) and rashes (36%). Petichiae and purpura were seen in 30% of cases, while 19% had mucosal bleeding . 79% had hepatomegaly which was noticed more in dhf and dss (88.5% and 96%) than in df (67.8%) group (p=0.006). Hepatic tenderness was observed in 36.3% of children, which was more in dhf (53.8%), dss (56%) compared to df(20.3%) group (p=0.001). Profile of liver function tests (lft) and ultrasound findings in different groups in dengue infection is shown in table 1 . As shown in table 1 abnormal liver functions were significantly more in dss and dhf group . Profile of liver function test and ultrasound findings in different groups of dengue infection alt: alanine transaminase; ast: aspartate transaminase; alk . Ph: alkaline phosphatase; aptt: activated partial thrombo - plastin time, inr: international normalized ratio table 2 shows the comparison of alt and ast levels between the groups . The rise in the levels of the enzymes were significantly more in dss and dhf group . More than 10 fold increase in the levels of both alt and ast were observed mainly in the dss and dhf group . Table 3 shows comparison of liver function tests with or without hepatomegaly and tender / non tender hepatomegaly . Interestingly there was no significant difference in the lft's in children with or without hepatomegaly . Among those with hepatomegaly also there was no significant difference in the lft's with / without hepatic tenderness . Ultra sound revealed gall bladder thickening, ascites, and pleural effusion more in the dhf (80%, 77%, 73%) and dss (80%, 72%, 68%) compared to df (50.8%, 33.9%, 32.2%) group . Comparison of liver function tests with or without hepatomegaly and tender and non tender hepatomegaly jaundice was present in 5 (4.5%) cases out of 110 children . All of them had tender hepatomegaly, decreased platelet count, elevated hematocrit, and deranged liver enzymes . Four children recovered completely by 3 weeks both clinically and biochemically and one was lost for follow up after discharge . Out of 110 dengue cases one child (6 months old) with deranged lft, adult respiratory distress syndrome (ards), coagulo - pathy and multi organ dysfunction expired . Hepatic involvement in dengue infections is often demonstrated by hepatomegaly and mild - to - moderate increases in transaminase levels . High mortality have been reported in children with dengue infection with acute liver cell failure [2, 11, 12, 14]. Hepatomegaly is one of the common clinical signs of dengue infection . Out of 110 cases in our study, 79% had hepatomegaly which was more common in dhf (88.5%) and dss (96%) group than in df group . Similar association of hepatomegaly in dengue has been reported in 43%-100% of cases in children [46, 9, 1518]. In fact petdachai and faridi et al reported hepatomegaly in all children with dss[4, 16]. Hepatic tenderness was observed in 36.3% of children and was more in dhf (53.8%), dss (56%) which is similar to observations made in a study from thailand . Abnormal hepatic enzymes in dengue infection have been reported by various workers and the range varies from 36.4%-96% both in children and adults [49, 16, 19, 20]. We observed elevated alt in 69.4% of df, 84.6% of dhf and 92% of dss, and raised ast in 88% of df, 100% of dhf and 96% of dss group . The hepatic enzymes were elevated significantly in dss and dhf when compared to df group which is similar to other studies [410]. We found more than 10 fold rise of ast in 44% of dss, 22.8% of dhf and only in 3.4% of df group . More than 10 fold rise in alt in 16% of dss, 7.7% of dhf and 0% of df group was observed in our study . More than 10 fold increase in transaminases levels was observed mainly in dss and dhf group than in df group which was statistically significant . In a large study from brazil, out of 1585 dengue cases, elevation in ast and alt were seen in 63.4% and 45% of patients respectively, with 3.8% of cases having 10 fold increase in transaminase levels . Similar increase of more than 10 fold rise in the liver enzymes was recorded by other authors also in adults and it varies between 1.8%-11.2% [8, 19, 20]. Higher incidence of more than 10 fold rise was observed in our study when compared to adult series . This may indicate that, children are at higher risk of hepatic involvement compared to adults . Detection of abnormally high transaminase enzymes among patients with dengue is important since the possibility of consequent hepatic encephalopathy can be expected . It is interesting to note that there was no statistical significant difference in mean liver enzyme levels in cases with or without hepatomegaly / hepatic tenderness in our study . Serum ap levels also showed similar trend in our study with raise in 45% of df, 65.3% of dhf and 72% of dss and again the raise was statistically significant in severe groups . Elevation of ast was more compared to alt in the present study and similar observations was made by others also [4, 10, 14, 21]. Ast rise more than alt in dengue may be due to involvement of myocytes [10, 21]. This differs from the pattern seen in viral hepatitis, in which alt levels are usually higher than or equal to ast levels [10, 21]. We found prolonged pt (inr>1.5) values in 20% of the cases and it was significantly more in dhf (31%) and dss (13%) group . Hypoglobinemia was observed more in dhf (69%) and dss (60%) compared to df group (17%). Wong et al reported low globulin level in 14.2% and low albumin level in 16.5%, derangements in pt and aptt in 42.5% of his adult cases . However itha s, et al noticed hypoalbumenemia in 76%, deranged pt and aptt in 7% of adult cases . The reduction of serum globulin may be an important factor in fluid loss into third space which is indicative of severity of dengue infection . Jaundice has been reported in 2%-25% of cases by several authors [5, 14, 21]. We observed jaundice in 5 (4.5%) cases and none of them had encephalopathy . Nimmannitya et al reported jaundice and encephalopathy in 18 cases of dhf of whom 10 died . In recent studies from india and thailand, dengue infection is the most important cause of acute hepatic failure in children contributing to 18.5% and 34.3% of the cases respectively [11, 12]. In endemic areas dengue should be considered as one of the differential diagnosis in children presenting with fever and fulminant hepatic failure [3, 12, 13]. Mechanisms of liver injury in dengue may be due to direct effects of the virus or host immune response on liver cells, circulatory compromise, metabolic acidosis and/or hypoxia caused by hypotension or localized vascular leakage inside the liver [5, 7, 10, 14, 22]. Reports have demonstrated a high affinity of the dengue virus for human liver cells and dengue virus has been isolated from the liver of fatal cases [10, 23]. A study from mexico in the mice and humans established the correlation between liver damage and dengue based on the ast activity . Shivbalan et al found alt, tender hepatomegaly and abdominal pain to be significant predictors for bleeding in dengue children . An indian study reported correlation between mortality and severe liver dysfunction in children with dengue infection . Predictive factors for liver damage have been identified as dhf, dss, secondary infection, thrombocyto - penia, elevated hematocrit, female sex and children by wong et al . Elevated transaminase levels have been suggested as a potential marker to help differentiate dengue from other viral infections during the early febrile phase by the same author . Strengths of the study: some of the previous studies are retrospective, study group included seronegative dengue cases and they have not excluded common illnesses pertinent to tropical region . In tropical countries liver can be affected in malaria, enteric fever, and viral hepatitis also . Therefore atmost care was taken to exclude these common disorders clinically and investigation wise in our study . Limitations: on humanitarian grounds liver biopsy was not done in any children to confirm the diagnosis . The spectrum of hepatic involvement in dengue varies from jaundice to elevation of liver enzymes . Significant rise of liver enzymes helps in recognition of severe forms of dengue infection (dhf and dss). Presence of fever, jaundice and hepatomegaly in endemic areas should arouse the suspicion of dengue hepatitis.
Radical cystectomy (rc) remains the standard of care for locally advanced, muscle - invasive and recalcitrant high - grade non - muscle invasive bladder cancer . A significant portion of morbidity following rc is associated with the choice of urinary diversion . Although orthotopic neobladder (onb) has the advantage of preserving body image, improvements in quality of life over ileal conduit have been hard to demonstrate . One factor that may be associated with a decreased quality of life is continence status, both incontinence as well as hypercontinence or urinary retention . A number of factors have been purported to influence continence, including gender, nerve sparing, length of bowel segment and vaginal or uterine sparing in females . Although the onb may be the preferred method for diversion, particularly for younger patients, improved quality of life may not be realized when the patients experience significant long - term voiding dysfunction . Urodynamic studies in patients with ileal neobladder substitution have shown that good voiding habits are dependent on the ability to perform effective straining and the location of the neobladder . The ability to empty a neobladder has been shown to be dependent on bladder compliance in urodynamic studies . The dynamic mechanism of voiding in patients after neobladder construction have also been evaluated with interactive magnetic resonance imaging, showing that the movements are very different than in nave bladders . When counseling patients regarding the potential advantages and disadvantages of the different types of urinary diversion, it is critical to mention the possible need for long - term clean intermittent catheterization (cic) with onb . Many patients are resistant to the idea of long - term cic and may choose a different diversion option when presented with the risk . Thus, it is critical to understand and define the peri - operative factors that may be associated with a patient's risk for requiring cic for long - term management of their onb . Herein, we identify the peri - operative clinicopathologic factors associated with the need for long - term cic following onb . Our study protocol received full approval from the institutional review board in compliance with the health insurance portability and accountability act (hipaa). We conducted a retrospective review of our electronic medical record, identifying all patients between july 2004 and february 2013 who underwent a rc and onb . All radical cystectomies were performed by one of two fellowship trained urologic oncologists at the institution . For patients to be considered for an onb diversion, they must have a good performance status with an eastern cooperative oncology group (ecog) score of 02 . All patients underwent creation of onb as originally described by studer and had approximately 60 cm of distal ileum utilized for neobladder construction . Men who were potent and sexually active prior to surgery had a nerve - sparing procedure completed with special attention to avoid damage to the neurovascular bundles on that lateral portion of the prostate . Women who were sexually active had a vaginal - sparing surgery where the anterior vaginal wall was left intact and not resected along with the posterior bladder wall . Patients had externalized ureteral stents and a urethral and suprapubic catheter immediately post - operatively . The ureteral stents were removed once the patients were tolerating a regular diet prior to discharge . Patients returned to the clinic with a cystogram prior to neobladder activation (catheter removal) at 3 weeks post - operatively . All patients were placed on a strict voiding schedule after catheter removal, which included instructions to void every 2 h and to perform cic twice a day to check for residual urine . After 1 month, if patients had residuals less than 50 ml, they were instructed to stop cic . In addition, all patients had routine post - void residuals obtained at each clinic visit, and patients with> 150 ml of residual were instructed to perform cic for complete emptying . Peri - operative clinical and pathologic data on all patients was obtained by chart review and utilized for the analysis of risk factors for the need to perform cic . The last follow - up appointment is where the catheterization status of the patient was determined . The date of this follow - up was different for each patient depending on the date of their neobladder construction . If a patient required catheterization post - operatively but then resolved prior to their latest visit, they were not considered hypercontinent, requiring cic . Variables analyzed included age, body mass index (bmi), gender, clinical and pathological stage, presence of diabetes mellitus, administration of neoadjuvant chemotherapy, history of previous abdominal surgeries and anterior vaginal or nerve - sparing procedures in females and males, respectively . Previous surgeries included were any prior abdominal and pelvic procedures; ventral and incisional hernia repairs of the abdomen were also included . The bmi of the patients used for this study was that recorded on the morning of surgery . Bmi (kg / m) was stratified into three groups, including <30, 3039 and> 40 . Clinical stage was based on the pathology report from the last transurethral resection and examination under anesthesia prior to cystectomy and pathological stage was divided into t0/tis / ta / t1, t2, t3 or t4 . An independent t - test was performed for the continuous variables and a chi - square test was used for the categorical variables . A multivariate forward stepwise logistic regression analysis was then used for all variables to determine which ones remained significant for the need to catheterize after neobladder urinary diversion . A p value of <0.05 was considered significant . There were 114 patients from july 2004 to february 2013 who underwent rc with onb urinary diversion . Age at the time of surgery ranged from 30 to 80 years, with a median age of 61 years . Of this group, 15 were female (13%) and 99 were male (87%). The bmi range at the time of surgery was 18.2160.5 kg / m, with an overall mean of 29 + 6.9 kg / m . Patient characteristics of the 114 patients, 84 (73.7%) did not require cic for emptying of their neobladder at the last follow - up, while 30 (26.3%) reported having to catheterize at least once a day for completely emptying their onb . Patients who reported requiring cic underwent office - based cystoscopy to rule out bladder neck contracture as a cause of the incomplete emptying, and none of the patients included in this group were reported to have a bladder neck contracture at the time of follow - up . It was found that five patients (all male) who required cic for emptying had ventral incisional hernias identified presumably from abdominal straining for neobladder emptying . On univariate analysis, three factors were statistically significant predictors for the need for cic and included younger age, higher bmi and undergoing non - conservative surgery (non - nerve sparing in males and non - vaginal sparing in females), table 2 . When age is evaluated as a continuous variable, the mean age in those who required long - term cic was 62 years compared with 57 years in those who required cic (p = 0.026). When bmi was used as a continuous variable, patients who performed cic had a mean bmi of 31.7 versus 28.1 for those who did not catheterize (p = 0.013). Forty - four (39%) patients had a conservative procedure, and only six (20%) of these reported catheterizing while 24 (80%) patients who did not have vaginal- or nerve - sparing procedures required catheterization . Because of the small numbers of patients, we combined males who had nerve sparing and females who had anterior vaginal wall sparing, including them as conservative surgical treatment . As shown in table 2, all other variables were not significant on univariate analysis . Univariate analysis comparing the use of cic and patients clinicopathological characteristics when these factors were used in a multivariable logistic regression analysis, we found that conservative procedure and age were the only two factors that were significant for increased need for cic . Table 3 demonstrates that males who underwent a nerve - sparing procedure and females with vaginal sparing had a significantly decreased risk of requiring long - term cic (odds ratio [or] 0.20, p <0.01). Surprisingly, older age was associated with a decreased risk of cic (or 0.92, p <0.01). Patients <50 years of age were more likely to catheterize than those 50 years of age, with an or of 6.4 (95% confidence interval [ci] 1.0638, p = 0.042). Multivariate logistic regression analysis of clinicopathological variables and need to perform cic the analyses were completed on patients catheterization status at their last follow - up appointment, with a median of 39 months in the study . Table 4 shows a breakdown of those requiring catheterization and those not requiring catheterization for onb emptying based on length of follow - up since rc with onb reconstruction . The onb has been considered a major advantage over ileal conduit urinary diversion, in that it allows individuals to void per urethra thus preserving body image and obviating the need for an external appliance . However, this improved quality of life may fail to be realized by the patient in whom significant voiding dysfunction occurs . Voiding dysfunction is divided into the failure to empty or the failure to store urine . In our report, we examine the rate of urinary hypercontinence following onb and peri - operative clinicopathologic risk factors associated with the need for cic . Previous studies have reported that between 4% and 25% of patients must perform intermittent self - catheterization due to incomplete emptying of the neobladder . Although speculative, we suggest that this may be due to continued, long - term follow - up (median 39 months) in our patient population and the routine usage of post - operative measurements of post - void residuals in asymptomatic patients in addition to clinical diagnosis in those with symptoms . Surprisingly, our analyses demonstrated that younger age was a risk factor for needing long - term cic . This is clearly of importance, as younger patients are frequently considered the ideal candidates for onb . Interestingly, of the 18 patients> 70 years of age, only five (28%) were reported to require long - term cic . Our findings are contradictory to other reports that have demonstrated no appreciable differences in voiding function following onb in the elderly . Theoretically, this may be a result of younger patients being more physically and mentally capable of long - term cic compared with elderly patients, who may demonstrate less compliance . Younger patients may have higher expectations and desire to remain completely dry, which may lead them to catheterize as a precautionary tool to keep their bladder empty and prevent incontinence . Perhaps it is the higher rate of incontinence in the elderly that may lead to a decreased need for cic, both potential explanations for this result . Those patients who underwent nerve sparing or vaginal sparing were less likely to perform cic . It is important to make this clear to patients when educating and when seeing patients during follow - up visits . We found in this study that the overall rate of cic for emptying was 33%, with a median follow - up of 39 months . When separated by length of follow up, it appears that catheterization may be required more often within the first year after surgery (60%) and then decrease over time to a rate of 28% in those patients with follow - up times longer than 5 years since onb creation . Many factors have been postulated for the precise pathogenesis of urinary retention and elevated residual urine after onb . Voiding after neobladder often requires a combination of valsalva voiding and pelvic floor relaxation . In this study population, we found five patients who developed incisional ventral hernias after onb, and all these patients were male and had hypercontinence requiring cic . The hernia may be related to the abdominal straining required to empty after onb, but then the presence of the hernia traps urine causing retention to result without the use of catheterization . Urodynamic studies after onb have demonstrated that patients with poor emptying ability (defined as residual urine> 150 ml) had increased compliance and capacity (1067 ml versus 623 ml) compared with those with a good emptying ability . Studies using urodynamic studies in neobladders have shown a wide range of cystometric capacities (3661370 ml). In one study, it was found that even with hypercontinent patients, the mean pressure of contractions was <40 cm of water . Other hypotheses of voiding difficulty after onb also include the inability to relax the external urethral sphincter, inadequate valsalva and anatomical factors including smooth continuity of the bladder neck to the urethra and appropriate bladder neck funneling . Although we did not find any significant difference in cic rates between males and females, studies have consistently found that women are more likely to develop urinary retention than men . This may be due to the fact that in this study there were only a small number of female patients that underwent rc and onb . Even though the exact mechanism of emptying and sensation is not known in patients with ileal neobladder, clearly, prevention of overdistention is of utmost importance to prevent dilatation of the upper urinary tract . As with any surgery, those individuals choosing to undergo onb for urinary diversion should be educated on the risk of urinary incontinence as well as urinary retention with the potential need for self - catheterization, even in the long - term setting . Patients should understand the post - operative rehabilitation necessary to train the bladder substitute to meet their needs and expectations . Quality of life studies have shown that those with onb had improved quality of life with regard to mental, physical and social functioning in daily life compared with ileal conduit . First, our study includes patient's self - reporting of performing cic for neobladder emptying, which may not represent the true rate of hypercontinence . However, at our institution, we routinely performed post - void residual bladder scan on all patients with onb at every follow - up visit and we frequently reiterate to patients the importance of compliance . Second, bmi was assessed on the day of surgery and not at the time of follow - up appointment when the report of cic was determined post - operatively . Furthermore, long - term cic was not correlated to major changes in bmi post - operatively, a common consequence of rc . Third, information on subsequent surgeries that may affect continence and emptying, such as urethral bulking injections, were not included in our report . On the other hand, patients with long - term retention were routinely ruled out for bladder neck contractures with office - based cystoscopy . In this study, we have only a small number of female patients; therefore, this may not be representative of females undergoing onb . Those males who underwent nerve sparing and females who had vaginal sparing surgery were combined and analyzed together as conservative management . There is also no patient - reported quality of life assessment at these follow - up time points to determine patient's feelings toward this need for cic even at long time intervals after surgery . Regardless of the limitations, it is quite clear that adequate patient counseling regarding choice of urinary diversion is imperative . Furthermore, factors that may portent an increased risk of long - term cic following onb should be considered when discussing options . Furthermore, patient characteristics associated with increased risk include non - conservative (non - nerve sparing and non - vaginal sparing) surgery, younger age and higher bmi.
Detainees executing custodial sentences in prison represent a special category as their status differs from the rest of the society . Imprisonment for committing a felony subjects the detainee to conditions that mark both his / her physical condition and personality . A proportion of the detainees who are also patients of the health care system in the national administration of penitentiaries (nap) sanitary network exhibit various pathological conditions . However, a noticeable number of inmates end up as patients due to self - harming or trauma inflicted by fellow inmates . Rights of in - custody persons are clearly stipulated in laws and internal regulations aligned with eu provisions and recommendations . The prisoners right to health care - diagnosis, treatment and care - is strictly observed within the nap sanitary network . Despite serious efforts, presently there is a shortage of qualified medical staff and equipment demanded and some pathological conditions cannot be investigated and properly treated in the nap sanitary network . Legal provisions allow treatment of such conditions in the public health care system provided that a legal medicine expertise would confirm that such action is necessary . The patient - physician relationship in the development of this medical expertise presents some particular aspects because of personality changes induced by the prison environment and in relation to the interdisciplinary character of this expertise . Convicts, whether or not presenting pathological conditions, have to comply with prison routine and this can lead to several personality shifts induced by the need to obey institutional rules and to adapt to living among other convicts . Restrictions imposed by prison life induce a personality destructuration, i.e. Giving up the former self in times of freedom, and lead to a new structure, i.e. Adaptation of the individual to the new social identity, that of a prisoner . Separated from the outer world, detainees are restricted to relate to penitentiary personnel and other inmates . New acquisitions in terms of personality traits are determined by the newcomers need to integrate . Arguably detainees are highly vulnerable to such influence and this may result in pursuing certain lines of action, some of them beneficial, e.g. Enrolling in educational / spiritual programs or various physical labor activities . Concern for the prisoners health is an institutional necessity in view of eu provisions and recommendations in terms of civil rights to which romania has subscribed . Since our prisons are overcrowded, increased efforts are required to prevent, diagnose and treat all pathological conditions within the penitentiary sanitary system . A quick overview of the current situation, as revealed by official reports, shows the main challenges in this field . The number of prisoners in nap custody was 31,874 as of december 31, 2014, while in march 2015 the figures were 29,952 (including 321 minors). If allocating a minimal area of 4 square meters per detainee, the nap system could host a number of 18,893 detainees . Despite the significant reduction, the cell occupation index was 157.78% as of march 3, 2015 . If relating to current regulations, the nap hosting deficit totaled a number of 10,969 places in penitentiary units . Another aspect which could rise problems in the future period is the age based structure of convicts population: 9,693 detainees were between 31 and 40 years old, 8,249 between 41 and 60, 648 had over 60 years of age . In our country, primary care for convicted patients is provided in medical practice offices within each prison . Specialist primary care involves transferring inmates to one of the 6 penitentiary hospitals in the country, according to the pathology presented and hosting availability . A penitentiary hospital is a unique structure that meets the criteria required of a prison unit, as well as medical equipment and healthcare professionals required of a hospital . The number of medical consultations is increasing and hospital admissions have evolved from 11,328 in 2013 to 15,327 in 2014 . On the other hand, admissions to secure medical units of the ministry of health (moh) dropped from 626 in 2013 to 475 in 2014, relevant in claiming increased abilities and endowments in the nap healthcare network . In addition, increased number of co - operation protocols with medical and pharmaceutical service providers increases the detainees access to healthcare and medication . Law 254/2013 provisions guarantee their freedom of conscience, opinion and religious beliefs, the benefits of work, education and information, access to personal documents and legal counseling, communication, petition and correspondence rights, as well as marital rights (including scheduled intimate visits) or the possibility to acquire and own goods . There are some objective factors limiting the prisoners possibility to exercise their conferred rights, depending on the regime of punishment enforced and security measures imposed on them, age or health status . Medical examinations provided include investigations conducted by visiting civilian or legal medicine physicians and appropriate treatment for diagnosed (including psychiatric) conditions . Facing patients in detention represents a great ethical challenge for physicians, including psychiatrists, working in correctional settings, with potential tensions between forensic and therapeutic demands . There are several reasons why convicts turn into patients in such large numbers: they have pre - existent pathological conditions, or acquire some health problems after imprisonment, or their medical condition is the result of violence or self - harm . Cases of self - harm were frequently associated with younger age, white ethnic origin, prison type, and a life sentence or waiting forsentence . Another study revealed that educational and occupational achievement, family history, demographic factors, mental health service use, and results of mental health screening at intake were predictive of self - injury . However, many studies have demonstrated that the detainees population runs a higher risk of suicide than the general population, requiring a systematic diagnosis and appropriate treatment by mental health professionals during the imprisonment in order to prevent the risk of suicide . A vital role in this respect is held by the penitentiary surveillance judge, who will listen to all inmates complaints, including health problems, and acts as an interface between them and the court that holds jurisdiction over the respective penitentiary . Special attention is given to monitoring the human rights under the european convention of human rights . Recommendations in 30 endings of the penitentiary surveillance judge and 23 criminal sentences pronounced by the courts in 2014 regarded detainees rights, including the need to ensure optimal accommodation conditions (14 decisions / endings), allocation of sanitary materials (1 ending) and entitlement to healthcare (3 endings). Conditions of detention have been the subject of 148 views sent to the ministry of foreign affairs (mfa) as government agent for the european court of human rights (echr). The fact that romania was condemned by the echr for violating detention conditions in 32 decisions in 2013 (totaling euro 221,819.00 in damages) and 29 resolutions in 2014 (amounting to 196,400.00 euro) shows that the situation in the penitentiary system requires efforts to correct this issue . Allowing representatives of non - governmental organizations (ngos) the possibility to check prison conditions and direct contact with the convicts serves as a control mechanism for observing detainees rights . In 2014 alone, a number of 74 evaluation reports were the result of ngo representatives visits . Analyzing procedural matters of the revised romanian code of criminal procedure when assessing if a person sentenced to a custodial sentence is suffering from pathological conditions that cannot be treated in the nap healthcare network, one can notice that several details were changed in relation to february 2014 provisions . In essence, article 589 (former article 453 in the old code) which deals with sentence postponement cases and article 592 (former article 455) which deals with sentence interruption cases are almost similar in content . In case of sentence postponement, the application may be submitted only by the convict or the prosecutor . A sentence interruption may also be requested by the court in whose jurisdiction the convict s place of detention is or by the prison administration . In both cases a waiver request may be filed at any time by the applicant . Situations in the admission of a sentence postponement request are clearly stipulated: when a legal medicine commission establishes that the convict s medical condition cannot be treated either in the nap health network, or under permanent security guard in public healthcare units, provided the convict does not pose threats to public order . Cases when the sentence interruption or postponement cannot be ordered include situations where the convict has harmed him / her - self, if he / she self - inflicted his / her medical condition, if he / she refused medical treatment or surgery intervention or avoided to submit to legal medicine examination . Reception of initial verbal requests and submission of the convicts formal written requests regarding postponement or interruption of the sentence on medical grounds are the responsibility of the penitentiary surveillance judge designated by the court that has jurisdiction over the penitentiary . The requests are submitted to the court, the only body empowered to order the performing of a legal medicine expertise in connection with any such request regarding a sentence disruption . Within this framework there is no medical filter between formulation and acceptance of such requests . Virtually all sentence postponement or interruption requests sanctioned by the court the methodology of performing legal medicine expertise in regard to sentence postponement or interruption requests is provided by law no . 459 on the organization and functioning of legal medicine institutions (published in official gazette no . Mentions that the commission conducting a legal medicine expertise in view of sentence postponement or interruption must include a forensic physician, a medical representative of the nap and a certain number of specialist physicians pending on case details, and states the mandatory conditions needed to be met in performing the expertise, including thorough physical re - examination conducted by the commission members . Given these aspects, it follows that, except for self - inflicted injuries and those produced by fellow inmates, for all requests based on pre - existent medical history or documented pathological conditions induced during detention, medical status would be the only reason behind such request . The number of expertises conducted in view of sentence postponement or interruption has seen a significant reduction (753 in 2012 and 909 in 2013) compared to past decade figures (6,287 cases in 2000). Despite such severe triage, 20% of the requests ordered to be conducted at the mina minovici national institute of legal medicine (nilm) in 2012 were actually blocked by the convicts refusal to submit to examination by the medical commission . It thus becomes evident that, along with the medical status, several factors influence the convicts motivation and timing in requesting such expertise . There are cases of repeated requests for medical expertise even in situations where conclusions that one s medical condition can be treated within the nap sanitary system were reached . This kind of attitude is likely to generate an unjustifiably high number of requests, resulting in an unjustifiably high number of unfinished expertise which lead to work overload on behalf of medical and security staff required to transport convicts to the six penitentiary - hospitals where thorough investigations can be performed, plus additional costs . Also the time consumed on these procedures is detrimental for patients in actually serious medical conditions, which face long waiting lists before being examined by the legal medicine commission . Correctional medicine is associated with unique medical ethics issues that are often difficult to interpret using fundamental ethical principles from clinical medicine . One aspect that needs special attention in reference to medical expertise requests is the high number of cases when the commission conducting the expertise indicated that the disease could safely be treated within the nap sanitary network and declined to recommend sentence postponements or interruptions . From another point of view, courts still repeatedly accepted requests submitted by the very same convicts even if no changes in the medical condition were observed . It should be noted that current legal provisions do not limit the number of requests one can submit, irrespective of one s previous history including finalized expertise concluding a particular medical condition can be treated within the nap sanitary system and/or dropouts i.e. Declination to submit to thorough examinations . Assumptions about the causes leading to such situations are: convicts present pathologies documented in medical records, but accuse new symptoms that could suggest a new pathological condition; during the expertise, convicted patients emphasize their symptoms and/or claim new symptoms unrelated to their documented medical condition; convicts submit repeated requests for which treatment solutions within the nap healthcare system had been already formulated . Simulation and over - simulation are documented features of detainees behavior and experienced medical staff should have no problems in detecting fake claims in nap primary care units . Documentation of such attempts in the convicts medical expertise records should raise questions and a skeptical attitude in regard to sentence disruption requests . On the other hand there are prisoners who have already submitted such requests and their application was denied on the grounds that their condition could be treated within the nap sanitary system, or have dropped out of ongoing medical expertise procedures for various reasons (such as claiming their medical condition improved even if before the sudden deterioration was suggested by the new attempt, or that the procedure was too elaborate and/or took too much time to complete . Pursuing such action reflects a tendency to imitate success stories perpetuated within the penitentiary environment . These elements are faced with the commission s need to comply with medical ethics norms defined by the principles of non - discrimination, respect, dignity, understanding and compassion . Although there is clear subjectivism on behalf of the convicts submitting sentence postponements or interruptions requests, their claims cannot be objectively dismissed unless they are subjected to a new medical expertise . The expertise commission is objective in reflecting the patient s medical status as assessed following legal procedures, reviewing treatment options within the nap sanitary network under the guidance of the nap medical representative . The expertise commission s objectivity reflects in referral to clinical and para - clinical (including laboratory) investigations in order to make an accurate diagnostic of the patient s pathological condition . Both commission physicians and specialists are called to clarify particular medical aspects needed to make all efforts required in order to diagnose the subjects status and define their therapeutic needs in prison health - facilities . This is required in order to decide whether or not the sentence interruption or postponement are justified for the legally - binding duty that have the patient s best medical interest in mind . On the other hand, perhaps the system is tributary to past records when ignoring such requests led to deaths or aggravation of medical conditions and judges tend to be more permissive with detainees claims, observing the better safe than sorry principle . Although there is no universally accepted definition of informed consent, this issue is always seriously taken into account when dealing with patients who are also convicts . Situations in which doctors are confronted with controversial decisions made by these types of patients are also signs which point to a possible lack of competence of the patients thereby entailing an ethical obligation to evaluate their competence . Other authors believe that if the only question to which the forensic legal medicine doctors are called to respond to the court is whether the disease can be treated or not into the nap, although valid, it is insufficient, and cannot clarify entirely the complex medical condition of the convict . Therefore, the doctor s role is to explain and argument to the judge the risks arising from his decision, whatever it may be . It is basically an ethical and deontological duty related to the exercise of the medical profession to be in support of that patient regardless of his social status . Another ethical issue we think of is that of the nature of legal medicine doctor patient . In our opinion this should be rather impersonal and distant, because the dialogue between the two actors is not based on honesty . On the contrary, as stated above it is not uncommon for the convicts to tell lies and simulate symptoms and signs of certain types of diseases . Patient relationship, in which it s in the patient s interest to be honest and explain very clearly to the doctor the symptoms he suffers from, in order for the later to properly cure the disease . Therefore, judging by the ideas stated above we might conclude that concerning the ethics of a classic doctor patient relation, the one we are involved in, is an exception from the rule that the doctor should create a personal relation between him and his patients . For instance it is considered very normal for a family doctor to give his / hers personal phone number to the patients in order to be as reachable as they can be . But, this harmless practice might prove to be rather harmful in the case of legal medicine doctor patient (convict) relation, in which contrary interests arise, the one of the society on one hand which practically is based on the penal code and the convict s personal code, on the other hand . Physician relationship in developing a legal medicine expertise in view of sentence postponement / interruption on medical grounds, we state the importance of such studies due to the society s general interest of judicial processes celerity . Furthermore, a better understanding of the ethical boundaries that characterize this relationship, can give us a clue about the legal consequences that come along, such as delaying the outcome of lawsuits, burdening the activity of legal medicine doctors or creating the general opinion that success stories or breaches in the system can happen, by emphasizing the symptoms or even creating new ones . The patient must be informed from authorized sources about the duration and steps to be taken in performing a legal medicine expertise in pursuit of sentence postponement or interruption based on medical conditions . Efforts to determine unauthorized sources (mainly experienced detainees with records of unsubstantiated demands) are surely beneficial . To provide a fair assessment of a patient s medical condition is a necessity and such findings should be taken into consideration by the penitentiary surveillance judge when analyzing requests of sentence postponement or interruption . Repeated requests and waivers of sentence disruption requests present a multi - factorial determinism which always includes a medical condition but also various aspects that reveal the convicts influence and perception of the expertise procedure as a break into the prison life routine . Studies to identify the determinants of such behaviors among fellow convicts need to be initiated . Reducing the number of unjustified requests would have a positive impact in relieving medical staff of extra activities in the legal medicine expertise commissions and allow channeling resources (time and money spent on examinations and investigations) towards subjects in real and serious medical conditions.
The use of bleaching materials both hydrogen peroxide and carbamide peroxide has become an attractive procedure in the dental clinic . Furthermore, the use of fluoride - releasing glass ionomer as a dental restorative material has also become popular . The situation where these materials interact within the oral cavity during the bleaching process can occur frequently; thus, understanding their reaction is important . The bleaching process is believed to occur through oxidation by hydroxyl radicals that are generated from the bleaching agent . With clinically favorable and safe aspects for patients, several studies have shown the effectiveness of bleaching agents on dental restorative materials and teeth with regard to surface hardness, or other modifications . During setting of glass ionomer, fluoride ions are produced from strong soluble aluminofluoride complexes like alf . When a fully set glass ionomer is exposed to neutral aqueous solutions, it absorbs water and releases ions such as sodium, silica, calcium, and fluoride . Two processes occur during fluoride release: a fast elution process during the early periods, and a long - term diffusive process . It is also influenced by experimental factors, i.e., storage media, frequency of change of the storage solution, composition and ph - value of saliva, plaque, and pellicle formation . In vitro, fluoride release increases in acidic media; this was explained by the fact that decreasing ph increases the dissolution of the material leading to a higher fluoride level in acidic immersion . Thereby, the proportion of free fluoride to bound fluoride was higher under acidic than under neutral conditions . When hydrogen peroxide is stored, an acidic ph must be maintained to extend the shelf life . They found that at home bleaching products have a ph range from 5.66 to 7.3 . While they found ph of in - office bleaching system were lower and ranged from 3.6 to 6.5 . When hydrogen peroxide interacts with dental materials, it decomposes to form hydroxyl radical intermediates and finally to form water and oxygen . Also, carbamide peroxide will dissociate to h2o2, co2, urea and nh3, and then h2o2 will decompose again to water and oxygen finally . Those chemical ingredients may affect the fluoride release of glass ionomer restoratives . The purpose of this study was to evaluate the effect of vital bleaching on the fluoride release of various types of glass ionomer restorations . Also, to compare the fluoride release of various types of glass ionomer restorations . Two vital bleaching commercial products and three types of glass ionomer restorative materials were selected for this study . Bleaching materials used were opalescence xtra boost (38%hydrogen peroxide with ph of 7) and opalescence quick (35%carbamide peroxide with ph of 6) both manufactured by ultradent (inc . Glass ionomer materials used were ketac fil (conventional glass ionomer), photac fil (resin modified glass ionomer), and f2000 (poly acid modified composite resin) manufactured by 3 m (espe, st paul, usa). Thirty disk shaped specimens (5 mm in diameter and 2 mm in thickness) were prepared for each brand of glass ionomer . The mold was sandwiched between two glass plates to allow setting of glass ionomer under pressure . Capsules of ketac fil were activated then triturated according to manufacturer instructions for 15 s, injected in the holes of the mold in one increment . The mold was filled to slight excess, the specimen's top surface was covered by a mylar strip and a glass slide was secured to flatten the surface and pressed with standard load 500 mg over the mold then left for setting . Capsules of both photac fil and f2000 were triturated according to manufacturer instructions for 15 s and injected into holes, covered with glass slide, and light cured for 40 s per each side using a light source (pencure, j morita mfg corp ., each disk specimen was removed from the mold by separating its two halves and placed in a numerated plastic tube containing 5 ml of distilled water, tightly sealed with a cap . The specimens were incubated at 37c during the whole experimental period (3 months). After 24 h each group was further subdivided into three sub - groups, 10 samples for each group . The first sub group was a control group, the second sub group was bleached with opalescence xtra (ox), and the last one was bleached with opalescence quick (oq). Second and third subgroups were bleached with the two bleaching agents ox and oq according to their manufacturer instructions, every sample was covered with 2 ml of the bleaching material and left for 1 h. disks were then washed thoroughly with distilled water, and then returned back to their tubes . Control samples (the first sub group) returned back to the tubes after water in the tubes of all subgroups being changed with new 5 ml of distilled water . The measurements were performed after 1 week, 1 month, and 3 months and every time, samples were rinsed with distilled water and water in the tubes changed with new 5 ml of distilled water . Fluoride release measurements were performed using specific ion electrode (ph meter f-22 horiba) after adding total ionic strength adjustment buffer (tisab) solution . Data were recorded and analyzed by using one - way analysis of variance (anova) followed by bonferroni multiple comparison post hoc test at the significance level of = 0.05 . The analysis of variance was carried out considering the factors (material, time, and interaction). Data were recorded and analyzed by using one - way analysis of variance (anova) followed by bonferroni multiple comparison post hoc test at the significance level of = 0.05 . The analysis of variance was carried out considering the factors (material, time, and interaction). Time had highly significant effect on fluoride released from all glass ionomer materials under test at p <0.05 [table 1]. Ketac fil showed initial burst in fluoride release in the first week (t1) of 58.6 ppm, then concentration of fluoride decreased sharply after 1 month (t2) of 10.94 ppm . After 3 months (t3), the concentration of fluoride decreased again of 5.94 ppm [figure 1]. For photac fil, time had only a significant effect on fluoride release [figure 2]. Fluoride release of f2000 was also affected by time and this was highly significant [figure 3]. Effect of time on fluoride release for three types of glass ionomer materials mean fluoride concentration of ketac fil as affected by time . Studying fluoride release as affected by the type of glass ionomer material regardless the type of bleaching and time; the result was highly significant at p <0.01 . Comparing the three brands; there was no significant difference at p> 0.05 in fluoride release considering only the type of bleaching regardless type of glass ionomer and time . A significant increase in the mean fluoride released from ketac fil bleached with opalescence xtra compared to the untreated control group and the group bleached with opalescence quick . For photac fil, opalescence xtra caused slight increase in fluoride release while no significant differences in fluoride release were found after bleaching f2000 . According to the type of bleaching and the time, highly significant difference was found between the tested materials at p <0.01 . The use of hydrogen peroxide or peroxide releasing agents, such as carbamide peroxide or sodium perborate for brightening discolored teeth has become a popular treatment modality . Glass ionomers are often used for restoration of cervical lesions because of bonding to tooth structure and releasing fluoride . The influence of various bleaching agents on physical properties, surface morphology, and color of different restorative materials has been investigated in several in vitro studies simulating the clinical situation as closely as possible . In our study, it was found that the effect of bleaching on fluoride release of glass ionomer is material dependent depends on the type of bleaching material and the type of glass ionomer . Moreover, time factor was found to have an essential role . The high initial fluoride effect was only observed with ketac fil and photac fil after 1 week and dropped sharply by the second period after 1 month . This finding is in agreement with previous studies which may be attributed to the high instability and erosion of glass ionomer during the early setting period . Those studies have shown that the cumulative amount of fluoride ions released from glass ionomer cements, after a short period of time, is diffusion controlled and follows a decreasing gradient, which is linear to the square root of time . Thereby, the initial high amounts of fluoride rapidly decrease after 24 - 72 h and plateaued to a nearly constant level within 10 - 20 days . In contrast significant difference in fluoride release was found between both ketac fil, photac fil, and f2000 but no significant difference was found between ketac fil and photac fil . Ranking the three brands according to their fluoride release at the first period of the test; ketac fill was the material with the greatest rate of fluoride release, followed by photac fill then f2000 . This difference can be explained by the composition of the compomer brands, which exhibited higher fluoride content and contained smaller fillers, which might lead to a better reactivity due to the greater size of the specific surface . However, it was material dependent and depended on the type of bleaching, type of glass ionomer, and time . This effect was highly significant by the first week and did not prolong to other periods of the test ., 1997 who stated that the main daily release of fluoride did not differ significantly between bleaching agent and control . The reason for the contrasting results between the two studies may be attributed to different concentrations of bleaching agents used in both studies . Opalescence quick has no significant effect on the fluoride release of the three materials . Excluding the ph factor (as both bleaching materials are close to neutral), this can be attributed to that: carbamide peroxide degrades into approximately one - third hydrogen peroxide and two - thirds urea, and hydrogen peroxide can be considered its active ingredient . The hydrogen peroxide content in opalescence quick is therefore much lower than that in opalescence xtra . Also opalescence quick has more complicated steps of break down to free radicals than opalescence xtra . This result was in agreement with lee, et al ., 2002 who concluded that hydrogen peroxide has a similar effect on the fluoride release from compomers compared to the case of distilled water . Opalescence xtra (ox) increased fluoride release from conventional and resin - modified glass ionomers in the first week while the effect faded by time . Opalescence quick (oq) had no significant effect on the fluoride release of the three materials.
The year 2006 may be remembered in history as the year of the amphioxus . European agencies failed to fund (or we european researchers failed to convince the agencies of the importance of the amphioxus genome). Fortunately, at the other side of the atlantic, linda holland (scripps institution, university of california) and jeremy gibson - brown (washington university) did not fail . They collaborated on a white paper to the joint genome institute of the department of energy 1 that was supported by the relatively few labs concentrated on amphioxus research . [ricard albalat (spain), marianne bronner - fraser (usa), hector escriv (france), jordi garcia - fernndez (spain), kaoru kubokawa (japan), vincent laudet (france), thruston lacalli (canada), leo pezzement (usa), georgia panopoulou (germany), mario pestarino (italy), pierre pontarotti (france), t.v . Ventakatesh (usa), hiroshi wada (japan), ulrich welsch (germany), kinya yasui (japan), and shi - cui zhang (china)]. A number of outstanding scientists outside the amphioxus community also gave support to the proposal (the list is available in ref 1). That the amphioxus genome was crucial to the understanding of the origin of the human genome maybe was not clear to funding agencies but it was for the human genome consortium, as in the landmark human genome paper in 2000 2: our results so far are insufficient to settle whether two rounds of wgd occurred around 500 myr ago [...]. Another approach to determining whether a widespread duplication occurred at a particular time in vertebrate evolution would be to sequence the genomes of organisms whose lineages diverged from vertebrates at appropriate times, such as amphioxus). Led by dan rokhsar (jgi), and also thanks to the est collections made by the team of nori satoh (kyoto university) in collaboration with jr - kai yu and linda holland (university of california) we are about to know it: are we, human, octaploid? And which were the gene novelties (if any) that characterised chordate evolution? Coming soon, very soon...and second, the big drama with amphioxus: how they do it . To be a model, a genetic, developmental and functional one, amphioxus has to allow researchers to use its eggs and sperm! And they do it not very often, the american species branchiostoma floridae once every two weeks in the summer, and not much more often the eastern species b. belchei . Still, pioneer experiments of gene knockdown, reporter constructs, and cell lineage have been performed 3 - 5 . As with the genome, there is a big new, again not thanks to the european funding agencies, but to the effort of european research groups . An amphioxus consortium headed by hector escriv (banyuls sur mer) and composed by members of the labs in barcelona, lyon, paris and genova have been, during three years, trying to understand the reproductive behaviour of the european amphioxus, b. lanceolatum (fig . Now, nearly every day, we are able to obtain eggs and sperm on demand during the breeding season (april - july) 6 . This is possible not only in place, at the laboratoire arago, the marine station at banyuls sur mer . But also in our laboratory in barcelona . As far as we know, this is the only dry lab (not a marine station) in where amphioxus eggs and sperm are obtained in a controlled manner, a small but big step towards the dream: developing amphioxus as an experimental model system (fig . Most of the amphioxus researchers that have fought for the genome and the embryos are giving their particular data or views in their particular area of research . This second part focuses particularly in the nervous system, one of the major steps forwards to the complexity of vertebrates . Homologies, innovations, brain, neural crest, colinearity,..., interesting, promising and provocative hypothesis arise from the study of our lovely little lancelet . Genome by the corner, embryos by the hand, things are getting better, every day . Amphioxus in the lab: banyuls (left), barcelona (center) and egg injection system (right). Developmental series of the amphioxus branchiostoma floridae . Photograph courtesy of hector escriv.
International teaching provides clinician educators an opportunity for professional development and cultural immersion.1,2 the experience also exposes medical educators to new teaching methods and learning styles that can enhance their overall teaching repertoire . Language and communication issues are understandably principal concerns when contemplating a foreign teaching assignment . The opportunity to teach medical residents in another country gave me a better understanding of the challenges that non - english speaking background learners face during english instruction . This experience prompted me to reflect upon which teaching strategies were most effective and to study the non - english speaking background (nesb) and english as a second language (esl) literature . Although my observations come from a single center in japan, my research and advice is meant to serve as a guide for clinician i was invited to teach for one month at a 419-bed community hospital in chigasaki, japan where 23 residents train in a 2-year program analogous to a transitional internship year in the united states . I provided instruction in english in lectures and case conferences and on rounds in the medical inpatient ward, intensive care unit, and emergency department . In japan, students study english for six to eight years before residency, with greater emphasis on written rather than conversational english.37 most japanese medical students and residents use japanese textbooks; a minority read english texts and articles regularly . There is increasing use of english internet resources including pubmed and uptodate, and english journal articles are commonly discussed . I observed a spectrum of spoken english proficiency among the residents, and there were usually one or more highly capable physician interpreters in any group setting . The added cognitive load of a second language while learning medicine should not be underestimated . I have great admiration for the residents who deciphered the medical lexicon of a foreign language while simultaneously processing the facts and reasoning strategies of their new profession . An analogy would be american residents, many of whom have studied a foreign language such as spanish for years, trying to learn from an exclusively spanish - speaking professor during their first months of internship . Adapt to the local educational culture a divergent method of instruction may be counterproductive or suboptimal in a culture that learns and processes information differently.8 my initial resources for advice about local pedagogy were faculty at my university who had taught in japan and conversations with visiting japanese physicians . In japan i made educational styles an early topic of conversation and closely observed the teaching style of the local faculty . The japanese educational system emphasizes didactic lectures and diligent study of written material with less instruction using interactive questioning and analytical reasoning.4,9,10 i, therefore, provided a lecture - based curriculum but also used interactive techniques (particularly directed questioning) during didactic sessions and bedside rounds . I regularly recalibrated this hybrid approach with feedback from the faculty and the chief resident . Questions from the residents, typically after class, were the clearest indicator of learner engagement . Speak clearly and slowly listening is a demanding task that limits complete understanding for some nesb students.11,12 unlike reading, where the learner can control the pace of information and reflect, listening requires several additional cognitive steps for comprehension13 including distinguishing similar sounding words, analyzing stress and intonation, and deciphering colloquialisms . One study of japanese students demonstrated increased comprehension with a slower english speaking pace,14 which facilitates native - language reprocessing and note taking11,15 . A colleague with extensive international teaching experience gave me the following advice: if you are not aware that you are speaking slowly, then it is not slow enough . Best describes the patient, phrases such as very tired will minimize uncertainty . It is imperative to avoid idiomatic, jargon, or slang english.7,11,15 phrases like the bottom line or emphasis on enunciation which brings both clarity and a decrease in speech rate is advisable . Less is more a common teaching mistake is presenting too much information.16,17 when i taught hypercalcemia, by necessity of unhurried and deliberate speech, i focused on the two leading causes hyperparathyroidism and malignancy with only a brief mention of granulomatous disease and exogenous calcium / vitamin d. i never mentioned the less common entities such as the minor effect of hydrochlorothiazide or the rare consequence of immobility . (notably, i overlooked a more prevalent cause in certain parts of my host country: htlv-1 infection .) Spending time on more common diagnoses allows time to clarify, repeat, and assess understanding in a way that encyclopedic coverage of a topic does not . By limiting information to the essential concepts a teacher can provide a basic cognitive structure and outline (scaffolding) and allow students to develop and organize detailed knowledge through their own reading and experiences18,19 . Others have found that providing opportunities for before - and after - session reading has improved understanding of basic vocabulary and has been well received by nesb students.7,11 had i been more cognizant of this, i would have made a habit of providing my next lecture s topic in advance and would have advised a reading topic after bedside sessions and case discussions . Use the board another helpful suggestion found in the literature is the use of visual reinforcement of the material covered in lectures.7,11,15,20 while writing or drawing on the board may be perceived as dead time21, the change of pace can ease the burden of uninterrupted listening11 and provide time for note taking, translation, or questioning . Writing on the board also helps students grasp key important concepts and vocabulary . In distinction to prepared computer slides, sketches on a board allowed for modifications as the situation demanded (e.g., simplifying, reconstructing, allowing for the addition of a japanese phrase). The board was a critical tool in providing instruction on cases that were presented in the classroom . Writing on the board facilitated confirmation of the spoken words of the presenter and created a visual display of the case for the residents to follow (capitalizing on the strength of their reading comprehension). The tenants of clinical reasoning were emphasized by choosing which clinical facts were important enough to write on the board and then linking differential diagnoses to the recorded clinical details . Understand the silence directed questioning of the teacher is uncommon in many countries, where the absence of questions reflects respect and local learning style rather than indifference . For instance, malaysian students in one study viewed problem students as those who challenged their teachers.24 furthermore, some nesb learners are hesitant to vocalize thoughts or questions because of concerns about their english language proficiency;12,15 i oftentimes encountered residents who apologized for their very admirable conversational skills . Second language communication adds to the complexity and anxiety of answering a question, but it is important to remain committed to this teaching format to foster familiarity and confidence in this type of interaction between learner and teacher . I typically asked one person (rather than the group); used a simple sentence structure but kept the content cognitively rigorous (what are the important physical exam findings in pericarditis? )8,25; and clarified my question by repeating, rephrasing, or seeking translation when necessary . I praised all efforts to speak english yet scrutinized the medical content of their response at a more demanding level . Challenges posed by the language barrier optimal communication and understanding require language fluency26 whereas a partial language barrier creates impediments to teaching that are not easily circumvented . It can be difficult to share anecdotes, mistakes, or humor, which sometimes make for the most enduring lessons . I regret not using resident names earlier for fear of mispronunciation and thereby forgoing stronger teacher learner bonds.7,8 finally, the language (and cultural) divide made receiving constructive feedback from the residents difficult . When the message was nuanced or critical, i worked with a physician interpreter . For example, when clinical features subtly supported or refuted a diagnosis, carefully chosen words were essential . Use of an interpreter slowed the pace of the session, but in return i saw polite attention transform into genuine understanding . International teaching is a valuable professional development experience which enhances a medical teacher s pedagogical skills . It should not be overlooked that clinical skills, the underlying currency of the clinician educator, will also grow in an environment with disproportionate exposure to interesting cases and ample time to learn new diseases, diagnostic approaches, and management strategies . The trend toward an increasingly multicultural and global society will bring more nesb learners to english instruction classrooms and clinics and will send more english - speaking teachers and students into foreign medical education systems . Proficiency in these teaching approaches and an understanding of the different linguistic, cultural, and academic backgrounds of nesb learners will be increasingly important for clinician educators.
A total of 20 male type 2 diabetic patients treated with oral glucose lowering medication (n = 19) or diet only (n = 1) participated in the current study . Exclusion criteria were self - reported renal failure and liver disease (hepatitis and cirrhosis), morbid obesity (bmi> 40 kg / m), uncontrolled hypertension (> 160 mmhg systolic or> 100 mmhg diastolic or both), and a history of severe cardiovascular problems (myocardial infarction in the past year or stroke). All subjects were informed about the nature and the risks of the experimental procedures before their written informed consent was obtained . After an overnight fast, subjects arrived at the laboratory at 0800 h by car or public transportation . A fasting blood sample was obtained, after which a standard 75-g oral glucose tolerance test was performed to confirm type 2 diabetes according to the american diabetes association criteria (24). After blood sampling, all subjects performed an incremental exercise test on a cycle ergometer (lode excalibur) to determine their maximal workload capacity . Subjects participated in a randomized crossover study consisting of three intervention periods separated by at least 1 week . Each intervention period consisted of 3 days, during which blood glucose homeostasis was assessed under standardized dietary conditions (supplementary fig ., subjects reduced their sedentary behavior either by three 15-min bouts of adl (postmeal strolling; 3 mets) or by a single 45-min bout of moderate - intensity cycling exercise (6 mets). On day 1 of each intervention period, participants arrived at the laboratory during the afternoon and received a short period of training in the use of the capillary blood sampling method (glucocard x meter; arkray, kyoto, japan). Subsequently, a continuous glucose - monitoring device (glucoday s; a. menarini diagnostics, florence, italy) was attached as described previously (7) and participants returned home . On day 2, participants arrived at the laboratory by car at 0730 h after an overnight fast . An intravenous catheter was inserted into an antecubital vein for blood sampling purposes, and participants were equipped with a heart rate monitor (polar rs300). Participants received breakfast, lunch, and dinner at 0830, 1230, and 1700 h, respectively . Blood samples were collected in prechilled edta - coated tubes 5 min before each meal, and 90 and 150 min after each meal (total of 9 samples). After the last blood sample at 1930 h subjects went home . On day 3, subjects reported back to the laboratory during the morning for removal of the continuous glucose - monitoring device . The three intervention periods were identical with the exception of the three 15-min bouts of adl or the single 45-min bout of endurance - type exercise, which were performed on the second day of the experimental period (supplementary fig . Participants were restricted to a sedentary laboratory environment and spent the day seated in a chair or couch while reading, talking, viewing television, or working on a laptop computer . During the adl condition, sedentary behavior of the patients was interrupted by three 15-min bouts of slow - paced strolling (3 met) performed after each main meal (0915, 1315, and 1745 h). The bouts of strolling were chosen to reflect light adl, such as walking the dog, household tasks, light gardening work, and so on . During each bout, the bouts were supervised by a physical therapist . During the exercise condition, participants completed a single 45-min bout of moderate - intensity endurance - type exercise after breakfast (0915 to 1000 h) and were sedentary throughout the remainder of the day . The moderate - intensity exercise bout consisted of continuous cycling performed on a cycle ergometer at 50% of individual maximal workload capacity of the patients, translating to an average absolute workload of 85 4 w (6 met). The met values for both the adl and moderate - intensity exercise intervention were estimated based on the compendium of physical activities (25). Glucose - lowering medications used by patients are listed in table 1 . Except for the screening, intake of all medication was continued throughout the entire study, including the days that subjects visited the laboratory for testing . All subjects were asked to maintain their normal physical activity patterns throughout the study but to refrain from exhaustive physical labor and exercise training for 2 days before each experimental period . On day 1 of each intervention period, subjects were provided with a standardized dinner and evening snack . On day 2 of each intervention period, the actual test day, participants were served a standardized breakfast (0830 h), lunch (1230 h), and dinner (1700 h) in the laboratory, and they consumed a standardized evening snack at home (2030 h). On day 3 of each intervention period, participants remained fasted until 0830 h (end of data collection), after which they resumed their regular diets . Participant characteristics breakfast and lunch were identical and both meals consisted of bread, margarine, salami slices, cheese, jam, and semi - skim (1.5% fat) milk . The quantity of the diet (energy content) was based on individual daily energy requirements of the patients as calculated with the harris and benedict equation multiplied by a physical activity level value of 1.4 . The resulting diet provided 9.8 0.1 mj / day, consisting of 50% of energy from carbohydrate, 15% from protein, and 35% from fat . Venous blood samples were collected in prechilled edta - coated tubes and centrifuged at 1,000 g and 4c for 10 min . Aliquots of plasma were immediately frozen in liquid nitrogen and stored at 80c until analyses . Plasma insulin concentrations were determined by a radioimmunoassay for human insulin (hi-14k; millipore, ma). Whole blood hba1c content was determined in 3 ml venous blood samples by high - performance liquid chromatography (bio - rad diamat, munich, germany). The data obtained by the continuous glucose monitor were downloaded to a personal computer with glucoday software (version 3.2.2). Values reported by the continuous glucose - monitoring device were converted into glucose values using the self - monitored capillary blood glucose values, which were obtained at least before each main meal and before night time . The 24-h glycemic control was derived from the glycemic profiles obtained between 8:30 and 8:30 h on days 2 and 3 of each experimental period and was defined as the average 24-h blood glucose concentration and the prevalence of hyperglycemia over the course of 24 h. based on the american diabetes association / european association for the study of diabetes guidelines for glycemic control (26,27), the prevalence of hyperglycemia was defined as total time during which glucose concentrations exceeded 10 mmol / l . The continuously monitored glycemic profiles obtained on day 2 of each experimental period also were used to assess postprandial glycemic control . Postprandial glycemic control was defined as the incremental area under the curve (iauc) above fasting glucose assessed over the 3.5-h postprandial periods after each main meal (3.5-h glucose iauc), and as the cumulative glucose iauc of all main meals (10.5-h glucose iauc). Plasma insulin concentrations obtained on day 2 of each experimental period (from 0830 to 1930 h) were used to calculate the iauc above fasting plasma insulin by the trapezoidal rule (11-h insulin iauc). Differences between nontime - dependent variables (prevalence of hyperglycemia, 24-h glucose concentration, iauc) were assessed by one - way repeated - measures anova, with treatment as the within - subject factor . In case of a significant main effect, a two - way repeated - measures anova with time and treatment as within - subject factors was used to compare differences between treatments over time (plasma insulin concentrations). In case of interaction between significant time and treatment, pairwise comparisons with bonferroni correction were applied for separate time points to locate differences between treatments . A total of 20 male type 2 diabetic patients treated with oral glucose lowering medication (n = 19) or diet only (n = 1) participated in the current study . Exclusion criteria were self - reported renal failure and liver disease (hepatitis and cirrhosis), morbid obesity (bmi> 40 kg / m), uncontrolled hypertension (> 160 mmhg systolic or> 100 mmhg diastolic or both), and a history of severe cardiovascular problems (myocardial infarction in the past year or stroke). All subjects were informed about the nature and the risks of the experimental procedures before their written informed consent was obtained . All patients underwent an oral glucose tolerance test . Blood glucose lowering medication was withheld 2 days before the oral glucose tolerance test . After an overnight fast, subjects arrived at the laboratory at 0800 h by car or public transportation . A fasting blood sample was obtained, after which a standard 75-g oral glucose tolerance test was performed to confirm type 2 diabetes according to the american diabetes association criteria (24). After blood sampling, all subjects performed an incremental exercise test on a cycle ergometer (lode excalibur) to determine their maximal workload capacity . Subjects participated in a randomized crossover study consisting of three intervention periods separated by at least 1 week . Each intervention period consisted of 3 days, during which blood glucose homeostasis was assessed under standardized dietary conditions (supplementary fig ., subjects reduced their sedentary behavior either by three 15-min bouts of adl (postmeal strolling; 3 mets) or by a single 45-min bout of moderate - intensity cycling exercise (6 mets). On day 1 of each intervention period, participants arrived at the laboratory during the afternoon and received a short period of training in the use of the capillary blood sampling method (glucocard x meter; arkray, kyoto, japan). Subsequently, a continuous glucose - monitoring device (glucoday s; a. menarini diagnostics, florence, italy) was attached as described previously (7) and participants returned home . On day 2, participants arrived at the laboratory by car at 0730 h after an overnight fast . An intravenous catheter was inserted into an antecubital vein for blood sampling purposes, and participants were equipped with a heart rate monitor (polar rs300). Participants received breakfast, lunch, and dinner at 0830, 1230, and 1700 h, respectively . Blood samples were collected in prechilled edta - coated tubes 5 min before each meal, and 90 and 150 min after each meal (total of 9 samples). After the last blood sample at 1930 h subjects went home . On day 3, subjects reported back to the laboratory during the morning for removal of the continuous glucose - monitoring device . The three intervention periods were identical with the exception of the three 15-min bouts of adl or the single 45-min bout of endurance - type exercise, which were performed on the second day of the experimental period (supplementary fig . Participants were restricted to a sedentary laboratory environment and spent the day seated in a chair or couch while reading, talking, viewing television, or working on a laptop computer . During the adl condition, sedentary behavior of the patients was interrupted by three 15-min bouts of slow - paced strolling (3 met) performed after each main meal (0915, 1315, and 1745 h). The bouts of strolling were chosen to reflect light adl, such as walking the dog, household tasks, light gardening work, and so on . During each bout, the bouts were supervised by a physical therapist . During the exercise condition, participants completed a single 45-min bout of moderate - intensity endurance - type exercise after breakfast (0915 to 1000 h) and were sedentary throughout the remainder of the day . The moderate - intensity exercise bout consisted of continuous cycling performed on a cycle ergometer at 50% of individual maximal workload capacity of the patients, translating to an average absolute workload of 85 4 w (6 met). The met values for both the adl and moderate - intensity exercise intervention were estimated based on the compendium of physical activities (25). Glucose - lowering medications used by patients are listed in table 1 . Except for the screening, intake of all medication was continued throughout the entire study, including the days that subjects visited the laboratory for testing . All subjects were asked to maintain their normal physical activity patterns throughout the study but to refrain from exhaustive physical labor and exercise training for 2 days before each experimental period . On day 1 of each intervention period, subjects were provided with a standardized dinner and evening snack . On day 2 of each intervention period, the actual test day, participants were served a standardized breakfast (0830 h), lunch (1230 h), and dinner (1700 h) in the laboratory, and they consumed a standardized evening snack at home (2030 h). On day 3 of each intervention period, participants remained fasted until 0830 h (end of data collection), after which they resumed their regular diets . Participant characteristics breakfast and lunch were identical and both meals consisted of bread, margarine, salami slices, cheese, jam, and semi - skim (1.5% fat) milk . The quantity of the diet (energy content) was based on individual daily energy requirements of the patients as calculated with the harris and benedict equation multiplied by a physical activity level value of 1.4 . The resulting diet provided 9.8 0.1 mj / day, consisting of 50% of energy from carbohydrate, 15% from protein, and 35% from fat . Venous blood samples were collected in prechilled edta - coated tubes and centrifuged at 1,000 g and 4c for 10 min . Aliquots of plasma were immediately frozen in liquid nitrogen and stored at 80c until analyses . Plasma insulin concentrations were determined by a radioimmunoassay for human insulin (hi-14k; millipore, ma). Whole blood hba1c content was determined in 3 ml venous blood samples by high - performance liquid chromatography (bio - rad diamat, munich, germany). The data obtained by the continuous glucose monitor were downloaded to a personal computer with glucoday software (version 3.2.2). Values reported by the continuous glucose - monitoring device were converted into glucose values using the self - monitored capillary blood glucose values, which were obtained at least before each main meal and before night time . The 24-h glycemic control was derived from the glycemic profiles obtained between 8:30 and 8:30 h on days 2 and 3 of each experimental period and was defined as the average 24-h blood glucose concentration and the prevalence of hyperglycemia over the course of 24 h. based on the american diabetes association / european association for the study of diabetes guidelines for glycemic control (26,27), the prevalence of hyperglycemia was defined as total time during which glucose concentrations exceeded 10 mmol / l . The continuously monitored glycemic profiles obtained on day 2 of each experimental period also were used to assess postprandial glycemic control . Postprandial glycemic control was defined as the incremental area under the curve (iauc) above fasting glucose assessed over the 3.5-h postprandial periods after each main meal (3.5-h glucose iauc), and as the cumulative glucose iauc of all main meals (10.5-h glucose iauc). Plasma insulin concentrations obtained on day 2 of each experimental period (from 0830 to 1930 h) were used to calculate the iauc above fasting plasma insulin by the trapezoidal rule (11-h insulin iauc). Differences between nontime - dependent variables (prevalence of hyperglycemia, 24-h glucose concentration, iauc) were assessed by one - way repeated - measures anova, with treatment as the within - subject factor . In case of a significant main effect, pairwise comparisons with bonferroni correction were applied to locate differences between treatments . A two - way repeated - measures anova with time and treatment as within - subject factors was used to compare differences between treatments over time (plasma insulin concentrations). In case of interaction between significant time and treatment, pairwise comparisons with bonferroni correction were applied for separate time points to locate differences between treatments . All statistical calculations were performed using the spss 15.0.1.1 software package . Unless otherwise indicated, data are reported as means sem . Average heart rates of subjects that were measured between 0830 and 1930 h were 72 2 bpm during the sedentary control condition and 78 2 and 82 2 bpm during the adl (p <0.001) and exercise conditions (p <0.001), respectively . As expected, 45 min of moderate - intensity exercise (125 4 bpm) was more intense than the 45 min of adl (100 2 bpm; p <0.001). Mmol / l) was prevalent for 6 h 51 min (1 h 4 min) throughout the day . A single bout of moderate - intensity exercise significantly reduced the daily prevalence of hyperglycemia to 4 h 47 min 1:02 (34 7%; p <0.001; fig . Although blood glucose concentrations were clearly attenuated after the onset of the 15-min bouts of adl (fig . 1), the prevalence of hyperglycemia over the course of 24 h was not significantly reduced (6 h 2 min 1 h 16 min; p = 0.67). 2b). A single session of moderate - intensity exercise significantly reduced average blood glucose concentrations by 0.6 0.1 mmol / l (p <0.001) relative to the sedentary control condition, whereas average 24-h blood glucose concentrations were basically unchanged during the adl condition (0.2 0.1 mmol / l; p = 0.92). The 24-h glycemic profiles in type 2 diabetic patients under sedentary conditions and under conditions in which prolonged sedentary time was reduced by three 15-min bouts of activities of daily living (adl; gray squares) or by a single 45-min bout of moderate - intensity endurance - type exercise (checkered square). The dotted lines indicate the ingestion of the main meals (0830, 1230, and 1700 h) or snack (2030 h). The error bars are not shown for clarity . The impact of the three experimental conditions on the prevalence of hyperglycemia over the course of 24 h (a), average 24-h blood glucose concentrations (b), and the cumulative postprandial glucose iauc (c). Moderate - intensity exercise strongly reduced the glycemic response to breakfast and, to a lesser extent, the glycemic response to lunch and dinner (p <0.05 for all postprandial periods; supplementary table 1). The decrements in postprandial glucose concentrations observed in the adl condition did not reach statistical significance for any of the postprandial periods (p> 0.05; supplementary table 1). More important, however, the cumulative glucose response to breakfast, lunch, and dinner (10.5-h iauc; fig . 2c) was significantly lower during both the adl (365 51 mmol / l/10.5 h; p <0.05) and moderate - intensity exercise condition (285 38 mmol / l/10.5 h; p <0.001) compared with the sedentary control condition (448 54 mmol / l/10.5 h). The 35 5% reduction in the cumulative glucose iauc during the moderate - intensity exercise condition was greater than the 17 6% reduction observed in the adl condition, although this observation did not reach statistical significance (p = 0.06). The postprandial increments in plasma insulin concentrations were significantly attenuated when adl were performed in the early postprandial phase . A single bout of moderate - intensity exercise soon after breakfast blunted the subsequent increase in plasma insulin concentrations . The impact of moderate - intensity exercise on plasma insulin concentrations persisted for up to several hours after exercise . The resulting plasma insulin response to the standardized diet (11-h positive iauc) was 17 5% lower during the adl condition (214 24 nmol / l/11 h; p <0.05) and 33 4% lower during the exercise condition (170 18 nmol / l/11 h; p <0.001) relative to the sedentary control condition (250 23 nmol / l/11 h). The insulin iauc during the exercise condition also was lower compared with the adl condition (p <0.001). The impact of the three experimental conditions on insulin concentrations over time (a) and the postprandial insulin iauc (b). Average heart rates of subjects that were measured between 0830 and 1930 h were 72 2 bpm during the sedentary control condition and 78 2 and 82 2 bpm during the adl (p <0.001) and exercise conditions (p <0.001), respectively . As expected, 45 min of moderate - intensity exercise (125 4 bpm) was more intense than the 45 min of adl (100 2 bpm; p <0.001). Mmol / l) was prevalent for 6 h 51 min (1 h 4 min) throughout the day . A single bout of moderate - intensity exercise significantly reduced the daily prevalence of hyperglycemia to 4 h 47 min 1:02 (34 7%; p <0.001; fig . Although blood glucose concentrations were clearly attenuated after the onset of the 15-min bouts of adl (fig . 1), the prevalence of hyperglycemia over the course of 24 h was not significantly reduced (6 h 2 min 1 h 16 min; p = 0.67). 2b). A single session of moderate - intensity exercise significantly reduced average blood glucose concentrations by 0.6 0.1 mmol / l (p <0.001) relative to the sedentary control condition, whereas average 24-h blood glucose concentrations were basically unchanged during the adl condition (0.2 0.1 mmol / l; p = 0.92). The 24-h glycemic profiles in type 2 diabetic patients under sedentary conditions and under conditions in which prolonged sedentary time was reduced by three 15-min bouts of activities of daily living (adl; gray squares) or by a single 45-min bout of moderate - intensity endurance - type exercise (checkered square). The dotted lines indicate the ingestion of the main meals (0830, 1230, and 1700 h) or snack (2030 h). The error bars are not shown for clarity . The impact of the three experimental conditions on the prevalence of hyperglycemia over the course of 24 h (a), average 24-h blood glucose concentrations (b), and the cumulative postprandial glucose iauc (c). Moderate - intensity exercise strongly reduced the glycemic response to breakfast and, to a lesser extent, the glycemic response to lunch and dinner (p <0.05 for all postprandial periods; supplementary table 1). The decrements in postprandial glucose concentrations observed in the adl condition did not reach statistical significance for any of the postprandial periods (p> 0.05; supplementary table 1). More important, however, the cumulative glucose response to breakfast, lunch, and dinner (10.5-h iauc; fig . 2c) was significantly lower during both the adl (365 51 mmol / l/10.5 h; p <0.05) and moderate - intensity exercise condition (285 38 mmol / l/10.5 h; p <0.001) compared with the sedentary control condition (448 54 mmol / l/10.5 h). The 35 5% reduction in the cumulative glucose iauc during the moderate - intensity exercise condition was greater than the 17 6% reduction observed in the adl condition, although this observation did not reach statistical significance (p = 0.06). The postprandial increments in plasma insulin concentrations were significantly attenuated when adl were performed in the early postprandial phase . A single bout of moderate - intensity exercise soon after breakfast blunted the subsequent increase in plasma insulin concentrations . The impact of moderate - intensity exercise on plasma insulin concentrations persisted for up to several hours after exercise . The resulting plasma insulin response to the standardized diet (11-h positive iauc) was 17 5% lower during the adl condition (214 24 nmol / l/11 h; p <0.05) and 33 4% lower during the exercise condition (170 18 nmol / l/11 h; p <0.001) relative to the sedentary control condition (250 23 nmol / l/11 h). The insulin iauc during the exercise condition also was lower compared with the adl condition (p <0.001). The impact of the three experimental conditions on insulin concentrations over time (a) and the postprandial insulin iauc (b). The current study demonstrated that hyperglycemia is highly prevalent throughout the day in patients with type 2 diabetes . A single 45-min bout of endurance - type exercise strongly reduced the prevalence of hyperglycemia over the course of 24 h. an increase in adl (three 15-min bouts of postmeal strolling) improved postprandial blood glucose homeostasis but did not significantly reduce the prevalence of hyperglycemia over 24 h. elevated blood glucose concentrations, which are most evident in the postprandial state, increase the risk for diabetes complications and mortality (16). In the current study, type 2 diabetic patients exceeded the recommended upper limit for postprandial glucose concentrations of 10 strikingly, these hyperglycemic episodes occurred despite the fact that most patients were using oral blood glucose lowering medication and were relatively well controlled according to the hba1c level (6.9 0.1% [52 1 mmol / mol]; table 1). These findings are in agreement with previous observations of the prevalence of hyperglycemia (8,28) and emphasize the need for additional treatment strategies in type 2 diabetes . Although the acute impact of moderate - intensity to high - intensity exercise on 24-h blood glucose homeostasis has been well established (1218), recent data also suggest an important role for light physical activity in maintaining or restoring proper glycemic control (2123). Thus far, experimental studies investigating the impact of such light physical activity strategies on glycemic control in type 2 diabetic patients are lacking . The current study shows that the introduction of repeated bouts of adl during sedentary behavior represents an effective interventional strategy to attenuate the increase in blood glucose and insulin concentrations after sequential meals in type 2 diabetic patients (figs ., these findings confirm our hypothesis that simply performing adl can improve postprandial blood glucose homeostasis . Considering the fact that postprandial hyperglycemia is a strong and independent risk factor for cardiovascular morbidity and mortality (46), our data indicate that even adl can improve cardiovascular risk profiles in patients with type 2 diabetes . Hence, the beneficial impact of such light physical activity on postprandial glucose concentrations may, at least to some extent, explain the relationships observed between active and sedentary behavior and cardiovascular morbidity and mortality (2932). The exact mechanisms by which light physical activity reduces postprandial blood glucose concentrations remain to be explored . Nonetheless, the concomitant reduction in postprandial insulin concentrations as observed in the current study (fig . 3) suggests an important role for noninsulin - dependent (i.e., contraction - induced) glucose disposal . It also could be speculated that delayed gastrointestinal transit or splanchnic hypoperfusion attributable to the physical activity might have contributed to the lowered postprandial glycemic and insulinemic responses (33). However, this effect is likely to be small considering the low intensity of the adl intervention . Despite its positive effects on postprandial glucose and insulin concentrations, the adl intervention did not significantly reduce the prevalence of hyperglycemic blood glucose excursions over the entire 24-h period (fig . In contrast, a single 45-min bout of moderate - intensity endurance - type exercise was shown to reduce the daily prevalence of hyperglycemia by 34%, along with a reduction of 0.6 mmol / l in average 24-h blood glucose concentrations (fig . 2a and b). Given the tight relationship between average 24-h glucose concentrations and hba1c (34), the moderate - intensity endurance - type exercise intervention is more likely to affect long - term glycemic control (i.e., hba1c) than the adl intervention . Moreover, the reductions in postprandial glucose and insulin iauc induced by moderate - intensity exercise (35 and 33%, respectively) were twofold greater than the decrements observed during the adl condition (17% for both glucose and insulin iauc). Thus, when matched for total activity duration, a single bout of moderate - intensity endurance - type exercise has a much greater impact on blood glucose homeostasis than repeated bouts of low - intense adl . We previously have speculated that the total volume of exercise (i.e., product of frequency, duration, and intensity) is of prime importance with respect to glycemic control (15). This theory also could explain the greater blood glucose lowering effects observed in the endurance - type exercise condition as opposed to the adl condition . The total energy expended during the 45 min of moderate - intensity endurance - type exercise (350 kcal) was approximately twofold higher compared with the 45 min (three 15-min bouts) of adl (175 kcal). Interestingly, this difference in volume tends to be in agreement with the twofold greater decline in postprandial glucose and insulin iauc observed during the exercise as opposed to the adl condition . Response relationship between the volume of aerobic physical activity and the subsequent improvements in blood glucose homeostasis . Response relationship also has been observed recently between the volume of exercise training and improvements in insulin sensitivity (35). Moreover, for a fixed volume of exercise, high - intensity exercise was not found to be more effective than moderate - intensity in improving long - term glycemic control (i.e., hba1c) (36,37). Taken together, it is tempting to speculate that equal volumes of adl and moderate - intensity exercise lead to similar improvements in glycemic control . This also would provide an answer to the question of whether an increase in adl provides any surplus benefit for those type 2 diabetic patients who already perform substantial levels of physical activity during daily life . In conclusion, implementation of moderate - intensity endurance - type exercise or repeated bouts of adl markedly improve postprandial blood glucose handling in type 2 diabetic patients . When matched for total duration, a single bout of moderate - intensity endurance - type exercise has a greater impact on daily blood glucose homeostasis than repeated bouts of adl . Nonetheless, the introduction of repeated adl bouts during prolonged sedentary behavior forms a valuable strategy in the management of blood glucose homeostasis in type 2 diabetes, especially in those patients who are unable or reluctant to perform structured exercise.
Hepatic injury takes the third place in abdominal injury and 80%90% of hepatic injuries are blunt ones . In 2013, a study using ultrasonography to evaluate the intraperitoneal trauma showed that liver was the mostly affected organ and younger people were more vulnerable to hepatic and pancreatic injury . In 1994, american association for surgery of trauma (aast) proposed the standard classification of hepatic trauma . According to the classification, level i - ii hepatic trauma is called minor hepatic trauma, accounting for 80%90% of all hepatic trauma . The hepatic trauma of level iii and above is called serious hepatic trauma, with the mortality of 10%, and if patients have multiple injuries, the mortality may be elevated to as high as 25% . Serious hepatic trauma is always combined with parahepatic vena cava injury, with the mortality of above 50% . The clinical experience shows that early diagnosis, accurate assessment, active resistance to shock, optimal treatment plan and the organ function preservation are protective factors to reduce the mortality and enhance the treatment . Patients have some typical clinical manifestations such as right upper abdominal pain (sometimes with radiating pain to the right shoulder), nausea and vomiting, thirst, peritonitis, and hypovolemic shock . Abdominal ultrasound can quickly assess intra - abdominal hemorrhage, suitable for hemodynamically instable patients, but limited by weak sensitivity and a high rate of misdiagnosis . Therefore, abdominal ultrasound is usually used for the patients who could not tolerate ct scanning . Ct is the most commonly used method for the diagnosis of intra - abdominal solid organ injury . For small occult liver damage, enhanced enhanced ct combined with ultrasound is regarded as the most valuable method to evaluate abdominal trauma.9, 10 thanks for the development of modern imaging techniques, ct scanning can provide adequate information for definite diagnosis of liver injury or intra - abdominal hemorrhage.11, 12 the most difficult and important aspect is the preliminary evaluation and early rescue . For hemodynamically instable patients, we should promptly determine the order of severity of hepatic trauma, and proceed with timely exploratory laparotomy and treatment . In the past, most scholars thought that non - operative therapy was only appropriate for level i - ii liver traumas, which were hemodynamically stable without signs of peritoneal irritation or other organ injuries . A study showed that non - operative therapy is effective for isolated liver trauma . With the development of conservative treatment in medical field, asfar et al revealed that about 80% of blunt hepatic injuries can be treated by non - operative therapy, especially the hemodynamically stable patients . In china, non - operative strategy is widely used in clinic, especially for minor blunt hepatic trauma and liver capsule bleeding . The reasons for this change lie in the following aspects: (1) in about half of blunt liver trauma patients, the bleeding has been stopped before exploratory laparotomy; (2) liver has the great capability of auto - hemostasis after injury; (3) ct has been improved and minimally invasive surgery has been developed; (4) medical treatment in intensive care unit is given . The study of about 40 000 liver injured patients from 405 trauma centers showed that the probability of operative therapy for successfully treated complicated liver trauma is lower than 40%, regardless of whether or not other organs are injured . This data indicated that non - operative therapy for complicated liver trauma is more successful than operative therapy, and the success rate of non - operative therapy is increasing . In cases of serious liver trauma (levels iii and iv), non - operative therapy reduced the mortality to 23.5% . Based on clinical experience, a substantial amount of evidences suggest that non - operative therapy has a great curative effect . Norrman et al reported that the curative ratio for non - operative therapy was 89% . Besides the adults, non - operative therapy also presents beneficial outcome for children . For perforating liver injury, operation is the first choice; for multiple organ injury, exploratory laparotomy could find the occult trauma . For blunt trauma patients who are hemodynamically stable, non - operative therapy could be adopted, with monitoring vital signs . In the absence of complicating factors, abdominal laparotomy is not dependent on the severity of hepatic trauma, as the success rate of non - operative therapy is 90% . For hepatic trauma patients, the doctors should pay close attention to the hemodynamic status . Hemodynamic stability is the basis of non - operative therapy, i.e., non - operative therapy depends upon the premise that the patients have no other injured organs, especially no intestinal damage . The monitoring system, angiography and endoscopic retrograde cholangiography are very important for hepatic trauma patients . Doctors should be experienced in order to closely observe the patients and prepare for emergent operation in time . In the early stage, the doctors should accurately judge the severity of injury, monitor the patients' vital signs and ensure hemodynamic changes timely . Moreover, symptomatic treatment, nutritional support, and the maintenance of the patient's water and electrolyte balance are necessary to promote the healing of viscus organs, meanwhile the doctors should also pay attention to the protection of viscus function . In china, it is believed that non - operative therapy applied for level iii hepatic trauma should be very prudent . Due to a lack of advanced medical techniques, most primary hospitals do not have adequate monitoring capacity, good icu guardianship or liver specialists in medical team, and follow - up treatment options, especially after non - operative therapy fails . Therefore, for liver trauma, especially for serious and complicated liver trauma, surgeons should select the optimal treatment method according to the patient's condition and the medical conditions of the hospital and in the end, if possible, they should broaden the indication criteria for operative therapy as required . If the patients are hemodynamic unstable, they should be operated upon promptly . For perforating liver wounds, operative therapy is the first choice, and for multiple organ damage, exploratory laparotomy can locate and repair occult trauma . For blunt trauma patients, who are hemodynamic stable, non - operative therapy may be suitable, with close monitoring and appropriate preparation for operation . The aim of operation is to ascertain the traumatic condition, stop any bleeding, prevent bile leakage, remove the devitalized tissues and give adequate drainage . For the patients who need surgical treatment, mors in tabula or during the first 24 h after injury and 6.9% of deaths occurred during the hospitalization . If the patients have absolute surgical indications, the surgery should be performed as soon as possible . Stopping bleeding is the key to treat hepatic trauma because it can influence the mortality of the hepatic trauma patients . In addition, thorough debridement and adequate drainage could reduce the decomposition products of necrotic tissue and prevent the formation of abdominal abscesses . Surgeons should choose the most appropriate scheme according the result of surgical exploration and the wound condition . Operation methods include single pure suture, deep mattress suture, debridement, anatomical hepatectomy, hepatic arterial ligation, gauze packing, liver coated mesh method, etc . Damage control is the principle for operative treatment since it may save time, which is beneficial for those patients transferred to other trauma centers, or requiring further treatment . Deep mattress suture is appropriate for contusion and laceration of the liver in which the cleft is deep, including the placement of hemostatic gauze and omentum majus into the liver tissue defect . This is suitable for level iii injury, and even some cases of level iv injury . Debridement should be performed based on the anatomical structure of the liver, in order to completely remove any necrotic tissues, ligature the damaged vessels and bile ducts, and retain the normal liver tissue to the greatest extent . This is routinely performed because debridement is focused upon the injured part of the liver, unlike anatomical hepatectomy . The anatomical hepatectomy requires excellent technical skill and a prolonged operation time, and is thus rarely used clinically . The peripheral hepatic gauze is effective to control bleeding for level iii liver trauma, even for levels iv and v liver trauma . Nicol et al found that the increased tamponade time was not associated with increased the morbidity of complications such as sepsis and bile leakage . The secondary operation should be performed 48 h after the condition becomes stable and the hypotension, hypothermia, acidosis and blood coagulation disorders should be corrected . In addition, surgeons should pay attention to excessive filling of the vena cava or renal vein caused by tamponade, which may lead to abdominal compartment syndrome . The filling parts could get effective drainage in order to reduce the risk of infection . Mesh wrapping is to use absorbable synthetic mesh to pack the damaged area of the liver or the entire organ, to achieve hemostasis by compression . This method is suitable for extensive damage to the liver parenchyma or star - shaped liver laceration, which has vitality and is connected with hepatic pedicle . Normally continuous hemorrhage results from the rupture of liver parenchyma or the damage of major blood vessels . To treat serious hepatic trauma such as levels iii and iv injuries if the patients present no hemodynamic instability, acidosis or blood coagulation disorders, stage i operation is advisable . During the operation, surgeons should expose operation vision quickly and achieve hemostasis, and the key to treat the complicated liver trauma is to control hemorrhage . When the surgeon is unable to find the exact origin of bleeding, he should avoid suturing hemostasis or hepatic lobectomy blindly . If the tip is still bleeding, it suggests that the bleeding comes from the main hepatic vein or inferior vena cave . These liver traumas are very intractable and the mortality is very high . In theory, surgeons could dissociate and control the inferior vena cave and repair the venous directly, but in fact it is very difficult to get enough time to dissociate the blood vessel . Therefore, it is advisable to control bleeding with gauze and stabilize the conditions for the secondary phase of treatment . In recent years, surgeons have developed new surgical methods to treat hepatic trauma, such as laparoscopic exploration, hepatic artery embolization and liver transplantation . The laparoscopic exploration is widely used for hepatic trauma patients, with advantages of damage control, clear vision, simple operation and high safety . With the development of interventional surgery, hepatic artery embolization is found to be an effective way to treat hepatic trauma patients, both adults and children, regardless of hemodynamic stability.26, 27, 28 some surgeons used transarterial microchip embolization to treat children who suffered from liver artery injury, and obtained beneficial results . Transcutaneous contrast - enhanced ultrasound - guided injection of hemostatic agents was compared with traditional surgery treatment for liver, spleen and kidney trauma, presenting better outcomes . For the patients with large - area comminuted liver damage and some cases of levels iii and iv hepatic trauma, liver transplant is their last resort, however, because of the lack of liver source for transplantation and high cost, it has not been widely applied . In 1983, stone et al proposed a theory of damage control surgery . In 1993, rotendo et al formalized the concept and the treatment specification of damage control surgery . Operative treatment may bring damages to patients, if combined with primary trauma, it may lead to a double - attack . The focus of damage control surgery is the reduction of the adverse impact on patients . At present, damage control surgery is widely recognized, but it has strict indications: firstly, surgeons should act according to the traumatic condition of patients; secondly, the patients with serious combined injuries are preferred; thirdly, the patients present with hemodynamic instability, clotting disorders and low temperature . The most important purpose of damage control surgery is to rapidly control the hemorrhage, shorten operation time and avoid complex surgery . Before effective resuscitation, the surgeons should repair liver vasculature to avoid the risk of low blood pressure, acidosis and clotting disorders . For a large area of comminuted liver rupture with uncontrollable bleeding, surgeons should stop the bleeding by stuffing gauzes around the liver and clear necrotic tissues as soon as possible . After hypothermia, acidosis and blood coagulation a majority of scholars, both in china and abroad, believe that the second phase of surgery should be 3672 h after the patient becomes medically stable.10, 34 concurrently, surgeons should be aware that this procedure may bring high risk of complications such as wound infection, abdominal abscess, wound dehiscence, even abdominal compartment syndrome . Due to severe hepatic trauma caused by extensive damage to the liver tissues, ischemic necrosis may cause a few complications such as bleeding, biliary fistula, abdominal abscess cyst formation . The drainage is necessary in such cases, i.e., the surgeons routinely set double tubes around the liver section and under the diaphragm area . After operation, sustained low pressure suction for 48 h is suggested, together with washing if necessary, to guarantee unobstructed drainage and prevent postoperative wound infection . If the patient suffers from late - onset bleeding with hemodynamic stability, vascular embolization should be performed to pinpoint the vascular damage and embolize the artery . Postoperative cholestasis or peripheral hepatic abscess can be treated by percutaneous puncture drainage, either under the ultrasound or ct - guided . The patients with large cysts usually have clinical manifestations including right upper distension, dull pain, fever and increased bilirubin level, but wbc count shows no obvious change . Biliary fistula can be treated by endoscopic retrograde cholangiopancreatography and endoscopic sphincterotomy, achieving satisfactory results . Batur et al reported a possibility of hepatic artery pseudoaneurysm, which should be paid attention to in clinic . At present, hepatic trauma is mainly managed by non - operative therapy in clinic . Serious hepatic trauma patients whose effective liquid recovery is still accompanied by hemodynamic instability require surgical intervention . The basic principle of operation is to control the trauma and choose the optimal operative method according to the general condition informed by surgical exploration . Meanwhile, surgeons' experiences and technical skill have great influence on the prognosis of the patients.
Using a cross - sectional design, recorded food intake was compared with recalled food intake . Two computer - assisted 24hr interviews were performed in the participant's home with a 28 week interval . In the planning of the interviews, an equal distribution of the different days of the week was considered . Both interviews were performed by dietitians trained to use epic - soft . Between the first and second interview, after the second 24hr interview, participants were instructed on how to complete a pre - structured 7-day edr . After the 7-day registration, the dietitians visited the participants once more to collect the records and check them for completeness and correctness . A sub - sample was provided with an accelerometer and instructed on how to wear it . This study was conducted according to the guidelines laid down in the declaration of helsinki and all procedures involving human subjects were approved by the regional ethics committee of ghent university hospital . Written informed consent was obtained from all subjects . A different approach for recruiting participants was performed for adolescents, adults and elderly . In adolescents, firstly, five secondary schools providing both general education as vocational training were contacted in the region of ghent . Subsequently, parent's permission was asked by written request . Because, selection of classes and communication with parents was performed by the school's administration adults invited for participation were acquaintances and family of students and researchers, elderly were recruited via social service centres . Elderly living in a residential care setting were excluded given the more limited freedom in food choices . The subjects did not receive any incentive for their participation . During a 24hr, the participants need to report the types and quantities of all foods and beverages consumed during the preceding day . Preferably interviews are carried out by a trained dietitian . Due to within - subject variation, a single 24hr is not able to offer a critically valid estimate of one's usual dietary intake (3). Performing two non - consecutive 24hr allows for important correction for within - subject variability in nutrient intake (57). Because a 24hr is an open - ended interview, this type of data collection requires standardisation . Epic - soft is a computerised 24hr program suitable for obtaining dietary information in national food consumption surveys (8). The 24hr interview performed with epic - soft is divided into four main steps: (1) general non - dietary information; (2) quick list (chronological list of consumed foods and recipes); (3) description and quantification of foods and recipes; and (4) quality controls at nutrient level . Entering foods in chronological order of consumption and the use of probing questions supports the respondent's memory (2). Quantification of foods was possible using weights or volumes, food photographs from the epic - soft picture book (9), household measures, standard units and standard portions from the belgian household weights and measures manual (10). After data collection, all foods with their characteristics including a food code were exported from epic - soft for future linking . Structured open - ended diaries containing predefined food groups (including the option other food items) at six food occasions (breakfast, lunch, dinner and three snacks) were provided to all subjects . The diary also contained a written example for future reference . During a 7-day period, all consumed foods and drinks had to be reported with notification of date and place of consumption, estimated consumed quantity expressed as a household measure, unit or weight, specification and if present a brand name . Separate forms were included to report on homemade recipes so name of dish, total quantities of all ingredients and fraction of dish consumed could be stated . Foods reported in the 5-day edr were entered in the diet entry & storage program (becel) (11) using a standardised set of food codes and exported for further linking . The number of days necessary to estimate true energy intake can be calculated as n=[(1.96cvwei)/d0] where d0 is the specified% of the true mean and cvwei is the within - person coefficient of variation (12). Using this calculation, the number of days needed to estimate a person's energy intake to within 20% of his true mean, 95% of the time, would be 4.7 days (cvwei calculated from the 5-day edr). Therefore, only participants who completed at least five days of the dietary record were included in the analysis and intakes were calculated from the first five consecutive days available . Usual intakes of energy, water, 10 macronutrients (protein, fat, saturated fatty acids (sfa), mono - unsaturated fatty acids (mufa), poly - unsaturated fatty acids (pufa), carbohydrates, starch, simple sugars, fibres, alcohol) and seven micronutrients (cholesterol, thiamine, riboflavin, ascorbic acid, potassium, calcium, iron) were calculated . Therefore, food codes of the exported files from the 24hr and edr were linked to food composition databases (fcdb). In total, five fcdb were used: (1) a belgian database for regular foods (nubel) (13); (2) a specific database with only brand foods (www.internubel.be) (14); (3) a database from the netherlands (nevo) (15); (4) a uk database (mccance and widdowson's) (16); and (5) a local fcdb (17). Selection of a fcdb for any given food was based on the best proximate in those food composition databases . However, priority was given to the belgian fcdb, followed by the database from the netherlands and the united kingdom . Finally, for both methods, calculated nutrients of all foods were aggregated on a day level . For both methods (24hr and edr), use of food supplements was not taken into account . It is well known that, regardless of the method, self - reported food intake underestimates true food and nutrient intake (18, 19). Data on a persons daily energy expenditure can be used to detect both under - and overreporting in conditions of energy balance because long - term energy expenditure should correspond to energy intake . Accelerometers are motion sensors which provide objective information on daily physical activity with minimal burden for participants . The motion sensors used in this study are piezo - electric uniaxial accelerometers (the computer science and applications, inc . ; csa, model 7164) which are able to distinguish between regular body movement and other sources of movement like external vibrations . Participants were instructed to remove the accelerometer for bathing, swimming activities, high contact sports and during sleeping . In addition, participants were requested to keep a diary for registration of duration and type of activity performed when the accelerometer was not worn . Accelerometers had to be worn for a minimum of 10 hours a day during at least four days . Reader interface unit. For adults, classification of 1-min epochs into the following three categories, resting / light, moderate and vigorous intensity categories was performed using cut - offs proposed by swartz and colleagues (20). These cut - offs were chosen because both type of activity and age of participants resembled best our adult study sample . The categories of intensity of activity correspond to the ratios of work metabolic rate to resting metabolic rate (metabolic equivalents; mets) <3, 35.99 and> 6, respectively . The specific count ranges used to classify activity as resting / light, moderate and vigorous intensity, respectively, were in adults and elderly as follows: 0573, 5744,944,> 4,945 (20). In adolescents for every age - category (15, 16 and 17 years), the corresponding age specific counts per minute for 3, 6 and 9 mets were calculated using a derivative of the equation proposed by freedson and colleagues (21). Counts per minute are given by the equation: countsmin=(met2.757 + 0.0895a)/(0.00150.000038a) with met being the met value for which the corresponding counts per minute need to be calculated and a the age of the respective age category expressed in years . Activity levels expressed in mets were assigned to all activities reported in the activity log using the compendium of physical activities from ainsworth (22). Then, data from csa and activity log were summed in such a way that for every participant, total time (expressed per minute) spent at the four different physical activity levels (resting to vigorous) was obtained . Subsequently, total energy expenditure (tee) per intensity category was calculated using the formula: tee (kcal)=body weight (kg)total minutes of activity (min. )met - value/60 . Self - reported body weight was taken from the general questionnaire . Because activity levels only correspond to certain ranges of mets, a mean met value was used as follows: inactivity, 1 mets; light activity: 2 mets; moderate activity: 4.5 mets and vigorous activity: 7.5 mets . In weight stable conditions, participants reported ei should accord to their tee, thus the ratio of both measures should be equal to 1 . Values above or below the 95% confidence limits of the ratio were taken to indicate over- or underreporting, respectively, using the equation from black & cole (23). The mean within - person coefficient of variation for daily energy intake (cvwei) was calculated from the edr and the 24hr data and number of days (d) was set to 5 and 2 respectively . The within - person coefficient of variation for energy expenditure was taken from an analysis of studies with repeated doubly labelled water (dlw) measurements and set to 8.2% (24). The correlation (r) between ei and ee from accumulated individual dlw data however, from a statistical point of view, three main factors can be identified including between - subject variability, within - subject variability and measurement error (26). Correcting for within - subject variability gives a better estimate of the population distribution for usual intake, especially for episodically consumed foods and nutrients . To estimate usual nutrient intake distributions from short - term dietary intake assessments, c - side (software for intake distribution estimation) was used to remove within - subject variability and transform the data to an approximately normal distribution (5, 6, 27). During this procedure, the differences between mean intakes of nutrients for both methods were assessed using student's t - tests . For this, adjusted sample means and standard deviations were used . Agreement of both methods was evaluated using spearman correlations on unadjusted data . Because the null hypothesis of the spearman correlation assumes that the ranks of one variable do not co - vary with the ranks of the other variable, which seems unlikely because both methods measure the same variables, weighted kappa correlations were also calculated . For all nutrients, kappa correlations between both methods were compared by gender after fisher r - to - z transformation . All statistical tests were performed using spss for windows release 18.0.0 (spss inc ., chicago, il, usa), two - tailed and p <0.05 was considered as statistically significant . Using a cross - sectional design, recorded food intake was compared with recalled food intake . Two computer - assisted 24hr interviews were performed in the participant's home with a 28 week interval . In the planning of the interviews, an equal distribution of the different days of the week was considered . Both interviews were performed by dietitians trained to use epic - soft . Between the first and second interview, after the second 24hr interview, participants were instructed on how to complete a pre - structured 7-day edr . After the 7-day registration, the dietitians visited the participants once more to collect the records and check them for completeness and correctness . A sub - sample was provided with an accelerometer and instructed on how to wear it . This study was conducted according to the guidelines laid down in the declaration of helsinki and all procedures involving human subjects were approved by the regional ethics committee of ghent university hospital . Written informed consent was obtained from all subjects . A different approach for recruiting participants was performed for adolescents, adults and elderly . In adolescents, firstly, five secondary schools providing both general education as vocational training were contacted in the region of ghent . Subsequently, parent's permission was asked by written request . Because, selection of classes and communication with parents was performed by the school's administration adults invited for participation were acquaintances and family of students and researchers, elderly were recruited via social service centres . Elderly living in a residential care setting were excluded given the more limited freedom in food choices . During a 24hr, the participants need to report the types and quantities of all foods and beverages consumed during the preceding day . Preferably interviews are carried out by a trained dietitian . Due to within - subject variation, a single 24hr is not able to offer a critically valid estimate of one's usual dietary intake (3). Performing two non - consecutive 24hr allows for important correction for within - subject variability in nutrient intake (57). Because a 24hr is an open - ended interview, this type of data collection requires standardisation . Epic - soft is a computerised 24hr program suitable for obtaining dietary information in national food consumption surveys (8). The 24hr interview performed with epic - soft is divided into four main steps: (1) general non - dietary information; (2) quick list (chronological list of consumed foods and recipes); (3) description and quantification of foods and recipes; and (4) quality controls at nutrient level . Entering foods in chronological order of consumption and the use of probing questions supports the respondent's memory (2). Quantification of foods was possible using weights or volumes, food photographs from the epic - soft picture book (9), household measures, standard units and standard portions from the belgian household weights and measures manual (10). After data collection, all foods with their characteristics including a food code were exported from epic - soft for future linking . Structured open - ended diaries containing predefined food groups (including the option other food items) at six food occasions (breakfast, lunch, dinner and three snacks) were provided to all subjects . The diary also contained a written example for future reference . During a 7-day period, all consumed foods and drinks had to be reported with notification of date and place of consumption, estimated consumed quantity expressed as a household measure, unit or weight, specification and if present a brand name . Separate forms were included to report on homemade recipes so name of dish, total quantities of all ingredients and fraction of dish consumed could be stated . Foods reported in the 5-day edr were entered in the diet entry & storage program (becel) (11) using a standardised set of food codes and exported for further linking . The number of days necessary to estimate true energy intake can be calculated as n=[(1.96cvwei)/d0] where d0 is the specified% of the true mean and cvwei is the within - person coefficient of variation (12). Using this calculation, the number of days needed to estimate a person's energy intake to within 20% of his true mean, 95% of the time, would be 4.7 days (cvwei calculated from the 5-day edr). Therefore, only participants who completed at least five days of the dietary record were included in the analysis and intakes were calculated from the first five consecutive days available . Usual intakes of energy, water, 10 macronutrients (protein, fat, saturated fatty acids (sfa), mono - unsaturated fatty acids (mufa), poly - unsaturated fatty acids (pufa), carbohydrates, starch, simple sugars, fibres, alcohol) and seven micronutrients (cholesterol, thiamine, riboflavin, ascorbic acid, potassium, calcium, iron) were calculated . Therefore, food codes of the exported files from the 24hr and edr were linked to food composition databases (fcdb). In total, five fcdb were used: (1) a belgian database for regular foods (nubel) (13); (2) a specific database with only brand foods (www.internubel.be) (14); (3) a database from the netherlands (nevo) (15); (4) a uk database (mccance and widdowson's) (16); and (5) a local fcdb (17). Selection of a fcdb for any given food was based on the best proximate in those food composition databases . However, priority was given to the belgian fcdb, followed by the database from the netherlands and the united kingdom . Finally, for both methods, calculated nutrients of all foods were aggregated on a day level . For both methods (24hr and edr), use of food supplements was not taken into account . It is well known that, regardless of the method, self - reported food intake underestimates true food and nutrient intake (18, 19). Data on a persons daily energy expenditure can be used to detect both under - and overreporting in conditions of energy balance because long - term energy expenditure should correspond to energy intake . Accelerometers are motion sensors which provide objective information on daily physical activity with minimal burden for participants . The motion sensors used in this study are piezo - electric uniaxial accelerometers (the computer science and applications, inc . ; csa, model 7164) which are able to distinguish between regular body movement and other sources of movement like external vibrations . Participants were instructed to remove the accelerometer for bathing, swimming activities, high contact sports and during sleeping . In addition, participants were requested to keep a diary for registration of duration and type of activity performed when the accelerometer was not worn . Accelerometers had to be worn for a minimum of 10 hours a day during at least four days . Reader interface unit. For adults, classification of 1-min epochs into the following three categories, resting / light, moderate and vigorous intensity categories was performed using cut - offs proposed by swartz and colleagues (20). These cut - offs were chosen because both type of activity and age of participants resembled best our adult study sample . The categories of intensity of activity correspond to the ratios of work metabolic rate to resting metabolic rate (metabolic equivalents; mets) <3, 35.99 and> 6, respectively . The specific count ranges used to classify activity as resting / light, moderate and vigorous intensity, respectively, were in adults and elderly as follows: 0573, 5744,944,> 4,945 (20). In adolescents for every age - category (15, 16 and 17 years), the corresponding age specific counts per minute for 3, 6 and 9 mets were calculated using a derivative of the equation proposed by freedson and colleagues (21). Counts per minute are given by the equation: countsmin=(met2.757 + 0.0895a)/(0.00150.000038a) with met being the met value for which the corresponding counts per minute need to be calculated and a the age of the respective age category expressed in years . Activity levels expressed in mets were assigned to all activities reported in the activity log using the compendium of physical activities from ainsworth (22). Then, data from csa and activity log were summed in such a way that for every participant, total time (expressed per minute) spent at the four different physical activity levels (resting to vigorous) was obtained . Subsequently, total energy expenditure (tee) per intensity category was calculated using the formula: tee (kcal)=body weight (kg)total minutes of activity (min. )met - value/60 . Self - reported body weight was taken from the general questionnaire . Because activity levels only correspond to certain ranges of mets, a mean met value was used as follows: inactivity, 1 mets; light activity: 2 mets; moderate activity: 4.5 mets and vigorous activity: 7.5 mets . In weight stable conditions, participants reported ei should accord to their tee, thus the ratio of both measures should be equal to 1 . Values above or below the 95% confidence limits of the ratio were taken to indicate over- or underreporting, respectively, using the equation from black & cole (23). The mean within - person coefficient of variation for daily energy intake (cvwei) was calculated from the edr and the 24hr data and number of days (d) was set to 5 and 2 respectively . The within - person coefficient of variation for energy expenditure was taken from an analysis of studies with repeated doubly labelled water (dlw) measurements and set to 8.2% (24). The correlation (r) between ei and ee from accumulated individual dlw data many factors contribute to the variance of food and nutrient intake data . However, from a statistical point of view, three main factors can be identified including between - subject variability, within - subject variability and measurement error (26). Correcting for within - subject variability gives a better estimate of the population distribution for usual intake, especially for episodically consumed foods and nutrients . To estimate usual nutrient intake distributions from short - term dietary intake assessments, c - side (software for intake distribution estimation) was used to remove within - subject variability and transform the data to an approximately normal distribution (5, 6, 27). During this procedure, the differences between mean intakes of nutrients for both methods were assessed using student's t - tests . For this, adjusted sample means and standard deviations were used . Agreement of both methods was evaluated using spearman correlations on unadjusted data . Because the null hypothesis of the spearman correlation assumes that the ranks of one variable do not co - vary with the ranks of the other variable, which seems unlikely because both methods measure the same variables, weighted kappa correlations were also calculated . For all nutrients, kappa correlations between both methods were compared by gender after fisher r - to - z transformation . All statistical tests were performed using spss for windows release 18.0.0 (spss inc ., chicago, il, usa), two - tailed and p <0.05 was considered as statistically significant . In total, 156 subjects agreed to participate in the study, representing a response rate of 55% in the adults and elderly . The response rate for the adolescents could not be calculated because cluster sampling was used and the total number of adolescents eligible for inclusion from all schools was not known . Almost all participants completed both 24hr (n=155); however, only 100 (64%) were able to complete all 7 days of the food record . This brings the final total to 127 (56% women). The sub - sample provided with accelerometers comprised 106 participants . Table 1 summarizes age and self - reported anthropometric measures of the participants . According to the three age categories, the number of subjects were 18 (14.2%), 51 (40.2%) and 58 (45.7%) for the adolescents, adults and elderly, respectively . Characteristics of the participants total energy intake from foods assessed by both methods was compared to tte calculated from accelerometer data . Tee and the ratio ei / tee with the 95% cis were calculated . For edr and 24hr the mean within - person coefficient of variation for energy (cvwei) was 22.0and 21.6% respectively . The lower and upper ratio cut - offs for edr and 24hr were 0.80 and 1.20; and 0.72 and 1.28, respectively . Fig . 1 summarises classification of participants as underreporter, acceptable reporter or overreporter clustered by method and gender . For both methods, the remaining 35% was more or less distributed over the under- and overreporters categories . For energy intake assessed with the 24hr, the number of underreporters in men was significantly lower compared to women (2 (2)=6.361, p<0.042). Percentage of participants (n=76) classified as underreporter, acceptable reporter and overreporter by the ratio energy intake over total energy expenditure (ei / tee) clustered by gender and method (estimated dietary record; edr (a), 24-hour recall; 24hr (b). The lower and upper ratio cut - offs for edr and 24hr are 0.80 and 1.20; and 0.72 and 1.28, respectively . * number of underreporters in men was significantly lower compared to women (22= 6.361, p=0.042)). Tables 2 and 3 show the usual mean daily macro- and micronutrient intakes assessed using both methods . Also ratios of 24hr / edr, p - values for differences using t - tests and spearman correlation coefficients are presented . Ratios vary over nutrients and gender; however, in general positive ratios were found indicating higher intake estimates in the 24hr compared to the edr . Negative ratios were found for fibre in the total sample and both genders, for protein and potassium in women only, for simple sugars in men only and for water and riboflavin in the total sample and women only . Mean usual intakes, p - values for t - tests, ratios and spearman correlations of macronutrients by both methods . Figures representing total sample are additionally adjusted for gender note: edr, 5-day estimated dietary record; 24hr, 2-day 24-hour recall . Spearman correlation coefficient . On consumption days only (nob, number of observations, nind, number of individuals), there is a significant difference between the two methods for fat, fatty acids, cholesterol and alcohol, for the micronutrients the difference was significant for vitamin c, thiamine, riboflavin and iron . The spearman correlation coefficients range from 0.35 to 0.70 for macronutrients and from 0.16 to 0.56 for micronutrients . Mean usual intakes, p - values for t - tests, ratios and spearman correlations of micronutrients by both methods . Figures representing total sample are additionally adjusted for gender edr, 5-day estimated dietary record; 24hr, 2-day 24-hour recall . Table 4 shows weighted kappa correlations between both methods based on correct ranking of participants into tertiles . The strength of agreement, as proposed by altman (28), was moderate for carbohydrates and water (0.42 and 0.54, respectively), to fair for protein, fat and alcohol (0.29, 0.36 and 0.31, respectively). For micronutrients, agreement for thiamine and calcium was found to be poor (0.10 and 0.17, respectively). Kappa correlations were significantly higher in men compared to women for total energy, mufa, carbohydrates, simple sugars and alcohol . Agreement between edr and 24hr by ranking of participants in tertiles expressed as weighted kappa coefficients with 95% confidence intervals note: edr, 5-day estimated dietary record; 24hr, 2-day 24-hour recall . Kappa correlation coefficient significantly different from women (fisher r - to - z test, 1-sided). Positive alcohol consumption in both methods only (nind: number of individuals). The objective of this study was to compare nutrient intakes collected by two non - consecutive 24hr using epic - soft against a 5-day edr to assess its relative validity for use in belgian food consumption surveys . The number of days from seven to five increased the number of available records to 127 . The authors decided to use the first five consecutive days from the edr in the analysis . Total energy intake from all 7 days was compared, and although the median from day 7 was the lowest, no significant differences between days were found (unpublished observations). Looking at the estimates of nutrient intakes obtained by both methods, some differences can be found . In general, there is a tendency of higher estimates by the 24hr compared to the edr . Positive 24hr / edr ratios were also found in other studies comparing 24hr and edr (29, 30). Other studies found negative ratios which were attributed to the omission of foods and errors in portion size estimations related to recalled intake (31). The edr was chosen as a relative reference method because of its acceptable level of accuracy when validated for assessing dietary intake compared to other methods (32). Moreover, the measurement errors of the edr and the 24hr are independent, because unlike the 24hr method, the edr does not depend on memory and involves immediate estimation of portion size . However, like any dietary assessment method, the edr is subject to some degree of misreporting . The degree of under- and/or overreporting in this study was assessed in a sub - sample (n=76) by comparison of energy intake in both methods against tee calculated from accelerometer data . The type of accelerometer (csa) used in this study has repeatedly been tested (21, 33, 34) and has shown to correlate significantly with doubly labelled water - derived energy expenditure estimations (35, 36). Nevertheless, not all physical activity can be translated into acceleration or deceleration resulting in errors in predicted energy expenditure especially in high intensity activity (35). In addition, some literature suggests that csa sensors are not sufficiently sensitive to quantify energy expenditure in free - living individuals (37). Participating in a study with a large battery of methods tested is very demanding and needs motivation . Therefore, it is likely that characteristics of participants are different than those from non - participants . When comparing body mass index (bmi) of the participants in the present sample with the bmi of those recruited during the belgian food consumption survey, a lower bmi is found in the present sample . Consequently, this observation may indicate that a sampling bias is present weakening the generalisability of the instrument's performance in a national nutrition survey context . In spite of these limitations, prevalence of underreporting for both the 24hr and edr has shown to be quite similar to those available in the literature (19). Also, the higher prevalence of underreporting in women versus men, found in other published studies was confirmed in this study (3840). A possible explanation for the fact that in the 24hr, prevalence of underreporting in men was significantly lower than in women could be that an interviewer - guided recall in men provides more complete daily intakes than those based on self - reported food records . Compared to dlw measurements, underestimation of tee assessed using csa devices has been found, even though rather small (25368 kj / day) (41). Consequently, if underestimation of tee is the case, it also implies underestimation of underreporting and overestimation of overreporting of the dietary intake assessment instruments under study . A major strength of this study is that nutrient intake data have been corrected for within - person day - to - day variability using a statistical model . Other studies have used the arithmetic mean of daily intakes to estimate a persons usual intake; however, this approach is likely to be inaccurate because the presence of the day - to - day variability can greatly inflate the variance of the distribution of individual means (42). Correcting for within - person day - to - day variability using statistical models produces comparable means for nutrient intake compared to unadjusted data; however, the distributions of intakes show smaller standard deviations which in turn decrease the odds of finding a different mean intake between both methods by chance alone . With respect to the positive recall / record ratio of total fat (1.26) and, by extension, fatty acids and energy, it should be mentioned that during the epic - soft - guided 24hr, participants are frequently prompted for missing ingredients such as fats or sauces . Also, because of the presence of facets and descriptors in the epic - soft program (43), for instance related to facets such as cooking method, fat content and type of fat used, the 24hr are more likely to yield higher intakes of fat compared to edrs where this information could be omitted by the participant . On the other hand, using standard factors for fat added during cooking another factor which could explain the differences in mean usual intake between the two methods is related to portion size estimation . During the 24hr interview, food photographs were used in addition to other quantification methods . Using two - dimensional models for portion size estimation can result in errors due to poor conceptualisation and perception . In a recent study, participants capability in estimating portion sizes of fat on bread using the epic - soft picture book was evaluated and showed high overestimation of portion sizes by both genders during perception testing (prevalence of overestimation was 90%) (44). The number of days from seven to five increased the number of available records to 127 . The authors decided to use the first five consecutive days from the edr in the analysis . Total energy intake from all 7 days was compared, and although the median from day 7 was the lowest, no significant differences between days were found (unpublished observations). Looking at the estimates of nutrient intakes obtained by both methods, some differences can be found . In general, there is a tendency of higher estimates by the 24hr compared to the edr . Positive 24hr / edr ratios were also found in other studies comparing 24hr and edr (29, 30). Other studies found negative ratios which were attributed to the omission of foods and errors in portion size estimations related to recalled intake (31). The edr was chosen as a relative reference method because of its acceptable level of accuracy when validated for assessing dietary intake compared to other methods (32). Moreover, the measurement errors of the edr and the 24hr are independent, because unlike the 24hr method, the edr does not depend on memory and involves immediate estimation of portion size . However, like any dietary assessment method, the edr is subject to some degree of misreporting . The degree of under- and/or overreporting in this study was assessed in a sub - sample (n=76) by comparison of energy intake in both methods against tee calculated from accelerometer data . The type of accelerometer (csa) used in this study has repeatedly been tested (21, 33, 34) and has shown to correlate significantly with doubly labelled water - derived energy expenditure estimations (35, 36). Nevertheless, not all physical activity can be translated into acceleration or deceleration resulting in errors in predicted energy expenditure especially in high intensity activity (35). In addition, some literature suggests that csa sensors are not sufficiently sensitive to quantify energy expenditure in free - living individuals (37). Participating in a study with a large battery of methods tested is very demanding and needs motivation . Therefore, it is likely that characteristics of participants are different than those from non - participants . When comparing body mass index (bmi) of the participants in the present sample with the bmi of those recruited during the belgian food consumption survey, a lower bmi is found in the present sample . Consequently, this observation may indicate that a sampling bias is present weakening the generalisability of the instrument's performance in a national nutrition survey context . In spite of these limitations, prevalence of underreporting for both the 24hr and edr has shown to be quite similar to those available in the literature (19). Also, the higher prevalence of underreporting in women versus men, found in other published studies was confirmed in this study (3840). A possible explanation for the fact that in the 24hr, prevalence of underreporting in men was significantly lower than in women could be that an interviewer - guided recall in men provides more complete daily intakes than those based on self - reported food records . Compared to dlw measurements, underestimation of tee assessed using csa devices has been found, even though rather small (25368 kj / day) (41). Consequently, if underestimation of tee is the case, it also implies underestimation of underreporting and overestimation of overreporting of the dietary intake assessment instruments under study . A major strength of this study is that nutrient intake data have been corrected for within - person day - to - day variability using a statistical model . Other studies have used the arithmetic mean of daily intakes to estimate a persons usual intake; however, this approach is likely to be inaccurate because the presence of the day - to - day variability can greatly inflate the variance of the distribution of individual means (42). Correcting for within - person day - to - day variability using statistical models produces comparable means for nutrient intake compared to unadjusted data; however, the distributions of intakes show smaller standard deviations which in turn decrease the odds of finding a different mean intake between both methods by chance alone . With respect to the positive recall / record ratio of total fat (1.26) and, by extension, fatty acids and energy, it should be mentioned that during the epic - soft - guided 24hr, participants are frequently prompted for missing ingredients such as fats or sauces . Also, because of the presence of facets and descriptors in the epic - soft program (43), for instance related to facets such as cooking method, fat content and type of fat used, the 24hr are more likely to yield higher intakes of fat compared to edrs where this information could be omitted by the participant . On the other hand, using standard factors for fat added during cooking could, in some participants, also result in an overestimation of fat consumption . Another factor which could explain the differences in mean usual intake between the two methods is related to portion size estimation . During the 24hr interview, food photographs were used in addition to other quantification methods . Using two - dimensional models for portion size estimation can result in errors due to poor conceptualisation and perception . In a recent study, participants capability in estimating portion sizes of fat on bread using the epic - soft picture book was evaluated and showed high overestimation of portion sizes by both genders during perception testing (prevalence of overestimation was 90%) (44). The present study shows a similar degree of energy misreporting in both 2-day 24hr and 5-day edrs . For national consumption surveys among the belgian population, group - level intakes of protein, carbohydrates, starch, sugar, water, potassium and calcium from duplicate 24hr do not differ from those obtained by 5-day edrs . This research received no specific grant from any funding agency in the public, commercial or not - for - profit sectors.
The subject population consisted of five male and three female individuals of scandinavian origin, chosen from an orthodontic clinic for the study . All were 10 to 14 years old and had premolars scheduled for extraction due to orthodontic reasons . A total of 23 premolars were used and the premolars had no signs of clinical wsls at baseline . For all scheduled study visits, participants did not brush their teeth the morning prior to sampling and had no breakfast within an hour before sampling . All appointments were scheduled between 9 am and 12 pm . While enrolled in the study, participants brushed their teeth with the non - fluoride toothpaste solidox (lilleborg as, oslo, norway) and did not use any fluoride or antimicrobials, such as chlorhexidine or triclosane . The study was approved by the regional ethics committee (rek sr - st, pb 1130, blindern, oslo, norway). The subjects and their guardians signed an informed consent form before the start of the study . Orthodontic bands with two metal posts (0.8 mm thick) welded onto the inner buccal surface specifically designed for plaque accumulation (16), were banded on premolars destined for extraction during the first visit (fig . Temp bond ne (kerr corporation, orange, ca, usa) was used to cement the bands in place (17). Plaque samples were taken from premolars at baseline (immediately before banding) and at the final visit 7 weeks after banding . A lip spreader was used to isolate the premolars and the buccal surfaces were allowed to air dry before sample collection . The same examiner collected all samples with a sterile orthodontic wire (fig . 1) and immediately suspended each sample in 300 l te buffer (10 mm tris the samples were transported to the laboratory using the nalgenetm labtop cooler (20c), before placing them at 80c until further processing . For baseline sampling, the buccal enamel surface where the band would be placed was sampled with a probe . At the final visit, the probe was inserted into the space between the band and the buccal tooth surface and the plaque sample was collected from the enamel surface . After collecting the sample at the final visit, the examiner extracted the premolars and the orthodontic treatment was continued as planned by the orthodontist . The buccal surface of the extracted premolars was carefully cleaned with water, air dried and then the buccal lesion was given a score in the following manner (fig . 2): no wsls=1, minor wsls=2 and severe wsls=3 (18). Resulting white spot lesion after 7 weeks of plaque retention . Dna was isolated from clinical samples using a ready - lyse lysozyme solution (epicentre) for overnight incubation before using a masterpure dna purification kit (epicentre) according to the manufacturer's directions . Purified dna samples were analyzed using homim, which was developed to simultaneously detect 300 of the most prevalent oral bacterial species . Briefly, 16s rrna - based, reverse - capture oligonucleotide probes (typically 1820 bases) were printed on aldehyde - coated glass slides . 16s rrna genes were pcr amplified from dna extracts using 16s rrna universal forward and reverse primers and labeled via incorporation of cy3-dctp in a second nested pcr . After washing, the microarray slides were scanned using an axon 4000b scanner and crude data were extracted using genepix pro software . Microbial community profiles were generated from image files of scanned homim arrays using a homim online analysis tool (available at: http://bioinformatics.forsyth.org/homim/). The detection of a particular taxon in a sample was determined by the presence of a fluorescent spot for that unique probe . A mean intensity for each taxon was calculated from the hybridization spots of the same probe and the signals were normalized and calculated as previously described (15). The range of signal levels was obtained by raising normalized signal intensities to the power of 0.3 . Any original signal that was less than two times the background value was reset to 1 and was assigned to the signal level 0; indicating absence of a particular taxon in a sample . The remaining signals, those greater than 1, were categorized into scores from 1 to 5; corresponding to different signal levels . To determine how bacterial community composition varied across samples, we compared total hybridization profiles obtained by homim arrays for each sample using correspondence analysis (coa) in mev 4.6 (19). Analysis was performed on the absolute intensity of homim data (frequency of scores from 0 to 5) as well as binary data (presence / absence). Wilcoxon rank sum test and t - test were used to identify statistically significant differences between groups (baseline and final visit; wsls 1, 2 and 3; and plaque indices 0, 1 and 2). A p - value of <0.05 was considered significant . False discovery rate (fdr) using benjamini - hochberg correction was used to control for multiple hypothesis . For the cluster analysis, jmp 9.0 (www.jmp.com/) and r statistical package (www.r-project.org/) were used in statistical analyses . The subject population consisted of five male and three female individuals of scandinavian origin, chosen from an orthodontic clinic for the study . All were 10 to 14 years old and had premolars scheduled for extraction due to orthodontic reasons . A total of 23 premolars were used and the premolars had no signs of clinical wsls at baseline . For all scheduled study visits, participants did not brush their teeth the morning prior to sampling and had no breakfast within an hour before sampling . All appointments were scheduled between 9 am and 12 pm . While enrolled in the study, participants brushed their teeth with the non - fluoride toothpaste solidox (lilleborg as, oslo, norway) and did not use any fluoride or antimicrobials, such as chlorhexidine or triclosane . The study was approved by the regional ethics committee (rek sr - st, pb 1130, blindern, oslo, norway). The subjects and their guardians signed an informed consent form before the start of the study . Orthodontic bands with two metal posts (0.8 mm thick) welded onto the inner buccal surface specifically designed for plaque accumulation (16), were banded on premolars destined for extraction during the first visit (fig . Temp bond ne (kerr corporation, orange, ca, usa) was used to cement the bands in place (17). Plaque samples were taken from premolars at baseline (immediately before banding) and at the final visit 7 weeks after banding . A lip spreader was used to isolate the premolars and the buccal surfaces were allowed to air dry before sample collection . The same examiner collected all samples with a sterile orthodontic wire (fig . 1) and immediately suspended each sample in 300 l te buffer (10 mm tris the samples were transported to the laboratory using the nalgenetm labtop cooler (20c), before placing them at 80c until further processing . For baseline sampling, the buccal enamel surface where the band would be placed was sampled with a probe . At the final visit, the probe was inserted into the space between the band and the buccal tooth surface and the plaque sample was collected from the enamel surface . After collecting the sample at the final visit, the examiner extracted the premolars and the orthodontic treatment was continued as planned by the orthodontist . The buccal surface of the extracted premolars was carefully cleaned with water, air dried and then the buccal lesion was given a score in the following manner (fig . 2): no wsls=1, minor wsls=2 and severe wsls=3 (18). Resulting white spot lesion after 7 weeks of plaque retention . Dna was isolated from clinical samples using a ready - lyse lysozyme solution (epicentre) for overnight incubation before using a masterpure dna purification kit (epicentre) according to the manufacturer's directions . Purified dna samples were analyzed using homim, which was developed to simultaneously detect 300 of the most prevalent oral bacterial species . Briefly, 16s rrna - based, reverse - capture oligonucleotide probes (typically 1820 bases) were printed on aldehyde - coated glass slides . 16s rrna genes were pcr amplified from dna extracts using 16s rrna universal forward and reverse primers and labeled via incorporation of cy3-dctp in a second nested pcr . After washing, the microarray slides were scanned using an axon 4000b scanner and crude data were extracted using genepix pro software . Microbial community profiles were generated from image files of scanned homim arrays using a homim online analysis tool (available at: http://bioinformatics.forsyth.org/homim/). The detection of a particular taxon in a sample was determined by the presence of a fluorescent spot for that unique probe . A mean intensity for each taxon was calculated from the hybridization spots of the same probe and the signals were normalized and calculated as previously described (15). The range of signal levels was obtained by raising normalized signal intensities to the power of 0.3 . Any original signal that was less than two times the background value was reset to 1 and was assigned to the signal level 0; indicating absence of a particular taxon in a sample . The remaining signals, those greater than 1, were categorized into scores from 1 to 5; corresponding to different signal levels . To determine how bacterial community composition varied across samples, we compared total hybridization profiles obtained by homim arrays for each sample using correspondence analysis (coa) in mev 4.6 (19). Analysis was performed on the absolute intensity of homim data (frequency of scores from 0 to 5) as well as binary data (presence / absence). Wilcoxon rank sum test and t - test were used to identify statistically significant differences between groups (baseline and final visit; wsls 1, 2 and 3; and plaque indices 0, 1 and 2). A p - value of <0.05 was considered significant . False discovery rate (fdr) using benjamini - hochberg correction was used to control for multiple hypothesis . For the cluster analysis, jmp 9.0 (www.jmp.com/) and r statistical package (www.r-project.org/) were used in statistical analyses . At the end of seven weeks at the final visit, 75% of the premolars had developed wsls on their buccal surfaces underneath the retention band (fig . 2). There was a clear shift of the microbiota from plaque found on sound enamel (baseline) as compared to plaque retained after seven weeks (final visit). Microbial communities at baseline were found to be significantly different (p<0.001; t test) from the microbial communities at the final visit (figs . 3 and 4). Signature for each individual; samples from the same individual, in general, were more similar to one another than when taken from two different individuals (fig . Plot of correspondence analysis (ca) of the enamel bacterial community using binary data (presence / absence). Only communities with data for both the baseline and final visit are plotted and labeled by color according to visit . The baseline samples are labeled with solid circles; samples from the final visit (7 weeks later) are labeled with open circles . Microbial communities from the baseline visit are significantly different (p<0.001; t test) from the final visit . Mean frequencies of bacterial probes that were significantly different (p<0.05; wilcoxon test) among subjects at baseline and final visit . * indicates adjusted p (benjamini / hochberg) values p<0.01 and * * p<0.001 . Fourteen bacterial taxa were found to be prevalent in plaque covering sound enamel at baseline (p<0.01; fig . The most commonly detected species in greater than 80% of samples were gemella morbillorum, kingella oralis and capnocytophaga granulosa . All but campylobacter concisus and campylobacter showae are capable of fermenting carbohydrates to acid, although c. concisus and c. showae can produce acetate and or succinate with formate and fumarate in the culture medium (20). Twenty - five bacterial species were significantly increased in plaque behind the retaining bands after seven weeks (fig . 4). Many of these species have been previously associated with caries development, such as streptococcus mutans, other species of streptococcus and species of lactobacillus . Other species less known to be associated with caries development included atopobium parvulum, dialister invisus, and species of prevotella and scardovia . Of note, 25% of teeth did not develop a lesion after seven weeks . Consequently, we compared the changes in microbiota on pairs of samples between baseline and for those samples that did not develop a lesion . For this small sample size, there were no taxa that were significantly more prevalent at baseline or at the final visit . The average number of taxa for plaque index 0, 1 and 2 was 38.50, 44.13 and 53.68, respectively . The wilcoxon signed - rank test was used for each pair; plaque indices 0 and 2 were compared: p - value=0.0014, and plaque indices 1 and 2: p - value=0.0247 . There were differences in the prevalence of specific taxa in supragingival plaque taken from wsl 1 sites as compared to supragingival plaque from wsl 3 sites at the final visit . Ot136/ot148, megasphaera micronuciformis, and selenomonas sputigena, were more prevalent in wsl 1 samples (no lesions), (p<0.01). However, due to the low number of samples (n), the results were not significant (e.g. P>0.05) when adjusted for multiple comparisons . At the end of seven weeks at the final visit, 75% of the premolars had developed wsls on their buccal surfaces underneath the retention band (fig . 2). There was a clear shift of the microbiota from plaque found on sound enamel (baseline) as compared to plaque retained after seven weeks (final visit). Microbial communities at baseline were found to be significantly different (p<0.001; t test) from the microbial communities at the final visit (figs . 3 and 4). Signature for each individual; samples from the same individual, in general, were more similar to one another than when taken from two different individuals (fig . Plot of correspondence analysis (ca) of the enamel bacterial community using binary data (presence / absence). Only communities with data for both the baseline and final visit are plotted and labeled by color according to visit . The baseline samples are labeled with solid circles; samples from the final visit (7 weeks later) are labeled with open circles . Microbial communities from the baseline visit are significantly different (p<0.001; t test) from the final visit . Mean frequencies of bacterial probes that were significantly different (p<0.05; wilcoxon test) among subjects at baseline and final visit . * indicates adjusted p (benjamini / hochberg) values p<0.01 and * * p<0.001 . Fourteen bacterial taxa were found to be prevalent in plaque covering sound enamel at baseline (p<0.01; fig . The most commonly detected species in greater than 80% of samples were gemella morbillorum, kingella oralis and capnocytophaga granulosa . All but campylobacter concisus and campylobacter showae are capable of fermenting carbohydrates to acid, although c. concisus and c. showae can produce acetate and or succinate with formate and fumarate in the culture medium (20). Twenty - five bacterial species were significantly increased in plaque behind the retaining bands after seven weeks (fig . 4). Many of these species have been previously associated with caries development, such as streptococcus mutans, other species of streptococcus and species of lactobacillus . Other species less known to be associated with caries development included atopobium parvulum, dialister invisus, and species of prevotella and scardovia . Of note, 25% of teeth did not develop a lesion after seven weeks . Consequently, we compared the changes in microbiota on pairs of samples between baseline and for those samples that did not develop a lesion . For this small sample size, there were no taxa that were significantly more prevalent at baseline or at the final visit . The average number of taxa for plaque index 0, 1 and 2 was 38.50, 44.13 and 53.68, respectively . The wilcoxon signed - rank test was used for each pair; plaque indices 0 and 2 were compared: p - value=0.0014, and plaque indices 1 and 2: p - value=0.0247 . There were differences in the prevalence of specific taxa in supragingival plaque taken from wsl 1 sites as compared to supragingival plaque from wsl 3 sites at the final visit . Ot136/ot148, megasphaera micronuciformis, and selenomonas sputigena, were more prevalent in wsl 1 samples (no lesions), (p<0.01). However, due to the low number of samples (n), the results were not significant (e.g. P>0.05) when adjusted for multiple comparisons . The results clearly showed an ecological shift in dental plaque over developing wsls in enamel . Many bacterial species, including typical caries - associated species such as s. mutans and lactobacillus spp ., increased with the development of wsls . Consequently, the bacterial community composition associated with the progression of wsl is specific and much more complex than previously believed and should be explored in future studies . Our results not only confirmed previous studies (6, 8, 10, 11), but additional species or phylotypes that were significantly associated with the longitudinal progression of caries in the secondary dentition were identified (table 1) (10). Comparison of statistically significant bacterial taxa associated with carious lesions in the secondary dentition many of the bacterial species found to be increased in plaque covering sound enamel and in plaque behind the plaque retaining bands are capable of producing acid . Bacteria capable of producing caries need to be both acidogenic (able to produce acid) and aciduric (able to survive in an acid environment) (21). It is noteworthy that non - mutans streptococci, such as those found in wsls, are capable of acidogenesis at low ph and typically outnumber mutans streptococci . Consequently, several species of non - mutans streptococcus have been implicated in caries production (13). Indeed, in this study several species or phylotypes were significantly more prevalent in wsls (fig . Our results provided strong evidence in support of the ecological plaque hypothesis, that is, enamel caries develops due to changes in local environmental conditions (plaque retaining bands), which disrupt the natural balance between plaque and the host, leading to enrichment of organisms that can potentially cause caries . In addition, our results showed that many bacterial species other than s. mutans and lactobacilli are associated with caries in vivo . In summary, the bacterial diversity of the predominant oral microbiota associated with development of cariogenic lesions was determined using homim in an in vivo model . Our results indicate that the microbiota on intact enamel was significantly different from that of the microbiota associated with wsls developed for seven weeks under protected metal bands . The microbial communities in dental plaque associated with caries included species of the genera acidaminococcaceae, streptococcus, lactobacillus, veillonella, prevotella, solobacterium, scardovia, and atopobium . Some of these were associated with the increasing severity of wsls such as s. wiggsiae, s. salivarius and v. atypica and might play important roles in the process of caries development . The in vivo model of microbial community succession provided novel insights into the microbial community shifts associated with the development of wsls, and likely dental caries . Consequently, this model can be used to study the efficacy of treatment or perturbations, such as diet, antibiotics, and other prophylactic and restorative treatments, and may help design more effective interventions and preventions . There is no conflict of interest in the present study for any of the authors.
The study base included all residents in the city of torino (900,000 inhabitants), aged 20 years, with a diagnosis of diabetes, and alive as at 31 july 2003 . As described in detail elsewhere (12), patients were identified using three data sources: the file of subjects registered in the regional diabetes registry (rdr), the file of prescriptions for antidiabetes drugs, and the file of hospital discharges with a diagnosis of diabetes . All data sources were matched by a deterministic linkage procedure using a unique identifier and were linked to the torino population register to determine each individual's educational level . This was classified according to three levels: high (university / high school, i.e., 13 years of education), medium (middle school, up to 12 years of education), and low (primary school / no formal education, i.e., 8 years of education). Census tract median income data were used as a proxy of individual income and calculated through record linkage between the torino population register and the 1998 tax register of the ministry of finance . The 3,419 census tracts (median number of 207 inhabitants) were grouped according to census tract median income percentiles into four income levels: low (<20th percentile; median level income 21,313), medium - low (20th49th percentile; 24,085), medium - high (50th79th percentile; 26,604), and high (80th percentile; 34,074) (17). We considered all those discharged from a hospital in the previous 5 years with a diagnosis of coronary heart disease (icd-9-cm code 410414), cerebrovascular disease (icd-9-cm code 430438), or disease of arteries (icd-9-cm code 440448) as individuals with established cardiovascular disease (cvd). Treatment was classified into three groups: diet only, oral antidiabetes drugs, and insulin . Information about therapy was retrieved from the rdr and, for patients not registered in the rdr, from prescriptions of antidiabetes drugs . Subjects who were prescribed both insulin and oral antidiabetes drugs were assigned to insulin treatment; all diabetic individuals who were not registered in the rdr and had not received any antidiabetes drug prescription (1,986 individuals) were considered within the diet - only treatment group . All italian citizens are cared for by a general practitioner (1,100 in torino) as part of the national health system (nhs). Primary care for individuals with diabetes is provided mainly by a public network of 700 diabetes clinics (14 in torino), delivering diagnostic confirmation, therapy, help in prevention, and early diagnosis of complications through close patient follow - up by a team of specialists and the scheduling of regular check - ups . Most patients are referred to these care units by their general practitioner and care is free . All laboratory tests and specialist medical examinations reimbursed by the nhs in the study period were linked to the population with diabetes to identify the following indicators of process of care: assessment of a1c, serum cholesterol (total, hdl, and ldl), microalbuminuria, examination of the eye (including at least one from among ocular examinations, observation of the fundus oculi, and retinography), and electrocardiogram (ecg) (including either an ecg alone or examination by a cardiologist). We also considered measurements of fasting glucose and triglycerides, but these results are not reported as they are similar to those for a1c and cholesterol . (gci) that included assessment of a1c and at least two assessments from among eye examinations, total serum cholesterol, and microalbuminuria . We considered all individuals who had a diabetologic consultation at least once in the follow - up period as cared for by a diabetes center, whereas those who had not were considered as cared for by a general practitioner only . To estimate the number of patients in the latter group who had contact with a general practitioner, they were linked to the drug prescription and laboratory test databases: 99.44% had at least one prescription (i.e., a contact with a general practitioner) in the study period . The proportion of individuals with diabetes receiving diabetes care procedures was estimated using a survival analysis based on kaplan - meier methods, where survival was defined as time from baseline to the date of the first laboratory test or examination . We considered as right - censored 428 individuals who died and 100 who moved out of torino during the study period . The relationship between indicators and explicative variables was investigated using a log - binomial regression model and is presented as prevalence rate ratio (prr). The models included all the variables described above and the local health unit of residence . The models were fitted using proc lifetest and proc genmod by sas (version 9.1). All italian citizens are cared for by a general practitioner (1,100 in torino) as part of the national health system (nhs). Primary care for individuals with diabetes is provided mainly by a public network of 700 diabetes clinics (14 in torino), delivering diagnostic confirmation, therapy, help in prevention, and early diagnosis of complications through close patient follow - up by a team of specialists and the scheduling of regular check - ups . Most patients are referred to these care units by their general practitioner and care is free . All laboratory tests and specialist medical examinations reimbursed by the nhs in the study period were linked to the population with diabetes to identify the following indicators of process of care: assessment of a1c, serum cholesterol (total, hdl, and ldl), microalbuminuria, examination of the eye (including at least one from among ocular examinations, observation of the fundus oculi, and retinography), and electrocardiogram (ecg) (including either an ecg alone or examination by a cardiologist). We also considered measurements of fasting glucose and triglycerides, but these results are not reported as they are similar to those for a1c and cholesterol . (gci) that included assessment of a1c and at least two assessments from among eye examinations, total serum cholesterol, and microalbuminuria . We considered all individuals who had a diabetologic consultation at least once in the follow - up period as cared for by a diabetes center, whereas those who had not were considered as cared for by a general practitioner only . To estimate the number of patients in the latter group who had contact with a general practitioner, they were linked to the drug prescription and laboratory test databases: 99.44% had at least one prescription (i.e., a contact with a general practitioner) in the study period . The proportion of individuals with diabetes receiving diabetes care procedures was estimated using a survival analysis based on kaplan - meier methods, where survival was defined as time from baseline to the date of the first laboratory test or examination . We considered as right - censored 428 individuals who died and 100 who moved out of torino during the study period . The relationship between indicators and explicative variables was investigated using a log - binomial regression model and is presented as prevalence rate ratio (prr). The models included all the variables described above and the local health unit of residence . The models were fitted using proc lifetest and proc genmod by sas (version 9.1). After 1 year, 71% of subjects had undergone an assessment of a1c, 65% had an assessment of lipids, only 31% had an assessment of microalbuminuria; 33% had undergone an ecg, and 25% had an eye screening test . Sixty - eight percent of patients were seen at least once at a diabetes center . There were almost no differences by sex, whereas all indicators showed large disadvantages among elderly individuals . As for clinical variables, individuals with established cvd had a lower frequency for all indicators, with the exception of ecg . The most striking difference concerned the treatment of diabetes, which was strongly related to process indicators; for all of the assessments considered, their frequency was lowest among patients receiving diet - only treatment and highest among those treated with insulin (table 1). Kaplan - meier estimates for indicators of diabetes care process; 1-year follow - up table 2 reports the results of the multivariate models . Slight sex differences in favor of men were present for eye examination, ecg, and gci . The effect of age differed between measures; a1c and cholesterol assessments increased with age up to the 65- to 74-year age class and decreased in the 75-year age - group . Microalbuminuria and eye examination showed no difference up to the 65- to 74-year age - group and dropped sharply in the last age class . Gci showed mild differences up to the 65- to 74-year age class and decreased sharply in the 75-year age class . Socioeconomic differences were absent or low and, if present, favored the disadvantaged social group . Subjects with previous cvd had a greater prevalence of cardiac tests, but poorer performance for typical diabetes screening tests, especially gci . The strong association between severity of disease and the whole set of indicators was confirmed . Prrs for indicators of diabetes care process; 1 year of follow - up data are prrs (95% ci). Table 3 shows the effect of introducing the diabetologist consultation into the multivariate model of table 2 . Although prrs for almost all indicators remained unchanged, differences by type of treatment were considerably reduced, and the diabetologist consultation emerged as the strongest independent predictor of a better screening process . Prrs for some indicators of diabetes care process after 1 year of follow - up adjusted for diabetologist consultation data are prrs (95% ci). Prrs are reciprocally adjusted for all variables and for local health unit of residence . The interactions between physician (diabetologist or general practitioner) and nearly all the variables considered were statistically significant (p <0.05). Table 4 reports the results of multivariate models in patients cared for by a diabetes center (n = 24,361) and patients cared for by general practitioners (n = 9,092). On the whole, differences among the latter were much greater than those among the former, suggesting a more uniform diagnostic and screening approach at the secondary care level . The most striking differences regarded the type of treatment: differences between patients cared for by a diabetologist were largely inferior to those in patients cared for by general practitioners . Prrs for indicators of diabetes care process, by diabetologist consultation at 1 year of follow - up data are prrs (95% ci). The first important conclusion that can be drawn from our work is that a low - cost surveillance program to monitor the quality of diabetes care process is feasible . Using routinely collected administrative data, we were able to monitor prospectively, at the population level, several indicators that are used internationally to assess the process of care (3,1416) and, consequently, to identify some strengths and weakness of the care system . On the basis of this set of indicators, the present study shows that there are considerable opportunities for improving the management of diabetes, particularly in elderly patients and in those with less severe forms of the disease . A recent survey in> 100 italian diabetes outpatient clinics (15) reported better performance for a1c (91.3%) and lipid measurements (70.3%), but the same low rate of microalbuminuria tests (44.0%) was found . Regarding similarity in europe, in the european core indicators project (16) annual a1c testing ranged from 51% (ireland) to 99% (france and the netherlands), lipid measurements ranged from 45% (ireland) to 99% (the netherlands), and microalbuminuria testing ranged from 25% (finland) to 97% (the netherlands). However, these surveys refer either to patients cared for by diabetes clinics or to selected cohorts and not to the general population of individuals with diabetes . Only a few cross - sectional studies in europe provide insight into the care process at the population level . In a u.k . Population of patients with diabetes, 92% had an a1c recorded within the past 15 months and 87% had a serum cholesterol concentration recorded, whereas the test rate for microalbuminuria was at 39% and retinal screening was 60% (8). Our results are very similar to those reported in the u.s . For medicare beneficiaries at the end of the 1990s for three quality measures: annual a1c testing, biennial eye examination, and biennial lipid profile (4). These levels of care are not shared by the whole of the population with diabetes, with elderly patients being the most disadvantaged . The abnormal fall in the quality of care among elderly patients, which has also been reported in some studies (10) but not in others (4), could be attributable to several factors, including greater difficulty in accessing health services and competing comorbidities that can lead to a less aggressive approach to the disease . On the other hand, we found no difference in the quality of care by socioeconomic position and only a very slight advantage among men . These are original findings as almost all studies, both in europe and in the u.s ., have constantly shown lower quality of care and higher risk of complications from diabetes among women and among individuals of low socioeconomic status (58,10,18). However, these findings are not unexpected as they are in line with previous studies showing substantial equity in the outcomes of care among individuals with diabetes residing in torino (12,19), adding convincing evidence that these patients receive clinical follow - up and care irrespective of their socioeconomic status, a fairly uncommon situation (20). The paradoxical excess of risk in high - income groups could be due to a more frequent recourse to private specialists (not recorded in nhs administrative databases). Regarding clinical determinants, there is an unequivocal relationship between severity of diabetes and intensity of care, whereas, paradoxically, a previous cardiovascular event reduces the attention to diabetes monitoring . It is plausible that because of the presence of cardiovascular complications, the interference of another specialist, less sensitive to this issue, diminishes the intensity of diabetes screening . However, consistently with other studies (1,21), the strongest predictor and effect modifier of the quality of care is the diabetologist . Patients cared for at a diabetes center are more likely to be monitored according to guidelines than patients who are only cared for by other physicians . Our results highlight a severity - of - disease effect, especially among patients not cared for by diabetologists . In primary care, general practitioners are more likely to realize the need for screening when they care for a patient taking insulin . Patients receiving diet treatment and, to a lesser extent, those taking pills are perceived as being at lower risk or sometimes are completely forgotten . Treatment seems to be a reminder of the disease and of the need for clinical assessment . The severity - of - disease effect is almost absent among patients cared for by diabetologists . Moreover, there is no difference by age among patients cared for by diabetologists, except for the oldest age class, whereas among patients who are only cared for by general practitioners, there is a linear inverse association with age and an impressive fall in the quality of care among elderly patients . The main strength of our study is that, through record linkage between several data sources, we included about 80% of the entire population with known diabetes (12) and were able to monitor the care process longitudinally at the population level and at very low cost . Most studies assessing quality of care are based on either selected populations or on more or less large samples, a condition that makes replication difficult and costly, reduces the feasibility of continuous monitoring of care, and delays or invalidates timely interventions to improve it . Available administrative databases do not provide information on whether risk control targets have been met . We were only able to monitor when laboratory tests were performed but have no information about their results . This aspect is relevant because it has been pointed out that better process indicators do not always guarantee better intermediate outcomes (22,23). However, previous analysis conducted in the same area as our study convincingly highlighted the role of secondary care on hard end points such as mortality (24) and hospital admission (2). A second limitation is the lack of information about some relevant screening procedures such as blood pressure measurement, bmi determination, foot examination, and duration of disease, not recorded in administrative databases; the latter, however, should not affect adherence to guidelines . As a proxy of disease severity we used only insulin treatment and cvd; thus, some residual confounding related to diabetes complications or comorbidities can persist, and, furthermore, the accuracy of our conclusions could be affected by not accounting for physician - level variation (both general practitioner and diabetologist) by multilevel modeling (25); unfortunately, an identification key to link physicians with patients was not available . Finally, because torino is an urban area in northern italy and residents have easy access to health services, we cannot assume that our results can be generalized to rural areas or to other regions . In summary, this study provides the first population - based data on quality in the diabetes care process in a large southern european cohort and indicates that, despite the increasing prevalence of diabetes and the widespread availability of up - to - date guidelines and screening procedures, a nonnegligible portion of the diabetic population still do not receive proper care . On the other hand, the good news is that there are no sex or social inequities in health care . Diabetes centers, although with several limitations, seem to perform screening regardless of the severity of disease or other conditions . Conversely, patients who are only cared for by general practitioners are at greater risk of receiving low - quality care, as the physicians may lack sufficient knowledge, decision support, or time to appropriately schedule their patients' annual control examinations . However, it must be highlighted that the purpose of a surveillance system is not to rank doctors but to provide evidence for improvement . Our findings suggest that care provided to patients with diabetes can be improved by increasing the intensity of disease management programs to foster greater participation by general practitioners, thus increasing knowledge and decision support and raising appropriateness.
One of the most important health indicators in each country is maternal health (1, 2). Today, the choice of cesarean section is one of the controversial issues in the health system of countries throughout the world (3). Because of its side effects and insensitivity, tendency for women to go ahead with vaginal delivery has decreased . Due to the naturalness of vaginal delivery, the most favoured method of delivery is vaginal delivery (4). Different factors such as the pregnant women s awareness regarding vaginal delivery, lack of awareness about the complications of cesarean section, fear of vaginal delivery, being encouraged by physician and the reduced role of midwives in training, have led to increased willingness of mothers for cesarean section (5). Moreover, other factors such as maternal age, progress in surgical techniques, social and economic factors, supplemental insurance and health insurance coverage, lack of experienced midwives and lack of training in pregnancy period, have led to decreased willingness of vaginal delivery (6). In recent years, according to the ministry of health data, the rate of cesarean section in iran has increased by 40 to 60% which is three times more than global standards (7). Although, according to who guidelines, the rate of cesarean section should be 515% (8). Complications of unnecessary cesarean section affect the health of the mother and children and increases economic burden . So, elective cesarean section is one of the most important challenges of health systems . It is essential for governments to perform effective changes in maternal health and also decrease the rate of elective cesarean section (9). The uncontrolled increase in the rate of unnecessary cesarean section is a major problem in the health system of iran (8). Hence, a program called the healthcare evolution plan has been implemented in iran since may, 4, 2014 in order to fulfill the goals of the who . (specific goals include health, fairness in financial contribution and meeting the non - treatment expectations of the public). One of the most important packages of this plan was to promote vaginal delivery (10). It was expected that by the end of 2014 the rate of cesarean section would be reduced by as much as 10% (11). Iran was the second highest country in the world to have caesarian section at the start of the project (8). Who guidelines emphasize that countries must improve maternal and infant health, by reducing the rate of cesarean section . The present study was conducted to assess the impact of healthcare reform plans on the rate of vaginal delivery and cesarean section . Furthermore, the frequency and deviation of deliveries in public and private hospitals of provincial capitals were compared . In order to gain suitable strategies for policy makers in shiraz university of medical sciences, a comparison was made on the statistics related to 2013 (one year before implementation of project) and 2014 (one year after implementation of project). The main aim of this study was to examine the impact of the healthcare reform plan on the number of vaginal deliveries and cesarean sections, and its impact on the government adopted policies toward increasing vaginal delivery . The rate of vaginal delivery and cesarean section in public and private hospitals were compared . First, descriptive statistics, related to the investigated period (20132014) were mentioned based on the number and percentage . Then the normality in the data was tested using kolmogorov - smirnov test . According to data distribution, finally, paired - samples t - tests and wilcoxon tests were used for assessing the hypotheses . The accurate date registration, honesty in data analysis, presenting correct statistics according to the collected data, publishing the results in a simple language and presenting them to the authorities for correct decision and policy making, were taken into consideration and emphasized by the researcher . The average number of vaginal delivery in 2013 was less than the average number of vaginal delivery in 2014 (table 1), it revealed that there is a significant difference between the number of vaginal delivery in 2013 and 2014 (p 0.01) (table 2). By observing the average number of deliveries, it was concluded that the health evolution plan was effective in increasing the number of vaginal delivery (table 1). However, the number of cesarean sections in 2014 had decreased in comparison to 2013 (table 1), was not significant (p=0.772) (table 2). In this study, different indications for cesarean section were not considered . By observing the average number of deliveries, it is obvious that the healthcare reform plan has been influential in increasing the number of vaginal delivery . In addition, implementing healthcare reform has increased the number of vaginal delivery in public hospitals and decreased it in private hospitals . Statistical analysis indicated that there was a significant difference between implementing the healthcare reform plan and the number of vaginal deliveries in public hospitals (p=0.019) (table 2). The findings showed that there was not a significant difference between implementing the healthcare reform plan and the number of painless deliveries (p=0.652). Despite the increasing number of painless deliveries in 2014, (due to the limited number of hospitals contributing in painless delivery), no significant difference could be seen and it could be concluded that the healthcare reform plan was not influential in this aspect . This study also revealed that there was not a significant difference between implanting the healthcare reform plan and the number of deliveries carried out by midwives (p=0.428). Despite the increasing number of deliveries done by midwives in 2014, due to the limited number of hospital using private midwives or lack of equipment for physiological delivery, promotion of vaginal delivery and reducing the rate of cesarean section are the primary objectives of the healthcare reform plan in iran . Various surveys have shown that the main reason of cesarean section is the repeated cesarean (12). Hence, proper planning is needed to reduce the number of cesarean sections in nulliparous women in order to prevent repeated cesarean sections in future . Fear of vaginal delivery, mother s age and physician s recommendations are the most influential factors which encourage mothers to undergo cesarean section . So, holding consultation sessions before and during pregnancy could help mothers to choose the best method of delivery (13). Furthermore, familiarity with delivery room, staffs, equipment, analgesia, presence of visitors and making the delivery room pleasant (14) are the factors reducing maternal anxiety, and aid the mother in choosing the best method of delivery . Based on the instructions of mother - friendly hospitals, training staff and physicians, limiting the use of elective cesarean section and cross section on uterus for possible vaginal delivery after cesarean section, were other factors which had influenced mothers choice and it had increased the number of vaginal delivery, and had decreased the number of cesarean section (15). After the implementation of the health evolution plan, due to increase in the number of vaginal delivery, the government decreased the franchise of vaginal delivery to zero . It was expected that with the zero franchise of vaginal delivery, the number of patrons in public hospitals would increase and the number of vaginal deliveries would increase too . The results of the present study showed that the percentage and number of vaginal delivery in public hospitals has been increased . However, implementation of healthcare reform not only decreased the number of vaginal delivery in private hospitals but also increased the number of cesarean section in those hospitals . The main reason of decline in vaginal delivery in private hospitals was making vaginal delivery free in public hospitals and physicians limitations for cesarean section in public hospitals . Fear was the most important reason - and also the main reason for nonmedical demand of mothers for elective cesarean section (11). Increase in the number of painless delivery was another policy adopted by the ministry of health to promote vaginal delivery . Despite the increased number of painless deliveries after the reform so, the number of samples for this type of delivery was little, and no significant difference was found between implementing healthcare reform and painless delivery . It can be predicted that the development of painless delivery facilities in other centers not only increase the number of vaginal delivery, but also improve equity in access of painless delivery . Another reason for mothers willingness for cesarean section is the fear of maternity units and lack of visitors . By the presence of trained visitors and providing the facilities with physiological delivery in hospitals, using midwives and making contracts with them in hospitals is another adopted policy to promote vaginal delivery (17). Despite the increased number of deliveries performed by midwives in 2014, in comparison with 2013, the limited number of hospitals having the facilities for vaginal delivery, and private midwives, led to the fact that there was no significant difference between the healthcare reform plan and delivery by midwife . With the launch of physiological delivery in all hospitals and benefiting from private midwives who have private offices, tabrizi et al . Also evaluated the health evolution plan . According to their nationwide study, the rate of cesarean section was 56.1% in 2013, and in the first quarter of the project it had been decreased to 53.6% . Besides this, the rate of cesarean section in public hospitals decreased from 47% to 42% after the reform however, the rate of cesarean section in private hospitals was 88% . It was revealed that the highest rate of decrease in cesarean section was related to public hospitals (5.3%). Other hospitals such as social security hospitals (0.2%), and private hospitals (0.4%) did not have any significant decrease . It indicated that the success of this project is in the public hospitals with more slope, thus more intervention is needed in private hospitals (18). In 2013 afshari et al . Carried out another study to show the rate of cesarean section in the first eight months of implementing the healthcare reform plan in the hospitals affiliated to isfahan university of medical sciences . Finally, it can be concluded that implementation of the healthcare reform plan has been effective on the rate of vaginal delivery but it did not have such influence on private hospitals . According to the negative impact of the healthcare reform plan in the private hospitals, it is suggested to increase tariffs of basic and supplementary insurance for delivery in private hospitals (20). Furthermore, in a number of private hospitals there are no facilities for vaginal delivery . As a result of equipping these centers with delivery rooms and vaginal delivery facilities, developing physiologic delivery rooms, performing painless delivery, having contract with midwives, the number and percentage of vaginal delivery would be increased . It is suggested to determine the causes of cesarean section and separate the nulliparous cesarean section from repeated cesarean section in the study (21). First, data for painless delivery and delivery by midwives in some centers were not available . Second, we were not able to compare the reform with other studies because no similar reforms had been implemented in other countries . One of the main aims of the health sector evolution plan in iran was to decrease cesarean section and increase vaginal delivery . Our study showed that however the number of vaginal deliveries has increased during the reform, cesarean section has not been changed after the reform . Policy makers must find solutions to decrease cesarean section in the health care private sector . In this article, it is suggested that other effects of the reform on iran health care delivery should be tested.
Cerebral malaria, a severe form of malaria caused by plasmodium falciparum, is a significant cause of childhood morbidity and mortality in sub - saharan africa [13]. It accounts for 1% to 27% of paediatric admissions with case fatality rates ranging from 15% to 50% in our region . Outcome of the disease is influenced by age of child, severity of symptoms, time of intervention and, quality of treatment received [2, 3]. Naturally caregivers of children play a pivotal role in the provision of care for childhood diseases . Since most children cannot fend for themselves, time of intervention and quality of care received depend on the actions of the caregiver . Understanding the concept and consequences of disease, knowledge of treatment modalities, and the capacity to provide or access care are some of the factors that could influence the health care seeking behavior of caregivers . Thus, appraising caregiver health care seeking behavior is necessary for effective prevention and control of grave childhood diseases such as cerebral malaria . This study was undertaken to examine the health care seeking behavior of caregivers of sick children who presented with cerebral malaria at ahmadu bello university teaching hospital (abuth), zaria and the impact, if any, on the outcome of the disease . The study was carried out, with approval of the abuth ethical and research committee, in the department of paediatrics, abuth, zaria, situated in northwestern nigeria . All it involved a review of thirty three cases of cerebral malaria managed between january 2000 and december 2009 . Parameters reviewed were the children's clinical features, the caregiver's social class distribution using oyedeji's social class classification and health care options utilized by them, duration of symptoms before presentation at abuth, and outcome of the disease . Presence of asexual forms of plasmodium falciparum, coma with or without seizures, and absence of other identifiable cause of fever or coma . Those with severe parasitaemia (> 250,000 parasites / ul of blood), coma, and whose cerebrospinal fluid culture yielded no bacterial isolates were also included . An individual whose responsibility, at a given time, is the care of a child . Individual licensed to sell and dispense limited number of drugs such as over the counter drugs . Primary health care centre, private or government hospital offering health care at a lower level than abuth . The classification by oyedeji was further grouped as upper social class (i iii) and lower social class (iv and v). Determination of sample size was dependent on the case definition which can be tenuous in cerebral malaria particularly with regards to the challenge of excluding all other possible causes of coma in a resource poor setting like ours . The last study carried out in zaria reviewed 50 cases over a period of seven years . Only 33 cases were reviewed in this study despite including all those who had severe parasitaemia and coma . In addition the increase in the number of tertiary health care institutions in the region over the years could have resulted in a reduction of those presenting to the unit . The variables were analyzed using frequencies, statistical averages, and standard deviation for variability . Test for significance was carried out using chi - square with fisher's exact test, and p values <0.05 were regarded as statistically significant . A total of 33 cases were reviewed, 24 were males and 9 females (m: f, 2.7: 1). The age range was 0.75 to 11 years (mean 3.0 1.1 years), and 12 (36.4%) were under fives . The presenting features are as shown in table 1 with fever and coma occurring in all the patients . Parents and grandparents were primarily responsible for care in 29 (87.9%) and 4 (12.1%) of the cases, respectively . The social class distribution of the caregivers was: i 2 (6.1%), ii 3 (9.1%), iii 15 (45.4%), iv 11 (33.3%), and v 2 (6.1%). Thus, 20 (60.6%) were in the upper social class, while 13 (39.4%) made up the lower social class . There were 4 cases of mortality associated with the lower class and 1 in the upper class . Of the 33 cases, 24 (72.7%) utilized more than one option before eventual presentation at the unit (table 2). There was administration of antimalarial therapy in 25 (75.8%) of the cases . Pms: this was the commonest 12 (36.4%) health care option used as first choice (table 2). All received an oral antimalarial (chloroquine, quinine, or artesunate) and either oral acetaminophen or ibuprofen . 7 (58.3%) received an oral antibiotic (chloramphenicol or metronidazole) for presumed typhoid fever . Home treatment: all received oral acetaminophen for fever, while 4 (40%) were given an oral antimalarial drug (chloroquine or a sulphadoxine / pyrimethamine combination). Health facility: similarly, all who used this option received either an oral or a parenteral antimalarial drug . 4 cases of mortality occurred among the 8 cases that did not receive any antimalarial therapy before presentation at the unit, while only one was associated with the 25 who had . The occurrence of mortality among those who did not receive any antimalarial drug was significant (p = 0.008). Day of presentation at the unit in relation to onset of symptoms was: 3, 5, 11, 6, and 8 cases on days 1, 2, 3, 4, and 5, respectively . Most 25 (75.8%) presented at the unit more than 2 days after onset of symptoms . None utilized the unit as first choice health care option, while 9 (27%), 22 (67%), and 2 (6%) utilized the facility as second, third, and fourth option, respectively . The least distance of the abode of any of the caregivers from the unit was about 3 kilometers . There were 5 (15.2%) cases of mortality (tables 3 and 4) which were significantly associated with the use of herbal concoction, treatment at a formal health facility, prolonged coma, severe anemia, multiple convulsions, and age less than 5 years . All the deaths occurred among those who presented at the unit 2 days after onset of symptoms . This study showed the use of health care options by caregivers of sick children who developed cerebral malaria . Generally, their initial options were inappropriate, and there was delay in presentation at the unit . This could be a reflection of the ability of those in this group to afford the cost of accessing care at higher levels of health care delivery . However, there was no significant difference in the outcome of the cases, between the two main social classes . The marginal difference could have been higher with a larger sample size . Out of the health care options employed by the caregivers, the pms belong to the informal health care sector and have been found to be routinely patronized by caregivers of sick children in the region of study and are often found selling, prescribing, and administering drugs for a variety of disease conditions . Since they have no formal pharmacological or medical training, their services could lead to grave consequences for patients . The practice of home treatment of disease is equally common in the region . In studies conducted about the management of fever, acute lower respiratory tract infections, and diarrhea in the region, home treatment was used in 67.2%, 60.5%, and 53.5% of the patients, respectively [68]. However, it is often inadequate, and like in the case of the pms could worsen morbidity and lead to delay in accessing appropriate health care . It is important to note that home management for malaria (hmm) has been identified as a useful tool in the reduction of morbidity and mortality resulting from malaria . This initiative requires training of prospective operators, and this was lacking in the cases studied . The use of herbal concoction in 6 (18.2%) cases reflect to some degree the practice of the use of traditional medicine in tropical africa where 7080% of the populations patronize traditional healers . The use of herbal mixtures is founded in the belief that herbs are efficacious in the management of diseases . In the south eastern nigeria for example, iloeje observed that 28.3% of parents believe that the best treatment for febrile convulsion is traditional medicine . Furthermore, the ingredients are readily available and affordable, but unhygienic preparations and potentially harmful combinations coupled with unconventional prescriptions make the use of herbal concoctions hazardous . However, proper processing and application of herbal extracts seen with artemisinin from artemisia annua and quinine from cinchona alkaloids have been quite efficacious in the management of malaria . It underscores the need for orthodox and nonorthodox health institutions to collaborate in the fight against endemic and potentially grave diseases . Over 60% of the cases in this study made use of formal health facility as an initial choice of health care . However, its preference in this study was as second or third choice of health care signifying that though desirable, there were limitations to its use as a first choice health care option . Perception of disease, severity, cost of management, accessibility to care, and attitude of health workers are some of the factors that influence utilization of services of formal health facilities . Overall, most caregivers in the study utilized health care options, in a similar manner to that observed with other febrile illnesses [6, 7], which invariably exposed their respective wards to inappropriate and inadequate treatment . Consequently, effort should be focused on educating child caregivers particularly parents, on early recognition, and use of appropriate health care options for common illnesses . Furthermore, the role of other informal health services such as traditional medicine and pms in child health care delivery should be appraised with a view to augmenting formal health services . These actions will equally foster achievement of the millennium development goal of combating common childhood illnesses.
Carbohydrates play critical roles during pollen growth and development, then in the final phase prior to dispersal carbohydrates change to prepare pollen for dispersal . Following dispersal and during pollen storage, the various metabolites comprising the carbohydrate pool change in relative proportion, a behavior that is understood as an adaptation for sustaining pollen viability in time . Sucrose in particular may be of particular importance during pollen storage, as variations among species for pollen desiccation tolerance have been linked to sucrose content . Sucrose may replace water to preserve native protein structures and spacing between phospholipids in the plasma - membrane during dehydration . The role of starch and sugars in pollen development, dispersal, and maintenance of viability has not been determined for any member of the cycadales, and is therefore a focus of needed research . Several authors have conducted robust surveys and noted that starchy pollen occurred disproportionately among anemophilous species . Representatives from the cycadales were absent from these surveys and this should be corrected, as cycad pollination studies have only recently illuminated the sophisticated pollination syndromes that characterize the threatened plant group . Although arthropods were collected from reproductive structures on various cycad taxa in the past, the scientific community largely ignored their potential role as pollinators due to the established belief that all cycads were anemophilous . The pendulum swung in the 1980s and 1990s when extensive experimental evidence confirmed mutualisms between cycad species and specialist insect pollinators . More recently, ambophily has been confirmed or proposed for several cycas species where wind has been shown to augment insect pollination . Furthermore, variations in aggregation tendencies and settling velocity have been reported for pollen from various cycad species . This is an opportune time to add members of the cycadales to studies that have linked the relationship of pollen carbohydrates to insect versus wind pollination strategies . The insect pollinators of cycads gather on male cones, where the adults socialize, mate, and use the post - dispersal male strobilus tissue as larvae food (fig . The study of idioblasts within cycad sporophyll tissues has illuminated intricacies in how general tissue chemistry may interact with pollinator feeding behaviors . For zamia furfuracea, these idioblasts remained intact in the male sporophyll tissue but appeared to release their contents into female sporophyll tissue prior to ovule receptivity . The authors concluded that toxins remained sequestered within the idioblasts for male tissue only, such that the pollinators could feed on parenchyma tissue around the idioblasts or consume intact idioblasts which protected insect metabolism from the toxins after consumption . Many but not all cycad species studied in this context exhibited similar idioblast traits . For example, cycas rumphii and stangeria eriopus strobili did not contain identifiable idioblasts . In contrast, macrozamia lucida and microcycas calocoma exhibited idioblast breakdown prior to pollination stage for both male and female sporophyll tissues . The interactions among carbohydrates, nutrients, and toxins within cycad strobili tissues in relation to these idioblasts may prove to be of crucial importance for developing a full understanding of how pollinators feed on the plant's reproductive tissues while enacting effectual pollination . Conservationists in need of improved knowledge of various pollination syndromes within the cycadales will require more studies within this context . Left: microstrobilus tissue is tunneled and consumed by larvae (arrows) immediately after pollen dispersal . Right: within days the entire microstrobilus is reduced to frass and pupation (arrow) heralds in a new generation of pollinators . The role of cycad sugars in mediating left: microstrobilus tissue is tunneled and consumed by larvae (arrows) immediately after pollen dispersal . Right: within days the entire microstrobilus is reduced to frass and pupation (arrow) heralds in a new generation of pollinators . The role of cycad sugars in mediating the majority of cycad pollinators consume strobilus tissue, but direct consumption of cycad pollen may occur for some cycad pollinators . Cumulative research on pollen digestion the addition of cycads to studies that determine carbohydrate and nutritional quality of pollen will greatly improve this line of research whether the mutualisms represent ancient associations that pre - dated angiosperms or examples where the contemporary mutualisms were recently derived from an initial antagonistic relationship . The reproductive structures of cycad species exhibit thermogenesis and volatile emissions at the time of pollination, traits that mediate pollinator behavior and maintain pollinator specificity . Research is accumulating in areas such as modeling the plant behavior and parsing the influence of specific volatiles on insect behavior . Enacting synchronized thermogenesis and volatile biosynthesis is an exceedingly expensive plant behavior, and no studies have determined the tissues of residence, quantities, and stoichiometric relations of the carbohydrate reserves that are mobilized to fund those activities . Droplets have been documented at the micropyle location on cycad ovules, and these droplets contain metabolites that may provide a reward for pollinators . Studies that marked pollinators then used deposition of the markers to track pollinator behavior have confirmed that the pollen they vector is trapped by the ovule droplets . This remarkable female strobilus behavior represents a system that would be interesting to study in relation to specificity of pollinator attraction, diversity of sugar rewards, and cycad phylogeny . Droplets may exhibit taxon - specific carbohydrates that are suited to attracting and nourishing specific specialist pollinators . Our recent report of fructose, glucose, and sucrose content in cycad tissues sets the stage for designing continued research on how non - structural carbohydrates are involved in cycad pollination biology . Moreover, cycad horticulturists routinely harvest, store, and ship pollen prior to its use for successful pollination . Improved understanding of how carbohydrates and other factors influence pollen viability and longevity would improve protocols for artificial pollination . Finally, the risks associated with coextinctions are very real during this phase of the anthropocene, and species with complex life history traits, such as cycads, appear to be at greater risk for direct involvement in coextinctions . An increase in knowledge of how cycad carbohydrates influence successful pollination relationships may help reduce the risks of coextinctions in these mutualisms that support contemporary cycad biology.
Drug product information (pi) provides details on the approved clinical use of drugs listed by the therapeutic goods administration (tga) in australia . Information included in pis is derived from clinical trials that support the use of a drug in each of these areas . Based on the pharmacology of a drug in relation to its approved indication, however, treatment of other medical conditions not listed on the pi may also be rationalised . Off - label prescribing occurs when a drug is prescribed for one or more criteria that are not included in the pi and, as such, information regarding appropriate dose for the condition or population group, pharmacokinetics / pharmacodynamics, and potential adverse effects may not be available in the pi or consumer medicines information (cmi). Nevertheless, off - label prescribing may be justified by good quality evidence from clinical trials or systematic reviews of the literature, and a number of examples have been accepted in general and specialist clinical practice . For example, until recently misoprostol was only approved by the tga for treatment and prevention of upper gastrointestinal (gi) ulceration . It is commonly used off - label in obstetrics for treatment of post - partum haemorrhage as part of a management algorithm since it has demonstrated effective haemorrhage prevention and control in combination with oxytocin (tuncalp et al ., 2012). Regimes for use of misoprostol in gynaecology to evacuate the contents of a gravid uterus, in both miscarriage and abortion have also been described (gomez ponce de leon et al ., 2007) and evaluated (dodd and crowther, 2010). Recently, misoprostol has also been approved in australia for use in combination with mifepristone to terminate pregnancy in women of child - bearing age . Misoprostol (15-deoxy-16-hydroxy-16-methyl pge1) is an orally active synthetic prostaglandin e1 (pge1) methyl ester analogue . After oral administration, misoprostol rapidly de - esterifies to its biologically active form, misoprostolic acid . It has four major effects: gastrointestinalcytoprotection (approved therapeutic indication), uterotonicity, and diarrhoea and abdominal pain which are regarded as adverse effects . Cytoprotective effect is mainly by topical contact, with inhibition of gastric acid secretion and induction of oedema of the mucosa and submucosa, increasing the thickness of both layers . Uterotonicity requires binding to receptors in uterine smooth muscle and are mediated systemically after oral dosing . Abdominal pain, diarrhoea and flatulence are probably the result of exposure to the released misoprostolic acid and correlate well with the timing and magnitude of the misoprostolic acid peak plasma concentration (davies et al ., 2001). Mifepristone (also known as ru-486) is a synthetic antiprogestin steroid with high affinity for the glucocorticoid and progesterone receptors and a weak affinity for the androgen receptor . Mifepristone acts by binding to the human uterine progesterone receptor with twice the affinity of that of progesterone, thus competitively inhibiting the endometrial and myometrial effects effect of progesterone . Under some circumstances, in the absence of progesterone, mifepristone may also act as a progesterone agonist (robbins and spitz, 1996). Its mechanism of action at the cellular level is highly complex and a variety of hypotheses have been proposed . During pregnancy mifepristone sensitises the myometrium to the contraction inducing action of prostaglandins (swahn and bygeeman, 1988). Administration of mifepristone in early pregnancy results in regular uterine contractility and increased sensitivity to prostaglandins . Moreover, with high concentrations of progesterone, blockage of decidual progesterone receptors by mifepristone results in withdrawal of progesterone support to the endometrium, leading to uterine bleeding and disruption of placental function . First trimester actions also include reduced cervical resistance, dilatation and opening of the cervix . Mifepristone was first registered for medical abortion in europe in 1988 and now has registration in many countries worldwide . From 1996 to 2005 in australia mifepristone was classified as a restricted good which could only be imported with written approval of the federal minister for health . In 2006 the therapeutic goods amendment (repeal of ministerial responsibility for approval of ru486) bill 2005 was passed in parliament which enabled the tga to assess the efficacy, safety and quality of mifepristone should any application for registration be made . No drug sponsor made immediate application for registration to the tga so mifepristone remained an unapproved drug in australia . It was, however, available to authorised prescribers under provisions of the therapeutic goods act 1989 which permitted importation and use of drugs recognised and used overseas but that were currently unavailable in australia . In 2012, mifepristone (therapeutic goods administration, 2014) was approved for use in combination with misoprostol (therapeutic goods administration, 2012) for medical abortion in women of child - bearing age . Prescription is restricted to clinicians who have undertaken defined women s health training administered by the drug sponsor, and who have registered on the specific prescribing program . Medical termination of a developing intra- uterine pregnancy up to 63 days of gestation, in sequential combination with a prostaglandin analogue; and 2 . Preparation for the action of registered prostaglandin analogues that are indicated for the termination of pregnancy for medical reasons beyond the first trimester . Combined mifepristone and misoprostol has reported widespread use for early first trimester abortions and has been the subject of a number of reviews (kulier et al ., 2011; raymond et al ., 2013) the combination has an acceptable safety profile in clinical practice (goldstone et al ., 2012; cleland et al.,2013) and controlled administration for abortion in outpatient and home settings has also been successfully performed even prior to formal registration of these drugs in australia (de costa et al . . Nevertheless, significant adverse events including incomplete abortion, sepsis and death have all been reported (murray and wooltorton, 2005; goldstone et al ., 2012). The recommendation from the royal australian and newzealand college of obstetricians and gynaecologists (ranzcog, 2012) is that medical termination should not be performed in an isolated or an inaccessible setting which lacks ready access to suitable emergency care (in a service accepting this responsibility) from administration of mifepristone until termination of pregnancy is complete . There is still debate as to the appropriate regime for medical abortion in using mifepristone and misoprostol . According to the pi misoprostol tablets are to be administered orally . One large systematic review has found better clinical outcomes with vaginal versus oral administration, and reduced adverse effects for vaginally versus sublingual or buccal misoprostol (kulier et al ., 2011). The current approved dose of mifepristone is 200 mg in australia whereas a dose of 600 mg of mifepristone is approved by the food and drug administration (fda) for use in the usa (creinin et al ., the international federation of gynecology and obstetrics (figo) guidelines recommend only 200 mg of mifepristone (fandes, 2011) which is also supported by recent evidence (raymond et al ., 2013). It is likely that dosing regimens will continue to be researched and further evidence will be obtained that will shape recommended dosage, frequency and route of administration at different gestations . Medical management of both early (miscarriage) and late pregnancy loss may be achieved with misoprostol . Its widespread use for management of first trimester miscarriage is well - supported by good quality evidence worldwide (gomez ponce de leon et al . Unfortunately there is still little uniformity in recommended treatment regimens although there is increasing evidence that lower doses may yield good results both clinically and psychologically (barcelo et al ., 2012; misoprostol is clinically effective in management of miscarriage, has cost - benefits over other methods, and is versatile from the point of view of storage, dosing regimen and route of administration . Yet, there is a clear disparity between its approved use for abortion and its off - label use for management of miscarriage . The physiological and pharmacological mechanisms involved in both these circumstances can be assumed to be directly comparable but for the purpose of approved use of misoprostol they are viewed differently . This raises a number of issues when dealing with women presenting with first trimester miscarriage for whom medical management is a preferred option . Off - label prescribing requires the clinician to inform the woman that her prescription is not for an approved indication as listed on the pi / cmi . The rationale for treatment with misoprostol should be explained with reference to the evidence available to reassure her of the safety and applicability of this treatment modality (gazarian et al ., 2006). Adverse effects and further information from the pi / cmi for misoprostol may be discussed, noting that that information is specifically applicable to termination of pregnancy but being inferred for her situation . This properly informed woman might then question the reason she may incur a non- subsidised fee for misoprostol whereas someone seeking a termination need not . She may also become hesitant to undertake medical management due to this personal cost and questions about something called off - label treatment . Instigation of management with misoprostol should commence as soon as reasonable given the clinical and emotional circumstances surrounding the miscarriage . A delay in medical management has been shown to result in significantly increased emergency department presentations and need for emergency surgical management (torre et al ., 2012). She may also decide not to undergo medical management at all and instead opt for surgical management . The may place an increased burden on the healthcare system given the lower cost of medical versus surgical management in circumstances such as incomplete or inevitable miscarriage (rausch et al ., 2012), as well as an increased risk of preterm birth in subsequent pregnancies (lemmers et al ., 2016). Clinicians, too, should be cautious when managing first trimester miscarriage with misoprostol . Since there are no formal guidelines in place, care must be taken when prescribing off - label to select a robust protocol that is supported with good evidence (creinin et al ., 2006). Public hospitals should have in place protocols approved at local and district levels, if not by state - wide policy if possible . Private clinicians or organisations should also have a credible system available that would withstand peer - review and legal challenge . Deviation from evidence - based regimens may leave the clinician and institution open to medicolegal challenge in the case of an adverse outcome or event . The utility of misoprostol is not being questioned since it has great applicability in gynaecology in the australian setting (krishnan et al ., 2014). The subtleties regarding indicated versus off - label use of misoprostol, however, must be given due attention given the transparency and evidence - based requirements in modern obstetrics and gynaecology.
The objective of this study was to produce maps that could be integrated into the sci - supported national intervention strategies and that explicitly represent uncertainties in spatial predictions so that national control managers could judge the quality of the evidence upon which the strategies will be based . The sci - supported programs involve mass distribution of praziquantel (for urinary and intestinal schistosomiasis) and albendazole (for soil - transmitted helminths). The parasitic infection with the highest prevalence is urinary schistosomiasis, caused by flukes (schistosoma hematobium), and the programs are planned to control this disease (2). Parasitologic data were collected in coordinated school - based field surveys in burkina faso, mali, and niger (figure 1) during 20042006 (preintervention) by using standardized protocols (available on request). The collated dataset covered a spatially contiguous area, 2,750 km 850 km, and included the infection status of 27,939 school - age children in 418 randomly selected locations . Infection status was defined according to egg count determined by microscopic examination of urine samples;> 1 s. hematobium eggs indicated infection . Prevalence of infection with schistosoma hematobium at 418 survey locations in burkina faso, mali, and niger, 20042006 . Spatial prediction was based on a logistic regression model (table), constructed by using the software winbugs, version 1.4.2 (mrc biostatistics unit, cambridge and imperial college, london, uk). The model had infection status as the binary outcome variable, age and sex of the survey participants as individual - level fixed effects, and distance from perennial water body (derived from electronic maps obtained from the food and agriculture organization) and land surface temperature (lst; with a quadratic term; see hay et al . For details on how these data were derived) as survey location level fixed effects . The model also included a geostatistical random effect for residual spatial clustering of infection prevalence (11). Values for the fixed effects are odds ratios; note the odds ratios for the climate variables are on a common scale, where the variables were standardized to have a mean = 0 and sd = 1 . The reference group for sex was boys and for age was 68 y. the number of children found to be infected with s. haematobium was modeled by using a binomial distribution described by the proportion infected and the total number sampled in each survey location . The proportion infected was modeled by using logistic regression with an intercept, covariates (sex, age, distance to perennial water body, land surface temperature, and a quadratic term for land surface temperature), and a random effect that described spatial correlation (i.e., clustering). Model outputs were distributions (termed posterior distributions) that can be summarized by using the mean, sd, and 95% cri (representing the range of values that contains the true value with a probability of 95%). A prevalence map for the study area was constructed, using the model, by predicting infection prevalence at the centroids of cells of a 0.15 0.15 decimal degree (18 km 18 km) grid . This model was implemented with the spatial.unipred command of winbugs (details are provided in the technical appendix). Estimates from bayesian models are distributions (termed posterior distributions) that represent the probability of each of a range of plausible values being true for the variable being modeled . To quantify the uncertainties surrounding the model predictions, we plotted the probability of each prediction location having a prevalence> 50%, rather than mean predicted prevalence at each location . The probabilities were calculated from the posterior distributions of predicted prevalence at each location (i.e., if 95% of the posterior distribution of predicted prevalence was> 0.5, the probability of prevalence> 50% at that location was 95%). Cross - validation was done by randomly allocating survey locations to 3 groups and undertaking 3 separate runs of the model; 1 of the 3 groups was sequentially omitted, and predicted prevalence at the omitted locations was determined by using the model . Predicted prevalence was compared with observed prevalence, dichotomized, according to a 50% observed prevalence threshold . The comparison statistic was the area under the curve (auc) of the receiver operating characteristic, and a value of> 0.7 was considered to indicate acceptable predictive ability . An average auc was calculated across the 3 model runs . In the final model (table), statistically significant correlations suggested that infection prevalence was higher in older boys and increased with proximity to perennial bodies of water, but no association was found between prevalence and lst . The range over which spatial correlation was> 5% (chosen to indicate statistically important spatial correlation) was 177 km, indicating the approximate radius of clusters . Results of the validation analysis showed an average auc of 0.86, indicating that the model had an acceptable predictive performance . Bayesian probability maps were produced for each sex and age group, but for illustrative purposes we present predicted probability of prevalence> 50% in boys ages 1316 years (the group with the highest infection prevalence; figure 2). Large clusters of prediction locations with a high probability (i.e.,> 50%; indicative of low uncertainty) of prevalence being> 50% intervention threshold were located in a mid - latitudinal band across mali, running from western to central regions, and in the niger river valley region of niger . Smaller clusters were located in various parts of southern and eastern mali, northwestern and northeastern burkina faso, and south - central niger . Predicted probability of prevalence of infection with schistosoma hematobium being> 50% in burkina faso, mali, and niger in boys ages 1316 years; results are based on a bayesian geostatistical model . The red areas had a low degree of uncertainty that predicted prevalence was> 50%, and the blue areas had a high degree of uncertainty that predicted prevalence was> 50% . Future schistosomiasis control plans should acknowledge uncertainties such as those presented in figure 2 . A possible approach would be to introduce a second threshold for the level of uncertainty that a location is above the intervention prevalence threshold; if the uncertainty is greater than this second threshold, then the location is excluded until new evidence is obtained that confirms prevalence is above or below the intervention prevalence threshold . This second uncertainty threshold should be determined by the quantity of resources available for disease control and the level of decision risk deemed appropriate . In addition to providing an evidence base for distributing resources in 3 west african countries as part of the sci - supported national control programs, the maps presented here have a potential role in maintaining sustainability of schistosomiasis control after sci support ends (sci is funded through 2009). They can be used as advocacy tools for channeling funds to high - risk populations in the affected countries and, in the likely event that money for schistosomiasis control in these countries becomes more limited after sci support ends, they can be used to ensure that scarce governmental resources are distributed as efficiently as possible . National coordinators who might face accountability for targeted (i.e., unequal) distribution of resources will benefit from the defendable, scientifically sound methods presented in this article . By focusing on uncertainty in spatial predictions, more flexible tools for disease control can be developed that allow the geographic dimensions of control programs to be scaled and modified according to available resources and acceptable levels of decision risk.
Donor specific tolerance through mixed chimerism can be achieved in various animal models by nonmyeloablative bmt and cb . Success rates of chimerism and tolerance induction have typically been high when donor - recipient strain combinations were used which cross only mhc barriers but share the same mhag background [2, 3]. However, this setting does not reflect the clinical situation where mhag disparities exist universally . When switching to a different donor - recipient combination, which crosses mhc plus multiple mhag barriers (balb / c bl6), retrospective review of pooled results revealed that overall only approximately 75% of mice developed lasting chimerism and of those that became chimeric approximately 15% rejected donor type skin grafts [47]. Mhag are polymorphic non - mhc proteins that are able to induce a t cell response due to allelic variations between donor and recipient . Mhag play a prominent role in hematopoietic stem cell transplantation (hsct) in many regards . Striking differences in engraftment of purified hematopoietic stem cells and/or development and severity of gvhd depending on mhag disparities were found in murine mhc - matched donor host strain combinations . In the human setting, disparities in mhag increase not only the rates of rejection and graft - versus - host - disease (gvhd) but also the efficacy of graft - versus - leukemia - effects (gvl). Recently, mhag have also been reported to play an essential role in the persistence of donor chimerism . Skin allografts differing only in minor antigens are rejected with the same pace as mhc disparate allografts . Moreover, a single mhag disparity was sufficient to induce chronic rejection of cardiac allografts in a congenic mouse model . In clinical studies of kidney transplantation only limited and controversial data exist regarding the impact of mhag disparities on graft survival . Humoral immunity to specific mhag, such as antibodies to angiotensin type 1 receptor (at1r) and endothelin type a receptor (etar), have been shown to correlate with an increased incidence of acute rejection and inferior long - term graft survival in kidney and heart allografts . However, so far the role of mhag disparities in the induction and maintenance of tolerance through mixed chimerism has not been clearly defined . Therefore, we investigated different donor host strain combinations displaying mhc mismatches only (either h2 or h2) or mhc plus multiple mhag mismatches (h2). Female c57bl/6 (bl6: h2), balb / c (h2), and c3h / n (h2) mice were obtained from charles river laboratories (sulzfeld, germany) and b10.d2 (h2) and b10.a (h2) from the jackson laboratory (bar harbor, me). All mice were housed under specific pathogen free conditions and used between 8 and 10 weeks of age . All experiments were approved by the local review board of the medical university of vienna and were performed in accordance with national and international guidelines of laboratory animal care . Age - matched female bl6 recipients underwent nonmyeloablative total body irradiation (tbi, 3 gy, d 1) prior to the intravenous injection of approximately 2 10 unseparated bone marrow cells (bmc) from balb / c, b10.d2, or b10.a donors as previously described [46]. Additionally mice were injected intraperitoneally with an anti - cd154 mab (mr1; 1 mg d0) and hctla4ig (0.5 mg d+2). (new hampshire, usa) and hctla4ig was generously provided by bristol - myers squibb pharmaceuticals (princeton, new jersey). Full thickness tail skin from sacrificed balb / c, b10.d2, or b10.a mice, respectively (donor specific), and c3h / n (h2; 3rd party) was grafted 7 or 15 weeks after bmt . Recipient mice were anesthetized through intraperitoneal injection of a mixture of ketamine (100 mg / kg) and xylazine (5 mg / kg) before attachment of skin grafts at the lateral thoracic wall . Two - color fcm was used to distinguish donor and recipient cells of particular lineages, by staining with fluorescein isothiocyanate- (fitc-) conjugated antibodies against cd4, cd8, b220, and mac1 and a biotinylated antibody against h-2d (34 - 2 - 12, developed with phycoerythrin streptavidin) and irrelevant isotype controls . To analyze the expression of v-subunits staining was performed with fitc - conjugated antibodies against v8.1/2 and v11 and pe - conjugated antibodies against cd4 . Mice were considered chimeric if they showed detectable donor cells within the myeloid lineage plus at least one lymphoid lineage . An epics xl - mcl flow cytometer (beckman coulter, il alliance, vienna, austria) was used for acquisition and expo32 adc software, applied cytometry systems, was used for analysis of flow cytometric data . Four micrometer sections were cut from paraffin - embedded tissue fixed in 4.5% formalin (ph of 7.5), stained with hematoxylin - eosin and giemsa according to standard protocols, and analyzed by an experienced pathologist in blinded fashion according to the banff 2007 working classification of skin - containing composite tissue allograft pathology . A two - tailed student's t - test was used for comparing percentages of v-positive populations and levels of chimerism within several cell lineages . Skin graft survival was calculated according to the kaplan - meier product limit method and compared between groups by using the log - rank test . The fisher exact test was used to compare histologically categorized skin grafts of different donor groups . A p value less than 0.05 was considered to be statistically significant . Three groups of mice were treated with a previously published nonmyeloablative bmt protocol [46]. Bl6 recipients (h2) received 2 10 bmc from different donor strains with mismatches of mhc with / without additional mhag mismatches after 3 gy tbi (d 1) together with cb consisting of a single dose each of anti - cd154mab (1 mg mr1, d0) and ctla4ig (0.5 mg, d2). Balb / c (h2), b10.d2 (h2, same background as bl6), and b10.a (h2, same background as bl6) mice were used as donors (figure 1(a)) to investigate the potential influence of mhag on top of the burden of mhc mismatch and the influence of the specific mhc haplotype on the induction of long - term multilineage chimerism (h2 versus h2). In bl6 recipients of balb / c bmc high levels of multilineage chimerism (tested in cd4, cd8, b cells, and myeloid cells, figure 1(b)) were initially induced in 17 of 18 mice . At 16 weeks after bmt only 13 of 18 mice stayed chimeric (pooled data of two independent experiments). This result is consistent with numerous previous experiments using this protocol showing that chimerism is lost in approximately 25% of recipients over time . In contrast, 21 of 21 bl6 mice receiving bmc of b10.d2 developed multilineage chimerism which remained stable in all but one animal over time (p <0.05 versus balb / c after week 16 after bmt, figure 1(c)). Interestingly the rate of chimeras also dropped in bl6 recipientsof b10.a bmc from initially 17 of 20 immediately after bmt to 13 of 20 at week 16 (p <0.05 versus b10.d2, figure 1(c)). These data indicate that mhag mismatches pose a barrier to establishing long lasting multilineage chimerism through bmt with cb . Additionally the mhc haplotype (h2 versus h2) also seems to influence bone marrow (bm) engraftment with this cb - based nonmyeloablative protocol . Analyzing lineage - specific blood chimerism levels in successful long - term chimeras it was noted that b cell chimerism was significantly higher in recipients of b10.d2 bmc compared to recipients of balb / c bmc at each investigated time point (e.g., b10.d2 versus balb / c: 81.9% 7.2 versus 61.3% 9.4 at week 19, figure 1(d), p <0.01, p <0.05), whereas cd8 and myeloid cell chimerism levels were comparable between these two groups . Cd4 chimerism was significantly higher in recipients of balb / c bmc at week 19 after bmt (b10.d2 versus balb / c: 36.08% 14.53 versus 58.75% 12.13, figure 1(d), p <0.01). Significantly lower chimerism levels were observed in myeloid lineages in b10.a bmc recipients compared to recipients of balb / c bmc from week 6 on . No consistent differences in t cell chimerism (cd4- and cd8 cells) and b cell chimerism levels were observed between long - term chimeras after bmt from b10.a or balb / c donors . Nonetheless, cd4 and cd8 t cell chimerism levels were significantly higher (b10.a versus balb / c: cd4: 25.56 10.43 versus 13.51 4.82 and cd8: 24.55 7.83 versus 15.48 8.86) in recipients of b10.a bmc 6 weeks after bmt but declined below that of balb / c bmc recipients by week 19 (b10.a versus balb / c: cd4: 37.71 25.44 versus 58.75 12.13, p <0.05). The total level of donor chimerism among leukocytes was 62.41% versus 62.26% versus 53.41% in recipients of balb / c versus b10.d2 versus b10.a bone marrow, respectively (at 19 weeks after bmt). These results suggest that both individual mhc haplotype and minor antigen disparities influence the degree of chimerism in distinct lineages . Specific skin graft acceptance is considered as a stringent test to indicate transplantation tolerance . To investigate a possible influence of mhag mismatches on skin graft acceptance, donor and 3rd party tail skin was transplanted 2 - 3 months after bmt . Among successfully established chimeras long - term donor skin graft survival (> 130 days) this rate is similar to our previous experience with this protocol [4, 6, 7]. In contrast, recipients of b10.d2 or b10.a bmc showed a significantly better long - term donor skin graft survival (b10.d2: 16/17, b10.a: 12/12, figure 2(a), p <0.05 for balb / c versus b10.d2 and b10.a donors; pooled data of two independent experiments). However, in recipients of balb / c bmc no significant difference in chimerism levels of long - term chimeras, which rejected donor skin grafts in comparison to tolerant animals was observed (figure 2(b)). Regarding the macroscopic appearance of donor skin grafts of long - term chimeras, no shrinking, thickening, or loss of surface aspect was observed in mhag matched b10.d2 and b10.a donor grafts in contrast to balb / c grafts (figure 2(b)). Histological analysis of those donor grafts that were retained until the end of follow - up revealed that balb / c donor grafts exhibited signs of chronic rejection, like sparse infiltration with lymphocytes and mast cells together with focally dense lymphocytic - mononuclear cell infiltration . In comparison no incidence of dense focal lymphocytic infiltration was seen, in b10.d2 donor grafts (figure 2(c)). Skin grafts were scored by a blinded pathologist according to the banff 2007 working classification of skin - containing composite tissue allograft pathology . Moderate (grade 2; 2/3) and mild signs of inflammation (grade 1; 1/3) were found in balb / c grafts, whereas no signs of inflammation (grade 0) were seen in 4/4 b10.d2 grafts (p <0.05 versus balb / c donors) and 2/4 b10.a grafts (2/4 grade 1, p = n.s . Versus balb / c, figure 2(d)). Taken together, these data suggest that mhag disparities increase the rate of chronic skin graft rejection in recipients with persistent levels of mixed chimerism . Peripheral and central clonal deletion are important mechanisms for the induction and maintenance of tolerance in models of mixed chimerism induced by bmt plus cb . Notably not all mice become chimeric with such a protocol and not all chimeric mice accept donor skin grafts indefinitely . We followed v11 + cd4 + t cells, which in this model recognize endogenous superantigens presented by donor mhc ii (i - e) but not recipient mhc class ii and thus serve as surrogate markers for donor - alloreactive t cells . Like in previous experiments balb / c long - term chimeras displayed marked deletion of v11 + cd4 + t cells by week 4 after bmt (2.04% 0.80 [n = 8] versus 5.20% 0.17 in nave bl6 mice [n = 2]). Compared to balb / c chimeras, a similar degree of deletion was observed in b10.d2 chimeras (1.99% 0.69 [n = 11], p = n.s . ). Interestingly, transplantation of b10.a (h2, mhag matched) bone marrow led to a significantly more pronounced early deletion compared to balb / c and b10.d2 (0.67% 1.62 [n = 9], p <0.05 versus balb / c and b10.d2 donors, both lineages). In contrast irrelevant v8.1/2 + cd4 + t cells were not deleted in either group after bmt, indicating the specificity of the deletion for superantigens presented by the donor (figure 3(a)). Ten weeks after bmt the degree of deletion was significantly enhanced in long time chimeras after balb / c and b10.d2 bmt (0.93% 0.22 [n = 8] and 1.26% 0.27 [n = 11], p <0.01 versus week 4 for both lineages) but still was significantly less pronounced than in recipients of b10.a bmc (0.23% 0.16 [n = 9], p <0.01 versus balb / c and b10.d2, both lineages; figure 3(b)). Concluding, the type of mhc (i.e. I - e versus i - e) may influence the extent and kinetic of deletion of donor - reactive t cells . In this study we provide evidence that mhag disparities play a decisive role in the induction and maintenance of tolerance in recipients conditioned with nonmyeloablative bmt and cb, in which mhag both impede the engraftment of bm and promote the rejection of donor skin in successfully established mixed chimeras . Tolerance induction through donor bmt depends on two, mechanistically separate, events: successful engraftment of donor bm and durable tolerization of all relevant donor antigens in the context of donor chimerism . The frequency of successful long - term chimeras was higher in the absence of mhag disparities when the mhc haplotype was the same (13/18 for balb / c versus 20/21 for b10.d2). These results are in line with findings that mhc - matched bm is rejected in sublethally irradiated mice . Only some of the minor antigens that drive alloreactivity in this strain combination (balb / c to bl6) have been identified, with h60 provoking a particularly strong reaction . H60 is a ligand for the activating receptor nkg2d which is expressed on nk cells and on activated cd8 t cells, which are both effective mediators of allogeneic bm rejection . Intriguingly, balb / c donor mice feature a higher surface expression of h60 than recipient bl6 mice . Nkg2d has been reported to enhance nk cell mediated bm rejection in semiallogeneic pairs (balb / c to f1) but seems to be dispensable in fully mismatched combinations (balb / c to bl6). Alternatively, nkg2d can function as a costimulatory receptor to augment the response of nave cd8 t cells . This could provide an alternative costimulatory route for cd8 t cells when cd40 and cd28 pathways are blocked . The role of nkg2d in cd8 t cell mediated bm rejection has not yet been evaluated although it is well established that h60 triggers an abnormally high number of responding cd8 t cells . Unexpectedly, significantly fewer mice developed long lasting multilineage chimerism after receiving bm from b10.a compared to b10.d2 donors (both mhag matched to recipient). Since the only difference between b10.a and b10.d2 is the h2 haplotype these results suggest that the mhc haplotype per se influences chimerism induction . Distinct h2 haplotypes are known to stimulate varying numbers of alloreactive t cells and thus exhibit a varying degree of immunogenicity, which apparently also influences bm rejection versus engraftment . Interestingly, if engraftment is successful, b10.a chimeras accepted donor skin grafts to a comparable extent as b10.d2 chimeras without macroscopical and histological signs of chronic inflammation . Thus, distinct mhc haplotypes impede bm engraftment to varying degrees but do not affect the success of skin graft tolerance in established mixed chimeras . With regard to the second event, mhag disparities increased the rate of skin graft rejection in successfully established chimeras (10/13 for balb / c versus 28/29 for b10.d2 and b10.a). In addition, the surviving skin grafts of balb / c but not b10.d2 donors exhibited histological signs of chronic inflammation . Thus, mhag disparities can drive chronic rejection in the presence of stable mixed chimerism . Several groups attributed tissue specific antigens, which are not present in the bm but the skin, for this state of so - called split tolerance . Obviously, for clinical translation this hurdle of mhag disparities with its associated risk of split tolerance recently, we could demonstrate that the combination of regulatory cell therapy with donor bm transplantation leads to a state of tolerance that encompasses donor mhag . Critically, this regimen relies on extensive regulatory mechanisms, including linked suppression, that appear superior and indeed indispensable for tolerization of donor mhag (pilat et al . This study reveals that mhag disparities have a negative impact on bm engraftment and tolerance maintenance in a nonmyeloablative, cb - based chimerism model . Preclinical tolerance protocols should encompass mhag disparities to reflect the clinical setting and need to induce mechanisms capable of durable tolerization of donor mhag.
Participants were drawn from the minnesota twin family study, a community - based sample of adolescents and their families . This sample was utilized because the participants were representative of minnesota families with children living at home (based on the 2000 us census) and because it included rigorous, developmentally - timed assessments of key study variables (see above). Of eligible families, youth were born between 1977 and 1982 (males) or 1981 and 1985 (females). Participants (752 males, 760 females) were first recruited and assessed when the youth were 11 (mean=11.7, sd=.4) and were invited back to return to the study at ages 14 (mean=14.8, sd=.5), 17 (mean=18.2, sd=.7), 20 (mean=21.5, sd=.8), and 24 (mean=25.3, sd=.7). Although twin zygosity was not considered in this report, both monozygotic (n=487) and dizygotic (n=269) pairs comprised the sample . This study was approved by the university of minnesota irb, and participants gave informed consent (if 18 or over or parent on behalf of a minor child) or assent (for minors). Consistent with the population of the state of minnesota at the time these youth were born, approximately 95% of the sample was white . Mdd was assessed in youth younger than age 17 using the diagnostic interview schedule for children and adolescents and in youth ages 17 and older using the structured clinical interview for dsm - iii - r . Diagnostic interviews were conducted in person by trained interviewers with bachelor s or master s degree in psychology, reviewed by teams of advanced clinical psychology doctoral students who achieved consensus agreement for each assessed symptom of mdd, and diagnosed using computer algorithms following dsm rules (kappas = .78 or better). For youth 17 and younger, diagnoses reported by either the mother or the child were counted as present (the best - estimate method). Definite and probable (exhibiting all symptoms necessary for the diagnosis except one) diagnoses were used . At the initial assessment, lifetime diagnoses were assessed; after that, mdd was assessed since the last visit to the study . Diagnoses reported at either age 11 or age 14 were combined into an assessment of mdd during early adolescence . If mdd was first reported at 17 or 20, this was considered to represent late adolescent - onset mdd . If mdd was first reported at 24, this was considered to represent an onset of mdd during early adulthood . Body mass index (bmi) was calculated using the standard formula (weight in kilograms divided by height in meters squared). For youth at age 20 and 24, the standard bmi cutoff of 30 was used to define obesity . For youth younger than age 20, growth curves from the center for disease control were used to determine obesity cutoffs (95 percentile) for each age and sex based on the average participant ages at each assessment (age 11: 23.90 for males, 24.89 for females; age 14: 26.71 for males, 27.99 for females; age 17: 28.90 for males, 30 for females). Analogous to mdd, obesity first occurring at age 11 or age 14 was combined into an assessment of obesity during early adolescence . If obesity was first present at 17 or 20, this if obesity was first present at 24, this was considered to represent an onset of obesity during early adulthood . Sas version 9.2 was employed to compute generalized estimating equations (gees; proc genmod) to account for the correlated observations in this sample (twins nested within families). There was little missing data because if a participant missed an early assessment, the relevant data for the missed assessment were obtained in a subsequent assessment . In cases where a data point was missing first, prevalences of the onset of each disorder during each developmental period, as well as anytime prior to the final assessment, were computed and compared across sex using gees . Next, in order to examine cross - sectional associations between these disorders, tetrachoric correlations were conducted (reported with asymptotic standard errors) to describe the associations between mdd and obesity with onsets occurring within each developmental stage (early adolescence, late adolescence, and early adulthood), as well as onsets anytime prior to the final assessment . For the prospective (i.e., across time) analyses that were the focus of our study, because of our interest in disorder onsets (rather than the recurrence or persistence of disorders), some participants were eliminated from certain analyses due to their having earlier onset of the disorder . For example, if a participant experienced mdd prior to age 14, he / she was not included in analyses predicting obesity onsets in early adulthood from mdd onsets between 14 and 20 (because the mdd onset had been experienced prior to that). For the prospective analyses, the first examined the overall effect of one disorder on the other, adjusting for the effect of gender . The second included a disorder - by - gender interaction term in order to assess the significance of gender differences in the effect of the independent variable on the dependent variable . First, we examined whether the occurrence of obesity by age 14 predicted the development of mdd (1) during late adolescence, and (2) during early adulthood . Second, we examined the association between obesity first developing during late adolescence and the onset of mdd in early adulthood . Next, we examined the opposite directions of effect: mdd by age 14 predicting the development of obesity (1) during late adolescence and (2) during early adulthood; and mdd first developing during late adolescence and the onset of obesity in early adulthood . For inclusion in the analysis, participants were required to have data at the oldest assessment point within each developmental period (age 14 for early adolescence, age 20 for late adolescence, and age 24 for early adulthood). Data were occasionally missing at the younger assessment point (age 11 for early adolescence and age 17 for late adolescence). If a participant missed one of these assessments, when he or she returned, mdd was assessed since the previous visit to the study; therefore, these entire developmental periods were covered . For obesity, the only way a case would have been missed would be if the participant first became obese and then became non - obese all within a 6-year period . Participants were drawn from the minnesota twin family study, a community - based sample of adolescents and their families . This sample was utilized because the participants were representative of minnesota families with children living at home (based on the 2000 us census) and because it included rigorous, developmentally - timed assessments of key study variables (see above). Of eligible families, youth were born between 1977 and 1982 (males) or 1981 and 1985 (females). Participants (752 males, 760 females) were first recruited and assessed when the youth were 11 (mean=11.7, sd=.4) and were invited back to return to the study at ages 14 (mean=14.8, sd=.5), 17 (mean=18.2, sd=.7), 20 (mean=21.5, sd=.8), and 24 (mean=25.3, sd=.7). Although twin zygosity was not considered in this report, both monozygotic (n=487) and dizygotic (n=269) pairs comprised the sample . This study was approved by the university of minnesota irb, and participants gave informed consent (if 18 or over or parent on behalf of a minor child) or assent (for minors). Consistent with the population of the state of minnesota at the time these youth were born, approximately 95% of the sample was white . Mdd was assessed in youth younger than age 17 using the diagnostic interview schedule for children and adolescents and in youth ages 17 and older using the structured clinical interview for dsm - iii - r . Diagnostic interviews were conducted in person by trained interviewers with bachelor s or master s degree in psychology, reviewed by teams of advanced clinical psychology doctoral students who achieved consensus agreement for each assessed symptom of mdd, and diagnosed using computer algorithms following dsm rules (kappas = .78 or better). For youth 17 and younger, diagnoses reported by either the mother or the child were counted as present (the best - estimate method). Definite and probable (exhibiting all symptoms necessary for the diagnosis except one) diagnoses were used . At the initial assessment, lifetime diagnoses were assessed; after that, mdd was assessed since the last visit to the study . Diagnoses reported at either age 11 or age 14 were combined into an assessment of mdd during early adolescence . If mdd was first reported at 17 or 20, this was considered to represent late adolescent - onset mdd . If mdd was first reported at 24, this was considered to represent an onset of mdd during early adulthood . Body mass index (bmi) was calculated using the standard formula (weight in kilograms divided by height in meters squared). For youth at age 20 and 24, younger than age 20, growth curves from the center for disease control were used to determine obesity cutoffs (95 percentile) for each age and sex based on the average participant ages at each assessment (age 11: 23.90 for males, 24.89 for females; age 14: 26.71 for males, 27.99 for females; age 17: 28.90 for males, 30 for females). Analogous to mdd, obesity first occurring at age 11 or age 14 was combined into an assessment of obesity during early adolescence . If obesity was first present at 17 or 20, this was considered to represent late adolescent - onset obesity . If obesity was first present at 24, this was considered to represent an onset of obesity during early adulthood . Mdd was assessed in youth younger than age 17 using the diagnostic interview schedule for children and adolescents and in youth ages 17 and older using the structured clinical interview for dsm - iii - r . Diagnostic interviews were conducted in person by trained interviewers with bachelor s or master s degree in psychology, reviewed by teams of advanced clinical psychology doctoral students who achieved consensus agreement for each assessed symptom of mdd, and diagnosed using computer algorithms following dsm rules (kappas = .78 or better). For youth 17 and younger, diagnoses reported by either the mother or the child were counted as present (the best - estimate method). Definite and probable (exhibiting all symptoms necessary for the diagnosis except one) diagnoses were used . At the initial assessment, lifetime diagnoses were assessed; after that, mdd was assessed since the last visit to the study . Diagnoses reported at either age 11 or age 14 were combined into an assessment of mdd during early adolescence . If mdd was first reported at 17 or 20, this was considered to represent late adolescent - onset mdd . If mdd was first reported at 24, this was considered to represent an onset of mdd during early adulthood . Body mass index (bmi) was calculated using the standard formula (weight in kilograms divided by height in meters squared). For youth at age 20 and 24, younger than age 20, growth curves from the center for disease control were used to determine obesity cutoffs (95 percentile) for each age and sex based on the average participant ages at each assessment (age 11: 23.90 for males, 24.89 for females; age 14: 26.71 for males, 27.99 for females; age 17: 28.90 for males, 30 for females). Analogous to mdd, obesity first occurring at age 11 or age 14 was combined into an assessment of obesity during early adolescence . If obesity was first present at 17 or 20, this was considered to represent late adolescent - onset obesity . If obesity was first present at 24, this was considered to represent an onset of obesity during early adulthood . Sas version 9.2 was employed to compute generalized estimating equations (gees; proc genmod) to account for the correlated observations in this sample (twins nested within families). There was little missing data because if a participant missed an early assessment, the relevant data for the missed assessment were obtained in a subsequent assessment . In cases where a data point was missing first, prevalences of the onset of each disorder during each developmental period, as well as anytime prior to the final assessment, were computed and compared across sex using gees . Next, in order to examine cross - sectional associations between these disorders, tetrachoric correlations were conducted (reported with asymptotic standard errors) to describe the associations between mdd and obesity with onsets occurring within each developmental stage (early adolescence, late adolescence, and early adulthood), as well as onsets anytime prior to the final assessment . For the prospective (i.e., across time) analyses that were the focus of our study, because of our interest in disorder onsets (rather than the recurrence or persistence of disorders), some participants were eliminated from certain analyses due to their having earlier onset of the disorder . For example, if a participant experienced mdd prior to age 14, he / she was not included in analyses predicting obesity onsets in early adulthood from mdd onsets between 14 and 20 (because the mdd onset had been experienced prior to that). For the prospective analyses, the first examined the overall effect of one disorder on the other, adjusting for the effect of gender . The second included a disorder - by - gender interaction term in order to assess the significance of gender differences in the effect of the independent variable on the dependent variable . First, we examined whether the occurrence of obesity by age 14 predicted the development of mdd (1) during late adolescence, and (2) during early adulthood . Second, we examined the association between obesity first developing during late adolescence and the onset of mdd in early adulthood . Next, we examined the opposite directions of effect: mdd by age 14 predicting the development of obesity (1) during late adolescence and (2) during early adulthood; and mdd first developing during late adolescence and the onset of obesity in early adulthood . For inclusion in the analysis, participants were required to have data at the oldest assessment point within each developmental period (age 14 for early adolescence, age 20 for late adolescence, and age 24 for early adulthood). Data were occasionally missing at the younger assessment point (age 11 for early adolescence and age 17 for late adolescence). If a participant missed one of these assessments, when he or she returned, mdd was assessed since the previous visit to the study; therefore, these entire developmental periods were covered . For obesity, the only way a case would have been missed would be if the participant first became obese and then became non - obese all within a 6-year period . Prevalences of the onset of each disorder during early adolescence, late adolescence, and early adulthood, as well as at any time prior to age 24, are presented in table 1 separately by gender . Turning to the bottom 3 rows, by age 24, lifetime rates of mdd (26.5% males, 36.4% females) and co - occurring mdd and obesity (7.8% males, 11.9% females), but not obesity considered alone (25.7% males, 27.5% females), differed by gender, with women having higher rates than men . Turning to specific developmental stages, gender differences were evident for mdd in late adolescence (12.0% males, 18.9% females) and early adulthood (7.6% males, 12.3% females), with females showing higher rates than males . As can be seen from table 1, the co - occurrence of the onsets of the two disorders at each developmental stage was uncommon, never attaining a rate higher than 1.8% for either gender, and thus did not occur with sufficient frequency to justify computing odds ratios . By age 24, the lifetime occurrence of obesity and mdd was significantly correlated (r=.14, se=.05, p<.05). However, of particular interest was how the correlation between these conditions varied with development; we expected that there would be stronger correlations at younger, compared to older, ages . Mdd and obesity were significantly correlated if both occurred by early adolescence (r=.20, se=.08, p<.05), but the correlation was not significant when mdd and obesity first occurred in late adolescence (r=.03, se=.09) or in early adulthood (r=.09, se=.11). As can be seen from table 2, obesity that developed by early adolescence did not significantly predict the onset of mdd anytime during the follow - up period (during late adolescence or early adulthood), though there was a trend for early adolescent obesity to predict the onset of mdd during the late adolescent period . Obesity that developed in late adolescence did predict the onset of mdd in early adulthood among females (a gender - by - obesity interaction effect; figure 1). As can be seen in table 2, mdd that developed by early adolescence predicted the onset of obesity in late adolescence among females (a gender - by - mdd interaction effect; figure 2). Mdd that developed in late adolescence did not predict the onset of obesity in early adulthood . Prevalences of the onset of each disorder during early adolescence, late adolescence, and early adulthood, as well as at any time prior to age 24, are presented in table 1 separately by gender . Turning to the bottom 3 rows, by age 24, lifetime rates of mdd (26.5% males, 36.4% females) and co - occurring mdd and obesity (7.8% males, 11.9% females), but not obesity considered alone (25.7% males, 27.5% females), differed by gender, with women having higher rates than men . Turning to specific developmental stages, gender differences were evident for mdd in late adolescence (12.0% males, 18.9% females) and early adulthood (7.6% males, 12.3% females), with females showing higher rates than males . As can be seen from table 1, the co - occurrence of the onsets of the two disorders at each developmental stage was uncommon, never attaining a rate higher than 1.8% for either gender, and thus did not occur with sufficient frequency to justify computing odds ratios . By age 24, the lifetime occurrence of obesity and mdd was significantly correlated (r=.14, se=.05, p<.05). However, of particular interest was how the correlation between these conditions varied with development; we expected that there would be stronger correlations at younger, compared to older, ages . Mdd and obesity were significantly correlated if both occurred by early adolescence (r=.20, se=.08, p<.05), but the correlation was not significant when mdd and obesity first occurred in late adolescence (r=.03, se=.09) or in early adulthood (r=.09, se=.11). As can be seen from table 2, obesity that developed by early adolescence did not significantly predict the onset of mdd anytime during the follow - up period (during late adolescence or early adulthood), though there was a trend for early adolescent obesity to predict the onset of mdd during the late adolescent period . Obesity that developed in late adolescence did predict the onset of mdd in early adulthood among females (a gender - by - obesity interaction effect; figure 1). As can be seen in table 2, mdd that developed by early adolescence predicted the onset of obesity in late adolescence among females (a gender - by - mdd interaction effect; figure 2). Mdd that developed in late adolescence did not predict the onset of obesity in early adulthood . The results of this study indicate that there appear to be developmental as well as gender differences in the association between mdd and obesity . Mdd occurring by early adolescence predicted the development of obesity in late adolescence among females . Conversely, obesity with an onset during late adolescence predicted the onset of mdd in early adulthood among females . In addition, mdd and obesity developing by early adolescence were cross - sectionally associated with each other; this effect was not present at later ages . The results of this study were consistent with our expectations and highlight the importance of the adolescent period in the development of comorbidity between these disorders . Regarding cross - sectional associations, we anticipated that these disorders would be more strongly related at younger, compared to older, ages, and mdd and obesity with onsets during childhood and early adolescence were cross - sectionally related while disorders with later onsets were not . It is important to note that within this key developmental period (i.e., by age 14), we do not know which disorder developed first, or whether they developed simultaneously . The prospective results were also consistent with expectations, with each disorder during adolescence predicting the later onset of the other disorder among females . The earliest - onset cases of mdd appear to be most predictive of later obesity for girls; this could be for any of the reasons discussed earlier, including the still - developing eating and activity habits of young people or the symptom differences between childhood mdd and mdd in adults . Interestingly, the earliest - onset cases of obesity were not the most predictive of later - onset mdd, though they were concurrently associated with mdd . Although obesity by early adolescence (age 14) did not significantly predict the later onset of mdd (though this effect was significant at a trend level, with obese early adolescents being at 1.5 times the risk of non - obese adolescents for developing mdd in late adolescence, and no significant gender difference in this trend), obesity developing during late adolescence (1420) was particularly predictive of the later onset of mdd among females . Perhaps body - related insecurities and/or peer pressure relating to body shape and weight are at a height during this late adolescent period (when the pressure to conform to peer norms is high and dating relationships are forming) and therefore young women who experience the onset of obesity during this time are particularly vulnerable to the subsequent onset of mdd . Considering lifetime diagnoses by age 24, both mdd and co - occurring mdd and obesity were more prevalent among women . Significant gender interaction effects were found for prospective associations in both directions, with the increased risk for the other disorder being found among young women specifically . For example, obesity may be a more stigmatized condition among females and/or women may be more likely to eat to cope with negative feelings than men . Interestingly, inspection of prevalences (figures 1 and 2) indicates that males with either earlier disorder were at slightly decreased risk for the development of the other disorder; this may indicate the presence of significantly different pathways for the development of these disorders among males and females . The results of this study are broadly consistent with prior prospective research that used study - assessed mdd and obesity diagnoses . Specifically, richardson and colleagues found that mdd between 11 and 15 was not associated with obesity at 26, though later mdd (between 18 and 21) was for females . We also found that effects were strongest on the adjacent developmental period (early to late adolescence for the mdd to obesity pathway). However, we did not replicate their effect of mdd between 18 and 21 (similar to the latter half of our late - adolescent period) on later obesity in females; the reasons for this difference are unclear but may relate to richardson et al.s examination of the occurrence of mdd and obesity, not specifically the first onsets of these disorders . The results of this study imply that prevention efforts aimed at both of these disorders in childhood and adolescence may be fruitful in decreasing the prevalence of this form of comorbidity . In particular, preventing mdd by early adolescence has the potential to decrease the later onset of obesity, and preventing the development of obesity during later adolescence (and perhaps early adolescence as well, given the trend - level effect found for that period) has the potential to decrease the prevalence of early adult - onset mdd, particularly among women . For example, if decreased activity among depressed youth moderates this association, then encouraging young girls with depression to exercise and/or participate in sports as they are being treated for depression may prevent the later onset of obesity . Although we found differences in the associations between these disorders depending on whether we examined the period from early adolescence to late adolescence or late adolescence to early adulthood, our methodology did not allow us to directly test for the presence of developmental differences (e.g., by examining age interaction effects, as we did to test for gender differences). Therefore, it is possible that the differences in significance that we found by developmental stage are not indicative of true developmental differences . For instance, although obesity first occurring in late adolescence was strongly associated with increased odds of mdd (or=2.83), obesity occurring by early adolescence showed a weak association with mdd (or=1.53) that just missed significance (see table 2). As we have noted above, from this we would not conclude that risk is only elevated in late adolescence . However, a somewhat different picture emerged for mdd as a risk factor for obesity, especially in girls . The interaction effect for mdd by early adolescence leading to obesity was significant, indicating that the risk was especially elevated for girls (or=3.76). For mdd first occurring in late adolescence, the interaction effect was not only not significant, but in the opposite direction, indicating that for girls, mdd was associated with non - significant but slightly reduced risk of obesity . Although this pattern of results cannot rule out that mdd first occurring in late adolescence is associated with elevated risk for obesity, it nonetheless offers plausible support backing the hypothesis that the key risk period in the mdd to obesity association is in early adolescence for girls in sum, until other research directly examines interaction effects by age, it is important to consider the developmental differences we found to be tentative . It is not clear how these results would generalize to other samples; however, other research has not found different associations between these disorders among african - american and white adolescents and our sample was representative of the state of minnesota at the time these participants were born . In sum, the results of this study indicate that among women, mdd occurring by early adolescence predicts the later onset of obesity . Conversely, adolescent - onset obesity among women (perhaps particularly obesity with an onset in late adolescence) predicts the later onset of mdd . In addition, the onsets of these disorders are cross - sectionally associated in childhood and early adolescence, but not later . Research investigating possible mechanisms accounting for these differing associations in different developmental periods would be useful . In addition, studies examining prevention and treatment efforts focusing on early - onset cases of mdd and adolescent - onset cases of obesity are warranted, as these may be most likely to reduce risk for the later development of the other disorder.
A 94-year - old woman was referred to the general internal medicine service for functional decline secondary to longstanding knee pain . Her medical history included osteoarthritis and her surgical history was significant for a right total knee arthroplasty in 1996 . On examination, her vital signs were normal; she was afebrile, but her right knee was red, warm and swollen . Her initial blood work showed an erythrocyte sedimentation rate of 54 mm / h (normal 0 mm / h to 27 mm / h), a c - reactive protein level 52.6 mg / l (normal 0 mg / l to 1 mg / l) and a white blood cell count of 6.210/l (normal 4.010/l to 10.510/l). A plain radiograph of the knee demonstrated loosening of the tibial component, with a large joint effusion believed to show metallosis a deposition of metallic debris in the periprosthetic soft tissues from abrasion of metallic components (1). An aspirate of the knee revealed calcium pyrophosphate crystals, with a total nucleated cell count of 11.310/l and differential of 97% neutrophils . Later, an enrichment broth subculture of the aspirate demonstrated growth of a gram - positive bacillus, which was identified as a lactobacillus species based on the following results: unidentifiable profile on rapid ana ii panel (oxoid canada), catalase - negative, pyr - negative, lap - negative and vancomycin resistance . She presented six weeks later with escherichia coli bacteremia arising from an acute urinary tract infection . A reassessment of the right knee showed a marked increase in swelling with persistent pain and tenderness . Infectious diseases was subsequently consulted to comment on the significance of the lactobacillus species that had grown on culture from the previous admission . A second aspirate was requested and grew the same organism, which was identified as a lactobacillus species . Of note, there were no calcium pyrophosphate crystals apparent in this aspirate and the total nucleated cell count and differential were 3.110/l and 96% neutrophils, respectively . The isolate was sent to the ontario public health laboratory (toronto, ontario) for identification using 16s ribosomal rna sequencing (2). 16s ribosomal rna sequencing revealed that the organisms from both knee aspirate cultures were identical and were subsequently identified as weissella confusa . Susceptibility testing of the organism from both isolates was performed using the agar dilution method and minimum inhibitory concentrations for various antibiotics are summarized in table 1 . Weissella was first described as a new genus in 1993 and was named after norbert weiss, a german microbiologist known for his contributions to lactic acid bacteriology . It is identified using 16s ribosomal rna sequencing to differentiate it from other organisms such as lactobacilli and other members of the family leuconostocaceae (3,4). Usual phenotypic identification methods have been shown to be ineffective and often lead to misidentified organisms (4). Fourteen species in total have been identified, of which two w confusa and weissella cibaria are clinically important because of their ability to infect human hosts and intrinsic resistance to vancomycin . Weissella species are alpha - hemolytic, gram - positive coccobacilli that typically grow in chains and are catalase negative and bile esculin positive . What differentiates w confusa and w cibaria are the acidification of different sugars (5). It was named confusa because it was often mistaken for members of the leuconostoc, pediococcus and lactobacillus genera (3). W confusa has a widespread environmental distribution and has been found in a variety of foods including sugar cane, carrot juice, milk, fermented meats, garlic mix and banana leaves . Congruently, it can be part of the normal microflora of the human intestine and can be found in human stool (4). Infection and immunocompromised, revealing a total of 19 cases in the english literature: 15 with bacteremia, two with endocarditis, one with osteomyelitis and one with a thumb abscess (table 2) (412). To our knowledge, we present the first case of a prosthetic joint infection caused by w confusa . In the largest case series, lee et al (10) reported 10 patients with bacteremia in a tertiary care centre in taiwan . Risk factors for invasive infection in this series included an immunocompromised host, central line catheter insertion and concurrent polymicrobial bacteremia . These findings were similar to case reports by harlan et al (8) and salimnia et al (12), who identified bacteremia in patients with hepatocellular carcinoma post - liver transplant and acute lymphocytic leukemia undergoing autologous stem cell transplantion, respectively . Other case reports have included risk factors for immunocompromised states, which consisted of chronic alcoholism, previous long - term steroid use and severe burn patients (7,12). Similarly, gastrointestinal manipulation via endoscopy or surgery may be one of the routes of translocation into the bloodstream because six of the reported 19 cases had documented medical procedures within three months of infection (811). W confusa is intrinsically resistant to vancomycin and exhibits high minimum inhibitory concentrations (412). This is important to recognize because clinicians often use vancomycin empirically as a treatment option in the immunocompromised patient when cultures initially reveal a gram - positive organism in the blood . This can be fatal in cases in which recognition of the organism is not identified in a timely fashion . Studies have reported high levels of resistance to trimethoprim / sulfamethoxazole, metronidazole, teicoplanin, ceftazidime and ceftriaxone . In general, penicillin, clindamycin, erythromycin, daptomycin and the fluoroquinolones are effective agents for treating w confusa infections (10). What was unique to our case was the lack of predisposing factors in our patient . While the patient did have evidence of a concomitant e coli bacteremia at her second presentation, she had already grown w confusa from the first aspirate of her knee six weeks previously . She received a one - week course of levofloxacin for her e coli bacteremia, which unfortunately, provided minimal clinical benefit to her prosthetic knee infection . She was discharged from hospital and returned to her long - term care facility in stable condition . Given her premorbid state and nonambulatory status, it was decided in discussion with the patient and her family to not pursue further medical or surgical therapy for her prosthetic joint infection . W confusa is a rare, but well documented, cause of invasive infection in humans . W confusa infection can be treated with a variety of antimicrobials such as penicillins and fluoroquinolones; however, it exhibits intrinsic resistance to vancomycin.
One of them is that development is the increase in production, promoting the health and therapeutic services level, and eliminating problems . Therefore, development as it is considered by people and national institutions is a complicated and multidimensional process that requires changes in social structure, accelerating economic growth, reducing inequality, eradicating poverty, establishing social justice and equality, and environment stability . Therefore, in order to achieve development, identifying developed and undeveloped regions is of great importance in the first step (1). Codifying and establishing development and success strategies in implicational and executive plans, studying and recognizing capabilities and shortcomings and deficiencies, determining development levels in regions based on a set of appropriate indexes are inevitable requirements through which executive managers will become enable to identify development strategies based on needs and specific conditions in each and propose plans consistent with the conditions in each region (2,3). Assessing and evaluating and determining priorities help executive managers meet necessary needs more quickly . Health and therapy section is one of the sections in which prioritizing for meeting needs regarding resources limitation is essential (4). Inequality and its dimensions are indexes of underdevelopment because in fact countries are considered developed that have high economic and social indexes and the distribution of incomes and revenues and facilities is rather equal in them while in undeveloped countries the amounts of these indexes are low and there is inequality in their distributions (5). Numerous indexes are considered for assessing development level with the limitations in a time interval or period and place range . There has been a lot of efforts to define and design an appropriate instrument which is an indicator of the socioeconomic status of people in a society (7, 8). For example, australian researchers believe that using an index such as the validity of residency place for determining the socioeconomic status of individuals is very questionable . Therefore, it is necessary to use different indexes for determining the socioeconomic status . Among these different development indexes, health care index is one of the most important indexes of progress and development in any country due to its significant role in providing the society s health and the success of national development programs depends highly on achieving these aims (9). A transient look at the health indexes in the country in the past decade shows the fast growing trend of the promotion of the indexes on one hand and inequalities in some indexes in different regions and provinces in the country on the other hand . It is necessary that in iran like in any developing country, special attention should be paid to the development of health and therapy section in order to improve the country s development status and position among other countries in the world since development in this section is the prerequisite for the development in other sections of the society . Nowadays, the issue of development is a big concern in many countries . In other words, development is nothing more than making the living status and conditions more satisfying for people (10). A lot of studies have been done about ranking the level of health indexes of development using statistical methods and mathematical patterns . In a research, regions of portugal were assessed and ranked regarding development using factor and cluster analysis techniques in the time intervals of 1991 and 1995 (11). In studies by soares et al . (11) in portugal and yanis and andriant (12), regions are ranked using health and economy indexes by factor analysis and clustering and fuzzy logic models . Despite all criticisms to using quantitative models in city issues since 1970, mathematic models can give a clearer picture and understanding of city phenomena if they are established and codified in simple frameworks with limited number of variables . Standardized score and moriss s models are among quantitative models for assessing and ranking regions . Standardized score model is used for comparing indexes and obtaining a single index from the combinatory results of the indexes . In fact, the standardized score model can uncover main differences among regions regarding the determined indexes (13). Morris model is also introduced as a model for ranking regions in terms of development by civil program of the united nations organization which is the most recent official model applied at an international level and is capable of being developed, replaced, and applied in the planning environments with various different scales . Therefore, for achieving this goal and establishing social equality, it is necessary to rank regions and identify their degree or level of development regarding health and therapy indexes, determining capabilities, shortcomings, and deficiencies . The present study addresses the analysis of development levels in cities in tehran province regarding health infrastructural indexes using standardized score and morris inequality models . The present study is applied or pragmatic based on its aim and descriptive based on its nature . In this study, the cities in tehran were ranked based on health indexes in 2012 using standardized score and morris models . The studied geographic scope was tehran province and the statistical population was 14 cities in tehran . After studying the experts articles and opinions, 10 indexes were selected as health indexes including the ratio of active medical and therapeutic institutions to a population of one thousand individuals, the ratio of beds at active medical and therapeutic institutions to a population of one thousand individuals, the ratio of health therapeutic and medical centers to a population of one thousand people, the ratio of governmental public health and medical institutions to active health and medical institutions, the ratio of daily medical and therapeutic centers to active health medical and therapeutic centers, the ratio of 24-hour health medical and therapeutic centers to active health medical and therapeutic centers, the ratio of laboratories to a population of one thousand individuals, the ratio of pharmacies to a population of one thousand individuals, the ratio of radiology centers to a population of one thousand individuals, and the ratio of rehabilitation centers to a population of one thousand individuals . The required data were gathered from the statistics center and tehran university of medical sciences using a researcher - made information list including items and questions about the name of the cities, the number of active medical and therapeutic institutions, available beds, the number of health and medical therapeutic centers, the number of governmental public health medical and therapeutic centers, the number of daily health medical and therapeutic centers, the number of 24-hour health medical and therapeutic centers, the number of laboratories, the number of pharmacies, the number of radiology centers, the number of rehabilitation centers, and the population of the cities . After the completion of the lists, the development in cities was ranked and calculated using morris inequality and standardized score models in excel in 2010 . The calculations in the two methods are as follows: first, the indexes were standardized based on the city using standardized score model, as follows: which, ssij is standardized score of index i for city j, xij is amount of index i for the city j, x is mean of indexes and is standard deviation of the index i. then, the standardized score of each of the studied indexes in each city are added up together and the result is divided by the total number of indexes . The obtained score is the average of the standardized score or the development index of any city that makes the comparison regarding development status possible as a single index: which, ssi is the index for city j and n is the number of considered indexes . In morris model, the development status or position of each region among other regions is determined based on the selected indexes using the gathered information for each region . This method is used for reporting human resource development by the united nations and the obtained index is the evidence showing countries ranking regarding human resource development . In this method, the deviation of the numerical values of the index i in any region or area from the minimum of the index i among the regions or areas is divided by the range of the changes of that index, and the degree of the inconsistency or inequality of the numerical value of the index in relation to the dispersion index of its changes or variation range is computed (r = x (max) - x (min) i). (3)miiij = xijx(min)ix(max)ix(min)i which, miiij is the value of morris inequality index for i index in the region or neighborhood j, xij is the numerical value of the index i in the region or neighborhood j, x(min)i is the lowest value of the index i and x(max)iis the highest value of the index i. in the next step, the mean of the numerical values of morris inequality index for indexes in each region or neighborhood is applied as the criteria for determining the ranking or development status from the highest value (the first ranking) to the lowest (the last ranking): which, miii is development index for region or neighborhood j, and n is the number of considered indexes . In addition, for determining the developmental gap in health and therapy section in cities, 5 classifications of developed, rather developed, intermediately developed, less developed, and undeveloped were considered . Then, for determining the distance between cities in 5 levels, first the range of changes in scores was obtained using a formula and then the distance between levels was calculated by b formula and as a result the cities were classified in 5 groups . Based on the standardized score model, rey city has the best, and pishva city has the worst condition in terms of health indexes (table 1). Based on the standard score model, 28% of the cities were placed in developed group and 43% of the cities were in undeveloped group (table 2). Based on morris inequality model, rey has the best state and pishva has the worst state (table 3). Based on morris inequality model, 28% of the cities were placed in developed group and 43% of the cities were placed in undeveloped group (table 4). The first step for developing health and therapy section and reducing the gap regarding health among different regions is to achieve a thorough understanding of the condition of the healthcare sector in the region . Indexes of development in developing countries are not distributed equally in the regions and geographical zones . One of the main indexes of development is health index or in other words, the degree to which a society benefits from the health and therapeutic services and facilities . The developmental gap of these indices can be easily observed in the provinces and cities in the country . The findings showed that regarding the rate of development in the health sector, there is a deep development gap among the cities in tehran and the distribution of health services and facilities in the cities of the province seems unbalanced and unequal.for determining the development of cities in the standardized model, five levels of highly developed, developed, developing, deprived, and very deprived were considered.based on standardized score and morris inequality, only 28% of the cities were placed in the developed countries and this is in line with the results obtained by tofighi et al (14) and mirvis (15). Therefore, planners and policy makers should focus their efforts to find the cause of the gap in development.given the values of tables (1) and (3), rey city has maintained its superiority over other cities and was considered as the developed city and pishva got the last ranking for the development of health indexes.the noticeable point is that tehran is in the third ranking despite the fact that it is the capital city which indicates that the geographical location cannot be considered as the factor influencing the development of a city and this was confirmed in other studies (14).bahadori et al . (16) also investigated the ranking of the health structural indexes in golestan province using scalogram method.the results showed that there is a large gap regarding the benefits of the health structural indexes among the cities in golestan province.aqqala city with 97 points enjoyed the most and azad city with 41 points enjoyed the lowest level of the benefits of health structural indexes respectively . In this study, in the studies by nastaran (17) and zarabi in isfahan (18), amini in all the provinces in the country (19) and taghvaee in all the provinces in the country (20), similar results were obtained about the gap in enjoying the health structural indexes . Therefore, it is suggested that officials, authorities, and planners pay attention to eliminating the mentioned problems, achieving growth and equal regional development, balancing the pattern of the distribution of health services and facilities, and decentralization of them in some cities (21). The distribution of health services and facilities should be done based on the level or degree of underdevelopment in cities . In general, ranking the country s cities and provinces in health sector makes it possible for the related authorities to make more accurate planning, identify strengths and weaknesses, and prioritize resources adapted to the needs of each city and province . In summary, the results showed that statistical methods are effective tools for ranking and determining the status of development in the health sector . The results of this study concerning the allocation of the health sector resources would be useful for health planners and policy makers . Structural indexes have always been considered as one of the main factors influencing health status and life.thus, to achieve a fair, balanced, and equal state of health in the province, it is suggested to make plans and take actions based on facts and the development situation of provinces and cities in order to reduce the gap in accessing and enjoying health facilities and services among the cities.furthermore, it is suggested that in the first stages of city development, authorities need to focus on short term policies and equity in access and pay attention to the development of necessary services in developing and deprived cities over a medium and long term plan.
Road traffic crash (rtc) is the main cause of non - intentional injuries and the second cause of deaths after ischemic heart diseases in iran . It accounts for more than 10% of total mortalities and about 23,000 deaths, in average, per year during the last decade . This is approximately equal to the number of deaths caused by the 2003 bam earthquake, one of the worst natural disasters of recent decades . These facts have made the rtc as a man - made disaster and real public health concern in iran . In line with the fourth i.r . Iran's national development plan (ndp), the fifth ndp for 2011 - 2015 has emphasized on development of rural infrastructures, including rural asphalt roads . Although this development has led to more traffic in rural roads, no significant improvement is observed in safe driving behavior and construction of roads in rural areas . In addition, compared with urban areas, rural people use older cars with less safety standards . The monitoring by traffic police and coverage of emergency medical services (ems) are also lower in rural roads than main roads . This article aims to provide the iranian policy makers with information on the burden of deaths that are caused by rural rtcs and demonstrates its association with expansion of the rural roads . We applied a retrospective analysis of secondary data to demonstrate the association of rural rtcs deaths with expansion of the rural roads in iran . The variables of interest included length of road (rural and urban), number of death (caused by rural and urban rtcs) and number of population . The sources that we used for data collection were the iran's high commission of road safety (hcrs) for length of road (km), the iran's forensic medicine organization (fmo) for the number of rtcs death and the iran's statistical center for population data . International classification of diseases-10 is the basis for coding the causes of death by fmo . For the purpose of analysis, we illustrated the trends of length of rural road from 2005 to 2010 and their corresponding mortality . Rates of traffic death in rural and urban roads were also estimated per 100,000 populations . For trend was the test of significance and p <0.05 was considered as statistically significant . Spss statistical software for windows (version 11.0, chicago, il) was used for statistical analysis . The number of rtc deaths in rural roads increased from 1,672 in 2005 to 2,206 in 2010 . This was parallel to construction of the rural asphalt roads that was increased from 56,424 to 86,519 km during the same period [figure 1]. The trend analysis showed a positive association between these two variables (for trend = 3.93, df = 1, p = 0.04). Length of rural asphalt roads and number of deaths caused by rural road traffic crashes, iran, 2005 - 2010 the expansion of urban asphalt roads was also on an increasing trend from 71,711 to 77,964 km, but the number of traffic deaths in these roads decreased from 26,083 in 2005 to 21,043 in 2010 . From 2005 to 2010, adjusted for 100,000 populations, the number of traffic deaths in urban roads decreased from 37.0 to 28.0, while this number increased from 2.4 to 2.9 in rural roads [figure 2]. Our study showed an increasing trend of the rtc deaths in iran's rural roads and its positive association with expansion of the rural roads . This is while, at the same period, the rate of traffic death in urban roads was on a decreasing trend . Therefore, expansion of the road network is one of the most important prerequisites for development of economics and infrastructures in rural areas, the policy makers should take preventive measures in rural roads to improve the safe driving condition . In this line, iran's ministry of road and urban construction is the lead agency for the hcrs . Traffic police, ems and car factories are the main stakeholders of this national coordination body . To reduce the rate of deadly traffic crashes in rural roads, taking the coordinated measures by the hcrs' members the hcrs may also rely on the successful experience in decreasing the rate of urban rtc deaths . According to available literature, the risk factors of deadly rtcs in rural roads of iran are unsafe roads, excessive speed, risky driving caused by inadequate knowledge and inappropriate risk perception, no use of seat belt and using of old cars with low safety equipments . Effectiveness of the enforcement measures for control of rtcs in iran is rated six out of 10, according to the world health organization . This is expected to be even lower in rural roads as they are less controlled by traffic police compared with freeways, highways and main roads . Timely and quality provision of medical care is essential for saving lives in a rtc . In 2010, the national emergency medical service was only able to cover 15% of minor roads, including rural areas . According to national ems, in addition to the current 1,028 ems stations, rural rtc is a concern not only in developing countries like iran, but also it accounts for the considerable number of death in developed countries . For instances, in germany, britain and the us, about two third of all rtc related fatalities occur on rural roads, which score badly when compared to the high quality motorway network in those countries . All these have said, there are evidences that fortunately show how the preventive measures can be effective in reducing rural rtcs . For example, in germany, reinforcement of speed limits and development of additional passing lanes were found effective . The expansion of rural asphalt roads exposes the people of rural areas with risk of severe rtc if effective preventive measures are not taken . To prevent from this threat, the iranian policy makers need to take the followings into consideration: public awareness, improving the safety of roads and vehicles, law enforcement, increasing coverage of police and ems
This prospective interventional case series was approved by the review board / ethics committee of the ophthalmic research center of the university . Five eyes of 5 patients with diagnosis of refractory csc (lasting more than 1 year) were included in this study . Diagnosis was made by the history of recurrent blurred vision and metamorphopsia for more than one year, detection of neurosensory detachment in ophthalmoscopy and optical coherence tomography (oct), and observation of active rpe leakage in flourscein angiography . Exclusion criteria consisted of any accompanying macular disease, severe media haziness which precludes oct evaluation, and noncompliance . All eyes received a single injection of 0.05 ml (1.25 mg) intravitreal bevacizumab (avastin; genentech inc ., south san francisco, ca, usa [made for f. haffmann - la roche ltd ., basel, switzerland]) performed by a 30-guage needle through supratemporal quadrant 4 mm from the limbus under sterile condition . All patients underwent a through ophthalmic examination 1 day, 1 week, and 1, 2, and 6 months after the injection . Best corrected visual acuity (bcva) of the eyes was checked by a masked optometrist . It was changed to the logarithm of minimum angle of resolution (logmar) scale for statistical purposes and compared at months 2 and 6 with the baseline values . Central macular thickness (cmt) measured by oct (3d oct-1000; topcon corporation, tokyo, japan) was performed at presentation and repeated 6 months after the intervention . It was measured in a 1-mm circle centered on the fovea by an optician who was masked to the study . None of the patients had history of intraocular surgery, diabetes mellitus, hypertension, cardiovascular disease and smoking . An increase of bcva was noticed during the follow - up in all eyes except case 1 . Mean bcva at baseline was 0.60 0.25 that improved to 0.42 0.16 and 0.24 0.21 logmar up to the month 2 and 6, respectively . This improvement at 2 months did not reach to a meaningful level (p = 0.064); however, it was statistically significant at 6 months (p = 0.025). No recurrence was observed in any of the eyes during the follow - up period . Central macular thickness decreased significantly from 370 65 m at baseline to 210 24 m at 6 months after injections (p = 0.009) (table 2). None of the eyes had intraocular pressure rise (> 21 mmhg) or cataract progression during the follow - up period . They include acetazolamide, beta - blockers, vitamins, and non - steroidal anti - inflammatory drugs . There are some controversial recommendations in the literature on the use of laser photocoagulation in this field . Some authors reporting that laser photocoagulation shortens the duration of disease and reduces recurrence rate, while others maintain that it does not affect final vision and recurrence rate . Furthermore, laser may be associated with permanent scotoma which may enlarge over time with rpe scar expansion, as the possible development of cnv . It may hasten resolution of exudation by reducing choroidal blood flow and hence favoring cessation of leakage . Most recently, several case series have reported the use of indocyanine green guided pdt in the treatment of chronic csc . Ober et al . Reported the successful treatment of focal rpe leaks in csc by pdt in a small pilot series which showed resolution and visual improvement . Cardillo piccolino et al . Performed indocyanine green guided pdt in 16 eyes with chronic csc and treatment resulted in complete resolution of serous retinal detachment 1 month after treatment in 75% of eyes . At 3 months after pdt, 69% of eyes had visual improvement of 1 or more lines . However, 31% of their cases developed secondary rpe changes at the site of pdt, which were thought to be due to hypoxic damage caused by choriocapillaris occlusion . Our study showed a significant visual improvement and cmt reduction following single injection of ivb (1.25 mg) in 5 cases suffering from refractory csc for more than one year . In a similar study on 5 cases with csc, torres - soriano et al . Noticed an improvement in bcva, fluorescein angiographic leakage, and reduced or resolved neurosensory detachment . However, they injected 2.5 mg ivb and included cases with history of decreased visual acuity more than 3 months, recurrent episodes of csc or even acute cases with excessive discomfort about visual acuity . In a case . Showed that in cases with chronic csc ivb injection improved bcva and reduced cmt . However, they performed multiple injections of 2.5 mg ivb at 6 to 8 week intervals (range, 1 to 4 weeks). However, recurrence did not occur in any case of our study during follow up period . In summery, the present study demonstrated a promising effect of ivb in the treatment of refractory csc; however, we cannot make specific treatment recommendations based on this small, uncontrolled case series.
Epidemiological research indicates oral diseases are widespread throughout the world and evidence exists to show that their extent and severity increases with age . Perceptions of need for dental care play a key role as to whether people in general will seek dental care and that lack of need perceptions constitutes an important barrier for utilization of heath care services . Reportedly, the main benefits of dental treatment relate to improved psychological and social well - being . Thus, oral symptoms and functional and psychological impacts from oral conditions seem to be of great significance in the assessments of individuals perceived need for dental care . Frail and functionally dependent elderly people, living in long - term care facilities or at home, have special difficulties in accessing dental care because the problems of attending a dental clinic often appear insurmountable . The accessibility of the dental office is important too, especially for functionally disabled older patients . To help overcome these barriers, onsite dental equipment may facilitate access in larger nursing homes, while mobile or portable dental equipment may be the appropriate method of choice for smaller care facilities and for older people living at home . One important component in the use of services is self - perceived need for treatment . In fact, several studies have shown that self - perception is influenced by service use, such that it is greater among those who use dental services . The present aim of the study was to determine the relationship between subjective need for dental care and the equivalent clinical findings in an attempt to understand the factors that contribute to individuals perception of the need for dental care . A cross - sectional study was conducted in three old age homes in vijayawada city . All the subjects (n = 182) present in the three old age homes were interviewed with pretested questionnaire, followed by clinical examination . All subjects who were residing in homes and who were willing to participate were included in the study . Medically comprised patients and those who were not willing to participate were excluded from the study . Sudha and nageswararao sidhhartha institute of dental sciences and prior permission was obtained from the old age homes authorities . Examinations were conducted under natural day light using plain mouth mirror and community periodontal index (cpi) probe for recording oral mucosal condition, dentition status, prosthetic status, and periodontal status using modified world health organization (who) proforma . The questionnaire consists of dental behavior (last visit, reason for the last visit) and self - rating of oral health their teeth and mouth . The answers to the questions were structured on a five - point likert - scale (excellent, very good, good, poor, and very poor). Functional impacts included questions regarding the impact of oral problems such as difficulty in speaking, eating, smiling, sleeping, and relaxing . During the clinical examination by using who proforma, the oral mucosal condition, prosthetic status were also noted . Examiner calibration was performed in the department of public health dentistry under the guidance of head of department . Table 1 illustrates the distribution of study subjects based on sociodemographic variables (age, gender, occupation, source of income, and type of institution). A total of 93.4% of subjects are unemployed and 95.5% of the study population is dependent on their children for daily expenses, 45.05% are staying in free institutions and 54.95% are staying in a paid institution . Table 2 shows distribution of study subjects based on previous dental visit and self - perceived needs . In regard to their present condition of mouth and teeth, 65.4% of subjects perceived that it is in a good state, while only 0.5% perceived it as poor . (p value 0.03) in respect to the perceived oral symptoms, 61.9% of subjects complained of hypersensitivity, 23.1% of subjects were having toothache, and 80.5% subjects were having difficulty in eating . The decayed missing filled teeth (dmft) scores showed the mean number of sound teeth was 9.22, decayed teeth was 1.89, missing teeth due to caries was 6.48, and missing due to other reasons was 7.13 . The overall mean of decayed, missing, and filled is 8.37 [table 3]. Among study subjects, 86.2% are not having any prosthesis, 9.9% had a partial denture, and 3.8% had a full denture (p value 0.02). A total of 12.1% of subjects required full prosthesis, 60.4% required multiple denture, and 9.9% required a combination of prosthesis [table 4]. Distribution of study subjects based on sociodemographic variables distribution of study subjects based on previous dental visit and self - perceived needs distribution of study subjects based on previous dental visit and dentition status distribution of study subjects based on previous dental visit and prosthetic status and prosthetic needs the results from the present study indicate that 54.4% of the elderly people perceived a need for dental treatment . Present study shows a greater percentage of need when compared with studies conducted by ekanayake and perera (46%) and slauther and taylor (43%). The reason in this difference could be some factors such as demographics, predisposition, and oral health condition . Chisick et al ., conducted a study to know the factors influencing perceived need of dental care active in u.s . The study showed that self - perception was greater among those who had not used dental services . In another study done by gilbert et al ., to understand the perceived need for dental care in dentate older adults, he concluded that perception for dental needs was greater among those who had used dental services . Individuals usually give greater importance to the symptoms, functional and psychological impact of oral diseases than to the visible signs of the disease . This was also evident in the present study, since perceived need for dental treatment was associated with worse perception of oral health condition and oral appearance, and to worse perception of chewing capabilities . A positive association between pain and self - perceived need for treatment is found in the present study and the results of this study is in accordance with the study conducted by ekanayake and perera in srilanka . Medically compromised patients were excluded from the study due to the sole reason that the existing debilitating disease may influence the sensory and the motor perception and function of the particular individual which may have an impact on the outcome of the study . Out of whole sample, 12.1% of subjects require full prosthesis, 60.4% required partial denture, 9.9% require a combination of prosthesis, and the edentate elderly people presented lower frequency of self - perceived need for dental treatment, possibly reflecting a certain accommodation with their edentate situation . Edentulism is prevalent among older people all over the world and is highly associated with socioeconomic status . Epidemiological studies show that persons of low social class or income and individuals with little or no education are more likely to be edentulous than persons of high social class and high levels of income and education . Results from the present study showed that there is a big discrepancy between self - ratings of satisfaction with oral health and clinically diagnosed treatment needs . These results are in accordance with the previous studies conducted by gilbert et al ., jokovic and locker, heft et al ., kaplan and baron - epel, ekanayke and perera, and underlines the limits of only clinical estimation of need . This is mainly due to the fact that clinical measures determine the extent of the disease and not its severity and, therefore, are not always associated with symptoms that the patient may or may not report . Subjective evaluation of oral health and oral disadvantage has a greater association with the reports of dental need compared with the presence of active disease . This underlines the perception that disease is something that individuals feel and experience and not just a pathological procedure . Higher prevalence of both untreated decay and unmet treatment needs was associated with lower utilization of dental care for dentate subjects . Paying for dental care, transportation difficulties, and poor health this study provided further understanding of the discrepancy between perceived need for dental care and clinically diagnosed dental problems . Self - perceived need for dental treatment suggests that health education should be stimulated . In this way, it would be possible to improve individuals capacity to carry out oral self - examination and to identify nonpainful signs and symptoms of oral diseases at an earlier stage, and to correlate these with the need for dental treatment . The results give insight into the role of normative need and significance of certain signs and symptoms on the patient's perception of dental need . These people require education, motivation regarding prevailing dental problems, and program for treating the problems faced by them.
Infectious diseases are a major reason for the health disparity between rich and poor countries (stiglitz and jayadev, 2010). They kill 14 million people worldwide every year, predominantly affecting members of poor populations in developing countries [world health organization (who), 2001]. In fact, these countries bear 98% of the global disease burden for infectious diseases, such as malaria, trachoma, lymphatic filariasis or schistosomiasis (who, 2008). Reasons for this public health tragedy can be understood as a combination of market failure with respect to drug development and public health policy failures . One strand of literature on the latter topic suggests that international harmonisation of patent policies and drug safety regulations are potential obstacles to improving the health situation in developing countries (kremer, 2001; trouiller et al ., 2001). It identifies lacking education, weak legal frameworks or faulty allocation of medical staff as the fundamental challenges (who, 1996; travis et al ., 2004). While addressing these issues may contribute to reducing the disease burden in poor countries, the focus of the present article lies on the analysis of the market failure of the drug development paradigm; lifesaving essential medicines either do not exist or badly need improvements to meet the developing countries needs (mrazek and mossialos, 2003; kremer and williams, 2010). The question of whether different policy approaches under other institutional arrangements are suitable to address this market failure is beyond the scope of this article . Under current market conditions, the pharmaceutical industry has little incentive to invest in research and development (r&d) for infectious diseases that predominantly plague poor nations, as medicines cannot be sold there at a price that would allow pharmaceutical firms to cover their high r&d costs (buckup, 2008). There is a significant positive relationship between a pharmaceutical firm's expected returns and its r&d expenditures (grabowski and vernon, 2000). Furthermore, acemoglu and linn (2004) suggest that pharmaceutical r&d is directed towards more profitable markets . In fact, the pharmaceutical markets in the poorest countries are too small to trigger significant r&d for medicines for neglected infectious diseases that are prevalent in these countries (maurer, 2005). Although a large number of consumers in the developing world lack effective medicines for such diseases, their purchasing power is too low to generate a sufficiently large market (kremer, 2002). Under these circumstances, pharmaceutical companies decide that the return on r&d investment for neglected infectious diseases will be less than the return on an equivalent investment for medicines for the developed world (webber and kremer, 2001). Although the infectious diseases that are the most prevalent in poor nations account for 11.4% of the global disease burden, only 1% of all pharmaceutical products marketed in the period from 1975 to 1999 were targeted at them (trouiller et al ., 2002). The introduction of patent protection in the developing world is not a sufficient solution to the problem of underinvestment in r&d for neglected diseases (kremer, 2002). Even if patent protection provided an adequate incentive mechanism to successfully stimulate r&d, patented medicines may still not be affordable for large groups of consumers in poor countries (kremer and glennerster, 2004). In this article, we analyse which incentive mechanisms mitigate the problem of underinvestment in r&d for medicines for neglected diseases . Figure 1 provides an overview of the push and pull programmes and selected examples as discussed in the article . While both types of programmes aim to increase the incentives to allocate resources into neglected disease research, they differ in their approaches . While push programmes such as r&d tax credits aim to reach their goal by subsidising research inputs, pull mechanisms, such as prizes, patent buyouts or advanced purchase commitments (apcs) rather reward research output . We explain the different incentive mechanisms in detail and provide a discussion of related advantages and disadvantages for each alternative . In particular, we analyse the question of whether push programmes may provide the basis for subsequent applied research in the pharmaceutical industry by promoting basic (non - patentable) research . In addition, we analyse the conditions under which pull mechanisms may help to reduce market uncertainty and increase the expected market for targeted drugs or medicines for neglected diseases.figure 1push and pull r&d incentive programmes and selected examples push and pull r&d incentive programmes and selected examples we selected the programmes under study on the basis of four criteria . First, we evaluated the academic relevance of each proposal in terms of quality and originality of the contribution . In particular, we addressed the question of whether pilot projects already exist that passed the market test . Third, and most importantly, we investigated the potential of each proposal to increase r&d incentives for neglected diseases by comparing the advantages and shortcomings of each policy option . Therefore, the scientific level of the discussion on these advantages and shortcomings was an important (fourth) criterion for including a proposal in our analysis . Programmes that subsidise research inputs through direct funding, such as research grants to universities and government laboratories or tax credits for r&d investment, are called push programmes . Current push programmes aimed at promoting r&d in malaria research are the medicines for malaria venture and the malaria vaccine initiative . Large publicly funded research institutions, such as universities or the us national institutes of health, play a significant role in promoting basic research (glennerster and kremer, 2001). They help to create non - patentable fundamental scientific knowledge, which provides a base for downstream discoveries of the profit - seeking pharmaceutical industry (maurer, 2005). This publicly available fundamental scientific knowledge generated by publicly funded research institutions reduces the research costs incurred by the pharmaceutical industry . It thereby potentially increases private incentives to invest in applied research (webber and kremer, 2001). However, negative experiences with publicly funded programmes in financing the commercial r&d of marketable pharmaceutical products suggest that push programmes are subject to difficulties resulting from information asymmetries between researchers and government research administrators (kremer, 1998). Moral hazard problems may arise because government research administrators cannot perfectly monitor research activities (kremer and glennerster, 2004). Researchers, once they are funded, may have incentives to redirect their resources to non - core research activities, directing their efforts towards unrelated and more rewarding research projects or towards preparing the next grant application (webber and kremer, 2001). The effective management of the performance of researchers, together with reputation effects and the contingency of future funding on previous performance, may help to mitigate moral hazard problems (gallini and scotchmer, 2002). Difficulties in determining the quality of research are likely to arise because these programmes pay for research inputs on the basis of an ex ante evaluation of potential product delivery, not on the basis of successful product development (maurer, 2005). Researchers have better information about the probability of success of a research programme than do government research administrators (kremer and glennerster, 2004). They may, therefore, have incentives to act opportunistically by overestimating the probability of success of the research programme in order to acquire the funding in the first place or to increase the amount awarded (hollis, 2007). However, due to the lack of appropriate information, government research administrators may be unable to determine which research projects should be funded or which diseases should be targeted (kremer, 2002). Hence, asymmetric information with respect to the probability of success of research projects may result in the funding of projects that only have a small probability of success (kremer and glennerster, 2004). Even worse, government research administrators may decide not to fund a worthwhile research project with a high probability of success because they doubt that the project's probability of success is credible (kremer, 2002). These problems can be diminished if a private pharmaceutical firm or research institution is only paid by a government agency after it has successfully developed a specific marketable pharmaceutical product . In this case, researchers will have strong incentives to evaluate the likelihood of success of their research projects more realistically and to focus on the development of the desired product (kremer and glennerster, 2004). In addition to the publicly funded research institutions mentioned above, a number of product development partnerships (pdps) have emerged in recent years . Pdps are long - term collaborations between partners from academia, the public sector and pharmaceutical companies that target the development of new medicines . Table 1 provides an overview of selected major pdps with a special focus on the development of vaccines and medicines for neglected diseases.table 1selected examples of product development partnershipsname (acronym)targeted diseasestotal expenditure 2010 in usdaerastuberculosis51.6 millioncontraceptive research and development programme (conrad)hiv / aidsn / adengue vaccine initiative (dvi)denguen / adrugs for neglected diseases initiative (dndi)chagas disease, helminth infections, human african trypanosomiasis, leishmaniasis, malaria, paediatric hiv30.9 millioneuropean vaccine initiative (evi)chagas disease, dengue, hiv / aids, leishmaniasis, malaria, tuberculosis15.7 millionfoundation for innovative new diagnostics (find)human african trypanosomiasis, leishmaniasis, malaria, tuberculosis25.7 millionglobal alliance for vaccines and immunisation (gavi)pneumococcal disease, haemophilus influenzae type b, yellow fever, hepatitis b, diphtheria, tetanus, pertussis899.0 millioninfectious disease research institute (idri)chagas disease, leishmaniasis, leprosy, malaria, pandemic influenza, tuberculosisn / amedicines for malaria venture (mmv)malaria55.3 milliontb alliancetuberculosis46.3 millioninstitute for one world health (iowh)diarrheal diseases, malaria, soil - transmitted helminthiasis, visceral leishmaniasis17.8 millioninternational aids vaccine initiative (iavi)hiv / aids88.0 millionaids = acquired immunodeficiency syndrome; hiv = human immunodeficiency virus . Source: annual reports and official internet sites of the selected pdps; buckup (2008). Note: amounts marked by * were converted from eur to usd using the purchasing power parity rate as of 31 december 2010 . Selected examples of product development partnerships aids = acquired immunodeficiency syndrome; hiv = human immunodeficiency virus . Source: annual reports and official internet sites of the selected pdps; buckup (2008). Note: amounts marked by * were converted from eur to usd using the purchasing power parity rate as of 31 december 2010 . In contrast to publicly funded research institutions, targeted r&d tax credits are a direct contribution to pharmaceutical companies, designed to promote r&d in specific neglected diseases (hall and van reenen, 2000). R&d tax credits finance research inputs rather than research outputs (kremer and glennerster, 2004). In the united states of america, for instance if a neglected disease also qualifies as an orphan disease, for example, due to its low disease prevalence in the united states, as is the case with malaria or tuberculosis (grabowski, 2005), a tax credit of as high as 50% on clinical development costs is possible . The us orphan drug act, which addresses these issues will be further explained in section 3 of this article . The private returns to r&d for neglected diseases are much lower than the social returns to r&d for these diseases (lybecker and freeman, 2007). Under these conditions, however, as targeted r&d tax credits subsidise research inputs for a specific pharmaceutical product rather than rewarding successful product development, they are subject to monitoring problems similar to those for other push mechanisms (kremer, 2001). Pharmaceutical companies may have incentives to use their superior knowledge relative to government agencies to maximise their claims through creative accounting (kremer and glennerster, 2004). As for r&d for medicines for neglected diseases, for example, a malaria vaccine suitable for consumers in poor regions, r&d tax credits may present a number of issues (mrazek and mossialos, 2003). A targeted r&d tax credit could be claimed by a pharmaceutical company pursuing r&d for versions of the pharmaceutical product that are not appropriate for poor countries (kremer and glennerster, 2004). Suppose that a pharmaceutical company claims a targeted tax credit for r&d for a malaria vaccine . The health needs of residents in low - income countries with respect to a malaria vaccine significantly differ from the health needs of residents in high - income countries: a malaria vaccine appropriate for travellers or military personnel, who only spend a limited period of time in an endemic region, may have different characteristics than a malaria vaccine appropriate for residents, who live in those regions permanently (kremer, 2002). They cannot mitigate the problem that residents in poor regions do not have access to affordable medicines (kremer and glennerster, 2004). Given the dearth of r&d for medicines for neglected infectious diseases, direct public funding of basic research into these diseases could be an appropriate option to provide a base for downstream discoveries in the pharmaceutical sector . Moral hazard and adverse selection problems suggest that push programmes may not be the optimal solution to finance the development of marketable pharmaceutical products . Push programmes are, however, suitable to promote basic research and provide a basis for subsequent applied and commercially exploitable research . Additional mechanisms are necessary to encourage private pharmaceutical companies to develop medicines for neglected infectious diseases and to improve affordable access to those medicines for residents of low - income countries . In contrast to push programmes, pull programmes such as prizes, apcs and patent buyouts reward research output rather than research input . A targeted prize is a payment that is made to a researcher conditional on the achievement of a particular outcome, that is, a technical specification of a desired drug or vaccine (maurer, 2005). Non - profit organisations have recently identified prize challenges as tools to create incentives that foster r&d in the pharmaceutical field . For instance, prize4life set up two challenges to promote r&d on amyotrophic lateral sclerosis (als, also known as lou gehrig's disease). With respect to neglected infectious diseases, the x prize foundation and the bill & melinda gates foundation are currently developing an x prize challenge for the effective diagnosis of tuberculosis in the developing world, where the world's second most lethal infectious disease is most prevalent . Love and hubbard (2007) promote a radical rethinking in the field of pharmaceutical innovation policy, suggesting a mandatory prize mechanism as an alternative to the marketing monopolies constituted by patents . The basic idea of the medical innovation prize fund is to divorce the incentive for innovation from the product's price to consumers so that knowledge goods, including the r&d for a new medicine, can be placed in the public domain immediately (love and hubbard, 2007: 1528). The reward shall only be given if an innovation has made a significant impact on public health . This would lead to open innovations, yet still reward innovators financially (provided that patients benefit from the new drug). An example of such a mechanism is the prize fund introduced by former us representative b. sanders, called the medical innovation prize act, based on proposals by love and hubbard . The total size of the proposed fund was to be 0.5% of the us gross domestic product . The prize fund would have been structured to target diseases that predominantly affect poor nations, with a minimum initial allocation of 4% for globally neglected diseases . Hollis and pogge (2008) promote a voluntary prize fund named the health impact fund (hif), which is designed as a supplement to the existing system of patent protection . In this optional pay - for - performance scheme for new medicines, pharmaceutical companies would be free to abandon monopoly pricing (but not their exclusivity right deriving from a patent) and instead participate by registering products with the hif, which would reward them in proportion to the measurable net health impacts of their products . Rewards would be conditional on the products being priced (roughly) no higher than the average cost of production (pogge, 2010). Participating states would act as funding partners . As for the nature of the payment, there are two design options . The first option is a fixed pool to be split among the innovators according to the product's health impact; the pool might be guaranteed for, say, 15 years . This would make the cost of the hif politically attractive and predictable for member states, but it would also place a burden on innovators resulting from uncertainty as to the exact rate of reward per quality - adjusted life year (qaly). An alternative would be to offer innovators a fixed amount of money per qaly . This would remove uncertainty for innovators but impose uncertainty on member states regarding the annual cost of the hif (pogge, 2010). Unlike the mandatory prize fund proposed by love and hubbard, the voluntary hif would be targeted at medicines for neglected infectious diseases in particular, while innovations with very high market value would still be distributed under the patent system (hollis and pogge, 2008). Other important prize schemes discussed in the literature are priority review vouchers and wild - card patent extensions . Regarding the former, ridley et al . (2006) propose to grant pharmaceutical companies that successfully develop therapies for neglected diseases transferable priority review vouchers . To be eligible for a voucher, therapies must meet particular criteria such as approval by the food and drug administration (fda) or the european medicines agency (ema) and, among other things, clinical superiority to existing therapies . The priority review voucher entitles its holder to the faster priority review process of the fda for another drug under development . The additional resources required for the priority review process of the fda would be recovered through an extra user fee to the voucher holder . 2006) estimate a reduction in review time from an average of 18 to 6 months . This would increase the net present value of sales by more than $300 million if the priority review voucher is used for a blockbuster medication . Most notably, the priority review voucher scheme was enacted in the united states in 2007 . A similar scheme discussed in the literature is the wild - card patent extension programme (spellberg et al . It rewards the development of a critically needed targeted drug of a particular pharmaceutical company by extending the patent on another marketed drug within the portfolio of the company . The patent extension of between six months and two years could also be sold to other companies . The tradability of patent extensions and priority review vouchers ensures that even (small) companies that do not have any high - revenue medication under patent or under development have an incentive to direct r&d resources into neglected disease research . First, suppose that the creation of a new drug or vaccine is successfully stimulated through a prize and donated to the public or made available to the public at the cost of production . In this case, the drug or vaccine is not subject to the inefficient (monopoly) pricing associated with the market exclusivity provided by a patent . Second, in contrast to push programmes, prizes are not likely to be subject to moral hazard problems . Because a researcher will only receive the prize once the desired drug or vaccine is successfully developed, incentives to stray from the task or shift research priorities to other projects are lower under a prize mechanism (maurer, 2005). Third, the technical specification of a prize could be designed to spur the development of a drug or vaccine appropriate for use in low - income countries (kremer and glennerster, 2004). For instance, the prize for the development of a malaria vaccine may only be awarded if it fulfils specific requirements, for example, that the vaccine should prevent not less than 50% of plasmodium falciparum malaria, which is the most dangerous type of malaria with the highest mortality rate (maurer, 2005; who, 2005). Fourth, in contrast to patents, an innovator awarded a monetary prize for successfully developing a specific drug does not have to fear profit - reducing infringement . He does not incur the high costs of litigation and identifying alleged patent infringers (gallini and scotchmer, 2002). With prize funds such as the hif or the medical innovation prize fund there are further advantages . Because rewards would be linked to actual results in terms of incremental healthcare benefits, the pharmaceutical industry would not be inclined to manufacture inferior or unnecessary products but would have incentives to make a measurable impact on global health . Consequently, this would create competition for product quality and effectiveness (love and hubbard, 2007). However, prices would remain low because pharmaceutical companies would have a great interest in making their product available to the greatest number of people in order to achieve the greatest possible health impact (pogge, 2010). Additionally, companies registered with a particular fund would have an incentive to do more than just sell the product . For their products to make an optimal impact on public health, patients would need to be fully instructed on dosage and compliance . Because of the lack of a public health infrastructure in poor countries, patients often receive unsuitable products or suitable products that are not used in the right way (mrazek and mossialos, 2003). Last - mile problem would be mitigated in a prize system in which companies would have an incentive to ensure that products are used properly by cooperating with governments and non - governmental organisations (pogge, 2010). Finally, the advantages of the fda priority review voucher scheme are its relatively low cost to the public and higher r&d incentives for medicines for neglected diseases (ridley et al ., 2006). If the market for transferable vouchers functions efficiently, the priority review will always be used for those drugs that are valued most by the public, as those will have the highest expected return for the drug company . Thus, priority review vouchers do not only increase r&d incentives for medicines for neglected diseases, but also help to make demanded (blockbuster) drugs available to the public sooner . First, if the sponsor of a prize does not have accurate information about the prospective benefits and costs of the innovation to be rewarded, the reward is likely to differ from the social value of the innovation, resulting in either underpayment or overpayment (maurer, 2005). The core difficulty with respect to prizes is determining how large the prize should be . For instance, the hif only rewards manufacturers of products that have made a positive impact on public health . Calculating the incremental health impact of medicines, which is essential for the effective operation of the hif, appears to be an extremely challenging task that could very well overburden agencies . Clinical trials do not give conclusive and accurate assessments of a drug's impact and are usually complicated by factors such as varying effects across different populations or the lack of suitable biomarkers (liddell, 2010). Although these efforts could be supplemented by field trials, the huge expenditures of time and money demanded by such undertakings could easily prevent agencies from carrying them out in the first place (liddell, 2010). Because the assessment of health impacts would rely in part on the number of units sold, fraud, aggressive marketing and advertising could become common practices among companies to exaggerate the benefits of their products (liddell, 2010). As incremental health benefits are difficult to calculate, even ex post, decision makers could act at their own discretion . For instance, a new drug typically substitutes or complements an existing product . The new drug may also be (more) beneficial to certain patients and not beneficial to others (kremer and williams, 2010). Depending on the room for discretion left to a committee in charge of ex post assessment, prize funds may create the potential for static costs associated with rent - seeking and dynamic losses from inappropriate incentives (kremer and williams, 2010). A further problem with the assessment of new products arises if one considers complementary inventions . The exact distribution of the awards may be difficult because producers would have incentives to overstate the importance and the r&d costs of their respective inventions and thus mislead decision makers about the size of their share (kremer and williams, 2010). Additionally, sponsors have incentives to renege on their promise once the invention is finished, for example, by creating reasons that the invention is useless and not eligible for the prize (maurer, 2005). It is, therefore, of critical importance that the rules of a prize, for example, the process for assessing the value of an innovation, are clearly specified in advance and enforceable by a court (kremer and glennerster, 2004). The sponsor must adopt a credible commitment strategy ex ante to reduce his ability to renege ex post to prevent the erosion of the incentives to innovate . This time - inconsistency problem may also be solved through a bonding mechanism, that is, a conflict resolution mechanism . Second, maurer (2005) suggests that publicly funded prizes are likely to be less favourable politically than patents because large lump sum (governmental) prize payments are more visible to voters than patent revenues spread out over a large number of doses . Third, shortages in supply may arise under programmes that condition the participation on drugs being marketed at or below a certain price cap (e.g. Average cost pricing under the hif). Under rigid price systems, prices cannot adjust to short - term market shifts such as demand fluctuations or supply problems at the manufacturing facilities . For instance, the medicare part b programme in the us caps the reimbursement of physicians for medications used in their practices at the average sales prices of the last six months plus 6% . In fact, short - term shortages, especially for cancer drugs, occurred under this payment system as it made it difficult for the manufacturers to increase their prices by more than 6% . At higher prices, fda (2011) reports 178 drug shortages, at least some of which were due to rigid price systems (link et al ., 2012). This development suggests that immediate and constant provision of generic drugs at average cost pricing cannot be taken for granted . Fourth, prizes may result in a wasteful prize race in which r&d investments are duplicated (kremer and glennerster, 2004). If prizes offer the full social value of an innovation, competing firms may allocate excessive resources to their research . Another disadvantage of prizes compared with patents stems from the fact that public or private sponsors are required to finance the prize (maurer, 2005). If a prize is publicly financed, it may eliminate the deadweight loss associated with patents . However, public financing (i.e. Through taxation of other goods) creates its own welfare - reducing distortions . Furthermore, if one considers a mandatory prize fund for the entire pharmaceutical market, it may be hazardous to make pharmaceutical r&d depend on the willingness of states to pay into the system, as unforeseen circumstances may cause them to commit to lower amounts of funding or prevent them from participating in the first place (hollis and pogge, 2008). Conversely, there is a certain danger that companies will simply ignore any voluntary mechanism if it generates lower profits than monopoly pricing . If, however, rewards from funds such as the hif were great enough to increase existing profit margins in the pharmaceutical sector at the expense of the public purse, this aspect of public funding would arguably not be appealing to taxpayers (liddell, 2010). Finally, prize schemes such as the fda priority review vouchers or wild - card patent extensions do not set an explicit incentive for the developer to ensure consumer access to affordable medicines in low - income countries (ridley et al ., 2006). In contrast to monetary prizes such as the hif that can be granted conditional on actual health impact in terms of qalys, priority review vouchers, once rewarded, give no additional incentive to make sure that patients have access to the newly developed drug . Another disadvantage of the voucher scheme may be that the fda approval for the drug for which the voucher is used is subject to uncertainty, which reduces the expected value of the voucher . Kremer (1998) examines the potential of patent buyouts to promote innovations and analyses the use of auctions to determine patent buyout prices . He suggests that the patent authority should offer to buy relevant patents at a price that is equal to their estimated private value plus a mark - up reflecting the ratio of the social to the private value of the invention . Under the assumption that the value of an invention is observable to competitors of the patent - holding firm, the market value of the patent would be estimated through a sealed - bid second - price auction . The patent authority should place most of the patents it buys in the public domain so that the innovation can be produced and marketed at a competitive price . However, only a small fraction of the patents purchased would be sold to the firm with the highest bid to provide the auction participants with incentives to disclose their true expectations of the market value of the patent (kremer, 1998; harhoff et al ., 2003). The patent authority would randomly choose which patent will eventually be sold to the high bidder and thus not be placed in the public domain . First, because the price the original developer of a patented innovation can realise from selling the patent to the patent authority typically exceeds the private value of the patent, patent buyouts are likely to increase private r&d incentives (kremer, 1998). Thus, they may help to moderate the market failure that private returns on r&d are typically lower than social returns on r&d (kremer and glennerster, 2004). Second, as most of the patents purchased will enter the public domain so that the innovation can be produced and marketed at a competitive price, the deadweight losses due to inefficient monopoly pricing associated with patents will be eliminated . Kremer (1998) points out that the pharmaceutical sector would be a natural area in which to try the buyout scheme . When purchased patents are put in the public domain, pharmaceutical markets are likely to be relatively competitive, as compared with a patent - induced monopoly situation with large monopoly mark - ups . Moreover, considerable information about medical products is gathered during the patent approval procedure of a new medicine, for example, through the ema in the european union or the fda in the united states . Auction participants could therefore use this information to make informed bids (kremer, 1998). Finally, monopoly profits would be eliminated in those cases in which the patent purchased is put in the public domain . Patent buyouts thus potentially mitigate the problem that the original innovator's competitors are typically inclined to invest in wasteful duplicative research for substitute products in order to capture profits from the innovator (kremer, 1998). The second - price auction, which is of crucial importance to the effective operation of patent buyouts, is potentially vulnerable to collusive behaviour between the patent holder and auction participants (kremer, 1998). Patent holders have incentives to pay auction participants to make a bid that is higher than their true valuation of the patent to increase buyout prices (kremer, 2001). Most of the purchased patents are placed in the public domain, whereas only a small fraction of them would actually be sold to the highest bidders . Hence, on the one hand, the bribed bidders would face a low probability of having to pay the patent authority . On the other hand however, kremer (1998) points out several mechanisms for preventing collusive behaviour, for example, sealed bids, punishing colluding firms, or rewards for whistleblowers, among others . Second, patent buyouts could aggravate the problem of patent races and wasteful duplication of r&d expenses, as the price the patent authority would pay for a patent is typically higher than its private (commercial) value (gallini and scotchmer, 2002). Additionally, patent buyouts are a visible lump sum payment and thus are likely to be less politically attractive than the less visible patent revenues spread out over a large number of doses (maurer, 2005). Huntington's disease, als and tourette syndrome are referred to as rare diseases or conditions, as only a very small number of people suffer from them . Under normal market conditions, the prospective market for medicines for these rare diseases is too small to stimulate research by the private pharmaceutical sector (villa et al ., 2009). Orphan drugs. Unlike neglected infectious diseases, these diseases are not necessarily diseases of poverty; however, they share the same core problem . Under normal market conditions, the pharmaceutical sector would be reluctant to develop new medicines to treat and cure these diseases . The main difference is that additional incentive programmes to stimulate research into rare diseases have already been successfully established in industrialised countries . The us orphan drug act provides r&d incentives in the form of regulatory assistance, for example, fast - track regulatory approval, research grants and tax credits for clinical testing and r&d expenses incurred in connection with research into diseases that affect fewer than 200,000 persons in the united states (kremer and glennerster, 2004). In addition, seven - year market exclusivity, from the date of approval, is granted independent from already existing patent protection . The exclusivity is achieved by prohibiting a regulatory agency from granting marketing authorisation to the same medication made by another manufacturer to be used in the same therapeutic area (villa et al ., 2009). Especially with regard to drugs for which patent protection is not available, weak, subject to uncertainty or already expired, the exclusivity can be an important feature of the orphan drug act (shulman and manocchia, 1997; grabowski, 2005). While authorisation can still be granted to the same medication for another indication, the provision rules out direct competition from lower - priced generic versions of the same drug for the same indication during the exclusivity period (rogoyski, 2006). Empirical evidence suggests that the combination of push mechanisms, such as grants or tax benefits, and pull mechanisms, such as the promise of market exclusivity as provided by the orphan drug act, successfully stimulates the development of medicines for rare diseases (lichtenberg and waldfogel, 2003). As of 4 october 2007, the total number of orphan drugs approved since 1983 is 315 (ricklin and lambris, 2007). In contrast, fewer than 10 such medicinal products for rare diseases were marketed in the decade prior to the orphan drug act (berndt et al ., 2007). As to the underinvestment in r&d for neglected infectious diseases, the orphan drug act may serve as a successful and tested model of a combination of push incentives such as tax credits and grants and pull incentives such as the promise of market exclusivity over a certain period (lichtenberg and waldfogel, 2003). Apcs are ex ante commitments by national governments, international organisations or private foundations to purchase a certain quantity of a drug or vaccine that has yet to be invented at a certain price (kremer and glennerster, 2000). A government, for instance, could sign a contract to buy a prospective malaria vaccine suitable for use in low - income countries from a pharmaceutical company . The vaccine would be required to meet certain technical criteria such as safety, efficacy and usability and pass a market test regarding its suitability for use in low - income recipient countries (kremer and glennerster, 2000; kremer, 2001). If the vaccine is successfully invented, the government would then make the vaccine available to countries in need at a price that is lower than the monopoly price (kremer and glennerster, 2004). The main purpose of an apc is to create a sufficiently large expected market for medicines for neglected infectious diseases so that pharmaceutical companies find an investment in r&d worthwhile . 2007) have investigated how large a purchase commitment would need to be to give developers incentives comparable to product markets for diseases prevalent in rich countries . Their results suggest that a $3.1 billion commitment in the net present value of sales would be comparable to the value of the sales earned by an average of a sample of recently launched commercial products . The first apc was launched at the g8 summit in l'aquila, italy, in 2009, when the governments of italy, the united kingdom, russia, norway and canada announced a partnership with the bill and melinda gates foundation to commit $1.5 billion to purchase pneumococcal disease vaccines tailored for developing countries . Per year, pneumococcal diseases kill more than 1.6 million people with more than 90% of these deaths occurring in the developing world . Pharmaceutical companies that take part in the programme have to guarantee in advance to provide a certain number of doses of vaccines for a 10-year period at a price no higher than $3.50 per dose . For the first 20% of their supplied doses, they will receive another $3.50 per dose from the apc in order to incentivise the initial investment that is necessary to build up the required capacity . Of the $3.50 that can be charged by the supplier the bill and melinda gates foundation estimates that this will bring pneumococcal vaccines to developing countries 10 years earlier than otherwise predicted, and therefore save over seven million lives by 2030 . A transfer of the concept to fight other diseases like malaria, tuberculosis and aids, if the pilot apc succeeds, has already been announced by the bill and melinda gates foundation . First, the most attractive features of a suitably designed apc are arguably that it reduces market uncertainty and increases the expected market for a desired drug or vaccine, as it specifies a guaranteed price and the quantity to be purchased in advance (webber and kremer, 2001). Second, in contrast to push mechanisms, apcs reward successful research output rather than research input (kremer and glennerster, 2004). Third, kremer and glennerster (2004) suppose that prospective sponsors are less than totally confident about the scientific prospects for the successful development of a malaria vaccine due to huge scientific challenges . On the one hand, a sponsor may not be inclined to provide direct push support to finance research into a malaria vaccine because she may not be willing to bear the risk of financing a project that will eventually fail . On the other hand, she might be more willing to make an apc, even when scientific prospects for success are not entirely clear (kremer and glennerster, 2004). Nevertheless, pharmaceutical companies supposedly have better information than sponsors or buyers about the feasibility of scientific research . Hence, under an apc, those pharmaceutical companies that find that the development of a malaria vaccine is scientifically feasible and commercially attractive will pursue research into the vaccine (kremer and glennerster, 2004). By creating incentives for pharmaceutical companies to follow those research strategies that they think will result in marketable pharmaceutical products, apcs imitate the r&d incentives a market typically provides (webber and kremer, 2001). Fourth, suppose that the buyer of a vaccine or drug promoted through an apc makes the medicines available to consumers in least - developed countries either for free or at a relatively low price . In this case, apcs would help to mitigate both of the central problems related to neglected infectious diseases: the underinvestment in r&d in those diseases and the lack of access to affordable drugs and vaccines in least - developed countries (kremer, 2002). Fifth, an analysis of the costs and effectiveness of apcs conducted by berndt et al . (2007) revealed that apcs can have a substantial stimulating effect on the r&d for a specific vaccine and still be cost - effective . Apcs are, like prizes, subject to a time - inconsistency problem (kremer and glennerster, 2004). Prior to the development of a desired drug or vaccine, buyers, such as governments or private foundations, have incentives to promise a guaranteed price that allows the innovating firm to cover its r&d costs at a given specified quantity . Innovators, however, remain in a position of considerable economic dependence because they have made large investments relying upon the purchase commitment of (typically) a single party on the demand side . In this situation they have incentives to renege on their promise ex post when the r&d investment is sunk so as to obtain the drug or vaccine at the lowest possible price (webber and kremer, 2001). Potential innovators will anticipate this situation and be reluctant to invest in risky and expensive r&d in the first place, or they may charge a premium before they take part in this type of pull programme (maurer, 2005). Consequently, to prevent a hold - up situation, an explicit long - term commitment with clear, judicially enforceable rules is of crucial importance . One way to address this is to establish an adjudication committee independent of the sponsor or buyer (kremer, 2002). The main purpose of this committee would be to evaluate whether a vaccine or drug promoted through a purchase commitment satisfies the eligibility requirements (kremer and glennerster, 2004). Another disadvantage of apcs stems from the fact that sponsors must specify the desired innovation to be promoted through the purchase commitment beforehand (villa et al ., apcs may therefore be an inappropriate mechanism to promote basic research, as it is typically difficult to specify the output of basic research and appropriate eligibility requirements in advance (kremer and glennerster, 2004). In contrast to basic research, it is easier to specify what is meant by an efficacious and safe drug or vaccine . Institutions such as the ema or the fda are already specialised in making such specifications (kremer and glennerster, 2004). In addition, similar to the problem of setting an adequate reward for prizes, it may be difficult to set an adequate guaranteed purchasing price in advance to spur research because expected r&d expenses are variable and difficult to estimate (dimasi et al ., 2003). Thus, maurer (2005) suggests that apcs could result in either underpayment or overpayment . On the one hand, given a certain quantity, if the buyer sets the guaranteed price too low, the apc fails to stimulate r&d . On the other hand, if the buyer sets the price for a certain quantity too high, the additional benefit may cause a sub - optimally high level of research efforts by competing firms . Finally, like patent buyouts and prizes, apcs might be less politically attractive than patents because revenues spread out over a large number of doses are less noticed by voters than (government) payments (maurer, 2005). The core benefit of pull programmes is that the sponsors of the programme only have to pay when an innovation is successfully developed (kremer and glennerster, 2004). By linking payments to successful development, pull programmes decrease shirking by researchers and increase their incentives to concentrate their research efforts on marketable innovations (kremer, 2002). The us orphan drug act provides a tested benchmark of how research into diseases with a small expected market can be stimulated successfully through a combination of push and pull mechanisms . As for neglected infectious diseases, pull programmes such as the advanced vaccine purchase commitment brought forward by kremer and glennerster (2000) have the potential to increase the incentives for pharmaceutical companies to develop medicines for neglected diseases through a market - oriented and transparent approach . The main difficulty with targeted prizes is the advance specification of the desired innovation (glennerster and kremer, 2001). However, prizes are less vulnerable to moral hazard and adverse selection problems than push mechanisms and therefore appear to be an appropriate incentive mechanism to promote basic research where monitoring is typically difficult . Prize fund mechanisms such as the hif appear to be adequate to promote research into neglected infectious diseases, as they link reward payments to both the successful development of effective medicines and the incremental health impact of registered medicines (hollis and pogge, 2008). Registered pharmaceutical companies would have significant interest in selling effective medicines at low prices and mitigating the last - mile problem. Nonetheless, patent buyouts also work in cases where the desired innovation cannot be specified in advance (kremer, 1998). Apcs and patent buyouts are market - based and link payments to the successful development of a desired product . An important feature of both is the potential for the establishment of access to affordable medicines in low - income countries (kremer and glennerster, 2004). Patent holders are likely to benefit from participating in the buyout mechanism, as they would enjoy a price that is typically significantly higher than the private value of the patent . Buyers of vaccines or drugs for neglected infectious diseases promoted through an apc would typically make the medicines available to patients in least developed countries either for free or for a low co - payment (kremer and glennerster, 2004). Nevertheless, it is of crucial importance that the advanced commitment is legally binding and enforceable to mitigate the hold - up problem once the innovation is made (hollis, 2007). As for patent buyouts, the auction mechanism used to determine the buyout price in a buyout scheme must be safeguarded against collusive behaviour between auction participants and the patent holder (kremer, 1998). However, there are also some practical differences between apcs and patent buyouts . First, apcs only work if the sponsor determines specific details of the desired innovation beforehand, whereas the buyout scheme requires no such determination (kremer, 2002). Second, apcs are less vulnerable to problems associated with the discovery of harmful side effects after the development and regulatory approval of a medicinal product (kremer and glennerster, 2004). For instance, suppose that unacceptable harmful side effects occur subsequent to a patent buyout . In this case, kremer and glennerster (2004) argue that the patent authority may have to engage in a potentially wasteful fight with the innovators to recover the buyout money . In contrast to patent buyouts, a sponsor participating in an apc could relatively easily suspend the purchase of a drug or vaccine as soon as unacceptable harmful side effects are discovered (kremer and glennerster, 2004). For pharmaceutical products such as vaccines that could relatively easily be specified in advance by governmental agencies, an apc is likely to be as effective as patent buyouts in terms of stimulating research into medicines for neglected diseases (kremer, 2001). Apcs are, however, likely to be politically more attractive than patent buyouts because payments are spread out over a large number of doses and at the same time less vulnerable to collusive behaviour (maurer, 2005). From their comparison of the mandatory prize mechanism (applied in the medical innovation prize act) and apcs, love and hubbard (2007) conclude that apcs require a huge degree of ex ante specification before financial support is provided, whereas the prize fund model offers flexibility by linking the reward solely to an ex post assessment of health results for the patients . Additionally, the evaluation of therapeutic benefits after the development of a therapy stimulated by optional reward systems, such as the hif, may be less difficult than the specification of pharmacological characteristics beforehand, as is required in apcs (kremer and glennerster, 2004). Nevertheless, hollis and pogge (2008: 7) point out that the hif is a comprehensive approach applying to all kinds of pharmaceutical products that improve human health and not just a particular specified vaccine for a neglected disease. By linking rewards to actual health benefits rather than subsidising sales, the hif system fosters innovation and improves accessibility in a comprehensive way to improve global health . Kremer and williams (2010) appear to be generally open - minded towards the prize mechanisms, but they favour a voluntary mechanism, such as the hif, as opposed to love and hubbard's mandatory approach . They argue that the implementation of a mandatory prize fund mechanism could reduce the pharmaceutical industry's expected return on investment, as no adequate alternative incentive mechanism to reward r&d would substitute for this mechanism if it failed (kremer and williams, 2010). Experimenting with voluntary mechanisms would lower this risk . It therefore seems advisable to first experiment with voluntary mechanisms in order to learn more about the most effective designs and also, arguably, to draw conclusions on the effective designs for mandatory mechanisms . Empirical evidence suggests that the incentives from patents in the developing world are not sufficient to promote research into neglected infectious diseases that is adequate to the social and economic costs of those diseases . We have, therefore, analysed several push and pull incentive mechanisms proposed in the literature with respect to the question of whether they mitigate the problem of underinvestment in r&d for neglected infectious diseases . Push mechanisms, such as research grants and publicly financed research institutions, appear to be more suitable than pull mechanisms, such as apcs, to promote basic research . Absent any subsidisation of research inputs, private incentives to invest in basic research are sub - optimal because basic innovations may be neither patentable nor commercially exploitable . The results of basic research are typically not specifiable in advance so that basic research usually cannot be stimulated through an apc (kremer and glennerster, 2004). Nevertheless, basic research discoveries provide the basis for subsequent applied research that is patentable and commercially exploitable (maurer, 2005). Push mechanisms are, however, vulnerable to moral hazard and adverse selection problems, due to information asymmetries between researchers and research administrators (webber and kremer, 2001). As to prize fund mechanisms, a voluntary mechanism is preferable to the more radical mandatory approach . We recommend experimentation with voluntary mechanisms that focus on a specific product, for example x prizes, which could then be improved and applied to a broader range of settings if they succeed . Experimentation and trial and error with voluntary mechanisms may also help to refine proposals for mandatory programmes such as the medical innovation prize fund . Regarding patent buyouts, the buyout price would typically be at least twice as large as the private value of the patent and thus potentially increases r&d incentives (kremer, 1998). Purchased patents would typically be placed in the public domain so that an innovation could be produced and marketed at a competitive price . This would mitigate the problem of access to affordable medicines that arises when manufacturers of pharmaceuticals charge monopoly prices . Legally binding and enforceable apcs are also likely to promote pharmaceutical research into neglected infectious diseases through a transparent, market - oriented approach (kremer, 2002). Sponsors involved in an apc would typically provide consumers in low - income countries with medicines at zero cost or for modest co - payment . However, apcs appear to be more appropriate than patent buyouts, as they are likely to be at least as effective as patent buyouts in terms of stimulating research but more politically appealing and less vulnerable to collusive behaviour (kremer and glennerster, 2004). Hence, a combination of push and pull programmes appears to be an appropriate strategy for stimulating research into neglected infectious diseases . On the one hand, early - stage (basic) research should be supported through push mechanisms, for example, research grants or publicly financed research institutions . On the other hand, pull mechanisms, such as legally binding and enforceable purchase commitments or prize fund mechanisms, have the potential to stimulate specific although the push and pull mechanisms analysed above may successfully address the market failure of the drug development paradigm, public health policy failures still pose a significant barrier to the reduction of the disease burden in developing countries . Especially weak health systems, driven by a low general level of education, financial and physical inaccessibility of pharmaceuticals and weak information systems, often prevent already existing drugs from being used or used in an appropriate way in developing countries (travis et al ., 2004). A lack of education, on the one hand, leads to a shortfall in the health workforce, with inexperienced and low - skilled staff working in hospitals and health institutions . On the other hand, improved educational standards may reduce the disease burden by enabling people to use existing health services more effectively and improve the overall hygiene awareness (who, 1996). Furthermore, certain members of society in poor countries, especially women, children and people from rural areas, often do not have sufficient access to existing drugs (bhutta et al ., 2004), a situation that contributes to what is commonly referred to as health inequity. Other policy failures directly hinder the development of drugs for neglected diseases and affordable access to medicines in poor countries . Particularly, the international harmonisation of drug development regulations, excessive patent protection and parallel trade legislation are potential barriers to the availability of drugs to treat neglected diseases in developing countries . As a result of the international conference on harmonisation, safety regulations on the development and clinical testing of new drugs are not adapted to the benefit risk preferences of developing countries but are internationally consistent in meeting the needs of developed countries . While basic regulations are necessary to protect consumers health, excessive regulation might lead to time - consuming and therefore expensive drug development, which can be especially problematic for developing countries, where expected returns are low . This can exclude people in those countries from access to potentially life - saving medicines (trouiller et al ., 2001). In addition, the notion that strengthening patent protection in developing countries, as stipulated in the agreement on trade - related aspects of intellectual property rights (trips agreement), stimulates neglected disease research is fiercely debated (lanjouw, 2003). For instance, trouiller et al . (2001) argue that with strong patent protection, access to essential drugs in low - income countries could be denied for many years . Finally, the regulation of parallel trade of drugs may also have an impact on the availability of drugs in developing countries . While pharmaceutical companies would typically discriminate prices between countries, and therefore set a lower price in developing countries with a high price elasticity of demand, parallel trade arbitrage will push prices up in those countries, reduce the expected overall profits of drug developers and hence reduce their r&d incentives (mueller - langer, 2012). To conclude, whereas we focus our analysis on push and pull mechanisms to stimulate the development of drugs for neglected diseases, appropriate r&d incentive mechanisms alone will not be sufficient to solve the problem of inaccessibility of urgently needed medication in poor countries . Strengthening local health systems and setting an appropriate legal framework will need continued attention in order to reduce the neglected disease burden in the developing world . The author thanks hans - bernd schfer, martina samwer, sebastian osterrieth, janis sussick and franz bauhuber for their valuable comments.
American cutaneus leishmaniasis (acl) is a vector - borne zoonotic disease caused by several species of leishmania trypanosome protozoan parasites and transmitted by phlebotomine sandflies (lutzomyia spp . ). In brazil, acl constitutes a significant health problem, with an incidence of about 20,153 new cases per year (2008). In humans, infections may not be readily apparent but can present a variety of clinical manifestations ranging from localised, sometimes self - healing cutaneous lesions to severe mutilating mucocutaneous lesions or diffuse cutaneous leishmaniasis . A high prevalence of infection has been reported in pernambuco state, northeastern brazil, concentrated predominantly in the atlantic forest region; transmission has increased dramatically in recent decades [3, 4]. Many different patterns of acl etiology have been described in brazil, particularly in highly endemic regions . Acl was originally considered to be focused among people who work or live within tropical forests; however, comparison of this idea with current patterns of occurrence suggests strongly that behavior of vectors may be changing, perhaps in response to environmental shifts [1, 6, 7]. Numerous studies point to the capacity of some lutzomyia species to adapt to human - altered environments in parts of brazil [1, 810], which opens possibilities for broader and much increased transmission . The sandflies lutzomyia whitmani and l. migonei are considered important acl vectors in brazil that have generally been found in peridomestic environments in southeastern (states of so paulo, minas gerais, esprito santo, rio de janeiro) [1113], northeastern (maranho, bahia, cear, pernambuco) [1416], and west - central (mato grosso, mato grosso do sul, tocantins) regions [10, 1719]. Lutzomyia intermedia, on the other hand, dominates and is considered the principal acl vector in areas of so paulo, rio de janeiro, and minas gerais [1, 11, 12]. Various factors have been identified as key in this domiciliation process, including climatic factors (annual and seasonal temperature and precipitation), vegetation type, and elevation, as well as socioeconomic conditions that may influence risk of transmission to humans [20, 21]. Finally, lutzomyia whitmani ranks among the most important acl vectors in brazil and has been found to be abundant in atlantic forest areas in pernambuco since at least the 1990s [4, 16]. This species has been found to be infected naturally with leishmania (viannia) braziliensis in this region, forming a key element in the zoonotic transmission cycle of this pathogen [23, 24]. The purpose of this study is to analyze the behavior in terms of distribution and population trends through time and across space of lutzomyia species in a long - term focus of acl transmission in the state of pernambuco, brazil . Given that l. whitmani dominates the sandfly fauna in this region almost absolutely, we focus on this species, as it clearly drives much of the dynamics of the system . We explore this species in relation to various environmental factors in amaraj, pernambuco, an area of intermingled atlantic forest and farmland that is of particular interest as regards high acl transmission [3, 24]. During the course of 2009, sandflies were collected in the municipality of amaraj, an atlantic forest - dominated locality just inland from the coast of pernambuco . Specifically, we collected at the small, rural settlements of refrigerio and tranquilidade (82259s 352709w, 289 m; figure 1). The sampling covered 9 months of 2009 (january, february, march, april, june, august, october, november). We used 10 cdc light traps per night on 3 - 4 nights, for a total of 255 trap - nights over the course of the study . One cdc light trap inside domiciles, and four in peridomicile (including animal shelters), and five in nearby forested areas . The traps were positioned 1.5 m above the ground on the edges of banana plantations or atlantic forest fragments, in the interior of forest fragments, and around human domiciles and associated structures (stables, granaries, etc . ). Each site was visited every second month, and the two sets of sites were sampled in alternating sets of months to maximize numbers of sites included in the study . An initial analysis of temporal dimensions sandfly abundance in this study has already been published . The location of each trap was georeferenced using a hand - held garmin (etrex hc series) global positioning unit, accurate to ~10 m on the ground using the datum wgs 1984 . The species lutzomyia whitmani was analyzed separately from the other species occurring in the area because of its near - absolute dominance among the sandfly fauna of the region . We used chi - squared tests to compare relative frequencies of different species in different environments, both in terms of numbers of individuals captured and numbers of sites at which the species were collected . We compared l. whitmani with the remaining lutzomyia species except as constrained by sample sizes for the latter species (expected frequencies had to be 5 for tests to be possible). All statistical tests were based on an = 0.05 . To summarize dimensions of land cover and vegetation characteristics and phenology, we calculated the normalized difference vegetation index (ndvi) from landsat images available from the u.s . Geological survey (http://glovis.usgs.gov/) with spatial resolution of 30 m (98 ft). Specifically, we used images from the enhanced thematic mapper-7 sensor for the following dates: 3 october and 21 october 2006, 15 april 2007, and 8 august 2009, which were the most cloud - free images available over the period 20062009 . To calculate ndvi, we used the formula 10,000[(b40 b30)/(b40 + b30)], where b40 and b30 represent the red and near - infrared bands from the landsat images, respectively . To identify environmental conditions under which lutzomyia species occur in the amaraj region, we used ecological niche modeling (enm) routines implemented in maxent . In general, we used default parameters to train models, so that we set the random testing percentage to 50% to provide an independent perspective on model quality; we focused on the logistic output format . To identify environmental parameters most relevant to the species' occurrence, we used a jackknife procedure that measures effects of each environment variable alone and when omitted from the model on predictions [27, 28]. To separate areas predicted as suitable from those predicted as unsuitable, we set the expected meaningful error parameter of peterson et al . We used as a threshold for separating prediction of suitability from prediction of unsuitability the highest logistic maxent suitability value that included (100e)%, in this case 98% of the training data, to take into account the possible presence of noise in the input data . To provide a quantitative test of model predictions, we were forced to focus on a subset of the study area, for which no cloud cover was present in at least two of the images (figure 1). To provide a clear test of predictive ability among spatial subsets, thereby avoiding some problems with spatial autocorrelation among training and testing data, we separated this subset of the study region into eastern, central, and western areas and challenged models to use each pair of areas to anticipate the distribution of the species in the third area . We then used a receiving operating characteristic (roc) approach to provide a threshold - independent evaluation of each prediction . However, in light of known problems with standard roc approaches [31, 32], we used a partial roc approach, in which analyses are limited to portions of the roc curve in which omission error is less than or equal to e; these tests were developed using a program developed by n. barve that is available upon request from the authors . The test statistic output from these routines is the auc ratio, which compares the observed area under the curve to null expectations; auc ratios are tested for difference from unity (i.e., random prediction) via 1000 repetitions of a 50% bootstrap of available input data . Finally, to provide a visualization of ecological niche patterns of lutzomyia species' distributions in the study area, we developed a final niche model based on all occurrence data available across the three areas (i.e., no subsetting). We combined (grid combine in arcgis 9.3) this map with the environmental data layers from which it was derived to yield a raster dataset with an associated attributes table that includes the value of each combination of environmental variables (ndvi of each time period) and the prediction from maxent . This table was exported in ascii format and used to develop various visualizations of niche patterns . We identified 12 lutzomyia species in the amaraj study during 2009, for a total of 1361 individuals across the 255 trap sites . Lutzomyia whitmani was by far the most abundant species, totaling 1195 individuals (87.8%; table 1). Other species recorded included l. evandroi (4.9%), l. quinquefer (1.9%), and l. complexa (1.3%), among others . In peridomiciliary environments, l. whitmani was even more dominant (98.2% of individuals); l. evandroi, l. quinquefer, and l. migonei appeared to show a similar association with human - modified environments, albeit in much lower numbers . In contrast, l. complexa, l. tupynambai, l. sordelli, l. longispina, and l. walkeri appeared restricted to forest and forest edge in this study (table 1). The concentration of l. whitmani in peridomiciliary environments was much greater than would be expected by chance (p <0.05); tests for the remaining species were equivocal, probably owing to small sample sizes . Table 1 shows the distribution of positive sites and individuals species in forested and peridomiciliary areas . Among the 120 sandfly positive sites, 82 (68.3%) were in peridomiciliary areas, while 38 (31.7%) were detected in forested areas (p = 0.005). L. whitmani and l. quinquefer were dominant in peridomestic sites (p <0.05), as well as l. migonei (p = 0.07), while l. complexa, l. sordelli, and l. tupynambai were found almost exclusively in forested areas (p <0.05). For all other species, distribution of positive sites among peridomiciliary versus forested areas could not be determined (p 0.05). L. whitmani was the most abundant species as well as the most broadly distributed across the study area . Relating patterns of occurrence to patterns of surface reflectance in the landsat imagery, the jackknife process indicated ndvi from october and april as the environmental variables most associated with presence of l. whitmani . Ndvi of march and august were omitted from models in light of their little contribution to fitness of models . Niche models estimated from and projected among the three regions of the study area for which cloud - free imagery was available showed good (i.e., better than random expectances) coincidence with independent testing data sets (table 2). In particular, for example, for l. whitmani, the model based on western and central regions predicted the distribution of the species in the eastern region with an auc ratio mean of 1.12, which has an associated probability value of p <0.001 . The other two predictions were similarly statistically significantly better than random expectations (table 2) thus amply confirming both the environmental influences on sandfly distribution and the predictive power of our models . Figure 2 shows the relationship between modeled distributions in environmental space of l. whitmani as opposed to the other sandfly species at amaraj, revealing differences in the distribution of species according to the vegetation index . Figure 3 shows adding detail regarding presences detected for l. whitmani versus other species in forested and peridomiciliary environments . L. whitmani appears to be associated negatively with ndvi values (both in april, which is the rainy season, and in october, which is the dry season), as areas predicted as unsuitable for this species show generally higher ndvi values (figures 2 and 3). Most other lutzomyia species, on the other hand, appear associated positively with denser vegetation (i.e., higher ndvi values) in both seasons (figures 3). Overall, then, lutzomyia species' occurrences are associated with specific environmental combinations (with contrast among species) in amaraj . In the amaraj region as well as in other areas of brazil, lutzomyia whitmani has been implicated as the principal acl vector, predominantly associated with leishmania braziliensis, the main parasite species involved in transmission, although in southern region of the country it is considered only a secondary vector [3, 13]. In amaraj, although 12 species were detected, l. whitmani was dominant constituting 87.8% overall of detections, and 95% in peridomiciliary locations . In forested areas, l. whitmani was less dominant (only 41.7% of detections), and other species played more meaningful roles in the sandfly community . This tie of l. whitmani to human - altered environments has been noted also in amazon basin, and in the center - west and southern parts of the country [10, 11, 14]. However, in a nearby region of pernambuco with greater forest cover, l. whitmani was found to be a relatively unimportant member of the sandfly community, and l. complexa and l. choti were much more numerous . Among the other species detected at amaraj, l. evandroi and l. migonei both also appeared to be concentrated in peridomiciliary environments . Although far less common than l. whitmani, the human association of these species makes them of some interest in acl transmission, as in other regions [11, 34, 35]. Given its domiciliation and massive dominance, l. whitmani is almost certainly the major acl vector in the region [24, 36]. While other species were rare around human habitations, this sand fly was more abundant in peridomiciliary and to a lesser degree forested areas, offering a possible vectorial role for other leishmania species in the wooded environments . Detection of l. whitmani in peridomestic and forested areas reinforces the assumption that deforestation does not result in decline of the species habitat but adaptation and/or tolerance of different vegetation type and climatic condition . Clearly, the next step in this process would be detailed analysis of (1) blood meal sources for each sandfly species in the region, (2) detection of leishmania infections in the flies, and (3) identification and association of leishmania strains in both sandflies and locally infected humans . This group of information, together with our spatial data, would offer significant insight into the details of acl transmission cycle in the region . Predictive models relating species occurrences to abiotic variables have been used in several previous studies of distribution and ecology of vectors, reservoirs, and infectious diseases [10, 21, 37]. Most previous analyzes have been carried out at scales that are set by resolution of the available environmental variables of occurrence data [21, 38, 39]. However, climate of the relatively small area designated in this study does not vary much over scales like this . Whereas the analysis of existing vegetation indirectly reflects the effects of rain and vegetation in the region, identifying ecologically disturbed and forested areas is of particular interest in the study of lutzomyia spp . The amount of vegetation in the dry and wet seasons were adequate in predictions of species occurrence, particularly for l. whitmani, which could be analyzed in detail . For this purpose, ndvi provides a good index of ecosystem function with strong correlation with absorbed photosynthetically active radiation . In spite the fact that l. whitmani has been associated with geoecological factors, this highly anthropophilic species is also influenced by socioenvironmental changes and transformation on landscape [10, 34], which were not evaluated in this study . There was a negative association between this species and higher ndvi values (denser vegetation), and predictions of the distribution of l. whitmani among regsions were statistically significantly better than random expectations . This result strongly suggests that it is feasible to predict the distribution of this important vector in regions where it is difficult to perform sampling due to factors such as difficult access and financial restrictions.
A safe and efficient hemostasis is one of the most important factors in minimally invasive surgery . Hemostasis can be achieved by sutures, clips, application of hemostyptica or thermic coagulation . For thermic coagulation, high - frequency (hf) coagulation in monopolar or bipolar mode, cold plasma, and ultrasonic coagulation klingele compared the ultrasonic technique with the bipolar technique in dissected vessels and examined the tissue damage . Underwood et al . Measured the differences in operative time, blood loss and complications when using bipolar or ultrasonic technique in colectomies and fundoplications [7, 8]. Sutton et al . Examined the lateral thermal spread using monopolar and bipolar diathermy, the harmonic scalpel and ligasure by measuring the maximum temperature . In our present study the tests were performed on perfused, isolated pig liver in a minimally invasive model with a pulsatile organ perfusion (p.o.p .) Trainer . For analysis a complete laparoscopic equipment setup for minimally invasive surgery was used together with a p.o.p . The experimental procedure began with heating the isolated, frozen liver in a water - cooled vacuum in order to warm it up to about 30c35c before the actual start of the experiment . The pump of the trainer was activated to check the correct function (figure 2). Small open vessels on the liver surface were closed with sutures . After a final check of the correct connection of blood vessels, after 30 minutes, the tissue temperature was detected by the laboratory thermometer at 5-minute intervals until it reached 37c . To start the experiment, a 2 - 3 cm thick slice of the liver was resected to create a deep tissue bleeding . After closure of the cover, the pump was activated again; the bleeding area was photodocumented (figure 3). The cut surface was divided horizontally in two halves . Only the upper half was coagulated to see the difference to untreated tissue and calculate the tissue loss (figure 4). The coagulation was started using one of the four techniques until the bleeding could be stopped . Using ultrasonic coagulation, it was not possible to create hemostasis in preliminary experiments for hemostasis of large bleeding areas in perfused pig liver . After 5 minutes, the cell walls were highlighted and a first approach of coagulated tissue became visible . The bleeding did not stop; the extraction of tissue by the mechanical vibrations of the ultrasonic applicator could be observed . After 10 minutes, there was an increase of foam; after 15 minutes, we saw extracted tissue without sufficient hemostasis (figures 5 and 6). Based on these preliminary tests, the ultrasonic technique was not considered for further experiments and pathological examination . Using the other devices, after stopping the pump and opening the cover, the tissue was fixed on a cork plate and placed in formalin solution after photodocumentation . From the resected tissue, 10 cuts in 510 mm distance were made, each cut was examined at 10 points microscopically (figure 7). Furthermore, the maximum tissue damage was determined to compare the tissue loss caused by the different techniques . The high - frequency coagulation devices were used with the settings shown in table 1 . The gas flow had little effect (cooling) on the coagulation performance . With 1.5 l / min gas flow, forced coag was chosen because the required output voltage of the monopolar technique for a similar coagulation is significantly higher than in bipolar technology . The tissue structure changes on the necrotic side the color is darker in the thermally damaged area . Microscopically the necrotic cells are not clearly defined and shrank because of the evaporated water . In addition, the color is very dark compared with the nondamaged tissue . The 10 measuring points are lined up linearly, so that the measurements cover a distance of 1 mm of the tissue sample . The tissue loss is measured in relation to the lower half of the untreated sample at the point of greatest loss . The measurement can be easily carried out macroscopically (figure 4). For statistical evaluation of tissue damage and tissue loss, we measured the coagulation time of 3 different techniques (monopolar, bipolar, and cold plasma) on 4 experimental days . Ultrasonic coagulation was excluded, because hemostasis of large bleeding areas could not be reached . As shown in figure 9, the shortest time there was almost no difference between monopolar (11 min) and cold plasma (11.25 min). To determine the tissue loss, the height difference between the coagulated area and the untreated area was macroscopically analyzed and measured in mm (figure 10). The minimal tissue loss was 4 mm (bipolar coagulation); the maximal tissue loss of 8 mm occurred using cold plasma coagulation . On average, the tissue loss was the least in bipolar technique (4.5 mm), more in monopolar technique (6.0 mm), and most in cold plasma coagulation (7.5 mm). The depth of tissue necrosis was analyzed microscopically and measured in mm (figure 11). The lowest value was found in cold plasma coagulation (0.157 mm), the highest in monopolar coagulation (0.598 mm). The slightest average damage to the tissue was observed in cold plasma coagulation with a mean of 0.264 mm . Bipolar coagulation led to an average depth of 0.346 mm, monopolar coagulation of 0.459 mm . Bipolar coagulation of large bleeding areas of the perfused pig liver led to a rapid hemostasis causing moderate tissue damage and depth loss . The worst results occurred with monopolar coagulation compared to bipolar technique (coagulation time + 33.3%, tissue loss + 33.3%, tissue damage + 32.7%). Ultrasonic coagulation was excluded because large bleeding areas could not be treated sufficiently and hemostasis was not reached . The aim of this study was to examine whether there are differences between the common coagulation techniques in a minimally invasive model concerning the efficiency of hemostasis and local tissue damage [1, 3]. The experiments were done with isolated, perfused pig livers . The use of ultrasonic coagulation did not lead to a complete hemostasis even after 15-minute coagulation time . The termination resulted from the application form of energy causing foam formation and extraction of tissue components . The benefits of ultrasonic technology in minimally invasive surgery are clear in the preparation and dissection of tissue, the use close to other organs, and the closure of isolated vessels of up to 57 mm . In our model, it was not useful for coagulation of large bleeding areas . The first parameter in this study was the coagulation time until a sufficient hemostasis was reached . A good instrument should be safe and quick to reduce damage to lateral tissue and to minimize the energy flow to the patient . We know from clinical use that with longer monopolar coagulation time more and more necrotic tissue sticks to the instrument and is pulled out . The average tissue loss was 4.5 mm in bipolar technique and 6.0 mm in monopolar technique (cold plasma coagulation 7.5 mm). The depth of tissue damage by coagulation was the third parameter in this study . Because of the high efficiency of bipolar coagulation, less energy was needed to stop the bleeding . This resulted in an average depth of tissue necrosis of 0.346 mm in bipolar coagulation and 0.459 mm in monopolar coagulation . It showed the longest coagulation time and the highest tissue loss, while the depth of tissue damage was the lowest in this study . One possible explanation could be the gas, which is pressed into the tissue during the contactless coagulation . It leads to a deep dissection of necrotic tissue and a rapid shrinkage of the particles (figure 13). This indicates a low degree of necrosis and corresponds with the previously mentioned results (figure 14). After monopolar coagulation, we regularly see black carbonized tissue (figure 15), after cold plasma coagulation grey - brown to black tissue (figure 16). In summary, the collateral tissue damage consisted of the tissue loss and the tissue necrosis in the depth . When both factors are added, the total damage can be calculated (table 2). The results of this work came from experiments on isolated pig livers in an in vitro test environment and cannot be easily transferred to human application . Perfusion of the isolated liver was achieved with colored saline solution and not with blood, what restricts hemostasis and prolongs the coagulation time . This is one reason for the relatively long coagulation time that we measured in the perfused liver . Further studies have to show the presumed superiority of bipolar technique . In our surgical department the experimental study showed differences between several coagulation techniques in a minimally invasive model for hemostasis in deep liver bleeding . Ultrasonic coagulation, which is very useful in dissection of tissue and coagulation of isolated vessels, did not lead to a sufficient hemostasis in large bleeding areas . The bipolar technique was the form of coagulation with the highest efficiency and the least tissue damage.
All sites were situated in the communes of lo, boura, and biha, within a radius of 30 km from the city of lo (11.10 n, 02.10 w). The climate is characterized by a unimodal rainfall pattern, with the rainy season starting in may and ending in october . The work was carried out at farmers fields and hedges of j. curcas, planted between 2009 and 2012 . To study the population dynamics of a. whitfieldi over a year s time, 12 sites planted in 2009 were selected in the communes of lo and biha . In each commune, two monocultures of j. curcas, two fields where j. curcas was intercropped with various other crops, and two j. curcas hedges were monitored from 1012 september 2012 to 24 september 2013 in lo and biha, respectively . In the intercropping systems, planting distances for j. curcas was 2 by 2 by 8 m, i.e., two rows of j. curcas were planted at 2 m distance and at 8 m from two other rows . Other crops were usually planted at 1.3 m distance from j. curcas stems . Intercropped plants included soybean, maize, groundnut, okra or pepper, and the species varied among fields and seasons . Every week, five trees were selected haphazardly in each plantation and the number of a. whitfieldi found on each tree was counted . Tree size varied within and between plantations because trees were growing rapidly and were pruned by the farmers . However, there was no evidence of significant differences in tree size among plantation systems throughout the year of observation . The monitoring system for assessing the population dynamics in the 12 plantations described earlier was also used to compare abundance of a. whitfieldi in monocultures, intercropped fields, and hedges however, because of the low number of plantations involved in this study, another study to assess environmental factors influencing the abundance of a. whitfieldi was carried out from 19 september to 1 october 2012 . At that time, a. whitfieldi was present at various levels of infestation in all plantations of the region . Thirty - one plantations were chosen haphazardly in the communes of lo, boura, and biha and surveyed for a. whitfieldi: 10 hedges, 13 monoculture fields of j. curcas, and 8 fields where j. curcas was intercropped with other plants . All fields were first planted in 2009 or 2010, but in many cases, young seedlings were planted later to replace dead trees . In each plantation, 20 trees of at least 2-yr old (i.e., planted in 2009 or 2010) were randomly selected . For each tree, damage by a. whitfieldi was assessed only in the lower part of the tree (50 cm from the soil) to minimize the effect of tree size, taking into account that trees had different heights and damage is usually higher in the lower part of the crown . Damage was assessed by evaluating, on 10 leaves, the average surface of leaves with damage by a. whitfieldi, i.e., the surface where photosynthesis cannot be performed, whether by direct feeding or drying out of the leaf due to the insect pest . Instead, we scored the average attack as follows: <1% (average 0.5%) of leaf surface damaged; 15% (average 3%); 520% (average 12.5%); 2050% (average 30%); 5090% (average 70%); and> 90% (average 95%). To score the general level of infestation of a plantation, we averaged all the average percentages of infestation of the 20 trees . At each plantation, we also assessed the proximity with fallow lands, i.e., we noted whether fields and hedges were directly adjacent to fallow lands or only to cultivated lands (i.e., where all assessed trees were at least 100 m from the next fallow). For fields, we also noted whether the field itself was left as fallow or weeded . When the field was not weeded, we considered it as a fallow . To further assess the influence of the distance to fallow lands on damage, in september 2012 we chose a field with 3-mo - old plants, weeded and intercropped with soybean, adjacent to fallow land at only one side, the three other sides being occupied by various weeded crops . We assessed the level of infestation, using the same scale, of five randomly selected trees at 1, 6, 11, 16, 22, 28, 33, 38, 43, and 48 m from the fallow land . To compare the abundance of a. whitfieldi between the three cropping systems at the 12 sites where beetle populations were monitored during 1 yr, we used a linear mixed effects model with cropping system as fixed factor, village as random factor, and the sum of beetle number per field as dependent variable . To analyze the influence of cropping systems and environmental factors on the level of infestation by a. whitfieldi at the 31 plantations monitored in september 2012 fixed factors used were j. curcas as hedge versus fields (all data); monoculture versus intercropping (fields only); and j. curcas plants adjacent to fallows in or outside the fields (all data and fields only). In the 3-month - old j. curcas field adjacent to fallow lands, the relationship between the level of infestation by the beetle and the distance to the nearest fallow was analyzed using a pearson correlation . All sites were situated in the communes of lo, boura, and biha, within a radius of 30 km from the city of lo (11.10 n, 02.10 w). The climate is characterized by a unimodal rainfall pattern, with the rainy season starting in may and ending in october . The work was carried out at farmers fields and hedges of j. curcas, planted between 2009 and 2012 . To study the population dynamics of a. whitfieldi over a year s time, 12 sites planted in 2009 were selected in the communes of lo and biha . In each commune, two monocultures of j. curcas, two fields where j. curcas was intercropped with various other crops, and two j. curcas hedges were monitored from 1012 september 2012 to 24 september 2013 in lo and biha, respectively . In the intercropping systems, planting distances for j. curcas was 2 by 2 by 8 m, i.e., two rows of j. curcas were planted at 2 m distance and at 8 m from two other rows . Other crops were usually planted at 1.3 m distance from j. curcas stems . Intercropped plants included soybean, maize, groundnut, okra or pepper, and the species varied among fields and seasons . Every week, five trees were selected haphazardly in each plantation and the number of a. whitfieldi found on each tree was counted . Tree size varied within and between plantations because trees were growing rapidly and were pruned by the farmers . However, there was no evidence of significant differences in tree size among plantation systems throughout the year of observation . The monitoring system for assessing the population dynamics in the 12 plantations described earlier was also used to compare abundance of a. whitfieldi in monocultures, intercropped fields, and hedges however, because of the low number of plantations involved in this study, another study to assess environmental factors influencing the abundance of a. whitfieldi was carried out from 19 september to 1 october 2012 . At that time, a. whitfieldi was present at various levels of infestation in all plantations of the region . Thirty - one plantations were chosen haphazardly in the communes of lo, boura, and biha and surveyed for a. whitfieldi: 10 hedges, 13 monoculture fields of j. curcas, and 8 fields where j. curcas was intercropped with other plants . All fields were first planted in 2009 or 2010, but in many cases, young seedlings were planted later to replace dead trees . In each plantation, 20 trees of at least 2-yr old (i.e., planted in 2009 or 2010) were randomly selected . For each tree, damage by a. whitfieldi was assessed only in the lower part of the tree (50 cm from the soil) to minimize the effect of tree size, taking into account that trees had different heights and damage is usually higher in the lower part of the crown . Damage was assessed by evaluating, on 10 leaves, the average surface of leaves with damage by a. whitfieldi, i.e., the surface where photosynthesis cannot be performed, whether by direct feeding or drying out of the leaf due to the insect pest . Instead, we scored the average attack as follows: <1% (average 0.5%) of leaf surface damaged; 15% (average 3%); 520% (average 12.5%); 2050% (average 30%); 5090% (average 70%); and> 90% (average 95%). To score the general level of infestation of a plantation, we averaged all the average percentages of infestation of the 20 trees . At each plantation, we also assessed the proximity with fallow lands, i.e., we noted whether fields and hedges were directly adjacent to fallow lands or only to cultivated lands (i.e., where all assessed trees were at least 100 m from the next fallow). For fields, we also noted whether the field itself was left as fallow or weeded . When the field was not weeded, we considered it as a fallow . To further assess the influence of the distance to fallow lands on damage, in september 2012 we chose a field with 3-mo - old plants, weeded and intercropped with soybean, adjacent to fallow land at only one side, the three other sides being occupied by various weeded crops . We assessed the level of infestation, using the same scale, of five randomly selected trees at 1, 6, 11, 16, 22, 28, 33, 38, 43, and 48 m from the fallow land . To compare the abundance of a. whitfieldi between the three cropping systems at the 12 sites where beetle populations were monitored during 1 yr, we used a linear mixed effects model with cropping system as fixed factor, village as random factor, and the sum of beetle number per field as dependent variable . To analyze the influence of cropping systems and environmental factors on the level of infestation by a. whitfieldi at the 31 plantations monitored in september 2012 fixed factors used were j. curcas as hedge versus fields (all data); monoculture versus intercropping (fields only); and j. curcas plants adjacent to fallows in or outside the fields (all data and fields only). In the 3-month - old j. curcas field adjacent to fallow lands, the relationship between the level of infestation by the beetle and the distance to the nearest fallow was analyzed using a pearson correlation . All sites were situated in the communes of lo, boura, and biha, within a radius of 30 km from the city of lo (11.10 n, 02.10 w). The climate is characterized by a unimodal rainfall pattern, with the rainy season starting in may and ending in october . The work was carried out at farmers fields and hedges of j. curcas, planted between 2009 and 2012 . To study the population dynamics of a. whitfieldi over a year s time, 12 sites planted in 2009 were selected in the communes of lo and biha . In each commune, two monocultures of j. curcas, two fields where j. curcas was intercropped with various other crops, and two j. curcas hedges were monitored from 1012 september 2012 to 24 september 2013 in lo and biha, respectively . In the intercropping systems, planting distances for j. curcas was 2 by 2 by 8 m, i.e., two rows of j. curcas were planted at 2 m distance and at 8 m from two other rows . Other crops were usually planted at 1.3 m distance from j. curcas stems . Intercropped plants included soybean, maize, groundnut, okra or pepper, and the species varied among fields and seasons . Every week, five trees were selected haphazardly in each plantation and the number of a. whitfieldi found on each tree was counted . Tree size varied within and between plantations because trees were growing rapidly and were pruned by the farmers . However, there was no evidence of significant differences in tree size among plantation systems throughout the year of observation . The monitoring system for assessing the population dynamics in the 12 plantations described earlier was also used to compare abundance of a. whitfieldi in monocultures, intercropped fields, and hedges . However, because of the low number of plantations involved in this study, another study to assess environmental factors influencing the abundance of a. whitfieldi was carried out from 19 september to 1 october 2012 . At that time, a. whitfieldi was present at various levels of infestation in all plantations of the region . Thirty - one plantations were chosen haphazardly in the communes of lo, boura, and biha and surveyed for a. whitfieldi: 10 hedges, 13 monoculture fields of j. curcas, and 8 fields where j. curcas was intercropped with other plants . All fields were first planted in 2009 or 2010, but in many cases, young seedlings were planted later to replace dead trees . In each plantation, 20 trees of at least 2-yr old (i.e., planted in 2009 or 2010) were randomly selected . For each tree, damage by a. whitfieldi was assessed only in the lower part of the tree (50 cm from the soil) to minimize the effect of tree size, taking into account that trees had different heights and damage is usually higher in the lower part of the crown . Damage was assessed by evaluating, on 10 leaves, the average surface of leaves with damage by a. whitfieldi, i.e., the surface where photosynthesis cannot be performed, whether by direct feeding or drying out of the leaf due to the insect pest . Instead, we scored the average attack as follows: <1% (average 0.5%) of leaf surface damaged; 15% (average 3%); 520% (average 12.5%); 2050% (average 30%); 5090% (average 70%); and> 90% (average 95%). To score the general level of infestation of a plantation, we averaged all the average percentages of infestation of the 20 trees . At each plantation, we also assessed the proximity with fallow lands, i.e., we noted whether fields and hedges were directly adjacent to fallow lands or only to cultivated lands (i.e., where all assessed trees were at least 100 m from the next fallow). For fields, we also noted whether the field itself was left as fallow or weeded . When the field was not weeded, we considered it as a fallow . To further assess the influence of the distance to fallow lands on damage, in september 2012 we chose a field with 3-mo - old plants, weeded and intercropped with soybean, adjacent to fallow land at only one side, the three other sides being occupied by various weeded crops . We assessed the level of infestation, using the same scale, of five randomly selected trees at 1, 6, 11, 16, 22, 28, 33, 38, 43, and 48 m from the fallow land . To compare the abundance of a. whitfieldi between the three cropping systems at the 12 sites where beetle populations were monitored during 1 yr, we used a linear mixed effects model with cropping system as fixed factor, village as random factor, and the sum of beetle number per field as dependent variable . To analyze the influence of cropping systems and environmental factors on the level of infestation by a. whitfieldi at the 31 plantations monitored in september 2012, generalized linear models were used to fit a gamma regression to infestation scores . Fixed factors used were j. curcas as hedge versus fields (all data); monoculture versus intercropping (fields only); and j. curcas plants adjacent to fallows in or outside the fields (all data and fields only). In the 3-month - old j. curcas field adjacent to fallow lands, the relationship between the level of infestation by the beetle and the distance to the nearest fallow was analyzed using a pearson correlation . The yearly abundance of a. whitfieldi at the 12 plantations is shown in figs . 1 and 2 . It appears before the main rains in april, but it becomes abundant only when the rainy season is well established, i.e., in late june and july . There was no significant difference in abundance between the different cropping systems (f = 11.451, p = 0.080, df = 2,6). 1.average number of a. whitfieldi adults per tree in the six fields in lo: two hedges, two intercropped fields, and two monocultures, between sept . 2012 and sept . 2.average number of a. whitfieldi adults per tree it the six fields in biha: two hedges, two fields intercropped fields, and two monocultures, between sept . Average number of a. whitfieldi adults per tree in the six fields in lo: two hedges, two intercropped fields, and two monocultures, between sept . Average number of a. whitfieldi adults per tree it the six fields in biha: two hedges, two fields intercropped fields, and two monocultures, between sept . Beetles were found at all 31 field sites surveyed in september 2012, with mean percentages of leaf surface damage varying from 0.5 to 39.5% . The type of cropping system did not significantly affect damage levels (hedges vs. fields, p = 0.463, wald = 0.538; intercropped field vs. monoculture, p = 0.573, wald = 0.318, df = 1) (fig . 3). However, the presence or absence of fallow land within or besides the plantation was important, i.e., a. whitfieldi was significantly more abundant on plants that were in the vicinity of fallows or when the field itself was not weeded (p = 0.001, wald = 11.97 with all data; p = 0.027, wald = 4.92 with fields only, df = 1) (fig . 3.percentage of leaf surface of j. curcas damaged by a. whitfieldi in 13 monoculture fields, 8 fields where j. curcas was intercropped with other plants, and 10 living hedges . 4.percentage of leaf surface of j. curcas damaged by a. whitfieldi in plantations in or adjacent to fallow lands compared with plantations where no fallow land occurred at <100 m from the assessed trees . Percentage of leaf surface of j. curcas damaged by a. whitfieldi in 13 monoculture fields, 8 fields where j. curcas was intercropped with other plants, and 10 living hedges . Percentage of leaf surface of j. curcas damaged by a. whitfieldi in plantations in or adjacent to fallow lands compared with plantations where no fallow land occurred at <100 m from the assessed trees . The importance of the proximity of fallows was confirmed by the separate observation in a plantation of 3-month - old j. curcas plants beside a fallow land . The level of attack by a. whitfieldi was significantly negatively correlated with the distance to the fallow (r = 0.590; p <0.001). Trees at 1 m of the fallow were defoliation at 85%, whereas those situated at more than 10 m of the fallow were defoliated at <40% and those at 38 m or more were defoliated at <10% (fig . 5). In the first 6 m from the fallow, 5.percentage of leaf surface of j. curcas damaged by a. whitfieldi in a plantation intercropped with soybean, adjacent to a fallow, according to the distance from the fallow . Percentage of leaf surface of j. curcas damaged by a. whitfieldi in a plantation intercropped with soybean, adjacent to a fallow, according to the distance from the fallow . Our long - term observations showed that population densities of a. whitfieldi and their damage on j. curcas were particularly high in the second half of the rainy season . Seem to be absent or less prevalent on j. curcas in dry areas (terren et al . Furthermore, j. curcas loses a large part of its leaves during the dry season, which does not favor the continuous presence of defoliating insects such as aphthona spp . It was common to observe newly planted seedlings totally defoliated and even killed by a. whitfieldi (a. s. unpublished observations). This study failed to show a significant difference in damage level in the different cropping systems, i.e., on hedges, monoculture plantations, or intercropping . Thus, the common observation that crops and trees are less vulnerable to pests in intercropping systems and mixed stands than in monocultures (e.g., andow et al . 1991, jactel and brockerhoff 2007) was not verified for a. whitfieldi on j. curcas . Nevertheless, in this preliminary study, we considered all intercropping systems together because we had no control on the associated crops, which varied not only between fields but also within the same field between seasons and years . It cannot be ruled out that a specific intercropping system could be found that would be able to lower pest populations, e.g., by repelling beetle or by attracting or hosting natural enemies . For example, in the region of kinshasa, drc, minengu et al . When j. curcas was intercropped with maize and the legume plant stylosanthes guianensis (aublet). Furthermore, there is a general agreement that, in africa, hedges and wide intercropping j. curcas systems should be favored over monocultures for economic, risk management, and food security reasons (e.g., jongschaap et al . Interestingly, a. whitfieldi seemed to be favored by the direct vicinity of fallow lands (wild grasses), including when j. curcas is planted in nonweeded land . Since we did not find a. whitfieldi on wild plants despite extensive surveys around j. curcas fields (a. s. unpublished observations), it is likely that the lower abundance of the pest in a clean environment is not due to the absence of wild hosts . Instead, it may rather be due to less favorable conditions for the immature stages (eggs, larvae, and pupae) in the soil . Indeed, weeding or ploughing the soil may affect immature stages, either directly or indirectly, by causing unfavorable abiotic conditions . Unfortunately, for the moment, little is known about the biology and ecology of a. whitfieldi, in particular during the immature stages . For example, it is still unclear in which stage the insect spends the dry season and how it survives the drought, how many generations it may have during the rainy season, what are its alternative host plants, etc . As other members of the alticinae subfamily, eggs are most probably laid on the ground and the larvae feed on roots . Several european aphthona spp . Used for the biological control of invasive euphorbiaceae in north america but these are temperate species, univoltine with an obligatory diapause in the soil the larval stage, broken by winter cold . It is likely that afro - tropical species have a very different bio - ecology that remains to be investigated before sustainable control can be developed . Aphthona spp . Can be easily controlled by chemical insecticides but their use is neither economically nor environmentally sustainable in africa (cassimo et al . 2015c). Based on preliminary observations described in this article and elsewhere, several recommendations can already be suggested for the control of a. whitfieldi and probably other aphthona spp . In other regions in africa . These recommendations will have to be tested through proper field experiments before being implemented . First, early plant establishment is critical, since the flea beetles are most damaging on young seedlings (rouamba 2011, minengu et al . 2015a, c) and, as shown by this study, mainly occurs in high numbers in the second half of the rainy season . Thus, every effort should be made to favor the fast growth of newly planted seedlings in the first part of the rainy season, by planting early and by planting as intercropping with fertilized crops, e.g., maize . Second, although the reasons are still unclear, we also showed that a. whitfieldi is more abundant in badly maintained (i.e., not weeded) fields and in the close vicinity of fallows furthermore, attention should be paid to seedlings planted right beside older j. curcas plants, even if these do not appear much affected . Established plants always sustain a variable level of flea beetles in the lower part of their crown (a. s. unpublished observations) and will act as a source of beetles for young, vulnerable seedlings.
The patient was a 25-year - old, right - handed woman who presented two months after the sudden onset of lower extremity paresthesias and sensory loss that extended into the abdomen and lower chest and one episode of urinary urgency and subsequent incontinence . Her examination was notable for brisk lower extremity deep tendon reflexes but no other abnormalities . Mri of the cervical and thoracic spine revealed both cervical and midthoracic plaques consistent with demyelination . A subsequent brain mri revealed five scattered, nonenhancing, white - matter lesions; including a large (approximately 5 mm in diameter) lesion involving the corpus callosum and two lesions perpendicular to the left lateral ventricle . Her b12 level, htlv-1 antibodies, vitamin e level, rpr, ana, and lyme titre were all within normal limits she was started on glatiramer acetate following her clinically isolated syndrome of partial transverse myelitis and mri findings confirming dissemination in space . Two and a half years after her initial presentation, she developed right hemiparesis that resolved over a few days following treatment with intravenous steroids . She had a subsequent similar episode of left hemiparesis and hemisensory deficit two months after that, confirming a diagnosis of clinically definite multiple sclerosis . One year after her initial presentation, she developed a sudden onset of discomfort in her legs associated with an urge to move that was worse at night and impaired sleep . The symptom resolved while walking and had been present for only 3 - 4 days at the time of presentation . Her last menstrual period was two weeks prior to this presentation, and she was faithfully using an oral contraceptive . Her iron level was 108 mcg / dl, iron saturation was 28.6%, and ferritin was 94 ng / ml . Her symptoms resolved a few days after a course of intravenous methylprednisolone (1 g daily for three days), and she had no recurrence over the next three years . Restless legs syndrome is a movement disorder characterized by distressing urge to move the legs (akathisia) associated with discomfort and that is brought on by rest, relieved by movement or walking, and become worse at night or in the evening . Her rather abrupt onset suggested the possibility of restless legs syndrome secondary to an underlying cause, such as pregnancy or iron deficiency . However, her diagnostic evaluation excluded these possibilities, and her clinical course and probable response to steroids suggested that her restless legs syndrome was due to an acute exacerbation of her multiple sclerosis . Several studies have reported an increased incidence of restless legs syndrome in patients with multiple sclerosis, have suggested both a role for restless legs syndrome in ms - related fatigue, and have suggested that multiple sclerosis is a cause of secondary restless legs syndrome [25]. However, none of these studies describe self - limited restless legs syndrome occurring as an acute exacerbation of multiple sclerosis as in this case . Manconi et al . Demonstrated a correlation between rls and cervical cord lesion burden . This patient had a known cervical cord plaque, and this correlation might also explain why no new intracranial lesion was detected during her acute presentation with rls . Restless legs syndrome is commonly idiopathic, but it has been associated with a number of conditions other than multiple sclerosis, including pregnancy, renal failure, peripheral neuropathy, and iron deficiency [1, 7]. Iron deficiency has been recognized in several studies as a cause for secondary restless legs syndrome, particularly at serum ferritin concentrations of less than 50 ng / ml [710]. The pathophysiology of even idiopathic restless legs syndrome is probably related to low brain iron levels . Mri, csf, and neuropathological studies have all implicated central nervous system iron deficiency in the pathophysiology of restless legs syndrome, even in the absence of systemic iron deficiency [1116]. Recently, there has been interest in the role of iron in ms and iron deposition because cerebral venous insufficiency has been suggested as a proposed mechanism for the disease . Haacke et al . Reported mri evidence of iron accumulation in the basal ganglia and thalamus of ms patients . Furthermore, iron appears to be an important cofactor in cns myelination, and van toorn et al . Have reported two cases of iron deficiency associated with tumefactive demyelination in children [2022]. The pathophysiology of ms consists of both an inflammatory demyelinating component and an axonal degeneration component . Levine et al . Reported normal csf ferritin, transferrin, and iron concentrations in ms patients with stable or relapsing and remitting ms, but elevated levels in the csf of patients with chronic progressive ms . Therefore, it is likely that the pathophysiology of rls in ms patients is related to the inflammatory, demyelinating component of the disease which may be associated with low or normal cns iron levels, rather than due to axonal degeneration, which is associated with cns iron accumulation . The observation that rls is associated with spinal cord plaques would also suggest a relationship to the inflammatory and demyelinating component of disease . This patient, presenting with transient rls due to an acute, inflammatory exacerbation of her multiple sclerosis, further supports the notion that the pathophysiology of rls in multiple sclerosis is related to autoimmune inflammatory demyelination.
Visceral obesity is associated with the metabolic syndrome (mets), type 2 diabetes and subsequent increased cardiovascular disease (cvd) morbidity and mortality . However, the exact mechanisms accounting for the deleterious effects of visceral fat on cvd remain unknown . It is now recognized that adipocytes are endocrine cells, secreting a number of molecules collectively referred to as adipokines that function as hormones, regulating the biological activities of different tissues and organs . Although many of these proteins remain uncharacterized, leptin, retinolbinding protein 4 (rbp4) and adiponectin have been identified as molecules responsible for the association between visceral obesity and insulin resistance (ir). Although many studies have documented the association between abdominal visceral adipose tissue (vat) or cvd risk in patients who are obese and have type 2 diabetes, confirmation of this relationship, after taking into account direct measurements of adipose tissue distribution in healthy individuals, is very limited . Furthermore, the role of adipokines in the association between body fat distribution and cvd risk has not been reported . The aim of the present study was to determine the relationship of cvd risk, as defined by the framingham risk analysis method, with body fat distribution (measured by clinical examination, bioelectrical impedance analysis [bia], fat computed tomography [ct] and dual energy absorptiometry [dxa]). In addition, we determined the possible role of adipokines, such as rbp4 and adiponectin, in the association between cvd risk and body fat distribution . The present study was designed to explore the associations of adiposity and adipokines in the korean population, and part of this had been presented before . In the present study, we recruited healthy adult volunteers (120 men and 180 women) by advertising . Volunteers participating in the present study had to meet the flowing criteria: (i) aged 1970 years; (ii) judged as healthy by a responsible physician with no abnormality identified on a medical evaluation, including medical history and physical examination; (iii) not pregnant in the case of females; and (iv) not taking any medication at the time of the study . Participants who were not suitable to participate in the present study for any reason, in the opinion of the responsible physician, were excluded . The analysis excluded participants for whom information was missing (1 man and 2 women), and with incidentally diagnosed diabetes with repeated testing (3 men and 3 women). As a result, the institutional review boards at the ilsan paik hospital approved the study protocol according to the declaration of helsinki; all participants provided informed consent . All participants completed a selfadministered questionnaire that included demographic characteristics, general health status, smoking history and current medications . Anthropometric and body composition measurements were carried out in all study participants before breakfast, with the participants wearing light clothing and without shoes . In addition, height, waist circumference (wc) and the hip circumference (hc) were measured . The body mass index (bmi) wc was measured midway between the inferior margin of the last rib and the crest of the ileum in the horizontal plane . Hc was measured around the pelvis at the point of maximal protrusion of the buttocks . Blood pressure (bp) was measured from the right arm subsequent to the participant sitting at rest for a period of 20 min . Total body fat and muscle were then measured by bia (inbody 3.0; biospace, seoul, korea). The total crosssectional abdominal and visceral fat areas were measured by ct scans (somatom plus 4; siemens, forchheim, germany) using an established protocol . A crosssectional scan, with 10mm thickness centered at the l4l5 vertebral disc space was obtained with the participant in the supine position using a radiograph of the skeleton as a reference; this was used to establish the position of the scans to the nearest millimeter . The abdominal subcutaneous adipose tissue (sat) area was calculated by subtracting the abdominal visceral adipose tissue (vat) area from the total area of adipose tissue . In addition, the body composition, including lean body mass and total body fat, was determined by a dxa (qdr 4500; hologic, bedford, ma, usa) carried out with a wholebody scanner . The trunk fat was determined as the amount of fat measured by the dxa from below the neck to the pelvis, excluding the limbs . Blood samples were collected from all participants after an overnight fast (10 h) between 08.30 h and 10.30 h, and the plasma were stored at 70 until used . Plasma rbp4 levels were measured with an enzyme immunoassay (eia) kit (adipogen, seoul, korea), and inter and intraassay variability were 7.2% and 5.5%, respectively . Plasma adiponectin was measured using a human adiponectin radioimmunoassay kit (linco research, st . Charles, mo, usa), with an intraassay coefficient of variation of 3.6% . The mean of two duplicated values was used for statistical analysis . Fasting plasma glucose, total cholesterol (tc), triglycerides (tg) and highdensity lipoprotein cholesterol (hdlc) were measured enzymatically using an autoanalyzer (advia 1650; bayer ltd ., highsensitivity creactive protein (hscrp) was measured by eia (modular p800; roche, basel, switzerland). The plasma levels of insulin and leptin were measured by radioimmunoassay (hitachi e170; hitachi ltd ., the ir index was calculated from the fasting plasma insulin, and the plasma glucose level was estimated by the homeostasis model assessment (homa) where: homa = fasting plasma insulin (lu / ml) fasting plasma glucose (mmol / l)/22.5 . The framingham risk score including age, tc, smoking status, hdlc and systolic bp, stratified by sex, was used to predict the 10year absolute risk of developing coronary heart disease (chd). To calculate the score for an individual, a 10year framingham coronary heart disease risk point (10year fcrp) score was assigned for each risk factor . Participants that smoked regularly during the previous 12 months were classified as current smokers . The presence of metabolic syndrome was determined according to the 2005 revised national cholesterol education program adult treatment panel iii (ncep atp iii) criteria . We defined visceral obesity as a wc 90 cm for males or 80 cm for females, as recommended by the revised ncep criteria . Analysis was carried out with 291 participants for whom both rbp4 and adiponectin data were available . Data are expressed as mean sd . The distributions for fasting insulin, tg, homair, rbp4, adiponectin, hscrp and leptin were normalized using log transformation, and transformed back for data presentation . We used the independent ttest or chisquaredtest to analyze differences in categorical data (with and without metabolic syndrome). Pearson s correlation analyses were used to describe the association between framingham scores and continuous variables of interest . A multiple linear regression analysis was used to test the independent association of framingham score and continuous variables . Multicollinearity was assessed using the variance inflation factor (vif). To avoid multicollinearity among wc, hc, waisttohip ratio (whr), total body fat and trunk fat, whr was included as an independent variable . To assess the significance of a linear trend, continuous variables were stratified to tertile . And, we used a oneway anova with posthoc analysis to assess the difference of mean values of the bmiadjusted vat or sat and levels of rbp4/or adiponectin with respect to the number of metabolic syndrome determinants . With twoway anova using the general linear model (univariate), we tested the effects of interaction between adiposity (bmi or vat) and the stratified variables (tertiles of crp, vat, sat, rbp4 and adiponectin) on means of framingham scores . Data were analyzed using spss for windows (version 12.0; spss inc ., chicago, il, usa). The present study was designed to explore the associations of adiposity and adipokines in the korean population, and part of this had been presented before . In the present study, we recruited healthy adult volunteers (120 men and 180 women) by advertising . Volunteers participating in the present study had to meet the flowing criteria: (i) aged 1970 years; (ii) judged as healthy by a responsible physician with no abnormality identified on a medical evaluation, including medical history and physical examination; (iii) not pregnant in the case of females; and (iv) not taking any medication at the time of the study . Participants who were not suitable to participate in the present study for any reason, in the opinion of the responsible physician, were excluded . The analysis excluded participants for whom information was missing (1 man and 2 women), and with incidentally diagnosed diabetes with repeated testing (3 men and 3 women). As a result, the institutional review boards at the ilsan paik hospital approved the study protocol according to the declaration of helsinki; all participants provided informed consent . All participants completed a selfadministered questionnaire that included demographic characteristics, general health status, smoking history and current medications . Anthropometric and body composition measurements were carried out in all study participants before breakfast, with the participants wearing light clothing and without shoes . In addition, height, waist circumference (wc) and the hip circumference (hc) were measured . The body mass index (bmi) wc was measured midway between the inferior margin of the last rib and the crest of the ileum in the horizontal plane . Hc was measured around the pelvis at the point of maximal protrusion of the buttocks . Blood pressure (bp) was measured from the right arm subsequent to the participant sitting at rest for a period of 20 min . Total body fat and muscle were then measured by bia (inbody 3.0; biospace, seoul, korea). The total crosssectional abdominal and visceral fat areas were measured by ct scans (somatom plus 4; siemens, forchheim, germany) using an established protocol . A crosssectional scan, with 10mm thickness centered at the l4l5 vertebral disc space was obtained with the participant in the supine position using a radiograph of the skeleton as a reference; this was used to establish the position of the scans to the nearest millimeter . The abdominal subcutaneous adipose tissue (sat) area was calculated by subtracting the abdominal visceral adipose tissue (vat) area from the total area of adipose tissue . In addition, the body composition, including lean body mass and total body fat, was determined by a dxa (qdr 4500; hologic, bedford, ma, usa) carried out with a wholebody scanner . The trunk fat was determined as the amount of fat measured by the dxa from below the neck to the pelvis, excluding the limbs . Blood samples were collected from all participants after an overnight fast (10 h) between 08.30 h and 10.30 h, and the plasma were stored at 70 until used . Plasma rbp4 levels were measured with an enzyme immunoassay (eia) kit (adipogen, seoul, korea), and inter and intraassay variability were 7.2% and 5.5%, respectively . Plasma adiponectin was measured using a human adiponectin radioimmunoassay kit (linco research, st . Charles, mo, usa), with an intraassay coefficient of variation of 3.6% . The mean of two duplicated values was used for statistical analysis . Fasting plasma glucose, total cholesterol (tc), triglycerides (tg) and highdensity lipoprotein cholesterol (hdlc) were measured enzymatically using an autoanalyzer (advia 1650; bayer ltd ., highsensitivity creactive protein (hscrp) was measured by eia (modular p800; roche, basel, switzerland). The plasma levels of insulin and leptin were measured by radioimmunoassay (hitachi e170; hitachi ltd ., the ir index was calculated from the fasting plasma insulin, and the plasma glucose level was estimated by the homeostasis model assessment (homa) where: homa = fasting plasma insulin (lu / ml) fasting plasma glucose (mmol / l)/22.5 . The framingham risk score including age, tc, smoking status, hdlc and systolic bp, stratified by sex, was used to predict the 10year absolute risk of developing coronary heart disease (chd). To calculate the score for an individual, a 10year framingham coronary heart disease risk point (10year fcrp) score was assigned for each risk factor . Participants that smoked regularly during the previous 12 months were classified as current smokers . The presence of metabolic syndrome was determined according to the 2005 revised national cholesterol education program adult treatment panel iii (ncep atp iii) criteria . We defined visceral obesity as a wc 90 cm for males or 80 cm for females, as recommended by the revised ncep criteria . Analysis was carried out with 291 participants for whom both rbp4 and adiponectin data were available . The distributions for fasting insulin, tg, homair, rbp4, adiponectin, hscrp and leptin were normalized using log transformation, and transformed back for data presentation . We used the independent ttest or chisquaredtest to analyze differences in categorical data (with and without metabolic syndrome). Pearson s correlation analyses were used to describe the association between framingham scores and continuous variables of interest . A multiple linear regression analysis was used to test the independent association of framingham score and continuous variables . To avoid multicollinearity among wc, hc, waisttohip ratio (whr), total body fat and trunk fat, whr was included as an independent variable . To assess the significance of a linear trend, continuous variables were stratified to tertile . And, we used a oneway anova with posthoc analysis to assess the difference of mean values of the bmiadjusted vat or sat and levels of rbp4/or adiponectin with respect to the number of metabolic syndrome determinants . With twoway anova using the general linear model (univariate), we tested the effects of interaction between adiposity (bmi or vat) and the stratified variables (tertiles of crp, vat, sat, rbp4 and adiponectin) on means of framingham scores . Individuals included 116 males (aged 40 11 years) and 175 females (aged 40 11 years). The bmi in men was higher than in women (25.4 3.1 vs 23.6 3.1 kg / m, respectively, p <0.001). When analyzed by presence of metabolic syndrome, the participants with metabolic syndrome were more likely to be male, older, a smoker and obese . Details relating to clinical, laboratory and anthropometric characteristics are presented in table 1 . The two groups were significantly different for all the metabolic and anthropometric parameters, as expected (table 1). Participants with metabolic syndrome showed higher levels of rbp4, crp, and framingham risk score and risk, whereas adiponectin values were lower than those without metabolic syndrome . Data are mean standard deviation or median (range), * p <0.05 . Bmi, body mass index; bp, blood pressure; hc, hip circumference; hdlc, high density lipoprotein cholesterol; homair, homeostasis model assessment of insulin resistance; hscrp, highsensitivity creactive protein; rbp4, retinolbinding protein 4; sat, subcutaneous adipose tissue; vat, visceral adipose tissue; wc, waist circumference; whr, waisttohip ratio . As shown in table 2, framingham score is significantly increased with age, bmi, wc, blood pressure, ir, tc / hdl, tg, obesity measured by bia and dxa, crp and rbp4, and, inversely, associated with adiponectin . The framingham score was higher in men compared with women (5.2 6.5 vs 0.8 0.91, respectively, p <0.001) and in smokers compared with nonsmokers (5.3 6.9 vs 1.1 1.4, respectively, p <0.001). Bmi, body mass index; bp, blood pressure;, correlation coefficients; hc, hip circumference; hdlc, high density lipoprotein cholesterol; homair, homeostasis model assessment of insulin resistance; hscrp, highsensitivity creactive protein; rbp4, retinolbinding protein 4; sat, subcutaneous adipose tissue; tc, total cholesterol; vat, visceral adipose tissue; wc, waist circumference; whr, waisttohip ratio . We carried out a stepwise multiple linear regression analysis using the framingham score as the dependent variable . In this analysis, we included sex, smoking status and variables, which were statistically significantly correlated with framingham score in table 2 (p <0.05) as independent variables . This model showed that age, smoking status, bmi, tg and rbp4 were independently associated with framingham score; in addition, they accounted for 76.1% (adjusted r) of the variance in the framingham score of analyzed individuals (table 3). In this model, bmi, body mass index; rbp4, retinolbinding protein 4; se, standard error . When participants were stratified according to the number of the determinants of the metabolic syndrome as defined by the revised ncep atp iii criteria, bmiadjusted vat increased with a number of determinants of metabolic syndrome (pvalue for trend <0.001; figure 1a). Sat also increased with a number of determinants of metabolic syndrome (data not shown). However, the bmiadjusted value did not show these linear relationships (p = 0.326 for trend; figure 1b). The rbp4 concentration was increased linearly according to the number of determinants of metabolic syndrome (p = 0.008 for trend), whereas the adiponectin decreased (p = 0.003 for trend; figure 1c, d). Means of body mass indexadjusted abdominal (a) visceral adipose tissue (a) and (b) subcutaneous adipose tissue (sat), plasma levels of (c) retinol binding protein 4 (rbp4), and (d) adiponectin with an increasing number of the determinant of metabolic syndrome (n for each number of determinant are 62, 94, 78, 36, 19 and 2, respectively). (c, d) bars signify means; error bar, 95% confidence interval of means . Figure 2 shows the distribution of framingham score by tertile crp, vat and sat according to bmi (figure 2a), and crp, rbp4 and adiponectin according to vat adjustment of bmi (figure 2b). The mean values of framingham scores were increased along the tertiles of crp and vat with increases of the tertiles of bmi (all p <0.001) without any interaction (p = 0.509 and 0.054, respectively). However, inverse relationships were observed in the case of sat values (p <0.001) without interaction (p = 0.151; figure 2a). The framingham score for each rbp4 tertile was significantly different at each level of bmiadjusted vat (p = 0.035), as well as adiponectin (p = 0.049) or crp (p = 0.015) without any interaction (pvalue ranged from 0.133 to 0.976; figure 2b). (a) mean values of the framingham score for each tertile of highsensitivity creactive protein (hscrp), visceral adipose tissue (vat) and subcutaneous adipose tissue (sat) along the body mass index (bmi) tertile, (b) and those for each tertile of hscrp, rbp4 and adiponectin along the vat tertile . * n = 97, each) are following: bmi 20.621.2, 24.024.3 and 27.528.3 kg / m; crp 0.0220.025, 0.0470.051 mg / dl and 0.1520.279; vat 36.841.6, 76.582.0 and 134.4149.4 cm; sat 103.8114.9, 168.5173.6 and 238.9258.2; vat * 1.71.9, 3.13.3 and 5.15.3 cm/[kg / m]; rbp4 33.135.4, 49.651.6 and 75.483.1 g / ml; adiponectin 2.93.3, 6.36.8 and 14.017.1; 149.4; sat 103.8114.9, 168.5173.6 and 238.9258.2 g / ml . The unique contribution of the present study is the evaluation of a wide range of traditional and nontraditional risk factors for cvd in wellcharacterized subjects . Furthermore, we documented the significant, independent associations of the direct measurements of vat and the framingham score with variation in the levels of rbp4 after adjustment for confounding factors . Individuals with visceral obesity are at an increased risk of type 2 diabetes and cvd . Furthermore, these individuals had increased metabolic risk factors including ir, dyslipidemia, elevated free fatty acids and subclinical inflammation compared with individuals with lower body obesity . Although paradigms, such as the portal hypothesis and the endocrine hypothesis, have been suggested, the role of adipokines remains unknown . However, it is possible that adipokines might become more important with longerterm obesity or visceral fat deposit itself, when a pro or an antiinflammatory role of these adipokines might become an important factor . The present study showed that an increased plasma level of rbp4 in visceral fat accumulation, measured by ct, was associated with cvd risk factors independent of traditional cvd risk factors (age, smoking, triglyceride, obesity). In the present study, we found a strong positive relationship between rbp4 and framingham score, composite of cvd risk factors, at the degree of visceral adiposity . In addition, the plasma level of rbp4 increased along the increase of determinants of metabolic syndrome, consistent with previous reports (figure 1a). These inconsistencies most likely result from variations in studied subjects: genetic background, sex ratio and age, sample size, effects of retinol status, iron status, kidney function, and assay methods used . In the present study, with multiple linear regression analysis of rbp4 as a dependent variable, plasma levels of rbp4 were independently associated with men (standardized coefficients = 0.288, p <0.001), triglyceride (= 0.239, p <0.001) and vat (= 0.152, p = 0.013) in participants without metabolic syndrome, and tg (= 0.398, p = 0.002) and vat (= 0.390, p = 0.002) in participants with metabolic syndrome (data not shown). Thus, we had observed a significant association between rbp4 and vat in all participants . This association was more prominent in participants with metabolic syndrome in whom rbp4 was independently associated with vat, even after accounting for sex, age and bmi . Consistent with a previous study, in which a correlation of rbp4 with abdominal obesity in participants with a wide range of bmi was shown, these findings let us suggest the possibility of an association between circulating rbp4 with specific fat deposits and a role of rbp4 in the associations of cvd risk factors . In addition, framingham scores in participants with the highest tertile of vat were not different between those with the lowest tertile of bmi and those with the highest tertile of bmi (mean [95% ci], 5.6 [3.0, 11.9] and 5.5 [7.7, 10.4], respectively, p = 0.129). However, there was weak, but not significant, interaction between visceral fat deposit (i.e. Vat) and overall obesity (i.e. Bmi) on the framingham score (p = 0.054). These findings are similar to that studied in an asian population study, and also agree with evidence linking specific visceral fat deposit to the increased risk of cvd . The opposite correlations of rbp4 and adiponectin for vat were consistent with studies of cultured visceral and subcutaneous adipocytes from humans and animal models . Findings from these studies have shown that although both adiponectin gene expression and secretion are higher in visceral adipocytes, adiponectin secretion from adipocyte deposition decreases with increasing visceral obesity . This might partly explain the present results, in regard to a blunted protective effect of adiponectin on the cvd risk with increasing visceral obesity (figure 2b). The underlying mechanism responsible for the interaction of these adipokines in situations of visceral fat deposit or metabolic syndrome with the cvd risk factors remains to be elucidated by future studies . Crp has been identified as an effecter in the atherothrombotic process, and as a predictor of cvd risk among representative inflammatory markers in the clinical setting . However, the correlation between crp and framingham score did not reach statistical significance in multiple linear regression analysis . These findings suggest that correlations between crp and various atherosclerotic risk factors should be corrected for adiposity or adipokines, because the adipocyte itself is a known source of various inflammatory cytokines . First, the framingham risk (represented as%) could overestimate or underestimate the risk in populations other than the usa population . Although it has not been established whether the framingham risk is suggested as a predictor of chd risk in korea, reasonable accuracy in predicting chd in an asian population had been shown in the past, and koreans were found to have a comparable cvd risk profile and their estimated 10year chd risk is currently almost as high as that in the general usa population . Second, there are no previous data available for determining sample size for the present study . Power calculations were based on the addition of a variable to an existing regression model with a r of 0.40.5 . A sample size of the present study provided 99.8% power at the 5% significance level for detecting an increase in the r of 0.05 or greater third, the participants in the present study were a clinically narrow range from the perspective of overall risk; as shown, 95.5% of study participants showed thus, someone might argue that this cohort was neither heterogeneous nor representative of the general population . However, the purpose of the present study and cohort was to investigate the association of adiposity and cvd risk in healthy subjects without any known cvd diseased condition . Despite the clinically narrow range from the perspective of overall risk, the study s findings showed the relevant relationship between plasma levels of rbp4 and cvd risk factors, represented by framingham score rather than framingham risk . Finally, the crosssectional deign of the present study did not definitively establish the causal relationships . Additional human studies using longitudinal study designs are required for further clarification of these relationships . In conclusion thus, rbp4 could play a role in the mediating deleterious effects of visceral obesity on the increased risk of cvd independent of traditional risk factors.
In carefully selected patients, bilateral total knee arthroplasty (b./l - ka) is considered to be a safe procedure.14 during the past few years, there has been an increasing frequency of patients undergoing b / l - tka . Quantum of pain and speed of rehabilitation are two main concerns for patients considering b / l - tka . The frequent query is whether the pain would be twice as much in b / l - tka as in unilateral total knee arthroplasty (u / l - tka). Literature is divided on this issue; few studies have shown increased pain in the first two days after b / l - tka while others show no difference in the pain between u / l and b / l - tka.58 in the long term, there is no difference between u / l - tka and b / l - tka with regards to function, pain or rom attained.56 some studies have shown that patients undergoing b / l - tka lag in rehabilitation milestones compared to their unilateral counterparts.78 but, how soon they reach comparable function is as yet not clear . The parameters compared in previous studies were pain,578 range of motion (rom),589 length of stay (los),581011 active straight leg raising (slr),8 transfer to stick walking,8 stair climbing.61012 studies comparing the long term function have compared sf-36 (short form 36), womac (western ontario and mcmaster universities osteoarthritis index questionnaire score), hss (hospital for special surgery) scores or similar functional scores.691214 an objective assessment of function in the early recovery period is lacking in most studies . We thus decided to compare the early functional recovery by evaluating a unique timed up and go test (tug) test . Also, previous studies have failed to take into account the status of the opposite knee when comparisons were made . The status of the opposite knee cannot be ignored as patients with significant oa in the opposite knee would be slower in rehabilitation as compared to patients whose opposite knee is already operated . The aims of our study were to 1) to identify approximate timelines by which the functional recovery of b / l - tka would match their preoperative status and also the recovery of patients with u / l - tka; 2) assess the effect of the status of the contralateral knee in u / l - tka on functional recovery . This was a retrospective study where records and data of 77 consecutive patients of a single surgeon (rm) operated over a period of three months was analyzed . Subjects included were 1) patients undergoing primary tka for osteoarthritis; 2) patients being able to walk three meters and back for tug test; 3) history of any previous surgery (including opposite knee arthroplasty) done should be at least three months before the current surgery . Our exclusion criteria were 1) neurological diseases, 2) patients with rheumatoid arthritis (as they interfered with performance of tug test). Consent was obtained from all patients regarding use of their data for study and analysis purpose . Postoperative values on day 3, day 5, day 14 2, day 42 5, day 90 7 and at 1 year 15 days post tka considering the day of surgery as day 0 were considered for analysis . We also analyzed records of anthropometric, personal and clinical characteristics including age, sex, side of the limb being operated, weight and height for all participants . All surgeries were performed with computer navigation and the same pfc sigma series (warsaw, in) of implants and the same computer - navigated technique was used by the surgeon in all the patients . The outcomes assessed were pain at rest and while walking on vas scale, active rom of the knee, tug test values, womac and sf-12 (short form 12) scores and los . While in the hospital, assessments were performed by one of the authors at the same time of day, i.e., in the morning before subjecting the patient to physical therapy sessions . Further assessments were done at subsequent followup visits . Pain score at rest and on walking was measured using a visual analog scale (vas) on a scale of 0 to 10.15 our patients were under continuous epidural analgesia for the first 48 hours and therefore we studied pain from day 3 onwards . The rom measurement was taken with a standard handheld goniometer . Its center of rotation was placed in line with the center of the knee, the fixed arm aligned with the greater trochanter and the mobile arm aligned with the lateral malleolus . Rom was measured at the edge of the bed with the patient sitting with his thighs parallel and horizontal to the floor . If the difference was more than 5, then a third measurement was taken and an average of the closest two measurements was taken.16 this functional test records the time taken by the patient to get up from a chair with armrests, walk 3 m, turn around, walk back to the chair and sit down.17 the chair seat was 46 cm in height, and the 3-m walkway was delimited by permanent painted lines on the floor . It is easy to perform and has the unique advantage that the patient is able to perform the test in the early rehabilitative period when other objective functional scores are difficult to assess . Tug test also assigns a score based on the time taken for the activity, which can be compared with other patients and also with one self at different time periods . Though this test was primarily used to assess basic functional mobility in geriatric age group patients,17 it has been shown to be useful in assessing functional results after total hip and knee arthroplasty.61820 womac and sf-12 are two elaborate tests with several items and very often, not possible by the patient to perform in the early postoperative period.2122 in our study, they were both administered preoperatively and postoperatively on day 90 and at 1 year . Length of stay was measured from the day of surgery, which was considered as day 0 . All patients were discharged at the same time in the evening after performing their last physical therapy session . Demographic and clinical characteristics of the subjects and baseline measurements were compared between groups by use of analysis of variance (anova) for continuous variables and chi - square tests for categorical data . Unpaired t test was used for further analysis if anova values were found to be significant . The type ii error () is 20%; therefore, the power for the study is 80% (1-). The outcomes assessed were pain at rest and while walking on vas scale, active rom of the knee, tug test values, womac and sf-12 (short form 12) scores and los . While in the hospital, assessments were performed by one of the authors at the same time of day, i.e., in the morning before subjecting the patient to physical therapy sessions . Pain score at rest and on walking was measured using a visual analog scale (vas) on a scale of 0 to 10.15 our patients were under continuous epidural analgesia for the first 48 hours and therefore we studied pain from day 3 onwards . Its center of rotation was placed in line with the center of the knee, the fixed arm aligned with the greater trochanter and the mobile arm aligned with the lateral malleolus . Rom was measured at the edge of the bed with the patient sitting with his thighs parallel and horizontal to the floor . If the difference was more than 5, then a third measurement was taken and an average of the closest two measurements was taken.16 this functional test records the time taken by the patient to get up from a chair with armrests, walk 3 m, turn around, walk back to the chair and sit down.17 the chair seat was 46 cm in height, and the 3-m walkway was delimited by permanent painted lines on the floor . It is easy to perform and has the unique advantage that the patient is able to perform the test in the early rehabilitative period when other objective functional scores are difficult to assess . Tug test also assigns a score based on the time taken for the activity, which can be compared with other patients and also with one self at different time periods . Though this test was primarily used to assess basic functional mobility in geriatric age group patients,17 it has been shown to be useful in assessing functional results after total hip and knee arthroplasty.61820 womac and sf-12 are two elaborate tests with several items and very often, not possible by the patient to perform in the early postoperative period.2122 in our study, they were both administered preoperatively and postoperatively on day 90 and at 1 year . Length of stay was measured from the day of surgery, which was considered as day 0 . All patients were discharged at the same time in the evening after performing their last physical therapy session . Pain score at rest and on walking was measured using a visual analog scale (vas) on a scale of 0 to 10.15 our patients were under continuous epidural analgesia for the first 48 hours and therefore we studied pain from day 3 onwards . Its center of rotation was placed in line with the center of the knee, the fixed arm aligned with the greater trochanter and the mobile arm aligned with the lateral malleolus . Rom was measured at the edge of the bed with the patient sitting with his thighs parallel and horizontal to the floor . If the difference was more than 5, then a third measurement was taken and an average of the closest two measurements was taken.16 this functional test records the time taken by the patient to get up from a chair with armrests, walk 3 m, turn around, walk back to the chair and sit down.17 the chair seat was 46 cm in height, and the 3-m walkway was delimited by permanent painted lines on the floor . It is easy to perform and has the unique advantage that the patient is able to perform the test in the early rehabilitative period when other objective functional scores are difficult to assess . Tug test also assigns a score based on the time taken for the activity, which can be compared with other patients and also with one self at different time periods . Though this test was primarily used to assess basic functional mobility in geriatric age group patients,17 it has been shown to be useful in assessing functional results after total hip and knee arthroplasty.61820 womac and sf-12 are two elaborate tests with several items and very often, not possible by the patient to perform in the early postoperative period.2122 in our study, they were both administered preoperatively and postoperatively on day 90 and at 1 year . Length of stay was measured from the day of surgery, which was considered as day 0 . All patients were discharged at the same time in the evening after performing their last physical therapy session . Demographic and clinical characteristics of the subjects and baseline measurements were compared between groups by use of analysis of variance (anova) for continuous variables and chi - square tests for categorical data . Unpaired t test was used for further analysis if anova values were found to be significant . The type ii error () is 20%; therefore, the power for the study is 80% (1-). During the three months of our study, 83 patients (97 knees) underwent primary tka . Of these, six patients were excluded as they did not conform to our selection criteria two patients had neurological disorder, two had rheumatoid arthritis and two patients were from outside the country hence their followup was incomplete . The first group consisted of 14 consecutive patients undergoing sequential b / l - tka (28 knees), second group consisted of 42 consecutive patients undergoing unilateral tka whose opposite knee was not operated u / l - tka (42 knees) and the third group consisted of 21 patients undergoing unilateral tka but whose opposite side had already been operated for tka earlier u / l + c / l - tka done (21 knees). There was no difference between the preoperative demographics [table 1] and in the parameters of pain, rom, tug test and preoperative deformity between the three groups . It was noted that patients who had the opposite knee operated in the unilateral group had a statistically better womac score preoperatively and patients undergoing b / l - tka had a better mental component sub - score of sf-12 . Preoperative demographics and comparisons between all parameters across all groups all patients were reviewed at the designated time periods except for eight patients who were excluded at the one - year assessment . Six of these patients were from the u / l - tka group; they underwent tka for the opposite side before the one - year followup and were thus excluded . One patient each, from the b / l - tka group and the u / l + c / l - tka done group missed their 1-year followup and were excluded from the analysis [figure 1]. Flowchart of groups and their followup results of the postoperative parameters for the three groups are tabulated in tables 26 . No statistically significant difference was found in the parameters of pain [table 2 and rom [table 3] amongst the groups at all assessment points . As judged by the tug test values, patients in the bilateral group were slower on days 3 and 5 as compared to other groups . These values became comparable in the three groups from day 14 onwards [table 5]. Within each group, tug test values at all assessment points were compared for each group with respect to their preoperative values [table 4]. Bilateral group patients returned to better than preoperative tug test values by day 42 compared to 90 days required for the other groups . No significant difference was found between the groups in womac at all time periods evaluated . Comparison between pain values at all time intervals comparison between range of motion across all time intervals timed up and go test values comparison within group comparison between timed up and go test values across all 3 groups western ontario and mcmaster universities osteoarthritis index questionnaire score and short form-12 comparisons preoperatively, 3 months and at 1 year los was five days for patients undergoing u / l - tka and six days for b / l - tka patients . Los was longer for b / l - tka patients in our series, as we had a fixed protocol of discharging b / l - tka patients on day 6 after surgery (one day more than u / l - tka patients), giving them a day more to rehabilitate for activities of daily living . The significant findings for each parameter in the three groups, up to 1 year are as under: pain at rest on day 3 was higher than the preoperative pain in all three groups, which is attributed to surgical site pain, and it returned to better than the preoperative values by day 5, improving steadily thereafter . Pain on walking was better than the preoperative values on day 3 and gradually improved equally in all three groups thereafter . Pain at rest and on walking showed no significant difference between the three groups at all time intervals . It was by day 42 that the rom in each group returned to the preoperative value . Tug test values were statistically higher in the bilateral group as compared to both unilateral groups at days 3 and 5 . By day 14, the values in all three groups were comparable to each other (p = 0.19), albeit they were still higher in bilateral group [table 5]. On day 42 and 90 if comparison was done within each group, then the bilateral group did statistically better at day 42 as compared to preoperative values, while those in unilateral groups took 90 days for the tug test values to be statistically better than their preoperative values [table 4]. Total womac scores were statistically better preoperatively in the u / l + c / l - tka group (p = 0.002). Even the pain, stiffness and physical function sub - scores were statistically better in the u / l + c / l - tka group preoperatively . Postoperatively, at day 90 and at one year though there was no significant difference between the three groups [table 6]. Sf-12 pcs sub - score did not show any difference preoperatively or postoperatively across all three groups . The mcs though was statistically better preoperatively as well as postoperatively in the bilateral group [table 6]. No patient had any complication like, superficial or deep infection, wound complications, deep vein thrombosis, pulmonary embolism, cardiac complications etc . Pain at rest on day 3 was higher than the preoperative pain in all three groups, which is attributed to surgical site pain, and it returned to better than the preoperative values by day 5, improving steadily thereafter . Pain on walking was better than the preoperative values on day 3 and gradually improved equally in all three groups thereafter . Pain at rest and on walking showed no significant difference between the three groups at all time intervals . It was by day 42 that the rom in each group returned to the preoperative value . Tug test values were statistically higher in the bilateral group as compared to both unilateral groups at days 3 and 5 . By day 14, the values in all three groups were comparable to each other (p = 0.19), albeit they were still higher in bilateral group [table 5]. On day 42 and 90, there was no statistical difference between tug test values of all three groups . If comparison was done within each group, then the bilateral group did statistically better at day 42 as compared to preoperative values, while those in unilateral groups took 90 days for the tug test values to be statistically better than their preoperative values [table 4]. Total womac scores were statistically better preoperatively in the u / l + c / l - tka group (p = 0.002). Even the pain, stiffness and physical function sub - scores were statistically better in the u / l + c / l - tka group preoperatively . Postoperatively, at day 90 and at one year though there was no significant difference between the three groups [table 6]. Sf-12 pcs sub - score did not show any difference preoperatively or postoperatively across all three groups . The mcs though was statistically better preoperatively as well as postoperatively in the bilateral group [table 6]. No patient had any complication like, superficial or deep infection, wound complications, deep vein thrombosis, pulmonary embolism, cardiac complications etc . Arthroplasty surgeons presenting surgical treatment options to patients with osteoarthritis are handicapped by the paucity of literature on early and intermediate functional outcomes following u / l - tka and b / l - tka surgery . The rate of recovery and regaining independence are the most important considerations while considering bilateral over unilateral surgery . We found no difference in pain at rest or on walking amongst the three groups at all assessment points . Powell et al . Studied pain in the first 48 hours and found pain scores to be one point higher with 20% more narcotic requirement in the bilateral group, but thereafter the pain and analgesic requirement was the same.7 fick et al . Studied narcotic use and found no difference except that the use of nonsteroidal anti - inflammatories and paracetamol was higher in the bilateral group, which they attributed to the longer stay in bilateral group.5 shetty et al . Also observed more pain in bilateral patients on days 1 and 4, having used regional anesthesia, periarticular injections and intravenous infusion followed by oral analgesics.8 our first measurements for pain were on day 3, so we cannot comment on the pain experienced in the first 48 hours as has been done in the other studies . But our study corroborates the earlier studies that there is no difference in the pain experienced by b / l and u / l - tka patients after the first 48 hours.578 between the three groups, rom values also showed no significant difference at all time intervals . None of the patients in any group required knee manipulation . For all three group patients, rom returned to preoperative values by day 42, which further improved by three months . Bilateral patients gained rom at the same rate as unilateral patients at all time intervals . Other studies too have not found any difference in the rom between unilateral and bilateral cases.589 the bilateral group had statistically significant higher tug test scores on days 3 and 5 . This is expected, as with both limbs operated, their functional recovery would be slow . By day 14, the values were still marginally higher in the bilateral group but the difference was not significant statistically . Thus, early functional recovery is slower in b / l - tka patients up to day 5, even though they have similar pain relief and rom as compared to u / l - tka patients . We could find two studies in the literature, which had compared early recovery after b / l - tka to u / l - tka . Used active slr and transfer to stick walking as parameters for judging early functional recovery and they concluded that there was only a 24-h delay in the ability to walk with a stick in bilateral knee patients.8 the activities of daily living of a postoperative patient during early recovery involve sitting and standing and also walking and turning, which are not evaluated by these parameters . Tug test evaluates these parameters and that was the reason for taking it as a parameter for early functional recovery . Zeni et al . In their study took tug test and stair climbing ability as parameters of functional recovery, but the first evaluation was at more than 3 weeks after surgery when there was no difference between bilateral and unilateral groups . The results of our study suggest a time duration of 2 weeks post b / l - tka for functional recovery to become equal to recover after u / l - tka . Tug test values in the b / l - tka group became better than the preoperative values by day 42 while the unilateral groups took 90 days for the same . Based on this finding, patients can be counseled regarding their recovery . As b / l - tka patients take longer to recover, los was longer in our series . We had a fixed protocol of discharging b / l - tka patients one day later than u / l - tka patients, giving them a day more to rehabilitate for activities of daily living . Studies that used rehabilitation milestones as the end point for discharge show a longer los for bilateral tka.5810 studies having a fixed day discharge protocol had to shift some bilateral patients to a rehabilitation center.11 we used two parameters for judging late functional recovery, the womac and sf-12 scores . As judged by the womac and sf-12 pcs scores, there was no difference in the late functional recovery between the three groups . Had used knee outcome score activities of daily living scale (kos), medical outcomes survey short form 36 physical component summary (pcs) and tug test to assess function and found no significant difference between their unilateral and bilateral groups at 1 and 2 years from the surgery.6 ritter et al . Found unilateral group to have consistently lower knee society score than bilateral tka group at 5, 10, 12 and 15 years post surgery, but considered this outcome to be clinically irrelevant.14 fick et al . At one - year postoperatively in unilateral and bilateral tka patients.5 our study reconfirms that there is no difference in the 1-year functional recovery between unilateral and bilateral tka . Sf-12 score showed no difference in the pcs component preoperatively as well as postoperatively at three months and one year . The mcs subcomponent though, had significantly higher values in the bilateral group preoperatively as well as at three months . Zeni et al . Too found no significant difference in sf-36 (pcs subcomponent) values in their groups of patients.6 we separated unilateral tka patients into u / l tka and u / l + c / l tka groups as the latter had better womac scores preoperatively . We hypothesized that this better function might translate into better functional recovery postoperatively, but this benefit did not seem to translate in a rapid postoperative recovery as seen by similar tug test values to the u / l - tka group . This could be due to the fact that with the analgesic regimen followed; the pain is well controlled in the nonoperated limb of the u / l - tka group patients and irrespective of its arthritic status they show good function . The unilateral group where the other side did not undergo tka included some patients who required tka of the other side and some who did not warrant arthroplasty on the other side . This could have affected the parameters for functional recovery . In day - to - day practice, one sees patients who complain of pain only on one side when in fact both the knees are severely involved as per radiological studies . So it becomes very difficult to have a division of these unilateral arthroplasty patients into two groups where one requires and the other does not require arthroplasty on the other side . To conclude the early functional recovery of bilateral tka patient lags behind that of unilateral tka patient for the first 5 days, becomes equal by the 14 day and remains equal till 1 year after surgery . Bilateral tka patients regain their preoperative functional status by 6 weeks against 3 months for unilateral tka . The operative status of the contralateral knee makes no difference to early functional recovery after unilateral tka . With bilateral tka
Integration of several quantum dot (qd) devices on a single chip offers the advantages of compact size, high speed and low optical losses, added to the advantages discrete qd devices offer due to three - dimensional carrier confinement in the active region . Ion implantation induced intermixing is a technique that is compatible with planar processing and can be used for band gap tuning, essential for device integration . Ion implantation induced intermixing has been widely used for band gap tuning of quantum wells (qw) and qds [3 - 8]. Though there are many reports on band gap tuning of qds, there are no reports to date on multi - color qd lasers using ion implantation induced intermixing . In this letter, we report on multi - wavelength qd lasers fabricated using implantation induced intermixing . We first demonstrate differential band gap shift and effect on carrier confinement and energy level spacing in qds due to ion implantation induced intermixing, using photoluminescence (pl). Then we report on multi - color qd lasers and discuss the effect of intermixing induced changes in confinement and energy level separation in the active region on the performance of the devices . The thin p - clad laser structures studied in this work were grown by metal - organic chemical vapor deposition (mocvd) system . Trimethylindium, trimethylgallium and ash3 with h2 as the carrier gas were used as the precursor sources; silane and ccl4 were used as n- and p - type dopant sources, respectively . The active region of the lasers consisted of five layers of in0.5ga0.5as qds incorporated into gaas barrier layers . 100 kev protons at a dose of 5 10 cm were implanted into the active region, wherever mentioned . Following implantation, the device structures were annealed at 600 c for 30 min in the presence of ash3 . Annealing conditions were chosen to maximize the room temperature (rt) pl recovery from the qds in the active region . Pl spectra from the active region of the devices were obtained prior to device fabrication by exciting the samples using a 635 nm laser and collecting the luminescence using a cooled ingaas detector . Four micrometers wide ridge wave - guide lasers were fabricated from the annealed and as - grown laser structures using the standard device processing steps . The as - cleaved devices were tested at rt in pulsed mode (duty cycle 5%). First, we present results demonstrating differential band gap shift and the effect of annealing on the carrier confinement and separation between consecutive energy levels in the qds in the active region of the laser structure . Due to larger effective mass of holes compared to that of electrons, the hole energy levels are closely spaced than the electron energy levels and holes are less confined than the electrons in the as - grown sample . Interdiffusion has the same effect on hole energy levels as that on electron energy levels, but we only discuss the effect of interdiffusion on carriers with higher confinement (electrons), as the device performance is affected mainly by changes in electron confinement rather than the hole confinement . Figure 1 shows the 10 k pl spectra from the active region of the device structures annealed with and without implantation . For the un - implanted region, the qd ground state (gs) luminescence peaks at 1015 nm (p1). Due to enhanced interdiffusion caused by proton implantation, the qd gs luminescence peak (p1) from the implanted region is blue shifted with respect to peak p1 from the un - implanted region . Under the implantation and annealing conditions used in this study, peaks p2 and p2 represent qd excited state (es) transitions in un - implanted and implanted samples, respectively . The wetting layer transitions appear at shorter wavelengths and are denoted as p3 and p3 for the un - implanted and implanted samples, respectively . Photoluminescence spectra at 10 k from the active region of the device structures annealed with or without implantation . Inset schematically defines the energy terms (eandeconf) used in the text the carrier confinement in the active region of the devices is determined by the separation between the gaas (barrier) band edge and the qd energy levels (econf in fig . 1). Assuming a conduction band offset of 0.6 eg, the confinement energy for the electrons occupying the lowest energy level in the conduction band of qds in the as - grown device structure is 230 mev (not shown), whereas the confinement energy for the carriers occupying the gs of qds in the un - implanted and implanted, annealed devices is 180 mev and 168 mev, respectively . Thermal population of qd es depends on the energy separation between the gs and es (e in fig . 1). The separation between consecutive energy levels in the conduction band calculated from the observed peaks in the pl spectra from both implanted (p1 and p2) and un - implanted (p1 and p2) samples is 35 mev, which is very close to the thermal energy of carriers at rt . These results indicate that the carriers in the annealed quantum dots have smaller confinement energy and greater probability of occupying es . We now present results demonstrating multi - color lasing from the qd lasers fabricated using ion implantation induced intermixing and compare their characteristics with as - grown devices . Figure 2 shows the lasing spectra of 2 mm long lasers fabricated from un - implanted and implanted device structures . The lasing spectrum of an as - grown device is also shown as a reference . The blue shift between the spectra of as - grown device and annealed only device is a result of interdiffusion due to background (grown - in) defect levels, whereas the shift between the annealed only device and device annealed after implantation is due to implantation induced differential band gap shift . The spectra of implanted and un - implanted devices are shifted with respect to each other by 40 mev . This shift is greater than the shift in the qd pl peak positions indicated by the dashed vertical lines in fig . 2 that the annealed devices have broader lasing spectra compared to that of the as - grown devices . Broad lasing spectra could be a consequence of high injection current densities required for lasing in the annealed devices . Lasing spectra of 2 mm long lasers fabricated from as - grown; un - implanted, annealed and implanted, annealed device structures . Inset shows lasing spectra of 1 mm long laser fabricated from implanted and un - implanted, annealed device structures simultaneous lasing from different energy levels in qd or qw lasers has been observed by several groups [13 - 16], especially for short cavity lengths and was explained in terms of high cavity losses, which lead to increase in threshold and thus to increased band filling . Increasing the operation temperature would also require higher injection and leads to the same effect . At rt, the as - grown devices studied in this work lase from qd gs for all cavity lengths whereas the annealed devices show simultaneous lasing from different energy levels (for l 1.5 mm for un - implanted and l 2 mm for implanted devices). 2 shows the lasing spectra of 1 mm long devices fabricated from annealed device structures (with or without implantation). As will be discussed later, the annealed devices have higher thresholds (consequence of smaller econf and e) leading to increased band filling . Also, smaller values of e in the annealed qds increase the probability of thermal population of higher energy levels . So we attribute simultaneous lasing from different energy levels in the annealed devices to modification of energy level separation in the active region, as a consequence of annealing . Figure 3 shows the threshold current densities of as - grown, un - implanted, annealed and implanted, annealed devices . The implanted and un - implanted devices have similar threshold current densities, suggesting that at the implantation conditions used, there are no additional residual defects in the implanted devices after annealing . The annealed (both implanted and un - implanted) devices have higher threshold current densities than the as - grown devices for any given cavity length . The annealed devices also have lower slope efficiencies than the as - grown devices (inset of fig . 3). From 5 c to 20 c, the slope efficiency of a 3 mm long un - implanted, annealed device changes by 89%, while that of an as - grown device of same length changes by only 30% by increasing the temperature from 5 c to 55 c . The smaller separation between consecutive energy levels (e) in the annealed qds cause loss of carriers from lower (lasing) energy states to higher energy states, reducing the net gain available from these states . Increased thermal population of higher energy states in the barrier / wl (smaller values of econf) increases the fraction of injected carriers that can access non - radiative recombination paths . The loss of carriers from the lasing states to higher energy levels in the qds / wl / barrier results in increased threshold currents and lower slope efficiencies in the annealed devices . The fraction of carriers lost from the lasing states to states that do not contribute to lasing increases with increasing temperature as [exp (e / kbt)], where e is the energy separation between the lasing and non - lasing energy states . The rate of loss of carriers is higher in annealed samples because of smaller values of e and econf, resulting in a rapid decrease in the slope efficiency with temperature, compared to the as - grown sample . Threshold current density versus cavity length for as - grown; un - implanted, annealed and implanted annealed lasers . Inset shows the output power (l) versus injected current (i) plots for as - grown and annealed devices (cavity length: 3 mm) the above results indicate that smaller values of e and econfin the multiple - wavelength devices result in poor performance compared to the as - grown devices . Improvement in device performance has been reported by engineering the qd energy levels (to increase e) and using algaas barriers (to increase econf). We believe that using similar approaches with implantation induced intermixing may result in multi - color lasers with improved characteristics . In summary, we have demonstrated multiple wavelength ingaas qd lasers using ion implantation induced intermixing . For a cavity length of 2 mm, the shift in the lasing wavelength of un - implanted and implanted devices is 40 mev . Implantation followed by annealing of device structures used for achieving differential band gap shift alters the energy level spacing in the active - region, resulting in broader lasing spectra, higher threshold current densities and lower slope efficiencies with respect to the as - grown devices . Hence band gap tuning using ion implantation induced intermixing requires careful design of devices to minimize carrier loss from the qd active region.
Sarcoidosis is a multisystemic, granulomatous disease of unknown etiology that may affect any organ system . It is characterized by the accumulation of t lymphocytes and mononuclear phagocytes with the formation of noncaseating epithelioid granulomas in affected organs . The trigger for this t cell and macrophage interaction is still uncertain, although bacterial, viral, and environmental antigens have all been studied . Recent literatures renewed the interest in mycobacteria as a causative agent in sarcoidosis tissue [2, 3]. Here we present a case of presumed ocular sarcoidosis diagnosed by ocular manifestation and treatment course, who developed tuberculous lymphadenopathy 6 years later without recurrence of ocular inflammation . A 35-year - old female was referred to our department with severe visual impairment for months . She was quite healthy until 1 year ago when she began to suffer recurrent episodes of uveitis with mutton fat keratic precipitates (kps) in both eyes . On presentation, ocular examination showed mild anterior uveitis with mutton fat kps and dense vitreous hemorrhage in both eyes . Systemic workup including general physical examination, complete blood counting, differential classification, blood biochemical tests, rheumatic factor, antinuclear antibody, human immunodeficiency virus, venereal disease research laboratory test, anticardiolipin antibody, and chest radiography were within normal ranges . Due to persistent vitreous hemorrhage and disabled vision, pars plana vitrectomy was performed in the left eye and then the right eye 2 months later . Sign of peripheral vasculitis with nodular choroid infiltration was noted during operation in both eyes . Gallium-67 scans showed panda sign of increased uptake in lacrimal glands and lambda sign of lymph nodes in the mediastinum (fig . 1). Chest computed tomography (ct) showed a small ground glass opacity nodule in the subpleural space of the right lower lobe, more in favor of inflammatory process . Based on these findings, ocular sarcoidosis was impressed and systemic and topical steroids administered in a tapering dose over 6 months . Unfortunately, painless enlargement of lymph node at her right neck was noted 6 years later . Lymph node biopsy showed granuloma with caseous necrosis, langhans giant cell, as well as acid - fast bacilli (fig . 2). Three combined antituberculosis medications (rifampin, isoniazid, and pyrazinamide) were given for 6 months . The eyes remained silent except cataract progression and glaucoma under two medications during this period (fig . 1gallium-67 scans showed panda sign of increased uptake in lacrimal glands and lambda sign of lymph nodes in the mediastinumfig . 2pathological finding from lymph node biopsy showed granuloma with caseous necrosis (hematoxylin and eosin, 40) (a), langhans giant cell (hematoxylin and eosin, 400) (b), as well as acid - fast bacilli (kinyoun's crystal fuchsin acid - fast stain, 1,000) (c)fig . 3postoperative color fundus picture of both eyes showed sheathing vessels and scattered laser scars at the inferior retina . A right eye . B left eye gallium-67 scans showed panda sign of increased uptake in lacrimal glands and lambda sign of lymph nodes in the mediastinum pathological finding from lymph node biopsy showed granuloma with caseous necrosis (hematoxylin and eosin, 40) (a), langhans giant cell (hematoxylin and eosin, 400) (b), as well as acid - fast bacilli (kinyoun's crystal fuchsin acid - fast stain, 1,000) (c) postoperative color fundus picture of both eyes showed sheathing vessels and scattered laser scars at the inferior retina . A right eye . The gold standard for diagnosis of sarcoidosis is histopathologic examination . Considering the fact that ocular sarcoidosis may occur in the absence of apparent systemic involvement, and the fact that biopsy is usually reluctantly accepted by uveitis patients, the international workshop on ocular sarcoidosis (iwos) established an international criteria for the diagnosis of ocular sarcoidosis . Although there was no pathologic proof of sarcoidosis in our case, her ocular manifestations met at least five of the iwos criteria . Though the lacrimal gland uptake of gallium (panda sign) is not a specific sign for sarcoidosis, her simultaneous presence of lambda and panda sign on ga-67 scans gave some support to sarcoidosis . As guided, other granulomatous diseases, including tuberculosis, foreign body reaction, bacterial and viral infections, should be excluded before the diagnosis of sarcoidosis . Other laboratory and image study ruled out the other possible etiologies . Besides, the ocular inflammation subsided after pars plana vitrectomy and systemic corticosteroid . There was no recurrence of inflammation even at the time of tuberculous lymphadenopathy . Presumed ocular sarcoidosis was impressed based on the ocular manifestations and treatment course . We could not make any conclusion whether ocular sarcoidosis and tb lymphadenopathy in this patient is just coincident or in real association with each other . Despite the increasing understanding of the immune responses behind the formation and maintenance of the granulomatous process in sarcoidosis mycobacteria have been implicated as a cause of sarcoidosis, although the demonstration of mycobacterial dna was inconsistent in different reports [6, 7]. Recent studies by detecting mycobacterium tuberculosis catalase peroxidase have renewed interest in mycobacteria as a causative agent in sarcoidosis [2, 3]. In our case, tb was ruled initially due to negative results of chest x - ray, aqueous tb culture, and pcr . Tuberculin skin test was not done as our cdc did not identify the significance of ppd in adult who received routine bacille calmette guerin vaccination . The ocular inflammation revolved after systemic steroid, and remained silent even at the presence of tb lymphadenopathy . Our speculation is that the presumed ocular sarcoidosis might be triggered by tb antigen in extraocular infection, which reactivated and presented as tb lymphadenopathy 6 years later . Tb could occur coincidently or in association with sarcoidosis, continued follow - up is important for patients with ocular sarcoidosis, even in silent case.
Typically, most of the coronary artery rests on the epicardium but some cases, the epicardial coronary artery runs congenitally into the myocardium . During the systole, the heart muscle exerts pressure across the region and constricts the coronary artery, which is called the myocardial bridge (mb). Since coronary angiography is a common procedure and non - invasive methods, such as multidetector computed tomography (mdct), can make a diagnosis of even a minute part more simple, myocardial bridges have been found in a substantial number of patients, even though the prevalence varies according to the report . Most clinical findings show that the mb does not lead to major problems while some cases report that unstable perfusion of the coronary arteries can cause serious cardiac disorders, such as myocardial ischemia, myocardial infarction, arrhythmia, and even sudden cardiac death . The authors experienced a bronchial spasm after an unexpected elevation of the st segment, followed by ventricular fibrillation immediately after sudden bradycardia and hypotension, which was suspected to be a coronary spasm . A 56-year - old, male patient (62 kg) with sinusitis presented for the removal of a nasal polyp and endoscopic sinus surgery . The patient had been administered acebrophylline, montelukast sodium orally for bronchial asthma, and was using formoterol fumarate dihydrate micronized budesonide turbuhaler every morning for the last two years . He often felt pain and palpation on the chest when he coughed heavily but the electrocardiogram (ecg) and echocardiography tests did not reveal any specific abnormalities . Twenty four hour holter monitoring had been advised to keep a log of the heart's electrical activity . However, the patient had not received further medical treatments because the symptoms had disappeared . He reported a feeling of anxiety when he was hospitalized, but there were no abnormalities in the blood test, simple chest x - rays, electrocardiogram and echocardiography . For administration before surgery, famotidine 20 mg and glycopyrrolate 0.2 mg were injected into the muscle site, and on the morning of the day of surgery, salbutamol sulfate was used as a spray . Upon admission, the vital signs indicated that the blood pressure, heart rate and oxygen saturation was 100/60 mmhg, 68 beats / min and 99%, respectively . Patient monitoring was measured with a non - invasive auto blood pressure, pulse oximetry, and electrocardiogram . For the induction of anesthesia, propofol 2 mg / kg and rocuronium 0.6 mg / kg were administered and endotracheal intubation was performed after muscle relaxation had been fully achieved . The blood pressure and heart rate immediately after endotracheal intubation was 140/90 mmhg and 90 beats / min, respectively . For the maintenance of anesthesia, sevoflurane 2 - 3.0 vol%, o2 1 l / min, and air 2 l / min were administered, and controlled respiration was performed to set the pet co2 (partial pressure of end - tidal carbon dioxide) to 30 - 35 mmhg . Remifentanil was administered from 0.25 g / kg / min at the onset but reduced to 0.05 g / kg / min at the end in a stepwise manner . After the induction of anesthesia, 200 mg of isepamicin was administered and the surgeon added a aqueous solution of lidocaine - epinephrine (1: 10,000) into a cotton roll and placed it into the patient's nasal cavity . After pulling it out 5 minutes later, a solution of lidocaine - epinephrine (1: 100,000) was injected into the membrane, and the operation was started . For his vital signs during surgery, the blood pressure range, heart rate range was 90 - 110/55 - 66 mmhg and 60 - 70 beats / min, respectively, and the electrocardiogram showed regular signs while the oxygen saturation and end - tidal co2 pressure was 99 - 100% and 35 mmhg, respectively . Five minutes after the operation was started, a minor abnormality of a st segment elevation appeared . After 10 minutes, the elevation of the st segment increased along with a gradual decrease in heart rate . The plateau observed in capnography at the release of gas out of the lung was decreasing by degrees . An immediate change to manual control ventilation with 100% oxygen was made, but there was a perceivable sense of resistance at the respiratory bag . The vital signs at that time were a blood pressure, heart rate oxygen saturation range and pet co2 of 88/50 mmhg, 50 beats / min, 84 - 99% and 45 - 48 mmhg, respectively . The vital signs at the subsequent measurements revealed a sheer decrease in bp and heart rate to 88/50 mmhg and 40 beats / min, respectively (fig . 1). Immediately, ephedrine 8 mg and atropine 0.5 mg were administered . In 10 minutes, however, a ventricular fibrillation occurred and the surgeon's attention was called to cease the operation, followed by cpr . With manually controlled ventilation and external cardiac massage, administration of external 360 j shocks restored normal sinus rhythm . At that moment, the vital signs were a bp, heart rate, oxygen saturation and pet co2 of 95/55 mmhg, 120 beats / min, 98%, 52 mmhg, respectively . A catheter was then inserted into the radial artery for an arterial blood gas analysis (abga). The results of the arterial blood gas analysis were a ph, paco2, pao2, hco3 and a sao2 of 7.167, 58.7 mmhg, 371.1 mmhg, 21.4 mm / l and 97.9%, respectively . After consulting with the surgeon, we reached the conclusion that the operation should be terminated . The vital signs were maintained with blood pressure, heart rate oxygen saturation and pet co2 of 100 - 110/60 - 65 mmhg, 110 - 120/min, 98%, 43 mmhg, respectively . The result of abga indicated a ph, paco2, pao2, hco3 and sao2 of 7.281, 48.4 mmhg, 268.0 mmhg, 23.0 mm / l and 99.1%, respectively . At the termination of the operation, he was transported to the intensive care unit while being intubated with an endotracheal tube . The vital signs measured at the arrival to the intensive care unit showed a bp, spo2 and heart rate of 110/65 mmhg, 99% and 120 beats / min, respectively . The patient complained that he felt tight in the chest and at his request, salbutamol sulfate, a medication usually taken by him, was administered by spray . A slight elevation of the sinus rhythm and st segment in the electrocardiogram was suspicious of myocardial ischemia, so nitroglycerine 1 - 2 g / kg / min was administered continuously . The chest x - rays and echocardiography were normal, and the cardiac marker test demonstrated troponin - t was positive . The troponin - i level was 5.33 ng / ml (normal <0 - 0.1 ng / ml), and the ck - mb also was normal . For approximately 2 hours, the vital signs were maintained quiet normally with the bp, heart rate and spo2 at 95 - 100/50 - 55 mmhg, 90 - 110 beats / min and 99%, respectively, when the st segment elevation disappeared and the suffocating feeling in the chest had been ameliorated to some degree . After consulting with a cardiac physician, coronary angiography was used to determine if the patient's vital signs had returned to normal . A follow - up examination of the ecg kept showing a normal rhythm, and for 24 hours, the normal vital signs were maintained with no abnormal findings . The coronary angiography performed on the next day revealed no abnormal findings, such as an arteriosclerotic legion or thrombus (fig . 2a), except for a myocardial bridge, approximately 2 - 2.5 cm in size, displaying 60 - 65% vascular stenosis during systolic period at themiddle part of the left anterior descending artery, which corresponded to the st segment elevation of v3-v5 (fig . Three days later, when hospitalization care at the internal medicine ended, he was discharged home without any particular abnormalities under a follow - up observation . A myocardial bridge is a congenital coronary anomaly that is present when a segment of the epicardial coronary artery runs intramurally through the myocardim and the coronary artery is compressed with each systole . Recently, leschka et al . Performed a comparative experiment of 100 patients with chest pain using conventional coronary angiography and multidetector computed tomography, and reported that coronary angiography detected mb in 12 (12%) out of 100 patients, whereas mdct detected mb in 26 patients (26%). According to them, the reason why mdct showed a higher depiction rate than conventional coronary angiography was that mdct can diagnose the depth and length of mb, as well as the extent of systolic compression pressure more closely . In addition, the most common affected region of mb is the left anterior descending (lad) artery, and the mb is usually distributed over the connecting area of the proximal and middle part of the lad artery . The clinical features vary from silence to atypical chest pain or angina symptoms according to the degree of systolic compression pressure or the depth and length of the tunneled segment . Although the ecgs of patients with mb usually show normal findings, stress testing might induce signs of ischemia, conduction disturbances, or arrhythmia, etc . . In other words, the clinical results of patients with mb are relatively mild and do not bring up serious issues . However, mb is known to cause unstable angina pectoris, myocardial infarction, arrhythmia and even sudden death when the coronary artery perfusion is unstable . However, their suggestions with vascular stenosis on the proximal part of mb or with the systolic compression could not give a satisfactory explanation to myocardial ischemia or patients' symptoms . Recently, ge et al . Demonstrated with image analysis using intravascular ultrasound (ivus) that the blood flow at the diastole in patients with mb increased in proportion to the occlusive time during the systole, and that the diastolic / systolic flow velocity ratio increased . They reported that the coronary vascular lumen at the late systole will be the minimum in patients with mb, while the vascular lumen at the late systole and early diastole will be a maximum in patients without . In addition, an increase in early diastolic flow triggers the still compressed narrow bridge segment, causing perfusion impairment in the coronary artery, which makes a crucial mechanism for ischemia . In particular, the occurrence of tachycardia reduces the filling time of the diastolic coronary and causes myocardial ischemia easily, whereas the increased systolic compression enhances the vascular compression during the diastole and systole, provoking the symptoms of mb easily . In addition, the hypofunction of endotheliocytes and angiospasm play an important role as a mechanism for myocardial ischemia . Coronary angiography performed after surgery did not reveal any fixed arteriosclerotic lesions, but found mb showing a stenosis in the coronary artery at the systole . A provocation test was not attempted during the coronary angiography because the patient underwent cpr . However, a myocardial bridge, approximately 2 - 2.5 cm in size, was found during the operation (fig . 2b) displaying 60 - 65% vascular stenosis during the systolic period at the middle part of the left anterior descending artery, which corresponded to the st segment elevation of v3-v5 (fig . The mb is believed to be responsible for the coronary spasm during anesthesia . Regarding the possibility of a coronary spasm at the site of mb triggering myocardial infarction, gallat et al . Suggested that an ergonovine provocation test showed a positive response in the case of patients with mb who had a myocardial infarction without any arteriosclerotic coronary disorders on angiocardiography . In an animal experiment on pigs, saitho et al . Reported that damage to the vascular endotheliocyte due to repeated coronary compression caused a coronary spasm . In a comparative experiment on the incidence of coronary spasm, teragawa et al . Reported that among patients with chest pain, the incidence of coronary spasm was higher in patients with mb than in the patients without (30 out of 41 patients with mb [73%] 29 out of 73 patients without [40%]). Although there has not been an established theory regarding the mechanisms for mb, such as the high incidence of coronary spasm, histological studies suggested that arteriosclerotic lesions do not appear in patients with mb on the coronary angiography, but they may be suppressed in the mb region . Hence, the likelihood of coronary spasm at mb is high . A coronary spasm also occurs when damage to the vascular smooth muscle and endotheliocyte causes a vascular malfunction, and repeated compression and shear stress to the mb are believed to worsen the vascular dysfunction . The gradual elevation of the st segments concomitant with an increase in the air way pressure due to bronchoconstriction in the present case suggests that parasympathetic accentuation was developed by an inducing factor during general anesthesia, causing an imbalance in the automatic nervous system . It is believed that such parasympathetic accentuation first causes coronary spasm at mb showing an endothelial dysfunction in the coronary artery governed by the parasympathetic nervous system, while bronchial asthma also activated by parasympathetic accentuation causes bronchoconstriction, resulting in an increase in air way resistance . In an experiment study, lee et al . Reported that the influence of remifentanil and nasal packing of epinephrine on the hemodynamic changes in endoscopic sinus surgery can accentuate the vagus nerve . Although the precise amount of epinephrine absorbed cannot be measured precisely because all the epinephrine packed in cotton does not infiltrate into the nasal cavity, it is suggested that the absorption of low doses (1 - 2 g / min) will stimulate the vascular relaxant 2 receptor to cause hypotension and bradycardia . In particular, the significantly high frequency of hypotension and bradycardia with 0.25 g / kg / min of remifentanil was reported to come from the side effects of blocking on vagus nerve stimulation and sympathetic activation . In our case, where the vital signs during the operation did not change enough to cause tachycardia or any significant changes affecting the level of myocardial oxygen consumption or supply, such as hypothermia, hypoxia, etc, vagus nerves accentuation is believed to be a factor to make a mb cause a coronary spasm . Glycopyrrolate or ephedrine can be helpful to prevent bradycardia or hypotension, but they should be used with care because they can induce myocardial ischemia due to tachycardia in patients with mb . Nitroglycerine, which is commonly used for ischemic heart diseases, was used in our case . According to hongo et al ., the use of nitroglycerine for the treatment of coronary spasm in patients with mb can decrease the intrinsic tone of the coronary artery wall and aggravate the ischemia caused by mb due to positive inotrophy stimulated by the sympathetic nerve . However, yu et al . Reported that among the medications used in a long - term clinical follow - up of patients with mb, the appropriate administration of a beta blocker, calcium channel blocker, and nitrate product according to the patient's condition showed favorable outcomes on most symptoms . In addition, koji et al . Suggested that the use of nitroglycerine to treat ischemia was quite effective in patients with mb associated with a coronary artery spasm . This case also highlights the use of nitroglycerine to treat ischemia in patients suspected of having mb to attenuate the suffocating feeling of which the patients complained, and did not aggravate the myocardial ischemia . Therefore, more case reports and studies on the use of nitroglycerine will be needed . Moreover, in light of such cases, the use of nitroglycerin in patients with mb needs more monitoring with caution . In general, a beta blocker and calcium channel blocker are used to secure hemodynamic balance during anesthesia for patients with mb . However, some reports claimed that the calcium channel blocker is more effective in the treatment of coronary artery spasm in patients with mb than a beta blocker because a beta blocker decreases the systolic narrowing in a segment of mb, aggravating the coronary artery spasm . Regarding the choice of anesthetics, lee et al . Used sevoflurane for patients with mb because there is a low occurrence of cardiac rate accentuation and no coronary steal . However, iwama et al . Published a case report of a fatal acute myocardial infarction during general anesthesia in a child with mb, in which sevoflurane is regarded as a vasodilator to cause hypotension and lead to a sheer decrease in coronary blood flow . The choice of anesthetics for patients with mb also requires more clinical case results and further study . In conclusion, cardiopulmonary resuscitation was performed due to sudden ventricular fibrillation that occurred after a progressive elevation of the st segment in a patient with an undetected underlying disorder in the coronary artery . As a coronary spasm was suspected, coronary angiography was performed after surgery and a mb was found showing constriction at the systole . Regarding the mechanisms for coronary artery spasm in patients with mb, an imbalance of the automatic nerve system and vascular over response have attracted attention . Therefore, a close diagnosis using the mdct at the early phase should be made, and the management of peri - operative anesthesia for patients with an underlying disorder, such as mb, requires discreet judgments in anesthetic methods and medication use with more caution in monitoring the ecg and vital signs.
This is an experience that affects women's future health and their relationship with their families . Positive experience of delivery in women is formed when they are well supported at the time of delivery . Since 1993, some changes in maternal and delivery care have occurred after designing various guidelines and bills of rights in most of the countries with the goal of modification of care quality and compliance with mothers rights including their awareness of various care methods and their informed selection and the increase of justice in receiving care . In iran, patients bill of rights was firstly designed in the ministry of health and medical education in 2001 and was revised due to its existing defects . Bill of rights for the mothers in labor and delivery was designed in accordance with the iranian culture by the ministry of health, treatment and medical education . This bill of rights, like the other bills of rights, includes conservation of privacy, confidentiality of the information related to the mother in labor, availability of information, informed consent, and respect to the mothers preferences and decisions, freedom, independency, and the right to participate in decision - making, receiving appropriate care, and being safe against any type of physical and psychological hazards, which should be obeyed by all treatment team members . Labor bill of rights is just a collection of ethical codes, already learned by the treatment team during their education, is laid in emotional domain with regard to categorization of educational goals, and should be institutionalized and valued . Based on this, it is recommended to consider this issue not only during the education as a theoretical lesson but also in clinical skills training . Even after graduation it is understood that compliance with patients bill of rights leads to improvement in patients health staff interaction . Patients awareness of their own rights results in an increase in quality of care and reduction of the costs . Meanwhile, disrespecting patients rights can endanger their health, life, and safety and results in a lowered efficiency of the care and services given to the patients . Literature review shows a wide gap between national policies and treatment team performance in giving services and the compliance with patients rights (especially among mothers during labor). The results of studies showed that neither the mother nor the treatment team staff is familiar with the rights of the mothers in labor . Meanwhile, some personnel, despite being aware of these rights, actually disrespect the bill of rights, which results in a disorder in their function . Khodakarami et al . Showed that 85% of the women were unaware of their rights in labor room and although most of them had signed the consent form, only 12.4% actually had an informed consent and most of them had no idea about the content of consent form . In addition, most of the mothers did not receive adequate knowledge about delivery stages, treatment interventions, and the related delivery mode . Bayrami showed that after holding an educational workshop on patients rights for the midwives, based on the viewpoints of 70% of the subjects in the study group, psycho - social legal rights issues had been followed at a very high level in the study group, while 96.5% of control group believed that their psycho - social rights were respected at medium level . Ozdemir reported that in turkey, 51% of the midwives and nurses claimed not to have studied any materials in relation with patients rights . Afshari reported that most of the midwives had adequate knowledge about religious legal issues (coverage of labor women's body, not looking at or touching her body, conducting episiotomy, etc . ), but their function was poor in some contexts . Respect to patients rights depends on social, cultural, economic, and ethical variables in a society . With regard to the importance of mothers compliance with the rights in the labor room and its role in different and specific outcomes among various patients, this study aimed to determine health providers compliance with the pregnant women's bill of rights in labor and delivery and some of its related factors in the year 2013 this is a descriptive, cross - sectional survey conducted in four educational hospitals affiliated to isfahan university of medical sciences . In the present study, 257 subjects were selected through census sampling (n = n), including undergraduate midwifery students (over semester 5), all non - straight bs students and ms midwifery students who were passing their internship or clerkship periods in labor rooms at the time of the study (n = 84), all residents of gynecology and obstetrics (n = 40), interns of general medicine (who were passing their internship period at the time of study) (n = 34), all academic members of the gynecology department (n = 21), and midwives (including casual or employed staff who attended the research environment) (n = 78). In case of losing interest in continuing with the study or not responding to the questions, the subjects were excluded . Finally, data analysis was performed with 226 completed questionnaires (response rate of 87%). Data collection tool was a researcher - made questionnaire designed based on mothers bill of rights in relation with labor that was issued by the ministry of health and medical education, and was completed through self - report method . The first section of the questionnaire included demographic characteristics such as age, school year of the residents, semester, marital status, and subjects personal experiences of labor . The second section was about the level of compliance with the mothers bill of rights in labor, designed by the ministry of health and medical education (16 items), scored in a five - point likert's scale (always, often, sometimes, rarely, and never) with points ranging 04, which was evaluated through a self - assessment method . In addition to calculation of relative and concrete frequency, the scores were categorized into five groups of very poor (020), poor (2040), moderate (4060), good (6080), and very good (80100). Content validity was used to establish the validity of the questionnaire through consideration of indications of 10 academic members of isfahan university of medical sciences . Test - retest was used to establish the questionnaire's reliability, and the questionnaire was completed by 15 students, residents, and midwifery personnel who were qualified to complete the questionnaire . Next, with a 10-day interval, the questionnaire was completed again and a correlation of over 80% was obtained for all items . Researcher obtained permission from the authorities of the nursing school and the educational hospitals, affiliated to isfahan university of medical sciences, based on subjects internship and working shift schedule . Then, after getting her letter of introduction and an informed consent from the subjects, the researcher distributed the questionnaires among the subjects to notify their viewpoints concerning their compliance with mothers bill of rights in a self - report method and collected them back . Ethics approval was obtained from the ethics committee of vice chancellery for research in isfahan university of medical sciences . Ethics approval was obtained from the ethics committee of vice chancellery for research in isfahan university of medical sciences . The findings showed that mean age of the subjects was 30.0 (8.29) years . There were general medicine interns (n = 32), midwifery personnel (n = 69), gynecology and obstetrics residents (n = 28), midwifery students (n = 79), and gynecology and obstetrics department academic members (n = 18). The results showed that there were 132 married (58.40%) and 94 single (41.60%) subjects . Only 82 subjects (36.28%) had experienced hospitalization in the labor room, while the rest did not have such an experience . The level of compliance with mothers bill of rights was found to be at an excellent level in 22.8% of midwifery students, 28.6% of gynecology and obstetrics residents, 21.9% of general medicine interns, 50% of gynecology and obstetrics academic members, and 31.9% of midwives [table 1]. Wallis test showed that the compliance with mothers bill of rights was not the same in the different groups (the lowest score was in the two groups of midwifery interns and midwives and the highest in gynecology and obstetrics academic members) (p = 0.002) [table 2]. There was a significant association between the level of mothers bill of rights compliance and the school year of gynecology and obstetrics residents (p = 0.001), midwifery students semester (p = 0.001), and work experience (p <0.001), but it showed no significant association with age (p = 0.826). Whitney test showed that the level of compliance with mothers bill of rights was higher in those with a personal experience of labor, compared to those without such an experience (p <0.001). Frequency distribution of the subjects compliance with labor women's bill of rights comparison of mean (sd) of subjects compliance with labor mothers bill of rights this study investigated the level of compliance with mothers bill of rights in the labor room and during parturient period among members of the treatment team in educational hospitals in isfahan . The results showed that about half of the academic members complied with the bill of rights at an excellent level . Meanwhile, in the other four groups, only about one - fourth of the subjects complied with mothers bill of rights at an excellent level, which shows a defective compliance . The subjects levels of compliance with mothers bill of rights in labor was not the same in such a way that the lowest was in the two groups of interns and midwives and the highest was in gynecology and obstetrics academic members . Based on researcher's investigations, no study has been conducted by the iranian ministry of health on compliance with labor mothers bill of rights in iran . Most of the studies had been conducted on compliance with patients bill of rights . An investigation on staff's viewpoints about patients rights in thailand showed that the healthcare providers had a high level of attitude and function concerning patients rights and reported that one of the reasons for such a high function of the treatment team was administration of care based on ethical codes . Showed that administration of care during labor contractions by the treatment team in tehran was at its lowest level of appropriateness . Mossadeghrad and esnaashary also reported that the compliance with patients rights was poor in shahid beheshti hospital in isfahan . Kazemnezhad and hesamzadeh, in a study on the level of compliance of the physician and nurses with patients bill of rights from the viewpoints of their colleagues, reported a significant difference in the two groups of physicians and nurses concerning general compliance with patients rights, and also reported that general compliance with patients rights was lower among the physicians . In the present study, compliance with mothers bill of rights was significantly higher among the subjects with previous experience of hospitalization in labor, compared to those without . In fact, they had a better understanding of the pregnant mothers condition in parturient period, which resulted from their own personal experience . The findings showed a direct association between compliance with mothers bill of rights in labor and the number of bs midwifery students semester and the residents school year in such a way that higher semesters of midwifery students and higher school years of residents brought about more compliance with the bill of rights . The obtained results showed that midwifery students and general medicine interns had a lower compliance with clients bill of rights, possibly due to their less exposure to a clinical setting . Patenaude et al . Reported that ethical considerations were higher among senior students compared to junior students . Meanwhile, in the same study, ethical consideration was reported to be higher in some university students attending hospital in their first year, and decreased with time . Yamany reported that the role of clinical education in learning professional ethical specifications was very important and suggested paying more attention to the role model character of an academic member to improve the role of clinical education in professional ethics . The present study showed a significant association between subjects compliance with mothers bill of rights and their age . Limjaroen reported no significant association between treatment team's attitude toward compliance with patients rights and their age in thailand . There was a direct association between subjects compliance with mothers bill of rights and their work experience in such a way that higher work experience brought about higher compliance . Nasiriani et al ., in a study on implementation of patients rights from nurses viewpoints, reported a significant association between the experienced staff having skills such as braveness, problem - solving skills, increased preparation for risk taking, and ability to overcome the problems during care, and administration of ethical care based on patients need . Therefore, one of the challenges in the educational system of the managers is development of the strategies that support the treatment team in development of such abilities and emphasizing on these skills . Compliance with patients bill of rights is based on cultural and social conditions in each society . Therefore, the advantages and disadvantages of its implementation in various societies should be investigated and modified with help of the results obtained in other studies and their localization . In the present study, observation of function of treatment team was conducted through self - report method in which the subjects might have scored their function falsely higher (compared to their real score), which it can be counted as a limitation . Therefore, conducting further studies through a non self - report method, as well as supervision, inspection, and evaluation of labor rooms in hospitals are recommended.
Chikungunya fever is a mosquito - borne emerging viral disease caused by chikungunya virus (chikv), which belongs to the genus alphavirus of the family togaviridae . It is endemic in many parts of africa and asia where seroprevalence rates reach 75%.1 in africa, the virus maintains a sylvatic cycle between nonhuman primates and forest - dwelling mosquitoes, while in asia transmission of chikv occurs in an urban cycle involving humans and aedes spp . Albopictus).2 typical clinical symptoms of chikungunya include fever, headache, myalgia, rash, and arthralgia . The symptoms, particularly joint pain, can be severe and long lasting in many patients.3 in many european countries, imported cases of chikungunya were repeatedly reported.47 first, autochthonous chikv cases were reported during the 2007 outbreak and involved more than 200 cases in the ravenna province, italy.8,9 in 2014, an outbreak including 12 chikv cases occurred in montpelier, france.10 in croatia, chikv antibodies were sporadically detected in travelers from endemic areas . A seroepidemiological study conducted during 20112012 showed that 0.9% inhabitants of the croatian littoral are seropositive to chikv.11 we report the first detection of an imported, clinically manifested case of chikungunya fever in croatia . On march 26, 2016, a 27-year - old woman visited the infectious diseases outpatient department because of persistent arthralgias and rash . She works as a stewardess on a cruise ship and she stayed in costa rica for 2 months where she developed symptoms; then she returned to croatia on march 21 . She remembered a mosquito bite on her left forearm because she noticed a little hematoma around the indurated papule which she had not experienced after earlier mosquito bites . Five days after the mosquito bite, on the first day of her disease, she felt symmetrical arthralgias in her ankles, knees, wrists, and elbows but also in small joints of her hands and feet . Her arthralgias deteriorated, so she could hardly walk . On the fifth day of her illness, an itchy rash appeared on her trunk, and the next day it extended to her face, extremities, as well as palms and soles . The erythematous papular rash subsided in the next 2 days . At the same time, she became afebrile, while arthralgias remained up to the tenth day of her illness after which she was feeling well, but exhausted . During the acute phase of her illness ten days after she had recovered, severe arthralgias in her ankles, elbows, right shoulder, and in the small joints of hands and feet reappeared . She also complained about morning stiffness lasting for 1030 min . On the initial visit (day 15 after the disease onset), the physical examination was normal except for rash on the trunk, extremities, palms, and soles (figure 1). Routine laboratory tests were normal, except for slightly elevated liver transaminases, erythrocytes 4.3510/l (reference range [rr]: 3.865.08), leukocytes 8.410/l (rr: 83.49.7), lymphocytes 21.5% (rr: 2046), c - reactive protein 1.3 mg / l (<5), platelets 21910/l (rr: 158424), bun 5.4 mmol / l (rr: 2.88.3), creatinine 70 mol / l (rr: 63107), aspartate aminotransferase 32 u / l (rr: 830), alanine aminotransferase 51 u / l (rr: 1036), -glutamyl transferase 21 u / l (rr: 935), and lactate dehydrogenase 196 u / l (rr: 25241). According to the case definition proposed by the international chikungunya expert group (2015), which distinguishes 4 chikungunya case categories; acute clinical case, atypical case, severe acute case, and suspected and/or confirmed chronic case;12 our patient was classified as a confirmed chronic chikungunya case . She was regularly followed up during the next few months in order to treat her arthralgias and also to observe the progress of her illness . Similar geographical distribution and clinical symptoms, the serum sample (taken on day 20) was initially tested for chikv igm / igg antibodies, using indirect immunofluorescent assay (ifa; euroimmun, lbeck, germany) as well as zika virus (zikv) igm / igg and dengue virus (denv) igm / igg antibodies using enzyme - linked immunosorbent assay (elisa; euroimmun). To exclude potential cross reactivity with other arboviruses, the sample was additionally tested for west nile virus (wnv) and usutu virus (usuv) antibodies using elisa (euroimmun), as well as yellow fever virus (yfv), japanese encephalitis virus (jev), and tick - borne encephalitis virus (tbev) using ifa (euroimmun). Chikv igm and igg antibodies were detected with titre 1:100 and 1:10,000, respectively (figure 2). In addition, postvaccinal yfv igg antibodies were found (titer 100). There was no cross reactivity with other tested arboviruses . In addition, the sample was tested for the presence of chikv rna using a qualitative real - time reverse transcriptase - polymerase chain reaction (rt - pcr) according to the protocol described by smith et al.13 for nucleic acid isolation, an automated system qiaxtractor (qiagen, hilden, germany) was used . Real - time rt - pcr was performed using a single - tube rt - pcr test kit (invitrogen superscriptiii platinum one - step qualitative kit; carlsbad, ca, usa). The amplification and detection were performed with 7500 real time pcr system (applied biosystems, foster city, ca, usa). The test tube contained a 25-l reaction mixture which included 5 l of isolated rna, 0.2 m forward primer (ccgaaaggaaacttcaaagcaact), 0.2 m reverse primer (cagatgcccgccattattgat), and 0.1 m probe (fam - gggaggtggagcatg - mgb). The reaction mixture was exposed to a 30 min 50c reverse transcription step, 2 min of taq activation at 95c, and 50 cycles consisting of 95c for 15 sec and 55c for 32 sec . Sensitivity of the rt - pcr is reported to be high (0.3 plaque - forming units; pfu / ml), as is specificity (no cross reactivity with the most common alphaviruses that contained a minimum of 3 log10 pfu of heterologous viral rna).13 on march 26, 2016, a 27-year - old woman visited the infectious diseases outpatient department because of persistent arthralgias and rash . She works as a stewardess on a cruise ship and she stayed in costa rica for 2 months where she developed symptoms; then she returned to croatia on march 21 . She remembered a mosquito bite on her left forearm because she noticed a little hematoma around the indurated papule which she had not experienced after earlier mosquito bites . Five days after the mosquito bite, on the first day of her disease, she felt symmetrical arthralgias in her ankles, knees, wrists, and elbows but also in small joints of her hands and feet . Her arthralgias deteriorated, so she could hardly walk . On the fifth day of her illness, an itchy rash appeared on her trunk, and the next day it extended to her face, extremities, as well as palms and soles . The erythematous papular rash subsided in the next 2 days . At the same time, she became afebrile, while arthralgias remained up to the tenth day of her illness after which she was feeling well, but exhausted . During the acute phase of her illness ten days after she had recovered, severe arthralgias in her ankles, elbows, right shoulder, and in the small joints of hands and feet reappeared . She also complained about morning stiffness lasting for 1030 min . On the initial visit (day 15 after the disease onset), the physical examination was normal except for rash on the trunk, extremities, palms, and soles (figure 1). Routine laboratory tests were normal, except for slightly elevated liver transaminases, erythrocytes 4.3510/l (reference range [rr]: 3.865.08), leukocytes 8.410/l (rr: 83.49.7), lymphocytes 21.5% (rr: 2046), c - reactive protein 1.3 mg / l (<5), platelets 21910/l (rr: 158424), bun 5.4 mmol / l (rr: 2.88.3), creatinine 70 mol / l (rr: 63107), aspartate aminotransferase 32 u / l (rr: 830), alanine aminotransferase 51 u / l (rr: 1036), -glutamyl transferase 21 u / l (rr: 935), and lactate dehydrogenase 196 u / l (rr: 25241). According to the case definition proposed by the international chikungunya expert group (2015), which distinguishes 4 chikungunya case categories; acute clinical case, atypical case, severe acute case, and suspected and/or confirmed chronic case;12 our patient was classified as a confirmed chronic chikungunya case . She was regularly followed up during the next few months in order to treat her arthralgias and also to observe the progress of her illness . Due to similar geographical distribution and clinical symptoms, the serum sample (taken on day 20) was initially tested for chikv igm / igg antibodies, using indirect immunofluorescent assay (ifa; euroimmun, lbeck, germany) as well as zika virus (zikv) igm / igg and dengue virus (denv) igm / igg antibodies using enzyme - linked immunosorbent assay (elisa; euroimmun). To exclude potential cross reactivity with other arboviruses, the sample was additionally tested for west nile virus (wnv) and usutu virus (usuv) antibodies using elisa (euroimmun), as well as yellow fever virus (yfv), japanese encephalitis virus (jev), and tick - borne encephalitis virus (tbev) using ifa (euroimmun). Chikv igm and igg antibodies were detected with titre 1:100 and 1:10,000, respectively (figure 2). In addition, postvaccinal yfv igg antibodies were found (titer 100). There was no cross reactivity with other tested arboviruses . In addition, the sample was tested for the presence of chikv rna using a qualitative real - time reverse transcriptase - polymerase chain reaction (rt - pcr) according to the protocol described by smith et al.13 for nucleic acid isolation, an automated system qiaxtractor (qiagen, hilden, germany) was used . Real - time rt - pcr was performed using a single - tube rt - pcr test kit (invitrogen superscriptiii platinum one - step qualitative kit; carlsbad, ca, usa). The amplification and detection were performed with 7500 real time pcr system (applied biosystems, foster city, ca, usa). The test tube contained a 25-l reaction mixture which included 5 l of isolated rna, 0.2 m forward primer (ccgaaaggaaacttcaaagcaact), 0.2 m reverse primer (cagatgcccgccattattgat), and 0.1 m probe (fam - gggaggtggagcatg - mgb). The reaction mixture was exposed to a 30 min 50c reverse transcription step, 2 min of taq activation at 95c, and 50 cycles consisting of 95c for 15 sec and 55c for 32 sec . Sensitivity of the rt - pcr is reported to be high (0.3 plaque - forming units; pfu / ml), as is specificity (no cross reactivity with the most common alphaviruses that contained a minimum of 3 log10 pfu of heterologous viral rna).13 after a bite from an infected mosquito, chikv rapidly spreads in the body eventually causing acute illness . It is known that up to 18% of infected patients, usually those younger than 25 years, are asymptomatic.14 after the resolution of the acute illness symptoms, myalgias and arthralgias may persist for weeks, months, and even years . The proportion of patients suffering from the chronic form of disease that can be attributed to chikv infection varies between studies . In singapore, 13% of patients had arthralgias 3 months after the acute phase, while 49% of patients from india had arthralgia 10 months after disease onset . After the outbreak of chikungunya in italy, 70% of patients reported persistent arthralgias after six months and after 12 months, and chronic symptoms were present in 32% of patients.15 severe arthralgia with morning stiffness was the most prominent symptom in our patient, too . Lymphopenia and thrombocytopenia are the most commonly detected pathologic laboratory findings associated with chikv infection . In the reunion island outbreak, lymphopenia was observed in 79% and moderate thrombocytopenia in 40%50% of chikungunya patients.16 in our case, the only abnormal laboratory findings were slightly elevated liver enzymes, a finding that has been less commonly reported during chikungunya fever . Similarly, leukopenia and thrombocytopenia were uncommon in imported chikv cases in italy during 2006.17 knowledge about the time period between the infection and the onset of symptoms is crucial as it can improve measures to prevent spreading of vector - borne infections . The incubation period in our patient was exactly 5 days, as she recalls the day when she had the mosquito bite . Chikv viremia is usually short - lived (5 to 6 days), and so rt - pcr is most sensitive when performed within a week after disease onset . However, a study from indonesia showed that duration of viremia during chikungunya was extended as early as 6 days prior until 13 days post - onset of fever.18 this observation suggests the possibility that our patient was viremic when she returned to croatia and that she could have been a chikv reservoir, representing the possible threat for transmission and spreading of chikv, since one of the main vector, ae . Albopictus, is established in this area.11 rt - pcr was performed to confirm the presence of viremia; however, chikv rna was not detected . Since the sample was collected in the post - acute phase and both chikv igm and igg antibodies were documented, the probability to detect viral rna was low . Serology is the most commonly used method for diagnosis of arboviral infections . Due to similar clinical symptoms and possible coinfections,19 chikv, denv, and zikv high titer of chikv igm and igg antibodies as well as negative denv and zikv serology indicated chikv infection . In recent years, the risk of chikv emergence in europe is increasing, as imported cases of chikungunya are continuously reported . Any country where aedes mosquito is present represents a potential area for future chikungunya outbreaks . Albopictus distribution maps showed that hot spots for establishment of this mosquito species in europe are southern france, the northern and northeastern coasts of spain, portugal, italy, the eastern coasts of the adriatic, and western turkey . During the last 2 decades, mosquito climate suitability has significantly increased over the southern uk, northern france, the benelux, parts of germany, italy, sicily, slovenia, croatia, and bosnia and herzegovina.20 it has been observed that the elimination of invasive mosquito species such as ae . Considering the intensive airline travel between europe and other parts of the world, it is almost just a question of when chikungunya will emerge as an autochthonous disease in europe . In croatia, this situation already happened with dengue in 2010;21 therefore, there is a great possibility that the same scenario will happen with chikv, since a competent vector ae . Detection of imported chikungunya fever in croatia highlights the need for clinicians to consider chikungunya in the differential diagnosis of arthralgia in all persons returning from areas where chikv transmission is documented.
Over the several last decades, nontuberculous mycobacteria (ntm) have been reported as some of the most important causes of pulmonary and non - pulmonary infections, which are explained in part by an increased number of susceptible immunocompromised individuals, such as those suffering from aids (1). The criteria for the treatment of ntm infections are based on the species involved, the immune characteristics of the patient, and the clinical manifestation of the infection (2). Nontuberculous mycobacteria are often resistant to first - line anti - tuberculosis drugs, which emphasizes the importance of species identification in mycobacterial diseases . Nontuberculous mycobacteria infections with slow - growing species are often treated by a three - component or dual therapy involving oral clarithromycin, rifabutin, ciprofloxacin, rifampicin, and ethambutol (3). Rapidly growing mycobacteria are usually sensitive to drugs such as new - generation macrolides, cephalosporin, and some fluoroquinolones . Recent studies have indicated that the newest class of antibiotics, the fluorinated quinolones, have a good reaction against rapidly growing non - mycobacteria (4, 5). However, when a mycobacterial infection is suspected, quick and exact species - level identification of the mycobacteria is the most important step toward successful disease therapy . Ciprofloxacin acts by inhibiting dna gyrase, an enzyme essential to separating the dna of the bacteria (6). Characterization of the gyra gene indicates that ciprofloxacin, in particular, acts as a barrier of cell division . Mutations in the gyra site confer conformational shifts to imperfect binding of the medicine and finally results in resistance . The gyra locus from mycobacterial spontaneous sequencing has been clearly applied to characterize mutations related to resistance, but a number of other methods, such as pcr single - strand conformational polymorphism (pcr - sscp), have also been successfully used (7). Pcr - sscp analysis implicates amplification of a part of the gene encoding for the specific object, and evaluation of the pcr products of medicine - sensitive and medicine - resistant strains by non - denaturing electrophoresis, in which mutations generally occur in a changed pattern (8, 9). In several parts of the world, in this study, we determined the mycobacterial species with multiplex pcr and used pcr - sscp and a direct sequencing analysis for detecting mutations in the dna of the gyra gene of ciprofloxacin resistance in clinical and environmental isolates of nontuberculous mycobacteria in the geographical region of isfahan province in iran . Based on a search of all of the available resources and databases in iran a total of 41 environmental and clinical isolates of ntm were collected from the microbial collection of the isfahan university of medical sciences microbiology department and isfahan tuberculosis . All isolates were subcultured on lowenstein - jensen medium (merck / germany) at 37c for four weeks, and were then characterized by conventional methods, including colony morphology, pigmentation, growth temperature, speed of growth, ziehl - neelsen staining, and the nitrate - reduction test, as reported previously (10). The chromosomal dna of the isolates was extracted with the dna mini - prep procedure, using hexadecyltrimethylammonium bromide (ctab) as previously described, and a high pure pcr template preparation kit (roch applied science, germany). Concentration and purity of the extracted dna was determined using a uv - photometer (biometra, germany) at 260 nm and 280 nm . Purified dna was stored at -70c until the pcr experiments, and about 10 ng of the extracted dna was used for pcr amplification (eppendorf, germany). A multiplex pcr based on different housekeeping genes, using seven primers, was used for detection of mycobacterium species . Genetic targets for the primer design included the 16s rdna gene of all members of the genus mycobacterium: the internal transcribed spacers of the mycobacterium tuberculosiscomplex (mtc) (mycobacterium tuberculosis, m. bovis, m. bovis bcg, and m. africanum), m. fortuitum, m. avium complex, and m. kansasii; the dnaj gene of m. abscessus; and the gyrb of m. gordonae, which are deposited in the ncbi, ddbj, and embl databases . The amplification reaction consisted of the following steps: one denaturation cycle at 95c for 5 minutes, then 40 cycles of amplification at 95c for 10 minutes, 60c for 40 seconds, and 72c for 1 minute, followed by one elongation cycle at 72c for 10 minutes . The size of amplicons was then analyzed by uv detection of ethidium bromide agarose gel (11). Colonies from all of the isolates were gathered from the lowenstein - jensen media and suspended in pbs, then thoroughly homogenized by shaking in glass bottles . Subsequently, a mcfarland 1.0 concentration of a suspension of each isolate was prepared . For each isolate, 100 l of 10 and 10 diluted suspension was inoculated on 7h10 agar medium enhanced with 10% oleic acid - albumin - dextrose complex (oadc). Serial three - fold concentrations of ciprofloxacin in media (1 g / ml, 2 g / ml and 4 g / ml) and an antibiotic - free medium as the control were prepared and inoculated by diluted suspension of mycobacterial isolates . After seven days of incubation (for rapidly growing mycobacteria) and/or 14 - 21 days (for slow - growing mycobacteria) at 37c, bacterial growth was measured . The lowest concentration of the drug that inhibited more than 99% of the mycobacteria was considered to be the minimum inhibitory concentration (mic) (12). Amplification of the mycobacterial gyra gene was done using primers f (5-cgccgcgtgctg / catgca / gatg-3) and r (5-c / tggtgga / gtca / gtta / gccc / tggcga-3) (bioneer / korea) (13 - 15). Pcr was performed in a 50 l reaction mixture containing 1.0 l of each primer (10 pmol), 25 l of master mix (dntp, mgcl2, 10x buffers, taq dna polymerase), 5 l of purified dna (20 ng), and 17 l of rnase - free water . The amplification reactions involved the following stages: one denaturation cycle at 94c for 10 minutes and 40 cycles of amplification at 94c for 1 minute, 55c for 1 minute, and 72c for 1 minute, followed by one elongation cycle at 72c for 10 minutes . Next, 5 l of the amplified result was run on a 1% agarose gel in 0.5x tbe, stained by ethidium bromide, and visualized by uv light photography . Next, 6 l of the pcr product was heated for 5 minutes at 95c and cooled on ice for 5 minutes, then loaded onto the acryl amide gel at 2 w for 14 - 16 hours in a cold room, and the gel was then silver - stained . Pcr products were purified, and samples of the quinolone - resistance - determining region (qrdr) of the gyra gene amplicons, with different pcr - sscp patterns from ciprofloxacin resistance and sensitive isolates, were sequenced with the applied biosystems 377 automated sequence procedure (abi prism dye terminator). Clustalw is a multiple - sequence alignment program and mega is software for conducting automatic and manual sequence alignments . Each sequence was compared both with the control strain sequences and with the published gyra gene sequence in genbank . A total of 41 environmental and clinical isolates of ntm were collected from the microbial collection of the isfahan university of medical sciences microbiology department and isfahan tuberculosis . All isolates were subcultured on lowenstein - jensen medium (merck / germany) at 37c for four weeks, and were then characterized by conventional methods, including colony morphology, pigmentation, growth temperature, speed of growth, ziehl - neelsen staining, and the nitrate - reduction test, as reported previously (10). The chromosomal dna of the isolates was extracted with the dna mini - prep procedure, using hexadecyltrimethylammonium bromide (ctab) as previously described, and a high pure pcr template preparation kit (roch applied science, germany). Concentration and purity of the extracted dna was determined using a uv - photometer (biometra, germany) at 260 nm and 280 nm . Purified dna was stored at -70c until the pcr experiments, and about 10 ng of the extracted dna was used for pcr amplification (eppendorf, germany). A multiplex pcr based on different housekeeping genes, using seven primers, was used for detection of mycobacterium species . Genetic targets for the primer design included the 16s rdna gene of all members of the genus mycobacterium: the internal transcribed spacers of the mycobacterium tuberculosiscomplex (mtc) (mycobacterium tuberculosis, m. bovis, m. bovis bcg, and m. africanum), m. fortuitum, m. avium complex, and m. kansasii; the dnaj gene of m. abscessus; and the gyrb of m. gordonae, which are deposited in the ncbi, ddbj, and embl databases . The amplification reaction consisted of the following steps: one denaturation cycle at 95c for 5 minutes, then 40 cycles of amplification at 95c for 10 minutes, 60c for 40 seconds, and 72c for 1 minute, followed by one elongation cycle at 72c for 10 minutes . The size of amplicons was then analyzed by uv detection of ethidium bromide agarose gel (11). Colonies from all of the isolates were gathered from the lowenstein - jensen media and suspended in pbs, then thoroughly homogenized by shaking in glass bottles . Subsequently, a mcfarland 1.0 concentration of a suspension of each isolate was prepared . For each isolate, 100 l of 10 and 10 diluted suspension was inoculated on 7h10 agar medium enhanced with 10% oleic acid - albumin - dextrose complex (oadc). Serial three - fold concentrations of ciprofloxacin in media (1 g / ml, 2 g / ml and 4 g / ml) and an antibiotic - free medium as the control were prepared and inoculated by diluted suspension of mycobacterial isolates . After seven days of incubation (for rapidly growing mycobacteria) and/or 14 - 21 days (for slow - growing mycobacteria) at 37c, bacterial growth was measured . The lowest concentration of the drug that inhibited more than 99% of the mycobacteria was considered to be the minimum inhibitory concentration (mic) (12). Amplification of the mycobacterial gyra gene was done using primers f (5-cgccgcgtgctg / catgca / gatg-3) and r (5-c / tggtgga / gtca / gtta / gccc / tggcga-3) (bioneer / korea) (13 - 15). Pcr was performed in a 50 l reaction mixture containing 1.0 l of each primer (10 pmol), 25 l of master mix (dntp, mgcl2, 10x buffers, taq dna polymerase), 5 l of purified dna (20 ng), and 17 l of rnase - free water . The amplification reactions involved the following stages: one denaturation cycle at 94c for 10 minutes and 40 cycles of amplification at 94c for 1 minute, 55c for 1 minute, and 72c for 1 minute, followed by one elongation cycle at 72c for 10 minutes . Next, 5 l of the amplified result was run on a 1% agarose gel in 0.5x tbe, stained by ethidium bromide, and visualized by uv light photography . Next, 6 l of the pcr product was heated for 5 minutes at 95c and cooled on ice for 5 minutes, then loaded onto the acryl amide gel at 2 w for 14 - 16 hours in a cold room, and the gel was then silver - stained . Pcr products were purified, and samples of the quinolone - resistance - determining region (qrdr) of the gyra gene amplicons, with different pcr - sscp patterns from ciprofloxacin resistance and sensitive isolates, were sequenced with the applied biosystems 377 automated sequence procedure (abi prism dye terminator). Clustalw is a multiple - sequence alignment program and mega is software for conducting automatic and manual sequence alignments . Each sequence was compared both with the control strain sequences and with the published gyra gene sequence in genbank . The frequency of isolates were as follows: m. fortuitum, 27 cases; m. gordonae, 10 cases; m. abscessus, two cases; and m. conceptionense and m. smegmatis, one case each (table 1). All isolates except for m. abscessus were sensitive to concentrations of 1 l / ml, 2 l / ml and 4 l / ml of ciprofloxacin (mic> 1 l / ml) (table 2). All clinical isolates and all environmental isolates except for m. abscessus were sensitive to ciprofloxacin . Based on the pcr - sscp results for the qrdr of the gyra gene, two ciprofloxacin - resistant m. abscessus isolates had four similar bands, which were different from mycobacterium fortuitum and m. gordonae isolates . Mycobacterium fortuitum also showed four bands, but the band size and positions were different from m. abscessus, and m. gordonae had three bands (figures 1 and 2). The pcr - sscp patterns of clinical and environmental m. fortuitum isolates with four bands were similar, and the clinical and environmental m. gordonae isolates with three bands were also similar . The amino acid sequence of m. abscessus resistant to ciprofloxacin was 100% similar to m. abscessus atcc 19977 (hq324097.1), but the nucleotide sequence was different at 12 points: 231 (tg), 240 (cg), 252 (tc), 258 (cg), 273 (cg), 288 (cg), 291 (gc), 294 (tc), 306 (tg), 318 (ct), 330 (gc) and 336 (at). Since the amino acid sequences of m. abscessus and m. gordonae atcc 14470(aj564389.1) were completely similar, their nucleotide sequences were also compared and were 96% similar (figure 3). The amino acid sequence of m. fortuitum sensitive to ciprofloxacin was 100% similar to that of m. fortuitum atcc 6841(aj564392.1), but the nucleotide sequence was 98% similar and had two alterations, at positions 283 (at) and 336 (ta) (figure 4). The amino acid sequence of m. gordonae sensitive to ciprofloxacin was 100% similar to m. gordonea atcc14470 (aj564389.1), but the nucleotide sequence was 92% similar and had nine alterations: 231 (gc), 240 (cg), 249 (ct), 294 (cg), 318 (ct), 321 (ct), 325 (ct), 330 (cg), and 336 (ga) (figure 5). The gyra gene sequences studied were deposited on the national center for biotechnology information website as follows: m. fortuitum (gene name: esfahanmyco - fort - gyra, accession number: lc074879.1), m. abscessus (gene name: esfahanmyco - abs - gyra, accession number: lc074880.1), and m. gordonae (gene name: esfahanmyco - gord - gyra accession number: lc074881.1). Abbreviations: atcc, american type culture collection; na, not available . Lane 1, molecular sized marker (100 bp dna ladder); lane 2, gyra pcr product from m. abscessus; lane 3, gyra pcr product from m. gordonae; lanes 4 - 5, gyra product from m. fortuitum atcc49403 and m. fortuitum; lane 6, gyra negative control . Lanes 1 and 2, m. abscessus (resistance to ciprofloxacin); lane 3, m. fortuitum atcc 49403; lanes 4 - 6, m. fortuitum; lanes 7 and 8, m. gordonae (sensitive to ciprofloxacin). The amino acid sequence of m. abscessus resistant to ciprofloxacin was 100% similar to m. abscessus atcc 19977 (hq324097.1) and m. gordonae, but the nucleotide sequence was different at 12 points (with m. gordonae at 13 points). The amino acid sequence of m. fortuitum sensitive to ciprofloxacin was 100% similar to m. fortuitum atcc 6841(aj564392.1). The amino acid sequence of m. gordonae sensitive to ciprofloxacin was 100% similar to m. gordonae atcc 14470 (aj564389.1). Over the past several years, nontuberculous mycobacteria (ntm) have been reported as some of the most important agents of infection in immunocompromised patients . M. abscessus, m. fortuitum, and m. chelonae are the most important opportunistic pathogens in humans (17, 18). Strategies for the treatment of tb are different from those for ntm, in that the latter is often resistant to anti - tuberculosis agents (2). On the other hand, conventional phenotypic methods, such as culture, are time - consuming because of the slow - growing nature of mycobacteria (19). Molecular methods, such as multiplex pcr, targeting many different genes simultaneously, have been used to detect and identify mtc and ntm in routine diagnostic laboratories (20). Mokaddas developed a multiplex pcr targeting the oxyr - ahpc and rpob genes for the direct identification and differentiation of clinical mtc or ntm isolates in primary cultures (19). Of the 41 isolates identified by phenotypic and molecular tests, the frequencies were as follows: m. fortuitum, 27 cases; m. gordonae, 10 cases; m. abscessus, two cases; m. conceptionense, one case; and m. smegmatis, one case . All isolates except for m. abscessus were sensitive to all three concentrations (1 l, 2 l and 4 l) of ciprofloxacin (mic> 1 l / ml). (21) analyzed 130 isolates of mycobacterium for susceptibility to grepafloxacin, ofloxacin, and ciprofloxacin . Different mycobacterial species showed different degrees of susceptibility to three antibiotics, and the activity of antibiotics against rapidly growing mycobacteria, such as m. fortuitum, was very good . This is consistent with our results . In 2010, gayathri (22) evaluated rapidly growing mycobacteria drug sensitivity to antibiotics, including ciprofloxacin . Of 148 isolates, 76% were susceptible to ciprofloxacin . A 1996 study by sanchez - carrillo et al . (23) on 64 ntm (40 rapidly growing and 24 slowly growing) compared the activity of several antibiotics, such as ciprofloxacin, that had high activity against rapidly growing ntm and good activity against slowly growing ones . In that study, m. gordonae (slow - growing) were susceptible to ciprofloxacin . In 2009, rafi et al . (24) evaluated the susceptibility of m. tuberculosis and ntm to two mycobacterial agents (ciprofloxacin and ofloxacin), and the findings demonstrated that ciprofloxacin could be effectively used against tb and ntm . The sensitivity of environmental ntm isolates (except for m. abscessus) and clinical isolates, including m. fortuitum and m. gordonae, to ciprofloxacin, this antibiotic should be regarded as a primary drug in the treatment of these infections . However, it is necessary to determine the <1 mic of the concentrations of ciprofloxacin . The sequences of a conserved site in the a subunit of dna gyrase corresponding to the qrdr were established for ntm species and then compared . The nucleotide sequences were highly conserved, probably because of the essential function of the gyrase, and they clearly differentiated one species from another (13). Furthermore, a domain of the n - terminal part of the a subunit is highly conserved among prokaryotes (25). In other words, from residues 67 - 106 in the numbering system used in e. coli, this domain contains the qrdr, which is supposed to be the site of interaction between the a subunit of gyrase and quinolones (26). Quinolone - resistance - determining region could be involved in intrinsic quinolone resistance in mycobacteria . We compared nucleotide and amino acid sequences of qrdrs from ntm species with different levels of susceptibility to quinolones . The detection of missense mutations at positions 83, 84, and 87 in gyra is a quick and efficient test for molecular identification of fluoroquinolone resistance in mycobacteria (27, 28). (14) evaluated the correlation between quinolone - resistant patterns and sequences in dna gyrase in 14 mycobacterial species . With regard to mics, the species could be organized into three groups: resistant, moderately susceptible, and susceptible .peptide sequences of the qrdr of gyra were identical in all of the species, except for the amino acid at position 83 . This suggests that this amino acid is implicated in the observed differences of quinolone susceptibility within the mycobacteria . In this study, the peptide sequences of resistant m. abscessus species were similar to those of m. abscessus atcc 19977, which is resistant to ciprofloxacin . (29) studied gyra / b mutations in 92 fluoroquinolone - resistant tb isolates in thailand . The other 22 isolates had no mutations in either the gyra or the gyrb qrdr . In another study, pitaksajjakul et al . (30) evaluated 35 fluoroquinolone - resistant mtb isolates that were amplified using pcr . Dna sequencing and sscp were further utilized for characterization of the mutations in the qrdr of the gyra / gyrb genes . On the dna sequencing, 60% exhibited single - point mutations at different positions, and there was one novel mutation in the gyra gene and asp495asn in the gyrb gene . Forty percent of the isolates had no mutation . In our study, there was no difference in the nucleotide sequences of resistant strains to the standard nucleotide sequence . Sscp was performed on 35 fluoroquinolone - resistant mtb isolates for mutations of gyra / gyrb amplicons, and five different sscp patterns were obtained . For each fluoroquinolone - resistant and fluoroquinolone - sensitive mtb isolate, the sscp patterns, in contrast to our results, were indistinguishable on repeated analyses (30). In some mycobacterium types, point mutations in the drug - binding locations occur, maintaining their protein function, which leads to the bacteria becoming resistant to the drug, and therefore the protein structure is preserved . The point mutation in the nucleotide sequence means that the changes happen on the nucleotide surface, but the codons translate to an amino acid, so we can say that a polymorphism has occurred . In this study, pcr - sscp the pcr - sscp patterns of mutated ciprofloxacin - resistant isolates were clearly differentiated from the pcr - sscp patterns of those sensitive to ciprofloxacin.
Unless contraindicated, biguanides are recommended as a first - line therapy for the treatment of type 2 diabetes mellitus (1). They exert their antihyperglycemic effects, in part, by decreasing hepatic gluconeogenesis from lactate and pyruvate, while they can increase lactate production through the inhibition of mitochondrial respiration and by promoting the conversion of glucose to lactate, which leads to lactic acidosis (2). The contraindications for the use of biguanides include severe renal or hepatic insufficiency, extreme old age, and serious acute illnesses involving circulatory dysfunction, because they are associated with a high risk of lactic acidosis (2). However, the incidence of biguanide - associated lactic acidosis has been reported to be very low when biguanides are properly used (3). Thiamine deficiency is important in the differential diagnosis of lactic acidosis, and has been recognized as a distinct clinical entity from biguanide - associated lactic acidosis (4). We herein present the case of a patient with biguanide - associated severe lactic acidosis who showed a dramatic improvement after the high - dose administration of thiamine . When diabetic patients taking biguanide present with lactic acidosis, thiamine deficiency should be suspected as a comorbidity and high - dose thiamine should be administered without delay as a diagnostic treatment . A 75-year - old woman was referred to our department due to sudden - onset shock of unknown origin with severe lactic acidosis . One year prior to her presentation, the patient experienced a cerebral infarction, which resulted in left - hemiparesis and mild cognitive impairment (mini - mental state examination score: 24/30); she also had diabetes mellitus, which was treated with buformin (100 mg / day) and sitagliptin (50 mg / day). She was also prescribed cilostazol (100 mg / day) for the secondary prevention of cerebral infarction, and lansoprazole (30 mg / day) and magnesium oxide (660 mg / day). Following the stroke event she had lived in a geriatric facility and had consumed a regular diet . She had remained in her usual state of health, and had not shown any significant weight changes, reduced dietary intake or specific gastrointestinal symptoms . Three hours before her presentation, she complained of dyspnea at rest and was transferred to another hospital, where she arrived with severe hypotension (blood pressure 70/36 mmhg, pulse 135 beats / min) with profound lactic acidosis (ph 7.108, base excess -24.6 mmol / l, lactate 18 mmol / l). On presentation to our department, a physical examination revealed the following, blood pressure, 60/45 mmhg; pulse, 158 beats / min; respiratory rate, 30 breaths / min; body temperature, 34.8c, and oxygen saturation, 98% with 5 l / min oxygen delivered through a face mask . Her height, weight and body mass index were 145 cm, 55.2 kg, and 26.3 kg / m, respectively . Although she presented with a decreased level of consciousness (glasgow coma scale score of e2v4m4), she did not show specific symptoms of polyneuropathy or wernicke's encephalopathy . She required immediate mechanical ventilation under endotracheal intubation due to the worsening of her mental state and hemodynamic instability . Echocardiography revealed biventricular systolic dysfunction with a left ventricular ejection fraction that was as low as 30% . Acute coronary syndrome and myocarditis were excluded because emergency coronary angiography revealed no significantly diseased vessels and an endomyocardial biopsy specimen from the right ventricle revealed no evidence of inflammatory infiltration . The patient's hemodynamic parameters were as follows: mean pulmonary capillary wedge pressure, 18 mmhg; pulmonary artery pressure, 36/25 mmhg (mean, 26 mmhg); right atrial pressure, 30/24 mmhg; cardiac output, 3.0 l / min; cardiac index, 2.0 l / min / m; systemic vascular resistance, 1,047 dynsec / cm; and pulmonary vascular resistance, 215 dynsec / cm . Based on her medical history of buformin therapy and the preliminary clinical data, our initial diagnosis was severe lactic acidosis resulting from the toxic effects of buformin and cardiogenic shock due to cardiomyopathy of unknown etiology . We initiated the conventional treatment for biguanide - associated lactic acidosis with continuous renal replacement therapy and the continuous infusion of 8.4% sodium bicarbonate . Because echocardiography and cardiac catheterization examinations showed marked biventricular systolic dysfunction and a low cardiac output with relatively low systemic vascular resistance, we initiated multiple inotropic and vasopressor support, including dobutamine (10 g / kg / min), dopamine (3 g / kg / min), noradrenaline (0.3 g / kg / min), and further added vasopressin (2 units / h), hydrocortisone (200 mg / day) and an intra - aortic balloon pump in order to maintain a mean atrial pressure of at least 65 mmhg . Although her hypotension and acidemia gradually improved, the profound hyperlactatemia persisted without any significant improvement (figure). On the second morning (17 hours after her arrival), because we had not obtained definite evidence of anaerobic metabolic disorders that would have caused persistent severe hyperlactatemia or a good clinical response to the conventional therapies for biguanide toxicity, we suspected thiamine deficiency as an alternative cause of her persistent severe lactic acidosis and administered high - dose fursultiamine (100 mg), a thiamine derivative, intravenously . The response to the thiamine replacement therapy was drastic; the patient's blood pressure rapidly increased, the reduced left ventricular ejection fraction was gradually restored to the normal range, the hyperlactatemia fully recovered within 24 hours, and all of the hemodynamic and renal support could be tapered off within a few days (figure). We continued to administer fursultiamine (300 mg / day, parenterally) for five days, after which we switched to oral supplementation . On day 9, she was successfully extubated, and had recovered to her premorbid state; her cardiac functions normalized as well . The serum concentration of vitamin b1, which was analyzed from a blood sample that had been obtained just before the first administration of fursultiamine, was 23 ng / ml (reference range: 26 - 58 ng / ml) (table). The clinical course of the patient s hemodynamic status, circulatory management, and lactic acidosis . The patient s marked lactic acidosis and the reduction in her left ventricular systolic function were dramatically reversed by the administration of high - dose thiamine . Each arrow indicates the intravenous administration of fursultiamine (100 mg), a thiamine derivative . Cas: denotes catecholamines, crrt: continuous renal replacement therapy, iabp: intra - aortic balloon pump, lvef: left ventricular ejection fraction, nahco3: sodium bicarbonate, sbp: systolic blood pressure bnp: denotes brain natriuretic peptide, bun: blood urea nitrogen, cre: creatinine, egfr: estimated glomerular filtration rate, na: not available, pco2: partial pressure of carbon dioxide, po2: partial pressure of oxygen diabetic patients taking biguanide are predisposed to thiamine deficiency, even if they have no disease - related factors that might provoke thiamine deficiency, and the intravenous infusion of high - dose thiamine may be essential for the treatment of this disorder . To the best of our knowledge, this is the first case report to demonstrate biguanide - associated lactic acidosis complicated with thiamine deficiency in a diabetic patient without predisposing risk factors for thiamine deficiency . First, diabetic patients taking biguanide may be at risk of developing thiamine deficiency syndrome . Although our patient was in the old - old age range, she had no predisposing factors for biguanide - associated lactic acidosis (these include chronic renal insufficiency, congestive heart failure, alcohol abuse and overdose) (2). That biguanides can cause lactic acidosis, especially in very elderly patients with advanced chronic kidney disease is well known in clinical practice (5). However, the need for caution with regard to thiamine deficiency when diabetic patients without predisposing factors for thiamine deficiency take biguanide has never been emphasized . Given that biguanides have been widely used as a leading anti - hyperglycemic agent in the current era (1), this caution provides important clinical implications . Although it is inconclusive, the lactic acidosis in our patient may be attributable to thiamine deficiency, the toxic effects of biguanide or both . In japan, buformin is contraindicated for patients who are 75 years of age due to the increased risk of lactic acidosis . This raises the possibility that the off - label use of buformin, at least in part, contributed to the development of lactic acidosis through the toxic effects of biguanide in our patient . However, the drastic response to the administration of thiamine suggests that the thiamine deficiency could have been involved in the pathophysiology of severe lactic acidosis . The further accumulation of cases is needed to elucidate whether biguanides can directly cause thiamine deficiency in diabetic patients without predisposing factors for this condition . Second, the intravenous infusion of high - dose thiamine is useful for the treatment and shows a high diagnostic value in the management of patients with this disorder . The patient's hyperlactatemia, which was refractory to the conventional treatment for lactic acidosis, including renal replacement therapy, promptly responded to administration of thiamine . Cardiac beriberi is a fulminant form of thiamine deficiency syndrome that is associated with ventricular systolic dysfunction and marked vasodilatation, which leads to hemodynamic collapse (6). In rare cases, this cardiac dysfunction manifests as low cardiac output, such as was observed in our patient . However, the treatment is the same: high - dose thiamine (7,8). In most cases, thiamine deficiency occurs in patients with preexisting comorbidities and metabolic stresses (9) such as alcohol abuse (7,10), dialysis, infection (11), the long - term use of diuretics and malnutrition (12). These predisposing factors for thiamine deficiency serve as an important diagnostic clue in the clinical setting and - in all cases - suspected thiamine deficiency can be immediately treated with high - dose thiamine without any significant adverse effects . The level of vitamin b1 in patients with thiamine deficiency is not necessarily extremely low . In the present case, the patient's serum concentration of vitamin b1 was only marginally lower than the normal range, which is consistent with previous reports of thiamine deficiency syndrome (7,10,11). However, because our patient did not present any predisposing factors for thiamine deficiency, we initially considered that her lactic acidosis was attributable to the toxic effects of buformin rather than thiamine deficiency . This was well exemplified in a randomized trial of high - dose thiamine for patients with septic shock and hyperlactatemia, which showed that thiamine treatment may be beneficial in a subgroup of patients with baseline thiamine deficiency (13). Notably, more than one third of the study cohort exhibited absolute thiamine deficiency at baseline (13). In addition, the current guidelines on parenteral nutrition recommend that 100 - 300 mg / day of thiamine be supplemented intravenously during the initial 3 days of treatment in critically ill patients with possible thiamine deficiency (14). Thiamine supplementation is a safe, easily available and well - tolerated therapy with few adverse effects other than anaphylaxis (11). We suggest two possible mechanisms by which buformin could have played a role in the development of thiamine deficiency in our patient . This notion is based on data from animal studies, which have shown that phenformin induces hyperlactatemia through the inhibitory effects on thiamin activity (15). More recently, it has been reported that when administered at their therapeutic doses, metformin and phenformin inhibit hthtr-2, a human thiamine transporter, suggesting that biguanides may cause clinically relevant thiamine deficiency by reducing the absorption of thiamine (16). Moreover, it has been reported that diabetic patients frequently show decreased plasma concentrations of thiamine due to the enhanced urinary excretion of thiamine (17). It is well - documented that metformin causes vitamin b12 deficiency over several years (18 - 20). The precise mechanisms by which biguanides interfere with thiamine to cause lactic acidosis warrant further examination . Thiamine deficiency remains an under - recognized condition and a diagnostic pitfall with major clinical implications (21). The course of our patient provided two important clinical suggestions; diabetic patients taking biguanide are predisposed to thiamine deficiency, even if they have no factors to provoke the deficiency, and that the rapid administration of high - dose thiamine is essential for the treatment and diagnosis of this disorder, which is otherwise prone to be medical oversight . In conclusion, critical care clinicians should consider the possibility of thiamine deficiency in patients with biguanide - associated lactic acidosis, and administer high - dose thiamine without delay as a diagnostic treatment.
Dipeptidyl peptidase (dpp)-4 degrades incretin hormones, such as glucagon - like peptide (glp)-1, and reduces the glucose - dependent insulinotropic effects of incretins on pancreatic cells . Dpp-4 inhibitors are a new class of anti - diabetic agents that improve glucose homeostasis by enhancing the actions of incretin hormones . Vildagliptin has a relatively shorter half - life than other dpp-4 inhibitors and therefore is preferably administered twice daily . Exposure to vildagliptin in patients with moderate - to - severe renal impairment is increased compared with that observed in control subjects . However, the degree of exposure to vildagliptin does not correspond to the severity of renal impairment . In contrast, the level of the primary metabolite of (dpp)-4 (m20.7) increases in association with declines of renal function; however, increases in the level of this metabolite have no clinically relevant consequences since m20.7 is pharmacologically inactive [1, 2]. Therefore, vildagliptin can be used without dose adjustment in patients with a creatinine clearance of> 50 ml / min . Although vildagliptin is, in principle, contraindicated in patients with moderate - to - severe renal impairment, a recent 24-week study suggested that vildagliptin (50 mg once daily) therapy is effective and well tolerated in moderate - to - severe renal impairment patients and those on dialysis with type 2 diabetes mellitus (t2 dm) [3, 4]. Dpp-4 is also known as adenosine deaminase complexing protein 2 or cd26 (ec 3.4.14.5) and is expressed on the surface of several cell types, including lymphocytes and monocytes, where it exerts immunoregulatory effects . In addition, dpp-4 substrates are proline- and alanine - containing peptides, including various growth factors, chemokines, neuropeptides and vasoactive peptides . Due to these off - target mechanisms, the use of dpp-4 inhibitors may result in unexpected side effects related to immunological responses . In this article, we report the first case, to our knowledge, of sarcoid - like lung granulomas in a hemodialysis patient treated with vildagliptin . A 70-year - old female began to receive hemodialysis for end - stage renal disease due to diabetic nephropathy in august 2010 . Her treatment regimen for t2 dm was changed from insulin injections to the oral administration of vildagliptin (50 mg / day) in december 2011 . Following the initiation of vildagliptin, the patient's level of hba1c ranged between 6.0 and 6.3%, and no episodes of hypoglycemia were observed . In april 2012, multiple nodular lesions were incidentally detected on chest computed tomography (ct) screening for lung cancer, without subjective symptoms (figure 1a). The patient had no pets, was not a smoker, had no experience of traveling overseas or allergies to drugs or foods . A quantiferon - tb (qft) blood test was positive; however, repeated sputum cultures and polymerase chain reaction assays were negative for tuberculosis (tb). The multiple nodular lesions increased in size on ct after 2 months (figure 1c); therefore, a ct - guided needle lung biopsy was performed, and granulomas without caseous necrosis were identified on a histological examination (figure 2). No pathogenic microorganisms were detected on staining, including grocott's methenamine silver and acid - fast staining . Furthermore, there was no evidence of tb on a culture of bronchial alveolar liquid (bal). Because the presence of tb infection could not be completely excluded and the size of the granulomas progressively increased (figure 1d), antituberculosis drugs, including rifampicin (450 mg / day), isoniazid (300 mg / day) and ethambutol (250 mg / two days), were administered empirically starting in september 2012 . Nevertheless, the granulomas further increased in size on follow - up ct performed 1 month later (figure 1e). Therefore, we discontinued both the antituberculosis drugs and vildagliptin . Following the discontinuation of vildagliptin, the size of the granulomas decreased within 1 month (figure 1f), and most of the lesions were barely detectable after 4 months (figure 1 g). Multiple lung nodules were incidentally found in april 2012 (a); no lung nodules were seen in april 2011 (b). The size of the nodular lesions progressively increased in june 2012 (c) and september (d). In spite of the initiation of antituberculosis drugs in september 2012, the granulomas increased in size in october 2012 (e). In november 2012, 1 month after the discontinuation of antituberculosis drugs and vildagliptin, the size of the granulomas decreased (f). In february 2013, 4 months after the discontinuation of these drugs, most of the granulomas were no longer detectable (g). Multiple lung nodules were incidentally found in april 2012 (a); no lung nodules were seen in april 2011 (b). The size of the nodular lesions progressively increased in june 2012 (c) and september (d). In spite of the initiation of antituberculosis drugs in september 2012, the granulomas increased in size in october 2012 (e). In november 2012, 1 month after the discontinuation of antituberculosis drugs and vildagliptin, the size of the granulomas decreased (f). In february 2013, 4 months after the discontinuation of these drugs, most of the granulomas were no longer detectable (g). We herein reported a case of sarcoid - like lung granulomas in a patient under hemodialysis who was treated with vildagliptin . To the best of our knowledge, this is the first case of granulomatosis related to the use of a dpp-4 inhibitor . In general, the incidence of adverse effects of dpp-4 inhibitors is lower than that of other oral hypoglycemic agents, and this case represents a very rare adverse effect of vildagliptin . The asymptomatic granulomas appeared following the initiation of treatment with vildagliptin and disappeared after its discontinuation . It is well known that dialysis patients have an increased risk of tb compared with the general population, with an often atypical pattern of development . The current patient presented with positive findings for qft, with no evidence of tb on cultures of the sputum and balf or histology of the biopsy specimen . Although empiric therapy for tb was administered, the size of the granulomas did not change . The patient's laboratory findings and clinical course indicate that the granulomas were not caused by tb . The occurrence of granulomatosis in patients treated with tumor necrosis factor (tnf) blockers has been previously reported . It has also been speculated that modulation of the cytokine environment by anti - tnf therapy is related to the formation of granulomas . It was recently reported that the inhibition of dpp-4/cd26 on t - cells by dpp-4 enzymatic inhibitors selectively suppresses lymphocyte proliferation and reduces the production of various cytokines, including interferon-, interleukin-17 and tnf- . Similarly, other dpp family members, such as dpp-8 and dpp-9, play roles in immunoregulation . In addition, it has been reported that glp-1 inhibits inflammatory pathways, thereby increasing the level of glp-1 via the inhibition of dpp-4, which may affect the inactivation of inflammatory pathways . Therefore, the effects of dpp-4 inhibitors may mimic those of anti - tnf therapies under certain conditions . Discontinuation of the anti - tnf therapies results in the resolution of granulomatosis in most cases . The granulomas also disappeared after the discontinuation of vildagliptin in the present case, suggesting similarities between the biological behavior of granulomas under these two conditions . Vildagliptin can be administered without dose adjustment in patients with a creatinine clearance of> 50 ml / min . However, it has been reported that the plasma concentrations of vildagliptin and its metabolites are increased in patients with severe renal impairment [1, 12]. The accumulation of vildagliptin and its metabolites may affect the immune system and provoke unexpected side effects in dialysis patients with t2 dm . Therefore, the use of non - renal excreted dpp-4 inhibitors, such as linagliptin, may reduce the risk of pharmacokinetic complications . Since we ethically cannot readminister the drug in this case, other possible causes of granulomas remain, for example, a late response to therapy for tb or the spontaneous regression of sarcoidosis . In conclusion, the administration of dpp-4 inhibitors in patients undergoing hemodialysis is possibly linked with the new onset of sarcoid - like granulomatosis.
Mobile health, which is the use of mobile communication and computing technologies for medicine and public health, is rapidly expanding.1,2 a personal health record (phr) is defined as a health record created using mobile computing technologies in which health information and personal health data are maintained by the patient.3 models of phr vary across a large range . One phr model utilizes patient - generated data about health and lifestyle that are recorded using a personal computer or web application and that help address specific health concerns.4,5 because a phr records health - related data generated by a patient, it is not only a repository of that patient s data but also a tool that facilitates interactions between the medical provider and patient via the provision of related health information.68 additionally, because technologies are designed to streamline the diagnosis and treatment processes, and big data analytics offer novel perspectives regarding the contribution of health data to health care, phrs provide the opportunity for a greater degree of interaction when managing health in one s daily life.9 several recent studies have used phrs to examine patient health and activity levels or to assess the management of patients through interventions outside medical institutions . Druss et al10 evaluated the effects of electronic phrs on the quality of medical care in 170 patients with serious mental illnesses who were treated at a community medical center and found that the use of phrs significantly improved the quality of medical care and increased the use of medical services by patients . Espie et al11 created a mobile health care application for the management of sleep disorders, which involved the development and psychometric validation of a brief scale (the sleep condition indicator [sci]), to evaluate sleep disorders in everyday clinical practice . These authors found that web - based cognitive behavioral therapy had a positive effect on the treatment of insomnia.12 park et al9 developed a phr based on teen - specific needs to promote better self - awareness and chronic disease management and determined that chronic psychological or physical states require constant attention because the symptoms can fluctuate spontaneously over time . Moreover, although patients often focus on immediate problems, the use of phrs may provide a tool that can gain the attention of individuals and remind them of these problems when not immediately apparent.9 taken together, these findings suggest that phrs constitute a useful tool to record the range of, and changes in, physical and psychological health states outside hospitals . A growing body of research has called attention to the influence of emotion on health and the possible management of the relationship between these two variables . The instantiation of an affective state directly involves alterations in multiple physiological systems of the body, which leads to physiological responses that can directly influence physical health depending on the nature, frequency, and time course of the emotional state.13 physiological responses are meant to be adaptive in the short term but can lead to maladaptive outcomes in the long term if not correctly regulated.14 furthermore, recent evidence has sufficiently demonstrated the importance of comorbid relationships among emotional, psychological, and physical symptoms.1520 for example, a worldwide survey using a national representative sample identified an association between chronic pain and mental disorders.2123 similarly, there is a growing consensus that negative emotions influence the development of cardiovascular diseases24 and that chronic digestive disorders are closely linked with a variety of psychological disorders, including depression.25,26 taken together, these studies provide a clear indication that chronic physical symptoms are best understood in the context of psychological factors . In this respect, the use of phrs could provide a strategy for improving medical care for patients with comorbid psychological and physical illnesses . In the current study, a mobile application called mind mirror was developed as a phr to evaluate the daily affective states and physical conditions of individual patients . Using participant - generated health records, detailed information on health was collected on a daily basis through the participants engagement and self - monitoring . This mobile platform was developed in order to collect health records while maximizing the patient s self - assessment in terms of paying attention to their physical condition and feelings throughout the day . A well - known example of self - assessment of daily experiences is the day reconstruction method (drm), in which a participant reviews daily affective experiences and the subjective feelings.27,28 this was a 30-day observational study that aimed to characterize the dynamic relationship between the emotional state of patients and their physical states, including pain and fatigue, and to determine whether self - recorded tools such as phrs would be useful for the assessment of the relationship between an individual s emotional and physical conditions . The inclusion criteria for the current study were as follows: participants were required to 1) be between 20 and 40 years of age, 2) have no history of any neuropsychological disorder or acute or chronic pain disorder, and 3) not be taking any type of medication . Written informed consent was obtained prior to participation . This study was conducted in accordance with the guidelines issued by the human subjects committee and approved by the institutional review board of kyung hee university in seoul, republic of korea . The primary goals for the mind mirror mobile application were to assess the daily emotional and physical changes of patients and to provide a platform from which large - scale data could be collected and analyzed . A novel user interface format was applied to measure the affective and physical states of a participant every 2 hours from 9:00 am to 9:00 pm for 30 days . The natural starting point of research on the dynamic nature of these symptoms lies in the analysis of symptoms measured over different time points . The analysis of time series data requires detailed records that reflect subtle changes in the emotional and physical conditions of individuals over time within a single day . In the current study, participants completed the entries of their daily emotional and physical states using the mind mirror software; they were instructed to complete the data input into the application at night prior to going to bed . Data regarding emotional valence, fatigue, and pain were entered by the participants over 30 days at seven time points each day between 9:00 am (09:00) and 9:00 pm (21:00). Of the eligible participants (n=21), one participant was unable to finish the study due to loss of mobile phone; thus, the final data analyses in the current study included 20 participants (eight females, mean age = 24.7 years). For the current study, an iphone operating system (ios) software application was developed using xcode 6.4 and the programming language swift; this application required ios 8.4 software development kit (sdk) or higher . Explicit methods were used to record the subjective ratings of the participants regarding their physical conditions and subjective valences of daily emotion . The explicit method collects data on emotions and physical conditions that the participant cognitively feels by asking direct questions or presenting straightforward tasks regarding their daily condition.29 upon turning on the application, a title page with a logo, as well as a message that reads once the participant has clicked on this message, the application begins its initial steps . This application applied two main methods to measure explicit emotions or feelings that were presented as tasks for the participants to complete on a daily basis . The first measure was designed to quantitatively visualize positive or negative affective states . On the screen, three auxiliary lines with the numbers 5, 0, and the words pleasant and unpleasant were placed beside the numbers 5 and 5 to indicate positive and negative emotional valences, respectively . Circles that could be dragged were located on the middle line, and time points shown in units of 2 hours from 9:00 am to 9:00 pm were visible . The participants moved the circles up and down on a vertical plane within the range of 5 to 5 to express their emotional states (figure 1b). The second measure depicted six basic emotions as described by ekman: anger, disgust, fear, joy, sadness, and surprise.13 the emotions were presented on each vertex of a hexagon, and the relative intensities of the six distinct emotions were defined as the circumplex model . Moreover, 10 small circles, which were depicted as drops of water, were presented at the center of the hexagon, and a single drop of water moved to attach to the corresponding emotion when the user touched any of the six emotions a single time . Each participant was asked to touch the emotions in order to distribute the 10 drops of water as a description of their overall emotional state for the day; it was not necessary to use all 10 drops of water (figure 1c). The data from this measure were collected from the participants as well, but not used for the study analysis . The first step in determining a participant s physical state involved asking questions about the weather during each day using simple pictures . After choosing the weather, the participants were asked to complete their assessment of the length and quality of the previous night s sleep and to evaluate their digestive function throughout the day . The last step involved assessing one chronic condition that the participant wanted to monitor for 30 days, which was reported prior to starting the study; the personalized chronic symptoms ranged from eye irritation to dizziness . To assess the chronic symptom, each participant moved a button across a bar that was labeled at each end to indicate the worst and best conditions . This system applied a variation of the visual analog scale (vas) in which performances in computer - based and web - based research have been validated.30 while categorical scales reach an ordinal - scale level, the vas extends the precision and discrimination of daily reports (figure 1d). The data from this measure were collected from the healthy participants and not used for the study analysis . Two main methods were applied to measure physical conditions according to time . Like the emotional tasks, these were presented as tasks for the participants to complete on a daily basis and quantitatively described the positive or negative physical states of each participant . The first task involved assessing one s overall pain and the second task involved assessing one s overall fatigue throughout the day . On the screen, three auxiliary lines with the numbers 10 and zero next to the top and bottom lines, respectively, were provided . The words extremely severe and none were placed besides the numbers 10 and zero to indicate the intensities of pain and fatigue . Circles that could be dragged were located on the middle line and time points shown in units of 2 hours from 9:00 am to 9:00 pm were visible . The participants moved the circles up and down on a vertical plane within the range of 100 to express their physical states throughout the day; the same procedure was applied for both pain and fatigue (figure 1e and f). Because this study focused on the dynamic relationship between emotional and physical states, records with a more frequent temporal resolution (units of 2 hours) were analyzed; thus, a time series analysis of the data of 20 participants was conducted to determine the correlations between the emotional and physical states . The collected data of the participants during the 30-day study were placed in a property list (.plist) file format that was converted to a comma separated values (.csv) file for the data analyses . There were three different categories of time series data emotional valence, pain, and fatigue which illustrated the experiences and emotional states of the participants on a daily basis . An interpolation process was applied to complete the data for time points between 11:00 pm and 7:00 am when the participants were assumed to be asleep . Using this preprocessing procedure, five time points for a single night, or 150 time points in total, were filled in to complete the data for the 30-day study period . To fill in the empty time points, the function in the forecast package of r (http://www.r-project.org), which assumes a linear relationship, was used to complete the data set . Following the preprocessing procedure, three sets of time series data for each of the 20 participants were available for data analysis . A logarithmic transformation was applied to each of the emotional, pain, and fatigue series to ensure the normality and homogeneity of variance of the residuals . Cross - correlations between the emotional valence and pain, emotional valence and fatigue, as well as fatigue and pain time series were analyzed by participant, and the correlation coefficients were averaged to visualize the correlation analysis . R software (version 3.2.3, wooden christmas tree) and r studio (version 0.99.892) were used for the data analyses . To investigate the possible relationships between emotional valence and physical states using the data of the 20 participants, a regression model was applied with consideration given for the random effects of the participants . When selecting a regression model to determine whether there were associations among emotion, fatigue, and pain, it was assumed that there were concurrent dynamics between emotion and the body based on cross - correlation results . Accordingly, a mixed model for multilevel data with a combination of between - subject and within - subject factors was used . While some methods for time series analyses account for random effects in multilevel data,31 many other methods examine the concurrent changes between multiple time series without lagged effects . Thus, a single model was selected to analyze the three series to determine whether any associations existed . The multilevel regression model, or the mlm,32,33 allows for the estimation of hierarchically structured longitudinal data on the individual and group levels . For the current data, a mixed model with participants as the random effect without temporal dislocation was applied because cross - correlation analyses of the series unanimously showed the highest correlation at lag 0 . Based on the regression beta coefficients, the dynamic structure between emotional valence, pain, and fatigue was visualized in a network; the green line indicates a positive relationship, whereas the red line indicates a negative relationship . The inclusion criteria for the current study were as follows: participants were required to 1) be between 20 and 40 years of age, 2) have no history of any neuropsychological disorder or acute or chronic pain disorder, and 3) not be taking any type of medication . Written informed consent was obtained prior to participation . This study was conducted in accordance with the guidelines issued by the human subjects committee and approved by the institutional review board of kyung hee university in seoul, republic of korea . The primary goals for the mind mirror mobile application were to assess the daily emotional and physical changes of patients and to provide a platform from which large - scale data could be collected and analyzed . A novel user interface format was applied to measure the affective and physical states of a participant every 2 hours from 9:00 am to 9:00 pm for 30 days . The natural starting point of research on the dynamic nature of these symptoms lies in the analysis of symptoms measured over different time points . The analysis of time series data requires detailed records that reflect subtle changes in the emotional and physical conditions of individuals over time within a single day . In the current study, participants completed the entries of their daily emotional and physical states using the mind mirror software; they were instructed to complete the data input into the application at night prior to going to bed . Data regarding emotional valence, fatigue, and pain were entered by the participants over 30 days at seven time points each day between 9:00 am (09:00) and 9:00 pm (21:00). Of the eligible participants (n=21), one participant was unable to finish the study due to loss of mobile phone; thus, the final data analyses in the current study included 20 participants (eight females, mean age = 24.7 years). For the current study, an iphone operating system (ios) software application was developed using xcode 6.4 and the programming language swift; this application required ios 8.4 software development kit (sdk) or higher . Explicit methods were used to record the subjective ratings of the participants regarding their physical conditions and subjective valences of daily emotion . The explicit method collects data on emotions and physical conditions that the participant cognitively feels by asking direct questions or presenting straightforward tasks regarding their daily condition.29 upon turning on the application, a title page with a logo, as well as a message that reads once the participant has clicked on this message, the application begins its initial steps . For the current study, an iphone operating system (ios) software application was developed using xcode 6.4 and the programming language swift; this application required ios 8.4 software development kit (sdk) or higher . Explicit methods were used to record the subjective ratings of the participants regarding their physical conditions and subjective valences of daily emotion . The explicit method collects data on emotions and physical conditions that the participant cognitively feels by asking direct questions or presenting straightforward tasks regarding their daily condition.29 upon turning on the application, a title page with a logo, as well as a message that reads once the participant has clicked on this message, the application begins its initial steps . This application applied two main methods to measure explicit emotions or feelings that were presented as tasks for the participants to complete on a daily basis . The first measure was designed to quantitatively visualize positive or negative affective states . On the screen, three auxiliary lines with the numbers 5, 0, and the words pleasant and unpleasant were placed beside the numbers 5 and 5 to indicate positive and negative emotional valences, respectively . Circles that could be dragged were located on the middle line, and time points shown in units of 2 hours from 9:00 am to 9:00 pm were visible . The participants moved the circles up and down on a vertical plane within the range of 5 to 5 to express their emotional states (figure 1b). The second measure depicted six basic emotions as described by ekman: anger, disgust, fear, joy, sadness, and surprise.13 the emotions were presented on each vertex of a hexagon, and the relative intensities of the six distinct emotions were defined as the circumplex model . Moreover, 10 small circles, which were depicted as drops of water, were presented at the center of the hexagon, and a single drop of water moved to attach to the corresponding emotion when the user touched any of the six emotions a single time . Each participant was asked to touch the emotions in order to distribute the 10 drops of water as a description of their overall emotional state for the day; it was not necessary to use all 10 drops of water (figure 1c). The data from this measure were collected from the participants as well, but not used for the study analysis . The first step in determining a participant s physical state involved asking questions about the weather during each day using simple pictures . After choosing the weather, the participants were asked to complete their assessment of the length and quality of the previous night s sleep and to evaluate their digestive function throughout the day . The last step involved assessing one chronic condition that the participant wanted to monitor for 30 days, which was reported prior to starting the study; the personalized chronic symptoms ranged from eye irritation to dizziness . To assess the chronic symptom, each participant moved a button across a bar that was labeled at each end to indicate the worst and best conditions . This system applied a variation of the visual analog scale (vas) in which performances in computer - based and web - based research have been validated.30 while categorical scales reach an ordinal - scale level, the vas extends the precision and discrimination of daily reports (figure 1d). The data from this measure were collected from the healthy participants and not used for the study analysis . Two main methods were applied to measure physical conditions according to time . Like the emotional tasks, these were presented as tasks for the participants to complete on a daily basis and quantitatively described the positive or negative physical states of each participant . The first task involved assessing one s overall pain and the second task involved assessing one s overall fatigue throughout the day . On the screen, three auxiliary lines with the numbers 10 and zero next to the top and bottom lines, respectively, were provided . The words extremely severe and none were placed besides the numbers 10 and zero to indicate the intensities of pain and fatigue . Circles that could be dragged were located on the middle line and time points shown in units of 2 hours from 9:00 am to 9:00 pm were visible . The participants moved the circles up and down on a vertical plane within the range of 100 to express their physical states throughout the day; the same procedure was applied for both pain and fatigue (figure 1e and f). This application applied two main methods to measure explicit emotions or feelings that were presented as tasks for the participants to complete on a daily basis . The first measure was designed to quantitatively visualize positive or negative affective states . On the screen, three auxiliary lines with the numbers 5, 0, and the words pleasant and unpleasant were placed beside the numbers 5 and 5 to indicate positive and negative emotional valences, respectively . Circles that could be dragged were located on the middle line, and time points shown in units of 2 hours from 9:00 am to 9:00 pm were visible . The participants moved the circles up and down on a vertical plane within the range of 5 to 5 to express their emotional states (figure 1b). The second measure depicted six basic emotions as described by ekman: anger, disgust, fear, joy, sadness, and surprise.13 the emotions were presented on each vertex of a hexagon, and the relative intensities of the six distinct emotions were defined as the circumplex model . Moreover, 10 small circles, which were depicted as drops of water, were presented at the center of the hexagon, and a single drop of water moved to attach to the corresponding emotion when the user touched any of the six emotions a single time . Each participant was asked to touch the emotions in order to distribute the 10 drops of water as a description of their overall emotional state for the day; it was not necessary to use all 10 drops of water (figure 1c). The data from this measure were collected from the participants as well, but not used for the study analysis . The first step in determining a participant s physical state involved asking questions about the weather during each day using simple pictures . After choosing the weather, the participants were asked to complete their assessment of the length and quality of the previous night s sleep and to evaluate their digestive function throughout the day . The last step involved assessing one chronic condition that the participant wanted to monitor for 30 days, which was reported prior to starting the study; the personalized chronic symptoms ranged from eye irritation to dizziness . To assess the chronic symptom, each participant moved a button across a bar that was labeled at each end to indicate the worst and best conditions . This system applied a variation of the visual analog scale (vas) in which performances in computer - based and web - based research have been validated.30 while categorical scales reach an ordinal - scale level, the vas extends the precision and discrimination of daily reports (figure 1d). The data from this measure were collected from the healthy participants and not used for the study analysis . Two main methods were applied to measure physical conditions according to time . Like the emotional tasks, these were presented as tasks for the participants to complete on a daily basis and quantitatively described the positive or negative physical states of each participant . The first task involved assessing one s overall pain and the second task involved assessing one s overall fatigue throughout the day . On the screen, three auxiliary lines with the numbers 10 and zero next to the top and bottom lines, respectively, were provided . The words extremely severe and none were placed besides the numbers 10 and zero to indicate the intensities of pain and fatigue . Circles that could be dragged were located on the middle line and time points shown in units of 2 hours from 9:00 am to 9:00 pm were visible . The participants moved the circles up and down on a vertical plane within the range of 100 to express their physical states throughout the day; the same procedure was applied for both pain and fatigue (figure 1e and f). Because this study focused on the dynamic relationship between emotional and physical states, records with a more frequent temporal resolution (units of 2 hours) were analyzed; thus, a time series analysis of the data of 20 participants was conducted to determine the correlations between the emotional and physical states . The collected data of the participants during the 30-day study were placed in a property list (.plist) file format that was converted to a comma separated values (.csv) file for the data analyses . There were three different categories of time series data emotional valence, pain, and fatigue which illustrated the experiences and emotional states of the participants on a daily basis . An interpolation process was applied to complete the data for time points between 11:00 pm and 7:00 am when the participants were assumed to be asleep . Using this preprocessing procedure, five time points for a single night, or 150 time points in total, were filled in to complete the data for the 30-day study period . To fill in the empty time points, the function na.interp in the forecast package of r (http://www.r-project.org), which assumes a linear relationship, was used to complete the data set . Following the preprocessing procedure, three sets of time series data for each of the 20 participants were available for data analysis . A logarithmic transformation was applied to each of the emotional, pain, and fatigue series to ensure the normality and homogeneity of variance of the residuals . Cross - correlations between the emotional valence and pain, emotional valence and fatigue, as well as fatigue and pain time series were analyzed by participant, and the correlation coefficients were averaged to visualize the correlation analysis . R software (version 3.2.3, wooden christmas tree) and r studio (version 0.99.892) were used for the data analyses . To investigate the possible relationships between emotional valence and physical states using the data of the 20 participants, a regression model was applied with consideration given for the random effects of the participants . When selecting a regression model to determine whether there were associations among emotion, fatigue, and pain, it was assumed that there were concurrent dynamics between emotion and the body based on cross - correlation results . Accordingly, a mixed model for multilevel data with a combination of between - subject and within - subject factors was used . While some methods for time series analyses account for random effects in multilevel data,31 many other methods examine the concurrent changes between multiple time series without lagged effects . Thus, a single model was selected to analyze the three series to determine whether any associations existed . The multilevel regression model, or the mlm,32,33 allows for the estimation of hierarchically structured longitudinal data on the individual and group levels . For the current data, a mixed model with participants as the random effect without temporal dislocation was applied because cross - correlation analyses of the series unanimously showed the highest correlation at lag 0 . Based on the regression beta coefficients, the dynamic structure between emotional valence, pain, and fatigue was visualized in a network; the green line indicates a positive relationship, whereas the red line indicates a negative relationship . Fuller test analyzing the three time series with no lagged differences indicated that the logarithmic emotion series, pain series, and fatigue series were each stationary time series . Thus, no temporal dislocation was required to meet the stationarity requirement for the regression analysis . The correlation analysis revealed that there were negative correlations between emotional valence and fatigue, as well as emotional valence and pain, while pain and fatigue were positively correlated; all three relationships showed the highest correlations at lag 0 . Figure 2 depicts the plots of the mean cross - correlation values among the participants between the emotional valence and fatigue, emotional valence and pain, and pain and fatigue series . The cross - correlation was the strongest at lag 0; at lag 0, the mean of the participants cross - correlation coefficient (ccf) values were as follows: emotion fatigue = 0.289 (p<0.001); emotion pain = 0.208 (p=0.007); and pain table 1 summarizes the dynamic interactions among the three series (), as well as the akaike information criterion (aic), bayesian information criterion (bic), and log likelihood of each model . The mlm revealed that fatigue was negatively associated with emotional valence (= 0.233, p<0.001) and positively associated with pain (= 0.398, p<0.001). Additionally, pain was significantly associated with fatigue (= 0.250, p<0.001) and emotional valence was significantly more negative as fatigue increased (= 0.150, p<0.001). Emotional valence also exhibited a negative change as pain increased (= 0.022, p=0.063) and pain increased as emotion changed negatively (= 0.021, p=0.063), but these results were not statistically significant . The dynamic network structure between emotional valence, pain, and fatigue is presented in figure 3 . Fuller test analyzing the three time series with no lagged differences indicated that the logarithmic emotion series, pain series, and fatigue series were each stationary time series . Thus, no temporal dislocation was required to meet the stationarity requirement for the regression analysis . The correlation analysis revealed that there were negative correlations between emotional valence and fatigue, as well as emotional valence and pain, while pain and fatigue were positively correlated; all three relationships showed the highest correlations at lag 0 . Figure 2 depicts the plots of the mean cross - correlation values among the participants between the emotional valence and fatigue, emotional valence and pain, and pain and fatigue series . The cross - correlation was the strongest at lag 0; at lag 0, the mean of the participants cross - correlation coefficient (ccf) values were as follows: emotion fatigue = 0.289 (p<0.001); emotion pain = 0.208 (p=0.007); and pain fatigue = 0.321, (p<0.001). Table 1 summarizes the dynamic interactions among the three series (), as well as the akaike information criterion (aic), bayesian information criterion (bic), and log likelihood of each model . The mlm revealed that fatigue was negatively associated with emotional valence (= 0.233, p<0.001) and positively associated with pain (= 0.398, p<0.001). Additionally, pain was significantly associated with fatigue (= 0.250, p<0.001) and emotional valence was significantly more negative as fatigue increased (= 0.150, p<0.001). Emotional valence also exhibited a negative change as pain increased (= 0.022, p=0.063) and pain increased as emotion changed negatively (= 0.021, p=0.063), but these results were not statistically significant . The dynamic network structure between emotional valence, pain, and fatigue is presented in figure 3 . The current study developed a phr called mind mirror for the recording of daily emotions, pain, and fatigue . By using explicit methods to retrospectively record changes in emotional valence, pain, and fatigue every 2 hours on a daily basis, this mobile platform enabled the collection of a set of individualized time series data that illustrated emotional and physical changes in individual patients . The analyses revealed that there were dynamic relationships between daily emotional and physical states in healthy participants . At lag 0, emotion and fatigue were negatively correlated, while fatigue and pain were positively correlated . In the dynamic structural network produced by the mlm, the body, or the physical states of pain and fatigue, instantly interacted with emotional valence . Additionally, the overall physical states of fatigue and pain seemed to positively interact with each other, which may have interactively facilitated either the improvement or worsening of a condition . The drm is one way of self - assessment on the daily affective experiences.27,28 while self - assessments of the recent affective experiences such as drm have been studied to contribute to subjective well - being, our study focused on not only the emotional states but also the participant s physical symptoms that may affect their daily experiences . By doing so, this mobile platform aimed to provide a tool for assessing daily situations, as well as a daily record of psychological and physical states . The current findings suggest that emotional valence and fatigue directly influence one another and that emotional valence and pain influence one another through the mediating symptom of fatigue, even in healthy individuals . These findings agree with those of previous studies that identified a relationship between negative emotions and physical states.2024,3538 for example, there are strong genetic links between chronic widespread musculoskeletal pain and fatigue as well as between chronic widespread pain and depression.34 other studies have identified a close relationship between emotional valence and one s physical condition . Accordingly, chronic pain is associated with mental disorders, and negative emotions are known to influence the development of cardiovascular diseases.21,22,24,35 pain disorders without a definite cause, including fibromyalgia (in which the most common symptoms are pain, fatigue, and depression), affect patients in such a way that treatments help to relieve symptoms but not to eliminate the cause of the disorders.34,36 diseases such as cancer are associated with a variety of emotional symptoms, including anxiety and depression, as well as physical symptoms, including pain and fatigue.20,37 on the other hand, although there is evidence that mood influences pain disorders, the influence of a negative emotional state on one s physical state has also been shown to be either selective, general, or unclear.23,38 a 30-day observational study demonstrated that emotions affect healthy individuals and that this influence is instantly evident even in the absence of awareness of a patient.24 in this respect, phrs may provide a possible strategy for improving medical care for patients with comorbid psychological and physical illnesses.39 thus, the findings of the current study can be applied to health management by medical professionals and institutions for the purpose of analyzing daily emotions that can lead to diseases as well as for predicting possible changes in daily emotions . Participant - generated health data, such as those produced by the current study, hold potential for the self - monitoring and daily measurement of health conditions, which will aid in the investigation of possible relationships between an individual s emotions and chronic physical symptoms outside the hospital . In a more general sense, phrs point to the promise of health technologies for managing health and preventing the occurrence or worsening of various disorders among members of the general population who have access to mobile technology . Moreover, a variety of diverse information can be obtained using this format, depending on the target population, including inpatients within medical facilities, outpatients who make regular visits, and healthy individuals who are yet to receive medical checkups . Reduced gaps in health - related information may aid in the diagnoses of individuals who do not have a clear cause for their symptoms . As these technologies are developed and distributed in the near future, it will be essential to ensure that they are available for and tested in patients with psychological and/or psychosomatic symptoms . This study found marked and direct, but not significant, relationships between pain and emotion, which may be interpreted from two different perspectives . First, this study was conducted with a limited number of participants and, thus, further investigations are needed to compare these findings with those of other studies in order to establish generalizability with other age groups and health settings with a larger population . Second, this study was conducted using only a subset of participants with regular emotional and physical health statuses and, thus, they may have had different relationships between their emotional and physical states relative to chronic disease patients . For instance, mental disorders, including depression, are known to be comorbid with chronic pain.40 thus, further research is needed to examine the benefits of this application and other types of novel technologies in different patient groups . Furthermore, the mobile application - based phr used in the current study required that the participants enter all data and access their records using smartphones, which may have limited the population eligible for this intervention . Third, the retrospective assessment of the pain, fatigue, and emotional valence by the participants, as indicated in our study, may introduce recall bias . While the strategy to use this mobile platform minimized any missing values during the trial, the recall bias may have consequences for the data quality . One way of avoiding this problem, as used by other mobile platforms, is to prompt the participants several times during the day . Finally, the current analyses did not include data collected from the circumplex model of categorical emotion or other items, including sleep or other chronic symptoms, because it was focused on the temporal dynamics of the relationships between the emotional and physical states of patients . It would be interesting to investigate the interplay between different types of emotions and physical symptoms in the future . Future studies in which a large sample size and the analysis of a combination of other items are utilized when an application - based phr is widely used worldwide should be conducted . The current 30-day observational study examined relationships among pain, fatigue, and emotional valence and provided evidence that the physical condition and emotional state of healthy participants are interrelated . Positive changes in emotional valence were associated with improvements in physical condition via decreases in pain and fatigue, while negative changes in emotional valence were associated with the aggravation of pain and fatigue . By measuring differences in daily emotions, the current study provided basic information about both emotional and physical health in daily life using a mobile platform that recorded emotional and physical changes throughout the day on a daily basis . These findings also suggest that further data collection and analyses will contribute to the ability to predict an individual s emotional and physical health conditions, which would aid in the management of an individual s health on a daily basis.
Endodontic treatment of necrotic immature teeth is challenging . Proper preparation and obturation of the apical portion of immature teeth are difficult to achieve because of the thin, fragile dentinal walls and the blunderbuss anatomy . Multiple - session apexification using calcium hydroxide used to be the treatment of choice for such cases . Later - proposed one - step apexification by the induction of artificial barriers using materials such as mta greatly decreased the frequency of sessions and duration of treatment . However, both these techniques suffer a major limitation; they do not allow the continuation of root development and consequently result in the formation of a fragile root . A recently suggested approach is based on creation of an environment that induces root maturation . This approach includes disinfection of the root canal system and use of antibiotic paste as an intracanal medicament . In contrast to the conventional apexification and artificial formation of an apical barrier, revascularization enables root maturation . Vital apical pulp tissue or hertwig s epithelial root sheath might have remained in necrotic, open - apex teeth . If present, these tissues may proliferate and result in root development when the canal has been well disinfected and the inflammatory process has been reversed . Modern era of regenerative endodontics was started by a case report by banchs and trope in 2004 . Different concentrations of sodium hypochlorite (naocl) including 6% [9, 10], 5.25% [5,8, 11], 2.5%, and 1.25% and different concentrations of chlorhexidine (chx) including 2% and 0.12% have been successfully used for this purpose . The procedure continues by application of triple antibiotic paste as an intracanal medicament, which is composed of ciprofloxacin, metronidazole and minocycline, as suggested by hoshino et al . In the absence of clinical signs and symptoms of periradicular diseases, the treatment continues with removing the paste and inducing bleeding into the canals by irritating the periapical tissues . After formation of a blood clot, the orifice of the canal is sealed with mta, which is placed over the clot as a biocompatible sealing material . Finally, the crown is permanently restored . There is no agreement on the methods to produce predictable clinical outcomes or optimal disinfection protocols . A range of clinical protocols have been used to treat these cases, with various irrigants, medicaments, clinical procedures and follow - up times . It is difficult to select the appropriate non - vital teeth with residual vital apical cells, which are believed to be necessary for a successful regenerative procedure . This article describes two different revascularization treatment protocols in necrotic immature teeth, which led to different clinical outcomes . A healthy 16 year - old male patient was referred to the department of endodontics at the school of dentistry of tehran university of medical sciences . The patient s chief complaint was occasional pus discharge from a gumboil in the anterior region of the upper jaw . The patient recalled a history of an impact trauma and crown fracture of the left maxillary incisor eight years earlier . All the teeth in the maxillary anterior region were responsive to cold test, using endo - frost cold spray (roeko; coltene whaledent, langenau, germany) except for tooth #21 . Radiography revealed immature root of tooth #21 with a radiolucent periapical lesion (fig . After local infiltration anesthesia with 1.8 ml of 2% lidocaine with 1:80,000 epinephrine (daroupakhsh, tehran, iran), rubber dam isolation, and access cavity preparation, the working length was determined by placing a large file in the canal and taking a periapical radiograph . The root canal system was irrigated with 20 ml of 5.25% naocl followed by 20 ml of 0.2% chx . Triple antibiotic paste (ciprofloxacin, metronidazole, doxycycline) was used as intracanal medicament for three weeks . In the next visit, local infiltration anesthesia was performed with 3% plain mepivacaine, without vasoconstrictor to facilitate bleeding as suggested by petrino et al . The antibiotic intracanal medicament was gently removed and flushed out of the canal with copious irrigation with 5.25% naocl . After drying the canal, bleeding was induced inside the canal with a sterile #50 hand file (mani inc ., utsunomiya, japan), which was inserted one millimeter beyond the apical foramen and the coronal part of the canal was sealed with proroot mta (dentsply tulsa dental, tulsa, ok, usa) over the blood clot . A moist cotton pellet was placed over the mta in the access cavity, and the tooth was temporarily restored with coltosol (asia chemi teb co., tehran, iran) (fig . (e and f) after placing mta plug as apical barrier and obturation of coronal part of the root . One week later, the patient was recalled to ensure the setting of mta, and permanent restoration of the tooth was performed with composite resin (dentsply international, milford, de, usa) (fig . Three months later, at the first follow - up appointment, no signs or symptoms were recorded . At the six - month recall, no evidence of thickening of the canal walls or continuation of root development was noted on radiographs and apical rarefaction was seen (fig . According to the american association of endodontics (aae) guidelines, the regenerative treatment was considered not successful . After preparing the access cavity, the coronal mta was removed with a diamond - coated straight tip (e32d, nsk, tokyo, japan) attached to an ultrasonic scaler (varios 970, nsk, tokyo, japan) under copious irrigation . A five - millimeter thick proroot mta plug was placed in the apical part of the canal (fig . After one week, the mta setting was ensured and the coronal part was filled with guttapercha (meta bio - med co., ltd, seoul, korea) and ah-26 sealer (dentsply, de trey, konstanz, germany). The crown was restored with composite resin (dentsply international, milford, de, usa) (fig . The patient was recalled every three months for radiographic examination and evaluation of clinical signs and symptoms . In the follow up sessions and after one year, the patient had no signs or symptoms . At the one - year follow up, the radiolucent lesion had resolved (fig . A healthy 17 year - old female patient was referred to the department of endodontics at the dental faculty of tehran university of medical sciences . The patient complained of slight swelling and pus discharge adjacent to one of her lower teeth . Clinical examination revealed an opening on the occlusal surface of the mandibular right second premolar (tooth #45) that seemed to cause pulpal exposure (fig . 2). Cavity on the occlusal surface of tooth #45 and a sinus tract in the lingual side of the tooth . On radiographs, tooth #45 had a blunderbuss short root with thin dentinal walls and a radiolucency embracing the root (figs . 3 and 4a). (a) blunderbuss short root of tooth #45 with thin dentinal walls and a radiolucency embracing the root . After injection of local anesthetic agent comprising of 3% plain mepivacaine and rubber dam isolation, the access cavity was prepared . The working length was determined by placing a large file in the canal and taking a periapical radiograph . Then, the root canal system was copiously and gently irrigated with 20 ml of 1.5% naocl followed by 20 ml of normal saline . Triple antibiotic paste (ciprofloxacin, metronidazole, doxycycline) was used as intracanal medicament for three weeks (fig . The antibiotic intracanal medicament was gently removed from the canal via irrigation with 20 ml of normal saline and 20 ml of 17% edta . After drying the canal, bleeding was induced inside the canal with an overextended #70 hand file (mani inc ., utsunomiya, japan), and the coronal part of the canal was sealed with biodentine (septodont, st . Note the non - traceable sinus tract in the lingual side of tooth #45 . One week later, the tooth was permanently restored with composite resin (dentsply international, milford, de, usa) (figs . 4b and no clinical signs or symptoms were recorded . At the six - month follow - up, no evidence of thickening of the canal walls or continuation of root development was seen on the radiographs, but obvious intracanal calcification was noted (fig . On radiographs, diffuse intracanal calcification was seen in the vicinity of the coronal biodentine, and radiopaque calcified bridges were noted in the middle and apical parts of the canal (fig . A healthy 16 year - old male patient was referred to the department of endodontics at the school of dentistry of tehran university of medical sciences . The patient s chief complaint was occasional pus discharge from a gumboil in the anterior region of the upper jaw . The patient recalled a history of an impact trauma and crown fracture of the left maxillary incisor eight years earlier . All the teeth in the maxillary anterior region were responsive to cold test, using endo - frost cold spray (roeko; coltene whaledent, langenau, germany) except for tooth #21 . Radiography revealed immature root of tooth #21 with a radiolucent periapical lesion (fig . After local infiltration anesthesia with 1.8 ml of 2% lidocaine with 1:80,000 epinephrine (daroupakhsh, tehran, iran), rubber dam isolation, and access cavity preparation, the working length was determined by placing a large file in the canal and taking a periapical radiograph . The root canal system was irrigated with 20 ml of 5.25% naocl followed by 20 ml of 0.2% chx . Triple antibiotic paste (ciprofloxacin, metronidazole, doxycycline) was used as intracanal medicament for three weeks . In the next visit, local infiltration anesthesia was performed with 3% plain mepivacaine, without vasoconstrictor to facilitate bleeding as suggested by petrino et al . The antibiotic intracanal medicament was gently removed and flushed out of the canal with copious irrigation with 5.25% naocl . After drying the canal, bleeding was induced inside the canal with a sterile #50 hand file (mani inc ., utsunomiya, japan), which was inserted one millimeter beyond the apical foramen and the coronal part of the canal was sealed with proroot mta (dentsply tulsa dental, tulsa, ok, usa) over the blood clot . A moist cotton pellet was placed over the mta in the access cavity, and the tooth was temporarily restored with coltosol (asia chemi teb co., tehran, iran) (fig . (e and f) after placing mta plug as apical barrier and obturation of coronal part of the root . One week later, the patient was recalled to ensure the setting of mta, and permanent restoration of the tooth was performed with composite resin (dentsply international, milford, de, usa) (fig . Three months later, at the first follow - up appointment, no signs or symptoms were recorded . At the six - month recall, no evidence of thickening of the canal walls or continuation of root development was noted on radiographs and apical rarefaction was seen (fig . According to the american association of endodontics (aae) guidelines, the regenerative treatment was considered not successful . After preparing the access cavity, the coronal mta was removed with a diamond - coated straight tip (e32d, nsk, tokyo, japan) attached to an ultrasonic scaler (varios 970, nsk, tokyo, japan) under copious irrigation . A five - millimeter thick proroot mta plug was placed in the apical part of the canal (fig . After one week, the mta setting was ensured and the coronal part was filled with guttapercha (meta bio - med co., ltd, seoul, korea) and ah-26 sealer (dentsply, de trey, konstanz, germany). The crown was restored with composite resin (dentsply international, milford, de, usa) (fig . The patient was recalled every three months for radiographic examination and evaluation of clinical signs and symptoms . In the follow up sessions and after one year, the patient had no signs or symptoms . At the one - year follow up, the radiolucent lesion had resolved (fig . A healthy 17 year - old female patient was referred to the department of endodontics at the dental faculty of tehran university of medical sciences . The patient complained of slight swelling and pus discharge adjacent to one of her lower teeth . Clinical examination revealed an opening on the occlusal surface of the mandibular right second premolar (tooth #45) that seemed to cause pulpal exposure (fig . 2). Cavity on the occlusal surface of tooth #45 and a sinus tract in the lingual side of the tooth . On radiographs, tooth #45 had a blunderbuss short root with thin dentinal walls and a radiolucency embracing the root (figs . 3 and 4a). (a) blunderbuss short root of tooth #45 with thin dentinal walls and a radiolucency embracing the root . After injection of local anesthetic agent comprising of 3% plain mepivacaine and rubber dam isolation, the access cavity was prepared . The working length was determined by placing a large file in the canal and taking a periapical radiograph . Then, the root canal system was copiously and gently irrigated with 20 ml of 1.5% naocl followed by 20 ml of normal saline . Triple antibiotic paste (ciprofloxacin, metronidazole, doxycycline) was used as intracanal medicament for three weeks (fig . The antibiotic intracanal medicament was gently removed from the canal via irrigation with 20 ml of normal saline and 20 ml of 17% edta . After drying the canal, bleeding was induced inside the canal with an overextended #70 hand file (mani inc ., utsunomiya, japan), and the coronal part of the canal was sealed with biodentine (septodont, st . Note the non - traceable sinus tract in the lingual side of tooth #45 . One week later, the tooth was permanently restored with composite resin (dentsply international, milford, de, usa) (figs . 4b and no clinical signs or symptoms were recorded . At the six - month follow - up, no evidence of thickening of the canal walls or continuation of root development was seen on the radiographs, but obvious intracanal calcification was noted (fig . On radiographs, diffuse intracanal calcification was seen in the vicinity of the coronal biodentine, and radiopaque calcified bridges were noted in the middle and apical parts of the canal (fig . Pulp necrosis in the first case was due to a traumatic event . In the second case, pulp exposure was assumed to be due to caries or dens evaginatus, which had led to necrosis before tooth maturation . Dens evaginatus may occur in any tooth but is most commonly seen in premolars, especially mandibular premolars . Dens evaginatus is one of the most prevalent tooth anomalies, and following attrition during normal tooth function, it usually leads to pulp exposure and devitalization at an early age [8,11, 18]. If necrosis occurs, these cases are usually asymptomatic, and development of periapical lesions and formation of sinus tract may pursue . Pulp revascularization was considered to be the treatment of choice in order to save the teeth and promote root development . The primary goal of regenerative endodontic procedures is healing of apical periodontitis as stated in the revised aae guidelines (july 2013). According to the guidelines, both the secondary and tertiary goals are desirable but possibly not essential to determine the clinical success . According to the guidelines, the first case did not fulfill the essential requirements of a successful treatment and consequently, the patient received an alternative treatment plan . One of the critical points is to choose the most effective antimicrobial agent for maximum cleaning of the root canal system . On the other hand, in teeth with an immature apex, the root canal is large in size, permitting easier permeation of antimicrobial agents into the root canal system and towards the periapical region . In fact, the concern is how to prevent relatively toxic antimicrobial agents from gaining access to the periapical tissues, which may contain stem cells and vasculature that are necessary for the regeneration process . Attempts were made to find an antimicrobial agent with the least toxic effects in terms of both chemical composition and concentration . The use of endo - vac has been mentioned as a good strategy to avoid periapical extrusion of irrigants such as naocl . The different concentrations of naocl including 6% [9, 10], 5.25% [5, 8, 11], 2.5% and 1.25% and different concentrations of chx (0.12% to 2%) have been successfully used for this purpose . In our two cases, different irrigation protocols were used . In the first case, the tooth was irrigated with 5.25% naocl followed by 0.2% chx . For removing the triple antibiotic paste in the second session, the root canal system was irrigated with 1.5% naocl followed by normal saline . In the next visit, the antibiotic dressing was removed from the canal using normal saline . Next, 17% edta was used as the final irrigant because the use of edta is beneficial for providing dentin - derived growth factors . The half- or full - strength (3% and 6%, respectively) concentrations of naocl have been shown to prevent stem cell attachment to dentin surfaces, and are toxic to stem cells of the apical papilla (scap) [20, 22]. It has also been shown that 2% chx was the most toxic irrigant for scap . It is worth noting that in some of the published successful revascularization cases, full - strength naocl has been used for irrigation, at least in the first appointment . Previous studies showed that the use of 17% edta significantly increased attachment of newly formed mineralized tissues to dentinal canal walls . Growth factors are released from the root canal dentinal walls following edta irrigation . In the second case (eliminating chx from the rinsing protocol), adding% 17 edta and using naocl in a lower concentration might have had a positive effect on the treatment outcome . In the second case, a previous study showed the bioactivity of biodentine as it increased pulp cell proliferation and biomineralization . Therefore, biodentine, as a suitable material, has been suggested for the purpose of dentin - pulp complex regeneration in the clinical setting . Only one previous study used biodentine in the revascularization process and reported resolution of the associated periapical pathology in a mandibular incisor of a 15 year - old patient . In the aforementioned study, the tooth was irrigated with 6% naocl and the triple antibiotic paste was applied as the intracanal medicament with no instrumentation . The authors stated that biodentine was suitable for maintaining the vitality of dental pulp stem cells and creating a suitable environment for revascularization of dental pulp and consequent completion of root maturation . The success of revascularization / revitalization therapy depends on efficient disinfection of the root canal system . If infection persists in the root canal, not only regeneration but also repair will not occur in the pulp - periapical tissue complex . There may be a relation between time of trauma and quality of root development; the longer the duration of pulp necrosis, the lower the quality of root development after regenerative treatments . Such association has also been discussed in previous studies reporting decreased or no root development and failure of the procedure [11, 25]. Lenzi and trope discussed the possibility of longstanding infection destroying the cells capable of pulp regeneration . However, considering the successful outcomes of regenerative endodontic treatments in cases with long - lasting apical periodontitis, they concluded that this might not be the reason . Another possible explanation is the maturation of bacterial biofilm, which results in more difficult elimination by conventional protocols . Perhaps this can be assumed as one of the underlying factors for the unfavorable outcome in our first case . In the second case, intra canal calcification was seen with no increase in root length or thickness of dentinal walls . Deposition of a cementum - like tissue on root canal dentinal walls following regenerative endodontic treatment was reported in an animal study . This tissue was irregular and assumed to be responsible for root development . In the same study, the authors reported the formation of cementum bridges in the root canal system and reported that it might be due to the mta potential of hard - tissue induction . Discussed the drawbacks and unfavorable outcomes of regenerative endodontic treatments and mentioned that formation of a hard - tissue barrier inside the canal between the coronal mta plug and the root apex was among the unfavorable outcomes . However, in a more recent article, fouad and nosrat suggested that clinicians and the research community must reach a consensus about the clinically acceptable outcome . They suggested re - defining the clinical success and proposed that the clinical success must be redefined as when calcification occurs in the absence of any signs and symptoms and the infection is completely resolved . Despite the fact that formation of intracanal mineralized tissue and pulp canal obliteration are inconsistent with the concept of regeneration, it seems logical to compromise the idealistic expectations in this field and overlook some of the shortcomings . There is considerable debate on the ideal outcome of regenerative endodontic treatment . With respect to the nature of regeneration, it seems that there is a gap between the expected histological outcomes and what actually happens in the root canal system, at least in many instances . Since many of these teeth achieve acceptable clinical outcomes i.e. Being infection - free, asymptomatic and clinically functional, it seems logical to reframe our perspectives in this field and expand the scope of definition of success in endodontic regenerative treatment, and consider the aforementioned clinical outcomes as success.
Multiple carcinoid tumors of the small intestine are rare and are very difficult to detect preoperatively . A 75-year - old woman in whom the bleeding focus could not be found by upper and lower endoscopy and abdominal ct was admitted for evaluation of anemia . We examined the patient with total double - balloon endoscopy (dbe) and located multiple submucosal tumors . We report a case of a successful laparoscopic operation for multiple carcinoid tumors in the small intestine without intraoperative endoscopy . Total digestive tract observation using dbe tumors of the small intestine account for 1% to 2% of all gastrointestinal neoplasms (only 0.3% of all neoplasms). However, the incidence of small intestine cancer has increased dramatically over the past 30 years, and the increase in carcinoid tumors has been largely responsible . Carcinoids of the ileum account for 15.4% of all gastrointestinal carcinoids and are multicentric in 2030% of patients . The lack of signs and symptoms, lack of definitive preoperative diagnostic tests, and the variable efficacy of available tests make small intestine tumors difficult to diagnose . The recent development of capsule endoscopy (ce) and double balloon endoscopy (dbe) has improved diagnostic capabilities for the small intestine . We report the first case of multiple carcinoid tumors of the small intestine preoperatively diagnosed by dbe and treated with laparoscopic surgery . A 75-year - old woman was referred to our hospital with melena and severe anemia (hemoglobin (hb) 7.2 g / dl). She had a history of stroke at age 59 years, and was being treated with antiplatelet therapy at the time of admission to the referring hospital . At that hospital, the source of gi bleeding was not revealed by upper and lower gastrointestinal endoscopy examination, abdominal computed tomography (ct), or ultrasound (us). Through radiological enteroclysis, an elevated lesion was found in the ileum, which was suspected to be a submucosal tumor and measured 15 mm in diameter . After 2 months at the referring hospital, she was admitted to our hospital for a thorough investigation of the small intestine . Physical examination revealed her abdomen to be soft and flat without any pain or tenderness . Results of blood tests were as follows: hb 11.3 g / dl (normal: 11.115.2 g / dl), red blood cell count 418 10/ml (normal: 380540 10/ml), and hematocrit 35.3% (normal: 35.645.4%). We then examined the patient with peroral dbe (en-450p5: fujifilm medical co., ltd ., a tumor was located about 250 cm from the ligament of treitz and measured 8 mm in diameter (figure 1). Histologic examination of the biopsy sample obtained by endoscopy confirmed the diagnosis of a carcinoid tumor . The tumor was composed of small uniform epithelial cells, which stained positively for chromogranin a and synaptophysin . Another tumor detected through peranal dbe was located about 110 cm from the ileocecal valve and measured 15 mm in diameter . Also, other small tumors were detected that measured 3 mm and 5 mm in diameter and had a relatively smooth surface, similar to a submucosal tumor . These small tumors were diagnosed as carcinoid tumors by endoscopic findings, whereas histologic examination could not make this diagnosis . The largest tumor had ulcerations, which could account for the gi bleeding (figure 2). The patient underwent partial resection of the small intestine by laparoscopic surgery (resected portion: 23.8 cm). She had already undergone a preoperative total small intestinal examination using dbe; therefore, it was not necessary to perform intraoperative endoscopy . The resected specimen contained tumors measuring 1410 mm, with central ulceration (figure 3), 2.86 mm and a tumor 3 mm in diameter . Microscopically, the tumors were composed of small uniform epithelial cells (figure 4b), which stained positively for chromogranin a and synaptophysin (figure 5). No metastases were found in the regional lymph nodes, and the surgical margins were negative for tumor cells . Follow - up dbe was performed 18 months later, and there was no sign of recurrence in the small intestine . This is the first report of laparoscopic surgery without the use of intraoperative endoscopy for multiple carcinoid tumors of the small intestine, which was possible because the tumors were diagnosed before surgery by dbe . Carcinoid is the second most common malignancy, accounting for approximately 2025% of all small intestine lesions . Carcinoid tumors are more common in the ileum (most within 60 cm of the ileocecal valve) than in the jejunum or duodenum, and lesions may be multiple and/or metastatic (liver and lungs) at the time of diagnosis because one fourth of carcinoid tumors in the small intestine are multiple . On the guideline, by far the majority of small intestinal neuroendocrine tumors (nets, including carcinoid) are malignant in nature . Whether liver metastases are present or not, resection of the primary tumor is appropriate to cure or to delay progression that would otherwise endanger the small bowel . Carcinoids of the rectum, stomach, and duodenum generally are found by endoscopy at an early stage, whereas carcinoid tumors of the small intestine usually are discovered after resection of the small intestine for symptoms of obstruction or during exploration of the small intestine in search of a primary tumor after distant metastases have been found [2,912]. Through conventional imaging techniques (e.g., ct, us, double contrast barium study), few tumors of a small diameter are identified . Currently, with advancement in methods of ce, small intestine tumors can be located . Ce had a high diagnostic yield of 45% for identification of primary small intestinal carcinoid tumors . However, it remains purely a diagnostic procedure at present because it is not suitable for histological diagnosis and procedures . For this reason, if laparoscopic surgery is performed in a patient who was diagnosed as having multiple carcinoid tumors of the small intestine, it is usually necessary to perform intraoperative endoscopy to confirm that the lesion is a carcinoid tumor . It is notable that in reporting the results of their study, m. bellutti et al . Suggested that intraoperative endoscopy is a potential gold standard for nets . On the other hand a submucosal tumor of the ileum or the jejunum was detected by dbe in 7 of 12 patients (58%) with suspected carcinoid syndrome . In addition, tumor marking using injection of ink for the exact location during dbe has been helpful for subsequent operations, especially for laparoscopic resection . By utilizing dbe, we were able to locate the multiple ileal tumors and to perform laparoscopic surgery without intraoperative endoscopy in the patient reported here . Dbe is a safe procedure, with low complication rates even when therapeutic maneuvers are performed . As only dbe allows direct, controlled visualization of small intestine tumors and their histological confirmation preoperatively, it may be considered the gold standard for the diagnosis of such tumors . Dbe is extremely useful to detect and diagnose asymptomatic small lesions in the small intestine . Based on the case presented here, we recommend total digestive tract observation using dbe before performing laparoscopic operation for multiple tumors of the small intestine.
Prostate cancer (pca) is one of the most common cancers in men over the world . Dietary factors have been found to play an important role during pca and special attention has been given to dietary fat . An important study by augustsson et al . Showed that a high fish intake (> 3 times per week) resulted in approximately 40% reduction of aggressive, metastatic pca but did not influence the overall pca incidence . Similar effects were confirmed by a meta - analysis, in which a high fish consumption was demonstrated to lower the incidence of metastatic pca by 44% and its mortality by 63% . This effect has been shown to be mainly attributable to the n-3 fatty acids (fas) found in fish . The mechanisms by which n-3 fas could have the potential to impede the formation of metastases are probably based on n-3 fas as precursors of eicosanoids, which are less prometastatic and less inflammatory than eicosanoids derived from n-6 fas . Eicosanoids are lipid mediators, tissue hormones with autocrine or paracrine activity, which are involved in many physiological processes such as platelet function, immune response, and pain modulation . Dysregulation of eicosanoid biosynthesis has been linked to inflammation, infertility, allergy, degenerative diseases, atherosclerosis, ischemia, metabolic syndrome, and, most importantly, to cancer . For eicosanoid biosynthesis, fas have to be liberated from membrane phospholipids by lipolytic enzymes, which are predominantly phospholipases a2 . Thereafter cyclooxygenases (cox) or lipooxygenases (lox), which are the first step enzymes in the transformation of n-3 or n-6 fas, convert the previously liberated fas into different eicosanoids . Pge2, which is derived from arachidonic acid (aa), is highly active in promoting metastatic spread and aggressive tumour growth while pge3, derived from the n-3 fa epa, is less active [5, 79]. This, and the fact that the conversion of epa is faster than the conversion of aa by the same enzyme (cox), n-3 fas have the potential to act antimetastatic . Thus, in tumour cells which often have an increased eicosanoid biosynthesis, the n-3/n-6 fas ratio in the cellular membranes could determine the aggressiveness of the tumour cells . However, to change the membrane n-3/n-6 fa ratio, the cells have to be supplied with the respective essential fas . In blood, fas from there, fas can be supplied to the cells, either as lysophosphatidylcholine (lpc) after the action of lcat (lecithin - cholesterol - acyltransferase), as free fas after their cleavage from other lipoproteins like ldl, vldl, or idl by lipases, or taken up with the whole ldl lipoprotein via its receptor . As discussed above, the incidence of metastatic pca has shown to be reduced by about 4050% if patients ingested high amounts of n-3 fas . During this clinical trial we investigated the interplay between metastatic growth of pca and the effects of n-3 fa uptake on (i) blood fa composition (n-3/n-6 fa ratio), (ii) lipoprotein-, and (iii) lpc levels in patients with pca as well as in elderly men without pca (controls). The clinical trial was performed in the south western region of germany, where fish consumption is usually low due to its scarcity in that area . Therefore, the study population consisted of low fish consumers . To establish fa-, lipoprotein, and lpc levels representative for high fish consumption, all subjects were supplemented with n-3 fas given as marine phospholipids (mpl) for 3 months . Mpl is an n-3 fa - rich extract from salmon roe containing high amounts of phospholipids (pls) containing the n-3 fas eicosapentaenoic acid (epa) and docosahexaenoic acid (dha). Its composition (approximately 1/3 of the n-3 fas are bound to pls and 2/3 are bound to triglycerides) resembles the fa composition of fish better than other n-3 fa supplements like fish oil, which contains no pls . It has been shown that the uptake and utilization of n-3 fas bound to pls is more efficient than those bound to triglycerides (tgs) [1315], but the metabolism of dietary ingested pls has not been thoroughly investigated and many mechanisms remain to be clarified . However, it has been shown that, unlike tgs, they are almost completely absorbed as free fatty acids (ffas) and lpc in the intestine . Following absorption, they are reesterified into pls and incorporated mainly into chylomicrons to enter the bloodstream . Also, about 20% of the ingested pls are absorbed passively and incorporated directly into high density lipoproteins (hdl). Additionally, other investigations with the same mpl formulation have found positive effects, for example, in the study of taylor et al . Patients with tumour associated weight loss (cachexia) achieved weight stabilization after mpl supplementation . These effects seem to be larger when compared to formulations of n-3 fa bound only to tgs . Therefore, supplementation with mpl is expected to be more effective in a relatively lower dose than fish oil or ethyl ester formulations regarding eicosanoid synthesis and its implications . In a previous study, a daily dose of 1.5 g mpl was shown to be enough to considerably change the n-3/n-6 fa ratio, while a study supplementing fish oil had similar effects, but with double the dosage (3 g n-3 fas daily). The prostagen study (registration i d: drks00000319 and utn: u1111 - 1113 - 4482) was a cohort clinical trial in which patients with prostate cancer (pca) and subjects without cancer (control group) were supplemented with marine phospholipids extract (mpls). The clinical trial was designed based on the primary outcome of the study, which is not going to be addressed in this paper . Here, we describe the results of the trial in relation to the effects of mpl supplementation on the lipid and fa levels on the study population (secondary outcomes). The study population consisted of patients with prostate cancer (pca) and subjects without pca . Patients were identified and recruited in freiburg in three different centres, at the department of medical oncology at the tumor biology center, the urological ward in the loretto hospital and the urological practice u3 for a period of 23 months between december 2009 and october 2011 . Pca patients were included with various cancer stages, receiving different therapies, for example, surgery, radiation, hormone therapy, chemotherapy, or active surveillance . A total sample size of 150 patients (50 patients without pca, 50 patients with pca and gleason score 7a, and 50 patients with pca and gleason score 7b) was calculated according to the primary endpoint of the study . Inclusion criteria for pca patients were male subjects older than 18 years with histologically proven pca and who signed a written informed consent . Inclusion criterions for subjects without pca were male subjects without pca or any other tumour, aged 70 years or older (according to the american cancer society, the median age of pca diagnosis is 66 years . In order to comply with the certainty (needed for analyzing the primary endpoint of the study) that patients without pca would not become pca in their remaining lifetime, patients without pca were to be 70 years or older . However, this risk was taken, since it does not affect the primary endpoint of the study . ). Pca diagnosis was defined as being excluded by the following criteria: (1) negative results from a 12x prostate punch biopsy and psa values below 10 ng / ml; (2) individuals with benign prostatic hyperplasia (bph), who had a transurethral resection of the prostate (tur - p) and reported histological negative results; or (3) individuals without pca diagnosis and with psa levels less than 4 ng / ml and no family history of prostate cancer . Subjects were excluded from this study if they had a known allergy to seafood, malabsorption, impaired coagulation, or other severe internal diseases, psychiatric or disorders of the cns, and subjects who were already taking supplementary n-3 fas . It is a salmon roe extract consisting of 29% phosphatidylcholine and approximately 70% neutral lipids . The n-3 fa profile is 18% eicosapentaenoic acid (epa) and 26% docosahexaenoic acid (dha) bound to pls and neutral lipids . It is formulated in soft gelatine capsules (500 mg / capsule), providing 223 mg epa and 256 mg dha daily (1/3 as pls and 2/3 as tgs). Participating subjects were asked to take one 500 mg capsule mpl (vitalipin) three times a day with their meals for a period of 3 months . Each subject received a patient diary in which capsule intake and fish consumption were to be documented weekly . Were surveyed for their nutritional habits (including their fish consumption), medical family history, current medication, and/or intake of supplements . Blood samples were collected for blood routine analysis, lipid electrophoresis, and plasma fa analysis . Blood samples were collected from each included subjects before and after mpl supplementation for determining blood parameters, fa analysis, and lpc analysis . Blood parameters were determined after collecting edta blood samples (1 s - monovette 2.7 ml with 1.6 mg edta / ml blood, sarstedt, nmbrecht, germany) and 1 serum tube (1 s - monovette 9 ml, sarstedt, nmbrecht, germany) before and after mpl supplementation . The following parameters were determined: prostate specific antigen (psa), c - reactive protein (crp), aspartate transaminase (ast), alanine transaminase (alt), cholinesterase (che), albumin, leukocytes, thrombocytes, triglycerides, total cholesterol, very low density lipoproteins (vldl), low density lipoproteins (ldl), and high density lipoproteins (hdl), which were determined in the clinical chemistry routine laboratory according to standard procedures . For fa analysis blood samples were collected in edta tubes (1 s - monovette 9 ml with 1.6 mg edta / ml blood, sarstedt, nmbrecht, germany) and centrifuged for 10 min at 2000 rpm at room temperature, the resulting plasma was stored in aliquots of 500 l at 80c until analysis . After lipid extraction of blood plasma with the methods of bligh and dyer (extraction with chloroform / methanol), the total lipid fraction was separated into two fractions with solid - phase extraction (spe, over an aminopropyl column), namely, the phospholipids and the neutral lipids, according to the procedure validated and described by taylor et al . . Afterwards, fa analysis was performed with gas chromatography (gc) according to taylor et al . . Gc analysis required derivatization; therefore all fractions were previously methylated with tmsh (macherey & nagel, dren, germany). Analysis was performed with a hp 5890 series ii plus, equipped with an agilent technologies (bblingen, germany) db-23 column (30 m, 0.25 mm i d, 0.25 m) with helium at 1 ml / min, oven temperature programming starting with 150c for 3 min, up to 220c with a rate of 5c / min, 220c for 3.5 min, split injection (1: 100), injector temperature 260c, and fid at 280c . Lpc analysis was performed with high performance thin layer chromatography (hptlc) after lipid extraction (as mentioned above) from blood plasma according to the method described by taylor et al . . The plasma samples and five calibration standard solutions of lpc (ranging from 80 to 400 m, sigma, steinheim, germany) were dissolved in nacl aqueous solution and extracted with chloroform / methanol . Dry extracts (plasma and calibration standard solutions) were dissolved in hexane / isopropanol / h2o and applied to a preconditioned hptlc plate (merck, darmstadt, germany) with the camag automatic sampler tlc iii . After development, plates were dried and stained with a copper sulfate / phosphoric acid solution . Quantification was performed with a camag tlc - scanner ii equipped with a tungsten bulb at 530 nm . Student's t - test and one - way analysis of variance (anova) were performed if data were normally distributed; otherwise mann - whitney u test and kruskal - wallis one - way anova on ranks were used . The recruitment totalled 159 subjects, out of which 124 finished the study (figure 1 and table 1). The results presented hereafter are based on a per - protocol analysis (n = 124). Most pca patients had a transurethral resection of the prostate (tur - p) or a radical retropubic prostatectomy (rrp) and were in remission after surgery . Subjects without pca had mainly benign prostate hyperplasia (bph) and were recruited also after surgical intervention (mainly tur - p, which confirmed the absence of pca). Since the control subjects had to be at least 70 years old to comply with the inclusion criteria, they had a slightly higher median age than patients . For the analysis of results, subjects were grouped according to their diagnosis taken from their medical records (figure 2). The first group included patients with active pca (n = 38), which were further divided into patients with metastasized pca (n = 18) and localized pca (n = 20). In both, metastasized and localized pca, the tumour was growing and patients were subjected to tumour therapy . The second group of subjects was defined by patients with inactive or no pca (n = 76), including patients with pca in remission in most cases after surgery and patients under active surveillance or without therapy in the past 6 months (n = 45), and subjects without pca (n = 31). The third group included subjects for whom the medical condition could not be clearly defined (n = 10, most of this patients did not agree to undergo further diagnosis) and were therefore not considered when analysing differences between the groups of subjects; otherwise, all subjects were included into the analysis . It is important to mention that psa values are to be evaluated with reservation, since most patients underwent surgery during the intervention . Besides the fact that many factors influence psa values, the significant decrease observed during this study (table 2) since most subjects had surgery a few days before study enrolment, their inflammatory markers like crp were elevated before mpl supplementation . Its normalization (decrease) observed after the intervention should not be attributed to mpl supplementation but rather to the usual decline after surgical intervention . Each subject's nutritional habits were determined before and after mpl intervention, including their regular consumption of meat, butter, fish, cheese, eggs, and vegetable oil (quantities of each food product were grouped in> 2/week, 1 - 2/week, 1 - 2/month, or no intake at all . Only the following fish products (due to their high n-3 fa content) were considered: salmon, herring, tuna, and mackerel . ). The reported nutritional habits confirmed the assumption of the low fish intake in the south - western region of germany . According to other studies analysing fish consumption (e.g., augustsson et al . ), we defined a high fish intake as 3 portions of fish per week . The intake of food products was analysed in relation to the lipid and fatty acid level, without finding any significant associations . Ten subjects (8%) reported fish - oil belching from time to time, which caused no discomfort, and only 11 subjects (9%) occasionally had fish - oil taste after mpl ingestion . Other effects which might be related to mpl supplementation were fish - oil smell in urine and/or stool (2 subjects, 1.6%), bloating and stomach discomfort (2 subjects, 1.6%), reduced coagulation (coagulation parameters were not measured during the study . (2 subjects, 1.6%), general fish - oil smell (1 subject, 0.8%), and improved male potency (1 subject, 0.8%). It was not possible to draw blood samples in a fasting state since subjects were mostly recruited after having breakfast . Since triglycerides and vldl are sensible to food intake, the values are not shown . The study population had normal median cholesterol levels before mpl supplementation (cholesterol reference values according to the dgff (lipid liga) e.v . ). Differences on the initial values of cholesterol were analysed in the groups of subjects revealing no significant differences . Subjects taking lipid lowering medication (about 38% of subjects) had significantly lower ldl initial values than all other participants, whereas hdl remained unaffected . After mpl supplementation, the measured total cholesterol, ldl, and hdl levels increased significantly in the whole study population about 15% (table 3). The change of ldl and hdl levels was not affected if subjects were prescribed lipid lowering medication . Differences in the lipid change between each group of subjects (figure 2) were analysed . The results show that patients with metastasized pca had almost no change in their total cholesterol levels after mpl supplementation, whereas all other patients and subjects without pca had a significant increase . Detailed analysis showed that these differences were found mainly in the ldl fraction of total cholesterol (figure 3). In regard to hdl cholesterol change nine fas in each subject before and after mpl supplementation were analysed (table 4). Since the plasma sample of one patient could not be used for the fa analysis, the results were based only on a study population of 123 subjects . Initial values of fas were analysed between each group of subjects (mentioned in figure 2). As seen in figure 4, initial values of -linolenic acid (ala) were significantly higher in patients with metastasized pca in contrast to all other subjects in both the tg and pl fractions . Dha values in the tg fraction of plasma were also significantly different between the groups of subjects . Patients with metastasized pca had a median relative value of 0.9%, whereas subjects without pca had 0.5% . No significant differences were observed for the initial values of all other fas between the groups of subjects . Table 4 shows the proportion of plasma fas before and after mpl supplementation and their respective relative change . Almost all fa proportions changed significantly with mpl supplementation . From the biologically active n-3 and n-6 fas, epa and dha increased significantly after mpl supplementation in both the tg and pl fractions of plasma, whereas the aa decreased significantly . Therefore, the n-3/n-6 fa ratio improved significantly from 0.38 to 0.58 ((epa + dha)/aa in the tg and pl fractions, with p <0.01) (figure 5). Linoleic acid (la, 18: 2, n-6 fa) and ala (18: 3, n-3 fa), which are precursors of the biologically fas, epa, and aa, were shown to increase significantly (p <0.01) in both the tg and the pl fractions of plasma, after mpl supplementation . Differences on the fa change between each group of subjects (mentioned in figure 2) were analysed, but no significant differences were found . Initial values of lpc were not significantly different between the groups of subjects and had a median value of 181 m . After mpl supplementation lpc increased in the whole study population to 223 m (p <0.001). When observing the lpc change in the different groups of subjects, patients with metastasized pca had a lpc decrease after mpl supplementation, while in all other groups lpc increased . The difference between the group of patients with metastasized pca and all others was significant (p <0.05). During this clinical trial we found that simulating a high fish consumption in subjects with a usually rather low fish consumption by supplying mpl improved the n-3/n-6 fa ratio significantly . Mpl supplementation showed to have a good compliance compared to fish oil supplementation described in other clinical trials . For example, the study of bruera et al ., in which fish oil was supplemented to patients in an advanced cancer stage, showed to cause multiple gastrointestinal problems with an even lower dose . Besides the mpl - induced increase of the n-3/n-6 fa ratio in all study groups, significant differences on the ldl and lysophosphatidylcholine (lpc)increase between the groups of subjects were observed . Patients with metastasized pca / active pca did not show the ldl and lpc accumulation, which was present in all other groups, probably due to a higher demand of the metastasizing tumour cells for these lipids . Another significant difference between both groups of subjects was found in the initial values of ala, possibly due to a higher eicosanoid biosynthesis from n-6 fa . To our knowledge until today, there is no evidence showing that actively growing pca cells have a higher ldl uptake, but there are clues that ldl plays a role in the development of pca . An in vitro study showed that the growth inhibiting effect of simvastatin on prostate cancer cell lines was prevented when adding ldl . The mechanisms by which ldl could be contributing to pca development remain unclear, but it might be possible that ldl receptors are overexpressed in tumour cells, facilitating its uptake to comply with their lipid demand for proliferation . . Observed in rats that the expression of ldl - receptor - related protein-1 (lrp-1), which is one ldl receptor type, was higher in premalignant lesions compared to normal cells . In general, a higher cholesterol demand by tumour cells has been linked to cancer progression through, for example, increased cellular proliferation, inflammation as well as regulating lipid rafts and thereby affecting signalling pathways of apoptosis . In consequence, hence, our results are in line with studies that showed reduced cholesterol levels in men developing cancer [2628], since tumour cells could be using cholesterol for their survival . The probable higher lpc uptake by metastatic tumour cells observed during our study corresponds with in vitro experiments showing that metastatic tumour cells rapidly catabolize lpc as well as incorporate it into their cellular membranes, thereby changing its membrane fa composition . Also, raynor showed that pca cell lines (pc3, du145, and lncap) had a higher lpc incorporation and metabolism than normal cells . During clinical trials, it was found that lpc levels were decreased in patients with an advanced cancer disease and in patients with colorectal cancer . Thus, the probable high lpc demand of aggressively growing tumour cells would explain the missing lpc increase observed in the group of patients with metastasized pca . However, it would have been consistent if lpc values before giving mpl were also lower in metastasized pca patients when compared to all other subjects, but no differences were observed before intervention . An explanation could be that all subjects had already low lpc values (181 m, normal values range from 200 to 400 m [3235]). It has been shown that eicosanoid synthesis from pufas is increased in tumour cells and that the relative proportion of n-3 and n-6 pufas in the cellular membranes is one factor which determines the types of eicosanoids that are generated . The n-6 fa aa has been described to be implicated in the development of cancer and also of metastases through the synthesis of series 2 eicosanoids, especially of pge2 [5, 6, 37]. With the results of this study we speculate that during metastasis an increased conversion of aa to eicosanoids takes place, since the values of -linolenic acid (ala) before mpl supplementation were higher in patients with metastasized pca compared to all other subjects . This finding supports the assumption that metastasized / active tumour cells consume more n-6 fas than n-3 fas, resulting in accumulation of the n-3-fa ala, which is the precursor of the n-3 fa epa . In concordance with this finding, lower initial values of the n-6 fa linoleic acid (la, precursor of aa) would have been expected in patients with metastasized pca as a consequence of a higher aa demand . While in other studies reduced proportions of la have been found in cancer patients in comparison to healthy individuals in this study no differences could be observed between the groups of patients . One explanation might be that due to the usually high aa intake in the western diet of all study participants, an increased conversion of la to aa might not be required to fulfil the needs of the metastatic tumour cells . In addition, la blood concentration is much higher than that of ala (la / ala in pl is approximately 80, in tg approximately 34) and, thus, a possible small reduction of la in relation to its high values cannot be clearly observed . Based on our results, a hypothesis is proposed (figure 7) which helps to explain the prevention of metastatic tumour growth in more than 40% of pca patients that have high fish consumption, which was shown in different clinical trials [2, 3]. From our data we assume that aggressively growing pca cells developed the ability to take up high amounts of ldl and that during metastatic transformation those cells developed the additional property to take up and metabolize high amounts of lpc (figure 6). Thus, ldl and lpc are expected to especially supply metastatic cancer cells with high amounts of fas . Depending on which kind of fas are predominantly contained in the diet (western diet: rich in n-6 fas versus fish diet (or mpl): rich in n-3 fas), the fa composition of ldl and lpc will be modulated accordingly . Therefore, we assume that the diet influences the n-3/n-6 fa ratio especially in metastatic tumour cells, influencing thereby whether cells synthesize either pro- or antimetastatic eicosanoids . Ldl and lpc could be regarded as trojan horses, which become only dangerous to the metastasizing tumour cells if they were previously enriched with n-3 fas . Patients, who respond to either western diet or fish diet with an increase in ldl and lpc, containing the respective pro- or antimetastatic fa, are therefore considered as omega - sensitive . Taken together mpl supplementation was shown to be effective in increasing the n-3/n-6 fa ratio significantly, with a very good compliance at the same time . With our results we could assume that active / metastatic tumour cells have an influence on the ldl and lpc levels, probably due to a higher demand of these lipids . Influencing the fa composition of ldl and lpc towards a higher n-3/n-6 fa ratio could convert ldl and lpc particles into trojan horses, having the potential to influence the n-3/n-6 fa ratio of tumour cells and thereby reduce the biosynthesis of proinflammatory eicosanoids . If the results of this clinical trial could be confirmed with further investigations, a high fish intake is recommended to pca patients, since it was shown that 4050% of patients profit from this diet to impede metastatic development . If achieving high fish consumption is not possible, mpl showed to be an efficient alternative in delivering n-3 fas . These results warrant further studies to confirm the effects of an n-3 fa increase in relation to pca development.
The pelvic floor muscle (pfm) is known to support the pelvic organs and contribute to the locking mechanism of the urethra and anus, adjusting incontinence, and it has recently been found to perform diverse functions, such as stabilization of the lumbopelvic girdle and spine, and postural adjustment . They also support the ventilation and adjustment of incontinence in the urinary bladder1,2,3,4,5 . The pfm supports trunk stabilization by adjusting or responding to abdominal pressure in cooperation with the muscles surrounding the abdominal cavity1, 2, 6 . Abdominal hollowing training for stabilizing the lumbo - pelvic region, pulls the abdominal wall toward the inside of the lower abdomen, contracting the transversus abdominis (tra), and it provides effective stabilization training7 . Neumann and gill6 reported that contraction of the pfm prompted activation of the tra and internal oblique muscle (io), and also raised the abdominal pressure by 6 mmhg . Kim ha - ru8 reported that there were significant changes in the thickness of the tra and io during contraction of the pfm, but electromyography showed there was a significant difference only in the io when the was pfm contracted . Kim bo - in1 noted that when the vaginal pressure increased, there was a significant difference in the thickness of the tra . Critchley9 observed that there was a more significant difference in the thickness of the tra when contraction of the pfm was made together with the abdominal hollowing motion than when only the abdominal hollowing motion was conducted . These study results show that contraction of the pfm promotes activation of the tra, a deep muscle . However, the pfm is not often used in daily life, and therefore performance of appropriate exercises and precise contraction of the muscle is very difficult . As a measure to resolve such problems for women with urinary incontinence and cystocele, biofeedback using ultrasound is being used to visualize the contraction of the pfm, to provide precise and immediate visual feedback to subjects10 . Nevertheless, no research has analyzed the effects of precise pfm contraction on abdominal muscles . Therefore, the purpose of this study was to verify whether precise contraction of the pfm using visual feedback actually affects the thickness of the abdominal muscles . The subjects were 29 adults in their 20s who consented to participate in this study . They had no history of neurological or muscle lesions within the previous six months . This study was approved by the ethics committee of the catholic university of pusan . First, the thicknesses of the external oblique muscle (eo), io, and tra were measured with the subjects lying in a supine position at rest . After a 10-minute rest, the subjects were instructed to contract the pfm in an ordinary way during the hollowing motion, and then the thicknesses of their abdominal muscles were measured . In order to exclude a carry - over effect, the thicknesses of the abdominal muscles were measured as the subjects contracted the pfm while watching a visual feedback video the next day . The subjects were instructed to tighten the internal muscles of the pelvis, as if to hold in urine, and slowly pull and raise them internally . However, they were not instructed to induce or prevent the utilization of the abdominal muscles6 . To provide subjects with accurate visual feedback, a convex ultrasound probe was positioned, with the angle between the abdomen and the probe at 10 (esaote europe b.v ., netherland), from 5 cm above the symphysis pubis, and visual feedback was given by casting the probe on the perineum . Changes in imaging during the contraction of the pfm were explained, and the subjects were taught how to contract the pfm . For the abdominal hollowing motion, a stabilizer (chattanooga group inc ., usa) was used in order to minimize the contraction of the io and eo and to trigger selective contraction of the tra . Ultrasonic diagnostic equipment (sonoace x4, korea) was used to measure the thickness of the abdominal muscles . The thicknesses of the external oblique abdominal, the internal oblique abdominal, and the transversus abdominis muscles were measured at the end point of expiration3 . They were measured in an anteromedial direction using a linear probe (7.5 mhz) at the middle, between the iliac crest and the eleventh rib on the right side of the subjects12, 13 . One - way analysis of variance was employed in order to compare the thicknesses of the abdominal muscles under the three different conditions . General characteristics of subjects (n=29)mean sdgender (m / f)29 (13/16)age (yrs)23.22.7heights (cm)167.27.6weights (kg)61.011.3 . There were no statistically significant differences in the eo and io between the measurements taken at rest and during the contraction of the pfm, and between those taken at rest and during the contraction of the pfm with visual feedback (table 2table 2 . Comparison of abdominal muscle thicknesses under the different conditions (n=29)musclerestpfmc + ahfeedback pfmc + ahexternal oblique0.680.200.650.160.620.11internal oblique0.530.150.630.090.580.25transverse abdominis*0.310.090.510.150.480.21pfmc: pelvic floor muscle contraction, ah: abdominal hollowing . : rest vs. pfmc,: pfmc vs. feedback pfmc,: feedback pfmc vs. rest). Rest vs. pfmc,: pfmc vs. feedback pfmc,: feedback pfmc vs. rest according to the post hoc test result, there were significant differences in the tra between the measurements taken at rest and during the contraction of the pfm, and between those taken at rest and during the contraction of the pfm with visual feedback . In particular, the thickness of the tra was highest during the contraction of the pfm without visual feedback (table 2). According to the results of the present study, there were no significant differences in the thicknesses of the eo and io during contraction of the pfm between rest and with and without visual feedback when the subjects conducted the abdominal hollowing motion . The tra thickness increased more during the contraction of the pfm without visual feedback than during the precise contraction of the pfm with visual feedback . In a study where subjects were instructed to contract the pfm lightly, at a moderate intensity, and at a strong intensity, reported that the thickness of the tra and io increased as the contraction intensity increased, but that there was no change in the thickness of the eo14 . This result is similar to the results of our present study, in that the contraction rate of the tra was higher during the contraction of the pfm without visual feedback . Critchley2 compared subjects that conducted abdominal hollowing only and those that contracted the pfm in a crawling position, and reported that the thicknesses of the eo and io decreased, but that the thickness of the tra increased during abdominal hollowing compared to the at - rest measurements . This result is similar to that of the present study, in that the thickness of the tra showed a statistically significant increase under both contraction conditions . However, critchely2 noted that because precise contraction of the pfm was difficult when subjects conducted the hollowing motion and contracted the pfm at the same time, there was a possibility that movement of the pfm did not occur or that subjects concentrated more on the contraction of the deep abdominal muscles drawing in the lower abdomen than on the contraction of the pfm . This could explain our result, that the thickness of the tra increased less during the precise contraction of the pfm with visual feedback than during the contraction of the pfm without visual feedback . Due to the pfm s anatomical location and structure, it is hard to voluntarily conduct precise contraction of the pfm . This may result in the iliacus muscle, the abductor muscle inside the hip joint, and the abdominal muscles, in particular the tra and the io, contracting together, rather than a contraction of the pfm9, 15 . Therefore, we presume that when subjects conduct the hollowing motion without precisely performing the contraction of the pfm, they concentrate on the contraction of the deep abdominal muscles, such as the tra, which affects the thickness of the tra . This study verified that there is an increase in the thickness of the tra during pfm contraction, but that the increase in the thickness of the tra was smaller during the contraction of the pfm with visual feedback . We speculate that this is likely because the precise contraction of the pfm decreases mobilization of the deep muscles reducing the simultaneous contraction rate of the tra . Training to strengthen the pfm may be an effective exercise for improving continence . However, if the purpose is to strengthen the tra simply for the stabilization of the lumbopelvic girdle, hollowing with visual feedback is not an efficient exercise method for the pfm.
The number of patients with ulcerative colitis (uc) has been increasing in japan, and recently, colitis - related cancer has attracted much attention (1 - 3). The risk of developing cancer is higher in patients with long - term morbidity due to uc . We experienced a rare colonic tumor that was difficult to differentiate from cancer in a patient with long - standing uc . A 51-year - old woman who had been experiencing frequent bloody mucosal diarrhea was diagnosed with uc involving the entire colon in 1978 . Since the diagnosis, she maintained a state of remission for 30 years with while only being adminstered oral 5-aminosalicylic acid . Surveillance colonoscopy was regularly performed, and an elevated tumor measuring 15 mm in diameter with a small ulceration was noted in the descending colon in july 2011 (fig . 1). Colonoscopy shows an elevated tumor with an unclear boundary and small ulceration in the descending colon . We performed biopsies of the tumor, including a boring biopsy, but all biopsy findings demonstrated mildly inflamed colonic mucosa with regenerative changes . Neither any neoplasm nor dysplasia was detected . The laboratory blood test showed no abnormalities, including tumor marker levels, such as carcinoembryonic antigen and carbohydrate antigen 19 - 9, except for a slight elevation in the c - reactive protein level (1.4 mg / dl). The tumor gradually progressed to resemble type-2 cancer after 14 months of observation (fig . 2). Abdominal computed tomography images revealed a tumor measuring from 20 - 30 mm in diameter in the descending colon, but no enlarged lymph nodes or metastases were detected . Endoscopic ultrasonography revealed that the tumor was located mainly in the submucosal layer, and the muscle layer was compressed (fig . We considered the possibility of colitis - related cancer and recommended surgical resection, but the patient rejected this . A pathological examination detected no cancer cells, despite the continued growth of the tumor after 18 months (fig . A contrast enema showed a smoothly elevated lesion with a central depression in the descending colon . Endoscopic ultrasonography shows a tumor of the submucosal layer, and the compressed muscle layer (a). The tumor demonstrates growth similar to type 2 cancer (b). In march 2013, the patient finally agreed to undergo surgery and received a laparoscopic partial resection of the descending colon . The gross appearance and low - power magnification of the specimen showed a protruded transmural tumor with ulceration (fig . The tumor was mainly composed of spindle cells having eosinophilic cytoplasm and cigar - shaped nuclei with a blunt end (fig . Immunohistochemical staining was positive for the conventional smooth muscle markers of -smooth muscle actin and desmin, and entirely negative for c - kit, dog-1, cd34, and s-100 (fig . The background colonic mucosa was edematous and accompanied with mild to moderate chronic inflammatory cell infiltration . After surgery, no recurrence or metastasis has been detected thus far (october 2015). The elevated tumor which resembles type-2 cancer measures 4.03.2 cm in size (a). Low - power magnification of the specimen stained with hematoxylin and eosin staining (h&e, 1) showing the transmural tumor with an ulcerated superficial mucosa (b). Pathological examinations of the tumor mainly composed of spindle cells having eosinophilic cytoplasm and cigar - shaped nuclei with a blunt end (hematoxylin and eosin staining, 200). Immunohistochemistry showing that the tumor is positive for -smooth muscle actin (a) and desmin (b), and negative for c - kit (c), dog-1 (d), cd34 (e), and s-100 (f) (40). Patients with uc are known to be at an increased risk of developing colorectal adenocarcinoma; however, non - epithelial malignancies are uncommon . Among non - epithelial tumors associated with inflammatory bowel disease, there have only been two reported cases of lms in uc (table) (4,5) and five cases of sarcomas associated with crohn's colitis as far as we searched pubmed with term inflammatory bowel disease and leiomyosarcoma . The two reported cases of lms in uc showed active colitis, uncontrolled bleeding, and polypoid tumors . Our case had minimal activity of uc with no symptoms and a tumor with a type-2 cancer - like appearance . The recent classification of mesenchymal tumor differentiates lms from gastrointestinal stromal tumors as a newly defined disease entity . Agaimy and wnsch reported only three cases (1.1%) of lms among 262 cases of gi mesenchymal lesions at their institution during a 12-year period (6). Yamamoto et al . Clinicopathologically reviewed 55 reported cases of lms in the gi tract, and found 25 small intestinal, 21 large intestinal, 5 gastric, and 4 esophageal tumors (7). The association of lms with uc is not described in these papers, and its exact incidence is unclear . However, chronic inflammation is suggested to be a risk factor for testicular lms in some case reports (8 - 11), and further study may thus be needed to reveal the causal relationship between lms and chronic bowel inflammation . The differential diagnosis for lms must include submucosal tumors such as lymphoma, gastrointestinal stromal tumor (gist), and inflammatory fibroid polyp (12). The endoscopic findings of lymphoma and gist are varied, but a pathological diagnosis may be possible with an appropriate biopsy . Inflammatory fibroid polyps form erosion and ulcers in the elevated mucosal surface and show an onion skin appearance on biopsy . Metastatic tumors of the colon that are most often found in gastric cancer and endometriosis that can occur in the rectum and sigmoid colon are rarely associated with an ulcer . An accurate diagnosis of submucosal tumors by biopsy is often difficult, and as a result, surgery is needed . Pre - neoplastic lesions and invasive cancers associated with uc usually develop as multiple and superficially extended lesions called dysplasia - associated lesions or masses (dalm) (13), and patients with cancer or dalm are recommended to undergo prophylactic proctocolectomy with an ileoanal pouch (14). The endoscopic findings of uc - related neoplasias are so varied that morphological classification is difficult (15). A retrospective multi - institutional questionnaire survey (16) found reddish and elevated tumors with obscure boundaries in 70% of patients with uc - related neoplasias . In the present case, however, the boundary of the tumor was clear, and neither dysplasia nor cancer was observed in the biopsy specimens . Therefore, we performed a partial colectomy and could correctly diagnose the lms by a detailed pathological examination . The reported clinical features of lms in the gi tract are polypoid and intramural types that can arise from either the muscularis mucosae or propria (6,17 - 19). Grossly, they resemble type-2 cancer, presenting with elevated and ulcerated tumors with transmural involvement (7), as was observed in this case . In most cases, the endoscopic and radiologic features are nonspecific; therefore, it is difficult to diagnose lms preoperatively (20,21). Lymphogenic spread is rare, and it is unnecessary to perform lymph node dissection for this tumor (6,18). Neighboring tissue invasion and liver metastases are common, and the prognosis of lms is generally poor . Tumor larger than 5 cm in size significantly correlate with a shorter overall survival time (7). Our patient had a tumor measuring less than 5 cm in size and no metastasis, and she has survived with no recurrence for 2.5 years after surgery . We herein reported a case of colonic lms in an uc patient that was difficult to differentiate from a colitis - related cancer . Although its incidence in association with uc appears to be extremely rare, the possibility of lms should be considered when a nonspecific tumor with repeatedly cancer - negative biopsy findings is found.
In all communities, health has been identified as a fundamental right of every one and the governments are responsible to satisfy it (1). Easy and inexpensive access of patients to health care centers is considered as one of the most important criteria of evaluating the health care system (2). The health care systems in many countries are trying to achieve three objectives of reducing the share of people in health expenditures, improving health and ensuring high quality services (3). Since many years ago, the need to provide quick and easy access to basic health needs was felt by iran s health authorities, who implemented different projects such as worker training, health plan, and the rezaieh plan aimed at ensuring the population had access to basic health needs (4). Lessons learnt from these projects coupled with the who s alma - ata declaration in 1978, which put the health for all by the year 2000 in the who s country members agenda, accelerated iran s health network design (4). According to iran s health network, health houses and (rural and urban) health centers are considered as the first level of providing health services with close contact with people (5). Evidence shows that effective primary health care had many advantages such as improving health - care outcomes, reducing health gaps, improving equitable access to care and ensuring quality care with lower costs (6). After a period of relative ignorance, in recent years, interest and reconversion has risen to primary health care, especially in low and middle - income countries (7). According to a world health report in 2008, the society s response to the challenges of primary health care is not satisfactory due to failure to mobilize resources, undue concentration on specialist hospital care, and scattered and heterogeneous health systems (8). Typically, the effectiveness of primary health care is evaluated by its contribution to the achievement of health system goals such as better health, fair access to services, accountability and financial protection . However, today s health systems, even in the most developed countries, are failing in achieving these objectives (9). With changing demographic and epidemiological factors changing people s expectations and level of education, especially literacy and expectations of rural women, change in people s views about the quality of provided services, as well as the fact that, iran s health network system was developed almost three decades ago, there is need to change existing technologies, and financial pressure to the government to meet the needs of the growing necessity to review the structure, quality and quantity of services provided, and the revision of the process of providing health services in iran s health houses (10). Therefore this study is aimed at identifying challenges of health houses and to provide solutions to overcome them . The present study was a qualitative study using a phenomenology approach which was carried out at nationwide during 12 months from february 2015 to february 2016 . The study population included policy makers, experts of the ministry of health, scholars and experts involved in the primary health care system in the country, heads of medical universities, authorities and health assistants in the provinces and physicians, health workers and the clients in the cities . Purposive sampling methods through criteria such as having key information in the field of primary health care (especially health houses), and having at least 5 years executive experience in the field of health, was used to identify informant participants and to achieve a more informed sample, and was completed by the snowball sampling method . Sampling was continued until it reached data saturation i.e. The point when no new information was expressed by new participants . Qualitative data were collected through semi - structured and in - depth interviews and holding expert panels . The colaizzi method was used, which is mostly related to phenomenological qualitative data analysis studies . It includes seven stages of familiarization with the general concepts of: extracting important statements and determining key areas (themes), formulating concepts and central statements, themes and categorization of main concepts and explaining themes, being the main structure extraction, and validation of study . All these steps were done manually by the researcher and without the use of special software . The number of interviewees was 24, and of this number, 19 persons were men and 5 persons were women . The average age of respondents was 45 years, and the average experience in the field of administration and management was 20 years . The creation of new government initiatives in the field of health, and the creation of applications injected into the healthcare system, may increase the expectations of society to receive better quality services . The core axis consists of two sub - axes as follows: the mismatch of services quality with educational level of health workers the relevance of quality of service with clients expectations . Health workers should upgrade their education, and must be updated on iran s health houses of the quantitative and qualitative terms, (because of the major changes that have occurred during the past three decades), manpower is one of the main challenges for iran s health houses . It also includes four sub - axes, as follows: 1) the mismatch of human resources with manpower, 2) conflict between work life and family life of health workers, 3) lack of motivation and job promotion for health workers, 4) acceptance rate decline and demotion of health workers in the community . A number of interviewees in this regard stated: from a quantitative point of view, the number of services that are being offered at iran s health houses has increased, but is not defined according to human resources, and it is in need of review in the discussion of manpower in iran s health houses in this regard, unfortunately, iran s health houses have received little attention and do not have enough facilities . The main axis also has three sub - axes as follows: physical space, technology, equipment . Measuring instruments do nt have the necessary quality, and have a short shelf - life (m 3) it is considered as one of the important principles of phc to the success of iran s health houses, it also has three sub - axes, which are as follows: 1) support by insufficient upstream references, 2) the weakness of inter - sectorial relationship, 3) the weak collaboration between different parts . We travel there from a long distance and there might not be supervisor, or they do not have time, and have no time for health workers, subsequently health house work may be delayed . (may 13). In recent years, issues such as: epidemiological transition, demographic transition and an aging population, along with the incidence of non - communicable diseases, the increasing trend towards urbanization have faced iran s health houses with basic challenges . This also includes two - axes, which are: 1) migration from rural to urban areas, 2) increasing levels of education and expectations . Interviewees in this regard expressed their statements as follows: the problems of iran s health houses are related to increasing number of health workers who want to migrate to the city to have access to better facilities day after day, the literacy of our population has increased and our expectations have increased, but in the past, since people did not have much information, their expectations were less, but over time, their expectations have increased the creation of new government initiatives in the field of health, and the creation of applications injected into the healthcare system, may increase the expectations of society to receive better quality services . The core axis consists of two sub - axes as follows: the mismatch of services quality with educational level of health workers the relevance of quality of service with clients expectations . Health workers should upgrade their education, and must be updated on iran s health houses of the quantitative and qualitative terms, (because of the major changes that have occurred during the past three decades), manpower is one of the main challenges for iran s health houses . It also includes four sub - axes, as follows: 1) the mismatch of human resources with manpower, 2) conflict between work life and family life of health workers, 3) lack of motivation and job promotion for health workers, 4) acceptance rate decline and demotion of health workers in the community . A number of interviewees in this regard stated: from a quantitative point of view, the number of services that are being offered at iran s health houses has increased, but is not defined according to human resources, and it is in need of review in the discussion of manpower in iran s health houses in this regard, unfortunately, iran s health houses have received little attention and do not have enough facilities . The main axis also has three sub - axes as follows: physical space, technology, equipment . Measuring instruments do nt have the necessary quality, and have a short shelf - life it is considered as one of the important principles of phc to the success of iran s health houses, it also has three sub - axes, which are as follows: 1) support by insufficient upstream references, 2) the weakness of inter - sectorial relationship, 3) the weak collaboration between different parts . We travel there from a long distance and there might not be supervisor, or they do not have time, and have no time for health workers, subsequently health house work may be delayed . (may 13). In recent years, issues such as: epidemiological transition, demographic transition and an aging population, along with the incidence of non - communicable diseases, the increasing trend towards urbanization have faced iran s health houses with basic challenges . This also includes two - axes, which are: 1) migration from rural to urban areas, 2) increasing levels of education and expectations . Interviewees in this regard expressed their statements as follows: the problems of iran s health houses are related to increasing number of health workers who want to migrate to the city to have access to better facilities day after day, the literacy of our population has increased and our expectations have increased, but in the past, since people did not have much information, their expectations were less, but over time, their expectations have increased (ad 7). The results show the challenges and major problems of the iranian health houses in different aspects . Major challenges include challenges related to the quality of health services provided at health houses, the challenges related to manpower, challenges related to equipment, technology and financial resources, inter - sectorial and intra - sectorial relations, and challenges related to the underlying infrastructure . Based on the findings of interviews with experts, issues such as the promotion of education and the expectations of society have led to the dissatisfaction of referrers with the quality of services provided in health houses . Since network system design and iran s health houses are related to three decades ago, and at that time, education level and knowledge of the rural population was low, currently, the quality of health services provided at iran s health houses, in some cases are not responsive to the expectations of visitors . Mohammad alizadeh et al ., in 2010, studied the barriers related to high quality primary health care services in a metropolitan area in iran, using the perspective of public health care service providers . The low quality of primary health care, resulting in employee dissatisfaction arose as factors outside of their control and organizational barriers; in fact, this study highlights the role of training staff in providing high quality primary health care services (11). In terms of manpower, one of the challenges mentioned by experts in this field is the issue of population migration . Now, for reasons such as lack of amenities in the countryside, as well as the tendency of people to urbanization, most of the villagers migrate to the city . Davoudi et al ., in 2007, in an article entitled introduction to the health care system identified the shortage of people who manage these systems as the most critical issue facing health care systems . Health systems based on primary health care must deal with the key challenges in the field of maintaining the man power, information management, financing in the health sector and fair production - and with emphasis on manpower as a key factor, must take necessary measures to achieve the goals of health system (12). In terms of infrastructures, major problems in three areas of equipment, technology and physical space are proposed . Based on interviews, investment in the health sector has been inadequate, and there has not been enough attention to this area . Regarding the challenges and problems in the field of equipment, most interviewees believed that equipment was basic and inexpensive for iran s health houses, and home health, because first contact level, and the first referral level in the network, does not require complex and expensive equipment . However, existing worn and old equipment, or lack of some equipment are the main issues and challenges in this field, which requires attention and management . Samir et al ., in a study entitled challenges and opportunities related to integration of primary health care information system: the northern state of sudan in 2010 showed that primary health care information system plans are inadequate and ineffective to provide quality information to support the managers in the decision making process . The main problems of the system include lack of proper infrastructure, lack of skilled specialists, working in parallel, lack of coordination, a lack of supervision and support, and feedback to lower levels, which are effective in the poor performance of the system (13). According to the opinions of experts, weak oversight, poor referral systems, a poor reporting system, lack of psychological support and adequate support of upstream references, and the absence of adequate feedback to health workers are considered as the main challenges and problems in the field of inter - sectorial relations . Mahryar, in an article titled primary health care and poor villages in the islamic republic of iran in 2004 introduced the most important challenges and problems facing the iranian health houses as follows: lack of adequate support for secondary and tertiary levels of health houses, lack of adequate government support of iran s health houses in the physical space and equipment, the lack of an integrated policy in connection with private sector units and centers of training health workers, and the lack of a stable mechanism to improve the quality of services (14). Lack of timely cooperation with the concerned authorities, and other organizations with health workers, and lack of timely follow - up and implementation of reported cases are the most important challenges mentioned in this field . In a study conducted by asadi primary health care experiences in iran, the list of challenges on the primary health care system is presented (15). The distribution pattern and population distribution, and the climatic and geographical conditions of the country, increasing trend towards urbanization, education and changing attitudes and expectations of people, lack of sufficient attractions in villages, migration and demographic changes in rural areas, lack of adequate welfare infrastructure facilities in villages, demographic and epidemiological transition, and the changing pattern of diseases are considered as the most important underlying challenges and infrastructure, which the health house has been faced with nekoeimoghadam et al . (2011), study showed that, although primarily healthcare service in iran between 1970 and 1980 is in accordance to the needs of iranian society, changes in the burden of diseases and changes in demand of population has led to the opinion that the desired system does nt have the ability to respond to new needs of the present time . Although, iran s primary health care system to respond has been successful to infectious diseases and maternal and newborn deaths, it seems that, it has been faced with some problems in response to non - communicable diseases (16). Based on the findings of interviews with experts, issues such as the promotion of education and the expectations of society have led to the dissatisfaction of referrers with the quality of services provided in health houses . Since network system design and iran s health houses are related to three decades ago, and at that time, education level and knowledge of the rural population was low, currently, the quality of health services provided at iran s health houses, in some cases are not responsive to the expectations of visitors . Mohammad alizadeh et al ., in 2010, studied the barriers related to high quality primary health care services in a metropolitan area in iran, using the perspective of public health care service providers . The low quality of primary health care, resulting in employee dissatisfaction arose as factors outside of their control and organizational barriers; in fact, this study highlights the role of training staff in providing high quality primary health care services (11). In terms of manpower, one of the challenges mentioned by experts in this field is the issue of population migration . Now, for reasons such as lack of amenities in the countryside, as well as the tendency of people to urbanization, most of the villagers migrate to the city ., in 2007, in an article entitled introduction to the health care system identified the shortage of people who manage these systems as the most critical issue facing health care systems . Health systems based on primary health care must deal with the key challenges in the field of maintaining the man power, information management, financing in the health sector and fair production - and with emphasis on manpower as a key factor, must take necessary measures to achieve the goals of health system (12). In terms of infrastructures, major problems in three areas of equipment, technology and physical space are proposed . Based on interviews, investment in the health sector has been inadequate, and there has not been enough attention to this area . Regarding the challenges and problems in the field of equipment, most interviewees believed that equipment was basic and inexpensive for iran s health houses, and home health, because first contact level, and the first referral level in the network, does not require complex and expensive equipment . However, existing worn and old equipment, or lack of some equipment are the main issues and challenges in this field, which requires attention and management . Samir et al ., in a study entitled challenges and opportunities related to integration of primary health care information system: the northern state of sudan in 2010 showed that primary health care information system plans are inadequate and ineffective to provide quality information to support the managers in the decision making process . The main problems of the system include lack of proper infrastructure, lack of skilled specialists, working in parallel, lack of coordination, a lack of supervision and support, and feedback to lower levels, which are effective in the poor performance of the system (13). According to the opinions of experts, weak oversight, poor referral systems, a poor reporting system, lack of psychological support and adequate support of upstream references, and the absence of adequate feedback to health workers are considered as the main challenges and problems in the field of inter - sectorial relations . Mahryar, in an article titled primary health care and poor villages in the islamic republic of iran in 2004 introduced the most important challenges and problems facing the iranian health houses as follows: lack of adequate support for secondary and tertiary levels of health houses, lack of adequate government support of iran s health houses in the physical space and equipment, the lack of an integrated policy in connection with private sector units and centers of training health workers, and the lack of a stable mechanism to improve the quality of services (14). Lack of timely cooperation with the concerned authorities, and other organizations with health workers, and lack of timely follow - up and implementation of reported cases are the most important challenges mentioned in this field . In a study conducted by asadi et al in 2004, entitled primary health care experiences in iran, the list of challenges on the primary health care system is presented (15). The distribution pattern and population distribution, and the climatic and geographical conditions of the country, increasing trend towards urbanization, education and changing attitudes and expectations of people, lack of sufficient attractions in villages, migration and demographic changes in rural areas, lack of adequate welfare infrastructure facilities in villages, demographic and epidemiological transition, and the changing pattern of diseases are considered as the most important underlying challenges and infrastructure, which the health house has been faced with nekoeimoghadam et al . (2011), study showed that, although primarily healthcare service in iran between 1970 and 1980 is in accordance to the needs of iranian society, changes in the burden of diseases and changes in demand of population has led to the opinion that the desired system does nt have the ability to respond to new needs of the present time . Although, iran s primary health care system to respond has been successful to infectious diseases and maternal and newborn deaths, it seems that, it has been faced with some problems in response to non - communicable diseases (16). The practical significance of these findings for the policy makers and the ministry of health authorities is that, they should revise the health houses from different aspects such as human resources, equipment and information systems . These revisions will enable the health houses to continue to play their vital role as the entry and the first contact of iran s health system . Future studies should focus on issues such as measuring the workload of health houses and to evaluate the efficacy of health houses human resources to meet all defined tasks and duties.
The cleanup of pollutants from soil and water is becoming an important task as human activities produce large amounts of chemical compounds (up to tens of millions) that are frequently released into the environment . Microbial populations play an important role in this process as they have acquired the ability to metabolise these compounds using them as carbon and energy sources (1). Decades of biochemical studies have produced a considerable wealth of knowledge about this unique metabolism, and this has recently started to be categorized and stored in structured databases . Examples of these are the university of minnesota biocatalysis / biodegradation database (um - bbd) (2) and the metarouter (3). Although this formalization has permitted the development of useful applications, such as a predictor of chemical biodegradability (4,5), the absence of information at the sequence level of the proteins required for the biodegradation process has limited further systematic studies . Questions such as the molecular basis of enzyme specificity, their catalytic mechanism, the evolutionary origin of this novel metabolism, or the spreading of such activities in the environment, are extremely difficult to address in the absence of accurate sequence and genetic information . Current biodegradation databases such as um - bbd or metarouter link reactions to protein sequences in databases that have been annotated with the corresponding enzyme commission code (ec code). For instance, many reactions share the same ec code although they use distinct substrates and generate different products . For example, the ec code 1.13.11.- is shared by more than 40 reactions, including a large number of dioxygenases with different substrates such as styrene or pyrene . Given that the uniprot database contains more than 200 sequences annotated with this particular ec code (1.13.11.-), it is impossible to use the information provided in the biodegradation databases to accurately associate the protein that actually carries out a specific biochemical reaction . In some cases, the databases provide links to the kyoto encyclopedia of genes and genomes (kegg), but unfortunately kegg associations between proteins and reactions, are often inaccurate, and direct to proteins electronically annotated in the course of complete genome sequencing projects . As an alternative method, um - bbd allows searches with the enzymatic activity name as query directly in genbank, but usually it is difficult to identify if the association between the protein and the biochemical activity is based on a published experimental characterization or whether it was inferred by computational methods . As an alternative to these approximations, bionemo provides accurate associations between proteins and reactions based on customized database searches, extensive literature mining and manual curation . Bionemo offers an additional level of information by adding molecular data on the transcriptional organization of biodegradation genes and their regulation . This molecular information is placed in the proper metabolic context and thus enables the exploration of particular features that have traditionally been difficult and tedious to address . In summary, bionemo complements the currently available information on biodegradation that focus in the biochemical aspects by adding additional layers of molecular information at the level of proteins and gene control . These are linked to the biochemical reactions defined as the transformation of substrates into products . These transcription units are regulated by one or more regulatory complex, comprising of a transcription factor, one or more dna - binding sites and generally an inducer compound . All entities in the database are linked to the corresponding external databases, such as genbank or the ncbi taxonomy database (6), uniprot (7), pfam (8) and um - bbd (2) (figure 1). All the biological entities contained in bionemo are shown as white boxes, with black arrows indicating their relationships . Entities are sorted in two vertical axes, the one on the left showing entities related to regulation and the one on the right showing entities related to metabolism . Orange boxes are external databases to which the different entities are connected, as indicated by dashed arrows all the biological entities contained in bionemo are shown as white boxes, with black arrows indicating their relationships . Entities are sorted in two vertical axes, the one on the left showing entities related to regulation and the one on the right showing entities related to metabolism . Orange boxes are external databases to which the different entities are connected, as indicated by dashed arrows . The first step in the manual curation process of bionemo consisted of obtaining all the pathways and reactions from the university of minnesota biocatalysis / biodegradation database, we manually searched sequence databases, embl (9) and genbank (6) using as many query terms as was possible, including ec number, reaction name, enzyme name or original publication as reported in the um - bbd . The resulting entries were then screened manually and the sequences were associated to a reaction only if we could find a journal article describing that particular enzymatic activity for the gene using the same name as in the sequence database, and that refers to the same organism, including the strain name . It is important to stress that all the connections between protein complexes and biochemical reactions were established manually and were always based on the information contained in the scientific literature . No sequence similarity information or other computational function prediction methods were used, nor were articles using those methods considered as evidence . In total, we obtained accurate and reliable protein associations for 324 reactions of the original set of 945 (table 1). A similar process was followed to retrieve genes and transcriptional units . In the case of regulatory proteins, both their binding sites and the regulatory actions on regulated promoters were also obtained from the literature, starting from the reviews by tropel and van der meer (10) and diaz and prieto (11), and following references therein . Table 1.summary of the bionemo information contentpathways145reactions945 with associated complex324enzymatic complexes537proteins1107microbial species234transcription units212transcription factors90effectors90tf dna - binding sites128promoters100 summary of the bionemo information content the main way to access bionemo is via its web site (http://bionemo.bioinfo.cnio.es). While a full list of each entity type is provided to browse the bionemo content, the web server implements a simple search interface that allows simultaneously querying all the biological entities described above . The results are shown categorized by tabs representing classes containing the entity types (reactions, complexes, etc . ). From the results page, the user can easily access entity - specific pages, in which all information available is summarized, including the biochemical, sequence and regulatory data . Links to external databases are provided, including the original um - bbd metabolic information, genbank and uniprot, the ncbi taxonomy database for microbial species, and the pubmeb references to the original information sources . Navigating the database is simple . To illustrate this benzoate. The results page returns all the available entities in bionemo with a partial match to that query, categorized in four classes: 54 reactions, 22 pathways, 22 enzymatic complexes and 24 compounds . Without navigating away from this page, the user can, for instance, access all the protein complexes that perform reactions related to benzoate or any derivative, and the gene that encode them . The user can also access the reactions in which any of the 24 compounds take part, either as product or substrate, and the 22 pathways they belong to . Should the user select the benzoate pathway (benz2), a graphical representation is shown (figure 2) that is also conveniently clickable . Transcriptional regulation, when available, can be shown on top of the pathway if required . As always, a link to the original source in um - bbd and connections to alternative pathways are also shown in this page, and we have made clickable all the compounds, reactions and regulators included in the graph . For instance, selecting the halobenzoate 12 dioxygenase link will take the user to the page for that reaction . This page includes a link to um - bbd for a full description of the reaction . Bionemo provides the list of all complexes capable to perform that reaction along with links to the articles we used to establish that association, and links to additional relevant articles describing either the reaction or the enzymatic complexes ., links to several external databases are offered, including genbank for dna sequences and genepep and/or uniprot for the protein sequences . In addition, if the protein sequence contains domains included in pfam, these are shown and properly connected to pfam . Clicking the domain name will retrieve the list of all proteins in bionemo containing that domain . Finally, if available, links to resolved 3d structures in the pdb are also provided . Figure 2.example of information retrieval using the bionemo web site . A standard case of use could start by browsing a pathway and its regulatory elements . From there, the user can navigate to different views . Then, by clicking on a reaction name, the user will be taken to a new page showing all the enzymatic complexes able to perform that reaction, and from there to one describing proteins, their coding genes, their transcriptional organization and the transcription factors involved . A standard case of use could start by browsing a pathway and its regulatory elements ., by clicking on a reaction name, the user will be taken to a new page showing all the enzymatic complexes able to perform that reaction, and from there to one describing proteins, their coding genes, their transcriptional organization and the transcription factors involved . Regarding the transcriptional information, the user can continue the exploration of the system by using the corresponding link . In this case, the gene cbda contains information about transcriptional regulation indicated by the transcriptional unit (the cbdabc operon) and by the transcription factor that regulates the gene: cbds (12). The transcription unit page contains a scaled schematic representation of the operon and its promoter region, including the coordinates of the transcription factor binding sites if known, the type of promoter that drives its expression, the type of regulation (activation or repression) and the molecules that can serve as effectors of the system . In the cbds transcription factor page, in addition to the standard gene information (links to external sequence databases, domain structure and relevant articles), the list of target transcription units and the molecules that act as effectors are also included . As seen in this example, the bionemo web site has been designed to facilitate browsing and fast access to relevant information . Bionemo has been intentionally designed to avoid redundancy with related databases, and we always provide external links to all of them . For advanced users, bionemo can be downloaded as a sql dump and installed locally . A perl api (application program interface) is also provided in order to facilitate programmatic access and to avoid the use of complex sql queries . The local installation process and information contained in bionemo can be useful for cloning, primer design for pcr amplification and design of directed mutations, among other applications . For the annotation of genomes and metagenomic libraries, bionemo is a better - suited alternative to the non - specialized sequence databases . In the field of sequence analysis, bionemo allows the generation of sequence alignments enriched in experimentally characterized proteins, which can be useful for finding residues related with substrate specificity or catalytic mechanism . Beyond these applications, we envision a wide range of emerging fields in which bionemo can be useful, such as systems biology of biodegradation . This field has started to produce relevant results (13) and can be enhanced by the availability of protein sequences and regulatory information . This information will allow researchers to dive deeper in the functional properties of the enzymes and their particular organization . But proteins are only a small part of the whole picture, where transcriptional events are the driving forces of evolution . Therefore, making accessible the genetic organization of biodegradation enzymes will allow a better characterization of their ability to be transferred among different organisms, a process that has been reported as key in the biogeochemical cycles of toxic compounds (14,15). From an engineering point of view, bionemo can also help in the designing of new pathways and regulatory circuits, in which sequence information and protein protein and protein dna interactions are required for the proper design of useful and independent systems (1618). In this context, bionemo will be useful to assist the design of new transcription factors with the desired specificity and with a predictable behaviour (19). In order to expand the reaction coverage of bionemo, we are currently implementing novel tools that will that will help us keep the result up to date . Our laboratory is currently working on a set of text mining tools that will scan the literature for precise biodegradation information that will be added to bionemo under expert curation . These tools will be able to mine relevant information: not only the database entries associations but also new biochemical reactions, the species involved and particular environment in which they take place . To summarize, bionemo is a unique resource that contains several layers of integrated information and enables rational and comprehensive access to the biochemical pathways, protein complexes, and genetic regulation of biodegradation . To the best of our knowledge we therefore expect this tool to be used in a broad spectrum of scientific and applied research . This work is funded by the emergence eu grants, the psysmo project within the sysmo framework, and the fundacin banco bilbao vizcaya argentaria (fbbva - biocon-3). I.c . Is a member of the ramn y cajal program of the spanish ministry of education and science.
Present the results of an exploratory study which aimed to identify the attributes of relational continuity as conceived by the actors involved in the organization of services to frail older people . The lengthening of the duration of life with autonomy loss warrants a transformation of the response to the needs of older people . The organization of services must evolve from a hospital - centered model to a residence - centered model better adapted to long - term care . This refocus on residential care provokes a multiplication of service providers which must be coordinated to ensure continuity of care . Amongst the three forms of continuity (informational, management and relational) twenty - seven interviews with practitioners, managers, family caregivers and users were conducted and analysed using a content analysis approach . While the family caregivers and users stressed the psycho - affective nature of the care relationship, the practitioners viewed it as a means to ensure the adequacy of services . From the user's viewpoint, the relationship is not the responsibility of one professional, but of a collective effort that may carry his voice across the services organization.
Paracetamol overdose remains one of the most important common poisonings in many parts of the world and an increasing problem in many developing and resource poor nations . N - acetylcysteine (nac) is an effective treatment in the vast majority of cases if given early . The decision to give nac is usually based on a paracetamol concentration measured at least 4 h after ingestion or later if the patient presents to hospital after this time . Although dose is recognised as a predictor of toxicity, reported dose is rarely used to define treatment if a paracetamol concentration is available . It remains unclear what the toxic dose of paracetamol is and in the majority of cases patients will have a serum paracetamol concentration measured irrespective of the reported dose taken . Australian and most international guidelines recommend 200 mg / kg or 10 g as a toxic dose . However, despite this being defined as a toxic dose the majority of patients will have a serum paracetamol concentration measured, even if they have ingested less than this amount . A comparison of the reported and toxic dose is only used in cases where a serum paracetamol concentration is not available (i.e. Late presentations) or in resource poor settings where laboratory services are not available . Although previous studies have shown that reported dose is an independent predictor of hepatotoxicity, this has not influenced risk assessment in paracetamol poisoning . If reported dose was a strong predictor of hepatotoxicity, then its use would potentially allow early initiation of nac in large overdoses or conversely avoid waiting for paracetamol concentrations for non - toxic doses . This is already done in some cases with massive ingestions, but this is based on anecdotal evidence . Currently, the practice of a single serum paracetamol concentration being above the nomogram between 4 and 24 h from ingestion remains the gold standard for starting nac therapy . Starting nac prior to measuring a paracetamol concentration has been suggested as a potential approach in paracetamol poisoning because it allows for slower administration rates, that is the loading dose to be given over a longer duration . However, it would be best if nac was only given to patients with a high probability of requiring nac . Therefore, predicting whether the paracetamol concentration will be above the nomogram line based on reported dose is of significance . The primary aim of this study was to determine whether reported paracetamol dose was predictive of the need for nac . In addition, we will investigate whether a minimal dose could be defined below which treatment may not be required (e.g. <10%) and a maximum dose above which the probability of requiring nac was greater than 90% . This study included dosing and drug concentration data from single acute paracetamol overdoses recorded in a prospective database . The use of the database and de - identified patient information has been granted exemption as an audit by the local human research ethics committee . Information for all presentations to a large regional toxicology centre was collected prospectively using a standardised data collection form that is completed at the time of presentation by the treating doctor . This information and any additional data from the medical record were entered into a relational database by trained research assistants . This included demographic information, details of the overdose / exposure (time of overdose and reported dose ingested), clinical information, laboratory investigations and treatment . All paracetamol overdoses (single acute ingestions> 1 g) presenting to the toxicology service between january 1997 and december 2011 were extracted from the database . Cases were only included if there was a serum paracetamol concentration measured between 4 and 16 h after ingestion, and both the time of ingestion and the amount ingested were reported and recorded in the database . We used reported dose to represent the dose that the treating clinicians believe the patient took . The reported dose was based on the patient history which was confirmed on multiple occasions and cross checked with any collateral history from the family, friends or pre - hospital services (e.g. Ambulance). Note the actual dose remains unknown and the perceived discrepancy between actual and reported dose is often perceived as the basis for uncertainty in the decision about treatment . The following data were extracted from the database: age, sex, reported dose ingested, time of ingestion, paracetamol concentration and the time of the paracetamol concentration (between 4 and 16 h), peak alanine transaminase (alt) and treatment (single dose activated - charcoal [sdac] and nac). Patients were further divided into two groups based on the time of their first paracetamol concentration . Early presenters were defined a priori as those that had their first paracetamol concentration between 4 and 7 h and could have nac started within 8 h. late presenters were defined as those that had their first level between 7 and 16 h post - overdose and were commenced on nac on admission . Seven hours was chosen as the cut - off because this meant that nac could be commenced within 8 h. hepatotoxicity was defined as an alt> 1000 u / l . For ease of interpretation data extracted from the database were analysed within a repeated measures logistic regression framework using nonmem (ver 7.2). The data were presented as 0 if the serum paracetamol concentration was below the line of the nomogram and hence no dose of nac would usually be given and 1 if the concentration was above the nomogram . The nomogram used started from 150 mg / l (1000 m) at 4 h and decreased with a half - life of 4 h. factors that were considered were age, sex, reported paracetamol dose and sdac . Model building was based on the likelihood ratio test where a decrease in the difference of two objective functions (proportional to twice the negative log - likehood) were assumed to be chi - squared distributed with the degrees of freedom equivalent to the difference in the number of parameter values for nested models . The general form of the linear model was: with additional terms being added for other effects (e.g. Sdac) as required . Following transformation, the probability that nac would be administered: the probability that the serum paracetamol concentration is greater than the value on the nomogram was the primary measure in the study but is considered to be a surrogate marker of the probability that nac would have been administered . For ease of interpretation continuous variables are presented as medians with interquartile ranges (iqr). Data extracted from the database were analysed within a repeated measures logistic regression framework using nonmem (ver 7.2). The data were presented as 0 if the serum paracetamol concentration was below the line of the nomogram and hence no dose of nac would usually be given and 1 if the concentration was above the nomogram . The nomogram used started from 150 mg / l (1000 m) at 4 h and decreased with a half - life of 4 h. factors that were considered were age, sex, reported paracetamol dose and sdac . Model building was based on the likelihood ratio test where a decrease in the difference of two objective functions (proportional to twice the negative log - likehood) were assumed to be chi - squared distributed with the degrees of freedom equivalent to the difference in the number of parameter values for nested models . The general form of the linear model was: with additional terms being added for other effects (e.g. Sdac) as required . Following transformation, the probability that nac would be administered: the probability that the serum paracetamol concentration is greater than the value on the nomogram was the primary measure in the study but is considered to be a surrogate marker of the probability that nac would have been administered . From a total of 2990 paracetamol poisoning admissions there were 1571 acute paracetamol overdoses with a reported dose, known time of ingestion and a paracetamol concentration performed between 4 and 16 h post - overdose . The reasons for exclusion were no known time of ingestion (385), no reported dose (94), dose less than 1 g (26) and no paracetamol concentration between 4 and 16 (914). The 1571 admissions were in 1303 patients, 1173 patients presented on one occasion and 130 on two or more occasions . The median age was 27 years (range: 1296 years; iqr: 2039 years) and 1140 (72.6%) were females . The median dose ingested was 10 g (range: 1100 g; iqr: 616 g). The paracetamol concentration was above the 150/1000 nomogram line in 337 of 1571 (21.5%) and 300 of these received nac . An additional 143 patients received nac who did not have a paracetamol concentration above the nomogram . Comparison of patients with an early (47 h) first paracetamol concentration to patients with a late (716 h) first paracetamol concentration . Table 1 compares patients who presented early (had a serum paracetamol concentration taken between 4 and 7 h post - overdose), to those who presented late (with a serum paracetamol concentration between 7 and 16 h). Patients who presented later had a higher rate of hepatotoxicity (5.5% vs. 0.4%; p <0.0001), were more likely to have a paracetamol concentration above the nomogram (33.6% vs. 18.2%; p <0.0001) and more likely to receive nac (47.6% vs. 23.0%; p <0.0001). The final model included paracetamol reported dose, age, sex and use of sdac . The data were not able to support a random effect on either the baseline or the influence of reported dose on the probability of the serum paracetamol concentration being above the nomogram line . There was no interaction between the use of sdac and ingested dose, age or sex . The probability of the paracetamol concentration being above the nomogram line based on the dose given is shown in fig . 1 for 30-year - old females and males . The probability of being above the nomogram line was lower for males at a similar dose compared to that for females . The influence of the ingested overdose dose on the adjusted probability of being above the nomogram line is given by the solid line . The probability based on dose is adjusted for the influence of sdac (dashed line), age of the patient and sex of the patient . It is seen that sdac reduces the probability of being above the nomogram line, shown by the dashed lines in fig . 1 . Sdac reduces the probability of nac by up to 14% at 28 g and less than 10% at either doses lower than 19 g or doses greater than 37 g. probability of the paracetamol concentration being above the nomogram line versus dose (a) for a 30-year - old female with (dashed line) and without (solid line) sdac; and (b) for a 30-year- old male (solid line) compared to a 30-year - old female (dashed line). Based on sdac not being administered then there was a 5% probability of being above the nomogram line at a dose of 69 g, a 10% probability of being above the nomogram line at a dose of 1316 g, a 50% probability of being above the nomogram line at a dose of 3034 g and a 90% probability of being above the nomogram line at 4850 g. this study demonstrates that reported dose is a strong predictor of patients having paracetamol concentrations above the nomogram line . It has also shown that patient age, sex and the administration of sdac influences this probability . The relationship between reported dose and toxic paracetamol concentration can potentially be used to allow early intervention in large overdoses . The study also confirmed that patients presenting 7 h or more after ingestion, who were therefore not administered nac within 8 h, were more likely to receive nac and develop an abnormal alanine transaminase . This supports current practice of commencing nac prior to getting a paracetamol concentration in all patients presenting after 8 h and then ceasing it if the paracetamol concentration is below the nomogram line . Most guidelines recommend that patients presenting within 8 h have a serum paracetamol concentration measured prior to commencing nac wait and see approach . The results of this study suggest that if the reported dose is greater than 50 g then more than 90% of patients require treatment so nac could potentially be commenced earlier in these patients . An alternate approach has been to commence nac early and stop it if the paracetamol concentration is non - toxic . For this approach, reported doses associated with a low probability of requiring nac could be used to define a group of patients where nac should not be commenced prior to a paracetamol concentration being determined . In other words, a reported dose cut - off could be used to determine patients where a wait and see approach is followed (<cut - off dose) or an approach to commence nac prior to obtaining a paracetamol concentration (> cut - off dose) and then revisit the use of nac once a paracetamol concentration is available . For instance, if a reported dose of 10 g was used this would prevent half of all paracetamol overdose patients (in this study) being started on nac early (i.e. If all patients are initially commenced on nac prior to a paracetamol concentration), with the associated small risk of adverse reactions . Patients ingesting 10 g only have a 57% probability of being above the nomogram line and therefore requiring nac . This study confirms a previous study (data prior to 1997) at the same toxicology unit which demonstrated that the administration of sdac reduces the probability of requiring nac . This would support the early administration of activated charcoal in cooperative patients to reduce the number of patients requiring nac and therefore reduce the length of stay . The study suggests that there is the greatest benefit of sdac for doses greater than 28 g. however, although sdac is a low risk intervention it could not be given as a duty of care in these patients because nac is an effective antidote . There are a number of limitations to the study including the retrospective extraction and review of the data . However, this is unlikely to affect the primary aim of the study which was based on the reported dose and the measured serum paracetamol concentration . Previous studies have demonstrated that reported dose is a good estimate of the true ingested dose and that patient history is reliable in the majority of cases although this remains a point of controversy in the literature . Another problem was that a large number of patients (47%) were excluded which may introduce selection bias . However, the majority (31%) were because a paracetamol concentration was not done between 4 and 16 h and includes late presenters, staggered, supratherapeutic and chronic paracetamol ingestions, where risk assessment is generally not based on a single paracetamol concentration plotted on the nomogram . Another limitation was that sdac was administered according to the emergency department doctor or treating clinical toxicologist and was not randomised . This may have meant that patients ingesting larger doses were more likely to receive sdac . However, there was no interaction between dose and sdac in the logistic regression model suggesting that this was unlikely to be the case . There were a number of patients with paracetamol concentrations above the nomogram who did not receive nac . This is most likely to be patients between the 150 and 200 mg / l nomogram lines who were not treated since this was prior to the change in australia from the 200 mg / l nomogram line to the 150 mg / l nomogram line . In addition to dose and sdac, the final logistic regression model included both age and sex as significant covariates . Figure 1 shows that there was a greater probability of the serum paracetamol being above the line in females compared to males . This may be because females on average weigh less than males and weight was not included in the model because it was not available in the majority of patients . The study shows that reported dose can be used as an early predictor of patients who require nac . This may improve the risk assessment in patients with paracetamol poisoning allowing the earlier administration in large overdoses or more targeted use of nac in early and late presenters.
It is caused by an abnormal number of coronary angiography (cag) trinucleotide repeats in the huntingtin gene (htt), which encodes a 350 kda ubiquitously expressed protein, huntingtin (htt).1 hd is characterized by movement disorder, cognitive impairment, dementia, and affective disturbances.2 hd patients have more than 40 cag repeats and show abnormal involuntary writhing movements . Juvenile hd patients have more than 60 cag repeats.1,3 the age of onset of hd is typically between 35 and 44 years old . A htt comprising more than 40 cag repeats is translated into mutant huntingtin (mhtt) protein, which causes the death of medium spiny neurons in the striatum . Normal htt is ubiquitously expressed and is essential for embryonic development.4 the mechanism of neuronal cell death by mhtt has not been clearly established although previous studies report that it has been linked with mitochondrial dysfunction, transcriptional dysregulation, altered protein - protein interactions, abnormal protein aggregations, and excitotoxicity.57 the treatment paradigm for hd patients depends on 3 main clinical domains: movement, psychiatric, and cognitive abnormalities . Antipsychotic agents, including haloperidol, pimozide, and clozapine, are used to treat patients with psychiatric / behavioral comorbidities . Furthermore, comparison of the available treatment studies is problematic due to differences in study populations, variable outcomes, the use of different instruments, and the confounding effects of drugs . The pharmacological treatment of hd can alleviate symptoms, but it cannot cure the disease . The ultimate goal of cell therapy is the replacement or neuroprotection of dead or dying cells . Cell therapy strategies can be classified into two broad categories based on the use of either fetal tissues / cells or stem cells . Studies using fetal brain tissue were performed using animal models of hd prior to 1990 . However, effective recovery has not been reported in any clinical trials, although some studies showed that fetal tissue transplantation provided cellular improvement around lesions.34,35 moreover, fetal tissue transplantation led to localized effects only and did not persist long - term.34,36 stem cells are being studied in various disease models, in preference to fetal tissue or cells due to the limited availability of the latter . Several types of stem cells, such as embryonic stem cells (escs), bone marrow mesenchymal stem cells (bm - mscs), neural stem cells (nscs), adipose stem cells (ascs), and induced pluripotent stem cells (ipscs), are used to develop cell therapy strategies . Embryonic stem cells are pluripotent, and mouse escs can differentiate into neurons, astrocytes, and oligodendrocytes.37 it has been reported that human escs (hescs) can differentiate into neurons in the lesions of hd animal models, attenuating progressive symptoms.38 despite these benefits of hescs, complications arising from their use include immune rejection, ethical concerns, and tumor formation.38 on the other hand, somatic stem cells such as bm - mscs, nscs, ascs, and ipss are ideal sources for clinical trials because these stem cells do not present the above mentioned immune rejection and ethical problems . Murine and human nscs (hnscs) have been studied in vivo as cell therapy sources for hd . A study involving an hnsc treated hd animal group investigated the migration of transplanted hnscs around a lesion site . Following tail vein or ventricle injection, a significantly greater volume of striatum was observed in the treatment group compared to the control group . Other studies reported that transplanted nscs differentiated into neurons, oligodendrocytes, and predominantly, astrocytes, in in vivo hd models, resulting in partial functional recovery.3842 bone marrow mesenchymal stem cells and ascs are easily obtained multipotent somatic stem cells that can be differentiated into neuronal cells . Moreover, these stem cells have the ability to secrete neuroprotective factors, such as growth factors, chemokines, and cytokines . Recent studies have shown that intrastriatal transplantation of bm - mscs reduced striatal atrophy, although transplanted cells only survived for up to 7 days in transgenic hd mice . Bm - mscs can be genetically modified to provide sustained and long - term delivery of neuroprotective factors, which increase neurogenesis and protect against cell death.4345 genetically modified mscs are currently under consideration for use in the treatment of neurodegenerative disorders, including hd.46 adipose stem cells are a feasible source for cellular therapy due to ease of isolation, manipulation, and a strong safety profile in the clinic . The intrastriatal transplantation of normal human ascs reduced lesion volumes in an hd rat model.47 to examine the long - term effect of asc transplantation and investigate the possibility of autologous asc transplantation in hd patients, hd patient - derived ascs have been investigated over a period of 4 months in the yac128 model.48 the results showed similar expression levels of growth factors, such as brain derived neurotrophic factor (bdnf), hepatocyte growth factor (hgf), vascular endothelial growth factor (vegf), and leukemia inhibitory factor (lif), in hd ascs compared with normal human ascs . However, no long - term effects of transplantation with either hd or normal ascs were observed in yac128 . Embryonic stem cells have two limitations regarding their clinic application: the ethical issues surrounding their use and allogenic immune rejection . Ipscs provide a potential solution because they have the ability to differentiate into various cell types and can be induced from the fibroblasts of an hd patient.49,50 ipscs from an hd patient with 72 cag repeats have been efficiently induced to form gamma- aminobutyric acid neurons and were functional following transplantation into a rat model of hd.51 although stem cells have the ability to differentiate into any type of cell, recent studies indicate that the beneficial effects of stem cell therapies actually occur via secretory molecules in addition to cell replacement, the so - called paracrine effect.47,52 stem cells secrete a variety of growth factors, cytokines, and chemokines that regulate their biology in an autocrine/ paracrine manner, and they interact with the surrounding microenvironment.53,54 vegf, hgf, insulin- like growth factor-1 and -2 (igf-1, -2) and stromal- derived factor-1 secreted from stem cells are important to neuronal survival, neurogenesis, and mitochondrial activation via a bystander - like mechanism . 47,55,56 these positive effects on recipient neural cells result in protection and repair, leading to the inhibition of hd progression (figure 1). They secrete multiple antiapoptotic growth factors, including vegf, hgf, bdnf, basic fibroblast growth factor, and igf-1.5759 one solution to the problem of stem cell availability may be the paracrine effect of ascs . The paracrine effects of human ascs on hd pathology were investigated in cell culture experiments and hd r6/2 mouse models.47 transplantation of ascs resulted in reduced lesion volume and fewer apoptotic striatal cells in the hd rat model compared with control animals . The asc transplanted group showed significant improvement in apomorphine- induced rotation tests via the paracrine effect . Ascs have been injected into the r6/2 hd mouse model, and treated mice exhibited a significantly longer survival time than control mice . The paracrine effect of ascs in the r6/2 hd mouse model was also investigated.60 asc extracts were isolated and used to treat r6/2 mice via intraperitoneal injection . The results were similar to those obtained from stem cell transplantation, suggesting that the injection of these stem cell extracts could also slow hd progression.60 taken together, the use of growth factors in hd could be an ideal stem cell strategy to protect against neuronal death, given that stem cells from an hd patient have the genetic components for autologous transplantation therapies . To implement this therapy, further works are required to elucidate the precise mechanism of the paracrine effects of asc extracts . Prior to clinical application, thorough in vivo studies examining the delivery method, toxicity, and pharmacokinetics of therapeutic candidates are required . Most of these drugs do not demonstrate significant effects, although several drugs are currently undergoing clinical trials . Stem cell therapy is an effective strategy for curing hd, and many preclinical trials show encouraging results . Although the precise mechanism of the stem cell paracrine effect has not been completely elucidated, this strategy has potential for clinical application.
Cytomegalovirus (cmv) colitis is common among immunocompromised patients who are more prone to opportunistic infections . After the infection of cmv is detected by histology or serology, antiviral treatment is usually chosen initially . Since cmv disease cannot be diagnosed on clinical symptoms alone, diagnosis and treatment are sometimes delayed . Here, we report a case of a hemorrhagic cmv colitis that occurred in an immunocompromised patient after a colectomy due to colon cancer and was successfully treated with ganciclovir . An 85-year - old woman underwent esophagogastroduodenoscopy and colonoscopy for investigation of anemia . A laterally spreading tumor of the granular type, 85 mm in diameter, although magnifying image - enhanced colonoscopy suggested a tubulovillous adenoma, surgical resection, not endoscopic mucosal resection, was chosen because of the size of the tumor . However, as she had a medical history including breast cancer, myocardial infarction, general edema due to chronic renal failure (oral administration of prednisolone 5 mg / day), diverticulosis of sigmoid colon, and bilateral ureteral stent placement due to retroperitoneal fibrosis, she did not want to take medical treatment anymore but to monitor her own condition for a while . After 3 months, she finally agreed to have surgery and was admitted to our hospital . The patient underwent ileocecal resection followed by stapled functional end - to - end anastomosis (fig . The postoperative course was favorable; dietary intake and oral drug administration were started on postoperative day 4 and both flatus and stool passed . However, she had sudden abdominal pain and heavy bloody discharge on postoperative day 11 . Although conservative treatment, including blood transfusion therapy for anemia, was performed initially, there was no improvement after a week . In addition to the endoscopic findings, the patent's immunocompromised state suggested possible cmv colitis . Because cmv antigen was confirmed in peripheral blood samples, intravenous antiviral treatment was started from the postoperative day 23 (ganciclovir, 150 mg / day). After 4 days of the treatment, bloody discharge stopped, and at 8 days, improvement of abdominal pain was observed . The antiviral treatment was continued for 2 weeks until the serological confirmation of negative cmv antigen . After improvement of the colitis - related symptoms, the patient was discharged from our hospital . Cmv infection often develops a latent infection with no signs or symptoms after acute infection . Although most people are exposed to cmv in their lifetime, typically only the patients with weakened immune systems, such as aids, malignancy, organ transplant or bone marrow transplant, and steroid or immunosuppressive treatments, become ill by reactivating cmv and present with cmv pneumonia, gastroenteritis, retinitis, and encephalitis . Cmv disease is often diagnosed by pathologic and serologic confirmation because clinical symptoms are not specific . Furthermore, colonoscopic findings of cmv colitis mimic many conditions, including pseudomembranous colitis, ischemic colitis, ulcerative colitis and crohn's disease . In our case, as we initially considered the bleeding from the diverticulum or anastomosis, conservative treatment was chosen . After one week of conservative therapy, there was no sign of improvement in bloody discharge; therefore, we decided to perform colonoscopy . We were hesitant to perform colonoscopy due to our patient having had a colectomy . According to the meta - analysis of cmv colitis in immunocompetent hosts, the highest mortality rates were associated with immune modulating conditions that include 16 patients . Of those analyzed, 5 patients (31.3%) received colectomy as initial treatment and 8 patients (50%) and 6 patients (37.5%) had coexisting renal failure and diabetes mellitus, respectively . In our case, as the patient was given steroids due to chronic renal failure and the colonoscopy revealed the longitudinal ulcer at the anastomosis, we were able to suspect cmv colitis and confirmed the diagnosis serologically . Because endoscopic biopsy was not performed, cmv infection was not evaluated histologically . Of note, we performed immunohistochemistry of cmv protein using resected colon cancer specimen, though cmv - positive stain was not detected . This result seems to relate with the fact that cmv is not associated with carcinogenesis and reactivation of latent cmv infection causes cmv colitis [5, 6]. The first choice of treatment of cmv infection is antiviral therapy [7, 8]. Systemic antiviral treatment has provided significant advances and has resulted in dramatically improved outcomes [7, 8]. Treatment time usually ranges from 1 to 4 weeks, depending on the treatment effect such as improvement of the symptoms and/or confirmation of the negative cmv antigen . In our case, despite the necessity of reducing the dose of ganciclovir due to renal failure, the patient showed good response to systemic therapy and did not require further treatment . Fortunately, as she did not show uncontrollable heavy bleeding or symptoms of bowel perforation, surgical resection was not needed . The case we mentioned above can potentially occur in immunocompromised patients . With recent progress in medicine, the number of high - risk patients who undergo surgery is increasing; therefore, the reactivation of latent cmv infection in immunocompromised patients should be actively considered for the differential diagnosis, leading to timely diagnosis and appropriate treatment.
Very few data are available regarding sex differences in cannabinoid cb1 receptor density and coupling to g proteins, and fewer ones are available on the endocannabinoid levels . Despite this limitation, a rather clear picture arises for cb1 receptor: in all the papers where cb1 receptor levels were measured in both male and female animals, a higher density was observed in males in almost all the cerebral regions analyzed (rubino et al ., 2008; the increase in cb1 receptor density was observed in both adolescent and adult animals, however it was stronger and wider in younger rats . For example in the adult amygdala, cb1 receptor binding site density was higher in females than males, a difference that appears to be dependent upon the presence of estradiol, since in ovariectomized female rats it was no longer seen (riebe et al ., 2010). Despite the lower receptor density, however, adolescent females showed the higher g protein activation after cb1 receptor stimulation in several brain areas (rubino et al . Higher cb1 receptor / g protein coupling was still present in the prefrontal cortex of female rats (burston et al ., 2010; mateos et al ., 2010), whereas it was no longer evident in the amygdala (mateos et al ., 2010), hypothalamus, periaqueductal gray, ventral midbrain, and cerebellum (burston et al ., (2010) described higher cp-55,940-stimulated g protein activation in male rats whereas mateos et al . Different hypotheses can be put forward to explain this discrepancy: first of all, different rat strains have been used, long evans vs. wistar rats . A different approach was employed to assess cb1 receptor / g protein coupling, namely autoradiographic analysis on brain sections in mateos study and binding studies on membrane samples from brain tissue in the burston s one . (2010), rats underwent intense behavioral analysis before the biochemical studies whereas in that of burston they did nt . Sex differences in cb1 receptor density were also reported in humans, again with men showing higher binding levels in early adulthood (age 1845; van laere et al ., 2008). Sex differences were still evident later in life (age 4570), but while men maintained or lost some cb1 binding sites, women increased them throughout the brain, thus presenting higher cb1 receptor levels at this specific interval of age (van laere et al ., 2008). Only one paper dealt with endocannabinoid levels in adult male and female animals (bradshaw et al .,, the authors found no significant differences in anandamide levels between male and female rats, whereas 2-arachidonoylglycerol (2-ag) was higher in the female pituitary gland and hypothalamus, but lower in the cerebellum . When the different phases of the estrous cycle were taken into account the picture became more complex, with fluctuation of the endocannabinoid levels among them and therefore much more diversity between male and female rats . In neonatal rats, females had lower amounts of the endocannabinoids 2-ag and anandamide in the amygdala and, accordingly, higher content of the endocannabinoid degradation enzymes, fatty acid amid hydrolase and monoacylglycerol lipase than males in this cerebral area (krebs - kraft et al ., 2010). Animal studies have shown sex differences in the metabolic processing of delta 9-tetrahydrocannabinol (thc). For example thc was oxidized selectively to 11-oh - delta 9-thc by liver microsomes of female rats, a form that retains the potency of thc, while in male rats, besides 11-oh - delta 9-thc, it was biotransformed to at least three different less active metabolites (narimatsu et al ., 1991). Accordingly, after intraperitoneal injections of thc, levels of its metabolites in brain tissue, including 11-oh - delta 9-thc, the major active metabolite, were higher in females than in males (tseng et al ., 2004). Adult male rats have a greater percentage of body fat than adult females and therefore their fat cells may retain more thc allowing a smaller amount to reach the brain . In view of this consistent dimorphism in the endocannabinoid system and thc metabolism, it is not surprising that cannabinoid compounds, and particularly thc, might have different effects when administered in male or female animals . Despite this obvious observation, very few studies have taken into account this possibility, performing the same experiments in both males and females . Curiously enough, most of them regarded the long - term effects of adolescent exposure to cannabinoids with particular emphasis on cognition and emotionality . When the object recognition test was used, adolescent exposure to increasing doses of the synthetic cannabinoid agonist cp-55,940 for 21 days (post - natal days 3050) induced impaired working memory checked following a long drug - free period in both female (oshea et al ., 2004) and male rats (oshea et al ., 2006). However, the same treatment at adulthood led to long - term memory impairments in male but not female rats (oshea et al ., 2004, 2006). In contrast, when the spatial memory was assessed through the morris water maze, thc significantly disrupted learning in the adolescent males and females and also in adult females, whereas it did not affect learning in adult males (cha et al . However chronic thc during either adolescence or adulthood had no effect on spatial learning in animals of both sexes tested after a long drug - free period (cha et al ., 2007). (2009) reported that also the cannabinoid agonist cp-55,940 administered during adolescence did not affect adult performance of animals of both sexes in the water maze . In our work, both male and female rats showed spatial working memory deficits tested in the radial maze long after adolescent exposure to thc (rubino et al ., 2009a, b). As a whole, this behavioral picture seems to suggest that whenever the exposure to cannabinoid agonists occurs during adolescence, it disrupts cognitive behaviors in both sexes if animals were tested immediately after, whilst the presence of long - term effects might depend upon the specific type of memory assessed and the sex of the animals . Besides the behavioral picture, also the molecular underpinnings of the cognitive impairments induced by cannabinoids might present sexual dimorphism . For example we showed that thc, although inducing the same behavioral deficit in the radial maze in both male and female rats, triggered a different cellular alteration at the level of brain circuitries (rubino et al ., 2009a, b). In adult female rats exposed to thc in adolescence the spatial working memory impairment was correlated to a significant decrease in synaptophysin and psd95 proteins in the prefrontal cortex . Moreover, proteomic analysis of the synaptosomes from this brain area, demonstrated the presence of less active synapses characterized by reduced ability in maintaining normal synaptic efficiency (rubino et al ., 2009a), thus suggesting the occurrence of altered synaptic plasticity throughout the prefrontal cortex in thc - pre - exposed female rats . In adult male rats chronically treated with thc during adolescence, the spatial working memory deficit was instead related to a significant decrease in the astroglial marker gfap as well as in pre- and post - synaptic protein expression (vamp2, psd95) and nmda receptor levels in the hippocampus . These animals also exhibited lower total dendritic length and number as well as reduced spine density in the hippocampal dentate gyrus (rubino et al ., 2009b), suggesting that male thc pre - treated rats may establish less synaptic contacts and/or less efficient synaptic connections throughout the hippocampus . These data support the notion that males and females may use differing neural paths to reach the same behavioral end point (see for review andreano and cahill, 2009) and that the same thc exposure may have different neuronal consequences in the brain of male or female rats . At the human level, besides the well - known notion that acute cannabis intoxication has been associated with transient and reversible decrements in attention, memory, and executive functions (see for review solowij and pesa, 2010), no evidence exists about sexual dimorphism in this dimension . Females are still too under - represented in epidemiological studies to gain a picture of different cognitive effects after thc exposure in men and women . Moreover, although few papers addressed this issue, they seem to support the notion that adolescent female rats appear to be more sensitive to the long - lasting effects triggered by chronic cannabinoid consumption on emotional responses than males; on the contrary, at adulthood, no sex differences are evident, or even males appear to be the more affected in the emotional domain . In fact, chronic cp-55,940 in adolescence impaired social interaction in both male and female rats, however when the same treatment was performed in adult animals, only males were affected (oshea et al ., 2004, 2006). Moreover, when hu210 was chronically administered in adult male and female rats, a significant antidepressant response was observed in both sexes (morrish et al ., 2009). In the hole board test, which measures the propensity for novelty and uncertainty, adolescent cp-55,940 treatment increased general motor activity and inspective exploration in female rats, whereas decreased explorative behavior without affecting general motor activity in males (biscaia et al ., 2003). Finally we observed that adolescent exposure to thc triggered the development of a complex depressive - like phenotype at adulthood only in female rats, male rats not presenting both behavioral and biochemical parameters of depression (rubino et al ., 2008). Among the biochemical parameters, the transcription factor creb seems to be involved in both the mechanism of action of antidepressants as well as the disease itself (blendy, 2006). Accordingly, adolescent thc significantly reduced pcreb in the prefrontal cortex and hippocampus of female rats but not in males . Conversely, elevated creb activity in the nac produces various depressive - like effects in rodents (see for review carlezon et al ., 2005), and thc significantly increased it in the nucleus accumbens of female rats . Again, male rats showed no changes in pcreb levels in this cerebral region (rubino et al ., 2008). As a whole these data seem to suggest that the adolescent female brain is more vulnerable to the adverse effects of chronic cannabinoid administration on emotional behavior than the adult brain . In support of this, when the same chronic thc treatment performed in adolescent female rats was administered in adult females, it did not induce long - lasting impairment in the emotional domain (realini et al ., 2011). The reason for this vulnerability is still unknown, however, possible sex steroid - dependent differences in the sensitivity of certain neuronal processes to cannabinoid treatment could be put forward . Accordingly, it was reported the existence of fluctuations along the ovarian cycle and sex steroid replacement in cb1 receptor density and affinity in certain brain areas (rodrguez de fonseca et al ., 1994; riebe et al ., estradiol elicits anxiolytic and antidepressant effects when injected in female rats (fink et al ., 1998; bodo and rissman, 2006; walf and frye, 2009; romano - torres and fernndez - guasti, 2010). Estradiol - induced changes in emotionality are sensitive to the blockade of cb1 receptors, thus suggesting that alterations in endocannabinoid activity may contribute to estradiol s ability to modulate mood and affect (hill et al ., 2007). Therefore it could be speculated that the disruption of the endocannabinoid system homeostasis by exogenous administration of cannabinoid compounds in adolescence, a period where hormonal changes leading to sexual maturation occur, might impact emotionality in developing females . As already observed for cognitive studies, no clear evidence exists about sexual dimorphism in emotional responses to cannabinoids at human levels . However in some epidemiological studies, although not clear stated, a gender difference might be found . For example, in a study where withdrawal symptoms after cessation of cannabis use was assessed, the symptoms formed two factors, one characterized by weakness, hypersomnia, and psychomotor retardation, and the second by anxiety, restlessness, depression, and insomnia (hasin et al ., 2008). When the authors examined the relationship of demographic characteristics to cannabis withdrawal symptoms in the full sample of frequent cannabis users, gender was associated with both the weakness symptoms and the anxiety / depression symptoms . Moreover, in an indigenous arnhem land community sample, a strong association between heavy cannabis use in young people and moderate severe depressive symptoms was found, and the rates of depression were nearly a third of females and one in six males reporting moderate severe symptoms (lee et al ., 2008). On the other hand, clinical data seem to indicate that the endocannabinoid system may be disturbed in affective disease, especially in females (hill et al ., 2008). Serum 2-ag content was significantly decreased in female patients diagnosed with major depression, and this decrease was correlated significantly and negatively with duration of the depressive episode (hill et al ., 2008). Together these observations suggest the potential utility of targeting the endocannabinoid system for the treatment of affective disorders in females . Finally, in addition to cognitive and emotional ones, other cannabinoid effects have been also shown to be sexually dimorphic . Cannabinoids are more potent and in some cases more efficacious in females than males in producing antinociception and altering movement (craft, 2005). In long evans and lister hooded rats, females showed a significant faster acquisition of win 55212 - 2 self - administration and maintained higher levels of responding than males, suggesting that cannabinoids might be more reinforcing for females than males (fattore et al ., 2007). Ovarian hormones might be involved in the modulation of the reinforcing effect of cannabinoids, in fact, when compared to intact females, a lower percentage of ovariectomized females acquired and maintained stable drug intake (fattore et al ., 2007). The data here reported clearly suggest the presence of sex differences in behavioral and neurochemical responses to cannabinoid compounds . The involvement of sex steroid hormones in most of the sex differences in cannabinoid - induced behavioral effects has been already put forward and appears to be the more likely explanation (gonzlez et al ., 2000; intriguingly, a very recent work even suggested the involvement of cannabinoid signaling in the establishment of normal sex differences in the brain (krebs - kraft et al ., 2010). The authors demonstrated that early exposure to cannabinoids masculinizes social play in females without altering this behavior in males . The likely cellular mechanism for this sexual differentiation of the developing brain and behavior might be the regulation of cell proliferation and cell type in the developing amygdala . On the basis of these observations, we would like to emphasize the need of including females in basic research and to analyze results for sex differences in epidemiological studies . Moreover, when acute cannabinoid effects are taken into account it would be very useful also to discriminate among the different female hormonal status . As a whole these data will help to better understand the therapeutic possibilities of the endocannabinoid system and to better exploit them, perhaps in a sex - dependent manner . The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Necrotizing sialometaplasia was first described by abrams et al.1 in 1973, and since then, other similar cases have been reported . Necrotizing sialometaplasia is an inflammatory, ulcerative lesion of the small salivary glands that usually occurs on one side of the hard palate, although it can also occur on the lower lip, posterior molar area, buccal mucosa, the parotid gland, tongue, and in the upper airway23 . Necrotizing sialometaplasia occurs more frequently in males, with the ratio of affected males to females approximately 2 to 12 . It is histologically similar to mucoepidermoid carcinoma and squamous cell carcinoma but is a benign disease that spontaneously heals within 4 to 10 weeks . Necrotizing sialometaplasia of the hard palate re - occurred on the contralateral side after 5 months . A 36-year - old woman was referred to the gangnam severance hospital (seoul, korea) by a private practice endodontist . The patient stated that her palate felt uncomfortable and that her throat had been swollen for a week . She had a history of smoking more than 40 cigarettes a day for 20 years and denied any other medical history . Endodontic treatment of the upper left first premolar under local anesthesia with 2% lidocaine and 1:100,000 epinephrine was completed by the endodontist before the patient's arrival to our hospital . A craterlike ulceration of 3 cm diameter, with necrotic tissue inside, was found on the left hard palate . A) the lesion was first diagnosed as either tissue necrosis caused by local injection of lidocaine containing epinephrine or necrotizing sialometaplasia, and was treated palliatively . It was not possible to perform a biopsy at that time because the tissue was already necrotized. (fig . C) after 5 months, the patient returned to the hospital for recurrence of the same symptoms on the contralateral side of the hard palate without any particular dental event. (fig . B) microscopically, the palatal lesion showed diffuse necrosis of acini and ducts of palatal salivary glands; however, the overall lobular structure of the involved gland was preserved . 3) based on histological analyses, the final pathological diagnosis for the palatal mass was necrotizing sialometaplasia . At the 3-year follow - up, the patient's oral mucosa of the hard palate was normal, without any signs or symptoms. (fig . C) this study was approved by institutional review board of yonsei university gangnam severance hospital (irb #3 - 2015 - 0114), and informed consent was obtained . The cause of necrotizing sialometaplasia is unknown, but it is thought to result from infarctions of the salivary gland tissue125 . The causes of such infarctions may be direct injury, effects of vasoconstrictors, or injuries from needles used in local anesthesia, ill - fitting dentures, drinking, smoking, cocaine use, radiation, infection of the upper airway or allergy, intubation, surgical treatment, and systemic diseases such as sickle cell disease, buerger's disease, raynaud's disease, and aids2345 . Shigematsu et al.6 reported that histopathological changes similar to those associated with necrotizing sialometaplasia may be observed when local anesthesia is repeatedly injected into the hard palate of mice . Necrotizing sialometaplasia with ulceration may occur when tissues in the salivary glands are infarcted and the acinar cells are subsequently necrotized . Brannon et al.2 reported that the risk of necrotizing sialometaplasia in smokers is about 10% (7/69). Smoking could cause infarctionsin the salivary gland by continuously stimulating the palate and inducing vascular stenosis . In a previous study, the researchers were unable to determine the cause of necrotizing sialometaplasia in 44% of the patient sample (30/69), and the rate of recurrence was 0% (0/14)2 . A number of reports have concluded that the risk of recurrence is normally 0%, and that instances of recurrence on the opposite side are rare . However, histologically, tissues in the salivary glands show infarction, inflammation, granulation tissue, and squamous metaplasia of the salivary duct . Because such squamous metaplasia is often observed, it may be misdiagnosed as squamous cell carcinoma, and because it is similar to mucoepidermoid carcinoma in that the squamous metaplasia is surrounded by a faint outline of necrotized acinar cells, it is easily misdiagnosed as malignant 1278 . However, despite similarities of infection and necrosis, necrotizing sialometaplasia is distinguished from malignancies because its ductal structure is preserved37 . When necrotizing sialometaplasia is misdiagnosed as a malignancy, irreversible treatment such as radical resection may follow . In contrast, some malignancies can be misdiagnosed as necrotizing sialometaplasia and subsequently go untreated . Therefore, bascones - martnez et al.5 reported that incisional biopsy is recommended for accurate diagnosis, with periodic treatment until full recovery9 . The stages are not clearly separated and can progress from occurrence to full recovery without any treatment . When salivary gland tissues become infarcted and are necrotized and separated, the necrotized tissues collapse, creating a crater - shaped ulcer . The surrounding mucous membranes show secondary healing and require approximately 4 to 10 weeks for complete recovery2347 . Pain may or may not be present; however, if there is pain in the first period of ulcer formation, the use of an analgesic is recommended . Because necrotizing sialometaplasia appears as an inflammatory ulcer, some doctors treat it with antibiotics or steroids, but with no reported effects on clinical symptoms7 . Our patient case had a negative medical history with the exception of smoking and local anesthesia for dental treatment . Thus, in the preliminary diagnosis, we diagnosed our patient with necrotized tissue caused by the blockage of the terminal blood vessels from complications of smoking and the use of lidocaine with epinephrine . After 3 weeks of follow - up, the necrotized tissues were no longer present and secondary healing of the soft tissues was apparent . Five months after the first occurrence of the lesion, we observed recurrence on the contralateral side of the hard palate without any particular factors other than smoking . The second lesion was still within the initial period of necrotizing when observed, and we therefore conducted an incisional biopsy including both normal and necrotized tissues to confirm the diagnosis of necrotizing sialometaplasia . Necrotizing sialometaplasia occurs unilaterally in 71% of previously - reported cases, and on both sides of the median suture line of the hard palate in 12% of cases2 . However, in our case, there was a second occurrence on the contralateral side with a time lapse between the first and second occurrences, a presentation that is thought to be quite rare . Our patient was not definitively diagnosed upon the second occurrence, but the second lesion may have been caused by the patient's heavy smoking habit, because she had experienced no dental events such as the use of local anesthesia.
Chronic obstructive pulmonary disease (copd) is characterized by chronic airflow limitation leading to pathologic alterations in the lungs with consequent extrapulmonary effects . It is not a completely reversible disease, generating systemic complications and comorbidities that contribute to the worsening of the disease and that can lead to death.1 2 its principal etiologic factors include the inhalation of particles or gases; exposure to smoking, occupational dust, chemical irritants; and socioeconomic conditions, among others.3 one symptom manifested by copd is coughing, which can occur daily or intermittently, and another is dyspnea, which is associated with disability in activities of daily living and decreased quality of life, progressing as the disease worsens.4 these factors exacerbate the disease, because they result in worse gas exchange and pulmonary hemodynamics . Furthermore, copd might affect the dynamics and coordination of other important functions such as deglutition.5 deglutition is considered both a dynamic and a complex process; it has the function of transporting the bolus from the mouth to the stomach in a safe manner . At the time the food is swallowed, a pause in breathing occurs for a few seconds, and the breath returns in the expiratory phase, thereby avoiding aspiration episodes.6 difficulties resulting from respiratory and/or ventilatory pattern might alter this coordination, resulting in decreased protection of the lower airway as may occur in patients with copd due to ventilatory functional alterations and thoracoabdominal biomechanics, which can lead to difficulties in swallowing process called dysphagia.5 dysphagia refers to changes during swallowing, which may involve any of the stages of this process; however, the alteration of the pharyngeal phase of swallowing might result in the entry of food into the airway, causing laryngeal penetration, laryngotracheal aspiration, pulmonary problems, undernutrition, dehydration, or aspiration pneumonia and might even lead to death.7 8 9 the literature presents studies that relate copd to dysphagia, suggesting that the laryngeal aspiration phenomenon, related to the alteration in the pharyngeal phase of swallowing, contributes significantly to the exacerbation of the symptoms of lung disease,6 10 in addition to causing more frequent hospitalizations.11 abnormalities in the swallowing process are associated with frequent exacerbations in patients with copd.12 however, it is unclear whether these abnormalities may already be found in patients with mild degree of disease.13 it is known that adequate protective reflexes of the airway have an important role in the aspiration prevention, whereas the impairment in the swallowing reflex may become a potential risk factor for exacerbations of copd.10 the purpose of this literature review was to investigate the relation between dysphagia and exacerbations of copd . The national library of medicine (medline), library online (scielo), literatura latino - americana e do caribe (lilacs), physiotherapy evidence database (pedro), and u.s . National library of medicine national institutes of health (pubmed) databases were searched for articles published from november 2012 to march 2013 . Deglutio, and transtornos de deglutio and their corresponding english pulmonary disease, deglutition, and deglutition disorders were used . The search was limited to portuguese and english languages and studies performed with adults with copd of both genders, published between 2000 and 2013 . Titles and abstracts were analyzed to obtain potentially relevant articles for review and in accordance with the proposed purpose in the present study . From the methodology applied, 16 studies were found, of which 14 were included in this review . The reviewed articles were organized in the following categories: (1) considerations about the copd and (2) dysphagia and exacerbations in copd . The world health organization estimates that through 2030 the mortality and disability caused by copd will increase significantly . Estimates suggest that 5.5 million people have the disease in brazil, and it is a major cause of deaths in the country . Tobacco use is responsible for 80 to 90% of cases,14 and its chronic use is associated with decreased pulmonary function . In addition to cigarette smoke, inhalation of particles and toxic gases, such as smoke from the firewood, irritating gases, and occupational exposure, have a direct relation to the development and maintenance of airway obstruction.15 for pneumology and physical therapy, the gold standard instrument for disease diagnosis is spirometry, which observes the restriction to airflow before and after bronchodilator use . The most important parameters in view of clinical application are the forced vital capacity (fvc), forced expiratory volume in 1 second (fev1), and fev1-to - fvc ratio . The fev1-to - fvc ratio after bronchodilator must be reduced (i.e., less than 80% predicted).16 the degree of severity of the disease is determined by clinical characteristics and the airflow limitation . Mild copd (stage i) is characterized by mild airflow limitation (fev1/fvc <70%, but fev1 80% of predicted), and at this stage the individual may not be aware that their lung function is abnormal; moderate copd (stage ii) occurs with worsening of airflow limitation (30% fev1 <70% of predicted and fev1 80% of predicted), and dyspnea becomes more intense to efforts; in severe disease (stage iii), fev1/fvc <70% or fev1> 50% of predicted plus respiratory insufficiency or clinical signs of right ventricular failure are evident.16 the concept of copd involves two entities, pulmonary emphysema and chronic bronchitis . Pulmonary emphysema may be defined as a chronic obstructive process, resulting in important alterations to the whole structure distal to the terminal bronchioles, called lobes, leading to accumulation of air in the lungs, condition called pulmonary hyperinflation.17 already chronic bronchitis is a clinical condition characterized by excessive secretion in the bronchial tree, the presence of chronic or recurrent cough, with expectoration for the least 3 consecutive months of the year and 2 consecutive years.18 physiopathology of chronic bronchitis involves the destruction of the lung parenchyma, causing pulmonary hyperinflation that leads to increased airflow obstruction and reduced lung elastic recoil.19 20 hyperinflation, due to alterations of the respiratory muscles, interferes in diaphragmatic excursion, which modifies the disposition of thoracic wall,21 reflecting an abnormal movement between the thorax and abdomen . The mechanical disadvantage found in patients with copd leads to recruitment of accessory muscles of inspiration and compromises diaphragm performance, which becomes rectified and decreases apposition area, thereby restricting its excursion.22 wouters emphasized that the clinical manifestations of copd extend beyond the lung issues, given the impact on general health by the influence of systemic manifestations, such as the incoordination of the swallowing function.23 swallowing is didactically divided into four phases: oral preparatory, proper oral, pharyngeal, and esophageal . The first two stages correspond to the preparation of food in the oral cavity by chewing (incision, mastication, and pulverization), associated with saliva to form the alimentary bolus, and the transport of the alimentary bolus toward the pharynx . In the pharyngeal phase, food is transported to the esophagus and involves a series of involuntary events for protection of the lower airway, which is the most important phase . The esophageal phase corresponds to the bolus transport to the stomach.24 dysphagia is characterized by any difficulty during the swallowing stage that prevents the proper conduct of the alimentary bolus from the oral cavity to the stomach.9 to verify the presence and severity of the swallowing disorder, after clinical evaluation speech - language pathologists often classify the swallowing dynamics according to the occurrence of clinical findings . The dysphagia risk evaluation protocol classifies swallowing at different levels ranging from level i (normal swallowing) to level vii (severe dysphagia); speech - language treatment is performed according to classification.25 it is noteworthy that dysphagia is not only detected by clinical evaluation due to the absence of clinical signs; sometimes it is necessary to objectively examine swallowing to verify aspirations that occur silently, with videofluoroscopy as the gold standard examination in this case.26 the lack of coordination of these movements is related to the presence of laryngeal penetration (i.e., the entry of secretions, food, or liquid above the level of the vocal folds and/or laryngotracheal aspiration, which happens with entry of any substance below the level of the vocal folds and can lead to aspiration pneumonia).5 26 subjects with copd are more susceptible to present this dyssynchrony.5 copd has the potential to alter the coordination between swallowing and breathing due to dyspnea and abnormalities of thoracoabdominal biomechanics, which negatively influences the normal process of swallowing of these individuals; they do not realize the respiratory pause that is observed in a process of normal swallowing, increasing the risk of penetration of the content into the pharynx.27 some authors suggest that the presence of dysphagia may be one factor that initiates the exacerbation of copd, especially when the incoordination of the swallowing reflex occurs with consequent laryngeal aspiration.10 28 exacerbations characterize the acute worsening of copd symptoms, accelerating the decline in lung function and compromising the quality of life of patients,29 30 because they increase the demand for doctor visits, hospitalization, and treatment costs . They can also contribute to airway inflammation and may present incomplete recovery and contribute to the decline of fev1, which in these patients is already at reduced values.31 32 proper coordination between breathing and swallowing events is essential for human survival, ensuring effective hydration and nutrition and preventing pulmonary aspiration.33 dysphagia may be the result of various disorders and diseases . Respiratory impairment itself leads the individual to have a higher energy expenditure, which can lead to weight loss and undernutrition . Swallowing disorders can also lead to other complications, including dehydration, aspiration pneumonia, or airway obstruction.34 strength and respiratory muscle endurance are reduced in patients with copd, because of hyperinflation, poor nutrition, and general deconditioning of the muscles that lead to increased work of breathing.35 the systemic effects of the disease go beyond the lung impairments . Pulmonary obstruction is caused by different pathophysiological factors that lead to hyperinflation of the lung.36 decline in lung function leads to diaphragmatic mobility reduction,37 and changes in diaphragmatic excursion alter the provision of thoracic wall, causing reverberating abnormal movement between the thorax and abdomen . Patients with copd commonly use the accessory muscles of respiration, which shortens the muscles and makes them tense . This change may reflect the disposition of the larynx and even the pharynx, damaging the effective process of swallowing . In a systematic review of the literature conducted by o'kane and groher, six of the seven studies surveyed documented some kind of alteration in the swallowing process of patients with copd.6 insufficient swallowing accompanied by pulmonary aspiration may be a predictive factor for exacerbations in patients with copd . In the same way, disease exacerbations may be precursors of poor swallowing, suggesting alteration in the swallowing reflex during exacerbations of the disease.38 the world health organization estimates that through 2030 the mortality and disability caused by copd will increase significantly . Estimates suggest that 5.5 million people have the disease in brazil, and it is a major cause of deaths in the country . Tobacco use is responsible for 80 to 90% of cases,14 and its chronic use is associated with decreased pulmonary function . In addition to cigarette smoke, inhalation of particles and toxic gases, such as smoke from the firewood, irritating gases, and occupational exposure, have a direct relation to the development and maintenance of airway obstruction.15 for pneumology and physical therapy, the gold standard instrument for disease diagnosis is spirometry, which observes the restriction to airflow before and after bronchodilator use . The most important parameters in view of clinical application are the forced vital capacity (fvc), forced expiratory volume in 1 second (fev1), and fev1-to - fvc ratio . The fev1-to - fvc ratio after bronchodilator must be reduced (i.e., less than 80% predicted).16 the degree of severity of the disease is determined by clinical characteristics and the airflow limitation . Mild copd (stage i) is characterized by mild airflow limitation (fev1/fvc <70%, but fev1 80% of predicted), and at this stage the individual may not be aware that their lung function is abnormal; moderate copd (stage ii) occurs with worsening of airflow limitation (30% fev1 <70% of predicted and fev1 80% of predicted), and dyspnea becomes more intense to efforts; in severe disease (stage iii), fev1/fvc <70% or fev1> 50% of predicted plus respiratory insufficiency or clinical signs of right ventricular failure are evident.16 the concept of copd involves two entities, pulmonary emphysema and chronic bronchitis . Pulmonary emphysema may be defined as a chronic obstructive process, resulting in important alterations to the whole structure distal to the terminal bronchioles, called lobes, leading to accumulation of air in the lungs, condition called pulmonary hyperinflation.17 already chronic bronchitis is a clinical condition characterized by excessive secretion in the bronchial tree, the presence of chronic or recurrent cough, with expectoration for the least 3 consecutive months of the year and 2 consecutive years.18 physiopathology of chronic bronchitis involves the destruction of the lung parenchyma, causing pulmonary hyperinflation that leads to increased airflow obstruction and reduced lung elastic recoil.19 20 hyperinflation, due to alterations of the respiratory muscles, interferes in diaphragmatic excursion, which modifies the disposition of thoracic wall,21 reflecting an abnormal movement between the thorax and abdomen . The mechanical disadvantage found in patients with copd leads to recruitment of accessory muscles of inspiration and compromises diaphragm performance, which becomes rectified and decreases apposition area, thereby restricting its excursion.22 wouters emphasized that the clinical manifestations of copd extend beyond the lung issues, given the impact on general health by the influence of systemic manifestations, such as the incoordination of the swallowing function.23 swallowing is didactically divided into four phases: oral preparatory, proper oral, pharyngeal, and esophageal . The first two stages correspond to the preparation of food in the oral cavity by chewing (incision, mastication, and pulverization), associated with saliva to form the alimentary bolus, and the transport of the alimentary bolus toward the pharynx . In the pharyngeal phase, food is transported to the esophagus and involves a series of involuntary events for protection of the lower airway, which is the most important phase . The esophageal phase corresponds to the bolus transport to the stomach.24 dysphagia is characterized by any difficulty during the swallowing stage that prevents the proper conduct of the alimentary bolus from the oral cavity to the stomach.9 to verify the presence and severity of the swallowing disorder, after clinical evaluation speech - language pathologists often classify the swallowing dynamics according to the occurrence of clinical findings . The dysphagia risk evaluation protocol classifies swallowing at different levels ranging from level i (normal swallowing) to level vii (severe dysphagia); speech - language treatment is performed according to classification.25 it is noteworthy that dysphagia is not only detected by clinical evaluation due to the absence of clinical signs; sometimes it is necessary to objectively examine swallowing to verify aspirations that occur silently, with videofluoroscopy as the gold standard examination in this case.26 the lack of coordination of these movements is related to the presence of laryngeal penetration (i.e., the entry of secretions, food, or liquid above the level of the vocal folds and/or laryngotracheal aspiration, which happens with entry of any substance below the level of the vocal folds and can lead to aspiration pneumonia).5 26 subjects with copd are more susceptible to present this dyssynchrony.5 copd has the potential to alter the coordination between swallowing and breathing due to dyspnea and abnormalities of thoracoabdominal biomechanics, which negatively influences the normal process of swallowing of these individuals; they do not realize the respiratory pause that is observed in a process of normal swallowing, increasing the risk of penetration of the content into the pharynx.27 some authors suggest that the presence of dysphagia may be one factor that initiates the exacerbation of copd, especially when the incoordination of the swallowing reflex occurs with consequent laryngeal aspiration.10 28 exacerbations characterize the acute worsening of copd symptoms, accelerating the decline in lung function and compromising the quality of life of patients,29 30 because they increase the demand for doctor visits, hospitalization, and treatment costs . They can also contribute to airway inflammation and may present incomplete recovery and contribute to the decline of fev1, which in these patients is already at reduced values.31 32 proper coordination between breathing and swallowing events is essential for human survival, ensuring effective hydration and nutrition and preventing pulmonary aspiration.33 dysphagia may be the result of various disorders and diseases . Respiratory impairment itself leads the individual to have a higher energy expenditure, which can lead to weight loss and undernutrition . Swallowing disorders can also lead to other complications, including dehydration, aspiration pneumonia, or airway obstruction.34 strength and respiratory muscle endurance are reduced in patients with copd, because of hyperinflation, poor nutrition, and general deconditioning of the muscles that lead to increased work of breathing.35 the systemic effects of the disease go beyond the lung impairments . Pulmonary obstruction is caused by different pathophysiological factors that lead to hyperinflation of the lung.36 decline in lung function leads to diaphragmatic mobility reduction,37 and changes in diaphragmatic excursion alter the provision of thoracic wall, causing reverberating abnormal movement between the thorax and abdomen . Patients with copd commonly use the accessory muscles of respiration, which shortens the muscles and makes them tense . This change may reflect the disposition of the larynx and even the pharynx, damaging the effective process of swallowing . In a systematic review of the literature conducted by o'kane and groher, six of the seven studies surveyed documented some kind of alteration in the swallowing process of patients with copd.6 insufficient swallowing accompanied by pulmonary aspiration may be a predictive factor for exacerbations in patients with copd . In the same way, disease exacerbations may be precursors of poor swallowing, suggesting alteration in the swallowing reflex during exacerbations of the disease.38 copd is a lung disease that affects 12% of the population, occurs in subjects mainly older than 40 years of both genders, and is the fourth to seventh leading cause of death in brazil.21 39 it is considered a public health problem that is growing every year . In brazil, studies related to copd epidemiology are scarce when compared with international studies, but the number of deaths from the disease has been increasing in the past 20 years, for both genders; mortality based on cause of disease increased 340%.40 smoking is a leading cause of copd, with the frequency of cigarette consumption associated with greater impairment of lung function and consequent airflow limitation.21 soares et al aimed to characterize the population to the risk of copd and found that in a sample of 157 subjects, 108 (68,8%) were male with a mean age of 53.85 years; the researchers also found that the greater amount of cigarettes smoked predominated in this sex.3 this finding highlights the need to perform early intervention in this population, to prevent the development and consequences of long - term copd . Some authors suggest that the clinical manifestations of copd may affect other important functions such as swallowing, which is justified by the incoordination during apnea of respiration when food passes through the pharynx.28 the pharyngeal phase of swallowing is considered the most important, because there are many occurrences necessary for directing the alimentary bolus movements, such as elevation and anterior displacement of the larynx, firm glottal closure and lowering of the epiglottis, along with breathing apnea; that there should be a synchronism in that movement so that the aliment is not diverted toward the lower airway.25 drozdz et al analyzed the pharyngeal phase of swallowing in subjects with chronic cough using videofluoroscopy.41 they found that mild dysphagia occurred in 20% of cases and they concluded that this population, despite not presenting swallowing complaints, has higher aspiration risk due to alteration in breathing pattern that could lead to lack of coordination between swallowing and breathing . Bastille et al compared the results of clinical and objective evaluation of swallowing of a subject diagnosed with copd.42 they found that the clinical evaluation of swallowing was normal; however, due to the presence of chronic cough, videofluoroscopy showed the presence of laryngeal penetration of the laryngotracheal aspiration, which was silent due to the decreased sensitivity of the laryngeal region . In this context, several studies have shown the relation of dysphagia with disease exacerbation in patients with copd . In one of these studies, a self - perception questionnaire was used, and 35 patients in clinical and medication treatment reported the presence of dysphagia in the pharyngeal and esophageal phases of swallowing.5 one study of 61 patients with no history of copd exacerbations in the previous 4 weeks, using the repetitive saliva swallowing test (rsst) and the modified water - swallow test, showed that dysphagia causes exacerbations in copd subjects; the rsst test was useful for dysphagia detect associated with exacerbations.43 similar findings were found in 2009, when 64 patients with copd were tested with the simple two - step swallowing provocation test and the rsst; swallowing dysfunction could be observed in the mild stage of the disease.13 in research conducted in 2007, 50 patients with copd were evaluated based on the response latency time of the swallowing reflex, timed from the instillation of 0.03 ounces of distilled water to the pharynx through a nasal catheter; results indicated impairments in this reflex, which was significantly associated with disease exacerbation.10 similar results were observed in a 2010 study, when 65 patients with copd who had episodes of exacerbation recorded over a period of 12 months were assessed using a self - perception questionnaire; results showed altered swallowing reflex that could predispose them to disease exacerbations.12 videofluoroscopy was used to evaluate 16 patients, and results suggested that impairments in swallowing may occur when there is ingestion of large quantities of liquids . Still, the authors suggested possible association of respiratory pattern with swallowing disorders.44 similar results were evidenced in 2002 in a study that also used videofluoroscopy to evaluate patient swallowing, which concluded that these patients had abnormal physiology of swallowing.45 gross et al in their study found that patients with copd had alterations between the process of breathing and swallowing, and this alteration may increase the risk of pulmonary aspiration contributing to disease exacerbations.28 the evaluation used respiratory inductance plethysmography to track respiratory signs, as well as the electromyography to score the behavior of the act of swallowing during each respiratory cycle . Mckinstry et al observed that alterations in the respiratory mechanics of copd commonly include swallowing disorders.46 research indicates that people with the disease have a propensity to develop oropharyngeal dysphagia as a consequence of the lack of coordination between breathing and swallowing . In research conducted by mokhlesi et al, the starting point was the hypothesis that patients with copd have a lower rest position and reduced larynx elevation, which increases the risk of aspiration.45 videofluoroscopy may show these patients have abnormal swallowing, but more studies are needed to assess the aspirations as a cause of exacerbations . Previous studies have cited these findings, noting that reduced laryngeal elevation occurs during the swallowing process and alterations of the cricopharyngeal muscle . The literature describes that this dysphagia in these patients is related to the lack of coordination between breathing and swallowing.33 in a study of 78 patients with copd, we observed that 85% of them had some degree of dysphagia.19 in a study performed with patients with copd and gastroesophageal reflux disease, patients who had daily or weekly symptoms were more prone to exacerbations of the disease, which may occur due to microaspirations of gastric contents leading to irritation of the airways . Another mechanism would be to increase intra - abdominal pressure generated by hyperinflation and increased respiratory effort, which alters the relation between the diaphragm and the esophageal sphincter.47 thus, it is evident that early detection of the presence of dysphagia, mainly related to lack of coordination between the functions of swallowing and breathing in subjects with copd, may assist in decreasing the disease exacerbation . In this review, a relationship between the presence of dysphagia and exacerbations of copd was noted, as identified by studies demonstrating that the difficulties associated with swallowing might lead to disease exacerbations . There seems to be a consensus among authors concerning this relation, so that the main factor for this occurrence is related by the lack of coordination between the functions of breathing and swallowing, because subjects with copd do not perform adequately apnea of breath . More research to clarify the relation between dysphagia and exacerbations of copd is needed; it might then possible to search multidisciplinary strategies to assist in the treatment of these patients in a comprehensive manner, to cater treatment to their specific needs due to systemic manifestations of pulmonary disease.
The plant c. chaerophylla was collected from nepal . Dried and powdered roots (435 g) were extracted with methanol in a soxhlet extractor . The crude base fraction was chromatographed over sio2 gel column eluting with solvents of increasing polarity . Eluants from c6h6-chcl3 (15: 85) on crystallisation from methanol furnished colorless granules (30 mg), rf . . 180~181, c20 h23 no4 (m341), []d-300 (c, 1.5, etoh). Mass spectrum exhibited molecular ion peak at m / z 341 and retro - diel's alder cleavage of ring c gave a base peak at m / z 190 . The hnmr and c nmr spectral data were identical to alkaloid 1-corydalmine (cava et al ., 1968). It was finally identified as 1-corydalmine by direct comparison with authentic sample (mixed m.p ., co - tlc and super imposable ir (fig . Stock solution (1000 ppm) of 1-corydalmine was dissolved in 5 mg of compound initially in a few drops of methanol and chloroform (1: 1) in a test tube . Required concentrations of the chemical (100, 250, 500, 750, 1000 and 1500 l) were made by the dilution of the solution with distilled water . The chloroform and methanol were evaporated on water bath at 80. a drop (30~40 l) of different concentrations of the chemical was placed separately on grease - free glass slides for studying spore germination . Several fungi, e.g., alternaria brassicae, a. brassicicola, a. solani, curvularia lunata, curvularia maculance, a curvularia sp ., h. penniseti and a heterosporium sp ., were isolated from their respective infected plant parts . Small portions of the infected material were incubated in moist petri dishes for 24 h and the fungal growth developed after 24 h on potato dextrose agar (potato 250 g + dextrose + agar 20 g + distilled water 1,000 ml) was picked up by an inoculating sterile needle and inoculated on slants which were later purified by single spore isolation technique (singh et al ., 1990). Approximately 200 - 300 spores of each fungus were picked up from fresh sporulating cultures by an inoculating needle aseptically and mixed in a drop of chemical kept on glass slides . The spores of erysiphe pisi causing powdery mildew of pea (pisum sativum) were directly removed from the infected leaves and mixed similarly with the chemical . All the slides were kept in petri dishes, which were humidified by fixing moist filter paper on the lower and upper surfaces of the base and lid of the petri dishes . All the petri dishes were incubated at 25 2 for 24 h. after incubation a drop of cotton blue prepared in lactophenol was put on the drop of the chemical containing spores and finally covered with a cover slip . The spore germination was observed under nikon binocular research microscope and finally the percent spore germination was calculated . Several fungi, e.g., alternaria brassicae, a. brassicicola, a. solani, curvularia lunata, curvularia maculance, a curvularia sp ., c. pallscens, fusarium udum, a helminthosporium sp ., h. penniseti and a heterosporium sp ., were isolated from their respective infected plant parts . Small portions of the infected material were incubated in moist petri dishes for 24 h and the fungal growth developed after 24 h on potato dextrose agar (potato 250 g + dextrose + agar 20 g + distilled water 1,000 ml) was picked up by an inoculating sterile needle and inoculated on slants which were later purified by single spore isolation technique (singh et al ., 1990). Approximately 200 - 300 spores of each fungus were picked up from fresh sporulating cultures by an inoculating needle aseptically and mixed in a drop of chemical kept on glass slides . The spores of erysiphe pisi causing powdery mildew of pea (pisum sativum) were directly removed from the infected leaves and mixed similarly with the chemical . All the slides were kept in petri dishes, which were humidified by fixing moist filter paper on the lower and upper surfaces of the base and lid of the petri dishes . All the petri dishes were incubated at 25 2 for 24 h. after incubation a drop of cotton blue prepared in lactophenol was put on the drop of the chemical containing spores and finally covered with a cover slip . The spore germination was observed under nikon binocular research microscope and finally the percent spore germination was calculated . The effect of the chemical was tested at varying concentrations starting from 100, 250, 500, 750, 1,000 to 1,500 ppm . The maximum effect of the chemical was seen on the spores of h. penniseti as there was no germination at 1,500 ppm and also only 21% at 1,000 ppm as compared to control (87.33%). Similarly, among the four curvularia species, c. lunata was the most sensitive as the spore germination was significantly inhibited even at 250 ppm . Significant inhibition of spore germination in a. brassicae was observed at 500 ppm and above and other two species of alternaria showed sensitivity at 750 ppm and above concentrations . While 250 ppm and above doses were significantly inhibitory for the germination of spores of heterosporium species, similar significant effect on erysiphe pisi and f. udum was seen at 1,000 and 1,500 ppm concentrations (table . A number of chemical compounds isolated from plants are antifungal (singh et al ., 1990; srivastava et al ., 1994; sarma et al ., 1999; singh et al ., 1999; basha et al ., 2002; maurya et al ., 2001, 2002; the fungi included in the present study belong to two different groups . But based on the activity of the chemical, it is at present difficult to conclude as to which group of fungi will be most susceptible to this chemical as the number of fungi from different groups is very low . Hence, only further detailed study on several members of other groups will decide its limit and specificity of efficacy . Nevertheless, as antifungal activity of the present compound has not been reported so far and the efficacy is significantly high at low concentrations, there is enough possibility of using this compound in plant disease control under field conditions.
It is well known that oxidant by - products of normal metabolism such as free radicals and reactive oxygen species (ros) in excess can cause extensive damage to dna, proteins, and lipids . Under stress, the body produces more ros, such as superoxide anion and hydroxyl radical, which are highly reactive and potentially damaging transient chemical species . These are continuously produced in the human body, as they are essential for energy supply, detoxification, chemical signaling, and immune function . Overproduction of free radicals and ros induced by exposure to external oxidant substances or a failure in the defense mechanisms causes oxidative stress in turn leading to various degenerative diseases of aging such as cancer, cardiovascular disease, cataracts, immune system decline, and brain dysfunction [2, 3]. Antioxidants reduce the oxidative stress in cells and are therefore useful in the treatment of many human diseases . The endogenous sources include antioxidant enzymes such as superoxide dismutase, catalase, glutathione peroxidase, and low - molecular weight antioxidants and exogenous sources such as food sources and medicinal plants . Several in vitro, ex vivo, and in vivo methods are used to measure the antioxidant potential of plants and foods . It is well known that the antioxidant capacity of a sample will differ with the different oxidants it is measured against, the substrate used (food or biological substrate), and the analytical method used to measure the overall antioxidant capacity . It is also important to examine the effect of antioxidant on markers of oxidative stress . Several biomarkers can be used to assess oxidative damage to lipids, protein, and dna . Thiobarbituric acid reactive substances (tbars) method is used to measure the level of resistance to oxidation . It determines the resistance of lipids and proteins to oxidation in the presence of an antioxidant . The malondialdehyde (mda) generated through oxidative degradation of polyunsaturated fatty acids forms a complex with thiobarbituric acid (mda - tba complex) to give a pink color which can be measured spectrophotometrically . These peroxidation products are measured to monitor levels of oxidative stress and are thus an indirect measure of antioxidant capacity . Biological substrates such as brain, microsomes, low density lipoprotein (ldl), red blood cells (rbc), and cholesterol are susceptible to oxidation due to their composition . Microsomes and rbc denatured haemoglobin products, particularly free heme, can promote membrane damage and hemolysis through mechanisms including lipid peroxidation and oxidation of protein thiol groups . The disruption of normal processes through injury or the presence of a xenobiotic may greatly enhance the microsomal source of free radicals, resulting in chemical modifications of surrounding structures . Extracts from the stems, roots, bark, leaves, fruits, and seeds of many plants have antioxidant potential . Phytomedicines are active ingredients exclusively derived from plants which are capable of preventing, curing, or managing a disease . Literature reports the use of various parts of medicinal plants from the western ghats of southern india in the treatment of several diseases . The whole plant of abutilon indicum has been used in urinary diseases and inflammation, the leaves of alstonia scholaris have been used in the treatment of asthma, beriberi, ulcers, and tumors, and the fruit of catunaregam spinosa has been used in the treatment of diarrhea and dysentery while the root of asparagus racemosus is reported to be beneficial in the treatment of piles, gastritis, cough, and diarrhea . In our laboratory, biscuits prepared by incorporating the extracts of amla powder (emblica officinalis), drumstick leaves (moringa oleifera), and raisins (vitis vinifera) exhibited better shelf life and were acceptable in sensory characteristics . Other medicinal plants, namely, morus indica, moringa oleifera, aegle marmelos, raphanus sativus, olive leaves, pomegranate peel, costus speciosus, canthium parviflorum, and abrus precatorius leaf extracts, have effectively inhibited the rate of oxidation in the edible oil emulsions . The selected medicinal plants for the study, andrographis paniculata, costus speciosus, canthium parviflorum, and abrus precatorius, have been reported to exhibit antioxidant, antipyretic, antibacterial, antiviral, anticancer, hypoglycemic, hepatoprotective, gastroprotective, immunoprotective, and cardioprotective effect [1419]. These four plants were selected to investigate their antioxidative ability in biological substrates based on our earlier investigations which revealed their ability to inhibit oxidation in food system [12, 13]. In this ex vivo study, the antioxidative ability of various solvent extracts of these four plants to prevent oxidative damage against fenton's reagent induced peroxidation in human erythrocytes and rat liver microsomes were explored . Thiobarbituric acid, triethanolamine, rutin, dithiothreitol, and edta were purchased from hi media pvt . Ltd . The plant samples selected for the study were andrographis paniculata (anp), costus speciosus (cs), canthium parviflorum (cp), and abrus precatorius (ap) which were collected from the western ghats . Janardhan, department of studies in botany, university of mysore, and voucher specimen was retained in the laboratory for future reference . The leaves were cleaned, washed, and dried in hot air oven at 55c for 810 h. the dried leaves were ground to a fine powder and passed through 60 sieve mesh and stored in air tight containers until use . Three different extracts were prepared from the dehydrated samples, that is, 100% methanol (me), 80% methanol (methanol 80: water 20) (80 me), and 100% aqueous (aq). 10 g of each sample was extracted in 100 ml of the solvent in a mechanical shaker for 12 hours and filtered with whatman number 1 filter paper . The filtrate obtained from me and 80 me was evaporated to dryness in a rotary evaporator at 50c (superfit, bangalore) and aqueous extract was freeze dried (thermo electron corporation, pune). Ascorbic acid was determined according to the titrimetric method using 2, 6-dichlorophenol - indophenol dye . -tocopherol was extracted by direct saponification of dried sample and estimated based on formation of a red complex from reaction of,-bipyridyl with ferrous ion due to reduction of ferric ion by tocopherol . -carotene was quantified by open column chromatography, followed by measuring the absorbance of elute at 450 nm against standard -carotene . Reduced glutathione was determined based on the development of a yellow compound due to reaction of dtnb (5, 5-dithio(bis)nitrobenzoic acid) with compounds containing sulphydryl groups . Total phenols were extracted from a weighed portion (1 g) of dried sample with 5 ml of 1.2 m hcl in 50% aqueous methanol for 2 h and with 70% acetone shaken for 2 h and analyzed by folin - ciocalteu micromethod . Saponins and steroidal saponins were estimated using diosgenin as standard [26, 27]. Two substrates, namely, rbc and microsomes, were chosen to study the potency of selected samples in inhibiting oxidation . Blood (20 ml) was drawn from healthy human volunteers, in vials, and centrifuged at 500 g for 10 min at 4c and plasma was separated . Rbc were washed with cell wash buffer in 1: 2 ratio (rbc-1: buffer-2) and centrifuged at 500 g for 10 min at 4c . The supernatant was removed and the procedure was followed 2 - 3 times . The study was approved by the human ethics committee of the university of mysore (ihec - uom number 36 res/2013 - 14, 16.04.2013). Microsomes were isolated from the liver of healthy adult male rats from central animal house of the university of mysore . Permission from institutional animal ethics committee of the university of mysore was taken (uom / iaec/04/2013 dated 28 - 09 - 2013). The liver tissue was minced, homogenized, and centrifuged for 10 min at 12,000 g to remove cell debris and mitochondria . The supernatant solution was carefully removed to prevent contamination with mitochondria and recentrifuged for 10 min at 12,000 g to ensure removal of mitochondria; it was then centrifuged at 60,000 g for 60 min . Frozen microsomes were resuspended in 0.1 m triethanolamine buffer, ph 7.4 containing 0.02 m edta, and 10 mm dithiothreitol . It was allowed to stand for 60 min packed in ice and diluted with buffer to give a protein concentration of 510 mg / ml . Substrate (rbc and microsomes) equal to 1 mg protein was taken for the experiment . Plant extracts of different concentrations (300500 l of 10 mg / ml concentration) were added to the substrates . Fenton's reagent was added to the substrates to induce oxidation (500 l of 20 mm feso4 and 250 l of 20 mm h2o2). In case of rbc, 1 ml trichloroacetic acid (tca, 10%) was added to precipitate the rbc and both substrates were incubated for 2 h at 50c . After 2 h, the rbc were separated by centrifuging at 3000 rpm for 10 min at 5c . The supernatant was separated and 1 ml of thiobarbituric acid (tba, 0.67%) was added . To the microsomes, 1 ml of tba (0.67%) and 1 ml of tca (10%) were added and kept in boiling water bath for 30 min and cooled . After cooling, 3 ml butanol was added to the tubes and vortex mixed . Ic50 values were calculated using mean values of triplicates of the inhibition of oxidation by the extracts at 300500 l . Consider (1)% inhibition of oxidation = o.d of controlo.d of sample[o.d of control]100 . Data was subjected to one - way anova using spss software, 2011 version (p <0.05). Antioxidants and phytochemicals from medicinal plants are now being used to counteract oxidation at the biological level, which is a safer approach than using pharmaceutical drugs to reduce oxidation . The plants investigated are used in traditional medicine for various medicinal and pharmacological effects [1419]. Studies also report that they exhibit good antioxidant activity in vitro [13, 31] table 1 depicts the phytochemical composition of the samples, where it was observed that cs and anp were good sources of polyphenols, glutathione, -carotene, total saponins, and steroidal saponins, whereas ap and cp were found to be good sources of flavonoids, alkaloids, -tocopherol, vitamin c, and tannins . In general, all the extracts of the samples were found to be fair sources ofpolyphenol and flavonoids; however, it was high in the extracts of ap . The polyphenol content in two extracts of anp (aq and me) was higher than in cp and cs, while the polyphenols in 80 me of cp and cs was higher than anp . Similarly, the flavonoid content of ap was high in all the extracts, followed by anp> cp> cs . It may be inferred that methanol and 80% methanol are solvents suitable for extraction of polyphenol and flavonoid in these samples . Similar trend was observed in earlier studies on morus indica [32, 33] and moringa oleifera . Lipid peroxidation is a complex process wherein the initially formed lipid radicals are converted to tbars . The first event of lipid peroxidation is oxygen absorption . In fenton's reaction, the free radical produced is hydroxyl radical which is the most deleterious and reactive radical among the ros with shortest half - life . The oxygen derived hydroxyl radicals in presence of transition metal ion fe causes the degradation to form malondialdehyde (mda) which produces a pink chromogen with thiobarbituric acid . Mda produced due to oxidative damage of biological substrates is an indicator of free radical pathology . In the present work, tbars was used to evaluate the antioxidative activity of different medicinal plant extracts and inhibition of generation of hydroxyl radicals by fenton reaction in two biological substrates, microsomes and rbc . Microsomes due to their high pufa content are susceptible to oxidation and hence are extensively used as a model for studying oxidative stress and antioxidant studies . The inhibition of oxidation at different concentrations (300, 400, and 500 l) by different solvent extracts of the sample is given in figure 1 . The activity was found to be dose dependent in all the extracts . At higher concentration, the inhibition was greater in 80 me (77%) and me (74%) of cp, cs (me, 68% and 80 me, 68%), and anp (me, 71%). In aq extract the activity was low in all the samples and maximum percent inhibition observed was 51 2.90% in cp . The results are in accordance with an earlier study in morus indica where me and 80 me extracts were potent in inhibiting the oxidation in microsomes . The inhibition of oxidation at different concentrations (300, 400, and 500 l) by different solvent extracts of the sample is given in figure 2 . The activity was found to be dose dependent in all the extracts of ap, whereas in the me of cs and anp, 80 me of cp, and aq of anp the maximum activity was exhibited at 400 l; however no notable difference was observed in the activity between 400 and 500 l . Among all the extracts of the samples, maximum activity of more than 90% as expected, tbars values were effectively reduced by the plant extracts in biological substrates . This indicated that the extracts could efficiently prevent the nonenzymatic induced lipid peroxidation in various models . The mode of action is primarily reducing oxidative damage by trapping the free radicals directly or scavenging them through a series of coupled reactions with antioxidant enzymes, contributing to stabilization of lipid peroxides . Hplc - ms analysis of ugni molinae leaves revealed the presence of polyphenols, flavonols and flavanols, myricetin, quercetin, and epicatechin . In another study, the stem bark extract of semecarpus anacardium showed significant protection against fenton reaction induced lipid peroxidation in sheep liver tissue homogenate model and heat induced hemolysis in human rbc membrane model . Hence, the antioxidant activity of these medicinal plants can be related to their phytochemical constituents . The ic50 values of different solvent extracts of the samples are depicted in figure 3 (microsomes) and figure 4 (rbc). In microsomes, it can be observed that the ic50 values of me (235 g) and 80 me of cs were lower than other extracts followed by me of anp and 80 me of cp . In rbc, the ic50 value of 80 me of cs (112 g) and, ap and aq of cp was lower than other extracts . In rest of the extracts, no remarkable difference was observed; however, a high ic50 value (921 g) was observed in me of ap . The correlation was measured in all the extracts in both substrates (given in tables 2 and 3). Me (r = 0.95; p 0.01) and 80 me (r = 0.96; p 0.01) of cp and cs and 80 me (r = 0.93; p 0.01) have shown a high correlation with both polyphenols and flavonoids indicating the protective effect of these phytochemicals on biological substrates . The inhibitory action might also be due to the presence of other phytochemicals such as glutathione, ascorbic acid . Literature reports the presence of alkaloids in these plants such as 2-amino-4-benzylthiomethyl-6-morpholino-1,3,5-triazine present in abrus precatorius, the lactone andrographolide and flavonoids, 5,7,2,3-tetramethoxyflavanone and 5-hydroxy-7,2,3-trimethoxyflavone in andrographis paniculata, flavonoids and phenolic compounds present in canthium parviflorum, and alkaloids and flavonoids in costus speciosus which also might have imposed a protective effect . It can be inferred from the findings that andrographis paniculata, abrus precatorius, canthium parviflorum, and costus speciosus possess ability to inhibit oxidation of biological substrates, by virtue of the presence of flavonoid and polyphenols . Further studies to isolate and identify the bioactive constituents are in progress for their optimal utilization.
The majority of emboli arise from the heart in association with atrial fibrillation, myocardial infarction, or valvular heart disease [24]. Approximately two - thirds of non - cerebral emboli obstruct the lower extremities, involving aorto - ilio - femoral arteries in approximately two - thirds of the patients, with the most common site being the femoral artery . Presentation of ali varies from silent ischemia to acute extremity loss, depending on the presence and extent of atherosclerosis and collateral blood flow . In ali patients with certain comorbidities, loss of extremities and death are not rare outcomes . Without intervention, mortality, gangrene, and chronic ischemia rate in long - term follow - up contemporary effective methods are mechanical thromboembolectomy, percutaneous thrombosuction (pt), and catheter directed thrombolysis . Despite use of these therapies, ali still carries a high risk for limb amputation (518%) and death (814%) [911]. Percutaneous removal of thrombi is a well - established treatment modality and is often used as the first - line therapy in ali patients . Pt and mechanical thrombectomy are effective methods for thrombus removal, but they cannot be applied to all patients due to technical reasons [1214]. Regardless of the treatment method, the success rate is lower in below - knee arteries compared to upper segments . Pt method is easier than mechanical thromboembolectomy, with similar outcomes; nevertheless, residual thrombus, distal microembolization, and dissection are disadvantages of both methods . Tirofiban is a strong antiaggregant that inhibits gpiib / iiia receptors and blocks 95% of platelet aggregation . The reduction of thrombus load is a well - known effect of tirofiban in coronary interventions . Pt together with tirofiban decreases slow - flow / no - flow phenomenon in coronary interventions and improves coronary arterial circulation . Despite being an established antiaggregant agent in patients with coronary thrombi, the efficacy and adverse effects of tirofiban in peripheral arterial diseases, especially in below - knee ali the aims of this study were to evaluate the effects of early pt (within the first 24 h) and additional tirofiban usage on procedural success, long - term safety, and the need for amputation in knee and below - knee arterial ali . Data from consecutive ali patients with popliteal and infra - popliteal arterial thrombosis who underwent pt within the initial 24 h between january 2010 and september 2015 were analyzed retrospectively . Limbs were classified using the society for vascular surgery / international society for cardiovascular surgery (svs / tscvs) clinical categories of ali (rutherford category). The degree of baseline occlusion was determined by using the schema adapted from ansel et al . . The patients with rutherford iia or iib, and patients with 91100% arterial occlusion on angiography were included in the study . Patients with a rutherford class i or iii, an inr higher than 1.5, serum creatinine> 2.5 mg / dl, and with comorbidities requiring tirofiban use were excluded from the study . Minneapolis, mn) using 7f (popliteal) and 6 - 5f (infra - popliteal) guiding catheters and a 0.014-inch wire in all 3 below - knee arteries until the thrombus completely disappears . The procedure was accepted as successful when 70% revascularization of the arterial lumen (thrombus removal) and maintenance of distal arterial blood flow were achieved . Tirofiban was given as a 10 g / kg bolus followed by a 0.15 g / kg / min infusion for 12 h . Unfractionated heparin (ufh) was administered at a bolus dose of 50100 u / kg, with a target activated clotting time (act) of 250300 s. ufh infusion continued for 24 h. slow - flow was defined as a timi-2 flow grade (i.e., requiring 3 beats to opacify the vessel) or a corrected timi frame count> 27 frames . Distal embolization was identified as disappearance or abrupt and unexpected occlusion of a distal vessel that had been visible in preprocedural cineangiograms . Sheath removal for the tirofiban - treated group was time - based (60 min after infusion discontinuation). The sheath was removed if act was below 180 s. major bleedings were accepted as intra- and retroperitoneal bleeding, intracranial bleeding, any overt procedure - related bleeding with a hemoglobin drop of 5 g / dl, and transfusion needing or invasive procedure needing bleedings . Minor bleedings were accepted as bleedings which did not need any transfusion or invasive procedure . Development of arterial occlusion or thrombus were checked in all patients by physical examination and doppler ultrasonography at the end of 6-month follow - up . Statistical analysis was performed using spss statistical software (spss version 19; spss, inc ., to assess the significances of differences, the t test was used for means and chi - square for percentages . Statistical analysis was performed using spss statistical software (spss version 19; spss, inc ., data are presented as mean standard deviation or percentages . To assess the significances of differences, from these, 105 patients (mean age 6716 years; 53% men) had 6-month follow - up . The majority of patients (69%) had infra - popliteal occlusion and below - knee atrial thrombus (67%) presenting with a slightly higher frequency (54%) of rutherford iib clinical status . Overall, atrial fibrillation (n 64, 61%) and hypertension (n 60, 57%) were the most important comorbidities . Clinical features of the tirofiban - treated and -untreated patients were similar to each other, except for a higher frequency of diabetes (52% vs. 40%; p=0.05) and structural heart disease (5% vs. 21% p=0.001) in the tirofiban - treated group . Slow flow entity was significantly higher in patients with diabetes mellitus (67%) and in smokers (57%). Post - procedural slow flow rate (17% vs. 30%; p<0.01) and distal embolization (6% vs. 16%; p=0.01) were significantly lower in patients receiving tirofiban . Rate of major (8% vs. 5%) and minor (29% vs. 9%) bleeds were higher in the tirofiban group, but the only statistically significant difference was minor bleeding rate . During 6-month follow - up, post - procedural hemodialysis requirement, need for amputation, recurrent emboli, significant vessel lesions, and mortality were recorded in all patients . The amputation rate was 9% and the rate of new occlusion was 19% . In both groups, hemodialysis requirement and recurrent emboli rates also, development of significant occlusion in the thrombus region was similar between those receiving and not receiving tirofiban (table 2). From these, 105 patients (mean age 6716 years; 53% men) had 6-month follow - up . The majority of patients (69%) had infra - popliteal occlusion and below - knee atrial thrombus (67%) presenting with a slightly higher frequency (54%) of rutherford iib clinical status . Overall, atrial fibrillation (n 64, 61%) and hypertension (n 60, 57%) were the most important comorbidities . Clinical features of the tirofiban - treated and -untreated patients were similar to each other, except for a higher frequency of diabetes (52% vs. 40%; p=0.05) and structural heart disease (5% vs. 21% p=0.001) in the tirofiban - treated group . Slow flow entity was significantly higher in patients with diabetes mellitus (67%) and in smokers (57%). Post - procedural slow flow rate (17% vs. 30%; p<0.01) and distal embolization (6% vs. 16%; p=0.01) were significantly lower in patients receiving tirofiban . Rate of major (8% vs. 5%) and minor (29% vs. 9%) bleeds were higher in the tirofiban group, but the only statistically significant difference was minor bleeding rate . During 6-month follow - up, post - procedural hemodialysis requirement, need for amputation, recurrent emboli, significant vessel lesions, and mortality were recorded in all patients . In both groups, hemodialysis requirement and recurrent emboli rates were the same (table 2). Also, development of significant occlusion in the thrombus region was similar between those receiving and not receiving tirofiban (table 2). Early pt intervention in ali even without tirofiban use is an easy and effective approach . Major bleeding rate has not increased but the minor bleeding rate was high . In all groups of patients, additional procedures increased the success rate to 91.5% . However, with exclusion, none of the patients were in rutherford iii stage in the first 24 h. there is not any criterion standard invasive or medical treatment approach in ali . Though knee and below - knee region thromboses rate are 50% of all cases, their response rate to treatment is lower than in upper segments . Below - knee arterial thromboses occurred in 67% of our cases; they were complicated lesions for successful bypass or thrombectomy . Even if the operation is successful, the surgical mortality rate can reach to 20%, especially in old and comorbid patients . Its use in knee and below - knee arterial thromboses is rare and not easy . The rates of major and minor bleeding using the thrombolytic approach are 617% and up to 17%, respectively [2730]. The low success rate in thrombolytic treatment is due to slow revascularization effect, inability to prevent myocardial infarction, organization of thrombus with different ages, and resistance to thrombolytic therapy . Mechanical thrombectomy is another effective approach to below - knee arterial thromboses, with a success rate of 90% . Other possible complications are residual occlusion, distal embolization, dissection, or lesions which need balloon or stent . Acute renal insufficiency due to hemoglobinuria caused by extreme muscle damage during or after mechanical thromboembolectomy may occur . Administration of pt in the coronary system or in acute myocardial infarction effectively reduces thrombus load and prevents no - reflow / slow flow . In myocardial infarction, aspiration of the thrombus and cleaning of atherosclerosis material before stent implantation has improved blood flow in arterioles and capillaries . There are studies that show pt administration in ali is effective . However, distal microembolization and dissection are disadvantages of pt use . In our study, the most important disadvantage was dissection via catheter, which significantly interrupts the flow (8%). This could be related to our catheter selection according to the vessel diameter for pt . Even with the thrombolytic approach, catheter - related trauma is 1.4% . In our cases, although ali can be treated up to 14 days after injury, early intervention reduces tissue damage and improves success . Interventions within 24 h has good outcomes . In our study, we have seen the same outcomes . Good outcomes and high success rate are due to intervention within 24 h. in the early stages, the thrombus is softer and more mobile . Later, the thrombus gets more organized and does not respond to thrombus aspiration and other medical procedures . Outcomes are also good in long - term follow - up (amputation 9%, survival rate 99%). In our study, no patient with clinical stage of rutherford iii was included within 24 h. this shows that early intervention prevented irreversible damage . We observed no acute renal insufficiency case in our study, due to early intervention that reduces tissue damage and reopens the vessels . It has the same early revascularization benefits in myocardial infarction and cerebrovascular events, and in our study we had the same results . Distal embolization is another factor affecting amputation and success rates of the procedure . In our study, amputation could be needed despite successful revascularization . In our study, the amputation rate was 11%, and in the tirofiban group it was lower (6%). Aha and esc have recommended tirofiban use in patients with massive thrombus, no - flow, slow flow, and thrombolytic complications for st segment elevation myocardial infarction . Tirofiban is effective in peripheral arterial disease with massive thrombus load, and using ali with tpa has been shown to be effective and safe . Decreased distal microembolization, platelet aggregation, and vascular thrombus formation potentially decreased abrupt ppi closure have increased the efficacy of thrombolytic therapy and improved long - term revascularization rates, with a potential decreased need for secondary re - interventions, especially in the diabetic ali population . Pt in ali has not been evaluated yet . In our study, tirofiban was effective and useful on slow flow and distal embolization . The importance of slow flow in ali is not known well, but slow flow is associated with distal embolization . Diabetes mellitus and smoking, which are risk factors for slow flow, are also risk factor for slow flow entity in ali [4749]. Despite the different amputation rates, it is lower in the tirofiban group (11% vs. 6%). The amputation rate was not significant in our study, probably due to patient number; however, significant outcomes could be reached in studies with more patients . Amputation can be secondary to distal embolization, so a lower amputation rate can be due to lower slow flow and distal emboli rate . As mentioned before, tirofiban is useful when applied to peripheric vascular disease for slow flow and distal microemboli . So during or post - surgical intervention, when slow flow or distal embolization is seen, tirofiban infusion can improve long - term success of the intervention . However, the adverse effect of bleeding on mortality and morbidity (8%) was lower than with other methods like thrombolytic approach . Major bleeding and minor bleeding rates were 613% and 517%, respectively . In ali when patients other diseases are taken in account, tirofiban has a negative effect on them but not on the procedure - related morbidity . Our study has some limitations: it was a non - randomized retrospective study, and the number of patients in the study group was small because of inclusion of patients presenting within 24 h of symptom onset and the localization of the thrombus . Pt approach only within 24 h of symptoms of ali in knee and below - knee arteries is impressively effective, with satisfactory results . Tirofiban could be used effectively in patients with slow flow entity and distal embolization, without increasing further risk.
The primary teeth restoration differ from permanent teeth due to the limited lifespan of teeth, different morphology of primary molars, lower biting forces in children and their susceptibility to caries.1 - 3 an ideal restorative material in children requires minimal cavity preparation, have adequate strength and wear properties, be easy to place with a certain amount of adhesion to tooth structure, and not be moisture sensitive during placement and setting.4 glass ionomer cement (gic) seems to meet most of these requirements along with particular advantages like ability to leach fluoride, coefficient of thermal expansion similar to tooth, chemical bonding to enamel and dentin, dimensional stability, insolubility in oral fluids at intraoral temperatures, excellent biocompatibility,5 better esthetics and less sensitivity to dentin moisture6 making it highly appropriate for use in children . The adhesiveness of restorative materials to tooth structure is an important factor in current restorative technique.7 it prevents micro leakage, secondary caries, marginal discolorations and pulpal damage . With effective adhesion, adhesions are usually evaluated by the determination of tensile and shear bond strength (sbs). Some of the commercially available gics are silver reinforced gic - miracle mix (mm) (gc america inc ., alsip high viscosity gic -ketac molar (3 m corp ., minnesota, usa) and the more recent ceramic reinforced glass ionomer amalgomer cr (advanced healthcare ltd . Thus, the present study was conducted to determine the sbs of the above - mentioned gics in primary teeth in vitro . This study comparatively evaluates sbs as the values of bond strength vary greatly with the method used, and it is advisable not to focus on absolute values of bond strength, but rather to compare different types or brands of materials.8 totally, 90 human deciduous non - carious primary molars that had been extracted for therapeutic purposes were collected, cleaned and stored in distilled water at room temperature . No caries / cracksintact crown enamel.9 intact crown enamel.9 the teeth after selection were randomly assigned into three test groups of 30 each . The tooth samples were embedded in a polyvinylchloride pipe using cold cure acrylic (dpi, india) with buccal surface exposed, and color coded according to the material used with duct tape (figure 1). The buccal surfaces were used for testing sbs because it showed the least variation and provided the most favorable conditions for testing an adhesive.10 the exposed dentinal surface was the ground flat, and the final surface was prepared with 320 grit wet silicon carbide paper to create a fresh surface . Surface was cleaned with pumice and rubber cup as it was found that polishing the dentin surface with pumice slurry reduced the layer of surface debris and did not affect the bond strength to dentine significantly.11 teeth were rinsed and dried . The flattened dentin surface of all the specimens was treated with dentin conditioner for 20 s, rinsed thoroughly with water and dried using absorbent paper . All three restorative materials i.e., miracle mix (mm) (gc america inc ., alsip, usa), ketac molar (3 m corp ., minnesota, usa) and ceramic reinforced glass ionomer amalgomer cr (advanced healthcare ltd ., kent, england) were manipulated according to manufacturer s instructions and placed on the smoothened buccal surface of the respective samples using a template bearing a hole measuring 3 mm diameter and 2 mm depth and stabilized using scotch tape (3 m corp) (figure 2). The excess material was removed, and the restoration was coated by dental varnish (copalite, cooley & cooley ltd ., all the samples were stored in distilled water for 24 h at room temperature and subjected to thermo cycling between 5 2 and 55 2 in a water bath for 100 cycles with a dwell time of 30 s.12 material placed using template the mounted samples were subjected to sbs test in a universal testing machine (instron corporation, usa) using a knife edge blade running at a cross - head speed of 1 mm / min (figure 3). The results were recorded in megapascals (mpa).4,6,7,10,12 - 14 following this, the specimens were observed under stereo microscope for adhesive and cohesive failure . Sbs testing in universal testing machine shear strength of each sample is calculated using the formula: shear strength (mpa) = break force / bonding surface area the data obtained were subjected to statistical analysis using one - way anova and tukey s test . Chi - square test has been used to find if there is any significant association between the failure and the groups (p = 0.347). No caries / cracksintact crown enamel.9 intact crown enamel.9 the teeth after selection were randomly assigned into three test groups of 30 each . The tooth samples were embedded in a polyvinylchloride pipe using cold cure acrylic (dpi, india) with buccal surface exposed, and color coded according to the material used with duct tape (figure 1). The buccal surfaces were used for testing sbs because it showed the least variation and provided the most favorable conditions for testing an adhesive.10 the exposed dentinal surface was the ground flat, and the final surface was prepared with 320 grit wet silicon carbide paper to create a fresh surface . Surface was cleaned with pumice and rubber cup as it was found that polishing the dentin surface with pumice slurry reduced the layer of surface debris and did not affect the bond strength to dentine significantly.11 teeth were rinsed and dried . The flattened dentin surface of all the specimens was treated with dentin conditioner for 20 s, rinsed thoroughly with water and dried using absorbent paper . All three restorative materials i.e., miracle mix (mm) (gc america inc ., alsip, usa), ketac molar (3 m corp ., minnesota, usa) and ceramic reinforced glass ionomer amalgomer cr (advanced healthcare ltd ., kent, england) were manipulated according to manufacturer s instructions and placed on the smoothened buccal surface of the respective samples using a template bearing a hole measuring 3 mm diameter and 2 mm depth and stabilized using scotch tape (3 m corp) (figure 2). The excess material was removed, and the restoration was coated by dental varnish (copalite, cooley & cooley ltd ., all the samples were stored in distilled water for 24 h at room temperature and subjected to thermo cycling between 5 2 and 55 2 in a water bath for 100 cycles with a dwell time of 30 s.12 material placed using template the mounted samples were subjected to sbs test in a universal testing machine (instron corporation, usa) using a knife edge blade running at a cross - head speed of 1 mm / min (figure 3). The results were recorded in megapascals (mpa).4,6,7,10,12 - 14 following this, the specimens were observed under stereo microscope for adhesive and cohesive failure . Sbs testing in universal testing machine shear strength of each sample is calculated using the formula: shear strength (mpa) = break force / bonding surface area the data obtained were subjected to statistical analysis using one - way anova and tukey s test . Chi - square test has been used to find if there is any significant association between the failure and the groups (p = 0.347). The sbs of miracle mix ranged from 3.62 mpa to 7.32 mpa with a mean of 5.39 mpa, of ketac molar ranged from 2.80 mpa to 6.46 mpa with a mean of 4.84 mpa and amalgomer cr ranged from 4.72 mpa to 8.37 mpa with a mean of 6.38 mpa (graph 1 and table 1). Three types of fractures were recorded - adhesive fracture (figure 4), cohesive fracture (figure 5) and mixed type of fracture (graph 2 and table 2). The chi - square statistic (pearson s chi - square) revealed that there was no significant association between the failures and the groups (p = 0.347). Gic systems have become important dental restorative materials for use in children as they are easy and practical to use,15 leach fluoride and adhere to tooth structure . These results are slightly higher than the values of the sbs of miracle mix in permanent teeth, which were found to be 4.08 mpa.14 another study conducted in 1996 put the value of sbs of miracle mix at 5 mpa without pre - treatment and 6 mpa with pre - treatment that is almost in accordance with our values.16 the present study showed the sbs of ketac molar, which is a high viscosity, condensable, improved, restorative gic to be 4.84 mpa . A study conducted in 2001 showed its sbs to be 3.77 mpa, which is slightly lesser than our value.13 amalgomer cr exhibited sbs of 6.38 mpa, which is significantly higher than that of miracle mix (metal admixed) and ketac molar (high viscosity gic). The mean sbs was statistically insignificant between miracle mix and ketac molar though miracle mix had slightly higher bond strength than ketac molar . In all the three restoratives, cohesive failure was the most common type of fracture . This means that adhesion between the restorative material and tooth is higher than the tensile strength of the cement itself and is considered as a superior property of the adhesive system because it shows that there is no further need for higher bond strength.17 in our study, there was no significant association found between the type of failure and the restorative materials . Similar observations were made in other bond strength studies.4,18 this finding is also in agreement with some studies, which proposed that the adhesive bond is usually not broken in shear bond testing and failure is usually cohesive within the restorative material.19,20 the sbs of miracle mix is low . Ketac molar, a high viscosity gic has the lowest sbs among the tested restoratives . This may be due to the probability that it has not reached its optimum tensile strength after only 24 h. it is expected to mature and strengthen over a period of several months.21 it can also be attributed to its intrinsic brittleness.4 amalgomer cr showed significantly higher sbs . More importantly, the tensile strength, flexural strength and fracture toughness of the cement is much higher than conventional gics.22 these properties in turn made amalgomer cr more resistant to shear stress . In general, the lower values of bond strength may be due to the fact that maximum achievable bond strength for glass ionomers is only reached after the cement has undergone its maturation process and some gics require several months to become stable.23 at full maturation, the cement at the interface will have become very viscous, and its initial reactions with the tooth substrate will have ensured close adaptation . The bond strength increases to become eventually limited by the cohesive tensile strength of the cement rather than by its adhesive strength alone.24 the study gives an overview of sbs of commercially available material in the market, but it may not be an accurate value due to the complex nature of adhesion mechanism to enamel and dentin . The brittle nature of gic invariably results in cohesive failure rather than failure within the ion exchange layer . Consequently, the true bond strength of ion - exchange layer is not known.25 though the ion exchange layer of the cement to the tooth interface seems to have been adequately developed in our in - vitro study, which is evident by the cohesive type of failure, it is questionable whether the positive dentinal fluid flow characteristic of what goes on in the mouth took place at all . This being the case, higher bond strengths to dentin can be expected in - vivo.4 conventional glass ionomers seldom perform well in the sbs tests because of their inherent weakness, which leads to their cohesive failure under these conditions . However, conventional gics have other desirable properties like limited setting shrinkage, good elasticity and the ability to show self - repair mechanism once cracks appear within them . All these factors help in the survival of restorations in the oral environment.24 also, due to the relatively small setting contraction and coefficient of thermal expansion, the requirements for adhesion are less in gics.8 although the result of the current study showed that the sbs of amalgomer cr to primary teeth is significantly higher than the rest, the physical and clinical qualities of each material are important in determining, which material is most suitable for a particular clinical situation . Only long - term clinical trials can determine whether in vitro laboratory study results correlate within in - vivo experience . Within the limits of the present in vitro study, we can conclude that: amalgomer cr has better adhesion to the primary teeth compared to miracle mix and ketac molar.amalgomer cr can be considered as a restorative material in pediatric dentistry . Amalgomer cr has better adhesion to the primary teeth compared to miracle mix and ketac molar . However, the results of this study should be corroborated with further investigation to reach a definitive conclusion . Ultimately, only long - term clinical trials can determine whether in - vitro laboratory study results co - relate with in - vivo experience.
The incidence and prevalence of chronic heart failure (chf) increase with age, due to a combination of the physiological and anatomical changes associated with ageing, and the increasing frequency of co - morbid conditions, which predispose to chf . This is exemplified by the finding that the mean age at diagnosis of chf in the uk is around 77 years . Yet, the average age seen in most landmark chf trials is somewhere in the 60's (table 1) and subsequently, the evidence base for treating elderly subjects with chf is generally extrapolated from cohorts up to 2 decades younger . Clinical trials require clear pre - determined eligibility criteria and rigorous follow - up . While some trials like solvd and merit - hf excluded those> 80 years of age, other key trials (without age as a specific exclusion criterion) also failed to recruit significant numbers of older patients . This may be due to the presence of other co - morbidities (such as chronic kidney disease) being exclusion criteria, a refusal of elderly patients committing to multiple study visits over several years of follow - up (limited mobility and functional impairment) or even investigator bias (deeming patients unsuitable or unlikely to participate). Elevated resting heart rate has been associated with increased risk of all - cause mortality and adverse cardiovascular (cv) outcomes in subjects with hypertension and cv diseases such as coronary artery disease (cad) and chf . The strength of this association has been documented in both epidemiological studies and clinical trials: subsequently heart rate has been incorporated into clinical risk prediction tools such as the global registry of acute coronary events (grace) scoring system for patients presenting with myocardial infarction . Resting heart rate (in sinus rhythm) of greater than 70 beats per minute (bpm) in stable patients with cad and left - ventricular dysfunction is associated with an increased risk of cv death (34%) and heart failure hospitalisations (53%) compared to those with heart rate of 70 bpm . An elevated heart rate in the presence of left ventricular systolic dysfunction without co - existent coronary artery disease is also directly related to the risk of death, cv death, or hospitalisation for heart failure . Habal, et al . In their study of hospitalised patients with heart failure demonstrated that heart rate at discharge (especially if> 80 bpm) was an important predictor of all - cause mortality, cv mortality and heart failure hospitalisations . * crt: cardiac resynchronization therapy; icd: internal cardioverter defibrillator; whilst there is consistent evidence that elevated resting heart rate is independently associated with increased cv risk and mortality across a spectrum of pathologies, including patients with chf, it has been less clear whether it is a marker of advanced disease or alternatively a modifiable risk factor in its own right . Since heart rate may be influenced by smoking, body mass index, diabetes and physical conditioning, it is possible that elevated heart rate identifies patients with co - morbid pathologies when evaluated in a large cohort (risk marker). There are a number of potential mechanisms by which heart rate per se may affect cv outcomes i.e., contribute to disease progression / expression (risk factor). For example, elevated heart rate is associated with altered myocardial metabolism and impaired efficiency and reflects a sympathovagal imbalance, a potential trigger for inflammation and atherosclerosis . Hemodynamic differences have been demonstrated across a range of heart rates and it has been postulated that these may translate to raised arterial stiffness, higher blood pressure, persistent myocardial strain, increased cardiac workload and adverse left ventricular remodelling over time . Activation of endothelial mechanoreceptors can additionally trigger a complex network of several intracellular pathways that promote atherogenesis and risk of plaque rupture . Treatments that result in heart rate reduction are associated with better outcomes in patients with chf, adding some support to heart rate being a modifiable risk factor . Beta - blockers have been extensively used in chf and although several of their beneficial effects are thought to be secondary to the inhibition of the deleterious effects of adrenergic receptor stimulation (impairment of cardiac myocyte function and survival, myocardial ischaemia, arrhythmogenesis, and renin secretion) the magnitude of heart rate reduction achieved may play an equally important role. A meta - regression analysis of patients treated with carvedilol, bisoprolol, metoprolol, bucindolol, or nebivolol demonstrated that the achieved resting heart rate (rhr) correlated strongly with all - cause mortality (adjusted r = 0.51, p <0.005; nine trials, n = 19,537) and the magnitude of change in rhr correlated with change in left ventricular ejection fraction (lvef) (adjusted r = 0.48, p <0.005; 26 trials, n = 3389). Cullington, et al . Evaluated 654 patients with lvef 40% on echocardiography and in sinus rhythm attending a community heart failure clinic and analyzed the effects of heart rate reduction and percentage of target doses of beta - blockers achieved on all - cause mortality . Their findings suggested that beta - blockers exert benefits through dual mechanisms: adrenergic receptor protection, (that may only require a low dose), and heart rate reduction (utilizing whatever beta - blocker dose is required to achieve a target heart rate). Ivabradine, a selective and specific inhibitor of the cardiac pacemaker if current, that results in pure heart rate reduction without adrenergic inhibition, offers a unique opportunity to test the hypothesis does hr lowering improve outcomes in patients with chf and left ventricular systolic dysfunction (lvsd)? Data from the systolic heart failure treatment with the if inhibitor ivabradine trial (shift, n = 6505), a multicentre, randomised, double - blind study comparing ivabradine with placebo on outcomes in patients with symptomatic chf [new york heart association (nyha) class ii iv], in sinus rhythm with rhr 70 bpm and lvef 35% have provided further insight . The primary composite end point was cv death or hospitalisation for worsening heart failure; 24% patients in the ivabradine group and 29% of those taking placebo had a primary endpoint event [hazard ratio (hr): 0.82, 95% confidence interval (ci): 0.750.90, p <0.0001]. These benefits were mainly driven by reduction in hospital admissions for worsening heart failure (21% placebo vs. 16% ivabradine; hr: 0.74, 95%ci: 0.660.83; p <0.0001) and deaths due to heart failure (5% vs. 3%; hr: 0.74, 0.580.94, p = 0.014). As such elevated resting heart rate, at least in patients in sinus rhythm, appears to be a modifiable risk factor in patients with chf and lvsd . Ivabradine is incorporated into the european society of cardiology (esc) guidelines for the management of heart failure and is licenced as an additional drug or as an alternative to beta - blockers (if not tolerated) when there sting heart rate remains 75 bpm . For example, aggressive hr reduction may not be prognostically beneficial in the presence of pre - existing atrial fibrillation . In addition, the tolerability and symptomatic benefit of this strategy in the elderly patient with chf remains uncertain, when there is often, concern regarding associated co - morbidities and multiple drug therapies . Key trial data and thereby evidence - based therapy for patients with chf have generally been established in much younger patient cohorts than those encountered in day - to - day clinical practice . Masoudi, et al . Recently applied the inclusion criteria of three major heart failure drug trials (angiotensin - converting - enzyme inhibitor: solvd; beta - blocker: merit - hf; and spironolactone: rales) to a typical heart failure population (mean age 78 years) in the us to ascertain what proportion of real life patients would have been included in these trials . Patients were identified from the medical records of medicare beneficiaries (aged 65 years) who had been hospitalised between 1998 and 1999 with a primary diagnosis of heart failure . Only 25% would have been deemed eligible for inclusion in rales (spironolactone), 17% for solvd (ace inhibitor) and 13% for merit - hf (beta - blocker). More than 40% of the reference population would have been excluded from solvd and merit on the basis of age alone . Although the rales trial did not exclude people on the basis of age, only 16% of women and 24% of men aged greater than 85 years would have been eligible due to other exclusion criteria . Given the changes in the demography of the population, there is a pressing need to conduct drug trials in older patients . The seniors study was a randomised trial to determine the effect of nebivolol on mortality and cv hospitalisation in chf patients 70 years of age . Pep - chf (perindopril in elderly people with chf) compared the effect of perindopril versus placebo in patients> 70 years with chf and preserved ejection fraction on a composite of all - cause mortality and unplanned heart failure related hospitalisation . Sub - group analyses of landmark studies retaining the original primary endpoints have been conducted in attempts to ascertain the benefits in older patients . For example, 22.8% of the charm study participants were aged 75 years or older (mean age of original cohort was 66 years); treatment with candesartan showed a similar benefit on the primary endpoint of cv death or heart failure hospitalisation in older patients to that seen in the whole study group . Subgroup analysis of the cardiac resynchronization - heart failure study (care - hf, mean age: 65 years, n = 813) showed that cardiac resynchronization therapy reduced the risk of the primary endpoint of all - cause mortality or cv hospitalization in both younger (<66 years; n = 406) and older (66 years; n = 407) patients . However only 40 patients were 8090 years of age, and none were 90 years . An age specific analysis of the shift study evaluated the effects of ivabradine on heart rate, cv outcomes, as well as adverse events (in particular bradycardia). Patients were grouped according to quartiles of age (<53 years, n = 1522; 53 to <60 years, n = 1521; 60 to <69 years, n = 1750; 69 years, n = 1712). Ivabradine (2.5 to 7.5 mg bid) reduced heart rate in all age groups (by around 11 bpm) with associated reductions in the relative risk of the combined primary endpoint of cv death and heart failure hospitalisation: for example, 38% (p <0.001) in patients <53 years and 16% (p = 0.035) in the oldest patients (69 years). Cardiovascular and heart failure deaths were also significantly (p <0.05) reduced with ivabradine in a subgroup of older patients (75 years, n = 722). The incidence of adverse events increased with age, but no substantial differences between ivabradine and placebo were noted in any of the age groups . Bradycardia occurred more frequently with ivabradine irrespective of age but there were no episodes of severe bradycardia or pathological pauses occurring in any age group . The main objectives of treating patients with heart failure are to relieve symptoms, improve exercise capacity, reduce hospitalisations and prolong life and these goals can be applied to patients of all ages . As patients grow older, develop more co - morbidities and become frailer, for many there comes a tipping point where qol and functional capacity become of greater importance . The impact of co - morbidities in the management of the older patient with heart failure cannot be under estimated . A united states based study of medicare beneficiaries with chf (hence> 65 years of age) demonstrated that about 40% of subjects had 5 co - morbidities and this group of patients accounted for 81% of total inpatient hospital days . In an attempt to curtail the burgeoning numbers of new heart failure diagnoses, risk prediction models incorporate risk factors such as age, coronary heart disease, impaired kidney function and impaired glucose tolerance . It is now accepted that additionally, in older patients, more complex factors such as social isolation, dispositional optimism or the lack of it, and poor drug compliance add significantly to the risk of developing heart failure . Social isolation is a key concept and can arise from lifestyle changes, medication regimens and drug side effects, combined with physical restrictions and limited ability to participate in social events . Patients are frequently anxious and live in fear of pain, of the future and of death . Patients also lose a sense of control over their lives and develop feelings of helplessness . Functional impairments and the loss of self - sufficiency also worsen short - term prognosis in the older patient admitted with adhf . It is thus hardly surprising then that qol is much worse in chf than in many other comparable chronic conditions and is itself increasingly recognised as a useful risk stratification tool . Poor qol scores predict higher mortality, worsening nyha class and the presence of comorbidities such as chronic kidney disease . For many frailer older patients, improving qol, optimising physical and cognitive function and maintaining independence are equally if not more important than prolongation of life the quality versus quantity debate. Stevenson examined how patient preferences for survival versus qol change after a hospitalisation for advanced heart failure; the median time that patients would trade in terms of survival time for fewer symptoms was 3 months . Targeting these issues, needless to say, is complex and beyond the limited physician while the importance of qol, particularly for older patients is irrefutable, the efficacy of heart failure therapy has in general been assessed in large scale studies with robust endpoints such as death and hospitalisation . These are reproducible and relatively easy to measure and are of course fundamental to establishing benefit and safety of a specific therapy . In contrast, assessment of qol or functional capacity is much more challenging and has historically been rather perfunctory . Ameta analysis by chang, et al . Utilized the minimum standards criteria for health related quality of life (hrqol) assessment recommended in oncology studies to assess the validity of heart failure studies where qol was the primary end point . Of the 136 articles identified, only 19 heart failure studies between 1990 and 2009 were considered to be probably robust in terms of methodological and reporting rigor . The mean age of subjects seen in these trials was generally in the 60s, again under representing the older heart failure patients where improving qol may be the greatest priority (table 2). Thus while some clinical trials over the last decade have included measures of qol, there is a need to develop more standardised methodology for measuring and reporting hrqol in studies that genuinely reflect clinical practice, and optimise their interpretation and applicability to real - life patient management . Data regarding the tolerability of guideline recommended therapy in elderly patients with chf and its impact on qolis limited . Why or by whom potentially lifesaving medications are stopped remains uncertain . In uk primary care for example, around one third of patients with chf are no longer receiving beta - blocker prescription at 1 year . It is encouraging to note the increasing emphasis on improving qol in heart failure- the national institute of clinical excellence (nice) in the uk now recommends the use of qol instruments as a means of assessing the overall health of a patient . The esc has also recently stated that all studies examining treatment of heart failure should include qol as an endpoint . These kinds of trials would help to establish whether specific therapies are truly safe, well tolerated and benefit qol in elderly patients with chf . Crt: cardiac resynchronisation therapy; crt - d: cardiac resynchronisation therapy - defibrillator; icd: implantable cardioverter defibrillator; lvef: left ventricular ejection fraction; lvsd: left ventricular systolic dysfunction; mlhfq: minnesota living with heart failure questionnaire; nyha: new york heart association; pom: personal outcome measures; qol: quality of life; sip: sickness impact profile . The shift trial did evaluate qol in a sub - study of 1944 symptomatic patients (with chf and lvsd) treated with recommended background therapy and randomised to ivabradine (n = 968) or placebo (n = 976). Mean age of the study population was younger than in clinical practice at 60.7 years . Health - related qol was assessed by the kansas city cardiomyopathy questionnaire (kccq) containing the following dimensions: overall summary score (oss) and clinical summary score (css) at baseline, and 4, 12, and 24 months . The incidence of clinical events (cv death or hospital admission for heart failure) was inversely associated with kccq scores . Treatment with ivabradine was associated with improved kccq, by 1.8 for css and 2.4 for oss (placebo - corrected, p = 0.02 and p <0.01, respectively); these changes were associated with the magnitude of heart rate reduction for both css (p <0.001) and oss (p <0.001). Initiation and adjustment of drug therapy and enrolment in a heart failure management programme form the mainstay of management for older patients with heart failure and requires full engagement of both patients and carers . Discussion around potential benefits (hard endpoints and qol), likely tolerability potential adverse effects combined with an assessment of comorbidity underpins an agreed individualised management plan . It would be extremely valuable to know whether or not the improvement in qol seen in shift can be replicated in a much older, frailer real life population of patients with heart failure, and this forms the basis for the recently initiated uk based live: life study . Live: life is a multi - centre, open - label, prospective, observational, cohort study specifically designed to assess the impact of ivabradine on qol and functional endpoints in an older cohort of patients . We believe the study presents a refreshing opportunity to recruit a wide range of real life, older patients who fulfill the indications for treatment with ivabradine . The live: life study will recruit patients over the age of 70 years (often the lower age limit for admission to specialist services for the treatment of older people within the uk), who have been identified to be initiated on ivabradine according to the licenced criteria in chf . Patients will be recruited across a range of clinical services: specialist cardiology, medicine for the elderly, and primary care . As ivabradine is already licensed for management of chf and recommended by nice and esc guidelines, it was felt that it would be unethical to conduct a randomised control trial in which patients could be randomised to placebo . A nested control of similarly matched individuals would have marked limitations, as by their very nature patients in whom ivabradine is indicated constitute a subset of patients with chf and have specific characteristics (driven by a resting heart rate in sinus rhythm 75 bpm).whilst the open label observational design of live: life, with the absence of a placebo group, has potential limitations and may lead to an overestimation of treatment effects, it will in contrast also permit evaluation of treatment effects in a population that is more reflective of routine clinical practice than that seen in landmark outcome studies . Controlled studies often restrict the inclusion of frailer and older patients with multiple co - morbidities due to strict inclusion and exclusion criteria . In live: life, for example, there are thus no significant inclusion / exclusion criteria other than actually receiving ivabradine within two weeks of recruitment . Consent will also be gained to contact general practitioners one year after the patient completes the six month study to determine if the patient is still alive, assess number of hospitalisations, current medications and the reasons behind medication changes . This should provide data on longer - term tolerability of drug therapy, and provide insight as to why adjustments have been made . Qol will be assessed utilizing well - validated tools; both generic and disease specific to allow a clear understanding of all influences on a patient's health at the time they complete the questionnaire . The primary end point will involve assessing the effect on ivabradine therapy on change in qol score between baseline and final visits . The study will use the minnesota living with heart failure questionnaire (mlhfq) as a disease specific measure of heart failure . The mlhfq is a user - friendly qol measure consisting of 21 items focusing on patient perception of the effect of their heart failure on their physical, psychological, emotional and socio - economic functioning . The mlhfq has been shown to be very sensitive to change and has a rich track record in heart failure clinical trials ., based on two previous studies with ivabradine and mlhfq we have calculated a sample size of 500 patients to allow for a significant change in qol score to be seen ., the main analysis will focus on the change in qol score between the baseline and final visit . Figure 1 provides an overview of the study and the various qol assessments that are being utilized at different time points . * ivabradine is indicated: chronic heart failure nyha class ii to iv with systolic dysfunction; in sinus rhythm with resting hr 75 bpm; in combination with standard therapy including beta blockers or when beta blockers are contraindicated or not tolerated . Qol: quality of life; mlhfq: minnesota living with heart failure questionnaire; nyha: new york heart association; 6mwt: 6 minute walk test . Sf-12 provides a more generic assessment, and has demonstrated a strong correlation with the mlhfq physical and total scores . Additionally, global assessment scores (by both patients and investigator) if there is a perceived change, then the direction of change and estimate the magnitude of that change will be defined as previously described . Global assessment scores are more likely than nyha classification to detect a meaningful change in clinical status of the patient, but it is accepted that they can be influenced by knowledge about the perceived benefits or side effects of medications . The incorporation of a 6 minute walk test (6mwt) fits with current guidelines for chf management,, and the recommendation within clinical practice to determine functional capacity . It is a simple and low - cost method for estimating exercise capacity with applicability to a wide population of heart failure patients, and only requires a pre - measured distance over a flat surface and a timing device . Various studies have shown the 6mwt results to correlate with mortality and morbidity,, and in the older population; change in 6mwt results appears to correlate to change in self - perceived symptoms . The last three decades have seen significant advances in the management of chf, which has translated into better outcomes for patients . The data behind these advances is generally derived from studies in younger subjects . Yet with the changing demographics of our population, patients with chf are often older with complex co - morbidities . As such patients who are the largest users of health and social service resources are those for whom we have less evidence on which to base our treatment . Clinical trials have generally focused on important outcomes such as avoiding death or hospitalisation these outcomes are crucial to demonstrate benefit without evidence of harm . Improved longevity may be less relevant as patients get a lot older; qol and maintained independence become the priorities . It is a collaboration between physicians in cardiology, medicine for the elderly and general practice that will recruit a cohort of patients who are much more reflective of day - to - day clinical practice . Although there are inevitable limitations that are associated with an observational study, it is anticipated it will yield important data which otherwise would be difficult to obtain, with the focus being on symptoms, tolerability of drugs, qol and function . This trial shifts the focus to patients' needs and for older patients even small changes in these parameters can have a dramatic impact on day to day living . Zachariah d, taylor j, rowell n declare that there is no conflict of interest . Kalra pr reports research grants, consultancy fees / honoraria from servier laboratories ltd (uk).
The first effective antifungal agent, i.e., griseofulvin, was introduced in 1959 . Up that time, there was no therapy available for patients with tinea capitis except radiation therapy (rt). There is no clear data on the number and method patients were treated in iran, but regarding the poor hygienic status of people, it can be imagined that probably thousands of patients, mostly children, have been treated with radiotherapy . Unfortunately, many did not even have this privilege and were left untreated or had underwent non - efficient remedies . Here, i will take a historical look at the issue followed by analyzing the clinical characteristics of bccs in irradiated patients . Tinea capitis was a common disease in northern iran, where the majority of population still resides in rural areas . The first effective antifungal agent, i.e., griseofulvin, was introduced in 1959 . Up that time, there was no therapy available for patients with tinea capitis except radiation therapy (rt). There is no clear data on the number and method patients were treated in iran, but regarding the poor hygienic status of people, it can be imagined that probably thousands of patients, mostly children, have been treated with radiotherapy . Unfortunately, many did not even have this privilege and were left untreated or had underwent non - efficient remedies . Here, i will take a historical look at the issue followed by analyzing the clinical characteristics of bccs in irradiated patients . In a retrospective study, the clinical records of all patients with bcc were reviewed . Demographic details as well as clinical details and history of rt for treating tinea capitis was analyzed . Data were analyzed using spss and p - values less than 0.05 were considered significant . The youngest one was a 27 years old man with gorlin s syndrome that was excluded from the study . Also, in 10 cases, the history for radiotherapy was not clear and therefore they were excluded from the study . Of the remaining 58 patients, there were 23 women and 35 men with an age range from 34 to 85 years (mean age 60 years). Twenty - nine out of 58 patients (50%) had positive history for rt in their childhood for treatment of tinea capitis . The demographic data of patients is shown in table 1 . Statistical analysis using chi - square test and t - test showed no significant difference from the point of gender and age between those who had history of rt and those who had not such history . In those who had positive history for rt, 23 out of 29 (79.3%) had multiple bccs . In 27 of them (93.1%), in contrast, in the group with negative history for rt, only three patients (10.3%) had multiple bccs, in only seven patients (24.1%), scalp was involved and only five patients (17.2%) had recurrent bccs . Non - melanoma skin cancers are the most common malignancies in iran, with an incidence of around 1015 new cases per 100,000 of the population . Bcc is the most common skin cancer and constitutes about three forth of all skin cancers in iran . Skin cancer, particularly bcc, presents a major problem for patients who have undergone irradiation for the treatment of tinea capitis . While ultraviolet radiation is the most common risk factor in bcc development, a significant number of the patients with bcc in northern iran, are still those who had radiation therapy for treating their tinea capitis . Guilan is a province located in northern iran, nowadays with a population of around three million . Guilan, with its humid climate and heavy rainfalls, is the center of rice and tea farms in iran . During the early years of twentieth century, this province and its capital, rasht, were the battlefield of civil wars and invasions by russians and the british . At that time, diseases such as malnutrition, cholera, tuberculosis, malaria, typhoid, leprosy and skin infections were common in this region . The american presbyterian mission started its mission in guilan in 1905, and the american christian hospital that was founded by this group was among the first hospitals made in northern iran circa 1917 and maybe the first hospital with x - ray facility (figure 1). John davidson frame (18801942) who established the hospital and worked as a physician and surgeon in rasht for about 37 years (figure 2). The exact number of patients with tinea capitis who have been treated with radiotherapy in the american christian hospital and other centers in guilan is unknown, but we as dermatologists are still seeing signs of radiotherapy - induced tumors today . Also, the dosage of rt was not clear, but the target dose was the induction of total depilation . The cutaneous symptoms after radiation exposure are based on a combination of inflammatory processes and alteration of cellular proliferation as a result of a specific pattern of transcriptionally activated pro - inflammatory cytokines and growth factors . The entire complex is referred to as cutaneous radiation syndrome and its severity depends on several factors such as the radiation dose, radiation quality, individual radiation sensitivity, the extent of contamination and absorption and amount of skin exposed . Clinical manifestations usually include a combination of hyper- and hypopigmentations, epidermal thinning and sclerosis (figure 3). In a study done by shore et al on more than 2,000 children given x - ray therapy for tinea capitis at new york university hospital, they found a relative risk (rr) of 3.6 for developing bcc in irradiated children, in 40% of whom the bccs were multiple . Also, they found an inverse association between bcc risk and age of radiation exposure . In another study, ron et al compared 10,834 patients irradiated for tinea capitis in their childhood in israel to a control group of 16,226, demonstrating an rr of 4.9 (95% ci = 2.68.9) for bcc in the irradiated group . The predominant type of bcc in our study was nodular type, which was in concordance with the study done in tunis . Bccs have been stratified as low - risk or high - risk according to their propensity for recurrence . Our study revealed a greater risk for recurrence among those who have had history for radiation . Hassanpour et al compared the management and treatment characteristics of patients previously irradiated for tinea capitis as well as unexposed patients and found that the previously irradiated patients proved to be more difficult to treat, with more hospital admissions (p = 0.008), more operations (p = 0.01), and longer hospitalization period (p = 0.01). Risk factors considered include histologic subtype, horizontal diameter, anatomic location, and patient health status . We believe that history of radiation should be considered as another independent risk factor for basal cell carcinoma in iran . The reason for higher recurrence rate and more aggressive natural history of these tumors is as yet unexplained . A recent study has revealed that mitochondrial d - loop instability is significantly higher in irradiated bccs than in the nonirradiated ones . On the other hand, a genetic study failed to demonstrate any genetic differences (specifically, difference in p53 and ptch) between bcc in irradiated patients and bcc in non - irradiated patients . Therefore, it seems that the natural history is more host - related than tumor - related . In addition to the problems inherent in any retrospective analysis, the sample size was small and lacking data on skin phototypes of patients and had no histopathologic comparison between the irradiated and non - irradiated patients . This study shows that x - ray radiation for treating tinea capitis is a significant cause of bcc development in northern iran . Bccs in those who had history of radiation have a more aggressive behavior with higher rate of recurrence.
Microneedles have been researched extensively to improve intradermal or transdermal drug delivery.15 the feasibility of microneedle - mediated delivery of nanoparticles into or through the skin has also been confirmed.6,7 initially, mcallister et al reported permeation of latex nanoparticles of up to 100 nm through human cadaver epidermis after the skin was treated with solid microneedles (150 m long, base diameter 80 m).6 coulman et al showed permeation of polystyrene nanoparticles (138 25 nm) through the micropores created in human skin by microneedles 280 m long with a base diameter of 200 m.7 in contrast, zhang et al did not observe any permeation of poly(lactic - co - glycolic) acid nanoparticles (166, 206, or 288 nm) through human skin pretreated with microneedles 200 m long but did show penetration of nanoparticles into the epidermis and dermis.8 new - generation vaccines based on recombinant dna technology generally need a vaccine adjuvant to be strongly immunogenic, and data from numerous studies have shown that many polymeric or solid lipid nanoparticles used as vaccine antigen carriers have potent adjuvant activity.9 one of the attractive applications of the combination of microneedle and nanoparticle technologies is in vaccine delivery.10 in fact, there have been significant and successful efforts to utilize solid microneedles coated with nanoparticle - based vaccine formulations, mainly virus - like particles, to perform transcutaneous immunization in animal models and in clinical trials.1025 however, the feasibility of transcutaneous immunization by applying antigens carried by nanoparticles onto a skin area pretreated with microneedles has not been thoroughly evaluated . Although application of a vaccine formulation onto the skin prior to or after the skin area is treated with microneedles is associated with the slight inconvenience of being a two - step process, it does have some advantages . For example, the dose of vaccines that can be applied is not as limited as when the vaccine is to be coated on solid microneedles, and coating of a vaccine onto microneedles on a mass production scale is still a topic of active research.26 recently, bal et al showed that application of diphtheria toxoid formulated into nanoparticles (211 4 nm) prepared with n - trimethyl chitosan onto a mouse skin area pretreated with solid microneedles (300 m long) induced an antidiphtheria toxoid antibody immune response . However, the response was not stronger than when the diphtheria toxoid was used alone.25 interestingly, it was reported that the simple physical mixture of diphtheria toxoid with n - trimethyl chitosan nanoparticles was more immunogenic than diphtheria toxoid alone.25 therefore, there continues to be a need to test whether transcutaneous immunization onto a skin area pretreated with microneedles with an antigen carried by nanoparticles is more effective than with the antigen alone . Previously, sloat et al reported the engineering of solid lipid nanoparticles of 200 nm in size from lecithin / glyceryl monostearate - in - water emulsions.27,28 it was shown that subcutaneous injection of protein antigens conjugated onto the nanoparticles induced strong functional antibody and cellular immune responses.27,29 in the present study, the antibody responses induced by ovalbumin nanoparticles or ovalbumin alone when applied onto a mouse skin area pretreated with microneedle rollers were evaluated and compared, using ovalbumin as a model antigen chemically conjugated onto nanoparticles (mean diameter 230 nm) and three different microneedle rollers with different - sized microneedles . Prior to an in vivo animal immunization study, permeation of the ovalbumin nanoparticles through mouse skin treated with microneedle rollers was evaluated in vitro . Microneedle rollers are commercially available and used for cosmetic (self - application) and clinical treatment of the skin . It has been shown that sequential insertion of microneedles on a microneedle roller requires less insertional force than insertion of microneedles on a flat patch.2 finally, a very important issue related to microneedle - based drug delivery has been rarely studied, ie, the potential risk of bacterial or viral infection via micropores created by the microneedles . Bacteria and viruses are physically nanoparticles or microparticles . Therefore, any micropores that allow the permeation of nanoparticles might also allow permeation of bacteria and viruses . It is generally assumed that the risk of infection associated with microneedle treatment is low, and many microneedle - related safety studies in clinical trials have focused on the degree of irritation and pain caused by the microneedles.3033 the first study on the ability of microbes to traverse microneedle - induced micropores was reported by donnelly et al, whereby permeation of microbes through porcine skin pretreated with a microneedle array (280 m long, base diameter 250 m) was confirmed in vitro.34 in the present study, an ex vivo model was designed to evaluate permeation of live bacteria through a mouse skin area pretreated with microneedles of different sizes . A nonpathogenic escherichia coli dh5 strain was used for this study . Based on the size of the microneedles, the microneedle rollers were named as rollers with large (1000 m long, base diameter 80 m), medium (500 m long, base diameter 50 m), and small (200 m long, base diameter 20 m) microneedles . Ovalbumin, fluorescein-5(6)-isothiocyanate, 2-iminothiolane (traut s reagent), 3,3,5,5-tetramethylbenzidine solution, sodium bicarbonate, sodium carbonate, tween 20, and phosphate - buffered saline were from sigma - aldrich (st louis, mo). Lecithin (soy, refined) was from alfa aesar (ward hill, ma). The 1,2-dipalmitoyl - sn - glycero-3-phosphoethanolamine - n-[4-(p - maleimidophyl) butyramide] (dppe - maleimide) and 1,2-dioleoyl - sn - glycero-3-phosphoethanolamine - n - carboxyfluorescein (dope - fluorescein) were from avanti polar lipids (alabaster, al). Goat antimouse immunoglobulin g was from southern biotechnology associates inc (birmingham, al). Nanoparticles were prepared as previously described.27,28 briefly, soy lecithin 3.5 mg and glyceryl monostearate 0.5 mg were placed into a 7 ml glass vial . One milliliter of deionized filtrated (0.22 m) water was added into the vial, followed by heating on a hot plate to 7075c, with stirring and brief intermittent periods of sonication (ultrasonic cleaner model 150 t, vwr international, west chester, pa). Once a homogeneous milky slurry was formed, tween 20 was added in a stepwise manner to a final concentration of 1% (v / v) to form an emulsion, which was then allowed to stay at room temperature while stirring to form nanoparticles . The endotoxin level in the nanoparticle preparation was estimated to be 0.180.57 eu / ml using a toxinsensor chromogenic limulus amebocyte lysate endotoxin assay kit from genscript (piscataway, nj).29 the size and zeta potential of the nanoparticles were determined using a malvern zetasizer nano zs (westborough, ma). To prepare the maleimide nanoparticles, dppe maleimide, which has a reactive maleimide group, was included in the lipid mixture (5%, w / w).27,29 to label the nanoparticles fluorescently, dope - fluorescein (5%, m / m of total lipids) was included in the lecithin and glyceryl monostearate mixture during nanoparticle preparation.27,29 the conjugation of ovalbumin onto the nanoparticles was completed as previously described.2729 prior to conjugation, ovalbumin was thiolated using traut s reagent . Ovalbumin was diluted in carbonate buffer (0.1 m, ph 9.6), followed by addition of traut s reagent (20 molar excess) and a 60-minute incubation at room temperature . Thiolated ovalbumin was desalted using a pd10 column (ge healthcare, piscataway, nj). To react the thiolated ovalbumin with the nanoparticles, 1 ml of freshly prepared maleimide nanoparticles were mixed with thiolated ovalbumin (10 mg) in phosphate - buffered saline (0.1 m, ph 7.4) and stirred under nitrogen gas for 12 to 14 hours at room temperature . Unconjugated ovalbumin was removed by repeated ultracentrifugation (600,000 g) and washing with phosphate - buffered saline three times . The amount of ovalbumin conjugated onto the nanoparticles was estimated as previously described using fluorescein - labeled ovalbumin.27,29 ovalbumin was labeled with fluorescein following the manufacturer s instructions (promega corporation, madison, wi) before being conjugated onto the nanoparticles . An in vitro permeation assay using franz diffusion cells was completed as previously described.6 the lower dorsal skin of c57bl/6 mice was used in all permeation studies . Hair was trimmed using an electric clipper 24 hours before collection of the skin, which was stored at 20c for a maximum period of one month and used when needed . After the fat layer was carefully removed, the skin was placed onto the flat surface of a balance, and the microneedle rollers were rolled in four perpendicular lines over the skin surface, five times each for a total of 20 times, with an applying pressure of 350 to 400 g, which was constantly measured using the balance while rolling the microneedle roller.35 the skin was then mounted onto franz diffusion cells from permegear inc (hellertown, pa), dorsal side facing upward . The receiver compartment contained 5 ml of phosphate - buffered saline (ph 7.4, 10 mm) and was maintained at 37c with a haake sc 100 water circulator from thermoscientific (wellington, nh). The donor compartment was loaded with fluorescein - labeled ovalbumin or fluorescein - ovalbumin nanoparticles in phosphate - buffered saline (500 l, ph 7.4, 10 mm) and covered with parafilm to prevent evaporation . The amount of ovalbumin protein loaded into the donor compartment was 0.6 mg . At hours 0, 1, 2, 4, 8, and 24, 200 l samples were withdrawn from the receiver compartment and immediately replenished with fresh phosphate - buffered saline . The fluorescence intensity in the sample was measured using a biotek synergy ht multimode microplate reader (winooski, vt). Hair on the dorsal skin of c57bl/6 mice was trimmed before the mice were euthanized to remove the skin . The skin sample was treated with nair lotion (church and dwight co, princeton, nj), rinsed with water, paper dried, and placed onto the flat surface of a balance . Microneedle rollers were rolled once over the skin surface with an applying pressure of 350 to 400 g. the skin was then stained with 20 l of methylene blue solution for no more than five minutes, followed by removal of excessive stain using normal saline swabs and later alcohol swabs . Stained skin was visualized using a stereoscopic zoom nikon smz1500 microscope (melville, ny). As a control, skin was also punctured with a 21 gauge hypodermic needle (becton dickinson, franklin lakes, nj). All animal studies were carried out following the national institutes of health guidelines for animal care and use . The animal protocol was approved by the institutional animal care and use committee at the university of texas at austin . Twenty - four hours prior to the application of the vaccine formulations, hair on the dorsal side of the mice was carefully trimmed . The skin was cleaned with an alcohol swab, and a 2 cm area was marked on the skin surface . Mice were anesthetized and placed onto the flat surface of a balance to monitor the pressure applied during application of the microneedle rollers . The microneedle rollers were disinfected with ethanol 70% and then rolled in two perpendicular lines over the lower dorsal marked skin surface, ten times each, again for a total of 20 times,5 with an applying pressure of 350 to 400 g. ovalbumin in phosphate - buffered saline or ovalbumin - conjugated nanoparticles in phosphate - buffered saline were carefully dripped onto the treated area; the skin area was then covered with a piece of self - adhesive tegaderm patch (3 m, st paul, mn), which was carefully removed 24 hours later . Immunization was repeated 10 days apart on two further occasions . As a positive control, a group of mice were subcutaneously injected three times with ovalbumin - conjugated nanoparticles in phosphate - buffered saline . Two weeks (or as where mentioned) after the last immunization, mice were bled for antibody assay . An enzyme - linked immunosorbent assay was completed as previously described.27,28 briefly, eia / ria flat - bottomed, medium - binding, 96-well polystyrene plates (corning costar, corning, ny) were coated with 100 ng of ovalbumin in 100 l of carbonate buffer (10 mm, ph 9.6) overnight at 4c . Plates were washed with phosphate - buffered saline / tween 20 (10 mm, ph 7.4, 0.05% tween 20, sigma - aldrich) and blocked with 5% (v / v) horse serum in phosphate - buffered saline / tween 20 for one hour at 37c . Samples were diluted 10-fold serially in 5% (v / v) horse serum in phosphate - buffered saline / tween 20, added to the plates following the removal of the blocking solution, and incubated for a further two hours at 37c . The serum samples were removed, and the plates were washed five times with phosphate - buffered saline / tween 20 . Horseradish peroxidase - labeled goat antimouse immunoglobulin g (5000-fold dilution in 1.25% (v / v) horse serum in phosphate - buffered saline / tween 20) was added into the plates, followed by another hour of incubation at 37c . The presence of bound antibody was detected following incubation for 30 minutes at room temperature in the presence of 3,3,5,5-tetramethylbenzidine solution, followed by addition of 0.2 m sulfuric acid as the stop solution . The absorbance was read at 450 nm using a biotek synergy ht multimode microplate reader . Twenty - four hours later, the trimmed area was disinfected with ethanol 70% and treated with the microneedle rollers as mentioned earlier . Negative control mice received hair trimming only . Before and immediately after the needle treatment (0 hour), transepidermal water loss was measured using a vapometer from delfin technologies inc (stamford, ct) following the manufacturer s instructions . If there were any uncharacteristic spikes during this period, a more representative reading was used . Transepidermal water loss readings were also recorded at hours 2, 3, 4, and 24 . For mice treated with the large microneedle roller, transepidermal water loss readings hair - trimmed mice were treated with the microneedle rollers on the lower dorsal skin (10 times each in two perpendicular directions, for a total of 20 times) and then immediately euthanized . The skin in the treated area was collected and used to evaluate the permeation of live bacteria on the same day . As controls, intact skin (hair trimmed) or skin punctured once with a 21 gauge needle were also used . In addition, for the microneedle roller with large microneedles, mice were treated with the roller and euthanized immediately or at hours 1, 3, 6, or 24 to collect the skin in the treated area . Mouse skin in the treated area and the working surface in a laminar flow cabinet were disinfected with ethanol 70% before treatment . E. coli dh5 bacteria were used to evaluate permeation of live bacteria through the treated skin . Bacteria were grown in luria - bertani medium (sigma - aldrich), harvested, and resuspended into the same volume of sterile phosphate - buffered saline (ph 7.4, 10 mm). The bacterial suspension was diluted in sterile phosphate - buffered saline (ph 7.4, 10 mm) to 1000-fold, and 500 l was then placed into the donor compartment of the diffusion cells . Four hours later, the sample in the receiver compartment was withdrawn, diluted 1-fold, 10-fold, and 100-fold in sterile phosphate - buffered saline, and 50 l was then spread onto luria - bertani agar plates, which were incubated at 37c overnight to count the number of colonies formed . The number of bacteria diffused through the skin was reported as colony forming units, and it was assumed that each colony had developed from a single bacterial cell . The diffusion cells and the parafilm used to cover the cells were thoroughly disinfected with ethanol 70% three times before use, and all other items were autoclaved before use . Statistical analyses were performed using analysis of variance followed by fisher s protected least significant difference procedure . Based on the size of the microneedles, the microneedle rollers were named as rollers with large (1000 m long, base diameter 80 m), medium (500 m long, base diameter 50 m), and small (200 m long, base diameter 20 m) microneedles . Ovalbumin, fluorescein-5(6)-isothiocyanate, 2-iminothiolane (traut s reagent), 3,3,5,5-tetramethylbenzidine solution, sodium bicarbonate, sodium carbonate, tween 20, and phosphate - buffered saline were from sigma - aldrich (st louis, mo). Lecithin (soy, refined) was from alfa aesar (ward hill, ma). The 1,2-dipalmitoyl - sn - glycero-3-phosphoethanolamine - n-[4-(p - maleimidophyl) butyramide] (dppe - maleimide) and 1,2-dioleoyl - sn - glycero-3-phosphoethanolamine - n - carboxyfluorescein (dope - fluorescein) were from avanti polar lipids (alabaster, al). Goat antimouse immunoglobulin g was from southern biotechnology associates inc (birmingham, al). Nanoparticles were prepared as previously described.27,28 briefly, soy lecithin 3.5 mg and glyceryl monostearate 0.5 mg were placed into a 7 ml glass vial . One milliliter of deionized filtrated (0.22 m) water was added into the vial, followed by heating on a hot plate to 7075c, with stirring and brief intermittent periods of sonication (ultrasonic cleaner model 150 t, vwr international, west chester, pa). Once a homogeneous milky slurry was formed, tween 20 was added in a stepwise manner to a final concentration of 1% (v / v) to form an emulsion, which was then allowed to stay at room temperature while stirring to form nanoparticles . The endotoxin level in the nanoparticle preparation was estimated to be 0.180.57 eu / ml using a toxinsensor chromogenic limulus amebocyte lysate endotoxin assay kit from genscript (piscataway, nj).29 the size and zeta potential of the nanoparticles were determined using a malvern zetasizer nano zs (westborough, ma). To prepare the maleimide nanoparticles, dppe maleimide, which has a reactive maleimide group, was included in the lipid mixture (5%, w / w).27,29 to label the nanoparticles fluorescently, dope - fluorescein (5%, m / m of total lipids) was included in the lecithin and glyceryl monostearate mixture during nanoparticle preparation.27,29 the conjugation of ovalbumin onto the nanoparticles was completed as previously described.2729 prior to conjugation, ovalbumin was thiolated using traut s reagent . Ovalbumin was diluted in carbonate buffer (0.1 m, ph 9.6), followed by addition of traut s reagent (20 molar excess) and a 60-minute incubation at room temperature . Thiolated ovalbumin was desalted using a pd10 column (ge healthcare, piscataway, nj). To react the thiolated ovalbumin with the nanoparticles, 1 ml of freshly prepared maleimide nanoparticles were mixed with thiolated ovalbumin (10 mg) in phosphate - buffered saline (0.1 m, ph 7.4) and stirred under nitrogen gas for 12 to 14 hours at room temperature . Unconjugated ovalbumin was removed by repeated ultracentrifugation (600,000 g) and washing with phosphate - buffered saline three times . The amount of ovalbumin conjugated onto the nanoparticles was estimated as previously described using fluorescein - labeled ovalbumin.27,29 ovalbumin was labeled with fluorescein following the manufacturer s instructions (promega corporation, madison, wi) before being conjugated onto the nanoparticles . An in vitro permeation assay using franz diffusion cells was completed as previously described.6 the lower dorsal skin of c57bl/6 mice was used in all permeation studies . Hair was trimmed using an electric clipper 24 hours before collection of the skin, which was stored at 20c for a maximum period of one month and used when needed . After the fat layer was carefully removed, the skin was placed onto the flat surface of a balance, and the microneedle rollers were rolled in four perpendicular lines over the skin surface, five times each for a total of 20 times, with an applying pressure of 350 to 400 g, which was constantly measured using the balance while rolling the microneedle roller.35 the skin was then mounted onto franz diffusion cells from permegear inc (hellertown, pa), dorsal side facing upward . The receiver compartment contained 5 ml of phosphate - buffered saline (ph 7.4, 10 mm) and was maintained at 37c with a haake sc 100 water circulator from thermoscientific (wellington, nh). The donor compartment was loaded with fluorescein - labeled ovalbumin or fluorescein - ovalbumin nanoparticles in phosphate - buffered saline (500 l, ph 7.4, 10 mm) and covered with parafilm to prevent evaporation . The amount of ovalbumin protein loaded into the donor compartment was 0.6 mg . At hours 0, 1, 2, 4, 8, and 24, 200 l samples were withdrawn from the receiver compartment and immediately replenished with fresh phosphate - buffered saline . The fluorescence intensity in the sample was measured using a biotek synergy ht multimode microplate reader (winooski, vt). Hair on the dorsal skin of c57bl/6 mice was trimmed before the mice were euthanized to remove the skin . The skin sample was treated with nair lotion (church and dwight co, princeton, nj), rinsed with water, paper dried, and placed onto the flat surface of a balance . Microneedle rollers were rolled once over the skin surface with an applying pressure of 350 to 400 g. the skin was then stained with 20 l of methylene blue solution for no more than five minutes, followed by removal of excessive stain using normal saline swabs and later alcohol swabs . Stained skin was visualized using a stereoscopic zoom nikon smz1500 microscope (melville, ny). As a control, skin was also punctured with a 21 gauge hypodermic needle (becton dickinson, franklin lakes, nj). All animal studies were carried out following the national institutes of health guidelines for animal care and use . The animal protocol was approved by the institutional animal care and use committee at the university of texas at austin . Twenty - four hours prior to the application of the vaccine formulations, hair on the dorsal side of the mice was carefully trimmed . The skin was cleaned with an alcohol swab, and a 2 cm area was marked on the skin surface . Mice were anesthetized and placed onto the flat surface of a balance to monitor the pressure applied during application of the microneedle rollers . The microneedle rollers were disinfected with ethanol 70% and then rolled in two perpendicular lines over the lower dorsal marked skin surface, ten times each, again for a total of 20 times,5 with an applying pressure of 350 to 400 g. ovalbumin in phosphate - buffered saline or ovalbumin - conjugated nanoparticles in phosphate - buffered saline were carefully dripped onto the treated area; the skin area was then covered with a piece of self - adhesive tegaderm patch (3 m, st paul, mn), which was carefully removed 24 hours later . Immunization was repeated 10 days apart on two further occasions . As a positive control, a group of mice were subcutaneously injected three times with ovalbumin - conjugated nanoparticles in phosphate - buffered saline . Two weeks (or as where mentioned) after the last immunization, mice were bled for antibody assay . An enzyme - linked immunosorbent assay was completed as previously described.27,28 briefly, eia / ria flat - bottomed, medium - binding, 96-well polystyrene plates (corning costar, corning, ny) were coated with 100 ng of ovalbumin in 100 l of carbonate buffer (10 mm, ph 9.6) overnight at 4c . Plates were washed with phosphate - buffered saline / tween 20 (10 mm, ph 7.4, 0.05% tween 20, sigma - aldrich) and blocked with 5% (v / v) horse serum in phosphate - buffered saline / tween 20 for one hour at 37c . Samples were diluted 10-fold serially in 5% (v / v) horse serum in phosphate - buffered saline / tween 20, added to the plates following the removal of the blocking solution, and incubated for a further two hours at 37c . The serum samples were removed, and the plates were washed five times with phosphate - buffered saline / tween 20 . Horseradish peroxidase - labeled goat antimouse immunoglobulin g (5000-fold dilution in 1.25% (v / v) horse serum in phosphate - buffered saline / tween 20) was added into the plates, followed by another hour of incubation at 37c . The presence of bound antibody was detected following incubation for 30 minutes at room temperature in the presence of 3,3,5,5-tetramethylbenzidine solution, followed by addition of 0.2 m sulfuric acid as the stop solution . The absorbance was read at 450 nm using a biotek synergy ht multimode microplate reader . Twenty - four hours later, the trimmed area was disinfected with ethanol 70% and treated with the microneedle rollers as mentioned earlier . Negative control mice received hair trimming only . Before and immediately after the needle treatment (0 hour), transepidermal water loss was measured using a vapometer from delfin technologies inc (stamford, ct) following the manufacturer s instructions . At least three readings were taken at every time point . If there were any uncharacteristic spikes during this period, a more representative reading was used . Transepidermal water loss readings were also recorded at hours 2, 3, 4, and 24 . For mice treated with the large microneedle roller, transepidermal water loss readings hair - trimmed mice were treated with the microneedle rollers on the lower dorsal skin (10 times each in two perpendicular directions, for a total of 20 times) and then immediately euthanized . The skin in the treated area was collected and used to evaluate the permeation of live bacteria on the same day . As controls, intact skin (hair trimmed) or skin punctured once with a 21 gauge needle were also used . In addition, for the microneedle roller with large microneedles, mice were treated with the roller and euthanized immediately or at hours 1, 3, 6, or 24 to collect the skin in the treated area . Mouse skin in the treated area and the working surface in a laminar flow cabinet were disinfected with ethanol 70% before treatment . E. coli dh5 bacteria were used to evaluate permeation of live bacteria through the treated skin . Bacteria were grown in luria - bertani medium (sigma - aldrich), harvested, and resuspended into the same volume of sterile phosphate - buffered saline (ph 7.4, 10 mm). The bacterial suspension was diluted in sterile phosphate - buffered saline (ph 7.4, 10 mm) to 1000-fold, and 500 l was then placed into the donor compartment of the diffusion cells . Four hours later, the sample in the receiver compartment was withdrawn, diluted 1-fold, 10-fold, and 100-fold in sterile phosphate - buffered saline, and 50 l was then spread onto luria - bertani agar plates, which were incubated at 37c overnight to count the number of colonies formed . The number of bacteria diffused through the skin was reported as colony forming units, and it was assumed that each colony had developed from a single bacterial cell . The diffusion cells and the parafilm used to cover the cells were thoroughly disinfected with ethanol 70% three times before use, and all other items were autoclaved before use . Statistical analyses were performed using analysis of variance followed by fisher s protected least significant difference procedure . The ovalbumin nanoparticles were 230 22 nm in diameter, with a polydispersity index of 0.2 . The amount of ovalbumin conjugated onto the nanoparticles was determined to be 96.6 11.0 g ovalbumin per mg of nanoparticles.29 lower dorsal mouse skin samples were harvested, treated with microneedle rollers, and used to evaluate permeation of the ovalbumin nanoparticles . Microscopic pictures of the skin stained with methylene blue solution immediately following treatment with different microneedle rollers are shown in figure 2 . As a control, the picture of the skin punctured by a 21 gauge hypodermic needle is also shown (figure 2a). The single pore created by the hypodermic needle was about 1 mm in diameter, which is to be expected because the nominal outer diameter of a 21 gauge needle is 819.2 m . The pores created by the microneedles were much smaller, and it seemed that the diameter of the micropores created using a roller with larger microneedles tended to be larger than that created using a roller with smaller microneedles (figure 2), in agreement with what was previously reported by zhou et al,5 who used ztgs microneedle rollers . Due to the extensive diffusion of the blue dye, an accurate measurement of the diameters of those micropores was not attempted . As shown in figures 3a and 3b, neither ovalbumin protein in solution nor ovalbumin conjugated onto nanoparticles could permeate through the intact skin, demonstrating the physical integrity of the skin samples . In contrast, both ovalbumin and ovalbumin nanoparticles were able to permeate through skin pretreated with microneedle rollers (figures 3a and 3b). Moreover, pretreatment using a roller with larger microneedles allowed more extensive permeation than treatment using a roller with smaller microneedles . For example, within 24 hours, only a minimum amount of ovalbumin nanoparticles permeated through the skin pretreated using a roller with small microneedles (200 m long, base diameter 20 m), whereas 13.6 2.4% of the ovalbumin nanoparticles permeated through the skin treated with the roller with large microneedles (1000 m long, base diameter of 80 m, figure 3a). As expected, pretreatment with the microneedle rollers allowed more extensive permeation of the ovalbumin in solution than the ovalbumin conjugated onto nanoparticles (figure 3a and 3b), considering that the ovalbumin nanoparticles are much larger than the ovalbumin molecules . For example, within 24 hours, 28.3 6.5% of the ovalbumin in solution diffused through the pores created by the roller with large microneedles, which is significantly higher than the 13.6 2.4% for the ovalbumin nanoparticles . To confirm that it was the ovalbumin nanoparticles, rather than the ovalbumin protein hydrolyzed from the ovalbumin nanoparticles, that diffused through the pores created by the microneedle rollers, permeation of the fluorescein - labeled nanoparticles alone the rate of diffusion of the fluorescein nanoparticles was similar to the diffusion of the fluorescein - labeled ovalbumin nanoparticles . Finally, diffusion of dope - fluorescein from the fluorescein - labeled nanoparticles placed into a dialysis tube (molecular weight cut off, 50,000) was evaluated as well . It was found that, within 24 hours, release of dope - fluorescein from the nanoparticles was not detectable, regardless of whether the release medium was phosphate - buffered saline or phosphate - buffered saline with sodium dodecyl sulfate 0.5% (data not shown), which indicated that the observed permeation of fluorescein - labeled nanoparticles in figure 3c was not caused by the diffusion of the dope - fluorescein molecules from the fluorescein - labeled nanoparticles and then through the skin . Taken together, the data in figure 3 demonstrate that ovalbumin nanoparticles of 230 22 nm permeated through the micropores created by a microneedle, even using the roller with the smallest microneedles (200 m long, base diameter 20 m), and that as expected, the extent of permeation was dependent on the size of the microneedles used . This observation is in agreement with that of coulman et al who showed permeation of 138 22 nm polystyrene nanoparticles through human skin pretreated with microneedles (280 m long, base diameter 200 m),7 but is in disagreement with the reports by zhang et al and bal et al using poly(lactic - co - glycolic) acid nanoparticles (166, 206, or 288 nm) and diphtheria toxoid - n - trimethyl chitosan nanoparticles (211 4 nm), respectively.8,25 in the study by bal et al, the length of microneedles used was 300 m.25 the size of the nanoparticles used in the present study was similar to that used by bal et al . It is interesting that the ovalbumin nanoparticles permeated through the skin area pretreated with the smallest microneedles (200 m long, base diameter 20 m). It is speculated that, besides particle size, other factors, such as materials used to prepare the nanoparticles, surface charge of the nanoparticles, and the strain and source of animals used to harvest skin all contributed to different observations in the different studies . Finally, in the present study, for easy detection, diffusion of the fluorescein - labeled nanoparticles through the skin and into the receiver compartment was measured . We are aware that, for transcutaneous immunization, one expects to target the antigen inside the skin, particularly the epidermis, not necessarily to deliver the antigen through the skin because the skin epidermis has abundant antigen - presenting cells.36 as shown in figure 4a, both ovalbumin in solution or ovalbumin nanoparticles failed to induce an antiovalbumin immunoglobulin g response when applied to intact mouse skin with hair trimmed . However, pretreatment using the microneedle roller with large microneedles (1000 m long, base diameter 80 m) allowed both ovalbumin alone and ovalbumin nanoparticles to induce an antiovalbumin immunoglobulin g response (figure 4a). Importantly, the antiovalbumin immunoglobulin g level in mice that received the ovalbumin nanoparticles was significantly higher than that in mice that received ovalbumin alone (figure 4a), demonstrating that, when dosed onto a mouse skin area pretreated with microneedles, formulating a protein antigen into nanoparticles can enhance its immunogenicity . Bal et al showed that microneedle - mediated delivery of diphtheria toxoid incorporated into n - trimethyl chitosan nanoparticles did not induce a stronger antibody response than the diphtheria toxoid alone.25 therefore, it does not appear that formulating any protein antigen in any nanoparticles will be beneficial . Many factors, including the physical, chemical, and immunological properties of the nanoparticles, the antigen itself, and the dimension of the microneedles, may be responsible for the disagreement observed . Interestingly, bal et al actually reported that when diphtheria toxoid was physically mixed with the n - trimethyl chitosan nanoparticles and applied onto mouse skin pretreated with microneedles, it induced a stronger antidiphtheria toxoid immune response than diphtheria toxoid alone.25 this observation led the authors to predict that conjugation of antigen with polymeric nanoparticles, instead of incorporation of antigens inside nanoparticles, could be a better option to potentiate further the immune responses by microneedle - mediated vaccination.25 our data in figure 4a appear to support their prediction . Therefore, more research on formulating the antigen of interest into the proper nanoparticles is warranted for successful microneedle - mediated immunization using antigens carried by nanoparticles . Figure 4b shows the antiovalbumin immunoglobulin g response induced by the ovalbumin nanoparticles applied onto a mouse skin area pretreated with different sized microneedle rollers . As expected, pretreatment using the roller with large microneedles enabled induction of a significantly stronger antiovalbumin immunoglobulin g response than using the rollers with small and medium microneedles (figure 4b). However, pretreatment using the roller with small microneedles and the roller with medium microneedles did not lead to different levels of antiovalbumin immunoglobulin g response (figure 4b). The in vitro diffusion data in figure 3a show that the roller with medium microneedles (500 m long, base diameter 50 m) allowed significantly more permeation of ovalbumin nanoparticles than the roller with small microneedles (200 m long, base diameter 20 m). It is possible that the amounts of ovalbumin nanoparticles that can permeate through the micropores created by these two different sized microneedles in vivo were not different enough to be detected by measuring the resulting antiovalbumin antibody levels . Therefore, it is likely that for any specific nanoparticle formulation, the optimal dimension of the microneedles to be used needs to be identified individually . Mice were treated with ovalbumin nanoparticles containing 10.5 g of ovalbumin initially in order to compare the antibody responses induced by ovalbumin nanoparticles applied onto a skin area pretreated using microneedles with the same ovalbumin nanoparticles applied by subcutaneous injection . As shown in figure 5a, antiovalbumin immunoglobulin g levels induced by ovalbumin nanoparticles given by subcutaneous injection or by transcutaneous immunization following microneedle treatment were not significantly different (p = 0.38, 100-fold dilution). Moreover, it appeared that the antibody response induced by the ovalbumin nanoparticles dosed onto a skin area pretreated with microneedles was dose - dependent . For example, ovalbumin nanoparticles at a dose of 70 g per mouse applied onto a skin area pretreated with the microneedles induced a stronger antiovalbumin immunoglobulin g response than at a dose of 10.5 g (figure 5a). However, when the ovalbumin dose was increased from 10.5 g per mouse to 70 g per mouse, transcutaneous immunization following microneedle treatment induced a weaker antiovalbumin immunoglobulin g response than subcutaneous injection (figure 5b), indicating that the antigen dose determines whether transcutaneous immunization following microneedle treatment with antigens carried by nanoparticles is more effective than subcutaneous injection . The dose of 70 g ovalbumin per mouse was initially selected because data from a previous study showed that subcutaneous immunization with 70 g of ovalbumin in ovalbumin - conjugated nanoparticles induced a strong antibody response.29 the ovalbumin dose of 10.5 g (ie, 15% of 70 g) per mouse was used later because the in vitro data in figure 3a showed that, within 24 hours, only about 15% of the ovalbumin nanoparticles permeated through a mouse skin area pretreated using the roller with large microneedles . Of course it is likely that in vivo, less than 15% of the ovalbumin nanoparticles have permeated through the skin treated using the same microneedle roller due to factors such as accelerated closure of the micropores and less than ideal permeation conditions . Moreover, it is known that microneedle puncture is less efficient in vivo than in vitro because of the more flexible skin tissue, a nonflat skin surface, the cushioning effect of fat and muscle layers.37 nonetheless, transcutaneous immunization with a nanoparticle - based vaccine formulation onto a skin area pretreated with microneedles has the potential to elicit a stronger immune response than that achieved by subcutaneous injection using a hypodermic needle . Transepidermal water loss was measured to evaluate the extent to which treatment with microneedle rollers had damaged the integrity of the skin . As shown in figure 6, transepidermal water loss in the treated skin area increased significantly, and the roller with larger microneedles led to a larger increase in transepidermal water loss immediately after treatment using the microneedle rollers . Transepidermal water loss then gradually decreased and reached a level similar to that of intact skin within 24 hours when the rollers with small and medium microneedles were used (figure 6), in agreement with what was previously reported.5 however, it took a longer period of time, ie, 48 hours, for transepidermal water loss on the skin area pretreated using the roller with large microneedles (1000 m long, base diameter 80 m) to reach the intact level (figure 6). The kinetics of transepidermal water loss in figure 6 confirmed that treatment with microneedles caused physical damage, albeit reversible, to the skin, which was previously known.5 however, the relevance of this reversible physical damage is not well understood . Specifically, it is unknown to what extent the micropores created by the microneedles may enhance penetration of microbes through the treated skin area, considering that microbes, such as bacteria and viruses, exist physically as nanoparticles or microparticles in the environment and on the skin surface . This information is clinically relevant because it allows prediction of the potential risk or lack of risk of microbial infection associated with treatment using microneedles . Recognizing this issue, donnelly et al studied in vitro permeation of radiolabeled microbes through porcine skin pretreated with microneedles.34 in their study, harvested porcine skin was saturated with bacteria and then treated with microneedles to evaluate the extent to which the microneedles can carry pre - existing microbes through the skin.34 in the present study, an ex vivo system was devised to evaluate the extent to which pre - existing micropores created by the microneedles will allow permeation of live bacteria through the skin . Anesthetized mice were treated with the microneedle rollers and immediately euthanized to harvest the treated skin samples, which were then used to evaluate permeation of live nonpathogenic e. coli dh5. E. coli is a rod - shaped bacterium about 200500 nm in diameter and 2 m long, which is physically a nanorod particle.38 as shown in figure 7a, live e. coli dh5 bacteria can permeate through micropores created by microneedle rollers on the skin, and pretreatment using a roller with larger microneedles allowed permeation of more bacteria . It was determined that using the present method, the microneedle rollers created about 250 pores / cm on the treated skin area . The area in the franz diffusion cells was 0.64 cm, which means that the number of bacterial colony forming units shown in figure 7a represent the total number of bacteria that permeated through roughly 160 micropores created by the microneedle rollers within four hours . Data in figure 7b showed that the micropores created by the microneedles also closed rather quickly . Within 36 hours of microneedle treatment, the pores became impermeable to e. coli bacteria, in agreement with what was previously reported, ie, that skin recovers its barrier function 34 hours after microneedle treatment.39 data in figure 7a indicate that the number of e. coli bacteria permeating through the single pore created by a 21 gauge hypodermic needle within four hours was equal to the number of e. coli permeating through the micropores (about 160) created by the roller with large microneedles (1000 m long, base diameter 80 m) within the same period of time . In other words, one single pore created by the 21 gauge hypodermic needle was equivalent to about 160 micropores created by the roller with large microneedles . Clinically, a 21 gauge needle is normally used to withdraw blood, and smaller needles are generally used for vaccination . It is expected that the risk of bacterial infection associated with microneedle treatment is more likely to be less than the risk associated with a hypodermic needle injection . Nonetheless, the finding in the present study does underscore the need for sterilization of any formulation that is to be applied onto a skin area pretreated with microneedles and also the need to keep the application area clean prior to and after microneedle treatment . Therefore, any findings made in a mouse model will ultimately need to be validated in humans . Before transition to humans, porcine skin is a good model to predict more accurately what is expected in humans because porcine skin is very similar to human skin.40 finally, microneedles have been exploited in various ways to deliver vaccine, ie, solid microneedles coated with vaccines, dissolvable microneedles with vaccine incorporated in the needles, hollow microneedle - based injection, and the application of a vaccine formulation onto the skin prior to or after the skin area was treated with microneedles . At this moment, transcutaneous immunization on a skin area pre - treated with microneedles has the slight limitation of being a two - step procedure . However, it is not impossible that this limitation can be overcome by creative engineering in the future . Moreover, all the four methods mentioned above have their own unique advantages and disadvantages.26 solid microneedles of sufficient strength are commercially available, and it is economical to mass produce them . However, coating of a particular vaccine onto solid microneedles involves reformulation to optimize viscosity and protein concentration to avoid aggregation.26 the long - term stability of a dry - coated microneedle vaccine is likely better than for liquid injectables, but the stability of a particular vaccine is dependent on refined formulation and appropriate packaging.24 in addition to all these issues, immunization via a coated solid microneedle is also a multistep process . Immunization needs administration of needles, a waiting time of 12 minutes to allow the coating to dissolve and, finally, application of a patch over the treated area . The manufacturing of dissolvable microneedles with sufficient strength is still a challenge, and laboratory scale production of dissolvable microneedles usually involves the melting of polymers at a high temperature, which is detrimental to protein stability.41 hollow microneedles for injection suffer from concerns about potential clogging, back pressure from densely packed skin layers, and aggregation and syringeability for highly concentrated formulations.26 in addition, stability of the proteins and leakage issues during storage of prefilled hollow microneedles are still of practical concern.26 therefore, the perceived inconvenience associated with the two - step procedure of transcutaneous immunization prior to or after microneedle treatment should not preclude further research efforts . Moreover, knowledge gleaned from using solid microneedles is always transferable to other microneedle systems . Transcutaneous immunization onto a skin area pretreated with microneedles with the protein antigen carried by nanoparticles induced a stronger antigen - specific antibody response than using the protein antigen alone . The antigen dose used to immunize the mice determined whether the microneedle - mediated immunization can induce a stronger immune response than when the same nanoparticle - based vaccine formulation was dosed by subcutaneous injection . Damage to the physical integrity of the skin caused by microneedles, although reversible, may permit permeation of live bacteria through the skin, but the risk of bacterial infection associated with microneedles is not expected to be higher than that associated with injection using a hypodermic needle . With the increasing interest in nanoparticles as a drug delivery system, more research on skin permeation of nanoparticles prior to or after microneedle treatment is warranted.
The arrayexpress archive of functional genomics data is one of the major international repositories for functional genomics high - throughput data . Since 2003 (1), the database has grown to 15 000 experiments comprised of 425 000 assays . During this period, the technology used to generate functional genomics data has changed from microarray - based experiments to high - throughput sequencing . To address this, we have developed and integrated submissions of high - throughput sequencing data with the european genome - phenome archive (ega) (lappalainen, i . Et al ., submitted) and the european nucleotide archive (ena) (2). Other important developments are the inclusion of all gene expression omnibus (geo) array - based data and a new data exchange agreement with the geo (3) for high - throughput sequencing data, a new advanced query capability supporting ontology - based queries over the entire archive contents . The european bioinformatics institute's gene expression atlas (gxa) (4) is now a separate resource from the archive and is linked from the arrayexpress graphical user interface . Adjusting arrayexpress to accept and display high - throughput sequencing experiments alongside existing array data is one of the major recent developments . We have worked closely with other resources at european bioinformatics institute, specifically the ena and ega, who archive short - read data for multi - species and potential human identifiable data, respectively . As outlined in minseqe guidelines (minimum information about a high throughput sequencing experiment, http://www.mged.org/minseqe), the provision of raw sequence data is insufficient to describe comparative experiments such as rna - seq; metadata describing the experimental conditions and processed data are necessary to interpret the experiment . There are parallels to the provision of metadata for microarray - based experiments (in addition to the raw data files, e.g. Cel files); therefore, the mage - tab (5) data representation format is both an appropriate and an easy to use format for describing these experiments . Submission of high - throughput sequencing data are now supported by the mage - tab template generation system (6). This allows users to generate and complete a taxon - specific tab - delimited template which describes their experiment and to supply related data files by ftp or aspera . Where raw data are available these are integrated into the ena at the point of submission, and both arrayexpress experiment accessions and ena identifiers for sequences are returned to the user by arrayexpress curators . Exceptions to this process are submissions with human data which are potentially identifiable, e.g. Sequence of human patients . These data are submitted direct to the ega in mage - tab format, raw data are retained by the ega and summary - level data which meet ethical requirements for release are released to arrayexpress . Sequencing - based experiments in arrayexpress now have clickable links from the user interface to the ena sequence archive to raw data files, and links are also provided in the mage - tab . Work is in progress to develop an automated bioconductor (7) package to identify, extract and reprocess rna - seq data for inclusion in the gxa . Arrayexpress provides rich metadata for samples and experiments, these are typically provided as free - text name value pairs, e.g. Disease state, invasive ductal carcinoma . To enable semantic queries (for instance, to find all cancer - related data sets even if they were not annotated as leukemia), we have developed open source software that allows for query expansion based on the experiment factor ontology (efo) (8). Efo is a data - driven application ontology developed to describe the sample attributes and experimental variables in functional genomics data sets . For example, retrieve all experiments where one or more samples is annotated as cancer, or a subtype of cancer returns 21 083 assays, without the ontology support and 49 729 assays using subsumption queries for known subtypes of cancer . The query results are visualized with yellow matching original input, green matching synonyms and red matching child terms . The ontology is visualized as a tree on query and users are provided with autocomplete options based on its content . Additionally, the interface has been modified so that experiments can be queried by assay types (array / high - throughput sequencing), source (geo / arrayexpress) and molecule (dna / rna). Arrayexpress has been importing selected geo (3) data sets (gds) in order to provide unified queries across public data and for integration with european bioinformatics institute databases such as ensembl (9). To date more than 12 000 geo - derived experiments and associated array designs are available, import of all geo data will be complete by the end of 2010 . Selected gds are re - annotated, subjected to quality control and integrated into the gxa . A data exchange agreement between geo and arrayexpress is now in place for high - throughput sequencing data and all htp sequencing data submitted to geo are present in arrayexpress . Software developed tools for curation processes are publicly available; recent software releases include a lexical mapping application, zooma (http://zooma.sf.net), the ontocat ontology query service (http://ontocat.sf.net), a canonical mage - tab parser (http://limpopo.sf.net), mage - tab format conversion tools (http://tab2mage.sf.net) and a mage - tab importer for bioconductor (10). Arrayexpress will be closely integrated with a new biosample database at the european bioinformatics institute (ebi) (http://www.ebi.ac.uk/biosamples). This database will store the sample descriptions for all the samples referenced by any of the databases . Samples can be pre - submitted and will be linked to ebi databases where related data exist . For example, 1000 genomes, coriell cell lines or hapmap samples have records in the ena, ega and arrayexpress . This new resource is being developed in conjunction with the ncbi and data exchange is planned . The replacement of existing mage - om centric architecture (11) with mage - tab - based infrastructure is ongoing and data migration is underway . This effort will significantly simplify all internal data management tasks and will benefit the users in improved data load times, faster issuing of accession numbers, faster data exchange with geo and improved query interfaces . The existing browse user interface will be maintained, as will current programmatic access and ftp site structure to ensure minimum disruption for users . Adjusting arrayexpress to accept and display high - throughput sequencing experiments alongside existing array data is one of the major recent developments . We have worked closely with other resources at european bioinformatics institute, specifically the ena and ega, who archive short - read data for multi - species and potential human identifiable data, respectively . As outlined in minseqe guidelines (minimum information about a high throughput sequencing experiment, http://www.mged.org/minseqe), the provision of raw sequence data is insufficient to describe comparative experiments such as rna - seq; metadata describing the experimental conditions and processed data are necessary to interpret the experiment . There are parallels to the provision of metadata for microarray - based experiments (in addition to the raw data files, e.g. Cel files); therefore, the mage - tab (5) data representation format is both an appropriate and an easy to use format for describing these experiments . Submission of high - throughput sequencing data are now supported by the mage - tab template generation system (6). This allows users to generate and complete a taxon - specific tab - delimited template which describes their experiment and to supply related data files by ftp or aspera . Where raw data are available these are integrated into the ena at the point of submission, and both arrayexpress experiment accessions and ena identifiers for sequences exceptions to this process are submissions with human data which are potentially identifiable, e.g. Sequence of human patients . These data are submitted direct to the ega in mage - tab format, raw data are retained by the ega and summary - level data which meet ethical requirements for release are released to arrayexpress . Sequencing - based experiments in arrayexpress now have clickable links from the user interface to the ena sequence archive to raw data files, and links are also provided in the mage - tab . Work is in progress to develop an automated bioconductor (7) package to identify, extract and reprocess rna - seq data for inclusion in the gxa . Arrayexpress provides rich metadata for samples and experiments, these are typically provided as free - text name value pairs, e.g. Disease state, invasive ductal carcinoma . To enable semantic queries (for instance, to find all cancer - related data sets even if they were not annotated as leukemia), we have developed open source software that allows for query expansion based on the experiment factor ontology (efo) (8). Efo is a data - driven application ontology developed to describe the sample attributes and experimental variables in functional genomics data sets . For example, retrieve all experiments where one or more samples is annotated as cancer, or a subtype of cancer returns 21 083 assays, without the ontology support and 49 729 assays using subsumption queries for known subtypes of cancer . The query results are visualized with yellow matching original input, green matching synonyms and red matching child terms . The ontology is visualized as a tree on query and users are provided with autocomplete options based on its content . Additionally, the interface has been modified so that experiments can be queried by assay types (array / high - throughput sequencing), source (geo / arrayexpress) and molecule (dna / rna). Arrayexpress has been importing selected geo (3) data sets (gds) in order to provide unified queries across public data and for integration with european bioinformatics institute databases such as ensembl (9). To date more than 12 000 geo - derived experiments and associated array designs are available, import of all geo data will be complete by the end of 2010 . Selected gds are re - annotated, subjected to quality control and integrated into the gxa . A data exchange agreement between geo and arrayexpress is now in place for high - throughput sequencing data and all htp sequencing data submitted to geo are present in arrayexpress . Software developed tools for curation processes are publicly available; recent software releases include a lexical mapping application, zooma (http://zooma.sf.net), the ontocat ontology query service (http://ontocat.sf.net), a canonical mage - tab parser (http://limpopo.sf.net), mage - tab format conversion tools (http://tab2mage.sf.net) and a mage - tab importer for bioconductor (10). Arrayexpress will be closely integrated with a new biosample database at the european bioinformatics institute (ebi) (http://www.ebi.ac.uk/biosamples). This database will store the sample descriptions for all the samples referenced by any of the databases . Samples can be pre - submitted and will be linked to ebi databases where related data exist . For example, 1000 genomes, coriell cell lines or hapmap samples have records in the ena, ega and arrayexpress . This new resource is being developed in conjunction with the ncbi and data exchange is planned . The replacement of existing mage - om centric architecture (11) with mage - tab - based infrastructure is ongoing and data migration is underway . This effort will significantly simplify all internal data management tasks and will benefit the users in improved data load times, faster issuing of accession numbers, faster data exchange with geo and improved query interfaces . The existing browse user interface will be maintained, as will current programmatic access and ftp site structure to ensure minimum disruption for users . European molecular biology laboratory, the european commission (sling grant agreement number 226073, gen2phen grant agreement number 200754); us national institutes of health (the national human genome research institute, the national institute of biomedical imaging and bioengineering and the national cancer institute) (grant number p41 hg003619). Funding for open access charge: european molecular biology laboratory functional genomics team budget . Conflict of interest statement.
Seasonal influenza epidemics impose a heavy burden on society, with 35 million cases and 250 000500 000 deaths worldwide every year.1 the resulting economic impact is large and includes both direct and indirect costs.2,3 traditionally, attention has been directed toward influenza a, which accounts for the majority of influenza cases in most seasons46; its subtypes are also responsible for influenza pandemics.7 during interpandemic periods, however, influenza b can represent a considerable proportion of total cases.8 since the 1970s, influenza b viruses have belonged to two antigenically distinct lineages called the victoria and yamagata lineages9; this has been a challenge for seasonal influenza vaccines as only one influenza b strain is included in the trivalent vaccine . Studies in the united states have shown that the frequent influenza b vaccine mismatches of recent years have been associated with substantial increases in cases, hospitalizations and deaths (up to annual 970 000 cases, with 8200 hospitalizations and 485 deaths, in the usa),10 as well as with large influenza - related medical costs, and costs associated with productivity loss.11 despite the important role of influenza b, much of the published scientific literature regarding the epidemiology of influenza has focused on influenza a, and we still have a relatively poor understanding of global epidemiology and burden of disease of influenza b, especially outside europe and the united states.8 several studies have reported on the burden of disease attributable to influenza b in a single season, or during consecutive seasons in a single country,12,13 but only one study thus far has looked at the global epidemiology of influenza b.4 in particular, it is very important to assess the epidemiology of influenza in the tropics, as this is where approximately 40% of the world s population live,14 and influenza activity there is quite different from other world regions15,16: countries in the tropics may experience two annual peaks, and epidemics are not as short and intense as in the northern and southern hemispheres.1719 these differences can have important implications for effective and evidence - based decisions regarding the composition and period of administration of influenza vaccines . The global influenza b study (gibs) was launched in 2012 with the main aim of collecting information on the epidemiology and global burden of disease of influenza b during the past 1015 years, to support future prevention policies . Gibs is a project of the global influenza initiative, an expert scientific forum established to address the ongoing problems related to influenza worldwide . To achieve this objective, we contacted countries around the world during the period june 2013 to february 2014, requesting access to data from their national influenza surveillance systems . Here, we compare four important epidemiological and virological characteristics of influenza a and b in 26 countries: the proportion of influenza b over all influenza cases; the community impact of influenza b; the frequency of influenza b vaccination mismatches; and the age distribution of influenza a and b cases . The global influenza b study (gibs) was launched in 2012 with the main aim of collecting information on the epidemiology and global burden of disease of influenza b during the past 1015 years, to support future prevention policies . Gibs is a project of the global influenza initiative, an expert scientific forum established to address the ongoing problems related to influenza worldwide . To achieve this objective, we contacted countries around the world during the period june 2013 to february 2014, requesting access to data from their national influenza surveillance systems . Here, we compare four important epidemiological and virological characteristics of influenza a and b in 26 countries: the proportion of influenza b over all influenza cases; the community impact of influenza b; the frequency of influenza b vaccination mismatches; and the age distribution of influenza a and b cases . We contacted national influenza centers in 43 countries in the northern and southern hemispheres and the intertropical belt; countries were selected to represent all world health organization (who) influenza transmission zones.20 all countries were asked to make available data originating from their national influenza surveillance system during recent years (ideally from 20002013). Spreadsheet data reporting templates were provided, along with instructions on how to report data . Each participating country was asked to provide the following: virological data: weekly number of influenza cases reported by the national surveillance system, broken down by age group (05, 635 months, 34, 517, 1839, 4064 and 65 years); virus type (a versus b); and virus subtype [a(h1n1), a(h3n2), a(h1n1)pdm2009, a(h1n2), a, unsubtyped] or lineage (b / victoria, b / yamagata, b, not characterized). Epidemiological data: weekly influenza - like illness (ili)/acute respiratory infection (ari) rates per 100 000 population or 100 consultations (depending on what is routinely available within each national surveillance system). Virological data: weekly number of influenza cases reported by the national surveillance system, broken down by age group (05, 635 months, 34, 517, 1839, 4064 and 65 years); virus type (a versus b); and virus subtype [a(h1n1), a(h3n2), a(h1n1)pdm2009, a(h1n2), a, unsubtyped] or lineage (b / victoria, b / yamagata, b, not characterized). Epidemiological data: weekly influenza - like illness (ili)/acute respiratory infection (ari) rates per 100 000 population or 100 consultations (depending on what is routinely available within each national surveillance system). For countries that extend over large areas, especially when stretched across different climate zones (such as china and brazil), we asked for data stratified by region / province, if it were available . All countries received a national feedback report shortly after providing the data, so that they had the opportunity to check the data they had sent . They were also all asked to complete a short questionnaire on the main features of their national influenza surveillance system (see table s1). The questionnaire included questions on the ili / ari case definition in use; patients being sampled; representativeness of data; methods used for identification and characterization of influenza virus; and the population denominator . Influenza epidemics usually occur between october of a given year and april of the following year in countries in the northern hemisphere, and between april and october of a given year in the southern hemisphere, with greater variability observed for countries situated near the tropics.17 for the purposes of this study, we define a season as being the period between the first and last week of a given year (for the tropics and the southern hemisphere) or between the 27th week of a given year and the 26th week of the following year (for the northern hemisphere), so that each season includes the whole period of increased influenza activity in each country . For conciseness, when looking at season 2005, we refer to 20052006 for countries in the northern hemisphere, and year 2005 for all other countries . For each country, only the seasons with at least 50 influenza reported cases and at least 20 weeks of data reporting were included in the analysis . Analyses were conducted for all countries and then separately for countries situated in the northern or southern hemisphere or in the intertropical belt (defined as the country centroid, when available, or the largest city being located north of the tropic of cancer and south of the tropic of capricorn).21 for each country and season, we calculated the percentage of influenza cases that were due to influenza b virus and then worked out its median value for countries in the northern and southern hemispheres and in the intertropical belt . We calculated the number of seasons that were dominated by either lineage among those where there was a significant circulation of influenza b (defined as the proportion of influenza b being 20% of all influenza cases reported during the season). For this analysis, we only considered seasons where the proportion of influenza b cases characterized was 10% . An influenza b vaccine mismatch was defined as a mismatch between the influenza b lineage included in the vaccine and the lineage that caused the majority (> 50%) of cases in a season with significant circulation of influenza b; using this definition, we calculated the proportion of seasons where a vaccine mismatch was observed . The information on vaccine composition was obtained from the who website.22 we calculated the percentage of vaccine mismatch according to three alternative scenarios: (i) all tropical countries situated north of the equator adopting the who recommendations for the northern hemisphere, and vice versa; (ii) all tropical countries using the northern hemisphere who recommendation; or (iii) all tropical countries adopting the southern hemisphere who recommendation . To explore whether there was an association between the magnitude of the influenza season and the proportion of influenza cases due to b virus type, we obtained the country - specific z - score of the weekly ili / ari rate (defined as the number of standard deviations above or below the country - specific average of the ili / ari rate) and calculated the pearson s correlation coefficient between its maximum value and the proportion of influenza b cases during each season . We hypothesized that a moderate - to - mild inverse correlation would be seen between the proportion of influenza b and the maximum weekly ili / ari rate in the northern and southern hemispheres, as influenza a viruses cause most influenza cases and are responsible for short and intense epidemics especially influenza a(h3n2)compared with influenza b. we calculated the percentage of influenza a and b cases in each country in each of the following age categories: 04, 517, 1864 and 65 years; we tested whether the percentage of influenza a versus b cases differed in each age group using a chi - square test . When the exact age was available, we also obtained virus type - specific median age and interquartile range (iqr) and used the wilcoxon rank sum test to detect any differences in median age of influenza a versus b cases . All analyses were performed using stata version 11 (statacorp lp, college station, tx, usa) and microsoft excel . All statistical tests were two - sided, and a p - value of <005 was considered significant . We contacted national influenza centers in 43 countries in the northern and southern hemispheres and the intertropical belt; countries were selected to represent all world health organization (who) influenza transmission zones.20 all countries were asked to make available data originating from their national influenza surveillance system during recent years (ideally from 20002013). Spreadsheet data reporting templates were provided, along with instructions on how to report data . Each participating country was asked to provide the following: virological data: weekly number of influenza cases reported by the national surveillance system, broken down by age group (05, 635 months, 34, 517, 1839, 4064 and 65 years); virus type (a versus b); and virus subtype [a(h1n1), a(h3n2), a(h1n1)pdm2009, a(h1n2), a, unsubtyped] or lineage (b / victoria, b / yamagata, b, not characterized). Epidemiological data: weekly influenza - like illness (ili)/acute respiratory infection (ari) rates per 100 000 population or 100 consultations (depending on what is routinely available within each national surveillance system). Virological data: weekly number of influenza cases reported by the national surveillance system, broken down by age group (05, 635 months, 34, 517, 1839, 4064 and 65 years); virus type (a versus b); and virus subtype [a(h1n1), a(h3n2), a(h1n1)pdm2009, a(h1n2), a, unsubtyped] or lineage (b / victoria, b / yamagata, b, not characterized). Epidemiological data: weekly influenza - like illness (ili)/acute respiratory infection (ari) rates per 100 000 population or 100 consultations (depending on what is routinely available within each national surveillance system). For countries that extend over large areas, especially when stretched across different climate zones (such as china and brazil), we asked for data stratified by region / province, if it were available . All countries received a national feedback report shortly after providing the data, so that they had the opportunity to check the data they had sent . They were also all asked to complete a short questionnaire on the main features of their national influenza surveillance system (see table s1). The questionnaire included questions on the ili / ari case definition in use; patients being sampled; representativeness of data; methods used for identification and characterization of influenza virus; and the population denominator . Influenza epidemics usually occur between october of a given year and april of the following year in countries in the northern hemisphere, and between april and october of a given year in the southern hemisphere, with greater variability observed for countries situated near the tropics.17 for the purposes of this study, we define a season as being the period between the first and last week of a given year (for the tropics and the southern hemisphere) or between the 27th week of a given year and the 26th week of the following year (for the northern hemisphere), so that each season includes the whole period of increased influenza activity in each country . For conciseness, when looking at season 2005, we refer to 20052006 for countries in the northern hemisphere, and year 2005 for all other countries . For each country, only the seasons with at least 50 influenza reported cases and at least 20 weeks of data reporting were included in the analysis . Analyses were conducted for all countries and then separately for countries situated in the northern or southern hemisphere or in the intertropical belt (defined as the country centroid, when available, or the largest city being located north of the tropic of cancer and south of the tropic of capricorn).21 for each country and season, we calculated the percentage of influenza cases that were due to influenza b virus and then worked out its median value for countries in the northern and southern hemispheres and in the intertropical belt . We calculated the number of seasons that were dominated by either lineage among those where there was a significant circulation of influenza b (defined as the proportion of influenza b being 20% of all influenza cases reported during the season). For this analysis, we only considered seasons where the proportion of influenza b cases characterized was 10% . An influenza b vaccine mismatch was defined as a mismatch between the influenza b lineage included in the vaccine and the lineage that caused the majority (> 50%) of cases in a season with significant circulation of influenza b; using this definition, we calculated the proportion of seasons where a vaccine mismatch was observed . The information on vaccine composition was obtained from the who website.22 we calculated the percentage of vaccine mismatch according to three alternative scenarios: (i) all tropical countries situated north of the equator adopting the who recommendations for the northern hemisphere, and vice versa; (ii) all tropical countries using the northern hemisphere who recommendation; or (iii) all tropical countries adopting the southern hemisphere who recommendation . To explore whether there was an association between the magnitude of the influenza season and the proportion of influenza cases due to b virus type, we obtained the country - specific z - score of the weekly ili / ari rate (defined as the number of standard deviations above or below the country - specific average of the ili / ari rate) and calculated the pearson s correlation coefficient between its maximum value and the proportion of influenza b cases during each season . We hypothesized that a moderate - to - mild inverse correlation would be seen between the proportion of influenza b and the maximum weekly ili / ari rate in the northern and southern hemispheres, as influenza a viruses cause most influenza cases and are responsible for short and intense epidemics especially influenza a(h3n2)compared with influenza b. we calculated the percentage of influenza a and b cases in each country in each of the following age categories: 04, 517, 1864 and 65 years; we tested whether the percentage of influenza a versus b cases differed in each age group using a chi - square test . When the exact age was available, we also obtained virus type - specific median age and interquartile range (iqr) and used the wilcoxon rank sum test to detect any differences in median age of influenza a versus b cases . All analyses were performed using stata version 11 (statacorp lp, college station, tx, usa) and microsoft excel . All statistical tests were two - sided, and a p - value of <005 was considered significant . China provided separate data for the northern and southern parts of the country.23 brazil provided data stratified by its five administrative regions: north, north - east, central - west, south - east and south; however, as results of the analyses did not differ across regions, results for the whole country are shown . Participating countries are distributed in the northern (n = 7) and southern (n = 5) hemispheres and in the intertropical belt (n = 14), cover 16 of the 18 who influenza transmission zones,20 and account for around 37% of the world s population (table1). Comparison of geography, demographics and main features of influenza surveillance systems of participating countries (from southern- to northernmost). The global influenza b study ari, acute respiratory infection; ili, influenza - like illness; pcr, polymerase chain reaction; sari, severe acute respiratory infection; who, world health organization . The influenza surveillance systems of the participating countries differ from each other (table1); in most cases, however, they cover the whole country, sample both outpatients and hospitalized patients, and send isolates to a who collaborating center for reference . Most countries in the northern and southern hemispheres had data on ili rates (ari rates for singapore), with a mixture of consultation and population denominators, but many countries in the tropics had no such data . Overall, 935 673 influenza cases were reported to the national influenza centers during 200 seasons between 2000 and 2013 (table2). Of these, 288 130 cases (308%) were reported before the emergence of the 2009 a(h1n1) pandemic influenza . Countries provided a median of seven seasons, ranging from four seasons for argentina, costa rica, and honduras, to 13 for new zealand . The proportion of influenza a cases subtyped was 651%, and 171% of influenza b cases were characterized . The information on age was available for 476% and 591% of influenza a and b cases, respectively . Influenza cases reported to the national influenza surveillance system of each participating country (from southern- to northernmost), and percentages of cases that were subtyped, by virus type . The global influenza b study seasons 20012002 and 20032004 in the ukraine were not included as the number of reported influenza cases was <50 . The proportion of influenza cases due to type b virus was <20% for 90 seasons, 2050% for 82 seasons and figure2 shows the distribution of seasons according to the proportion of influenza cases caused by type b virus, separately for countries situated in the northern or southern hemisphere or in the intertropical belt . The median proportion of influenza b over all influenza seasons was 178% in the southern hemisphere (iqr 35304%; 39 seasons), 243% in the intertropical belt (iqr 102408%; 94 seasons), and 214% in the northern hemisphere (iqr 73380%; 67 seasons). The p - value for the comparison of the median proportion of influenza b in the southern hemisphere versus the intertropical belt was borderline significant (007) and not significant for the other comparisons . Distribution of influenza seasons by proportion of influenza b cases and geographical area (southern hemisphere, intertropical belt and northern hemisphere). The spearman s rank correlation coefficient for the association between the proportion of influenza b during a given season and the maximum ili rate z - score during the same season was 031 in the southern hemisphere [95% confidence interval (ci) 064 to 012; 23 seasons], 009 in the intertropical belt (95% ci 043 to 026; 32 seasons), and 031 in the northern hemisphere (95% ci 054 to 004; 51 seasons) (figure3). Proportion of influenza b and maximum influenza - like illness (ili) rate (z - score) during each season, by geographical area (southern hemisphere, intertropical belt and northern hemisphere). The proportion of influenza b cases that were characterized was 10% for 79 of the 200 seasons . If one assumes that all countries in the intertropical belt used the who recommendations for the hemisphere they are situated or the who recommendation for the southern hemisphere, an influenza b vaccine mismatch was seen in 19 of 79 seasons (2425%): 11 of 36 seasons in the northern hemisphere (31%), six of 22 seasons in the southern hemisphere (27%), and two of 21 seasons in the intertropical belt (10% or 14%) (table s2). If one assumes the who recommendation for the northern hemisphere was followed, the results are very similar: there were a total of 20 mismatches and three mismatches for the intertropical belt countries . Influenza b accounted for 20% or more of all influenza cases during 50 of these 79 seasons: victoria and yamagata lineages predominated in 32 (64%) and 18 (36%) seasons, respectively . Also, the victoria and yamagata lineages often co - circulate in the same season: in 16 of 50 seasons, both lineages accounted for at least 20% of influenza b cases (table s2). Table s3 presents the age distribution of a versus b influenza cases in each country . A consistent finding across most countries is a younger age for influenza b versus a cases . In particular, there was a consistently higher proportion of influenza b cases in the 517 years age group, and a cases in the 1864 years age group in southern and northern hemisphere countries (except south africa, brazil, turkey, and ukraine) and in some countries of the intertropical belt (madagascar, indonesia, singapore, costa rica, nicaragua, guatemala, and vietnam). Influenza b cases were also younger than a cases in panama, el salvador, and honduras, where there was a higher proportion of b cases among patients aged 04 years . No differences in age distribution were observed in kenya, cameroon, and the ivory coast; these were the only countries where over 50% of all influenza cases were aged 4 years . Finally, influenza a cases were older than b cases in south africa, brazil, turkey, and ukraine . The gibs was conceived and implemented to obtain a better understanding of the global epidemiology of influenza b, with a particular focus on the tropics, which have been relatively neglected by the research so far.8 our main finding was that influenza b is a common virus in the 21st century, representing roughly 20% of all cases reported to national influenza centers in 26 countries around the world during 20002013 . Although the differences were not statistically significant, there is some evidence of geographical variability in the occurrence of influenza b around the world, with it being most common in the tropics (median 243%) and least common in the southern hemisphere (178%). We found that influenza b rarely represented over 50% of flu cases (once every seven seasons) and was generally associated with lower rates of ili in the northern and (with borderline significance) southern hemispheres . We also found that there was frequently a vaccine mismatch when influenza b circulated in a country; this happened more often in the northern and southern hemispheres compared with the tropics . Finally, influenza b generally affected younger persons than influenza a, with the former mainly affecting school - aged children (aged 517 years) and the latter adults (aged 1864 years). It is not yet clear what causes the differences in influenza epidemiology (including timing, periodicity, and patterns of transmission) in the tropics compared with the southern and northern hemispheres.15 the non - significant higher proportion of influenza b in the tropics may simply reflect the relatively higher proportion of children, who are the most affected age group, in most countries of this region compared to the northern and southern hemispheres . It would, however, be necessary to calculate age - specific incidence rates of influenza to confirm or refute this hypothesis . Future research should prioritize the study of influenza epidemiology in this very populous area of the world, to optimize prevention strategies and the composition and timing of administration of the influenza vaccine . The divergent results of the correlation between the proportion of influenza b and peak of ili rate mirror the differences in influenza epidemiology in temperate and tropical countries, with short epidemics and greater year - to - year fluctuations for influenza a than b in the former4 and a year - round influenza activity and higher average proportion of b in the latter.17 it is usually not possible to predict with reasonable accuracy the impact of the upcoming influenza season based on historical data,24 and we have shown that victoria and yamagata lineages often co - circulate in the same season (table s2). The frequency of vaccine mismatch has been high in recent years (2425% in the gibs database), but its potential consequences in terms of influenza cases, influenza - related deaths, and economic costs are difficult to estimate at the beginning of an influenza season . This has important implications for vaccination strategies, including the decision to adopt a quadrivalent influenza vaccine.10 differences in the age distribution of influenza a versus b patients across countries may be explained in a variety of ways, including differences in the age structure of the population and in the national influenza surveillance systems (e.g. Whether the latter is mainly outpatient or hospital based). Inequalities in access to health care by age or the presence of comorbidities (children and older patients are more likely to see a general practitioner or be taken to hospital, and therefore be sampled, compared with adults over 18 years of age) may also affect the age distribution of influenza cases . In some countries (e.g. Cameroon and kenya), the lack of differences in age distribution may be due to the small number of influenza cases in those age categories where the differences are most frequently observed, that is, 517 and 1864 years . Finally, the percentage of influenza a cases due to seasonal and pandemic a(h1n1) and a(h3n2) subtypes may differ across gibs countries (especially as a consequence of each country providing data for different influenza seasons), so comparing b versus a as a whole may be suboptimal virus a subtypes may preferentially affect people of different age groups.25 a more in - depth analysis of age distribution across virus subtypes and lineages will be the topic of a future gibs publication . The major limitation of our study lies in the differing characteristics of the national influenza surveillance systems of participating countries . In particular, the different definitions of ili (or ari) that are in use and the differences in the sources of patients included in the national databases (outpatients, hospitalized patients, severe ari patients) may reduce the comparability of data across countries . Some world regions (such as northern africa and central asia) are currently not represented in our database, which somewhat lessens the generalizability of our results . However, the gibs database already includes more than 900 000 influenza cases and is still growing; in the future, therefore, it will be possible to address specific questions on subsets of cases with common characteristics . Large countries may have very different epidemiological patterns at a regional level and climatic characteristics, and in those cases, the lack of stratified data may prevent the execution of analyses with the required level of detail . For some countries, regional data are available (e.g. Brazil and china), but in other countries, for example the united states and australia, it remains an issue this study indicates that it is important to take into consideration influenza b in the epidemiology of seasonal influenza, as it often co - circulates with influenza a and accounts for roughly 20% of total cases in all regions of the world, despite it rarely being the dominant strain . We believe that global data on the epidemiology of influenza b, as those produced by the gibs, are needed on a continuing basis to help optimize influenza prevention policies and determine the public health value of introducing influenza vaccines containing two b lineages . In particular, we recommend that future studies exploit the potential of the gibs database, with its age - specific data, to assess the benefits of adopting influenza vaccination in different regions of the world, and tailor the vaccination campaigns to each country s requirements . Sc, fs, qsh, mac, spl, and jp participated in the design of the study . Gk, ro, sw, cmph, rn, raf, hy, lf, mz, awc, hk, spu, hak, ge, j - mh, qsh, lwa, mv, mac, am, lb, and ltqm collected the data . Sc, fs, qsh, mac, spl, and jp interpreted the data . Other than some of the authors being gii members, and the gibs being supported by an unrestricted research grant from sanofi pasteur, the authors have no competing interests to declare . The global influenza b study includes the following members: juan manuel rudi, instituto nacional de enfermedades respiratorias dr . Emilio coni, santa fe, argentina; rhonda owen, influenza surveillance section, surveillance branch, office of health protection, department of health and ageing, woden, australia; kunzang dorji, public health laboratory, department of public health, ministry of health, thimphu, bhutan; jos ricardo pio marins and walquiria aparecida ferreira de almeida, ministry of health, braslia, df, brazil; marie - astrid vernet and guy vernet, service de virologie, centre pasteur du cameroun, yaounde, cameroon; winston andrade, seccin de virus respiratorios y exantemticos, instituto de salud pblica de chile, santiago de chile, chile; juan yang and ming li, division of infectious disease, key laboratory of surveillance and early - warning on infectious disease, chinese center for disease control and prevention, beijing, china; jenny lara, national influenza center, ministry of health, san jos, costa rica; celina de lozano, national influenza center, ministry of health, san salvador, el salvador; richard pebody, joanna ellis and helen green, respiratory diseases department, public health england, colindale, uk; leticia castillo, national influenza center, ministry of health, guatemala city, guatemala; maria luisa matute, national influenza center, ministry of health, tegucigalpa, honduras; nurhayati, ministry of health, republic of indonesia, and us naval medical research unit no . 2, jakarta indonesia; isabella donatelli, national influenza center, istituto superiore sanit, rome, italy; coulibaly daouda, national institute of public hygiene, abidjan, cte divoire; joshua a. mott, us centers for disease control and prevention, nairobi, kenya; norosoa harline razanajatovo, national influenza center, virology unit, institut pasteur of madagascar, antananarivo, madagascar; laurence randrianasolo, epidemiology unit, institut pasteur of madagascar, antananarivo, madagascar; liza lopez, institute of environmental science and research, wellington, new zealand; angel balmaseda, national influenza center, ministry of health, managua, nicaragua; brechla moreno, national influenza center, ic gorgas, panama city, panama; jeffrey cutter, communicable diseases division, ministry of health, singapore, singapore; vernon j. lee, communicable diseases division, ministry of health, singapore, and saw swee hock school of public health, national university of singapore, singapore; cheryl cohen, centre for respiratory diseases and meningitis (crdm), national institute for communicable diseases, johannesburg, south africa, and school of public health, faculty of health science, university of the witwatersrand, johannesburg, south africa; selim badur, istanbul university, istanbul, turkey; larysa radchenko, l.v . Gromashevsky institute of epidemiology and infectious diseases national academy of medical science of ukraine, kiev, ukraine; joseph bresee, epidemiology and prevention branch, influenza division, centers for disease control and prevention, atlanta, ga, usa . Table s1 . Questionnaire on national influenza surveillance systems used for the global influenza b study . Proportion of influenza b cases due to victoria or yamagata lineage virus, and mismatch with recommended world health organization (who) influenza vaccine . Seasons were only considered during which at least 20% of influenza cases were due to virus type b with at least 10% of these being characterized . The global influenza b study . Proportion of influenza a versus b cases across age categories, median age and interquartile range (iqr), in countries (from southern- to northernmost) participating in the global influenza b study.
Serpiginous choroidopathy, also known as geographic helicoid peripapillary choroidopathy, is one of the white dot syndromes and is a rare clinical condition responsible for less than 5% of posterior uveitis cases . It is unassociated with systemic disease, affects young to middle - aged adults and has a high relapse rate as noted by wells and smith (2014). As described by nazari and rao (2013), tuberculosis has been associated with a chorioretinitis that mimics serpiginous choroidopathy and is termed serpiginous - like choroidopathy (slc). According to crawford and igboeli (2013), treatment of serpiginous choroidopathy with corticosteroids is not as effective as anti - inflammatory treatment with cyclosporine, cyclophosphamide or chlorambucil in preventing recurrences . Stem cell ophthalmology treatment study (scots) uses the platelet rich bone marrow fraction which contains bone marrow derived stem cells (bmsc). The constituents of the platelet rich bone marrow may include various growth factors that can be stimulatory to the constituent bmsc such as hepatocytic growth factor and insulin - like - growth factor (zhang et al ., 2015). Paracrine factors released from mesenchymal stem cells within the bmsc fraction may be neuroprotective and stimulate neuronal regeneration (mead et al ., 2015). Bmsc have been show to stimulate proliferation and differentiation of retinal progenitor cells through cytokine expression and neurotrophic factors (xia et al ., bmsc have been shown to produce nerve growth factor and glial neurotrophic factors (garcia et al ., 2004). Additional evidence has developed for the release of micro rna (mirna) and transfer rna (trna) through exosomes in msc from the bone marrow as established by baglio et al . (2015) have noted that extracellular vesicles derived from bmsc appear to play a role in tissue repair, including microvesicles and exosomes containing diverse proteins, messenger rna (mrna) and mirna . (2013) have shown that immunomodulation provided by bmsc may promote recovery of damaged tissues including neurologic tissue through interleukin (il)-23/il-17 in disease with an inflammatory component . These various mechanisms all probably play a role in recovery of visual function in choroidal disease through reduction of residual inflammation and improvement in the existing cellular function . Transdifferentiation of the bmsc may also be occurring as evidenced by the increased macular thickening and improved vision, similar to neural transdifferentiation of bmsc transplanted into injured spinal cord tissue noted by vaquero and zurita (2009). Scots, the stem cell ophthalmology treatment study, is the largest ophthalmology stem cell study registered at clinicaltrial.gov (nct01920867) approved by an institutional review board verified by the us national institutes of health . Written informed consent was obtained from the patient . All patients meeting eligibility criteria and enrolled in the study receive active treatment of bone marrow derived stem cells and their associated neurotrophic factors . Bone marrow aspirated from the posterior iliac crest is separated to provide bmsc within the stem cell concentrate separated through centrifugation . -have objective, documented damage to the retina or optic nerve unlikely to improve or -have objective, documented damage to the retina or optic nerve that is progressive . -and have less than or equal to 20/40 best corrected central visual acuity in one or both eyes and/or an abnormal visual field in one or both eyes . -be at least 3 months post - surgical treatment intended to treat any ophthalmologic disease and be stable . -if under current medical therapy (pharmacologic treatment) for a retinal or optic nerve disease be considered stable on that treatment and unlikely to have visual function improvement (for example, glaucoma with intraocular pressure stable on topical medications but visual field damage). -have the potential for improvement with bmsc treatment and be at minimal risk of any potential harm from the procedure . -be medically stable and able to be medically cleared by their primary care physician or a licensed primary care practitioner for the procedure . Medical clearance means that in the estimation of the primary care practitioner, the patient can reasonably be expected to undergo the procedure without significant medical risk to health . -patients who are not capable of an adequate ophthalmologic examination or evaluation to document the pathology . -patients who are not capable or not willing to undergo follow up eye exams with the principle investigator or their ophthalmologist or optometrist as outlined in the protocol . -patients who may be at significant risk to general health or to the eyes and visual function should they undergo the procedure . There are three arms of scots with the type of treatment chosen based on the degree of visual loss, etiology of visual loss, associated risk factors for the treatment arms and the patient's medical risk status . Bilateral treatment is provided assuming both eyes meet eligibility requirements . As these are autologous stem cells, no immunosuppression is required . An fda cleared centrifugation medical device is used to separate the bone marrow aspirate into a stem cell concentrate . This concentrate has averaged 1.2 billion total nucleated cells including mesenchymal stem cells in approximately 1415 ml of concentrate . 3 ml of concentrate was used for retrobulbar injection, 1 ml for subtenon injection, 0.05 ml for intravitreal injection, approximately 0.1 ml for subretinal injection and approximately 0.2 ml for intra - optic nerve injection . Arm 1 consists of retrobulbar and subtenon injection of stem cell concentrate followed by intravenous infusion . Patients with ophthalmic conditions which preclude safe or effective utilization of intravitreal injection of concentrate, such as the presence of silicon oil, may be offered arm 1 if meeting inclusion criteria . Arm 2 consists of the administration of retrobulbar, subtenon and intravitreal concentrate followed by intravenous infusion . Patients meeting inclusion criteria with visual acuity between 20/40 and 20/200 in one or both eyes and/or visual field loss may be offered arm 2 . Arm 3 is reserved for retinal and optic nerve disease patients with severe visual loss meaning visual acuity of 20/200 or worse in at least one eye . Arm 3 consists of the better - seeing eye receiving the same treatment as arm 1 or more typically, arm 2, and the eye with more extensive visual acuity loss receiving a core pars plana vitrectomy with injection of subretinal or intra - optic nerve concentrate followed by the infusion of intravenous stem cells . Follow up is required at 1, 3, 6 and 12 months post treatment with reporting of the eye exam results to the principal investigator and study director . Unlike pharmaceutical studies in which a single condition is treated, scots focuses on the endpoint of visual loss, not the instigating cause . This allows the treatment of various retinal and optic nerve diseases, many of which are not presently the subject of clinical treatment studies, and include visual loss resulting from more than one disease . The scots procedure is patient funded and typically performed under general anesthesia . Written informed consent is obtained from each patient for publication of reports and any accompanying images . Treatment is provided in a fully licensed ambulatory surgical center in coconut creek, fl, usa . -have objective, documented damage to the retina or optic nerve unlikely to improve or -have objective, documented damage to the retina or optic nerve that is progressive . -and have less than or equal to 20/40 best corrected central visual acuity in one or both eyes and/or an abnormal visual field in one or both eyes . -be at least 3 months post - surgical treatment intended to treat any ophthalmologic disease and be stable . -if under current medical therapy (pharmacologic treatment) for a retinal or optic nerve disease be considered stable on that treatment and unlikely to have visual function improvement (for example, glaucoma with intraocular pressure stable on topical medications but visual field damage). -have the potential for improvement with bmsc treatment and be at minimal risk of any potential harm from the procedure . -be medically stable and able to be medically cleared by their primary care physician or a licensed primary care practitioner for the procedure . Medical clearance means that in the estimation of the primary care practitioner, the patient can reasonably be expected to undergo the procedure without significant medical risk to health . -patients who are not capable of an adequate ophthalmologic examination or evaluation to document the pathology . -patients who are not capable or not willing to undergo follow up eye exams with the principle investigator or their ophthalmologist or optometrist as outlined in the protocol . -patients who may be at significant risk to general health or to the eyes and visual function should they undergo the procedure . There are three arms of scots with the type of treatment chosen based on the degree of visual loss, etiology of visual loss, associated risk factors for the treatment arms and the patient's medical risk status . An fda cleared centrifugation medical device is used to separate the bone marrow aspirate into a stem cell concentrate . This concentrate has averaged 1.2 billion total nucleated cells including mesenchymal stem cells in approximately 1415 ml of concentrate . 3 ml of concentrate was used for retrobulbar injection, 1 ml for subtenon injection, 0.05 ml for intravitreal injection, approximately 0.1 ml for subretinal injection and approximately 0.2 ml for intra - optic nerve injection . Arm 1 consists of retrobulbar and subtenon injection of stem cell concentrate followed by intravenous infusion . Patients with ophthalmic conditions which preclude safe or effective utilization of intravitreal injection of concentrate, such as the presence of silicon oil, may be offered arm 1 if meeting inclusion criteria . Arm 2 consists of the administration of retrobulbar, subtenon and intravitreal concentrate followed by intravenous infusion . Patients meeting inclusion criteria with visual acuity between 20/40 and 20/200 in one or both eyes and/or visual field loss may be offered arm 2 . Arm 3 is reserved for retinal and optic nerve disease patients with severe visual loss meaning visual acuity of 20/200 or worse in at least one eye . Arm 3 consists of the better - seeing eye receiving the same treatment as arm 1 or more typically, arm 2, and the eye with more extensive visual acuity loss receiving a core pars plana vitrectomy with injection of subretinal or intra - optic nerve concentrate followed by the infusion of intravenous stem cells . Follow up is required at 1, 3, 6 and 12 months post treatment with reporting of the eye exam results to the principal investigator and study director . Unlike pharmaceutical studies in which a single condition is treated, scots focuses on the endpoint of visual loss, not the instigating cause . This allows the treatment of various retinal and optic nerve diseases, many of which are not presently the subject of clinical treatment studies, and include visual loss resulting from more than one disease . The scots procedure is patient funded and typically performed under general anesthesia . Written informed consent is obtained from each patient for publication of reports and any accompanying images . Treatment is provided in a fully licensed ambulatory surgical center in coconut creek, fl, usa . A 77-year - old male patient experienced bilateral acute visual loss in their middle 20's to 20/100 in both eyes as a result of a choroidopathy, eventually diagnosed as serpiginous choroidopathy . The vision loss improved somewhat early in its course, but persisted throughout the patient's life . In the patient's early 70's, following cataract surgery with intraocular lens implantations, the visual acuity remained the same at 20/100 in the right eye and improved to 20/30 in the left eye . Five years later, best corrected visual acuity was 20/80 in the right eye and 20/50 in the left eye as a result of the serpiginous choroidopathy . Visual acuities on the early treatment diabetic retinopathy study (etdrs) charts were 22 in the right eye and 36 in the left eye at one meter . On pre - procedure examination, old inactive scarring of the retinal pigment epithelium and choroid in both eyes and small disc drusen in both eyes were observed (figure 1). Pre - procedure retinal photographs of right eye (right image) and left eye (left image) showing extensive chorioretinal atrophy and pigmentary changes as a result of serpiginous choroidopathy . The baseline visual fields demonstrated dense central and paracentral scotomas of both eyes: right mean deviation was 20.00 with pattern standard deviation 12.52 and left mean deviation was 19.48 with pattern standard deviation 13.63 (figure 2). The baseline ocular coherence tomography of the maculae (figure 3) showed a bilateral maculopathy with retinal nerve fiber layer thinning in both eyes . Pre - procedure (september 2, 2014) humphrey visual fields, with the right eye (right image) and left eye (left image) showing visual field loss . Pre - procedure (september 2, 2014) and post - procedure (july 30, 2015) macular thickness measurements showing improvement in each eye approximately 8 months following the stem cell ophthalmology treatment study procedure . The patient was assigned to scots arm 2 in each eye, and bmsc were administered through retrobulbar, subtenon and intravitreal approaches on december 12, 2014 without complication . At 1 month after surgery, the patient reported a 2 week history of dramatic visual acuity improvement sufficient to regain his driver's license . The visual acuities improved in each eye by snellen and etdrs (near and far) testing . At 1 month after surgery, best corrected snellen visual acuity improved in the right eye from 20/80 to 20/60 and in the left eye from 20/50 to 20/20 . Etdrs showed steady improvement over this time with gains of 46 letters for the right eye and 33 letters for the left eye at 1 meter finally achieving a score of 68 in the right eye and 69 in the left eye . Table 1 shows the visual acuities at baseline, 1 and 8 months after scots treatment . Early treatment diabetic retinopathy study (etdrs) and snellen pre and post stem cell ophthalmology treatment study (scots) treatment showing visual acuity improvement over time in july 2015, at 8 months after scots, there was mild improvement centrally in the humphrey visual fields: the right eye appeared slightly better with mean deviation 19.41 and pattern standard deviation 11.62; the left eye showed mean deviation of 20.51 with pattern standard deviation 13.19 (figure 4). Ocular coherence tomography showed a thickening of the retinal nerve fiber layer in the macula of each eye at 8 months after scots as compared with the baseline measurements . Figure 3 baseline macular volumes and macular volumes 8 months after therapy demonstrate the ocular coherence tomography fast macular scans . During the post - scots procedure post - procedure (july 30, 2015) humphrey visual fields, with the right eye (right image) showing mild central improvement . This patient with serpiginous choroidopathy included in this study initially experienced bilateral acute visual loss (20/100 in the right eye and 20/100 in the left eye). In the patient's mid 70's, the visual acuity was best corrected 20/80 in the right eye and 20/50 in the left eye . The patient chose to participate in scots and underwent retrobulbar, subtenon and intravitreal injection of autologous bmsc in each eye . At 1 month after treatment, the visual acuity improved to 20/60 in the right eye and 20/20 in the left eye . At 8 months after surgery, the visual acuity was 20/60 in the right eye and 20/25 in the left eye . This patient with long term serpiginous choroidopathy experienced significant improvement in his visual acuity and ocular coherence tomography outcomes following treatment with autologous bmsc as proscribed in the protocols developed for the scots . Autologous bmsc may prove a valuable addition to the treatment of serpiginous choroidopathy and other retinal conditions demonstrating an immunologic or choroidal component.
This view is supported by the large number of intrinsically unfolded proteins that are the causative agents of amyloid diseases, such as -synuclein, amyloid- peptide (a), and amylin . In terms of folded protein precursors, a link between local or global unfolding and the onset of aggregation has been documented . Indeed, decreased native state stability and a reduction in co - operativity have been linked with enhanced amyloidogenicity of several proteins, including human lysozyme, transthyretin, prion protein, superoxide dismutase (sod), and 2-microglobulin (2 m). These findings have guided theoretical approaches to predict aggregation - prone regions of folded proteins by combining the intrinsic propensity of a protein sequence to self - assemble with its probability to become exposed (e.g., by increased predicted hydrogen - exchange rates). Along similar lines, strategies to stabilize native - like conformations by the use of small molecules, aptamers, molecular chaperones or via other protein protein interactions all reduce amyloid formation . However, a quantitative link between the conformational properties and dynamics of individual partially folded species and amyloid propensity remains elusive, in part because of difficulties in identifying and characterizing amyloid intermediates in atomic detail . In addition, the complexity of the energy landscape of proteins, which involves many potentially amyloidogenic species, exacerbates the intricacy of the system . In this study we investigate the structural, kinetic, and thermodynamic properties of sparsely populated intermediates of human and murine 2 m (h2 m, m2 m, respectively) and link their properties to the known, very different amyloid propensities of these proteins . M forms amyloid fibrils in the joints of patients undergoing hemodialysis, in a pathological condition known as dialysis - related amyloidosis . Previous studies have examined the link between the folding pathway of 2 m and its aggregation propensity . These studies showed that h2 m does not aggregate at neutral ph unless additives such as cu, trifluoroethanol (tfe), or other cosolvents, which partially unfold the protein, are added . As h2 m contains a thermodynamically unfavorable cis prolyl - peptide bond at position 32, protein folding involves a slow folding phase which is attributed to trans cis proline isomerization of this bond . A native - like intermediate containing a trans - pro 32 (it) accumulates during folding of h2 m, which can be trapped by removal of the n - terminal six residues of the protein, to create the variant n6 . At neutral ph, the concentration of it correlates directly with the rate of amyloid formation of h2 m, suggesting that formation of this on - pathway native - like folding intermediate is a key determinant of amyloid formation . This supposition is confirmed by the ability of n6 to aggregate readily at ph 6.2 . On the other hand, m2 m, despite being 70% identical in sequence to h2 m and also containing a cis - x pro 32 bond, does not form amyloid fibrils at neutral ph, or even when unfolded under acidic conditions (unless high concentrations of salt are added) (figure 1a and 1b). The basis of such dramatically different amyloid propensities despite the sequence and structural similarities of these two proteins remained unclear . (a) the nmr structure of monomeric h2 m (gray-2xks) overlaid with the crystal structure of m2 m bound to the mhc - i complex (green-1lk2) or with the solution structure of n6 (red-2xku). (b) aggregation assay of 80 m h2 m (gray), m2 m (green), or n6 (red) in 10 mm sodium phosphate buffer, ph 6.2 (three replicates for each protein). Negative stain electron micrographs, color - coded with the same scheme, are shown on the right (scale bar = 500 nm). (d) correlation between experimental rdcs measured for m2 m in 10 mg / ml phage pf1 and those back - calculated from the crystal structure 1lk2 (r = 0.85). Here, we set out to investigate the molecular origins of the reduced amyloidogenicity of m2 m . We characterize the stability, structure, and dynamics of the native protein and show that despite its inability to form amyloid, m2 m is kinetically and thermodynamically less stable than its human counterpart . The folding pathway of m2 m is then explored using real - time nmr, taking advantage of the power of nonuniformly sampling (nus) methods to reveal detailed information on the energy landscape of m2 m folding . Combined with other biophysical methods, we show that while m2 m also folds through an it state, this species is relatively more flexible than its h2 m counterpart and in conformational exchange with other, less - structured non - native states . The molten globule - like characteristics of the m2 m folding intermediate reduce the lifetime of the structured, well - folded it state, which now represents only a minor substate in the structural ensemble . Our findings confirm the vital role of it (and hence a highly structured, yet non - native species) in determining the aggregation of 2 m . Moreover, the results highlight the importance of defining the energy landscape of amyloidogenic proteins in detail to allow prediction of their amyloid propensity . The findings presented also suggest that targeting a defined non - native species should be a successful means of controlling the fate of assembly of 2 m and, in principle, that of other amyloidogenic proteins which aggregate via a specific, non - native precursor . The pink plasmid containing the h2 m, m2 m, or n6 gene was transformed into e. coli cells of the bl21 de3 plyss- strain . Starter cultures were generated by inoculating 100 ml of lb medium with cells containing the relevant gene and 50 g / ml carbenicilin and 50 g / ml chloramphenicol and incubating overnight at 37 c, 200 rpm . (1 g / l n - nh4cl, 2 g / l c - glucose) medium were inoculated with 10 ml of starter culture . Cells were incubated at 37 c, 200 rpm until they reached an od600 of 0.6 and then the expression of 2 m was induced by the addition of isopropyl -d-1-thiogalactopyranoside (iptg - final concentration of 1 mm). Expression was allowed to continue overnight at 37 c, and cells were harvested next morning using a heraus continual action centrifuge performing at 15 000 rpm . The cell pellet containing 2 m as inclusion bodies was chemically lysed by the addition of 50100 ml of lysis buffer (100 g / ml lysozyme, 50 g / ml dnase i, 50 g / ml phenylmethylesulfonyl fluoride (pmsf), 10 mm tris - hcl ph 8.0). Further cell disruption was performed using a constant cell disrupter system (constantsystems) at a high pressure of 20.0 kpsi . Inclusion bodies were separated using centrifugation (15 000 rpm using a sorvall ss34 rotor) in a beckman centrifuge for 40 min at 4 c, and the inclusion body pellet was washed with 10 mm tris - hcl ph 8.0 buffer four times . Finally, 2 m was solubilized in 1020 mm tris - hcl ph 8.0 (h2 m, n6) or 1020 mm tris - hcl ph 8.5 (m2 m) containing 8 m urea (mp biomedicals) and refolded by dialysis (3000 mw cutoff) against 25 the refolded protein was centrifuged for 30 min at 15000 rpm (sorvall ss34 rotor) to pellet insoluble material, and the supernatant was loaded on a q - sepharose (ge healthcare) column already equilibrated with 2 column volumes of 20 mm tris - hcl ph 8.0 (h2 m, n6) or 20 mm tris - hcl ph 8.5 (m2 m) for anion exchange purification . Bound protein was eluted with a gradient of 0400 mm nacl (in the same buffer) over 800 ml and was freeze - dried after dialysis in dh2o or concentrated using 3000 mw cutoff centricons (avanti ltd). Freeze - dried protein was resuspended in 10 mm sodium phosphate buffer ph 7.0 (h2 m, n6) and 10 mm sodium phosphate buffer ph 8.2 (m2 m) filtered through 0.2 m filters (fisher scientific) and gel - filtered using a hiload superdex-75 prep column (amersham biosciences), calibrated with a standard gel filtration calibration kit (ge healthcare). The monomer peak was collected, concentrated, aliquoted, and stored at 80 c or freeze - dried . Assignments of the backbone atoms of m2 m were obtained using samples of 500 or 750 m uniformly labeled (n, c) protein in 10 mm sodium phosphate buffer ph 6.2, 83.3 mm nacl, 0.02% (w / v) nan3, and 10% (v / v) d2o . Three - dimensional (3d) nmr experiments were recorded at 25 c using varian inova spectrometers (agilent) operating at proton frequencies of 500 mhz (hnca, hnco, cbca(co)nh, hn(ca)co) and 750 mhz (hncacb), equipped with a room temperature or cryogenic probe, respectively . Samples for h / d exchange experiments were prepared in 10 mm sodium phosphate buffer ph 6.2 and then freeze - dried . Freeze - dried protein was dissolved in 100% (v / v) d2o containing 83.3 mm nacl and placed into the nmr tube after manual mixing . The loss of intensity of amide proton resonances was then monitored by sofast h n hsqc spectra (510 min each) at 25 c . Residual dipolar coupling (rdc) experiments (j modulated series) were carried out using a sample of 200 m n - m2 m in 10 mm sodium phosphate ph 8.2 and aligned in 11 mg / ml bacteriophage pf1 (asla scientific). Rdc data were back - calculated from crystal structures using pales . For relaxation experiments, a sample of 80 m n - m2 m was prepared in 10 mm sodium phosphate buffer at ph 6.2 with 10% (v / v) d2o, 0.02% (w / v) nan3, 83.3 mm nacl . T2 experiments were perfomed with 2048 and 128 complex points in the direct and indirect dimension using 18.8, 37.7, 56 . 6, 75.5, 94.4, 113.2, 132,1, 151.0 ms as relaxation delays . The relaxation delays for the t1 experiments were 0.0.16, 0.32, 0.48, 0.64, 0.80, 0.96, 1.12, 1.44 s. for h n noe cross - relaxation experiments saturation of amide protons was achieved with a train of 120 pulses for 3.5 s prior to the experiment . All relaxation and rdc experiments were performed at 25 c, using a 600 mhz varian inova spectrometer equipped with a room tempreature probe . Direct carbon detection experiments were performed using a sample of c, n m2 m at 1.3 mm on a 950 mhz bruker spectrometer equipped with a cryogenic tci probe (1024 and 160 complex points in the direct and indirect dimensions). For real - time refolding experiments two refolding protocols were followed: (1) protein samples were made in 10 mm sodium phosphate buffer ph 6.2 and freeze - dried . Unfolding was performed by dissolving the freeze - dried protein (23 mg) in 3060 l of the same buffer containing 8 m urea at 37 c for 1 h, and the protein was then refolded by rapid 10-fold dilution in 10 mm sodium phosphate ph 6.2, 10% (v / v) d2o, and 0.02% (w / v) nan3; (2) protein samples were made in 250 l of 10 mm sodium phosphate and 10% (v / v) d2o, and the ph was adjusted to 2.0 (or ph 3.6) using tris - hcl . Refolding was then initiated by addition of 50 l of 300 mm sodium phosphate buffer, ph 7.2 (final ph 6.16.3). Both refolding protocols were found to give rise to similar spectra of the intermediate species . This observation demonstrates that the increased flexibility of the murine intermediate (see results) is not the result of the residual 0.8 m urea present at the end of the first refolding protocol . The refolding from it to native h2 m was monitored by a series of sofast h n hsqc spectra at 25 c, with 80 increments in the indirect dimension, two scans per increment and 512 complex points, resulting in a total acquisition time of 45 s. to assign the i1 state of m2 m, refolding was monitored by continuous acquisition of nus nmr spectra . N best - trosy were collected on separate samples (800 mhz bruker avance iii hd spectrometer with 3 mm tci cryoprobe). N best - trosy, having the highest sensitivity, was chosen as a reference spectrum to guide 3d spectra multidimensional decomposition (mdd) coprocessing with a sliding time frame window, resulting in a temporal resolution of a few minutes (see supplementary methods). To aid assignment of the real - time spectra, two samples were prepared in which the early intermediate of m2 m was highly populated . The first consisted of 600 m of uniformly labeled c, n m2 m in 10 mm sodium phosphate and 10 mm sodium acetate ph 3.6, and the second consisted of 250 m of uniformly labeled c, n m2 m in 10 mm sodium phosphate ph 6.2 with 1 m urea added . Both samples gave rise to hnca spectra that closely resembled the real - time hnca spectrum of the early intermediate of m2 m . Additional 3d spectra were performed using these samples including hnca, hnco, and cbcaconh utilizing a 600 mhz varian inova spectrometer equipped with a room tempreature probe . Talos+ uses h, nh, co, c, and c backbone chemical shifts to calculate the random coil chemical shift index which is then converted to backbone s. aggregation assays performed on these samples confirmed that the early folding intermediate of m2 m is not aggregation - prone . Samples containing 60 m protein in 10 mm sodium phosphate buffer, ph 6.2, or 10 mm sodium phosphate, with 10 mm sodium acetate ph 3.6, or in 10 mm sodium phosphate buffer, ph 6.2, with 1 m urea, with the appropriate amount of nacl added to give a total ionic strength of 100 mm), 0.02% (w / v) nan3 and 10 m thioflavin t (tht) were incubated at 37 c in sealed 96 well plates (thermo scientific) with agitation at 600 rpm . Fluorescence was monitored at 480 10 nm after excitation at 440 10 nm using a fluorostar optima microplate reader (bmg labtech). Urea stock solutions containing 75 mm sodium phosphate buffer, ph 6.2, and either no urea or 10.5 m urea were made, and the exact concentration of urea was determined using the measured refractive index (ceti refractometer). The stock solutions were used to make samples of protein containing 010 m urea in 0.2 m increments, with a final protein concentration of 0.2 mg / ml . Samples were incubated at 25 c for 12 h before analysis using tryptophan fluorescence . Fluorescence was excited at 295 nm, and the emission was monitored at 340 nm using a photon technology international qm-1 spectrofluorimeter (pti). The data were then globally fit to a two - state model:1where guf (kj mol) is the equilibrium stability, muf is the equilibrium m - value, a and c represent the denaturant - dependence of the folded and unfolded signal intensities, respectively, and b and d are the signal intensities of the folded and unfolded states, respectively, in the absence of denaturant . Carbon coated copper grids were prepared by the application of a thin layer of formvar with an overlay of carbon . Samples were centrifuged (14 000 g, 10 min), and the pellets were resuspended in fresh 10 mm sodium phosphate buffer, ph 6.2, diluted to a final protein concentration of 12 m with deionized water and then applied to the grid in a dropwise fashion . The grid was then carefully dried with filter paper before it was negatively stained by the addition of 18 l of 2% (w / v) uranyl acetate . Experiments were performed using an applied - photophysics sx1.8mv stopped - flow fluorimeter . The temperature was held constant at 37 c (0.1 c) using a neslab circulating water bath system . Experiments were performed in buffered solutions containing 10 mm sodium phosphate (ph 6.2) and 83.3 mm sodium chloride with or without 0.4 m sodium sulfate . Refolding experiments were performed by 1:10 dilution of 80 m protein in buffer containing 8 m urea, into buffered solutions with final urea concentrations in the range 0.758.0 m. the final urea concentration ranged from 3.0 to 8.0 m for unfolding experiments . To obtain refolding data at 0 m urea, a ph jump was performed by a 1:10 dilution of 80 m protein in 10 mm phosphate (ph 2.5) into 80 mm sodium phosphate (ph 6.2). Data were normalized to the signal of the folded and unfolded protein in 0 and 8 m urea, respectively . At each urea concentration at least seven kinetic traces were obtained, averaged, and fitted to a single exponential function using the manufacturer s software . Gui1 was determined by plotting the fluorescence at the end point of a 20 s kinetic trace of folding against urea concentration and by plotting the fluorescence of the unfolded state against urea concentration (in the latter case, the values at low urea concentration were obtained by linear extrapolation from the values at high urea concentration). The fluorescence of the it state decreased with increasing urea concentration until it approached the fluorescence of the unfolded state . To estimate gui1 at 0 m urea, data were also recorded in the presence of 0.4 m na2so4 and the data in 0 and 0.4 m na2so4 were fitted globally to eq 1 . As well as being 70% identical in sequence, m2 m and h2m/n6 have similar structures (backbone rmsd 1.5) (figure 1a). However, only n6 is able to aggregate into amyloid fibrils at ph 6.2 as monitored by the increase in tht fluorescence and by negative stain em (figure 1b), in agreement with previous studies . To enable nmr studies of m2 m, chemical shift assignments were obtained for the native monomeric protein using a range of 3d nmr experiments (bmrb 19772) (85% of backbone atoms were assigned; see methods). N hsqc spectrum of native m2 m at ph 6.2 shows a single set of well - dispersed intense peaks, characteristic of a folded protein in solution that undergoes limited chemical exchange on the ms time scale (figure 1c). The only available structure of m2 m is the crystal structure of the protein bound to the heavy chain of the major histocompatibility complex (mhc - i). In the case of h2 m, binding to the heavy chain causes conformational changes particularly in the ab loop and the d strand of the protein . To determine whether the crystal structure of m2 m bound to the mhc - i complex constitutes a good representation for the structure of the monomeric protein in solution, residual dipolar couplings (rdc) were measured . Figure 1d shows that there is excellent agreement (r = 0.85) between the measured rdcs and those back - calculated from the crystal structure of mhc - i - bound m2 m (figure 1d), confirming the identity of the solution structure of monomeric m2 m with that bound to mhc - i . Therefore, differences in the structures of the native proteins cannot explain the different amyloid potential of the two variants . We next assessed whether differences in thermodynamic and/or kinetic stability between m2 m and h2m/n6 could rationalize their different amyloid propensity . Equilibrium denaturation experiments revealed that m2 m is less stable than h2 m (gun = 12.4 kj / mol) (figure 2a, 2b and supplementary table 1). Remarkably, m2 m is less stable than the aggregation prone n6 (figure 2a, 2b) demonstrating that thermodynamic instability cannot explain the inability of m2 m to form amyloid . Notably, n6 shows a reduced m - value compared with h2 m and m2 m, consistent with exposure of hydrophobic residues that are normally buried in the core of h2 m (10 of the 17 core residues become more exposed in n6). N hsqc spectra revealed that m2 m is also kinetically less stable than h2 m, with amide protons exchanging with the solvent more rapidly than h2 m, while n6 is the least kinetically stable of the three proteins studied here (figure 2c, figure s1a c, and figure s2). Nmr relaxation experiments on native m2 m also showed no regions of increased dynamics on the ps ns time scale, apart from the de loop which is known to be flexible in all 2 m variants (figure s2d thus, there is no correlation between thermodynamic or kinetic stability and amyloidogenicity of these different 2 m variants . (a) equilibrium denaturation curves for m2 m, h2 m, and n6 monitored using tryptophan fluorescence (75 mm sodium phosphate buffer ph 6.2, 25 c). (b) unfolding free energies obtained by fitting data in (a) to a two state model (see table s1). (c) representative hydrogen exchange profiles for the amide hydrogen of residue 83 in h2 m, m2 m, and n6 at 25 c and ph 6.2 (see figure s2). We next investigated whether the folding pathway of m2 m also involves transient formation of an intermediate containing trans x - pro 32 (known as the it state), the accumulation of which has been shown to correlate directly with the rate of amyloid formation of the human protein . For these experiments, m2 m was unfolded either by incubating the protein at ph 2.0 or by the addition of 8 m urea at ph 6.2 . Refolding was then initiated by dilution to a buffer of ph 7.2 or to a buffer lacking urea (see methods, figure s3), and nmr spectra were collected in real time to track the refolding reaction in residue - specific detail . In the case of h2 m, and in accordance with previous studies, a well - dispersed spectrum was observed 3 min after refolding was initiated, in which only small chemical shift differences are detected in comparison with those of the native protein (figure 3a and 3b). These results indicate that a native - like intermediate (the it state) accumulates during folding of h2 m, consistent with previous results . N sofast hsqc spectrum of native h2 m in 10 mm sodium phosphate ph 6.2 . N sofast hsqc spectrum of h2 m collected 3 min after refolding was initiated by urea dilution . Peaks that are already in their native positions are colored gray, while peaks with non - native chemical shifts are shown in red . N hsqc spectrum of n6 closely resembles the spectrum of the real - time folding intermediate of h2 m . An overlay of the spectra shown in b and c is shown as an inset . N hsqc spectrum of native m2 m in 10 mm sodium phosphate ph 6.2 . N best - trosy - hsqc of m2 m collected 3 min after refolding was initiated by urea dilution . Peaks that are already in their native positions are colored green while peaks with non - native chemical shifts are shown in purple . N hsqc spectrum of m2 m at ph 3.6 closely resembles the spectrum of the real - time folding intermediate of m2 m . As previously reported, the spectrum of n6 is very similar to that of the human it state (figure 3c). In marked contrast with the behavior of h2 m, however, the h n hsqc spectrum of m2 m 3 min after refolding is initiated revealed only 20 intense peaks with limited chemical shift dispersion in the h dimension which coexist with the most intense peaks of the native state (figure 3d and 3e). Interestingly, the partially folded state of m2 m at ph 3.6 gives rise to a h n hsqc spectrum that closely resembles the spectrum collected at ph 6.2, 3 min after refolding was initiated (figure 3f). These results suggest that partially folded species are significantly populated during the folding of m2 m, but that these species differ in structure and/or dynamics compared with their human counterparts . In order to assign the real - time spectrum of the intermediate state of m2 m, continuous, nus nmr spectra (2d - best - trosy hsqc, 3d - hnca+, and 3d - hnco+) were collected during refolding and the whole data set was coprocessed together, resulting in a temporal resolution of a few minutes . Importantly, and in contrast with other real - time studies of protein folding which consist of acquisition of sequential stand - alone spectra, this nus approach requires the acquisition of only a single spectrum . Therefore, it does not require prior knowledge about the folding reaction in order to decide on the length of each individual experiment, since the time resolution can be determined in the processing step . Additionally, increased sensitivity is achieved by coprocessing less sensitive 3d nmr spectra (e.g., hnca) with 2d experiments (e.g., hsqc). The same set of intense resonances shown in figure 3e were observed in 3d real - time spectra, consistent with these residues being flexible in the folding intermediate of m2 m . As only 20 spin systems are present in the real - time hnca spectrum further backbone assignment experiments were performed on m2 m at ph 3.6 (figure 3f) and m2 m at ph 6.2 with 1 m urea added, both of which gave rise to spectra similar to those of the kinetic intermediate (figure 3f and data not shown), removing the need for rapid data acquisition (see methods). The residue - type specific information of the c atoms from these equilibrium experiments greatly facilitated the assignment of the real - time hnca spectrum . The assignment walk on the c resonances of m2 m 5 min after folding was initiated is shown in figure 4a . The assignment revealed that all of the intense peaks shown in figure 3e correspond to residues located in the n - terminal region, the a strand, and the ab loop of m2 m (figure 4b and 4c), regions of the polypeptide chain whose dynamics have been implicated in the initiation of the aggregation of the human protein . The c - terminal four residues of the protein were also detected with chemical shifts that are different (h+n> 2 ppm) from those in the native structure . The backbone assignments (n, nh, c, c, co atoms; supplementary table 2) allow the accurate prediction of the order parameter s and, therefore, an assessment of protein dynamics . Figure 4b and 4c show that the 20 n - terminal residues show significantly increased dynamics in the folding intermediate in comparison with the native state, while the c - terminal four residues, while visible, have conformational dynamics similar to those of the native protein . (a) the assignment walk on the c atoms of the real - time best - hnca spectrum of m2 m collected 5 min after refolding was initiated by urea dilution at ph 6.2 . The s parameters of the native state are shown as light blue bars and as a red line . (c) residues observed in the real - time spectrum of the folding intermediate are highlighted in red in the structure of m2 m . (d) far - uv cd spectra of native m2 m at ph 6.2 (green) and of the folding intermediate 3 min after folding was initiated by a ph jump from ph 2.0 to ph 6.2 (red). (e) normalized fluorescence signal at the end of each stopped - flow transient (20 s) as a function of urea concentration for m2 m in the absence (red) or presence (black) of 0.4 m sodium sulfate . The data were fitted globally to a two - state model (see methods). The molten - globule - like behavior of the intermediate state (named here i1) prevents the direct observation of the majority of the resonances (apart from the 20 most flexible) in h - detected experiments, as they are in conformational / solvent exchange . To overcome this problem direct c - detection experiments were performed on m2 m at ph 3.6 in order to obtain information about the structural properties of the rest of the protein in the i1 state . These experiments revealed 80 resonances, 20 of which have sharp lines which correspond to the 20 n - terminal residues assigned above . Other resonances show broader lines suggesting that they correspond to residues with a higher degree of folding (figure s5). The far - uv cd spectrum of m2 m obtained 3 min after the ph jump from ph 2.0 to ph 6.2 shows that in i1 73% of native -sheet structure is already formed, as quantified by the ratio of the intensities at 219 nm (figure 4d). These results show that m2 m at ph 3.6 is partially structured, with the majority of residues being in a -sheet conformation, potentially native - like . These residues undergo chemical exchange on the ms time scale (or exchange rapidly with solvent) and, therefore, cannot be observed in the h n spectrum shown in figure 3e . In order to estimate the stability of the i1 state, stopped - flow fluorescence experiments were used to determine the fluorescence intensity of m2 m 20 s after folding was initiated (figure 4e). These experiments revealed that, by contrast with the it state of h2 m for which the gun is 9.57 0.54 kj / mol at 37 c, the i1 state of m2 m (gun = 4.8 kj / mol at 37 c) is only marginally stable in solution, in accordance with the real - time nmr data (figure 4e). Overall, the data show that m2 m folds through a flexible / molten globule - like intermediate state in which the n - terminus and the a strand are dynamic and detached from a native - like -sandwich fold (i1) (figure 4c). The amyloid fibrils of h2 m are composed of parallel in register -strands, while in the native monomer the -strands are all antiparallel (figure 1a). Thus, a major conformational change has to occur on the pathway to fibrils . Detachment of the a strand might represent a first step toward the remodeling of the native protein, and therefore, the early intermediate of m2 m, i1, might be expected to be highly amyloidogenic . To test this hypothesis, aggregation assays were performed using n6 at ph 6.2 as a mimic of the highly aggregation - prone state it, and m2 m at ph 3.6, conditions which favor the less structured intermediate state (i1) of m2 m . Consistent with previous results, these experiments showed that n6 aggregates rapidly at ph 6.2 with a lag time of 30 h, resulting in the formation of amyloid fibrils (figure 5a). In marked contrast, no increase in tht fluorescence was observed for m2 m at ph 3.6 (figure 5a). Indeed, the majority of the murine protein remained soluble after 100 h of incubation, while n6 was quantitatively converted into amyloid fibrils (figure 5b and 5c). Interestingly, the small amount of m2 m that was not found in the supernatant also formed short fibrils 300 nm in length (figure 5c). These results show that the partially folded state of m2 m is not highly aggregation prone . On the other hand, the specific structural features of the native - like it intermediate of h2 m are crucial for assembly . (a) tht fluorescence assays of 60 m n6 in 10 mm sodium phosphate buffer ph 6.2 (red) or 60 m m2 m in 10 mm sodium phosphate, 10 mm sodium acetate ph 3.6 (green). (b) sds - page gel of the end points shown in (a). 20 l of the reaction were spun down using a benchtop centrifuge for 20 min and a sample of the total reaction (w) or of the supernatant (s / n) after centrifugation, was analyzed by sds - page . (c) afm image of 60 m m2 m after 95 h of incubation (green in a, note that fibrils correspond to <5% of the protein added) and electron micrograph of 60 m n6 (fibrils correspond to> 95% of the protein added) after 95 h of incubation (red in a). The data presented above demonstrate that the conformational properties of the dynamic i1 state of m2 m are different from those the native - like h2 m it state . However, additional states could be populated after the formation of i1 and prior to the formation of native m2 m . Indeed, as the folding time progresses a third set of peaks (apart from the native and the flexible intermediate states (figure 3)) emerges in the real - time h these peaks show small chemical shift differences compared with the native m2 m resonances and are generally broad (figure s4) suggesting that additional, more native - like states are populated at later times during the folding of the protein . This observation presumably reflects an ordered assembly mechanism, in which the initially highly dynamic intermediate (i1) folds to the native state via a transiently populated more structured (it - like) state . To investigate this possibility further, partially folded m2 m at ph 3.6 (which mimics the i1 state figures 3e and 3f) was allowed to fold by a rapid ph jump to ph 6.2 and folding was monitored in real time using nmr . N hsqc spectrum collected 3 min after refolding was initiated showed a well dispersed spectrum (figure 6a) in striking and marked contrast with the molten globule - like spectrum of the i1 state shown in figure 3e . Indeed, the spectrum obtained 3 min after the ph jump is reminiscent of that of native m2 m with significant chemical shift differences being limited to residues in the n - terminal region (residues 16), the bc, de, and fg loops (figure 6a and 6b). Moreover, the peaks that show chemical shift differences from the native protein are remarkably similar to the third set of peaks observed in figure s4b, consistent with folding from the partially folded state (i1) to a more native - like intermediate (presumably it). Importantly, residues that show significant chemical shift changes are surrounded by residues whose resonances are not detected in the real - time nmr spectrum (figure 6b). These areas reside in close spatial proximity to pro 32 in the native structure and, therefore, are exchange - broadened . A similar scenario has been observed for the real - time folding intermediate of h2 m (it). Furthermore, n6 shows chemical shift differences to native h2 m in these same regions . Together, the results show that m2 m folds through a native - like intermediate state that has similar structural properties to the amyloidogenic it state of h2 m . However, due to its decreased stability, this species is copopulated with an ensemble of partially folded, flexible states in which the n - terminal region is highly disordered (i1). N sofast hsqc spectrum of m2 m collected 3 min after refolding was initiated from the partially folded state at ph 3.6 (blue), overlaid with the h n sofast hsqc of native m2 m (collected after 90 min) (gray). N chemical shift differences between the native and the it state of m2 m, using the spectra displayed in (a). Blue dots residues that show chemical shift differences greater than 1 ppm (dashed line) are colored yellow, those that show chemical shift differences less than 1 ppm are shown in gray, and residues that are broadened beyond detection in the 3 min spectrum are colored red . The strucure of m2 m colored in the same color scheme is shown on the right . The results presented above highlight the importance of determining the precise details of the folding energy landscape of a protein in order to elucidate whether one or more partially folded, or non - native states, have the potential to initiate amyloid assembly . Characterization of ensembles of interconverting non - native species that not only are lowly populated but also have a short lifetime, such as those involved in protein folding and aggregation, is a challenging task, even for the most advanced biophysical methods . While time - resolved nmr studies on proteins can be highly informative, these studies usually suffer from low resolution and poor sensitivity . By combining the use of sparsely sampled nmr and coprocessing of more complicated / less sensitive experiments with others that show increased sensitivity, we demonstrate here the detection and atomic level depiction of the early molten globule state, i1, of m2 m, that is populated for only 15 min, a task that would not have been possible using standard nmr methodologies (see supplementary methods). The power of the real - time nmr experiments allowed us to identify conditions that stabilize the i1 state (ph 3.6 or addition of 1 m urea at ph 6.2) and to perform more detailed nmr experiments on the trapped intermediate state that led to a complete description of the folding mechanism of the murine protein . The approach is potentially applicable to other amyloidogenic proteins or proteins that fold through the accumulation of transient intermediate states . The folding pathway of h2 m has been investigated in detail over the past decade using different protein variants and different techniques . Together, these studies have shown that the folding of h2 m involves the formation of a native - like intermediate it that is kinetically trapped by virtue of the non - native trans x - pro 32 bond . This species is preceded by a less well characterized species (i1) that forms in the dead time of a stopped flow experiment (<3 ms) and is less structured than the it state (figure 7). The fine details of the exchange processes between these different folding intermediates has a dramatic effect on the propensity to aggregate . For h2 m the structured aggregation - prone it state is the most highly populated species during folding, accumulating, on average, to 4% (ph 7.0, 37 c) at equilibrium . By contrast, the flexible i1 state represents the most highly populated intermediate state during the folding of m2 m . Indeed, the most intense peaks of the i1 state (but not those of the it state) are visible in the spectrum of native m2 m, enabling estimation of its equilibrium concentration to 7% (figure s6). This reduces the population of the m2 m it state, with the effect that aggregation no longer occurs (at least on an experimentally tractable timescale) (figure 7). Thus, although the folding mechanisms of human and murine 2 m are conserved (the same species are populated on the pathway to the native state), the precise balance between these states reduces the population of the key amyloidogenic precursor it for m2 m and thus defines the course of amyloid formation . The native - like it state is predominantly populated during the folding of h2 m (gray scheme, left). This allows the entrance to the aggregation landscape (red scheme) as it shows enhanced amyloidogenicity . In the case of m2 m (right) it represents only a minor conformation during folding, but instead the flexible molten globule - like state in which the a strand is detached from the -sandwich fold is the major non - native species . As i1 is not aggregation - prone, m2 m is protected from misfolding and instead folds to the native state (the energy levels of the aggergation landscape are drawn for illustration purposes only). Interestingly, urea denaturation experiments on a partially folded state of h2 m formed at ph 3.6 have shown that the n - terminal six residues and the a strand are the least stable regions, while the rest of the protein forms a stable core . These results are consistent with the real - time nmr studies on the i1 state of m2 m presented here, showing that the conformational properties of the early partially folded states of h2 m and m2 m are similar . Interestingly, neither of these states is able to form long, straight fibrils characteristic of amyloid, but instead they form short rod - like fibrils (m2 m at ph 3.6) or worm - like fibrils (h2 m at ph 3.6) (figure 5). A direct link between decreased native state stability and increased aggregation propensity has been observed for several proteins including lysozyme, transthyretin, and antibody light chains . Accordingly, destabilizing mutations enhance the rate of exchange between the native protein and partially folded non - native species, which show increased amyloidogenicity compared with the native state . Interestingly, m2 m is less thermodynamically and kinetically stable than h2 m and, as a consequence, the molten globule - like nonamyloidogenic i1 state is the most abundant non - native species (figure 7). The increased conformational dynamics results in a protein that is unstable yet protected from amyloid assembly, since i1 is not able to form amyloid . These findings argue against a simple link between native state stability and amyloidogenicity (at least for 2 m). Instead, they highlight the importance of the precise conformational properties of the native - like it state that are vital for assembly . Together, the results demonstrate that amyloid formation of 2 m at neutral ph is initiated via the highly structured it state . Hence, from the myriad of potential non - native conformations that could be populated during folding, only the it state allows the entrance of 2 m to the aggregation landscape (figure 7). Such a finding highlights the ordered specificity in the early stages of assembly into amyloid and opens the opportunity to target a specific non - native state in order to control the onset of aggregation, for example through the development of antibodies, nanobodies, or small molecules that specifically recognize this species . The results highlight the importance of considering multiple factors in order to predict amyloid formation . Hydrophobicity, the propensity of the sequence to aggregate, the stability of the native state, solubility, transient exposure of aggregation - prone regions through protein dynamics, and the stability of the polypeptide sequence within the fully assembled fibril structure itself, may all contribute to enhanced amyloidogenicity . Although, these factors are well understood individually, the interplay between them during aggregation remains poorly explained . The results presented emphasize the importance of understanding the energy landscape of aggregation in intricate detail, from both thermodynamic and kinetic view points, in order to predict whether or not a protein will aggregate and how / why minor alterations in solution conditions / amino acid sequence can have a dramatic effect on the course of assembly, by small changes in the relative populations of amyloidogenic versus nonamyloidogenic states . In this study we have used nus nmr methods to study the relationship between protein folding and aggregation of a globular protein that forms amyloid fibrils from a structured precursor state, using 2 m as the test protein . We show that the least thermodynamically stable protein is the least aggregation - prone sequence of the family of proteins studied here . Analysis of the folding energy landscape of the protein using real - time nmr revealed that the decreased stability and decreased lifetime of a precise and well - defined native - like amyloidogenic precursor (it) are sufficient to tip the balance from aggregation to folding . The power of sparsely sampled nmr allowed us not only to detect a dynamic intermediate state (i1) of m2 m but also to structurally characterize this species in residue - specific detail . The results reveal that the least stable protein (m2 m) populates predominantly a flexible intermediate (i1) that is not aggregation - prone, while its more stable counterpart (h2 m) folds through a native - like intermediate that has enhanced amyloidogenicity . Subtle changes in the folding energy landscape thus lead to dramatic changes in the aggregation outcome . Instead it is the precise balance and kinetic partitioning of intermediate states that determines whether 2 m will fold to the native state or aggregate to form amyloid fibrils.
Dopa - responsive dystonia (drd) is characterized by childhood - onset dystonia and a dramatic and sustained response to administration of low - doses of oral levodopa . This disorder typically presents with gait disturbance, caused by lower limb dystonia with diurnal variation, a positive family history, and gradual progression to generalized dystonia . A ten - year - old girl was brought with complaints of difficulty in walking and stiffness of both lower limbs, for the past six months . She also had a history of frequent falls while walking and was unable to stand for prolonged periods . Her antenatal, birth, and neonatal periods were uneventful and developmental milestones were appropriate for her age . Her higher mental functions were normal, speech was hypophonic; she had a gait disturbance characterized by leg stiffness, and a tendency to walk in an equinus posture, resulting in difficulty in balancing . Her tone was slightly increased in all the four limbs, with cog - wheel rigidity . Deep tendon reflexes in all the four limbs were exaggerated with extension of both great toes (striatal toes)., it was found that the symptoms and signs were relatively mild in the morning during rounds, whereas, they gradually worsened as the day progressed, rendering the child almost unable to walk by evening . Magnetic resonance imaging (mri brain and spine were normal . In view of the typical diurnal variation of dystonia, a therapeutic challenge with levodopa / carbidopa was tried and there was a dramatic decrease in dystonia within two days and the child's gait improved . The child was treated with a combination of levodopa, carbidopa, and trihexyphenidyl . On follow - up genetic studies were planned, but could not be done due to lack of resources . Drd is an inherited disorder characterized by dystonia with diurnal variation and favorable response to levodopa / carbidopa . The inheritance is usually autosomal dominant; however, autosomal recessive inheritance is also seen in some cases . The enzyme deficiency responsible for the manifestations is gtp cyclohydrolase 1 (gch), which is a rate - limiting enzyme in the synthesis of dopamine . This disorder had been referred to as hereditary progressive basal ganglia disease, hereditary progressive dystonia with marked diurnal variation, segawa disease, and drd in the past . At present, segawa disease specifically denotes an autosomal dominantly inherited mutation in the gch 1 gene located on chromosome 14q22.1 to q22.2 . The disease usually manifests in school age children, however, adults with the disease have also been reported . Initial manifestations of this disease include postural dystonia of the lower limbs with characteristic equino varus deformity of both feet . The dystonia gets worse as the day progresses, becomes maximal by evening, and decreases after sleep by morning . Investigations characteristically reveal low levels of pteridine metabolites in the cerebrospinal fluid, normal neuroimaging, and increased blood phenylalanine levels after phenylalanine loading tests . Assessing the therapeutic response to levodopa is a useful and recommended method of diagnosing drd, when the diagnosis is in doubt and when dystonia is not attributable to hypoxic ischemic encephalopathy . In one reported series, administration of low - dose levodopa had resulted in complete to near - complete recovery of symptoms in a cohort of chinese patients, with no significant long - term side effects . In our case, the child presented with gait disorder characterized by dystonic movements of the lower limbs of gradual onset, which disappeared during sleep, and reappeared after getting up from bed and progressively worsened throughout the day with symptoms, for the past six months . With the above - mentioned clinical findings and a dramatic response to the levodopa / carbidopa combination children with recent onset dystonia and gait abnormalities may pose a diagnostic challenge . A careful history and focused neurological examination, looking for diurnal variation in symptoms, holds the key in arriving at the diagnosis . In such children a therapeutic response to levodopa might be a safe and appropriate way of confirming drd.
In contemporary affluent societies, increases in life expectancy have enhanced the opportunities for grandparents to care for their grandchildren (uhlenberg, 1996; friedman et al ., 2008; coall & hertwig, 2010). These enhanced opportunities for grandparental childcare created by the larger shared lifespan between grandparents and grandchildren are frequently utilized . In the united states 23% of the children under 5 years of age are weekly cared for by their grandparents (johnson, 2005) and 60% of grandparents provide occasional or more frequent care (fuller - thomson & minkler, 2001). A study in europe found that 58% of grandmothers and 49% of grandfathers took care of at least one of their grandchildren in the preceding year (hank & buber, 2009). The quality of grandparental childcare is valued more highly than formal childcare by british as well as dutch parents . Both british and dutch parents mention the importance of trust for this preference (wheelock & jones, 2002; portegijs et al ., grandparents are thought to provide care that meets the specific needs of the grandchildren (wheelock & jones, 2002). Grandparental childcare is also less expensive than formal childcare (portegijs et al ., 2006). Beside the perceived quality and low price of grandparental childcare this care could ease women's dilemma of combining paid employment and motherhood (hoppmann & klumb, 2010). Grandparental childcare could allow the mother to maintain or increase her labour force participation (cardia & ng, 2003; gray, 2005; dimova & wolff, 2011) and might make it easier for her to have more children (kaptijn & thomese, 2010; kaptijn et al ., 2010). Although grandparental childcare can also be a source of conflict between grandparents and children, these conflicts are usually perceived as manageable (wheelock & jones, 2002). A majority of older women have reported differentiating their investments among their adult children (suitor et al ., 2006, 2007). In explaining these differential investments, cultural, economic and evolutionary perspectives have all focused on different explanatory factors while rarely taking account of each other's views (coall & hertwig, 2010). Cultural explanations have focused on values and norms and found that parents who hold an unconditional family solidarity norm invest more in their children (kohli & knemund, 2003), that parents invest more in children who are more in need (mcgarry & schoeni, 1997; suitor et al ., 2006, 2007; 2009) and that parental investments are lower for children who had problems with substance use or law enforcement (suitor & pillemer, 2000). Economic explanations have focused on reciprocity and found that parents invest more in children who also provide support to them (kunemund & rein, 1999; boerner & reinhardt, 2003; pillemer & suitor, 2006; suitor et al ., 2006) and that parents receive more support from children in whom they invested more heavily in the past (henretta et al . Evolutionary explanations have focused on the adult child's sex and found that maternal grandparents invest more than paternal grandparents (euler & weitzel, 1996; michalski & shackelford, 2005; pollet et al ., however, evolutionary studies of inter - generational transfers in particular have been criticized for ignoring the importance of cultural factors for grandparental investments (silverstein, 2007; friedman et al ., 2008; gilding, 2009). This study focuses on two key evolutionary hypotheses concerning grandparental investments differentiated by the child's sex while also taking account of cultural and economic explanations . Within the darwinian paradigm, grandparental investments are understood as part of an evolved strategy in old age aimed at increasing the grandparents' reproductive success through the survival of their progeny . Especially women could gain fitness with these investments by increasing the reproductive success of their offspring rather than by continuing to reproduce themselves (hawkes, 2004; lahdenpera et al . This view, although debated (strassmann & garrard, 2011), is supported by several studies in pre - modern populations, which found that the presence of a grandmother has a positive effect on the survival chances of the grandchild (reviewed by sear & mace, 2008). In modern societies almost all children stay alive after birth and grandparents are not expected to contribute to the survival chances of their children . However, human behaviour in modern societies may still be explained by the vestiges of adaptations formed in pre - modern societies (tooby & cosmides, 1990, 1992; buss, 1994; geary, 1998). In line with this reasoning, discriminative grandparental investments in modern societies have been explained by differences in the certainty of genetic relatedness between grandparents and grandchildren and differences in the reproductive potential of the children (e.g. Euler & weitzel, 1996; chrastil et al ., 2006; grandparents are more certain of the genetic relationship with their daughters' children than with their sons' children, so grandparents are expected to invest more in their daughters' children than in their sons' children (euler & weitzel, 1996). However, under good socioeconomic conditions sons are expected to produce more children than daughters (hopcroft, 2006; fieder & huber, 2007; nettle & pollet, 2008). This would direct grandparental investments to the sons' children under good socioeconomic conditions (trivers & willard, 1973), the potential reproductive benefit partly overcoming uncertainty over paternity . From an evolutionary perspective the main objective of parental investments is to enable one's own children to survive and reproduce . Although both men and women have an evolutionary interest in investing in their children, men and women are unequal in the certainty that their parental investments will actually benefit their biological children . Women are absolutely certain that the children they bear are their biological children . In contrast, men are less than 100% certain that they are the biological father of their putative children (trivers, 1972). Even if men feel certain about their paternity, they run the risk of unknowingly investing in the children of somebody else . Based on a review of 67 studies, anderson (2006) estimated the current rate of non - paternity for men with high paternity confidence to be 1.9% . The risk of investing in somebody else's children is thought to shape men's parenting decisions . In line with this idea, men invest less in their children when the physical resemblance with their putative children is smaller (alvergne et al ., 2009; heijkoop et al ., 2009) and when they are less certain about their paternity (anderson et al ., 2007). Because grandparents also run the risk of investing in genetically unrelated grandchildren when they invest in their sons' children, paternal grandparents are expected to invest less than maternal grandparents . Numerous studies have tested this hypothesis using a wide range of outcome measures and methods . Paternal grandparents are found to have less contact with their grandchildren (salmon, 1999; pollet et al ., 2006, 2009), to be emotionally less close to their grandchildren (laham et al ., 2005; michalski & shackelford, 2005; bishop et al ., 2009), to take less care of their grandchildren (euler & weitzel, 1996; euler et al ., 2001; chrastil et al ., 2006) and to give less financial support to their grandchildren (pollet et al ., 2009) these results are obtained using self - reports from the grandchildren (salmon, 1999; laham et al ., 2005; bishop et al ., 2009), the grandparents (michalski & shackelford, 2005; pollet et al ., 2007, 2009) and retrospective reports of adult grandchildren (euler & weitzel, 1996; euler et al ., 2001; although the results of these studies are consistent and could be interpreted as support for the paternity uncertainty hypothesis, these studies are limited in their use of samples from western populations . The results are also in accordance with cultural explanations (dubas, 2001; friedman et al ., 2008). That is, women usually are more involved in family relationships and bear the prime responsibility for maintaining the family bonds . Thus, the larger investments of maternal grandparents compared with paternal grandparents might also be a consequence of women being socialized to have stronger bonds with their parents than men (eisenberg, 1988; dubas, 2001). Grandchildren in farm families in iowa reported more frequent contact and higher quality relationships with their paternal grandparents (king & elder, 1995; king et al ., 2003). Also in rural greece, grandchildren reported having higher quality relationships with their paternal grandparents (pashos, 2000). Although the authors themselves explained these results by reference to the rural patrilineal culture (king & elder, 1995; pashos, 2000; king et al ., 2003), these studies have been criticized for not truly measuring grandparental investments, but attempts of the middle generation to acquire land from the grandparents (michalski & shackelford, 2005). A second limitation of the above - mentioned studies is that they do not take reciprocity into account as an alternative explanation of the observed smaller investments of paternal grandparents . Exchange and delayed exchange might be important motives of the grandparents to invest in their grandchildren (kohli & knemund, 2003; friedman et al ., 2008). In accordance with this idea parents invest more in adult children who also provide support to them (kunemund & rein, 1999; boerner & reinhardt, 2003; pillemer & suitor, 2006; suitor et al ., 2006). The grandparental investment bias toward maternal offspring thus might be partly explained in terms of stimulating reciprocal support from daughters, particularly as future caregivers (friedman et al ., 2008). In order to evaluate the relevance of the paternity uncertainty hypothesis beside cultural or economic explanations of biases towards daughters' children in grandparental investments, this hypothesis is tested in this study using data from two culturally different countries: the netherlands and china . The netherlands is a typical western county where a grandparental investment bias towards daughters' children has been reported (pollet et al ., 2006, 2007). China has a patrilineal culture where sons are valued more than daughters, especially in rural areas (lai - wan et al ., 2006). To account for reciprocity, emotional and instrumental support that the grandparent received from the children is included in the analysis of both populations . To meet the critique on previous studies of not truly measuring grandparental investments, the provision of grandparental childcare is used as a direct measure of grandparental investment this measure of grandparental investment has also been reported to be positively related to the children's fertility in the netherlands (kaptijn et al ., 2010), which makes it a relevant indicator of grandparental investment from an evolutionary perspective . In addition to the certainty that grandparental investments actually benefit genetically related grandchildren, the reproductive potential of the children is also expected to play a role in discriminative grandparental investments . From an evolutionary point of view, grandparents should have an incentive to devote more of their resources to children who can be expected to produce the largest number of grandchildren . Because on the marriage market the value of occupying a high socioeconomic position differs between the sexes, the reproductive potential of sons and daughters also differ according to their socioeconomic position . In general, women tend to prefer men of high socioeconomic status, while men find the socioeconomic status of a potential partner less important (buss & schmitt, 1993; geary et al ., 2004). As a result, high status men are more likely to marry than lower status men, leaving lower status men more often unmarried and childless, while for women such a pattern does not occur (fieder & huber, 2007; brown et al . 2011). In most human populations, especially in serial monogamous and polygamous societies, variance in men's fertility the effect of men's social status on their reproductive success is stronger in hunter gatherer societies (nettle & pollet, 2008), but also in contemporary serial monogamous societies, the relationship between socioeconomic status and fertility is positive for men, but negative for women (hopcroft, 2006; fieder & huber, 2007; nettle & pollet, 2008; fieder et al ., higher status sons are expected to produce more children than higher status daughters, whereas lower status daughters are expected to produce more children than lower status sons . The hypothesis that parental investments and by extension grandparental investments are biased towards the child with the largest reproductive potential was originally formulated by trivers & willard (1973) and became known as the trivers willard hypothesis . Trivers & willard (1973) predicted a bias in the sex ratio of the children towards sons under good material conditions and towards daughters under poor material conditions . Parents in good conditions seem to have a larger chance of getting sons (hopcroft, 2005; almond & edlund, 2007; magnuson et al ., 2007; cameron & dalerum, 2009), but parental investments are not always biased towards the sex with the largest reproductive potential (gaulin & robbins, 1991; freese & powell, 1999; keller et al ., 2001; koziel & ulijaszek, 2001; hopcroft, 2005). Since, by taking care of the grandchildren, grandparents could facilitate their children's fertility (kaptijn & thomese, 2010) and enhance the success of existing grandchildren (coall & hertwig, 2010), grandparental investments are expected to be biased towards children of the sex with the largest reproductive potential, namely higher status sons and lower status daughters . Euler & weitzel (1996) examined interaction effects between the parents' social status and sex on grandparents' solicitude with their grandchildren . Willard hypothesis in their study, but the sample of college students they used might have shown too little variance on socioeconomic conditions . In contrast with euler & weitzel (1996), this study uses representative samples of the older population of the netherlands and rural china . The use of culturally different populations allows acknowledgment of possible cultural factors in how investment strategies used by grandparents vary by the sex and socioeconomic status of the children . Further, emotional and instrumental support received from the adult children of grandparents is included to account for reciprocity as a motivation for grandparental investments . The paternity uncertainty hypothesis predicts that grandparents bias their investments towards their daughters' children, because grandparents are more certain of their genetic relationship with their daughters' children than with their sons' children . Willard hypothesis predicts that grandparents bias their investments more towards their sons' children under good socioeconomic conditions and more towards their daughters' children under poor socioeconomic conditions because, due to marital selection processes based on socioeconomic position that are highly gendered, high status sons are expected to produce more grandchildren than high status daughters and the other way around for children with a lower socioeconomic status . These two mechanisms may operate simultaneously such that a general bias in grandparental investments towards maternal grandchildren may be reduced or shift to a bias towards paternal grandchildren under good socioeconomic conditions, but may be enlarged under adverse socioeconomic conditions . Although grandparental investments in modern society might convey a fitness benefit for the grandparents, and dutch parents that received childcare support from the grandparents had a higher probability of having additional children (kaptijn et al ., 2010; but see waynforth, 2012), this hypothesis is not tested in this paper . Paternity uncertainty and a trivers willard effect are thought to have shaped grandparental investment decisions during the human evolutionary past (euler & weitzel, 1996; pollet et al ., 2006; bishop et al ., 2009). It is assumed that grandparents in modern societies may still invest according to these earlier evolutionary pressures even if this behaviour is no longer maximizing grandparental fitness in modern societies (tooby & cosmides, 1990, 1992; buss, 1994; geary, 1998). This study tests if discriminative grandparental investments in modern societies are in line with the paternity uncertainty hypothesis and the trivers in contrast to grandmothers, who experience menopause, grandfathers could gain fitness by continuing to reproduce in old age instead of investing in their grandchildren . Opportunities for men to reproduce at old age were widespread in pre - modern polygamous societies, but in modern serial monogamous societies these opportunities are much more limited (tuljapurkar et al ., 2007). There is not much evidence that grandfathers were beneficial for grandchildren's survival in pre - modern societies in the same way as grandmothers were (sear & mace, 2008). Still, in evolutionary studies on discriminative grandparental investments, grandfathers' investments in their grandchildren in modern societies are commonly understood as an evolved reproductive strategy of men at old age (e.g. Euler & weitzel, 1996; michalski & shackelford, 2005; pollet et al . This study grandfathers' investments in their grandchildren are included to examine if evolutionary explanations also hold for grandfathers' investments . The sample of the dutch older population is derived from the survey on living arrangements and social networks of older adults (lsn; knipscheer et al ., 1995) and its follow - up, the longitudinal aging study amsterdam (deeg et al ., 2002). The lsn survey is a representative sample of the dutch older population stratified by age and sex . Face - to - face interviews were conducted in 1992 when respondents were aged 55 to 89 . In 1992, a random sample of 729 grandparents in the lsn survey were asked about the childcare they gave to each individual grandchild aged 16 or younger . In 2002, a new cohort of people aged 55 to 64 was included in the sample of the longitudinal aging study amsterdam (lasa). From this new cohort, a random sample of 544 grandparents were asked about the childcare they gave to their grandchildren . The units of analysis are the children of the respondents . Only the children who were parents themselves because the paternity certainty hypothesis and trivers willard hypothesis only refer to presumably biological children, all stepchildren and adopted children were excluded from the sample, leaving 2407 biological children eligible for analysis . Due to missing values on the relevant variables the final sample consisted of 2375 children . Anhui, a mostly rural province of china, is characterized by a relative high proportion of older adults and high levels of out - migration of working - age adults . Twelve rural townships were randomly selected from the chaohu region, located in the central part of anhui . In the second stage, a random selection was drawn of the inhabitants of these villages aged 60 and over with an over - sampling of people aged 75 and over . The initial sample included 1421 grandparents who were asked about the childcare they provided to their grandchildren aged 16 or younger . The anhui survey did not include questions about stepchildren or adopted children, so these could not be excluded . For 263 children there was information missing on one or more of the relevant variables, leaving a final sample of 4026 children . These missing cases are for 49%, due to grandparents not knowing the age of their children or grandchildren . The grandparents were asked how much they had taken care of each individual grandchild aged 16 or younger in the past 12 months . Sometimes and often. Although this question was answered for each individual grandchild, there was not much variance at the grandchild level . In most (93%) cases, therefore, it was decided to aggregate this variable to the child level by taking the maximum frequency of grandparental childcare . In the chinese sample the grandparents were asked how much they had taken care of any of the grandchildren from a specific child in the preceding 12 months . Never, less than once a month, every month or so, several times per month, at least once per week, daily, or more often, but not all day and full - day custody. In both the dutch and the chinese sample, the sex of the children is derived from the interview with the grandparent . Willard hypothesis was tested with an interaction term between child's sex and grandparental socioeconomic position . Information on the child's socioeconomic condition was not available in the dutch sample, so grandparental socioeconomic condition was used as a proxy for the child's socioeconomic position in both samples . A separate analysis was run using an interaction term between child's socioeconomic position (i.e. Educational achievement) and child's sex in the chinese data ., educational achievement was measured on a nine - point ordinal scale . In the chinese sample, educational achievement was measured on a seven - point ordinal scale . In order to enhance comparability across both populations this measure grandparents with a lower vocational education or higher belong to the more educated group . In the chinese sample, one could argue that educational achievement does not differentiate well on grandparental socioeconomic condition in china, because 77% of the elderly in the sample did not get any education at all . In order to address this issue, the trivers willard hypothesis was additionally tested in china using grandparental income and house ownership as alternative measures of socioeconomic condition . These additional analyses led to the same conclusions as the ones presented in this paper . A number of possible confounding factors at the grandparent level and the child level were controlled for . In most cases, the measurement of these variables does not differ between the dutch and the chinese samples . In this paper, the cases in which the measurement in both populations is different will be explicitly referred to . At the grandparent level, grandparent's sex, having a partner living in the same household, the grandparent's educational achievement, the grandparent's health and the number of children of the grandparent who are parents of children aged 16 or younger are controlled for . Health is measured as self - rated health . In the dutch sample, there were five answer categories . Good and very good. In the chinese sample, there were four answer categories: good and excellent. In order to enhance comparability, both were standardized . Because the dutch sample consisted of two cohorts the cohort in the dutch sample was additionally controlled for . At the child level, having a partner living in the same household, the geographical distance between the child and the grandparent, the child's age, the age of the grandparent relative to the child's age, the age of the youngest grandchild relative to the child's age, the number of grandchildren and the emotional and instrumental support that the grandparent received from the child were controlled for . In the dutch sample, the distance between the child and the grandparent was measured as the travel time for the grandparent to the child (in minutes, log transformed). In the chinese sample, the distance between the child and the grandparent was measured on an ordinal scale . The answer categories were: in the same household, in the same village, in the same township, in the same county, in the same city, in the same province, in china and outside china. Because only four children lived abroad the categories in china and outside china were merged into the category outside the province. The child's age, the grandparent's age and the age of the youngest grandchild were strongly correlated . In order to be able to include these three variables in the model, the standardized residual of the grandparent's age and the standardized residual of the age of the youngest grandchild were used, both after regression on the age of the child . A positive value on these variables means that the grandparent or youngest grandchild is relatively old given the child's age . In the dutch sample, the questions regarding emotional and instrumental support were only asked if the child was identified as a member of the personal network of the grandparent: that is, if the grandparent had regular contact with the child and the grandparent considered this contact important . In addition, these questions were only asked if the child belonged to one of the twelve (or ten, in case of the younger cohort) network members with whom the grandparent had the most frequent contact . Because of this procedure, the scores on emotional and instrumental support were not available for 24% of the children . A dummy was constructed indicating if the scores on emotional and instrumental support were missing and the mean for the children whose scores on these variables were not available was imputed . A separate analysis was run in which all cases with missing values on emotional or instrumental support were excluded . The conclusions from this separate analysis were the same as the ones presented in this paper . Emotional support is measured with the question how often did it occur in the last year that you told [your child] about your personal experiences and feelings? And instrumental support is measured as how often did it occur in the last year that [your child] helped you with daily chores in and around the house? Both variables were measured on a four - point scale ranging from never to often. In the chinese sample emotional support is measured with the question: how much do you feel that [your child] would be willing to listen when you need to talk about your worries and problems? Possible answer categories were: not at all well, quite well. Instrumental support was operationalized as the value, in chinese yuan, of the money, food or gifts that the child had given to the grandparent in the preceding year . All measures of emotional and instrumental support were standardized to improve the comparability of these measures across both populations . Descriptive statistics of all variables are shown in table 1 for the dutch sample and table 2 for the chinese sample . Table 1.descriptive statistics of the dutch samplemeansdrangegrandparent levelgrandmother55%partner in household75%educated64%health3.111.1215number of children1.981.19110young cohort42%age (years)67.657.745589no . Grandparents1240child leveldaughter52%partner in household95%travel time (minutes, log)3.101.250.007.27age (years)36.686.121771age youngest grandchild (years)6.084.75016number of grandchildren1.930.8618emotional support to grandparent2.960.8614instrumental support to grandparent2.110.9414support to grandparent not available24%grandparental childcare provisioningnever44%seldom8%sometimes25%often23%no . City1%same province7%outside the province30%age (years)36.215.612161age youngest grandchild (years)8.714.02016number of grandchildren1.780.82112emotional support to grandparent2.520.6213instrumental support to grandparent3.771.63110grandparental childcare provisioningnever65%less than once a month8%every month or so1%several times per month3%at least once per week4%daily, or more often, but not all day12%full - day custody7%no . Children4026apercentage shown if variable is dichotomous.bnot shown if variable is dichotomous . Descriptive statistics of the chinese sample percentage shown if variable is dichotomous . Not shown if variable is dichotomous . An ordinal multilevel regression analysis was conducted to test the hypotheses using the markov chain monte carlo (mcmc) method to estimate the parameters of the model . This is the preferred estimation method for ordinal multilevel models because it generates reliable interval estimates of the parameters of non - linear multilevel models (rasbash et al ., 2004 the models have two levels, with children at level one and grandparents at level two . The models' intercepts are random and have a common variance on the grandparent level . The regression coefficients of ordinal probit models can be interpreted as the effect on the z - score of that latent variable (liao, 1994). For example, a regression coefficient of 0.5 means that a one - point increase in the independent variable leads to an expected increase of half a standard deviation in the latent continuous variable . Because a grandparental investment bias towards daughters' children might be partly mediated by the emotional and instrumental support that the child gave to the grandparent, a stepwise analysis is performed . Model 1 includes the child's sex and the control variables except for emotional and instrumental support . Model 2 includes the child's sex and all control variables including emotional and instrumental support . The trivers this model includes the same variables as model 2 plus the interaction term between child's sex and grandparental educational attainment . All independent and control variables were centred at their means so that the intercepts can be interpreted as the thresholds between the categories of the dependent variable (liao, 1994). The results of the analysis of the dutch data are shown in table 3 . In the dutch sample daughters this effect hardly changes with the addition of emotional and instrumental support in model 2, which shows that this effect is not mediated by reciprocity . The results of the dutch data thus seem to be in accordance with the paternity uncertainty hypothesis . However, the analysis of the chinese data in table 4 shows that in china daughters receive significantly less grandparental childcare support than sons . Also in the chinese data this effect is not mediated by instrumental or emotional support . Table 3.regression estimates for ordered probit multilevel models explaining the intensity of grandparental childcare provisioning in the netherlandsmodel 1model 2model 3grandparent levelgrandmother0.328*0.2940.296partner in household0.2340.2470.244educated0.0770.0600.106health (standardized)0.106 * 0.097 * 0.096number of children0.1960.1680.169young cohort0.5150.4760.472child leveldaughter0.3970.3270.380*partner in household0.3160.2930.295travel time (minutes, log)0.393*0.3640.365age (years)0.0980.0950.095residual age grandparent0.2350.2270.227residual age youngest grandchild0.3410.3280.329number of grandchildren0.0480.0460.047emotional support to grandparent (standardized)0.1080.106instrumental support to grandparent (standardized)0.0170.018support to grandparent not available0.4510.450grandparent's educationdaughter0.083thresholds11.2421.2521.25520.1400.1380.14030.2140.2200.217*variance of intercepts0.5260.5050.511no . Children237523752375aasterisks are not shown because mcmc confidence intervals of variance parameters always exclude 0 (hox, 2002). p<0.05; * * p<0.01; * * * p<0.001 . Table 4.regression estimates for ordered probit multilevel models explaining the intensity of grandparental childcare provisioning in chinamodel 1model 2model 3grandparent levelgrandmother0.0580.0460.048partner in household0.1890.1910.193*educated0.0920.0810.107health (standardized)0.065 0.0610.062number of children0.0680.0700.069child leveldaughter0.9260.9310.916partner in household0.4940.5370.534distance from grandparentsame household1.2071.1831.186same township0.4630.4820.481same county0.3950.4290.431same city0.3810.4280.425same province0.1990.2410.243outside the province0.2670.2330.231age0.0600.0600.060residual age grandparent0.1410.1430.143residual age youngest grandchild0.0700.0710.071number of grandchildren0.088 * 0.092 * 0.093emotional support to grandparent (standardized)0.0170.018instrumental support to grandparent (standardized)0.0780.078grandparent's educationdaughter0.071thresholds12.1942.1952.19621.3151.3161.31731.1271.1271.12840.9880.9880.98850.9300.9300.93060.5700.5700.570variance of intercepts0.6290.6200.619no . Grandparents136113611361no . Children402640264026aasterisks are not shown because mcmc confidence intervals of variance parameters always exclude 0 (hox, 2002). p<0.05; * * p<0.01; * * * p<0.001 . Regression estimates for ordered probit multilevel models explaining the intensity of grandparental childcare provisioning in the netherlands asterisks are not shown because mcmc confidence intervals of variance parameters always exclude 0 (hox, 2002). * p<0.05; * * p<0.01; * * * p<0.001 . Regression estimates for ordered probit multilevel models explaining the intensity of grandparental childcare provisioning in china asterisks are not shown because mcmc confidence intervals of variance parameters always exclude 0 (hox, 2002). * p<0.05; * * p<0.01; * * * p<0.001 . Willard hypothesis is tested in model 3 of table 3 and model 3 of table 4 . Willard hypothesis was found in the analyses of the dutch and the chinese data . In both analyses the interaction term of grandparental educational achievement with child's sex is not statistically significant . In the netherlands, more educated grandparents bias their childcare provisioning towards daughters' children as much as less educated grandparents do . In china, more educated grandparents bias their childcare provisioning towards sons' children as much as less educated grandparents do . The control variables in general show the importance of grandparents' opportunities and children's needs . Grandparents provide more care to their grandchildren when they have a partner living in the same household, when they are healthier, when they can divide their efforts over a smaller number of children and when they are younger relative to the child's age . Children receive more childcare when they do not have a partner living in the same household, when they are younger and when they have younger children . In the case of china children with a larger family children living in the same household as the grandparent receive more grandparental childcare than children living in the same village as the grandparent . Exclusion of the children living in the same household as the grandparent did not change the conclusions . Children who live further away receive less grandparental childcare than children who live in the same village as the grandparent, though these effects are not statistically significant in all models . Children who live outside the province receive more grandparental childcare than children who live in the same village as the grandparent . Additional analyses revealed that this last effect is primarily due to grandparents providing more daily care and full - day custody to the grandchildren of these children living outside the province . The dutch data did not show such a u - shaped relationship between travel time and the frequency of grandparental childcare provisioning . The control variables further show that reciprocity also plays a role in explaining grandparental childcare provisioning, though there are also country - specific differences in this effect . In the netherlands, children who provide more emotional support to the grandparent the children whose scores on emotional and instrumental support to the grandparent were not available, because they were not identified as a member of the personal network of the grandparent, or because they did not have frequent contact with the grandparent, received less grandparental childcare . In china, emotional support has no statistically significant effect, but children who provide more instrumental support to the grandparent receive more grandparental support . Cultural, economic and evolutionary perspectives have all focused on different factors to explain discriminative grandparental investments, while rarely taking account of each other's views (coall & hertwig, 2010). This study focused on two evolutionary hypotheses concerning grandparental investments differentiated by the child's sex while also taking account of cultural and economic explanations . The evolutionary hypotheses were tested in a contemporary dutch and a contemporary rural chinese population, two culturally and economically diverse societies, to account for cultural factors, and emotional and instrumental support was controlled for to account for reciprocity . According to the paternity uncertainty hypothesis, grandparents tilt their investments towards their daughters' children because they are more certain of their genetic relationship with their daughters' children than with their sons' children . In the dutch sample a grandparental investment bias towards daughters' children was found, which is in accordance with this hypothesis, but is also consistent with the dutch cultural orientation that favours mother daughter bonds . In china, which predominantly has a patrilineal culture, a grandparental investment bias towards sons' children was found, which goes against the paternity uncertainty hypothesis . These results raise doubts over the relevance of paternity uncertainty as an explanation of the grandparental investment bias towards daughters' children that is often found in western populations (e.g. Euler & weitzel, 1996; michalski & shackelford, 2005; chrastil et al ., 2006; bishop et al ., 2009; pollet et al ., one could argue that maybe paternity uncertainty is higher in the netherlands than in china . To the authors' knowledge however, also, when paternity uncertainty in china is low, chinese grandparents would still run the risk of investing in unrelated grandchildren . Even with low levels of paternity uncertainty the grandparental investment bias towards sons' children in china would be inconsistent with the paternity uncertainty hypothesis . Although no consistent bias was found in grandparental investments towards daughters' children, these results do not imply that paternity uncertainty is irrelevant for grandparental investments in general . While at the societal level cultural prescriptions may be a dominant factor in investment decisions, at the family level they may reflect individual assessments of parental certainty (silverstein, 2007) in the same way as men have been found to invest less in their putative children if they are less certain about their paternity (anderson et al . The behaviour or reputation of the daughter - in - law and the physical resemblance between the grandchildren and the grandparents' son might give cues to the certainty of the genetic relationship between grandparents and specific grandchildren . The paternity uncertainty hypothesis in this way was beyond the scope of this study, but might be a fruitful path for future research . According to the trivers willard hypothesis, grandparents bias their investments more towards sons' children under good socioeconomic conditions and more towards daughters' children under adverse socioeconomic conditions . Our study found no evidence for this hypothesis in its analyses of the dutch and chinese data . The investment bias towards daughters' children in the netherlands and sons' children in china was equal for more educated and less educated grandparents in both populations . Willard hypothesis is limited because grandparental socioeconomic condition was used as a proxy of the child's socioeconomic condition . However, in the chinese sample the trivers willard hypothesis was also tested using the child's educational achievement as a measure of socioeconomic condition . Chinese grandparents bias their investments towards sons' children, irrespective of the educational achievement of these sons . It may be that a trivers willard effect at the grandparent level manifests itself only as a relationship between grandparental socioeconomic condition and sex ratio of the grandchildren, not as a relationship between grandparental socioeconomic condition and biased grandparental investments after the grandchildren are born . Several studies on the relationship between parental socioeconomic condition and sex ratio have found a trivers willard effect (hopcroft, 2005; magnuson et al ., 2007; almond & edlund, 2007; cameron & dalerum, 2009), whereas studies that used measures of parental investment to test the trivers willard hypothesis found much less support for this hypothesis (freese & powell, 1999; keller et al ., 2001; koziel & ulijaszek, 2001; hopcroft, 2005). Further research may examine the relationship between grandparental socioeconomic condition or grandparental investments and the sex - ratio of the grandchildren for a trivers willard effect . Although this study was not designed as a test of cultural and reciprocal explanations of grandparental investments, the results do suggest that cultural conditions and reciprocity are relevant explanatory factors in discriminative grandparental investment . The observed grandparental investment bias towards daughters' children in the netherlands is in line with the kin keeper hypothesis, and the grandparental investment bias towards sons' children in china could be explained by the patrilineal chinese culture . The relevance of reciprocity is shown by the positive effect of the child's emotional support on grandparental investment in the netherlands and the positive effect of the child's instrumental support on grandparental investment in china . The importance of emotional support in the netherlands is possibly the result of the greater wealth of the dutch grandparents relative to the chinese grandparents . When grandparents are well - off materially, emotional support may become more important to them than instrumental support . Although the different operationalization of instrumental support instrumental support in the form of services in the netherlands and instrumental support in the form of money and goods in china limits the comparability of the effect of instrumental support in both populations, it is unlikely that this limited comparability has affected this study's conclusions . It was very uncommon for grandparents in the netherlands to receive payment from their children for looking after the grandchildren at the time of data collection (portegijs et al ., 2006). The aim of this study was to test two evolutionary hypotheses: the paternity uncertainty hypothesis and the trivers willard hypothesis . However, the results suggest that discriminative grandparental investments are better understood as the outcome of cultural prescriptions and reciprocity than by these two evolutionary hypotheses . That is not to say that evolutionary processes in general are irrelevant for understanding discriminative grandparental investments . Human reciprocity and cultural changes can also be understood from an evolutionary point of view (trivers, 1971; richerson & boyd, 2004; nowak, 2006). Human reciprocity is not at odds with evolution when both exchanging parties benefit from the exchange (trivers, 1971; nowak, 2006). In addition, human culture itself can be understood as an adaptation (richerson & boyd, 2004; boyd & richerson, 2009)., it is important to realize that not all ideas that are spread by social learning are necessarily adaptive . The benefits of social learning come with the downside that people have to be credulous and conformist, leaving the possibility for maladaptive ideas to spread (see richerson & boyd, 2004; boyd & richerson, 2009). However, these alternative evolutionary explanations are commonly not referred to in the evolutionary literature concerning discriminative grandparental investments and were not tested in this study . Grandparents' and children's attitudes towards sex roles that specify who is primarily responsible for childcare and maintaining family bonds might be especially important in this respect . Preserving the family name might be another culturally induced motive for grandparents to bias their investments . Discriminative grandparental investments might also be explained by a mechanism of delayed reciprocity . In return for their grandparental investments, grandparents may receive more support from their children in the future (geurts et al ., 2012). A caveat is that our study did not include measures for the expected future support from specific children . Therefore, delayed reciprocity cannot be excluded as an explanation of the reported biases in grandparental investments . However, our study included measures of current support from the children to the grandparent and current support might be a good proxy for expected future support . Recent evolutionary studies have suggested that discriminative grandparental investments might be better explained by x - chromosome relatedness than by paternity uncertainty (fox et al ., 2010, 2011; rice et al ., 2010). X - chromosome relatedness varies by the combination of the sex of the grandchild, the sex of the parent and the sex of the grandparent (chrastil et al . Tests of the x - chromosome relatedness hypothesis have yielded positive results in pre - modern societies (fox et al ., 2010, 2011; rice et al .,, 2006; rice et al ., 2010; tanskanen et al ., 2011). Testing this hypothesis requires the sex of the grandchild that is cared for to be known . The sex of the grandchild that was cared for was unknown in the chinese data . In the dutch data the sex of the grandchild was known, but grandparents hardly varied their amount of care at the grandchild level . In 93% of the families the grandparent took care of all grandchildren of the same child equally often . (2011), who analysed data from the uk and concluded that x - chromosomal relatedness does not appear to shape grandparental investments in modern societies . However, more research in modern societies with different cultural backgrounds is needed to assess the influence of x - chromosomal relatedness on grandparental investments . A final caveat is that this study did not focus on grandparental investments in the grandchildren of stepchildren or adopted children . Research on grandparental investments in genetically unrelated grandchildren could enhance our knowledge of the importance of genetic relationships for grandparental investments . In contrast to the situation of paternity uncertainty, there is clarity about the absence of a genetic relationship between grandparents and stepchildren or adopted children . However, the chinese sample did not include information on stepchildren and adopted children . The dutch sample only included five adopted children . In the dutch sample the contact of older adults with their stepchildren they concluded that social factors superseded genetic factors in determining the amount of contact between older parents and their biological and stepchildren . This conclusion is in line with the results of our study, which suggest that discriminative grandparental investments are not categorically affected by the certainty of the genetic relationship and the reproductive potential of children and, more generally, attest to the importance of testing evolutionary hypotheses in populations from diverse cultural backgrounds.
Nhanes 19992000, 20012002, 20032004, and 20052006 are serial cross - sectional surveys including nationally representative samples of the noninstitutionalized civilian u.s . Nhanes 19992006 included 7,975 adults, aged 20 years, who attended the morning examination and had fasted for 924 h at the time of their blood collection . Participants missing fpg or a1c measurements (n = 37) with a prior self - reported diagnosis of diabetes (n = 537) and those meeting the criteria for diabetes (fpg 126 mg / dl or a1c 6.5%) were excluded (n = 372) from the current analyses . After these exclusions, the current analyses were based on data from 7,029 participants without diabetes . Of particular relevance to the current report, serum glucose was measured using a modified hexokinase enzymatic method, and a1c was measured using a high - performance liquid chromatography system by the diabetes diagnostic laboratory at the university of missouri columbia and by the fairview medical center laboratory at the university of minnesota for 20052006 . A1c and glucose values were recalibrated for nhanes 20052006 to account for the differences in the assays used among laboratories (7,8). Both assays have been validated and are diabetes complications and control trial aligned (9). The coefficient of variation was <3% in each 2-year period for glucose and <2% for a1c . In 20052006, a subset of 1,680 participants completed an ogtt after an overnight fast of 924 h. of these participants, the current analysis was conducted among 1,382 participants without diabetes (i.e., no self - report, a1c <6.5%, fpg <126 mg / dl, and ogtt <200 mg / dl). After the initial venipuncture, participants were asked to drink a calibrated dose, 75 g of glucose, and had a second venipuncture 2 h (15 min) later . Participants were categorized into one of four mutually exclusive groups by the presence or absence of pre - diabetes according to ifg and a1c criteria . Characteristics of the study population were calculated for each of these four categories as mean se, median (25th, 75th percentiles), or percentages, as appropriate . The prevalence of pre - diabetes was then calculated for ifg and various cut points of a1c . The sensitivity, specificity, and positive and negative predictive values for having pre - diabetes by ifg were then calculated for each a1c level . Adults with discordant pre - diabetes results based on ifg and a1c values was determined . First, the test characteristics of pre - diabetes by a1c versus ifg defined as fpg levels of 110125 mg / dl, the previous fasting glucose range for defining pre - diabetes, were determined . Second, using the subset of participants with ogtt results, the sensitivity, specificity, and positive and negative predictive values were determined for pre - diabetes by ifg and a1c, separately, and for the presence of either or both of these test results using igt as the reference standard . Population and conducted using sudaan (version 9; research triangle institute, research triangle park, nc) to account for the complex survey design of nhanes . Adjustment of the sampling weights corrects for differences in missing data across age, sex, and race / ethnicity strata but assumes that data within strata are missing, randomly (10). Participants were categorized into one of four mutually exclusive groups by the presence or absence of pre - diabetes according to ifg and a1c criteria . Characteristics of the study population were calculated for each of these four categories as mean se, median (25th, 75th percentiles), or percentages, as appropriate . The prevalence of pre - diabetes was then calculated for ifg and various cut points of a1c . The sensitivity, specificity, and positive and negative predictive values for having pre - diabetes by ifg were then calculated for each a1c level . Adults with discordant pre - diabetes results based on ifg and a1c values was determined . First, the test characteristics of pre - diabetes by a1c versus ifg defined as fpg levels of 110125 mg / dl, the previous fasting glucose range for defining pre - diabetes, were determined . Second, using the subset of participants with ogtt results, the sensitivity, specificity, and positive and negative predictive values were determined for pre - diabetes by ifg and a1c, separately, and for the presence of either or both of these test results using igt as the reference standard . Population and conducted using sudaan (version 9; research triangle institute, research triangle park, nc) to account for the complex survey design of nhanes . Adjustment of the sampling weights corrects for differences in missing data across age, sex, and race / ethnicity strata but assumes that data within strata are missing, randomly (10). Participants with pre - diabetes by a1c but not by ifg were more likely to be women, non - hispanic blacks, and hypertensive and to have hypercholesterolemia, chronic kidney disease, microalbuminuria, elevated c - reactive protein, and lower triglycerides than those with pre - diabetes by ifg but normal a1c (table 1). Overall, participants with pre - diabetes by both criteria had higher levels of the cardiovascular risk factors investigated . Characteristics of nhanes 19992006 study participants by a1c and fasting glucose data are se,%, or median (25th75th percentiles). Adults categorized as having pre - diabetes by the a1c and/or ifg criteria . The recommended pre - diabetes a1c range between 5.7 and 6.4% provides the highest agreement with ifg . Nonetheless, the overlap is low; among u.s . Adults without diabetes, 7.7% have pre - diabetes according to both the ifg and a1c criteria, whereas 4.9% have pre - diabetes by the a1c but not the ifg criterion and 20.5% by the ifg but not the a1c criterion (fig . Adults without diagnosed diabetes by the cross - classification of a1c and fasting glucose, using different a1c cut points data are prevalence estimates se . Using ifg as the reference standard for pre - diabetes, a1c levels between 5.7% and 6.4% would reclassify 37.6 million americans with ifg as not having pre - diabetes and 8.9 million without ifg as having pre - diabetes for a total of 46.5 million reclassified (table 3). At this modification decreases the sensitivity and negative predictive value of diagnosing pre - diabetes but at the same time increases the specificity and positive predictive value . The total number of u.s . Adults reclassified, using ifg as the reference standard for pre - diabetes, is lowest at an a1c level of 5.76.4% . Sensitivity, specificity, positive predictive value, negative predictive value, and number reclassified according to different a1c cut points for test characteristics, values higher than the a1c cut point are considered positive test results, and fasting plasma glucose of 100125 mg / dl is the reference standard for pre - diabetes . In calculating the number reclassified, specifically, sampling weights were calibrated based on the proportion of nhanes 19992004 participants missing data by age - group (<40, 4059, 6074, and 75 years), sex, and race / ethnicity . Adjusting the sampling weights correct for differences in missing data across age, sex, and race / ethnicity strata but assumes that data within strata are missing randomly (10). When a more restrictive ifg definition (i.e., fpg of 110125 mg / dl) is applied, the prevalence of pre - diabetes decreases from 28.27.7% . Of the 20.5% of u.s . Adults (n = 37.6 million) with pre - diabetes by ifg but not a1c, 79.0% (n = 29.8 million) have fpg between 100 and 109 mg / dl . Adults have pre - diabetes by a1c but a fpg <110 mg / dl, 4.9% have a1c in the normal range but fpg of 110125 mg / dl, and 3.4% have both pre - diabetes level a1c and fpg of 110125 mg / dl . The test characteristics for pre - diabetes defined by a1c using fpg levels of 110125 mg / dl rather than 100125 mg / dl as the reference criterion, produces a lower sensitivity (45%) and specificity (90%). Further, because the prevalence of pre - diabetes is lower, as expected, the positive predictive value (27%) is lower and the negative predictive value (95%) is higher . The prevalence of pre - diabetes by igt was 16.5%, whereas 5.7 and 11.6% of u.s . Adults as not having pre - diabetes despite pre - diabetes by ifg and a1c, respectively . With igt as the reference standard, the sensitivity, specificity, and positive and negative predictive values for pre - diabetes were 30, 89, 33, and 87% by a1c; 59, 79, 34, and 91% by ifg; 22, 95, 43, and 87% by a1c and ifg; and 66, 73, 31, and 92% by a1c or ifg, respectively . When a more restrictive ifg definition (i.e., fpg of 110125 mg / dl) is applied, the prevalence of pre - diabetes decreases from 28.27.7% . Of the 20.5% of u.s . Adults (n = 37.6 million) with pre - diabetes by ifg but not a1c, 79.0% (n = 29.8 million) have fpg between 100 and 109 mg / dl . Adults have pre - diabetes by a1c but a fpg <110 mg / dl, 4.9% have a1c in the normal range but fpg of 110125 mg / dl, and 3.4% have both pre - diabetes level a1c and fpg of 110125 mg / dl . The test characteristics for pre - diabetes defined by a1c using fpg levels of 110125 mg / dl rather than 100125 mg / dl as the reference criterion, produces a lower sensitivity (45%) and specificity (90%). Further, because the prevalence of pre - diabetes is lower, as expected, the positive predictive value (27%) is lower and the negative predictive value (95%) is higher . The prevalence of pre - diabetes by igt was 16.5%, whereas 5.7 and 11.6% of u.s . Adults as not having pre - diabetes despite pre - diabetes by ifg and a1c, respectively . With igt as the reference standard, the sensitivity, specificity, and positive and negative predictive values for pre - diabetes were 30, 89, 33, and 87% by a1c; 59, 79, 34, and 91% by ifg; 22, 95, 43, and 87% by a1c and ifg; and 66, 73, 31, and 92% by a1c or ifg, respectively . Data from the current study indicate that the 2010 ada recommendations for inclusion of a1c as an acceptable pre - diabetes diagnostic criterion will have a substantial impact on the number of u.s . Adults identified as having pre - diabetes with the classification being different for nearly 50 million americans . If providers use a1c alone, they will classify 8.9 million people who would have been considered normal by fasting glucose as having pre - diabetes . However, they will also reclassify 37.6 million people as not having pre - diabetes by a1c who would have been labeled as having pre - diabetes by the ifg criteria . This discordance is in contrast to a relatively good agreement between a1c and fasting glucose when applied to the diagnosis of diabetes (11). The inclusion of a1c is designed to increase the feasibility and dissemination of diabetes screening because it eliminates the need for fasting before testing . This practical advantage is likely to be well received by primary care providers working in environments with increasing constraints . Because a1c, fpg, and ogtt are all considered acceptable diagnostic tests for pre - diabetes by the ada, there may be a strong shift toward using a1c alone to identify patients with pre - diabetes and diabetes . Recent data demonstrating a1c as an independent predictor of incident cardiovascular disease and death in addition to diabetes will only reinforce this shift (12). The current data suggest that further discussion is needed because using a1c alone will lead to a reclassification as normal of many patients who previously (i.e., using ifg) were considered to have pre - diabetes . This reclassified group includes a large number of individuals (n = 8 million) with fasting glucose in the range of 110125 mg / dl . Fasting glucose in this range is associated with a substantially higher risk for diabetes incidence (57 times greater than that with fasting glucose of 100109 mg / dl) (13). Whereas combined use of either ifg or a1c as the criteria of pre - diabetes would be more sensitive, it would eliminate the practical advantages of using a1c alone . It is important to recognize that either criterion (fasting glucose or a1c) is a diagnostic test, not a traditional screening test in that it is not compared with a true criterion standard . Astute clinicians may recognize the shortcomings of each test; however, many providers will probably choose only one or the other for use in practice . The clinical guidelines do not comment on the need for follow - up testing for pre - diabetes . This situation increases the likelihood of higher degrees of variation in screening practices with a possibility of more confusion among providers and patients . Educational interventions may need to be developed to help primary care providers and patients understand the advantages and shortcomings of each test used alone or in combination . Pre - diabetes is a label developed to identify those at highest risk for incident diabetes in the near future . Data from observational studies suggest that 2540% of individuals with pre - diabetes will develop diabetes over the next 38 years (1416). Currently, the most effective intervention for the prevention or delay of diabetes is intensive lifestyle behavior change with metformin therapy a less potent alternative (14). Whereas intensive lifestyle interventions are recommended for individuals identified via ifg, a1c, or igt, current guidelines recommend that metformin be reserved for those with both combined ifg and igt plus other risk factors such as a1c> 6%, hypertension, low hdl cholesterol, elevated triglycerides, or a family history of diabetes in a first - degree relative who are obese and aged> 60 years (5). This recommendation has led some investigators to call for follow - up igt testing in all individuals identified as having pre - diabetes based on their fasting glucose (17). This is in part due to the observation that the odds for incident diabetes are fourfold higher among individuals with both ifg and igt than either alone (odds ratio 39.5 vs. 10.0 and 10.9, respectively) (18). With the use of a1c as a legitimate alternative diagnostic criterion for pre - diabetes, the need for a follow - up ogtt before prescribing metformin may become a point of contention . If an ogtt is not performed, combined criteria of a1c with follow - up ifg testing could be used because this group would also be very high risk, and the data could be combined with other metabolic abnormalities using one of the established diabetes risk calculators to generate a more precise risk estimate (19,20). Which criterion is more accurate and clinically relevant for predicting diabetes and tailoring interventions will need to be examined in future prospective studies . The low concordance among a1c-, ifg-, and igt - based diagnosis of pre - diabetes highlights the multifactorial pathophysiology of glucose dysfunction . Ifg is predominately a dysfunction in hepatic insulin resistance, whereas igt is dominated by muscle insulin resistance (21). Each is also associated with dysfunctional insulin secretion but with different patterns (21). In contrast to the daily glucose snapshot offered by ifg and igt, a1c represents chronic exposure (over 23 months) to basal and postprandial hyperglycemia and reflects a combination of these mechanisms (22). Together, the different mechanisms underlying each test help explain the discordant diagnoses of pre - diabetes using ifg, a1c, and ogtt . As diabetes itself develops, each underlying mechanism plays a role, which may help explain the reasonable concordance between a1c and ifg in diabetes (11). Nevertheless, clinicians need to be aware that each test will classify as normal a substantial proportion of those found to be pre - diabetic by one of the other tests . Most notably, each test (fpg, a1c, and ogtt) was only performed once in nhanes 19992006, and the test results may change over time . Even though the coefficient of variation for a1c is quite small, the clustering of pre - diabetes around 5.8% suggests that small differences could have a disproportionate impact on classification of pre - diabetes . However, unpublished sensitivity analyses (and table 2) that vary the pre - diabetes a1c criteria to 5.6% showed insignificant differences . In addition, hemolytic anemias are known to artificially lower a1c levels although this concern is minimal, considering the relative rarity of these conditions compared with pre - diabetes . Despite these limitations, most notably, nhanes 19992006 uses a complex stratified sampling design to recruit participants, which allows estimates to be made for the u.s . Population . In addition, nhanes 19992006 includes a broad range of demographic, medical, and biochemical data collected by trained staff, following a standardized protocol . In summary, the revised 2010 ada standards of medical care in diabetes includes three options for identifying patients at high risk for diabetes: fpg, a1c, and ogtt . Because a1c has significant practical advantages over ifg, it is likely to become the preferred test among primary care providers for diagnosing pre - diabetes . The clinical impact of this change is not yet known, but the current analysis suggests that it will substantially alter the population identified as having pre - diabetes with tens of millions of americans who would have been considered to have pre - diabetes previously being classified as not having pre - diabetes . This subgroup of individuals includes a substantial number with fasting glucose levels of 110125 mg / dl and a burden of cardiovascular risk factors similar to that of their counterparts with pre - diabetes by a1c and ifg . Policy makers and clinicians will need to consider the tradeoffs between performing both fpg and a1c testing alone or in combination.
Hip fractures are a major cause of mortality and morbidity in the elderly population and the 1-year mortality rate is approximately 10 - 20%.1 so the hip fracture in elderly is an important issue from the perspective of society and health . Of the factors that affect mortality, early surgery (within 1 to 3 days from admission) has shown favorable outcomes in many studies.23456 however, some studies have not shown a clear advantage of early surgery.789101112 therefore, it is not certain that all medical environments in different countries will show favorable outcomes . In addition, asian countries lack large scale studies on this subject . The purpose of this study was to identify the potential benefits of early surgery in elderly hip fracture patients at multiple centers in korea by evaluating the effect of timing of surgery on mortality . 1388 consecutive patients older than 65 years, admitted to three urban teaching hospitals with a diagnosis of traumatic hip fracture between january 2002 and december 2009 constituted this retrospective study . These hospitals were selected because they were willing to allow a review of their medical records . The exclusion criteria included: patients with multiple fractures, previous hip fracture history, subtrochanteric - type of fracture, injury occurred more than 48 h before hospitalization, patients who received conservative treatment, patients unable to walk before injury and missing data . Before proceeding to hip fracture surgery, clinicians at all three hospitals evaluated the patient's active medical problems and solved them by consulting specialists . After the surgery, all patients underwent gait training as soon as possible . Data was collected in a retrospective manner from medical record review by three researchers in each hospital and by using the same study protocol . In each hospital, the institutional review board approved the study protocol . Upon admission to the ward, sex, age, height, weight and year of admission were recorded, as were smoking habits, body mass index, insurance status, general health status, hip fracture type, type of surgical procedure, postoperative complications and walking ability at discharge . The following major comorbid conditions at admission were recorded: hypertensive disease (international classification of diseases-10 code: i10-i15), diabetes (e10-e14), chronic ischemic heart disease (i20, i23-i25), heart failure (i50), chronic lower respiratory disease (j40-j47), chronic kidney disease (n17-n19), dementia or alzheimer's disease (f00-f03, g30) and malignancy (any c code). These conditions were recorded for patients who needed medical attention for these at the time of hospitalization . We used two composite indicators of physical condition: the charlson comorbidity index (cci)13 and the american society of anesthesiologists (asa) physical classification system.14 socioeconomic status was sorted into insurance and medical aid groups according to the type of insurance coverage held by the patient . Smoking habits were recorded as smoker or non smoker (never and ever smoker who ceased smoking over 1 year). The operative techniques were classified as internal fixation (by screw or nail) or replacement (hemiarthroplasty, total arthroplasty). Was graded using the simplified kitamura's classification: can walk (grade i - iii) versus cannot walk (grade iv - v).15 we have defined time to surgery as the length of time from occurrence of fracture to surgery and based on this, early surgery as surgery less than 3 days, which has been referred to as the criterion of early surgery in existing studies . The delayed - surgery group was subdivided into two groups: surgery between 3 and 7 days and surgery after 7 days . The surgeries were scheduled by the medical staff after the medical condition of the patients was assessed . The patient data was recorded separately if the surgery was delayed for other reasons . Without any separate record, it was assumed that the surgery was delayed because of medical conditions . National death data between january 1, 2002 and december 31, 2011 were used to confirm death and the date of death.16 the entire study group was followed for 2 - 10 years after surgery . We evaluated mortality at 30 days and 6 months after the fracture and we also evaluated the in hospital complication rate after surgery . The morbidity was evaluated in all patients after admissions, the in - hospital complications that were considered to occur at a relatively high rate and to affect mortality were selected . These complications included: bed - sores, pneumonia, thromboembolism, pulmonary congestion and acute renal failure . Pneumonia patients were identified by documentation in medical charts, diagnosis by culture or radiography and the presence of antibiotic use in the medical records . A bed - sore was defined by newly developed lesions occurring during the hospital stay, with documentation in the medical chart . Pulmonary congestion was defined by a diagnosis made by chest x - ray and subsequent treatment . Illinois, usa) was used for all statistical analyses . The chi - squared test or fisher exact test was used for nominal variables . A linear - by - linear association was used to analyze trends of ranking variables . Student's t - test or the wilcoxon rank sum test was used for continuous variables . To identify factors significantly associated with mortality after hip fracture surgery cci, asa class, comorbid condition, year of admission, admitted to which hospital, sex and age were included in the model . Whose expected value was over five in the contingency table and that showed statistical significance on univariate analysis (p <0.05). By these methods, relationships between operative delay, mortality and the trend of results over time were studied . Illinois, usa) was used for all statistical analyses . The chi - squared test or fisher exact test was used for nominal variables . A linear - by - linear association was used to analyze trends of ranking variables . Student's t - test or the wilcoxon rank sum test was used for continuous variables . To identify factors significantly associated with mortality after hip fracture surgery cci, asa class, comorbid condition, year of admission, admitted to which hospital, sex and age were included in the model . Whose expected value was over five in the contingency table and that showed statistical significance on univariate analysis (p <0.05). By these methods, relationships between operative delay, mortality and the trend of results over time were studied . Of these there was insufficient data of one patient, 117 had nonsurgical treatment, 19 were injured more than 48 h before admission, 33 had a subtrochanteric type of fracture, 58 had a previous fracture history and 286 had multiple fractures other than hip; these patients were thus excluded . As a result, 874 patients were analyzed . The average age of the patients was 77.1 years (range: 65 - 95 years) and 676 of 874 (77.3%) were females . Of the 874 patients, 162 (18.5%) had surgery within 3 days of hospitalization and 472 (54%) had surgery at least 7 days after admission . In comparison with the delayed surgery group, the early surgery group had fewer comorbid chronic conditions, showed better physical status according to asa class, had shorter periods of hospitalization and had more cases in which patients recovered their ambulatory ability during their hospitalization . However, the median survival time in the early surgery group was 643 days (interquartile range 202 - 1337), which was not significantly longer than the median survival time of 588 days (interquartile range 231 - 1303) in the delayed - surgery group . For the entire cohort of 874 subjects, the 1-month, 6-month, and 1-year mortalities were 1.4%, 7.6%, and 12%, respectively . The early surgery group showed a lower mortality rate than the delayed surgery group, but it was not significant [table 1]. Clinical details of patients on an unadjusted bivariate analysis, the timing of surgery, sex, age, current smoking, body mass index, operation type, cci, some of the comorbid conditions, recovery of walking ability, physical condition indicators and some of the complications were associated with 1-year mortality . Mortality hazard ratio of the 712 patients who did not receive surgery within 3 days after the fracture injury increased in relation to the elapsed time with an unadjusted mortality rate of 1.2 (95% confidence interval [ci]: 0.8 - 1.2) in patients who had surgery within 3 to 7 days after the injury and 1.6 (95% ci: 1.1 - 2.1) in patients who had surgery at least 7 days after admission . However, in an adjusted analysis the timing of surgery did not have a significant effect on the 1-year mortality [table 2 and figure 1]. Association between time to surgery and mortality adjusted long term survival of elderly hip fracture patients according to time from admission to surgery . (a) comparison of survival between surgery within 3 days and surgery after 3 days . The survival plots show that time to surgery did not significantly relate to survival in patients who had surgery after 7 days, the unadjusted 30-day and 6-month mortality hazard ratios were significantly increased, with ratios of 1.5 (95% ci: 1.1 - 2.2) and 1.6 (95% ci: 1.1 - 2.2), respectively . In patients who had surgery 3 - 7 days after admission, the 30-day and 6-month mortality rates were not significantly higher than those of the early - surgery group . After adjustment, the timing of surgery was no longer significantly associated with 30-day and 6-month mortality [table 2]. The relative risk of major complications that occurred at a relatively high rate in the delayed - surgery group was not significantly higher compared with that in the early - surgery group [table 3]. Several previous studies on the timing of hip fracture surgery have generally shown that early surgery within 2 - 3 days is associated with high long term survival and a low complication rate.2368171819 however, several studies have also shown that early surgery and prognosis are not related.789101117 in the present study, the rate of early surgery within 3 days of hospitalization was 18.5%, which was relatively lower than the early - surgery rate of nearly 40% in england or other european or north american countries.2 in addition, 54% of the patients received surgery after at least 7 days of hospitalization, which was different from the results of other previous studies . However, the 1 year mortality rate was 9.9% in the early surgery group and 12.5% in the delayed surgery group, which was similar to or lower than, the mortality rate reported in previous studies . In addition, the results of this study show that the time to surgery did not have a significant effect on short term or long term mortality and complications, probably because the major reason for the delay of surgery was an active medical problem.810202122232425 in this study, the rate of poor physical status was high in the delayed - surgery group, which may account for the high mortality and complication rate in this group . However, in elderly patients, 1 week of bed rest resulted in muscle weakness and a 1/3 decrease in strength, and it increased the rate of complications such as pulmonary embolism . Furthermore, it is true that with the passage of time after injury the morbidity does increase in the elderly, which ultimately may be the cause of morbidity . Therefore, even if adequate medical care can ameliorate the disadvantages associated with delayed surgery, the necessity of preparing the patient for surgery as soon as possible is clear.19 however, rather than recommending a universal timing for surgery, the condition and medical environment of each patient should be considered in deciding the timing of surgery . Thus, the results of this study suggest that the importance of reducing the absolute number of unacceptable delays outweighs the importance of advancing the date of the surgery . The limitations in this study include the following: first, the study was not a randomized trial and therefore, cannot cover all aspects of mortality and other factors related to complications . However, this limitation is considered to be minimal because many variables have been collected from the medical records . Second, when data was gathered from medical records, missing, or incorrect data may have been used . Additionally, methods of medical treatments, physical condition of the patients and surgery skills may vary by year and by hospital . Third, the operative technique was simply classified into two groups (internal fixation and replacement) to increase the statistical power for analyzing these small sized sample groups . Currently however, various operative techniques are used for hip fracture and each of these techniques can have its own mortality or morbidity . Finally, this study did not evaluate the functional capacity of the patients, e.g. Patient activity changes between the fracture and long term followup, recurrence after discharge resulting in nonunion, residential district of the patients and treatment for osteoporosis . Additionally, the data may lack accuracy because all data was gathered from charts and the possibility that the cause of death could be nonmedical too cannot be ruled out . Moreover, although variables that seem to affect mortality were addressed, only variables with relatively high prevalence were included in the multivariate analysis . Therefore the time to surgery was not significantly related to short or long term mortality or to an increase in the in hospital complication rate . However, these findings do not devalue the standard teaching in which the elderly patient, whenever fit for anesthesia, should be operated on as early as possible basis in view of the comorbid conditions . We recommend concentrating more on optimizing the condition of patients early with sufficient medical treatment rather than being bound by the absolute timing of surgery.
Thalassemia is a genetic disease in which oxygen is not properly supplied to bodily organs due to an abnormal structure of the patient s hemoglobin (1). The disease is seen in almost all human races, but it is more prevalent in the mediterranean and tropical regions as well as in asia and africa (1, 2). The annual incidence rate of symptomatic cases has been estimated to be 1 in 100,000 populations worldwide and 1 in 10,000 in european countries (3). Iran, with approximately 3 million minor thalassemic and 25 thousand major thalassemic patients, is located in the thalassemia belt (2). Repeated blood transfusions and iron absorption from the intestine may cause iron overload in these patients (4). Iron overload can, in turn, lead to increased levels of free radicals in the body . Studies have indicated that the level of oxidative stress is significantly high in patients with transfusion - dependent thalassemia (5 - 7)], while the levels of antioxidants, such as vitamins e and c, are lower than the normal range (8, 9). Excess iron is precipitated in the visceral organs, primarily the heart, liver, and endocrine glands (1). Despite the availability of iron - chelators, heart toxicity remains the leading cause of death in beta - thalassemia major patients due to iron overload (10 - 12). The most common treatment method for the removal of excessive iron is chelation therapy (1). Desferal is a medicine in this category; however, it has several side effects, such as excessive pain during injection (13). The quality of its oral form is also challenging, and it is not applicable to all patients (14). Moreover, with the rising cost of desferal, a high economic burden is imposed on society s healthcare system . Attempts to identify appropriate and cost - effective ways to reduce iron overload in patients with beta - thalassemia were among the researchers top concerns . Nevertheless, few studies have been conducted in this area so far . In an investigation by schumacher et al ., iron depletion was reported in 10% of male and 20% of female athletes (15). Furthermore, some researchers assessed the effects of aerobic exercise and intercessory prayer on ferritin in patients with thalassemia (2, 16). Other researchers, by determining the nutritional needs of these patients and suggesting the addition of specific complements to the treatment program, have tried to meet the nutritional needs of these patients and reduce tissue damage due to iron overload (17). Yet, only a limited number of studies have been conducted in this regard, particularly in iran . Therefore, the present study aimed to investigate the effect of nutrition, exercise, and a prayer program on reducing iron overload in patients with beta - thalassemia major . This randomized clinical trial with pre / posttest design was performed on two groups of thalassemia patients (intervention and control groups). This study was conducted in shahid dastgheib hospital affiliated with shiraz university of medical sciences, the largest center for thalassemia patients in shiraz . The inclusion criteria for the study were being between 15 and 35 years of age, having the ability to receive the training and take care of oneself, not being prohibited to exercise by a cardiologist, and not having participated in similar studies during the past six months . On the other hand, the exclusion criteria were a lack of cooperation during the study (unwillingness, migration, or non - compliance with the program), hospitalization for any reason (acute complications of the disease, cardiovascular disorders, and other problems), suffering from acute or chronic infectious diseases, and an urgent need to alter the chelation therapy due to an excessive increase or decrease in iron overload . Based on similar studies (16), a 30-subjects sample size was determined to be adequate for the study (15 patients in each group). However, considering the probability of loss, the sample size was increased to 50 subjects (25 in each group). Among the 390 patients with thalassemia who had been referred to the hospital, 200 did not meet the inclusion criteria and 100 were not willing to participate in the study . Therefore, 50 patients with major thalassemia were selected based on the inclusion criteria of the study (figure 1). These patients were randomly divided into an intervention and a control group . In this study, 12 patients were excluded due to hospitalization, unwillingness to continue participating in the study, and suffering from infectious diseases . Thus, the number of patients in the intervention and control groups decreased from 25 each to 18 and 20, respectively . The educational content was prepared based on various resources, articles, and specialists opinions . In the first session, the group members became familiar with each other, expressed their goals, and talked about their life experiences . The patients educational needs were also determined using a questionnaire . In the second session, the patients were provided with a brief description of the types of the disease, new treatment methods, and the dos and donts of eating . Considering nutrition, the focus was on avoiding heme - iron - rich foods (iron found in meat), substitution of the nutritional needs with non - heme - iron - rich foods (iron found in non - meat materials), and the consumption of antioxidants, such as vitamins e and c (box 1). In the third session, exercise and physical activity within one s physical endurance were emphasized, and the principles and methods were explained . In addition, the patients were asked to do moderate exercises, such as walking, at home for 15 minutes every day and increase or decrease their duration and speed depending on their tolerance (box 2). In the fourth session, the importance of preventing infection, the association between infection, iron, and iron chelators as well as the prevention strategies was trained (box 3). It was reported that iron overload impaired the immune system and increased the risk of infection in thalassemia patients (18). Moreover many organisms, such as yersinia enterocolitica, klebsiella species, escherichia coli, streptococcus pneumoniae, pseudomonas aeroginosa, legionella pneumophila, and listeria monocytogenes, have been indicated to increase virulence in the presence of excessive iron (19). In the fifth session, the nature, reason, and ways of praying were explained and the patients were asked to pray every day and fill their moments with god by attracting their heart and mind towards him . The spiritual training programs (including intercessory prayer) were carried out according to the participants religious beliefs (all were muslim). It should be mentioned that the patients were required to repeat spiritual words and phrases at least three times a day . Each training class lasted for 1 - 1.5 hours considering the patients understanding and tolerance levels . To ensure patient learning, they were involved in discussions and question - and - answer sessions after each training session . In addition, the participants were given a 15-page booklet entitled care program for major thalassemia patients, which contained the educational content of the training program after the intervention . A self - reporting performance record form was filled out daily by the patients to confirm their compliance with the educational program . They recorded no intake of red meat, fish, liver and kidney, the consumption of dairy products but only with meals, having fruits and vegetables as snacks, walking and its duration, performing infection strategies, and frequency of repetition of spiritual phrases . The researcher s contact number was also given to all the participants for any possible questions . The participants demographic characteristics consisted of age, gender, education level, time of diagnosis, number of transfusions, and medications used to reduce iron overload . Additionally, the basic iron content included serum iron, ferritin, unsaturated iron - binding capacity (uibc), and total iron - inding capacity (tibc). The basic iron content was measured in a specialized laboratory . To ensure the reliability of the test results, all the experiments were carried out in a specialized laboratory by just one individual using specific kits (electrochemi luminesence from roche germany) to determine the amount of ferritin and then the colorimetric method to determine the iron and uibc at a given time . To prevent information transfer, the study was initially conducted in the control group, so that they could not get any information about the details of the intervention . It should be noted that the individual who took blood from the patients and the one who analyzed the tests were blind to the study groups . This study was registered in iranian registry of clinical trials of the ministry of health and medical education (irct2014011216190n1). The study was also approved by the ethics committee of shiraz university of medical sciences . Written informed consent was obtained from all the participants . In this way they were also informed about the voluntary nature of the study and that their participation / non - participation had no effects on their treatments and care . The study data were analyzed using chi - square, fisher s exact test, mann - whitney, wilcoxon, independent samples t - test, and paired samples t - test with the the spss statistical software (ver . This randomized clinical trial with pre / posttest design was performed on two groups of thalassemia patients (intervention and control groups). This study was conducted in shahid dastgheib hospital affiliated with shiraz university of medical sciences, the largest center for thalassemia patients in shiraz . The inclusion criteria for the study were being between 15 and 35 years of age, having the ability to receive the training and take care of oneself, not being prohibited to exercise by a cardiologist, and not having participated in similar studies during the past six months . On the other hand, the exclusion criteria were a lack of cooperation during the study (unwillingness, migration, or non - compliance with the program), hospitalization for any reason (acute complications of the disease, cardiovascular disorders, and other problems), suffering from acute or chronic infectious diseases, and an urgent need to alter the chelation therapy due to an excessive increase or decrease in iron overload . Based on similar studies (16), a 30-subjects sample size was determined to be adequate for the study (15 patients in each group). However, considering the probability of loss, the sample size was increased to 50 subjects (25 in each group). Among the 390 patients with thalassemia who had been referred to the hospital, 200 did not meet the inclusion criteria and 100 were not willing to participate in the study . Therefore, 50 patients with major thalassemia were selected based on the inclusion criteria of the study (figure 1). These patients were randomly divided into an intervention and a control group . In this study, 12 patients were excluded due to hospitalization, unwillingness to continue participating in the study, and suffering from infectious diseases . Thus, the number of patients in the intervention and control groups decreased from 25 each to 18 and 20, respectively . The educational content was prepared based on various resources, articles, and specialists opinions . In the first session, the group members became familiar with each other, expressed their goals, and talked about their life experiences . The patients educational needs were also determined using a questionnaire . In the second session, the patients were provided with a brief description of the types of the disease, new treatment methods, and the dos and donts of eating . Considering nutrition, the focus was on avoiding heme - iron - rich foods (iron found in meat), substitution of the nutritional needs with non - heme - iron - rich foods (iron found in non - meat materials), and the consumption of antioxidants, such as vitamins e and c (box 1). In the third session, exercise and physical activity within one s physical endurance were emphasized, and the principles and methods were explained . In addition, the patients were asked to do moderate exercises, such as walking, at home for 15 minutes every day and increase or decrease their duration and speed depending on their tolerance (box 2). In the fourth session, the importance of preventing infection, the association between infection, iron, and iron chelators as well as the prevention strategies was trained (box 3). It was reported that iron overload impaired the immune system and increased the risk of infection in thalassemia patients (18). Moreover many organisms, such as yersinia enterocolitica, klebsiella species, escherichia coli, streptococcus pneumoniae, pseudomonas aeroginosa, legionella pneumophila, and listeria monocytogenes, have been indicated to increase virulence in the presence of excessive iron (19). In the fifth session, the nature, reason, and ways of praying were explained and the patients were asked to pray every day and fill their moments with god by attracting their heart and mind towards him . The spiritual training programs (including intercessory prayer) were carried out according to the participants religious beliefs (all were muslim). It should be mentioned that the patients were required to repeat spiritual words and phrases at least three times a day . Each training class lasted for 1 - 1.5 hours considering the patients understanding and tolerance levels . To ensure patient learning, they were involved in discussions and question - and - answer sessions after each training session . In addition, the participants were given a 15-page booklet entitled care program for major thalassemia patients, which contained the educational content of the training program after the intervention . A self - reporting performance record form was filled out daily by the patients to confirm their compliance with the educational program . They recorded no intake of red meat, fish, liver and kidney, the consumption of dairy products but only with meals, having fruits and vegetables as snacks, walking and its duration, performing infection strategies, and frequency of repetition of spiritual phrases . The researcher s contact number was also given to all the participants for any possible questions . The participants demographic characteristics consisted of age, gender, education level, time of diagnosis, number of transfusions, and medications used to reduce iron overload . Additionally, the basic iron content included serum iron, ferritin, unsaturated iron - binding capacity (uibc), and total iron - inding capacity (tibc). The basic iron content was measured in a specialized laboratory . To ensure the reliability of the test results, all the experiments were carried out in a specialized laboratory by just one individual using specific kits (electrochemi luminesence from roche germany) to determine the amount of ferritin and then the colorimetric method to determine the iron and uibc at a given time . To prevent information transfer, the study was initially conducted in the control group, so that they could not get any information about the details of the intervention . It should be noted that the individual who took blood from the patients and the one who analyzed the tests were blind to the study groups . This study was registered in iranian registry of clinical trials of the ministry of health and medical education (irct2014011216190n1). The study was also approved by the ethics committee of shiraz university of medical sciences . Written informed consent was obtained from all the participants . In this way they were also informed about the voluntary nature of the study and that their participation / non - participation had no effects on their treatments and care . The study data were analyzed using chi - square, fisher s exact test, mann - whitney, wilcoxon, independent samples t - test, and paired samples t - test with the the spss statistical software (ver . The study results showed that the majority of the participants in both groups were 20 - 24 years old . In addition, 50% of the participants in the control group and 72.2% of those in the intervention group were female . In addition, 35% of the control group and 44.4% of the intervention group participants had high - school degrees . The results of the chi - square test (or fisher s exact test in case the sample size was not large enough) showed that the subjects in the two groups were homogeneous in terms of demographic characteristics (age, sex, and education level), time of diagnosis, onset of transfusion, and chelator agent . A comparison of the iron measurements in the two groups both before and after the intervention is presented in table 2 . As the tabulation depicts, the intervention group s mean of ferritin two months after the intervention was significantly lower compared to before the intervention (p = 0.04). However, no significant change was observed in the control group in this regard (p = 0.29). Besides, the mean level of serum iron was reduced in the intervention group, but the difference was not statistically significant (p = 0.81). Also, this index increased in the control group, but the difference was not statistically significant (p = 0.4). Moreover, the uibc level decreased in both groups, but it the decrease was significant only in the control group (p = 0.04) compared to the intervention group (p = 0.32). The tibc level also decreased in both the intervention and control groups, but the difference was not statistically significant (p = 0.26 and p = 0.11, respectively). Also, despite the decline in ferritin level in the intervention group after the intervention, the difference was not statistically significant (p = 0.96); however, it was clinically considerable . Finally, changes in serum iron, uibc, and tibc levels were not statistically significant (p = 0.96, p = 0.12, and p = 0.20, respectively). A comparison of the changes in iron indices in the two groups before and after the intervention has been presented in table 3 . Abbreviations: sd, standard deviation; tibc, total iron binding capacity; uibc, unsaturated iron binding capacity . Abbreviations: uibc, unsaturated iron binding capacity; tibc, total iron binding capacity; sd, standard deviation . The results of this study showed that application of a comprehensive educational program could improve ferritin levels and eventually decrease the complications of iron overload in thalassemic patients . In fact, application of the educational program in the intervention group significantly decreased the serum ferritin level two months following the intervention in comparison to before the intervention . This observation was consistent with the findings of the study by rahmaninia, as cited in heidary, which was conducted on the athletes in order to compare the effects of two types of physical activities on iron status and the soluble transferrin receptor (2). Presumably, the insignificant reduction in the intervention group participants serum iron levels was due to daily changes in serum iron levels as well as to demolition of iron release from red blood cells . In general, serum iron fluctuates daily and is influenced by several factors, including diet and infectious or inflammatory diseases (15, 20). These results were also in line with those obtained by heidary et al . In a study investigating the effect of eight weeks of aerobic training on hematology indices in patients with beta - thalassemia minor . The study results indicated that the serum ferritin level significantly was reduced in the intervention group eight weeks after doing aerobic exercises (2). The present study further attempted to investigate the effects of exercising in conjunction with other methods of iron overload reduction, such as the reduction of intestinal iron absorption through the consumption or prohibition of some food groups, the application of safety methods to prevent infectious diseases, and prayer . Considering the effect of exercising on reducing ferritin, it seems reasonable that hemolysis of unfavorable thalassemic hemoglobin occurs more frequently during exercise activities, eventually decreasing serum ferritin levels . Additionally, some researchers believe that intestinal iron absorption is lower than normal in athletes . Hence, in case thalassemic patients can decrease iron absorption through regular and constant aerobic activities, they can control their iron supply (16). Changes in the cell membrane, in turn, release tissue iron and increase serum ferritin and iron levels . However, desferal helps the iron to be excreted when iron is present in the blood . This is where the role of exercise in reduction of iron overload is manifested either directly or indirectly by increasing the efficiency of desferal (21). The findings of the present study showed a decreased uibc in both study groups, but the difference was significant only in the control group (p <0.05). Studies have shown that high degrees of some substances, such as bilirubin, copper, and lipemia, and hemoglobin hemolysis> 200 mg / dl could affect uibc; hence, the obtained results might not be very reliable (22). Thus, in case of liver disease or lack of adequate dietary protein, transferrin levels are reduced (23) and, consequently, both uibc and tibc drop without any direct relationship to the iron changes . These findings were not consistent with those of the studies by heydari et al . And vashtani et al . In addition to what was mentioned earlier about uibc, increase of tibc following reduction of serum iron level mainly occurs in anemia . In iron overload, on the other hand, by saturation of transferrin - iron binding capacity, non - transferrin bound iron (ntbi), which is more toxic compared to iron bound to transferrin, appears in the blood circulation (4, 24, 25). Therefore, the change in tibc in response to a reduction of available serum iron is not valid in patients with iron overload . One of the limitations of the current study was that the patients responsibility and economic, occupational, and social status could have affected their adherence to and compliance with the training . Therefore, to achieve more accurate results, further studies with larger sample sizes, longer follow - up periods, and more accurate methods of assessing iron overload (such as soluble transferrin receptor liver iron concentration) are recommended to be carried out . Nowadays, similar to other patients suffering from other chronic diseases, thalassemic patients require careful training to perform the required care . Providing and regulating training and care programs through comprehensive and constant courses by nurses can result in more accurate follow - ups and help reduce iron overload . These programs should be carried out by nurses since they have direct contact with patients while providing their services . In addition, comprehensive care programs meet the patients educational needs in various dimensions; evidence from experiments has expressed the efficiency of such programs in reducing ferritin in thalassemic patients . Therefore, the application of such care programs is recommended as a crucial step in reducing iron overload and its complications in different bodily organs, thereby improving the thalassemic patients health status.
Coronary artery disease (cad) is the leading cause of morbidity and mortality throughout the world [1, 2]. Male pattern baldness, also called androgenetic alopecia, is responsible for the majority of hair loss in male individuals [35]. It generally starts at the second or third decade and is characterised by varying degrees of thinning / hair loss primarily at the frontal area and vertex of the scalp . Several epidemiological studies have shown an association between androgenetic alopecia and cad [610]. Among these, the framingham heart study revealed an association between progression of hair loss during adulthood and cad in male individuals, although there was no relationship with the extent of baldness . In a case - control study, lesko et al . Reported that vertex baldness was associated with threefold higher risk of myocardial infarction among men younger than 55 years . Several other studies reported the presence of an association between androgenetic alopecia and cad [1113]. However, results of several other studies argue against this relationship [14, 15]. Clarifying the potential relationship between androgenetic alopecia and cad might help to better understand the pathophysiology of coronary heart disease . Although several epidemiological studies have shown an association between male pattern baldness and atherosclerosis, it has never been studied by investigating angiographic presence and severity of cad . We therefore aimed to shed light on this issue by investigating whether there is an association between male pattern baldness and angiographic cad severity and collateral development . The study was approved by the local ethics committee, and all participants gave written informed consent before participating . Patients scheduled for an elective coronary arteriogram in the cardiology department of gaziantep university hospital were invited to participate . Demographic data on the study population including age, sex, height, weight, history of diabetes mellitus, hypertension, smoking status, family history of cad, lipid parameters and creatinine levels were recorded . Before coronary arteriogram, the presence and severity of hair loss was recorded according to the criteria mentioned later in the text . Severity of cad was determined according to the gensini score and collateral flow was graded according to the rentrop score . Exclusion criteria were female sex, history of coronary artery bypass surgery, history of acute coronary syndrome in the past 4 weeks, other types of alopecia and patients with known hormonal problems . Coronary arteriogram was performed via the femoral, radial or brachial artery using judkins technique (integris h 5000, philips medical systems, the netherlands). Coronary artery stenosis severity (gensini and rentrop scores) was estimated visually by two independent observers who were blinded to clinical information on the patients . Coronary arteries were considered to be normal (0: no stenosis), obstructed (25, 50, 75, 90 or 99% stenosis) or 100% occluded, according to the maximum obstruction that was observed in any projection . The severity of coronary atherosclerosis was classified according to the gensini score, which grades narrowing of the lumen as 1 for 125% stenosis, 2 for 2650%, 4 for 5175%, 8 for 7690%, 16 for 9199% and 32 for total occlusion . This score was multiplied by a factor that accounted for the importance of a lesion s position in the coronary arterial tree: 5 for the left main coronary artery; 2.5 for the proximal left anterior descending coronary artery or proximal circumflex artery; 1.5 for the mid left anterior descending coronary artery; 1 for the proximal right coronary artery, distal left anterior descending coronary artery, obtuse marginal artery or posterior lateral artery; and 0.5 for other stenoses . The severity of disease was expressed as the sum of the scores for the individual lesions . By definition, collateral vessels were graded according to the rentrop classification: 0: no filling of any collateral vessels, 1: filling of side branches of the artery to be perfused by collateral vessels without visualisation of the epicardial segment; 2: partial filling of the epicardial artery by collateral vessels; and 3: complete filling of the epicardial artery by collateral vessels . By definition, a rentrop score of 2 or more was accepted as well - developed collaterals . We used the modified hamilton grading system, as it was used by the majority of the studies: grade 1: no hair loss; grade 2: frontal baldness only; grade 3: mild vertex baldness; grade 4: moderate vertex baldness and grade 5: severe vertex baldness as previously described [12, 18]. Each investigator had a chart illustrating these five different hair types, as depicted by lotufo et al . And decided to which grade the individual patient s hair status fits best . Additionally, investigators asked each participant which category best describes his hair status when he was 35 years old . According to the power calculation, to provide 95% power at 5% significance to detect a 4% mean absolute difference in baldness and gensini score, 306 subjects were necessary . To provide 80% power at 5% significance to detect a 4% mean absolute difference in baldness and rentrop score, 149 subjects were necessary . Continuous data were expressed as mean standard deviation, while categorical data were presented as number or percentage of patients . Chi - square test was used for comparison of categorical variables, while the mann multivariate logistic regression analysis (backward) was performed to determine the independent predictors of a high gensini score . All analyses were carried out with spss version 15.0 software for windows (spss inc ., the study was approved by the local ethics committee, and all participants gave written informed consent before participating . Patients scheduled for an elective coronary arteriogram in the cardiology department of gaziantep university hospital were invited to participate . Demographic data on the study population including age, sex, height, weight, history of diabetes mellitus, hypertension, smoking status, family history of cad, lipid parameters and creatinine levels were recorded . Before coronary arteriogram, the presence and severity of hair loss was recorded according to the criteria mentioned later in the text . Severity of cad was determined according to the gensini score and collateral flow was graded according to the rentrop score . Exclusion criteria were female sex, history of coronary artery bypass surgery, history of acute coronary syndrome in the past 4 weeks, other types of alopecia and patients with known hormonal problems . Coronary arteriogram was performed via the femoral, radial or brachial artery using judkins technique (integris h 5000, philips medical systems, the netherlands). Coronary artery stenosis severity (gensini and rentrop scores) was estimated visually by two independent observers who were blinded to clinical information on the patients . Coronary arteries were considered to be normal (0: no stenosis), obstructed (25, 50, 75, 90 or 99% stenosis) or 100% occluded, according to the maximum obstruction that was observed in any projection . The severity of coronary atherosclerosis was classified according to the gensini score, which grades narrowing of the lumen as 1 for 125% stenosis, 2 for 2650%, 4 for 5175%, 8 for 7690%, 16 for 9199% and 32 for total occlusion . This score was multiplied by a factor that accounted for the importance of a lesion s position in the coronary arterial tree: 5 for the left main coronary artery; 2.5 for the proximal left anterior descending coronary artery or proximal circumflex artery; 1.5 for the mid left anterior descending coronary artery; 1 for the proximal right coronary artery, distal left anterior descending coronary artery, obtuse marginal artery or posterior lateral artery; and 0.5 for other stenoses . The severity of disease was expressed as the sum of the scores for the individual lesions . By definition, collateral vessels were graded according to the rentrop classification: 0: no filling of any collateral vessels, 1: filling of side branches of the artery to be perfused by collateral vessels without visualisation of the epicardial segment; 2: partial filling of the epicardial artery by collateral vessels; and 3: complete filling of the epicardial artery by collateral vessels . By definition, a rentrop score of 2 or more was accepted as well - developed collaterals . We used the modified hamilton grading system, as it was used by the majority of the studies: grade 1: no hair loss; grade 2: frontal baldness only; grade 3: mild vertex baldness; grade 4: moderate vertex baldness and grade 5: severe vertex baldness as previously described [12, 18]. Each investigator had a chart illustrating these five different hair types, as depicted by lotufo et al . And decided to which grade the individual patient s hair status fits best . Additionally, investigators asked each participant which category best describes his hair status when he was 35 years old . According to the power calculation, to provide 95% power at 5% significance to detect a 4% mean absolute difference in baldness and gensini score, 306 subjects were necessary . To provide 80% power at 5% significance to detect a 4% mean absolute difference in baldness and rentrop score, 149 subjects were necessary . Continuous data were expressed as mean standard deviation, while categorical data were presented as number or percentage of patients . Chi - square test was used for comparison of categorical variables, while the mann multivariate logistic regression analysis (backward) was performed to determine the independent predictors of a high gensini score . All analyses were carried out with spss version 15.0 software for windows (spss inc ., a total of 511 male patients (mean age: 58.6; range: 3384) were included in the study . Gensini score was available in 511 patients, whereas the rentrop score was available in 136 patients . Table 1 presents the characteristics of the study population.table 1characteristics of the study population n age51158.6 12.0hypertension (%) 511182 (35.7)diabetes (%) 511106 (20.9)smoking (%) 511330 (64.6)family history (%) 511190 (37.2)baldness scale5112.84 1.54gensini score51141.3 40.3rentrop score1361.84 1.09body mass index (kg / m 50927.1 4.4creatinine (mg / dl)4781.02 0.94low - density lipoprotein (mg / dl)419111.2 33.5high - density lipoprotein (mg / dl)41935.5 15.9total cholesterol (mg / dl)419176.0 42.0triglyceride (mg / dl)419173.3 128.0data are expressed as mean standard deviation or percentages characteristics of the study population data are expressed as mean standard deviation or percentages comparison of demographic, clinical and laboratory characteristics of the subjects according to gensini score is expressed in table 2 . Those with a higher gensini score (20) were older, had a higher level of triglycerides and androgenetic alopecia was more common among them . The hair status at the age of 35 was similar between the groups with high and low gensini scores . Additionally, the rest of the laboratory results and demographic characteristics were similar between the groups with high and low gensini scores . When we compared bald (modified hamilton score 2) and non - bald (modified hamilton score = 1) subjects, bald patients had a higher gensini score (44.2 42.1 vs. 33.0 35.3; p = 0.003). Smoking rate was higher in the group with higher gensini scores (p = 0.002). There were no differences in terms of presence of diabetes, hypertension and family history of cad between the groups with high and low gensini scores.table 2comparison of demographic, clinical and laboratory characteristics of the subjects according to gensini scoreparameter n gensini score <20 n gensini score 20 p valueage19656.3 12.231560.1 11.7 0.001 baldness scale1962.63 1.53142.97 1.5 0.016 baldness scale at age 351701.58 0.92931.52 0.90.4creatinine, mg / dl1791.03 1.172951.01 0.780.8triglycerides, mg / dl161154.5 81263185.5 149 0.006 hdl, mg / dl15236.7 9.926334.7 18.50.1ldl, mg / dl158112 30.8264110.7 35.10.7total cholesterol, mg / dl158175.8 37.6264176.2 44.70.6bmi, kg / m 19527 4.231027.4 4.30.2data are expressed as mean standard deviation or as number of patients hdl high - density lipoprotein, ldl low - density lipoprotein, bmi body mass index comparison of demographic, clinical and laboratory characteristics of the subjects according to gensini score data are expressed as mean standard deviation or as number of patients hdl high - density lipoprotein, ldl low - density lipoprotein, bmi body mass index comparison of demographic, clinical and laboratory characteristics of the subjects according to the rentrop score is expressed in table 3 . There were no differences in terms of presence and severity of baldness, hair status at the age of 35, demographic characteristics and laboratory findings in subjects with (rentrop score 2) and without (rentrop score 0 or 1) adequate collateral development . Additionally, the rate of smoking, presence of diabetes, hypertension and family history of cad were similar in subjects with and without adequate collateral development.table 3comparison of demographic, clinical and laboratory characteristics of the subjects according to rentrop scoreparameter n rentrop <2 n rentrop 2 p valueage4258.2 12.69460.6 12.10.3baldness scale423 1.4942.9 1.40.7baldness scale at age 35421.67 1941.55 10.5creatinine, mg / dl420.98 0.38850.97 0.280.8triglycerides, mg / dl35195.5 142.477194.5 158.30.9hdl, mg / dl3541.5 45.57732.5 9.20.2ldl, mg / dl35111.1 33.978110.7 41.60.9total cholesterol, mg / dl35176.3 31.977174.2 55.20.8bmi, kg / m 4226.9 4.29027.4 3.70.5data are expressed as mean standard deviation or as number of patients hdl high - density lipoprotein, ldl low - density lipoprotein, bmi body mass index comparison of demographic, clinical and laboratory characteristics of the subjects according to rentrop score data are expressed as mean standard deviation or as number of patients hdl high - density lipoprotein, ldl low - density lipoprotein, bmi body mass index of 511 patients, 59 had normal coronary arteries (zero - vessel disease), 171 had one - vessel disease, 176 had two - vessel disease and 105 had triple - vessel disease . The mean number of diseased vessels was higher in bald subjects when compared with their non - bald counterparts (1.71 0.9 vs. 1.44 0.9; p = 0.004). The number of diseased vessels correlated with the severity of baldness (r = 0.125; p = 0.005). The mean number of diseased vessels was lower in the group with adequate collateral development when compared with those without adequate collateral development (2.47 0.5 vs. 2.69 0.4; p = 0.028). The number of diseased vessels was inversely correlated with rentrop score (r = 0.226; p = 0.008). In univariate analysis, age more than 60, body mass index more than 30, smoking and baldness were among the predictors of a high gensini score . In multivariate analysis, only age more than 60 (p <0.001; odds ratio 2.590; 95% confidence interval 1.6374.098), smoking (p <0.001; odds ratio 2.385; 95% confidence interval 1.4963.802) and body mass index more than 30 (p = 0.012; odds ratio 1.937; 95% confidence interval:1.1543.252) were independent predictors of a high gensini score (table 4). After adjusting for age, presence and severity of baldness was not an independent predictor of a high gensini score.table 4independent predictors of gensini score> 20 (multivariate logistic regression analysis)variableodds ratio95% confidence intervalage> 602.5901.6374.098smoking2.3851.4963.802bmi> 30 kg / m 1.9371.1543.252 bmi body mass index independent predictors of gensini score> 20 (multivariate logistic regression analysis) in the present study, we aimed to investigate whether there is an association between male pattern baldness and angiographic cad severity and collateral development, which has not been reported previously . According to our findings, although subjects with higher gensini scores had more frequent and severe baldness, they were older than the group with lower gensini scores . After adjusting for age, presence and severity of baldness lost its value in predicting the severity of cad . Additionally, there were no differences in terms of presence and severity of baldness in subjects with and without adequate collateral development . Because cad is the leading cause of morbidity and mortality worldwide, researchers aim to investigate potential novel risk factors or associated conditions which might enable the early detection of cad . Male pattern baldness is androgen - dependent miniaturisation and loss of frontal and/or vertical hair . It generally starts at the second or third decades and effects almost half of middle - aged men . Therefore, it is quite reasonable that investigators are trying to clarify the presence and extent of a potential interaction between cad and male pattern baldness . Although the exact reason for the association between baldness and cad is unclear, several mechanisms have been proposed . First, elevated androgen levels and increased peripheral sensitivity to androgens have been reported, both in subjects with androgenetic alopecia and cad [1921]. Second, it has been suggested that they have common atherosclerosis risk factors such as hypertension, dislipidaemia, smoking, hyperinsulinaemia / insulin resistance, metabolic syndrome and chronic inflammation [2224]. Third, it has been proposed that the two conditions might share a similar pattern of inheritance [12, 25]. In 1972, cotton et al . For the first time reported that patients with myocardial infarction had no increase in male pattern alopecia . In 1979, cooke reported that there was no association between cad and either male pattern alopecia or premature male pattern alopecia in 478 male caucasian hospital inpatients . In 1993, in a case - control study, lesko et al . Reported that vertex baldness (threefold higher risk of myocardial infarction) but not frontal baldness was associated with myocardial infarction among men younger than 55 years . In the framingham heart study, 30-year follow - up revealed that progression of hair loss during adulthood but not extent of baldness was associated with cad in men additionally, the first national health and nutrition examination survey reported an association between severe baldness and cad mortality in men younger than 55 years, but not among older men . In two recent studies, sharma et al . Reported that early - onset androgenetic alopecia in male individuals (less than 40 and 45 years old, respectively) is independently associated with cad [27, 28]. In contrast, in 2007, shahar et al . Investigated the association of androgenetic alopecia with cad in 5000 men aged 5275 years, of whom 767 had a history of myocardial infarction and concluded that male pattern baldness cannot be used as a risk factor for myocardial infarction or asymptomatic atherosclerosis . To date, there are no other studies in the literature investigating the association between androgenetic alopecia and angiographic cad severity and collateral development; therefore, we cannot make a direct comparison with published data . We were not able to detect any relation between presence, severity and age of occurrence of male pattern baldness and gensini and rentrop scores, which are important measures of presence and severity of cad . In our study, although subjects with higher gensini scores had more frequent and severe baldness, they were older than the group with lower gensini scores . And after adjusting for age, presence and severity of baldness lost its value in predicting severity of cad additionally, there were no differences in terms of presence and severity of baldness in subjects with and without adequate collateral development . Thus, the previously reported association between cad and androgenetic alopecia was not confirmed in our angiographic study . Reported that men with vertex - type androgenetic alopecia (n = 41) had higher levels of serum lipoprotein (a) and triglyceride when compared with the group with normal hair status (n = 36). In their recent study, dogramaci et al . Reported that male individuals with androgenetic alopecia had higher levels of triglycerides and lower levels of high - density lipoprotein . In our study, subjects with vertex baldness but not frontal baldness had significantly higher triglyceride levels supporting the results of the studies by sasmaz et al . And dogramaci et al . In our study, the rest of the lipid parameters were comparable between bald and non - bald subjects regardless of the severity of baldness . Interestingly, of the lipid parameters only triglyceride level was higher in subjects with higher gensini scores . The physicians health study, which included 19,112 subjects who were free of cad at baseline with a follow - up of 11 years, reported that vertex pattern but not frontal baldness was associated with increased risk of coronary events and this association was more robust among men with hypertension or hyperlipidaemia . Reported that men with baldness before the age of 35 years had an increased risk for needing early coronary revascularisation . In our study, presence and severity of androgenetic alopecia before the age of 35 was not associated with angiographic cad (gensini and rentrop scores). Reported that androgenetic alopecia significantly correlated with cad and previous history of myocardial infarction in women under the age of 55 . We did not study women; however, we did not find an association between androgenetic alopecia and angiographic cad in men . In a recent meta - analysis, yamada et al . Investigated six observational studies with a total of 36,690 participants . They reported that vertex baldness but not frontal baldness increased the risk of cad, and the relationship was more robust with severe baldness . As it was a meta - analysis and first, despite the fact that the majority of published data reports an association between androgenetic alopecia and cad, our study argues against this relationship . Second, our study is the first in the literature to investigate the association between male pattern baldness and angiographic cad severity and collateral development . Third, our study gathered designs and settings of several previously published studies, such as presence, severity and age of occurrence of male pattern baldness, associated hypertension and hyperlipidaemia . Fourth, regardless of the results, the present study provides more in - depth data in this issue that we believe will shed light for prospective large - scale studies . First, the sample size of the present study is relatively small, especially for the collateral data . Second, this is a cross - sectional study; therefore, it would provide more valuable information if we were able to follow - up the study population, especially to draw conclusions about clinical coronary events . Third, we asked each participant which category best describes his hair status when he was 35 years old . In summary, although the majority of studies reported an association between androgenetic alopecia and cad, we were not able to detect any relation between presence, severity and age of occurrence of male pattern baldness and gensini and rentrop scores, which are important measures of presence and severity of cad . The potential interaction of male pattern baldness with cad warrants large - scale prospective studies.
The earliest concept of community health workers in the world came into existence from chinese barefoot doctors program and thailand village health volunteers and communicators.1,2 community health volunteers and community health workers are potential assets to deal with many maternal and child health (mch) problems in resource - limited settings . Community health volunteers from bangladesh demonstrated the good knowledge and management of childhood illness.35 the concept of female community health volunteer (fchv) program in nepal was introduced in 19881989.6,7 broadly, the chief goal of fchv program is to help in achieving national health goal through community involvement . Fchvs, the self - motivated cadres selected by local mother s group, address mch through promotional and preventive measures in conjunction with reducing child acute respiratory tract infections and diarrheal diseases and newborn care through curative measures . Fchvs are the major backbone in implementing public health programs, namely, family planning, safe motherhood, vitamin a supplementation, deworming, sick child care, and immunization . There are altogether 50,000 fchvs in nepal operating in each village development committee (vdc) under family health division, ministry of health.6,8 the major health challenges of nepal are life expectancy, infant, maternal, and under five mortality . High poverty, illiteracy, and geographical barrier are the key factors that affect the health status among nepalese.9 in nepal, according to nepal demographic and health survey, infant mortality rate is 45 per thousand and under five mortality rate is 54.5 per thousand . Similarly, maternal mortality ratio is 229 per hundred thousands live births and institutional delivery is 35.3%.10 there has been improvement in health indicators pertaining to mch, thanks to the active role of fchvs.11 the major responsibilities of fchvs delegated to them in delivering maternal health service delivery include counseling and advice during pregnancy, focusing on nutrition, antenatal care, immunization, iron and folate consumption, and postpartum visit . Similarly, in child health service delivery, they participate in delivering essential new born care (safe cord clamping, cord stump care, early breast feeding, and prevention of hypothermia), treating the child with acute respiratory tract infections, and early referral of the sick child . Assessing the knowledge and performance of health workers is essential; many countries focus on them as they are good assets for achieving the millennium development goals.12 various sociodemographic correlates determine the level of knowledge and performance of community health workers . Community health workers of higher age group have better performance on service delivery.13 female health workers of higher age group are established members of society and have already obtained enough exposures earlier . Community health workers who have obtained higher level of education outperform those who are illiterate.14 similarly, work experience as a health volunteer affects the level of knowledge and performance . Experienced ones outperform the nave ones.15 prior studies of ethiopia and nigeria, respectively, demonstrated work experience as a strong predictor of knowledge and practice toward tuberculosis control and injection safety among health workers.13,16 there is a synergistic effect of local nongovernmental organizations (ngos) and performance of community health workers . In nepal, mother and infant research activities (mira) is an ngo that conducts studies, launches interventions for improving maternal and infant health, and trains fchvs . An effective program of neonatal sepsis identification and management with collaboration of local ngos with community health volunteers has been reported in a previously published nepalese article.17 an analytical report on national survey of fchvs of nepal reported that the highest percentage of fchvs is in the age group 3039 years . About 62% of fchvs are literate, of which 42% have completed primary school or have ever gone to secondary education . Additionally, the same report highlighted that the fchvs had better knowledge of mch compared with rural women and performed better in terms of pregnancy counseling, and> 90% of them could provide essential newborn care.8 this study aims to highlight sociodemographic factors associated with knowledge and performance of fchvs in delivering mch services in rural nepal . A cross - sectional survey assessing knowledge and performance of fchv on mch services using a structured questionnaire was used in 16 vdcs of dhanusha district of nepal from the first of january to the end of february of 2014 . Among these 16 vdcs, the district was selected purposively because approximately all the indicators of mch service utilization in this district were found lower as compared to adjacent district and national figure.6,17,18 this was a cross - sectional study conducted among 138 fchvs working in 16 vdcs of dhanusha district of nepal . The sample size for this study was calculated by using a sample size calculator for finite population.19 there are 101 vdcs in dhanusha district and 909 fchvs working in rural area . Hence, the population size (n) is 909 . P is taken as 0.12 (proportion of fchvs in dhanusha who miscategorized infant weight in a trial by mira is 12%).20 the permissible margin of error in the estimated value was taken as 5% with degree of assurance as 95% confidence level . After entering all the values in the calculator, we obtained 134 fchvs as the sample size . Taking all the fchvs available during the survey in 16 vdcs, the total number of fchvs included in this study became 138 as the final sample . Dhanusha district of nepal was selected purposively . Out of seven primary health care centers (phccs) in dhanusha district, then, the list of vdcs in the selected phccs was obtained from the district public health office, dhanusha . Altogether, 16 vdcs (four from each phcc) were selected randomly to meet 138 fchvs . The outcome variables of the study were the knowledge and performance of fchvs on mch services . Assessment of knowledge and performance of fchvs on mch services was based on the several parameters of mch services that are obtained from maternal and newborn health counseling package jeevan suraksha developed by united states agency for international development, which has been adopted by the department of health services, ministry of health and population, government of nepal, national nutrition policy and strategy, and national fchv programme revised strategy of nepal.2123 assessment of knowledge of fchvs was assessed on the basis of the following ten major mch parameters recommended by the government of nepal (see supplementary materials): minimum number of antenatal care visit recommended;total number of iron / folic acid tablets to be consumed during pregnancy;dose for tetanus toxoid immunization;dose of deworming;presence of skilled birth attendants provides safe delivery;number of postnatal visits recommended by the government of nepal;number of iron tablets to be consumed postpartum;dose of vitamin a;number and time for child immunization; andadditional food intake required . Minimum number of antenatal care visit recommended; total number of iron / folic acid tablets to be consumed during pregnancy; dose for tetanus toxoid immunization; presence of skilled birth attendants provides safe delivery; number of postnatal visits recommended by the government of nepal; number of iron tablets to be consumed postpartum; number and time for child immunization; and additional food intake required . Assessment of performance of fchvs was on the basis of the following ten parameters of mch services recommended by the government of nepal: create community awareness to promote health and healthy behaviors;counsel pregnant women on antenatal visit and postnatal visit;counsel pregnant women for safe delivery (skilled birth attendants / institutional delivery);conduct regular mothers meeting;counsel pregnant women for additional diet;counsel postnatal mothers on breastfeeding, weaning, and growth monitoring;distribute condom, pills, oral rehydration solution packets, and vitamin a capsules;mobilize mother and children for immunization;refer complicated cases to health institution; andregular reporting of pregnancy to health facilities . Create community awareness to promote health and healthy behaviors; counsel pregnant women on antenatal visit and postnatal visit; counsel pregnant women for safe delivery (skilled birth attendants / institutional delivery); conduct regular mothers meeting; counsel pregnant women for additional diet; counsel postnatal mothers on breastfeeding, weaning, and growth monitoring; distribute condom, pills, oral rehydration solution packets, and vitamin a capsules; mobilize mother and children for immunization; refer complicated cases to health institution; and regular reporting of pregnancy to health facilities . One score (0 or 1) was assigned for each parameter by asking the respondents for their knowledge and performance regarding mch services . For knowledge, we assigned score 0 for each of the incorrect answer and score 1 for each of the correct answer . We assigned score 0 if there was no task performed by fchvs and score 1 if there was partial or full task performed by fchvs . As the score of these parameters ranged between 0 and 1, the sum of scores for all the parameters for each participant was calculated and taken as the level of knowledge and performance . If the correct answers were equal or more than the median score, the fchv s knowledge was considered, the knowledge was considered poor . Similarly, performance was considered satisfactory for equal and more than median scores and unsatisfactory for scores less than the mean.24 age of fchvs was categorized as <35 years, 3545 years, and> 45 years . Ethnicity / caste was based on the caste system in nepal and was divided into three major groups based on available literature and similarities between the caste / ethnic groups: advantaged / upper caste (brahmin, chhetri, and bhumihaar), middle caste (yadav, koiri, sudi / teli), and lower caste (dalit, janjati, mandal).25 religion was categorized as hindu and muslims / others (christian, boudha). Working experience as a health volunteer was recorded as <10 years and 10 years . Knowledge in terms of good and poor category and performance in terms of satisfactory and unsatisfactory category were taken as the dependent variables . Age, education, caste, religion, work experience as a health volunteer, and place of residence at mira working area were taken as explanatory variables . The association between independent variables and the level of knowledge and performance were examined using chi - square () test in univariate analysis . Then, the effect of each of the explanatory variables was adjusted for all other variables together in a multivariable logistic regression model . This study obtained the ethical approval from the institutional review board of banarus hindu university, india, and written approval letter was obtained from district health office, janakpur . The aims and objectives of the study a cross - sectional survey assessing knowledge and performance of fchv on mch services using a structured questionnaire was used in 16 vdcs of dhanusha district of nepal from the first of january to the end of february of 2014 . Among these 16 vdcs, the district was selected purposively because approximately all the indicators of mch service utilization in this district were found lower as compared to adjacent district and national figure.6,17,18 this was a cross - sectional study conducted among 138 fchvs working in 16 vdcs of dhanusha district of nepal . The sample size for this study was calculated by using a sample size calculator for finite population.19 there are 101 vdcs in dhanusha district and 909 fchvs working in rural area . Hence, the population size (n) is 909 . P is taken as 0.12 (proportion of fchvs in dhanusha who miscategorized infant weight in a trial by mira is 12%).20 the permissible margin of error in the estimated value was taken as 5% with degree of assurance as 95% confidence level . After entering all the values in the calculator taking all the fchvs available during the survey in 16 vdcs, the total number of fchvs included in this study became 138 as the final sample . Dhanusha district of nepal was selected purposively . Out of seven primary health care centers (phccs) in dhanusha district, four phccs were randomly selected . Then, the list of vdcs in the selected phccs was obtained from the district public health office, dhanusha . Altogether, 16 vdcs (four from each phcc) were selected randomly to meet 138 fchvs . The outcome variables of the study were the knowledge and performance of fchvs on mch services . Assessment of knowledge and performance of fchvs on mch services was based on the several parameters of mch services that are obtained from maternal and newborn health counseling package jeevan suraksha developed by united states agency for international development, which has been adopted by the department of health services, ministry of health and population, government of nepal, national nutrition policy and strategy, and national fchv programme revised strategy of nepal.2123 assessment of knowledge of fchvs was assessed on the basis of the following ten major mch parameters recommended by the government of nepal (see supplementary materials): minimum number of antenatal care visit recommended;total number of iron / folic acid tablets to be consumed during pregnancy;dose for tetanus toxoid immunization;dose of deworming;presence of skilled birth attendants provides safe delivery;number of postnatal visits recommended by the government of nepal;number of iron tablets to be consumed postpartum;dose of vitamin a;number and time for child immunization; andadditional food intake required . Minimum number of antenatal care visit recommended; total number of iron / folic acid tablets to be consumed during pregnancy; dose for tetanus toxoid immunization; presence of skilled birth attendants provides safe delivery; number of postnatal visits recommended by the government of nepal; number of iron tablets to be consumed postpartum; number and time for child immunization; and additional food intake required . Assessment of performance of fchvs was on the basis of the following ten parameters of mch services recommended by the government of nepal: create community awareness to promote health and healthy behaviors;counsel pregnant women on antenatal visit and postnatal visit;counsel pregnant women for safe delivery (skilled birth attendants / institutional delivery);conduct regular mothers meeting;counsel pregnant women for additional diet;counsel postnatal mothers on breastfeeding, weaning, and growth monitoring;distribute condom, pills, oral rehydration solution packets, and vitamin a capsules;mobilize mother and children for immunization;refer complicated cases to health institution; andregular reporting of pregnancy to health facilities . Create community awareness to promote health and healthy behaviors; counsel pregnant women on antenatal visit and postnatal visit; counsel pregnant women for safe delivery (skilled birth attendants / institutional delivery); conduct regular mothers meeting; counsel pregnant women for additional diet; counsel postnatal mothers on breastfeeding, weaning, and growth monitoring; distribute condom, pills, oral rehydration solution packets, and vitamin a capsules; mobilize mother and children for immunization; refer complicated cases to health institution; and regular reporting of pregnancy to health facilities . One score (0 or 1) was assigned for each parameter by asking the respondents for their knowledge and performance regarding mch services . For knowledge, we assigned score 0 for each of the incorrect answer and score 1 for each of the correct answer . We assigned score 0 if there was no task performed by fchvs and score 1 if there was partial or full task performed by fchvs . As the score of these parameters ranged between 0 and 1, the sum of scores for all the parameters for each participant was calculated and taken as the level of knowledge and performance . The median for knowledge and performance if the correct answers were equal or more than the median score, the fchv s knowledge was considered satisfactory for equal and more than median scores and unsatisfactory for scores less than the mean.24 age of fchvs was categorized as <35 years, 3545 years, and> 45 years . Ethnicity / caste was based on the caste system in nepal and was divided into three major groups based on available literature and similarities between the caste / ethnic groups: advantaged / upper caste (brahmin, chhetri, and bhumihaar), middle caste (yadav, koiri, sudi / teli), and lower caste (dalit, janjati, mandal).25 religion was categorized as hindu and muslims / others (christian, boudha). Working experience as a health volunteer was recorded as <10 years and 10 years . Knowledge in terms of good and poor category and performance in terms of satisfactory and unsatisfactory category were taken as the dependent variables . Age, education, caste, religion, work experience as a health volunteer, and place of residence at mira working area were taken as explanatory variables . The association between independent variables and the level of knowledge and performance were examined using chi - square () test in univariate analysis . Then, the effect of each of the explanatory variables was adjusted for all other variables together in a multivariable logistic regression model . This study obtained the ethical approval from the institutional review board of banarus hindu university, india, and written approval letter was obtained from district health office, janakpur . The aims and objectives of the study in a total of 138 fchvs, three - quarters of them (76.9%) were> 35 years of age . Majority of them had more than secondary and above level of education (61.6%), believed in the hindu religion (79.0%), work experience as volunteer 10 years (65.2%), and area of residence non - mira area (62.3%). The unadjusted odds ratio shows that all the sociodemographic variables of the fchvs were associated with good knowledge of mch services except the religion . However, only the age, educational level, and area of residence where mira is working were associated with satisfactory level of performance on mch care services (table 1). The multiple logistic regression analysis was employed to analyze the factors associated with knowledge and performance of fchvs on mch services (table 2). Adjusting for significant variables associated with knowledge and performance and within - cluster effect, level of education and area of residence where mira is working were significantly associated with both the knowledge and the performance of fchvs . Fchvs who had education level secondary and above were likely to have good knowledge (adjusted odds ratio [aor] 5.2; 95% confidence interval [ci] 2.212.2) and satisfactory performance (aor 8.9; 95% ci 3.224.3) on mch services than only literate and primary level of education . Fchvs who were residing in mira working areas were more likely to have good knowledge (aor 3.7; 95% ci 1.58.8) and satisfactory performance (aor 9.0; 95% ci 3.522.6) on mch services than those who were residing beyond mira working areas . The result also revealed that middle caste fchvs were more likely to have good knowledge (aor 3.3; 95% ci 1.010.3) on mch services than upper and lower caste . In a total of 138 fchvs, three - quarters of them (76.9%) were> 35 years of age . Majority of them had more than secondary and above level of education (61.6%), believed in the hindu religion (79.0%), work experience as volunteer 10 years (65.2%), and area of residence non - mira area (62.3%). The unadjusted odds ratio shows that all the sociodemographic variables of the fchvs were associated with good knowledge of mch services except the religion . However, only the age, educational level, and area of residence where mira is working were associated with satisfactory level of performance on mch care services (table 1). The multiple logistic regression analysis was employed to analyze the factors associated with knowledge and performance of fchvs on mch services (table 2). Adjusting for significant variables associated with knowledge and performance and within - cluster effect, level of education and area of residence where mira is working were significantly associated with both the knowledge and the performance of fchvs . Fchvs who had education level secondary and above were likely to have good knowledge (adjusted odds ratio [aor] 5.2; 95% confidence interval [ci] 2.212.2) and satisfactory performance (aor 8.9; 95% ci 3.224.3) on mch services than only literate and primary level of education . Fchvs who were residing in mira working areas were more likely to have good knowledge (aor 3.7; 95% ci 1.58.8) and satisfactory performance (aor 9.0; 95% ci 3.522.6) on mch services than those who were residing beyond mira working areas . The result also revealed that middle caste fchvs were more likely to have good knowledge (aor 3.3; 95% ci 1.010.3) on mch services than upper and lower caste . Previously published research articles on fchvs highlighted the detection and management of low - birth weight babies, early pregnancy detection, and use of fchvs for childhood illness from user perspectives.20,26,27 our study demonstrated that knowledge and performance of fchvs on mch services are affected by selected sociodemographic factors in rural nepal . Increased level of education among fchvs and their area of residence where mira is working are significantly associated with good knowledge and satisfactory performance on mch services . Fchvs who had attained higher educational level were more likely to have sound knowledge and satisfactory performance, which could be attributed to contribution of school health curriculum and enhancement of service delivery skills with increasing educational level . Contrarily, a study done in india revealed that overqualified (with higher education) community health workers are less interested in field - based work and had lower performance level.28 however, this is consistent with one of the major findings of the kenyan study that demonstrated that the higher level of education of community health workers was associated with better performance of maternal health services.14 additionally, the finding in this study is similar with nigerian and bangladeshi studies.29,30 mira, an ngo working for capacity improvement of fchvs in dhanusha district of nepal, might influence the better knowledge and performance on mch services.17 for the better performance of mch service delivery in rural nepal, therefore, more focus is needed on upgrading the level of education and engaging the development partners that can assist in improving fchvs knowledge and performance . This study has strengths as it has identified some predictors on knowledge and performance of fchvs on mch services in rural nepal based on primary data . As this cross - sectional study covered only a small area of southern terai, nepal, the findings cannot be generalized to whole fchvs existing in nepal . Level of education and area of residence of fchvs where an ngo is working influenced positively the knowledge and performance of mch services . The study recommends considering level of education while recruiting rural fchvs and capacity enhancement through additional training and development programs in collaboration with developmental partners . Survey questionnaire . Abbreviations: vdc, village development committee; mch, maternal and child health; fchv, female community health volunteer . Abbreviations: mira, mother and infant research activities, ifa, iron and folic acid; tt, tetanus toxoid; sba, skilled birth attendants; gon, government of nepal; ors, oral rehydration salt; dk, do not know; anc, antenatal care.
Thirty - three eyes of 33 patients who underwent implantation of pc iols into the ac between may 2006 and july 2008 were evaluated retrospectively . Fourteen eyes had inadequate support due to posterior capsular rupture during phacoemulsification, and 19 eyes were previously aphakic . The procedures were performed under topical or subconjunctival anesthesia . If the remaining capsular support was considered to be insufficient for iol implantation during phacoemulsification, an anterior vitrectomy was performed and acetylcholine was injected into the ac for miosis . The vacuum level of the vitrectomy was set to 200 mmhg and the frequency to 50 cuts / min . Two iridectomies were performed on the midperipheral iris with a vitrectomy cutter at the 7 and 1 oclock positions . The iols were implanted in the ac with the haptics passing through the iridectomies to the pc . The first five patients received polymethylmethacrylate (pmma) iols (aurolab, madurai, tamil nadu, india), while single piece foldable iols (ocuva, vsy, istanbul, turkey) were implanted in the remaining 28 patients . (a) intraoperative posterior capsule rupture and desantralization of the sulcus - fixated iol . (d - f) using the same probe at 50 - 100 mmhg vacuum, two iridectomies were created at the 1 and 7 oclock positions . (g and h) iol haptics were implanted into the iridectomies using a dialer with the aid of ocular viscoelastic substance . (i - o) suturation of the inferior and superior iol haptics to the iris using mccunnel's technique the procedures were performed under topical or subconjunctival anesthesia . If the remaining capsular support was considered to be insufficient for iol implantation during phacoemulsification, an anterior vitrectomy was performed and acetylcholine was injected into the ac for miosis . The vacuum level of the vitrectomy was set to 200 mmhg and the frequency to 50 cuts / min . Two iridectomies were performed on the midperipheral iris with a vitrectomy cutter at the 7 and 1 oclock positions . The iols were implanted in the ac with the haptics passing through the iridectomies to the pc . The first five patients received polymethylmethacrylate (pmma) iols (aurolab, madurai, tamil nadu, india), while single piece foldable iols (ocuva, vsy, istanbul, turkey) were implanted in the remaining 28 patients . (a) intraoperative posterior capsule rupture and desantralization of the sulcus - fixated iol . (d - f) using the same probe at 50 - 100 mmhg vacuum, two iridectomies were created at the 1 and 7 oclock positions . (g and h) iol haptics were implanted into the iridectomies using a dialer with the aid of ocular viscoelastic substance . (i - o) suturation of the inferior and superior iol haptics to the iris using mccunnel's technique the mean age of the 16 men and 17 women was 56.3 12.2 years . Fourteen eyes had inadequate posterior capsular support due to posterior capsular rupture during phacoemulsification and underwent primary iol implantation . Nineteen eyes that had previously been left aphakic for various reasons underwent secondary iol implantations . Mild corneal edema, which resorbed in 5 - 7 days, was detected in eight of 14 patients with primary iol implants . Pupillary block developed in two of the first five patients who had received a pmma iol, and neodymium - doped yttrium aluminum garnet (nd: yag) laser iridotomies were performed to relieve the block in these eyes . One of the patients with a pmma iol presented with dislocation of the haptic into the ac . The haptic was resutured to the iris with a 10/0 nylon suture for this patient . None of the patients had longlasting corneal edema, iris atrophy, uveitis, corneal contact with iol, or retinal detachment during the follow - up period . Pigment dispersion was seen in four patients; however, we did not document any pigmentary glaucoma . While mild guttata was seen in five eyes during the follow - up period, none of the eyes had corneal decompensation . A marked increase in visual acuity was observed in the patients with posterior capsular rupture during surgery compared to the preoperative levels (20/50 versus 20/25), while visual acuity increased moderately from 20/40 to 20/30 in those who were previously aphakic and underwent secondary iol insertion . Posterior capsular rupture is also a well - known intraoperative complication of cataract surgery . In the presence of a posterior capsular tear, an iol can be placed in the sulcus if the capsular rim is available, or in the bag if the tear is small . If the remaining capsule does not offer sufficient support for the iol implantation, the surgeon may choose one of following options: ac iol, iris - claw iol, iris - sutured iol, pc iris - sutured iol, sutureless iol with iris anchors, or scleral - fixated lol . Ac iols and scleral - fixated iols are generally recommended when capsular support is insufficient or absent . Complications associated with ac iols, including postoperative inflammation, pupillary transformation, glaucoma, and the loss of corneal endothelial cells have been reported . Even though there is no contact between scleral - fixated iols and the fine structures of the ac angle and corneal endothelium, these iols also have some drawbacks, which limit their usage . Recently, totan and karadag reported sutureless scleral fixation of a three - piece foldable iol using 25-gauge transconjunctival sutureless vitrectomy trocars in patients with insufficient posterior capsule support . Iris - claw iols may be a good alternative, however higher costs limit their extensive usage . By implanting a pc iol in the ac through two iridectomies, the optics and haptics of the iol are placed in positions that are far from the corneal endothelium and the ac angle . We observed that patients had transparent corneas, centralized iols, and iol haptics that fitted into the iridectomies throughout the follow - up period . The number of patients with complications was very small, and the complications were negligible and not vision - threatening . We also found that primary iol implantations gave better postoperative visual results compared to secondary implantations . The main limitation of the study is the lack of availability of data associated with corneal endothelium pre- and postoperatively . We created the iridectomies at one and seven oclock positions 180 apart from the midperipheral iris ., iol dislocation may be due to large iridectomies, loose sutures or suture release, or the inappropriate positions of opposed iridectomies . However, iol dislocation in this technique can easily be overcome by resuturing the haptic into position . The surgical correction of an iol dislocation in our technique is less traumatic and complicated than that for sclera - fixated or posterior iris - fixated iols . This study suggests that this technique is a practical alternative that leads to favorable visual outcomes and minimized risk of complications in eyes without adequate capsular support . However, a long - term study on a large population is required to confirm these findings.
Tenofovir disoproxil fumarate- (tdf-) containing combination antiretroviral therapy (art) is currently considered a first - line regimen for hiv treatment and prevention of mother - to - child transmission (pmtct) option b / b+ by the world health organization (who). Tdf and the fixed - dose combination of emtricitabine (ftc) 200 mg and tdf 300 mg are also recommended by who for antiretroviral preexposure prophylaxis (prep) in key populations, including women in hiv - serodiscordant couples who may wish to conceive . Tdf is considered a pregnancy category b drug, which means that no adequate evidence of risk in humans has been established by the united states food and drug administration (fda). The fda recommends tdf as an alternative nucleotide analogue reverse transcriptase inhibitor (nrti) for hiv - infected antiretroviral - nave pregnant women due to limited data on tdf safety during pregnancy . Animal studies in macaques have found adverse effects of high - dose tdf during pregnancy on bone mineralization and intrauterine growth measured at birth, but these effects were not observed at lower doses, which are more consistent with human tdf use [58]. As art and pmtct option b / b+ programs expand and prep accessibility scales up, the likelihood of pregnant women using tdf will increase and obtaining safety information on tdf use during pregnancy will have important public health implications . Several studies [1020] and one systematic review reported that prenatal tdf use for hiv treatment generally appears to be safe for pregnancy outcomes . Additionally, the most recent report from the antiretroviral pregnancy registry showed no evidence of increased birth defects among 1,982 infants born to hiv - infected women in the united states who took tdf during their first trimester . Limited data are available on the safety of tdf use for prep in pregnancy, though small studies suggest no difference in birth outcomes between mothers with and without short - term prenatal prep use [22, 23]. However, few studies have assessed the effects of prolonged prenatal tdf use on postnatal infant growth and bone health, and these have mixed results [14, 18, 19, 24, 25]. Only one small study evaluated prolonged prenatal tdf use and infant growth outcomes in a sub - saharan african cohort indicating a need for additional data from this setting . Data from hiv - exposed uninfected (heu) infants could be particularly useful when assessing safety of prenatal tdf use for prep . We aimed to evaluate the relationship of prenatal tdf use and growth outcomes among heu infants born to mothers who used combination art for pmtct or hiv treatment during pregnancy in kenya . Data, from participants enrolled in two cross - sectional surveys evaluating the national pmtct program and maternal - child health (mch) indicators in kenya conducted between june and december 2013, were analyzed for this study . The first survey used probability proportionate to size sampling to select 121 mch clinics in seven of the eight geographical regions in kenya from which all mother - infant pairs were sampled to participate during a 5-day period per clinic . The second survey sampled only hiv - infected women attending 30 mch clinics in nyanza province during a fixed 10-day period . In total, 140 clinics were sampled as some clinics were selected for both surveys . Women were eligible to be included in the survey if they were willing and able to provide informed consent and their infant was attending clinic to receive week 6 or month 9 immunizations . Infants were excluded if they were brought to the clinic by someone other than their biological mother or informed consent from their mother was not provided . At enrollment into both surveys, a nurse administered the study questionnaire and obtained anthropometric measurements of the mother and infant . Hiv status during pregnancy and timing of hiv diagnosis were confirmed using mch booklets, a form of clinical records used in kenya which documents mch and hiv services received in pre-/postnatal care . All mothers identified as hiv - infected were offered infant hiv testing and a dried blood spot (dbs) sample was taken for hiv dna pcr testing after consent . All infants with pcr - confirmed hiv - negative serostatus and complete anthropometric measurements born to hiv - positive mothers with documented use of 3-drug combination art during pregnancy were included in this analysis . Data on infant birth and medical characteristics was also collected . Maternal body mass index (kilograms / meters) was calculated from height and weight measurements ascertained by study nurses at questionnaire administration . Data were abstracted from mch booklets if mothers were not sure of art regimen used during pregnancy, who clinical stage, last cd4 count, infant birth weight, or gestational age at birth . Trimester of art initiation was calculated using the date of art initiation and infant birth date, as documented in mch booklets . All mothers with confirmed art initiation prior to pregnancy were considered to have first trimester art use . Maternal prenatal tdf use was defined as a documented use of tdf - containing art regimen for any amount of time during pregnancy . Trained study nurses obtained standardized anthropometric measurements from each infant, including length in centimeters (cm), weight in kilograms (kg), and head circumference in cm . Z - scores for weight - for - age (waz), weight - for - length (wlz), length - for - age (laz), and head circumference - for - age (hcaz) were calculated using the who child growth standards in who anthro software [27, 28]. All hiv - infected mother - heu infant pairs with information on prenatal 3-drug combination art regimen type and anthropometric measurements were included in this analysis; hiv - infected mothers without information on art regimen type and verification from their mch booklets were excluded . Chi - squared tests for proportions and kruskal - wallis tests for continuous measures were used to detect differences in sociodemographic and medical characteristics among mother - infant pairs with and without prenatal tdf use . Growth outcomes among heu infants with and without maternal prenatal tdf use were compared using t - tests and multivariate linear regression for continuous measures of weight (kg), length (cm), head circumference (cm), waz, wlz, laz, and hcz . Characteristics associated with growth faltering, defined as waz, wlz, laz, and hcz <2 standard deviations (sd), were assessed using chi - squared tests and multivariate logistic regression . All linear and logistic regression models accounted for clustering at the clinic level . We determined a priori to adjust our statistical models for maternal age, education level, bmi, time since hiv diagnosis, and infant breastfeeding and gestational age at birth due to the known associations of these factors with tdf use or infant growth outcomes [2932]. Additionally, we identified several demographic, behavioral, and medical characteristics to assess as potential confounders: who clinical stage, number of living children, marital status, marriage type (monogamous versus polygamous), enrollment site in nyanza (a culturally distinct region with high hiv prevalence), ever having received cd4 testing, last cd4 count (cell/l) during pregnancy, and trimester of first combination art regimen use during pregnancy and protease inhibitor- (pi-) containing art regimen (versus no pi). Additional potential confounders were included in the final models if they substantially changed the logistic regression model odds ratio or linear regression coefficient (> 10% change). Multivariate risk scores were used to simultaneously adjust for maternal age, maternal education level, breastfeeding, gestational age at birth, time since maternal hiv diagnosis, maternal who clinical stage, timing of art initiation (before or during pregnancy), and trimester of first use of 3-drug combination art regimen during pregnancy and pi - containing art regimen in final models . Multivariate risk scores were used to impute missing data for adjustment in multivariate models . The validity and details regarding this approach have been described elsewhere [33, 34]. These scores were included in the final models as quintiles . To examine our statistical models with the most precision for first trimester 3-drug combination art exposure, we restricted our dataset to only mother - infant pairs with documented art initiation prior to pregnancy . Current who child growth standards calculate age and sex - adjusted z - scores based on infants born> 37 weeks of gestation and therefore potential nondifferential z - score misclassification may occur in preterm infants (gestational age <37 weeks). To examine the robustness of our multivariate regression models without the effect of prematurity, we repeated the primary analysis restricted to infants born> 37 weeks of gestation . We also repeated the primary analysis using indicator variables for missing values to account for the potential categorical effect of missing data . Data were analyzed using stata 13.1/mp for windows (stata corporation, college station, tx). The study was approved by the institutional review boards of the 3 collaborating institutions including the kenya medical research institute, the university of washington, and the us centers for disease control and prevention . A total of 277 hiv - infected mothers and their heu infants (56% of all heu infants in both surveys) had documented 3-drug combination art use during pregnancy that met criteria for inclusion in this analysis; 155 (56%) attend 6-week infant immunizations; 122 (44%) attend 9-month infant immunizations . Most mothers were married (84%), the median age was 29 years (interquartile range (iqr) 2534), and the median time since hiv diagnosis was 8 years (iqr 58). Over half of the mothers (64%) initiated 3-drug combination art before pregnancy and 89 (32%) used a tdf - containing regimen at any time during pregnancy . Among mothers that did not use tdf - containing regimens, the most common combination art was zidovudine, lamivudine, and nevirapine (azt/3tc / nvp) (78%) followed by stavudine, lamivudine, and nevirapine (d24/3tc / nvp) (8%). Tenofovir, lamivudine, and nevirapine (tdf/3tc / nvp) and tenofovir, lamivudine, and efavirenz (tdf/3tc / efv) were the most common regimens among mothers who used tdf - containing art (65% and 26%, resp . ). Mothers with and without prenatal tdf use had similar sociodemographic characteristics (table 1). Compared to mothers without prenatal tdf use (n = 188), mothers with prenatal tdf use (n = 89) were more likely to receive pis (26% versus 7%, p <0.001), were more likely to be who clinical stage iii (14% versus 6%, p = 0.030), and had modestly lower median bmi (22 versus 23, p = 0.031). There was no difference in median time since art initiation between mothers with and without tdf use that initiated 3-drug combination art prior to pregnancy (42 versus 36 months, p = 0.654). Similarly, mothers with and without tdf use that initiated 3-drug combination art in pregnancy (n = 76) did not have a significant difference in median time since art initiation (6 versus 9 months, p = 0.809). Most infants were currently breastfeeding (87%) and half (51%) were male . Mean gestational age at birth was similar for infants with and without mothers that used tdf during pregnancy (37.8 weeks versus 38.1, p = 0.337). We did not detect differences in mean birth weight (3.0 kg versus 3.2 kg, p = 0.14) or prevalence of low birth weight <2.5 kg (10% versus 7%, p = 0.449) among infants with and without prenatal tdf exposure . We detected a modest difference in mean weight (4.3 kg versus 4.7 kg, p = 0.015, table 2) and waz (0.8 versus 0.4, p = 0.033) between infants attending 6-week visits with in utero tdf exposure compared to infants without exposure to tdf . 2 sd among infants attending 6-week visits (12% versus 7%, p = 0.288). There were no detectable differences for wlz (0.3 versus 0.6, p = 0.462), wlz <2 sd (10% versus 16%, p = 0.317), length (52.8 cm versus 53.0 cm, p = 0.766), laz (1.2 versus 1.2, p = 0.951), and laz <2 sd (37% versus 38%, p = 0.976). There were also no differences in head circumference among heu infants attending 6-week visits with and without prenatal tdf exposure . After adjustment for maternal age, maternal education, breastfeeding, gestational age at birth, time since maternal hiv diagnosis, maternal who clinical stage, timing of art initiation (before or during pregnancy), and trimester of first combination art regimen use during pregnancy and pi - containing art, we found no association between maternal prenatal tdf use and weight, length, and hc among infants attending 6-week visits (table 3): waz (adjusted coefficient (adj = 0.46, 95% confidence interval (ci): 0.93, 0.01, p = 0.057); wlz (adj . Coeff . = 0.30, 95% ci: 1.16, 0.56, p = 0.483); laz (adj . = 0.0, 95% ci: 0.83, 0.83, p = 0.992); hcz (adj . We also found no association between z - scores <2 sd and maternal prenatal tdf use for waz (adjusted odds ratio (aor) = 1.9, 95% ci: 0.5, 6.4, p = 0.321), wlz (aor = 0.6, 95% ci: 0.2, 1.9, p = 0.374), laz (aor = 1.0, 95% ci: 0.5, 2.1, p = 0.941), or hcz (aor = 2.1, 95% ci: 0.3, 16.1, p = 0.483). Because maternal bmi and maternal who stage were collinear, a separate multivariate model was constructed including all covariates except for who stage . The association between maternal prenatal tdf use and waz remained non - significant (adj . = 0.4, 95% ci: 0.9, 0.2, p = 0.192). Among infants receiving 9-month immunizations, we did not detect differences for any measure of weight between heu infants with or without mothers that used tdf during pregnancy (table 3): weight (8.1 kg versus 8.4 kg, p = 0.302); waz (0.6 versus 0.3, p = 0.306); waz <2 sd (18% versus 12%, p = 0.336); wlz (0.1 versus 0.4, p = 0.597); and wlz <2 sd (13% versus 9%, p = 0.431). Similarly, we did not detect differences between length or head circumference . Among infants attending 9-month visits, we found no association between weight, length, or hc growth indicators and whether or not mothers had used tdf during pregnancy after adjustment (table 3): waz (adjusted coefficient [adj . Coeff .] = 0.31, 95% ci: 0.97, 0.35, p = 0.349); wlz (adj . = 0.22, 95% ci: 1.19, 0.76, p = 0.655); laz (adj . = 0.35, 95% ci: 1.40, 0.71, p = 0.514); hc (adj . Coeff . Similarly, we did not find any association between z - scores <2 sd and maternal prenatal tdf use for waz (aor = 1.6, 95% ci: 0.6, 4.6, p = 0.378), wlz (aor = 1.6, 95% ci: 0.5, 5.9, p = 0.452), laz (aor = 1.9, 95% ci: 0.8, 4.5, p = 0.147), or hcz (aor = 1.3, 95% ci: 0.3, 5.3, p = 0.684). When substituting maternal bmi for maternal who stage, the association between maternal prenatal tdf use and waz remained non - significant (adj . When restricting our dataset to only mother - infant pairs with documented 3-drug combination art initiation prior to pregnancy (n = 176), we found that maternal prenatal tdf use was associated with a trend for lower absolute waz (crude coeff . = 0.59, 95% ci: 1.17, 0.02, p = 0.044), similar to our primary results . In adjusted models, we did not detect significant associations between maternal prenatal tdf use and any growth indicator, though our power to detect associations was reduced . To reduce the effect of potentially misclassified z - scores for preterm infants, we repeated the primary analysis excluding heu infants from the overall study population born 37 weeks of gestation (n = 63). Among heu infants attending 6-week visits born> 37 weeks of gestation (n = 91), we detected a modest difference in mean weight (4.4 kg versus 4.8 kg, p = 0.011) and mean waz (0.3 versus 0.8, p = 0.021) between those born to mothers with and without prenatal tdf use . = 0.5, 95% ci: 0.9, 0.04, p = 0.072) or waz <2 sd (aor = 2.0, 95% ci: 0.4, 10.2, p = 0.418) among heu infants born> 37 weeks of gestation . Results for length, hc, wlz, laz, and hcz excluding infants born <37 weeks of gestation did not have appreciable differences with those of the full study population for infants attending 6-week or 9-month visits (data not shown). Results using indicator variables for missing values to account for the potential categorical effect of missing data were similar to our primary results (data not shown). Given the increasing use of tdf for hiv treatment and biomedical prevention strategies in sub - saharan africa, further evaluation on postnatal effects of prenatal tdf use in this setting is crucial . While data on prep use in pregnancy accumulates, current data available from heu infants born to mothers on tdf - containing art regimens may potentially contribute to the growing safety profile of prolonged maternal prenatal tdf use on infant growth outcomes . In this study of heu infants in kenya, we found marginal differences in weight and waz between infants attending 6-week visits born to mothers with and without tdf use during pregnancy . After adjustment for sociodemographic and medical characteristics, prenatal tdf use was associated with a trend for modest decrease in weight or waz . We found no association of prenatal tdf use with length, wlz, laz, hc, or hcz among infants attending 6-week or 9-month visits . Our data contribute to the limited number of studies investigating safety of tdf on postnatal growth outcomes among sub - saharan african heu populations . Growth indicators, specifically height and haz, may provide important information on prenatal tdf use and infant bone health in settings where bone mineralization tests are not readily available . (2012), which examined a population (n = 182) of pcr - confirmed negative heu infants in uganda and zimbabwe, we did not find differences in height or haz among infants with and without maternal tdf during pregnancy . A larger cohort study (n = 2029) in the united states detected slightly lower infant length at 12 months of age between infants with and without in utero tdf exposure (laz 0.17 versus 0.03, p = 0.04). The long - term clinical relevance of this modest difference is not well understood . Who child growth standards, commonly used in clinical settings of kenya and other sub - saharan african countries, relate observed growth parameters (height, weight, hc, and middle upper arm circumference) to those expected in normal children according to percentiles using z - scores . However, current who child growth standards are calibrated for infants born> 37 weeks and do not account for growth trajectories of preterm infants which differ from term infants [28, 35]. Other studies investigating safety of tdf use during pregnancy have used alternative growth charts that account for gestational age at birth [24, 25]. However, these methods have not been validated in sub - saharan africa where who child growth standards are typically used . To our knowledge, this is the first study evaluating prenatal tdf use and growth outcomes among heu in africa to incorporate the potential effect of prematurity on postnatal growth outcomes . A systematic review and meta - analysis reported that 12% of infants in sub - saharan africa are born preterm . In our study, which included only infants born to hiv - infected mothers, ~24% of infants were born 37 weeks of gestation, similar to other studies of hiv - exposed infants in sub - saharan africa [37, 38]. Future evaluations of prenatal tdf use on infant growth outcomes in this setting should make analytic considerations for z - scores of preterm infants when accurate gestational age at birth information is available . Forthcoming international growth standards for weight, length, and head circumference by gestational age and sex developed by the intergrowth-21st project may be particularly useful for evaluating postnatal growth in settings with high prevalence of birth 37 weeks of gestation in africa . The relatively small sample size may have limited our power to detect statistical differences and associations, though most studies examining prenatal tdf use and growth outcomes have included fewer infants [14, 18, 19, 26]. As roll out of tdf as a first - line pmtct option b / b+ scales up and longitudinal data becomes available, larger prospective studies will remain important in evaluating the safety of prenatal tdf use . This limited our ability to precisely investigate the association between timing of in utero tdf exposure, fetal development, and subsequent growth outcomes . Data from future prospective studies that follow art or tdf nave women that initiate tdf use during pregnancy will be especially valuable as timing of tdf exposure as it relates to fetal bone development is not well understood . Our findings add to previous studies, indicating that prenatal tdf use appears to be safe compared to non - tdf - containing art regimens . More specifically, our study contributes to the very limited data available on safety of tdf use and growth outcomes in africa where tdf - containing regimens are expanding for hiv treatment and pmtct . Prep for hiv - uninfected women during pregnancy may have additional benefit in africa where maternal seroconversion during pregnancy and breastfeeding contributes significantly to the pediatric hiv burden . Further research on long - term effects of maternal prenatal tdf use, particularly from mothers using prep in pregnancy, is vital as tdf use rapidly scales up.
The heart consists of the cardiac muscle, vasculature, and to a lesser extent interstitial infiltrating cells . It is considered that the gene expressions are separately regulated in these tissue components under physiological and diseased conditions [1, 2]. Although the mrna expression analysis has been established in the whole myocardium, it is difficult to investigate the expression level of each tissue component . Recently, the laser microdissection (lmd) method has been developed to isolate specific microscopic regions from tissue samples and separately collect the specimens of interest, which enables us to selectively evaluate the mrna expression levels in targeted cell clusters in the tissues, especially in malignant tissues . The regions of interest are marked on the monitor of a vertical microscope and cut out by the laser beam under computer control . The isolated samples fall down into collecting tubes, which are subjected to quantitative real - time reverse - transcribed polymerase chain reaction (rt - pcr) or gene - chip / microarray assay . Thus, we sought to establish a method to selectively collect the muscular region and arterial region in myocardial sections using the lmd method . The mrna expression levels of maker genes specific for cardiac myocytes or vascular smooth muscle cells (vsmcs) were analyzed in the muscular and vascular samples, respectively, obtained from rat heart sections . The study protocol was reviewed and approved by the animal care and treatment committee of kurume university . Male wistar - kyoto rats (wky) and stroke - prone spontaneously hypertensive rats (shr - sp) were purchased from slc (shizuoka, japan) and housed under standard conditions of humidity, room temperature, and a 12: 12-hour dark - light cycles . They were provided with free access to tap water and chow . At 24 weeks, blood pressure was measured using a tail - cuff sphygmomanometer (mk-2000st, muromachi, tokyo, japan), as described previously . Thereafter, rats were anesthetized with intraperitoneal ketamine (50 mg / kg) and xylazine (10 mg / kg). Percentage of left ventricular fractional shortening was measured using an echocardiography equipped with a 10 mhz transducer (aloka, tokyo, japan) [58]. The next day, rats were euthanized with an overdose of pentobarbital (100 mg / kg, intraperitoneally). After the rats were perfused with ice - cold saline (4c) at 100 mmhg, the heart was removed . The left ventricle was snap - frozen in isopentane / dry ice, embedded in oct compound, and sectioned with cryostat . The cryosections (7 m in thickness) were mounted on ice - cold pen - slides (leica microsystems, wetzlar, germany). Fresh cryosections were fixed in rnase - free - ethyl acetate (acetic acid: ethanol = 1: 19) and stained with 0.05% toluidine blue dissolved in rnase - free distilled water . The regions of the cardiac muscle and intramyocardial arteries were identified based on microscopic observation and were separately isolated from the section using lmd6000 system (leica microsystems). To collect vascular samples, we consistently placed the laser cut line on the outside border of the medial vsmc layer (figure 1(a)). The isolated fragments were collected in the cap of an eppendorf tube (eppendorf japan, tokyo, japan) containing trizol reagent (life technologies japan, tokyo, japan). Muscular samples were dissected from the myocardium area without microscopically visible vasculatures and infiltrating cells (figure 1(b)). The vascular sample included 40 cross - sections of the intramyocardial arteries for each animal . The muscular fragments with a total of 6 10 m were collected in each animal . Total rna was purified using rneasy micro (qiagen, valencia, ca) according to the manufacturer's instructions . Electropherogram exhibited clear peaks for 18s and 28s ribosomal rnas in the purified rna samples (figure 2(a)). Rna was reverse transcribed using a high capacity rna - to - cdna kit (ge health care, waukesha, wi). Equal amount of the resulting cdna was subjected to real - time pcr using the taqman universal pcr master mix and a sequence detection system model 7700 (life technologies japan) [5, 9, 10]. Primer pairs and taqman probes for rat type b - natriuretic peptide (bnp), -smooth muscle actin (-sma), and -actin were obtained from ge health care . Good amplification plots for target genes were shown in the muscular and vascular samples (figure 2(b)). At 24 weeks of age, systolic blood pressure was 120.5 12.2 mmhg in wky (n = 5) and 252.5 16.7 mmhg in shr - sp (n = 3) (p <0.001). Percentage of left ventricular fractional shortening was 26.8 4.1% in wky (n = 5) and 29.8 5.2% in shr - sp (n = 3) (no significance). We present one example of real - time rt - pcr analysis in wky, which showed bnp mrna expression in the muscular samples, but not in the vascular samples (figure 3). Next, we compared the expression levels of bnp, a molecular marker of cardiac myocyte hypertrophy, between wky and shr - sp (figure 4). Shr - sp had a significantly greater bnp expression than wky in the muscular samples . Bnp mrna was not expressed in the vascular samples of wky and shr - sp . The present study demonstrated that the lmd method enabled us to selectively collect myocardium and intramyocardial arteries from the heart section . Selective sampling was verified because the expression of cardiac myocyte - specific gene marker, bnp, was detected exclusively in the muscular samples, whereas the vsmc - specific marker, -sma, was expressed only in the vascular samples . Moreover, hypertrophic gene upregulation, as assessed by bnp expression, was significantly greater in the muscular samples obtained from shr - sp than from wky . Recently, it has been reported that the lmd method is useful for selective sampling of the arterial component from the surrounding tissues, for example, the isolation of the arterial lesions in the lung specimen of patients with familiar pulmonary hypertension and the isolation of the collateral vessels in the ischemic hindlimb in mice . Also, the lmd method was used for selective sampling of the intimal plaques in the human atherosclerotic lesions [13, 14]. However, there have been few studies using the lmd method for gene expression analysis of the heart . Thus, we sought to establish the method to selectively collect muscular and vascular samples from the heart sections using the lmd method . As shown in figure 1(a), the intramyocardial arterioles were surrounded by thin loose connective tissue separating from the cardiac muscle tissue . Thus, the microscopic guidance allows us to easily isolate vascular samples . In this study, we successfully collected and analyzed the intramyocardial arteries with a diameter of approximately 50 m . This finding was in line with the previous studies demonstrating that relatively small vascular samples, such as intrapulmonary arteries at a size between 50 and 200 m and intrarenal arterioles with a diameter of approximately 100 m, were selectively isolated using the lmd method [16, 17]. In contrast, it was necessary that we consistently took a great care in isolating muscular samples by avoiding microscopically visible vessels and infiltrating cells . The mrna expressions of bnp and -sma were not detected in the vascular and muscular samples, respectively (figure 3). Moreover, the bnp mrna upregulation associated with cardiac hypertrophy was documented specifically in the muscular samples in shr - sp (figure 4). These findings suggested that the contamination of cardiac myocytes in the vascular samples or vsmcs in the muscular samples was negligible . In conclusion, the lmd method enabled us to separately collect the muscular and vascular samples from the myocardial sections and to selectively evaluate the mrna expression changes in individual tissue component.
The prevalence of obesity, defined as a body mass index (bmi) 30 mg / m, continues to increase in the united states . According to recent data, the prevalence is 33.8% for adults and the rate of morbid obesity (bmi 40 kg / m) is 5.7% . It is estimated that by 2015 more than 40% of the population will be obese . Consequences of endemic obesity include increased risk for cardiovascular disease, diabetes mellitus, cancer, several gastrointestinal disorders and overall mortality . The economic burden associated with obesity is significant, with nearly 10% of the 2002 united states health expenditures going toward care of the overweight and obese . Not surprisingly, with the increasing prevalence of obesity in the united states, more obese patients are being treated in the intensive care unit (icu). Although the forced vital capacity and forced expiratory volume in 1 second increase, functional residual capacity, vital capacity and total lung capacity are maintained . As a result morbid obesity is characterized by increased total blood volume and cardiac output at rest but a depressed ejection fraction and left ventricular contractility at rest and exercise . For example, a cardiac index in a 510 250-kg male patient with a cardiac output of 8 l / min is 2.16 l / min but it is 3.56 l / min in a 510 100-kg male also with a cardiac output of 8 l / min . If care is being titrated to cardiac index alone without considering the cardiac output the obese patient may experience adverse effects . Similarly, dosing of medications in obese patients can be problematic, particularly during critical illness . This is because distribution, metabolism, and protein binding may all be altered by the physiologic changes associated with obesity . Extrapolation of manufacturer dosing recommendations or standard guidelines designed for non - critically ill, non - obese patients can potentially lead to treatment failure or drug toxicity in the obese . Obese and morbidly obese patients have a larger blood volume than normal weight patients due to the additional vasculature required to perfuse the excess adipose tissue . Comparatively, the blood volume of adipose tissue is less than lean tissue . For medications, including unfractionated heparin (ufh), total drug required for therapeutic efficacy is dependent on the volume of distribution and the total blood volume . Medication dosing in obese patients can be further complicated by volume shifts associated with shock and resuscitation during critical illness . Obesity is a risk factor for venous thromboembolism and there seems to be an incremental risk with increasing bmi . Critically ill obese patients are among those at highest risk for morbidity and mortality of venous thromboembolism . Unfractionated heparin is a commonly used anticoagulant and many studies and guidelines support the dosing based on actual body weight . Unfortunately, few patients in published studies were obese or morbidly obese, and it is unclear whether actual or ideal body weight should be used to dose these patients . The development and modification of weight - based nomograms for ufh have lagged behind the rapid increase in the number of morbidly obese patients . Two retrospective studies have been recently published comparing dosing of ufh in obese, morbidly obese and non - obese patients . Bauer et al ., concluded there were no differences in proportion of first activated partial prothrombin time (aptt) measurements within goal range in obese patients receiving weight - based heparin dosing but the percentage of critically ill patients was not specified . Riney et al ., showed in a study of 273 hospitalized patients, (including 83 critically ill patients) that morbidly obese patients required smaller ufh rates compared to non - obese patients based on the infusion rate per kilogram of actual body weight at the time of the first therapeutic aptt . In our surgical icu since indexes and tidal volumes are based on ideal body weight it was discussed if ideal body weight should be used to dose continuous infusions of medications throughout the health system's icu . A point of disagreement was dosing of ufh, especially if there would be a difference in time to first therapeutic aptt . Based on the limited data available to guide ufh dosing in critically ill patients, this study was conducted to compare dosing rates of ufh in the critically ill with and without obesity . After approval from the institutional review board, a retrospective review of patients admitted to the surgical or medical icus at a tertiary care medical center receiving continuous ufh infusions for> 24 h between july and december 2007 was performed using clinical and pharmacy computer systems . Patients were considered non - obese if their bmi was between 20.0 - 29.9 kg / m, obese if bmi was between 30.0 - 39.9 kg / m and morbidly obese for bmi> 40.0 kg / m . Our protocol is to treat patients requiring ufh (without a bolus) based on actual body weight at an initial infusion rate of 16 units / kg / h if non - obese or 12 units kg / kg / h if obese or morbidly obese . The initial rates were chosen based on our institution's quality improvement evaluations of heparin . A standardized nomogram is used to achieve a goal aptt of 57 - 84 sec (normal range, goal aptt 1.5 - 2.5 normal) or 57 - 70 sec (low range, 1.5 - 2 normal, [table 1]). Patient charts were reviewed for demographics (age, gender, height, weight), indication for ufh, dosing information, laboratory values including aptt, and bleeding complications . Minor bleeding was defined as ecchymosis, epistaxis, hematoma, hematuria hemoptysis, petechiae or oozing . The primary endpoint was ufh dosage in units / h, unit / kg ideal body weight (ibw)/h and units / kg actual body weight / h at first therapeutic aptt and time to first therapeutic aptt . Secondary outcomes included achievement of steady state (defined as a three consecutive aptts in therapeutic range [aptt 57 - 84 sec for normal range or 57 - 70 sec for low range]), time to steady state, dosage at steady state aptt and percentage of aptts in the subtherapeutic, therapeutic and supratherapeutic ranges for each group . Continuous data were analyzed using anova for parametric data and kruskal - wallis test for non - parametric data . Parametric data are presented as mean standard deviation and non - parametric data are presented as median [25%-75% intraquartile range]. Categorical data were analyzed using fisher's exact test and are presented as frequency distributions . Sixty - two critically ill patients were included in analysis, 21 non - obese, 21 obese and 20 morbidly obese . Obesity did not seem to influence achievement of at least one therapeutic aptt (92%) or achievement of steady state (60%) [table 3]. Time to the first therapeutic aptt as well as time to steady state was also similar between groups . To determine what dosing strategy would be most effective at reaching a therapeutic aptt, total hourly dosages were evaluated along with actual and ideal weight - based dosages (calculated retrospectively). At the time of the first therapeutic aptt the mean total doses of ufh were significantly higher in obese patients (878 341 units / h non - obese, 1051 347 units / h obese, vs. 2007 648 units / h morbidly obese, p <0.001), suggesting an influence of weight . When dosing was corrected for weight using ideal body weight (ibw), there were similar statistically significant differences in these dosages (14.3 4.8 units / kg / h non - obese, 18.0 5.9 units / kg / h obese, vs. 30.1 8.4 units / kg / h morbidly obese, p <0.001). In contrast, when dosing using actual body weight there were no significant differences (13.5 4.0 units / kg / h non - obese, 11.7 4.5 units / kg / h obese, vs. 12.5 2.9 units / kg / h morbidly obese, p = 0.35). We next determined the influence of weight on ufh dose required to reach steady state . Similar to the first therapeutic aptt, the mean total ufh doses at steady state were statistically different between groups (1106 447 units / h non - obese, 1023 401 units / h obese, vs. 1915 594 units / h morbidly obese, p <0.001). When ufh dosing at steady state was corrected using ibw, the per kg doses remained significantly different (18.1 7.6 units / kg / h non - obese, 17.7 7.0 units / kg / h obese, 29.0 . Unlike dosing at first therapeutic aptt, correction of doses using actual body weight did not resolve the discrepancy in doses for achieving steady state (16.3 5.3 units / kg / h non - obese, 11.6 5.5 units / kg / h obese, vs. 11.1 1.2 units / kg / h morbidly obese, p = 0.01). Approximately half the aptt values measured were in the therapeutic range with 52% of cases targeting the lower range of aptt values [table 4]. The median proportion of aptts in the therapeutic range was 47% (17.5 - 64.5%) non - obese, 45% (33 - 66.5%) obese, and 60% (50 - 64%) for morbidly obese (p = 0.33). The median proportion of aptt values were subtherapeutic in 33% (12.5 - 55%) of non - obese, 19% (7.5 - 33%) of obese, and 17.5% (1.75 - 39.75%) of morbidly obese (p = 0.17), and the median proportion of aptts that were supratherapeutic were 20% (9 - 31.5%) non - obese, 33% (8.5 - 45.5%) obese and 20% (2.25 - 39.5%) morbidly obese (p = 0.43). Approximately 15% of all patients had an aptt greater than 180 sec including 23.5% non - obese, 9.5% obese and 15% of morbidly obese, p = 0.45 . No patients developed a major bleeding event and approximately 10% developed minor bleeding including 4.8% of non - obese, 9.5% of obese and 15% of morbidly obese, p = 0.57 . None of the patients that developed minor bleeding had an aptt value greater than 180 sec . In this study, similar outcomes were achieved in critically ill patients when heparin was dosed on actual body weight using our institutional nomogram . The initial heparin dose was 16 units / kg / h in the non - obese and 12 units / kg / h in the obese and morbidly obese . Appropriate dosing of weight - based medications, particularly ufh, continues to be a challenge in the morbidly obese, especially given the potential for adverse outcomes with both under- and overdosing . Unlike previous studies addressing ufh dosing in morbidly obese patients, this study focuses on ufh use in the critically ill . With its unpredictable pharmacokinetics, dosing of heparin in the critically ill may be difficult and may explain why approximately 60% of patients had three consecutive aptt values in goal range regardless of body mass index . In morbidly obese critically ill patients we found they required larger total ufh infusion rates (units / h) and rates based on ibw to achieve first therapeutic aptt and steady state which is not surprising since dosing of heparin is based on total blood volume which is increased in obesity . Conversely, we found no difference in dosages based upon actual body weight to achieve first therapeutic aptt . Based on these data, we decided to continue to dose continuous intravenous medication based on actual body weight . This is the first dedicated study to specifically look at dosing of ufh in critically ill obese patients . Most previous studies comparing the dosing of ufh in the obese to non - obese do not include the morbidly obese or focus only on the initial aptt values or the time to first therapeutic aptt value . In the first published study comparing dosing of ufh in 20 obese to 20 non - obese, the authors concluded that there was not a significant difference in the time to first target aptt, initial or final infusion rates between groups . The mean body weight of the obese group was 95 + 14.4 kg with only 6 patients weighing more than 100 kg, and the results may not be comparable to our study due to these differences in weight . In the largest study published to date of 1,054 patients, bauer et al ., concluded that there was no difference in proportion of the first aptts in goal range between groups . Barletta et al ., also concluded there was no difference in proportion of patients with therapeutic initial aptt in a retrospective study of 101 morbidly obese and non - morbidly obese patients treated with ufh . In the study by bauer et al ., all patients received a ufh bolus and statistically more of non - morbidly obese patients received a ufh bolus (95%) compared to the morbidly obese (79%, p = 0.018) in the study by barletta et al ., which may have confounded their results . The use of only the first aptt as an endpoint in both these studies may be more reflective of use of the bolus dose compared to continuous infusion dose . The results of our study are similar to the few studies that report data beyond the initial one or two aptt measurements . Riney et al ., prospectively examined 273 patients receiving ufh, including 83 critically ill patients where ufh was dosed based on actual body weight . The mean rate of ufh required to achieve the first therapeutic aptt and two consecutive aptts in goal range was significantly lower in those with a bmi greater than 40 kg / m . Dee et al ., published the results of their ufh dosing strategy in 55 patients where all patients received an 80 units / kg bolus (maximum bolus 10,000 units) followed by 18 units / kg / h except for those who were more than 50% of their ideal body weight where the initial rate was 15 units / kg / h . There were no differences between study groups with regards to the proportion of patients with at least one therapeutic aptt (primary endpoint) or time to therapeutic aptt . The results of both these studies are similar to ours in that patients with significant obesity had improved anticoagulation parameters with the use of a reduced initial dose based on actual body weight . At our institution, ufh was not bolused and dosing was based on actual body weight . Our results are similar to the studies by riney et al ., and dee et al ., suggesting that ufh should be based on actual body weight with lower initial dosages based on actual body weight . Many of the previously published studies have looked at the dosage at the first aptt usually drawn 6 h after initiation of ufh . Unfortunately, either all the patients or some of them were administered boluses which confounds the results at the first aptt . In the study by riney et al ., the mean times to first therapeutic aptt were similar if patients did or did not receive a bolus . These results are similar to our data where the mean time to first therapeutic aptt was 16.8 11 h in the morbidly obese, 20.8 11.6 h in the obese, and 17.2 14.1 h in the non - obese . In addition about half of the patients in this study achieved steady state which further decreases the evaluable population and the statistical power for this endpoint . Although weight is the most significant predictor, age, race, gender, renal function, tobacco use, indication and history of diabetes mellitus or thyroid disease may all potentially contribute to variability in ufh dosing, and these variables were not evaluated in this study . Finally, this study was conducted in a single institution with a specific ufh dosing protocol and results may not be applicable to other populations . Obese and morbidly obese critically ill patients required lower dosing of ufh based on actual body weight than non - obese critically ill patients . Dosing of ufh in morbidly obese and obese critically ill patients based on actual body weight and a reduced initial dose was associated with similar time to first therapeutic aptt and steady state . The initial rate of weight - based ufh should be reduced in obese and morbidly obese critically ill patients.
Retinitis pigmentosa (rp) is a heterogeneous group of inherited retinal disorders characterized by night blindness, constricted visual fields, abnormal color vision, and retinal degeneration . The prevalence of rp is approximately 1 per 4000 persons, with more than 1 million affected individuals existing worldwide . Rp patients show various inheritance patterns including autosomal recessive, autosomal dominant, x - linked, mitochondrial, and digenic inheritance . Autosomal dominant rp (adrp) makes up 30 to 40% of the overall rp cases, while mutations in the rhodopsin (rho) gene are responsible for about 25% of adrp cases found in caucasians . The rho gene has been mapped to the long arm of chromosome 3 (3p21 - 24) and encodes 348 amino acids . In 1990, the rho gene was first described in the literature as being the causative gene for adrp [5, 6]. While rhodopsin is a typical seven transmembrane g - protein - coupled receptor, a photon and not a molecular ligand is responsible for initiating the rhodopsin phototransduction cascade . When rhodopsin absorbs the photon, retinal chromophore (11-cis - retinal) changes to all - trans - retinal . The conformational changes that occur in rhodopsin result in the hyperpolarization of the rod cells, which play an important role in vision . Dominant (or heterozygous) rho mutations have been reported to show two different rp phenotypes, classic rp and sector rp [812]. Classic rp is a typical form of rp that is characterized by early - onset and diffuse / generalized retinal dysfunction, whereas sector rp is characterized by adult - onset and regionalized / sectorial retinal dysfunction [1315]. Sector rp, as originally described by bietti in 1937, is characterized by retinal degeneration that is limited to one or two quadrants of the fundus and slowly progression compared with classic rp [1315]. For example, there is a much lower frequency of rho mutations in japanese, chinese, and korean populations compared with european populations [1719]. Found rho mutations in 1/13 (7.7%) adrp japanese patients, whereas a separate study found that 43/150 (29%) adrp patients in north america had the rho mutations . Thus, rho mutations have not been considered a major cause of adrp in japanese patients . To date, only a small number of rho mutations have been reported in the japanese population [20, 2225]. In our current study, we used a whole - exome sequencing technique and identified two rho mutations in two japanese families with adrp, one (p.w126l) of which was novel . We additionally examined the impact of the p.w126l mutation on rhodopsin conformation by investigating the molecular modeling . The protocol of this study was approved by the institutional research board of the jikei university school of medicine and national hospital organization tokyo medical center . The protocol adhered to the tenets of the declaration of helsinki, and informed consent was obtained from all participants . Rp diagnosis was based on the visual field, fundus examination, and electroretinogram (erg) findings . Detailed ophthalmic examinations were conducted in the two families that exhibited the rho mutations (family 1: ju#0678 - 062jikei and family 2: ju#0575 - 037jikei) (figures 1(a) and 1(b)). These evaluations included decimal best - corrected visual acuity (bcva), slit - lamp, and fundus examinations, optical coherence tomography (oct) (cirrus hd - oct; carl zeiss meditec ag, dublin, ca), and fundus autofluorescence imaging (spectralis hra; heidelberg engineering, heidelberg, germany). Visual fields were assessed with kinetic goldmann perimetry (gp; haag streit, bern, switzerland). Full - field erg was performed according to the protocols of the international society for clinical electrophysiology of vision . Details of the methods and normal data have been reported previously . After obtaining venous blood samples from ten adrp patients, whole - exome sequencing was performed in all ten adrp patients using a previously described method . The obtained sequence data in the patients were compared with reference human genome sequences (1000 genomes phase 2 reference, hs37d5). Subsequently, we then focused on only the variants that could change the amino acid sequence, such as the nonsynonymous variants, splice acceptor, and donor site variants, and the short insertions and deletions . In the next step, we filtered the remaining variants using the criteria that the frequency of the variant had to be less than 1% in the databases of the 1000 genomes project (http://www.1000genomes.org) and the human genetic variation browser (http://www.genome.med.kyoto-u.ac.jp/snpdb/index.html). In the final step, we screened variants residing within the 212 retinal disease - associated genes listed in the retnet database that was last updated on march 10, 2014 (https://sph.uth.edu/retnet/). Sanger sequencing for rho mutations was conducted in two of the japanese families, which included probands and other family members (figures 1(a) and 1(b)). We used two primer pairs: a forward primer (rho-2f), 5-ctcctcaaatccctctcccactcct-3, and a reverse primer (rho-2r), 5-tcttctgccctacacccctaccctg-3 for exon 2, and a forward primer (rho-5f), 5-cgaacctcactaacgtgccag-3, and a reverse primer (rho-5r), 5-ggtcttggtggatgtcccttc-3 for exon 5 . The models for molecular dynamics (md) simulation were generated using two bovine rhodopsin / opsin crystal structures as the templates: the dark - adapted rhodopsin (protein data bank i d: 1u19, chain a) and the ligand - free form opsin (protein data bank i d: 3cap, chain a). To examine the impact of the p.w126l mutation on protein conformation, amino acids in these templates were replaced with the corresponding amino acids from the human sequence, thereby resulting in the wild - type (wt) models . The p.w126l models were generated from the wt models by changing the tryptophan at position 126 to leucine . All amino acid replacements were performed by using the simple mutate function of the coot software . The membrane environment was an artificially generated palmitoyl - oleoyl - phosphatidyl choline bilayer of approximately 120 molecules with a dimension of 80 80 . All of the models we developed were superposed onto each other so that each model was embedded in the artificial membrane at almost identical orientations . The protein - membrane system was then solvated with water containing 150 mm nacl . Md simulations were run by the not (just) another molecular dynamics program through the visual molecular dynamics interface using the following conditions: 1 fs per step, 100,000 steps (100 ps) for minimization, and 1,000,000 steps (1 ns), periodic boundary conditions and particle mesh ewald method, cut - off at 10, and switching at 9 . The calculations were carried out under a constant pressure and temperature ensemble at 310 k and 1 bar . A figure was prepared using the discovery studio visualizer software (accelrys inc ., san diego, ca). Patient ii-2 (a proband) was a 58-year - old man, who was referred to our hospital because of suspicion of rp . Bcva at his first visit to our hospital was 1.5 (with + 1.50 diopter (dpt), cylinder (cyl) 1.25 dpt axial (ax) 20) in his right eye and 0.7 (with + 1.50 dpt . No abnormalities were found except for slight senile cataracts in the anterior segments and media of both eyes . Fundus examination revealed retinal degeneration around the inferior vascular arcade in his right (figure 2(a)) and left eyes . The oct images showed marked thinning of the outer nuclear layer (onl) and disruption of the inner segment / outer segment (is / os) line, except for the foveal region of his right (figure 2(a)) and left eyes . Gp at a previous hospital showed depression of visual fields and an arcuate scotoma at the superior visual field in his right (figure 2(a)) and left eyes . Full - field erg showed that there were decreased amplitudes in the rod, standard combined, cone, and 30-hz flicker responses (figure 3(a)). The clinical findings of patient iii-1 were essentially similar to those found for patient ii-2 . 35) in her left eye . There were no abnormalities found in the anterior segments and media of either eye . Fundus examination revealed retinal degeneration in the nasal area of her right (figure 2(b)) and left eyes . The oct images showed marked thinning of the onl and disruption of the is / os line except for the foveal region of her right (figure 2(b)) and left eyes . Gp showed several isolated scotomas in her right (figure 2(b)) and left eyes . Full - field erg showed that there were decreased amplitudes in the rod, standard combined, cone, and 30-hz flicker responses (figure 3(b)). Patient ii-1 (a proband) was a 35-year - old woman referred to our hospital for assessment of a causative gene for her rp . Bcva was 0.7 (with no correction) in her right eye and 0.6 (with cyl . 30) in her left eye . There were no abnormalities found in the anterior segments and media of either eye . Fundus examination revealed diffuse retinal degeneration and intraretinal pigment deposits with a bone - spicule configuration around the vascular arcade to the periphery of her right (figure 2(c)) and left eyes . The oct images showed marked thinning of the onl and entire disruption of the is / os line in her right (figure 2(c)) and left eyes . Gp showed a ring - like defect in her right (figure 2(c)) and left eyes . Full - field erg showed that there were no responses in the rod, standard combined, and 30-hz flicker erg (figure 3(c)). Patient iii-1 was a 14-year - old boy, who was first found to have night blindness at 6 years of age . At the age of 11, a dark - adapted single flash erg performed at another hospital showed that there were reduced responses in both eyes (data not shown). 180) in his right eye and 1.0 (with + 7.00 dpt ., cyl . 1.50 fundus examination revealed retinal degeneration of the inferotemporal areas in his right (figure 2(d)) and left eyes . The oct images showed that there was marked thinning of the onl and disruption of the is / os line, except for the foveal region of his right (figure 2(d)) and left eyes . Gp showed constriction of visual fields with small scotomas in his right (figure 2(d)) and left eyes . A fundus autofluorescence image revealed a perifoveal hyperautofluorescent ring in his right (figure 2(e)) and left eyes . The obtained sequence data were analyzed in accordance with the filtering steps discussed in the material and methods section . Table 1 summarizes the remaining rare variants that were examined in families 1 and 2 . The analysis focused on the 212 retinal disease - causing genes that were listed in the retnet database . The two rho mutations revealed in the data, c.377g> t, p.w126l in exon 2 and c.1036g> c, p.a346p in exon 5, were found in the adrp patients of families 1 and 2, respectively . With the exception of these rho mutations, there were no other mutations found in the obtained sequence data for both families 1 and 2 that fulfilled the rp phenotype and autosomal dominant inheritance pattern conditions . The p.w126l mutation has not been previously reported in the literature and is not found in the dbsnp (http://www.ncbi.nlm.nih.gov/snp/), 1000 genomes database, or the hgmd (http://www.hgmd.org). On the other hand, the p.a346p mutation was previously reported to be the cause of adrp in one spanish family . We used in silico bioinformatics tools to investigate the impact of the p.w126l mutation on the rho function . Results of the polyphen-2 program generated a score of 0.999 (probably damaging), which was close to the maximum value of 1.00, while the sift program generated a score of 0 (damaging). For the cosegregation analysis, we investigated whether six of the family 1 members and four of the family 2 members had either the p.w126l or the p.a346p mutation . Our results revealed there was complete cosegregation of each mutation with the rp phenotype in each family (figures 1(a) and 1(b)). By using energy minimization and md simulations, we investigated the possible effects of the p.w126l mutation on the structure of the human opsin moiety that was represented by either the dark - adapted like (high affinity for 11-cis - retinal) or the light - adapted like (high affinity for all - trans - retinal) crystal structures . Although the simulation time was limited, all four models examined approached similar levels of equilibria . Because the mutation site w126 is located in the third transmembrane helix (tm3), we analyzed differences in the tm3 backbone and in the nearby helices . In the dark - adapted template, the extracellular and central regions of tm3 did not appear to move significantly during the simulation regardless of the type of side chain (w or l) at position 126 (figures 4(a) and 4(b)). This result corroborates the previous observation that the p.w126l mutation affected the 11-cis - retinal binding only marginally in cos-1 cells . Interestingly, in the light - adapted like template, the tm3 helix within the heptahelical bundle moved differently in the wt and the p.w126l mutant models during the 1 ns simulation (figures 4(c) and 4(d)). While the wt and the p.w126l mutant models exhibited only marginal changes in the tm3 during the first 300 ps of simulation (data not shown), this helix progressively tilted only in the p.w126l mutant during the subsequent 1 ns of simulation (figure 4(d)). Persistence of this tilting during longer periods may lead to a decrease in the distance between the cytoplasmic ends of tm3 and tm6 and may affect the signal - transduction properties of the protein . The residue l125, which is next to w126 in bovine rhodopsin, is in contact with a highly conserved phenylalanine in the middle of the tm6 at residue 261 . These side - chain interactions may therefore be critical for the ligand - induced activation of the rhodopsin - like g - protein - coupled receptors, similar to that which has been proposed for the 2-adrenergic receptor . In this study, we identified two rho mutations (p.w126l and p.a346p) as disease causes by using whole - exome sequencing in two japanese families with adrp . We additionally used molecular modeling to analyze the impact of the novel mutation (p.w126l) on the protein structure and function and then evaluated the genotype - phenotype correlations among japanese rp patients with heterozygous rho mutations . For the cosegregation analysis, further validation by sanger sequencing in other family members demonstrated there was complete cosegregation of each mutation with the rp phenotype (figures 1(a) and 1(b)). For the novel p.w126l mutation, the tryptophan residue at the position 126 is located in the tm3 and is highly conserved among orthologs in vertebrates (figure 1(c)). A biochemical experiment using reconstituted bovine rhodopsin has shown that an analog of 11-cis - retinal is cross - linked to the w126 residue . Our in silico study, which used the polyphen-2 and sift programs, predicted that the p.w126l mutation would cause severe damage to the rhodopsin . In addition, the results of our protein modeling and simulations (figure 4) suggest that the p.w126l mutation will likely affect the side - chain interaction between tm3 and tm6 in the light - adapted form but will not affect the interaction in the dark - adapted form . These molecular modeling and simulation findings suggest that the p.w126l mutation may impair rhodopsin function by affecting its conformational transition in the light - adapted form . This interpretation is in line with previous studies that have shown that p.w126l of bovine rhodopsin is less potent during g - protein activation . Thus, these results predict that the p.w126l mutation can affect the rho function, especially in the light - adapted form, thereby leading to the phenotype of rp . On the other hand, p.a346p has previously been reported to be an adrp - causing mutation in one spanish family . Both our cosegregation data for each family and the molecular modeling confirm that p.w126l is a disease - causing mutation . With regard to the phenotypes of our patients, the p.w126l (family 1) and p.a346p (family 2) mutations are likely to be associated with sector rp and classic rp, respectively . However, it should be noted that patient iii-1 (family 2) was not diagnosed with either classic or sector rp, as patient iii-1 exhibited an early stage of rp . The phenotypes of patient ii-1 (family 2) were similar to those previously reported for a patient of european descent who carried the p.a346p mutation and exhibited classic rp . These findings suggest that the p.a346p mutation might be associated with the phenotype of classic rp . When trying to diagnose classic or sector rp, it is highly important that one understands the severity and prognosis of rho - associated adrp . As compared to classic rp, sector rp is considered to be a less severe disease with subnormal erg and visual field defects that correspond to the affected sectors [13, 14]. In fact, it has been reported that sector rp is caused by a number of rho mutations, including p.t4k, p.n15s [3941], p.t17 m [33, 42], p.p23h, p.t58r, p.n78i, and g106r [11, 25, 44]. To the best of our knowledge, there have been nine rho mutations reported in the japanese adrp population [20, 2225, 32, 33, 41], with detailed phenotypes described in five (p.n15s, p.t17 m, p.g106r, p.e181k, and p.p347l) out of the nine mutations [20, 2325, 32, 33, 41]. Among these five rho mutations, one (p.p347l) exhibited classic rp while the other four (p.n15s, p.t17 m, p.g106r, and p.e181k) showed sector rp . Table 2 summarizes the clinical features that were described for the genotype - phenotype correlations of the seven japanese adrp families (including our families) with the seven rho mutations (p.n15s, p.t17 m, p.g106r, p.w126l, p.e181k, p.a346p, and p.p347l). Interestingly, patients with five other mutations (p.n15s [3941], p.t17 m [33, 42], p.g106r [11, 25, 44], p.a346p, and p.p347l [5, 32, 45]) were found to have phenotypes that were similar to japanese and other ethnic groups, although the clinical phenotypes for two other mutations (p.w126l and p.e181k [20, 21, 46]) could not be sufficiently evaluated [5, 11, 20, 21, 25, 3234, 3942, 4446]. These findings suggest that the location of each missense mutation is important for the purpose of predicting a diagnosis of either classic or sector rp and that there is a similarity of phenotypes between japanese and other ethnic group rp patients who have identical rho mutations . Report the phenotype - genotype correlations between adrp patients with rho mutations, revealing that patients with mutations altering the intradiscal domain near the n - terminal region (or a low - numbered codon) tended to have better visual function than patients with mutations altering the cytoplasmic domain near the c - terminal region (or a high numbered codon); patients with a mutation altering the transmembrane domain or a mid - numbered codon had intermediate function . Thus, identification of rho mutations appears to be useful for predicting the severity of the rp phenotypes and providing precise genetic counseling . In conclusion, we identified two rho mutations (p.w126l and p.a346p) in two japanese families with adrp . The genotype - phenotype correlations indicated that the location of the rho mutations is likely to determine the phenotype of either classic or sector rp . Identification of rho mutations is a very useful tool for predicting the disease severity and providing precise genetic counseling.
Out - of - hospital cardiac arrest is still a major public health issue, claiming hundreds of thousands of lives worldwide yearly . Bystander - initiated cardiopulmonary resuscitation (cpr) is essential to increase the chance of survival and neurological recovery . Despite huge efforts to train laypeople to recognize and treat cardiac arrest, incidence of bystander reluctance to perform mouth - to - mouth ventilation is one of the major reason . Whereas cpr including ventilation is still considered the gold standard approach before advanced life support can be instituted, a growing number of studies compared a simplified form of cpr, based on chest compression alone versus standard cpr including ventilation . Animal studies showed no difference in survival or even worse outcomes when ventilation was added to chest compressions; nevertheless, in animal models of cardiac arrest due to respiratory causes a positive effect of ventilations was demonstrated . In humans, observational studies of bystander - initiated cpr comparing standard and compressions - only cpr reported similar survival rates; however, interpretation of the results is made difficult due to the high heterogeneity of the causes of cardiac arrest and of the rescue characteristics . Chest compression - only cpr is simpler than standard cpr to teach (during courses but even by dispatchers under real conditions), and likely a higher percentage of bystanders would accept to perform it while avoiding mouth - to - mouth contact: the demonstration that it is (at least) as effective as standard cpr can be crucial to improve survival rate in out - of - hospital cardiac arrest . With the underlying hypothesis that out - of - hospital cardiac arrest bystander - initiated compression - only cpr is equivalent to cpr including ventilation (standard cpr), we performed a comprehensive systematic review and meta - analysis of randomized controlled trials, focusing on survival at hospital discharge . Pertinent studies were independently searched in biomedcentral, central, and pubmed (updated september 1, 2010) by several trained investigator . (cpr or resuscitation) and compression and breath * and cardiac and arrest and survival). Further hand or computerized searches involved the recent (2008 - 2010) conference proceedings from the international anesthesia research society, american heart association, american college of cardiology, american society of anesthesiology and european society of cardiology congresses . In addition, we employed backward snowballing (ie scanning of reference of retrieved articles and pertinent reviews) and contacted international experts for further studies . No language restriction was enforced, and non - english - language articles were translated when appropriate . References obtained from database and literature searches were first independently examined at the title / abstract level by several investigators with divergences resolved by consensus, and then, if potentially pertinent, retrieved as complete articles . The following inclusion criteria were employed for potentially relevant studies: a. random allocation to treatment; b. comparison of chest - compression - only versus standard cpr . The exclusion criteria were: a. non - parallel design (ie cross - over) randomized trials, b. duplicate publications (in this case only the article reporting the longest follow - up was abstracted); c. non - human experimental studies; two investigators independently assessed compliance to selection criteria and selected studies for the final analysis, with divergences finally resolved by consensus (table 1). Design features and appraisal of the internal validity of included studies . * data abstraction and study characteristics baseline and outcome data were independently abstracted by several investigators with divergences resolved by consensus (table 2). The primary end - point of the present review was survival (hospital discharge). Overall characteristics of 3737 patients who received either compression - only (1852 patients) or standard - cpr (1895 patients) for out of hospital cardiopulmonary resuscitation . Internal validity assessment the internal validity of included trials was appraised according to the cochrane collaboration methods, ie judging the risk for selection bias (ie the bias due to the unbalanced enrolment of specific patient subsets in one of the groups), performance bias (ie the bias due to differences in the management of patients or ancillary treatment, beyond the intervention object of randomized allocation), attrition bias (ie the bias due to incomplete follow - up or different length of follow - up), or difference in number of withdrawals), and reporting bias (difference between reported and unreported findings), and expressed as low risk of bias (a), moderate risk of bias (b), high risk of bias (c), or incomplete reporting leading to inability to ascertain the underlying risk of bias (d). In addition, allocation concealment explicitly distinguished as adequate (a), unclear (b), inadequate (c), or not used (d) (table 1). Two independent and experienced reviewers (gl, gb - z) appraised study quality, with divergences resolved by consensus . Data analysis and synthesis binary outcomes from individual studies were analyzed in order to compute individual risk ratios (rr) with pertinent 95% confidence intervals (ci), and a pooled summary effect estimate was calculated by means of a fixed effects model . Statistical heterogeneity and inconsistency was measured using, respectively, cochrane q tests and i. the risk of small study bias was not assessed given the inclusion of 3 studies only . Computations were performed with revman 5.0 (the cochrane collaboration, copenhagen, denmark). Database searches, snowballing and contacts with experts yielded a total of 32 citations (figure 1). Excluding 29 non - pertinent titles or abstracts, we retrieved in complete form and assessed according to the selection criteria 3 studies . Which were included in the final analysis . Study characteristics the 3 randomized controlled studies included 3737 patients (1895 to chest - compression - only and 1842 to the standard cpr group) (table 2). All studies were performed in non - traumatic out of hospital patients and stated that the updated international basic life support and advanced life support guidelines were strictly followed . All studies were of high quality (table 1) as testified by the details on the method used for randomized sequence generation and allocation, adequate allocation concealment and low risk of selection, performance, attrition and detection bias . One study employed a multicenter design, a feature which does not strictly impact on internal validity, but usually increases external validity of a trial . Quantitative data synthesis overall analysis showed that, in comparison to standard cpr, chest - compression - only was associated to increased survival at hospital discharge (211/1842 [11.5%] vs 178/1895 [9.4%], rr=1.24 [1.01 - 1.54], p=0.04) (figure 2). Forest plot for the comparison of standard cpr vs compression - only cpr on hospital survival after cardiopulmonary resuscitation . Similar results were obtained at sensitivity analyses using random - effect methods or risk differences (all p<0.05). Only one study considered the favourable neurological outcome suggesting better outcome in clinical subgroups of patients receiving chest - compression - only . Available evidence from randomized controlled trials strongly supports the superiority of bystander - initiated compression - only cpr, given that patients who experienced out - of - hospital cardiac arrest could be saved by limiting cpr to chest compression . These results are crucial to significantly improve the first response to out - of - hospital cardiac arrests, a worldwide major public health problem . Previous findings from observational studies in humans documented that spontaneously performed (i.e., not dispatcher instructed) compression - only cpr was as effective as standard cpr . In the sos - kanto study, including witnessed cardiac arrests, compression - only cpr resulted in a higher proportion of patients with a favourable neurological outcome than standard cpr in patients with apnoea, shockable rhythm and resuscitation started within 4 minutes; ventilations did not add benefits in any subgroup . On the contrary, two recent nationwide observational studies conducted in japan concluded that standard cpr should be preferred in out - of - hospital cardiac arrests of noncardiac origin, both in adults and in children; in this group, the two cpr techniques were similarly effective for arrests of cardiac origin . Among the tree randomized controlled studies included in this meta - analysis, only one study included paediatric patients <8 years old, but results of this subgroup were not separately reported; the study by rea et coworkers reported a tendency towards a worse efficacy of compression - only cpr than standard cpr in cardiac arrests of noncardiac origin, and a tendency towards a better efficacy in shockable rhythm and in rapid (<6 minutes) response by the emergency medical system . The results of the present meta - analysis are consistent with the most recent observational study on 4415 cardiac arrests not due to trauma or asphyxia, drug overdose or drowning, in which a 5-years data collection was accompanied by a statewide public education campaign aimed to increase bystander compression - only cpr . In this study, the incidence of bystander - initiated cpr increased every year, as did the proportion of compression - only cpr; more importantly, overall survival increased significantly over time . Overall survival to hospital discharge was equal between the no bystander cpr and the standard cpr groups, while survival and neurological outcome were significantly better in the compression - only cpr group; compression - only cpr resulted particularly effective when the cardiac arrest was witnessed and presented with a shockable rhythm . In 1128 patients with cardiac arrest of presumed noncardiac origin, not included in the study, survival was lower and not different among the two technique and no bystander cpr . It is well documented that both interruptions of chest compressions during ventilation and positive -pressure ventilations have detrimental effects on survival rate . Oxygenation and ventilation could be allowed - at least initially- by passive ventilation during chest compressions, by spontaneous gasping and by the lungs capacity to act as a reservoir in addition, compression - only cpr is easier to teach, to remember and to perform, and it does not require mouth - to - mouth contact, so resulting in a better willingness to start cpr by bystanders . It is worth noting that in two of the three analyzed studies bystanders randomly assigned to standard cpr were significantly more likely to withhold cpr than callers assigned to compression - only group . Based on our findings, compression - only cpr should be considered as the preferred bystander cpr technique, even if ventilations still have a crucial role in cardiac arrests of presumed noncardiac origin, in children and when resuscitation is started more than 4 minutes after the arrest . . However, it should be considered that most victims of cardiac arrest are adults, and the cause is cardiac in about 2/3 of cases . The importance of ventilations in cardiac arrests lasting more than 3 - 4 minutes is more controversial, as two recent studies in a porcine models reported contradictory results . Likely laypersons training on cpr should be simplified to privilege compression - only cpr; in 2008 the american heart association already recommended that untrained bystanders should provide compression - only cpr for adults with sudden cardiac arrest . However, fatigue can be a relevant problem decreasing the quality of compressions and a change of cpr providers every one minute instead of every two minutes has been suggested . Available evidence from randomized controlled trials suggests that compression - only cpr is superior to standard cpr at least when performed by untrained bystander . These results have relevant implications on teaching, and if adequately publicized they should favour a crucial increase in the rate of bystanders performed cpr.
Communication among neurons is essential for higher brain functions, such as perception, memory, and movement . The mature nervous system is an intricate network in which neurons are extensively interconnected to each other . These connections are made up during embryonic and postnatal development and are modified during life by experience . As suggested by early experiments of sperry [13], during circuit development axon - target recognition relies on chemical matching . Intercellular signals such as adhesion molecules, chemoattractants, and neurotrophic factors, remarkably well conserved during evolution, provide crucial directions to the developing nervous system [46]. In addition, electrical activity in the forming circuits also plays a critical role in shaping connectivity, as shown by the pioneering experiments of hubel and wiesel in the development of the visual cortex [711]. Activity - dependent fine - tuning of neuronal circuitry is not limited to early development and neural circuits are adaptable even in the mature individual . As firstly proposed by hebb in the 1940s, synaptic strength increases when the pre- and postsynaptic elements are synchronously active . The existence of synapses whose efficiency is remarkably influenced by previous activity and that undergo long - term potentiation (ltp) has been discovered in rabbit hippocampus by bliss and lomo and then long - term depression (ltd) has been observed in the cerebellar cortex . Synaptic plasticity has long been implicated in cognitive processes such as learning and memory [1618]. Interestingly, the same processes of plasticity described in simple nervous systems of invertebrates such as aplysia, helix, lymnaea, helisoma, and drosophila seem to be conserved in mammals and many similar molecular mechanisms underlining both simple and complex forms of learning and memory [16, 17]. In the last decades, cellular and molecular aspects of synaptic plasticity have been analyzed in detail in circuits of few cells, while less information is currently available about dynamics of large populations of neurons during development and plastic modifications . Experimental analysis of connectivity with simultaneous multiple site recordings within functional neuronal networks is therefore a promising approach in neuroscience research . Nowadays, microelectrodes arrays (meas) are the state of the art for studies on neuronal network dynamics . By means of those devices it is possible to characterize the neuronal dynamics of several biological preparations (i.e., from invertebrates [21, 22] to different cerebral mammalian areas such as cortex and hippocampus) by studying their development and delivering electrical [2628] or chemical stimulation [2931] to induce synaptic plasticity at the network level . Recently, improvements to the mea technology have led to an increase in the number of recording sites [3236]. In this way, the idea to have one neuron plated over the surface of each electrode (1: 1 coupling) becomes achievable, thus implying the possibility of realizing neuronal networks with a precise and well identified topology . Signal recording systems (microtransducers) based on meas and field effect transistors (fets) have been established as powerful tools for recording the electrical activity of networks of neurons cultured in vitro [30, 3741]. Under this experimental condition, neurons are directly connected to the microtransducers by a neuroelectronic junction, and the neuronal electrical activity is noninvasively extracellularly recorded over long periods of time . Meas are made of cell - sized electrodes (10100 m diameter) placed onto a glass or on a printed circuit board substrate . The electrodes, typically made of gold, indium tin oxide (ito), titanium nitride (tin), or black platinum, are biocompatible, long - lasting, and preferably with a low impedance (less than 500 k at 1 khz) for low thermal noise . The mea surface and electrode leads are coated with biocompatible insulators (e.g., polyamide or silicon nitride / oxide) which prevent short circuits with the electrolyte bath . These insulators, coated with adhesion molecules such as polylysine and laminin, allow and help neuronal coupling to the device surface . Finally, the low impedance of the electrodes and the choice of a correct voltage range for avoiding the generation of neurotoxic redox complexes allow the delivery of external stimuli . Meas can be grouped on the basis of the number of electrodes which define the array (from 60 to 10,000 electrodes), the electrode size (from 10 up to 30 m), and the interelectrode spacing (from 20 up to 500 m). Most of the results presented in this review are based on meas with 60 flat round electrodes made of titanium nitride . Tracks and contact pads are made of titanium or ito, and the insulation material consists of silicon nitride (si3n4). The electrodes are positioned in an 8 8 layout grid with missing corner electrodes . Ito contact pads and tracks are transparent to allow a perfect view of the specimen under the microscope . Finally, a glass ring is placed at the center of the array in order to contain the culture medium . In this way the cultures may survive for several weeks when placed in an incubator . A considerable contribution in the microtransducer field for electrophysiological neuronal activity recording was made by fromherz and coworkers [37, 40, 4346]. They demonstrated that open - gate fets are able to detect the transient extracellular voltage beneath a single neuron attached, through its cell membrane, to the gate insulator of a fet . Briefly, a field - effect transistor consists of four terminals (figure 1(a)): the source (s), the drain (d), the gate (g), and the bulk (b). The region between the source and drain defines the channel . The gate is separated from the channel by an insulator (sio2 or si3n4). The source and drain connections are degenerately doped n - type silicon, while the bulk of the transistor is p - type . If there is any kind of voltage applied to the gate, the source and drain are electrically disconnected . If a positive voltage is applied to the gate, positive charges in the gate will electrostatically repel the holes in the underlying p - type channel . If the applied bias is further increased, the positive charges on the gate will attract minority carriers (electrons) and a channel that will link the source and the drain together will take place, allowing the passage of current . Thus, one can modulate the drain - source current by applying a particular gate voltage . For the use of a fet as microtransducer to record electrophysiological activity, the metallic gate is removed . In this way, the insulator is directly exposed to the cell membrane and to the electrolytic solution . The activity of the neuron leads to ionic and displacement currents flowing through the attached membrane, resulting into an extracellular voltage drop along the narrow cleft between the membrane and the gate insulator . The change of the extracellular voltage induced by the neuronal activity gives rise to an electric field across the insulator which modulates the drain - to - source current of the fet; this current, transduced into a voltage, describes the extracellular recorded signal probed by the microtransducer . Compared to the first generation of fet - based systems [37, 46], nowadays low - noise level fet - based systems are available . The introduction of low - noise transistors permits recording the electrophysiological activity also from mammalian neurons (cortical or hippocampal neurons) which exhibit a peak - to - peak amplitude smaller (~100 v) than the one originated by large invertebrate neurons (up to tens of millivolts). We can then conclude that, with respect to conventional meas, three main advantages can be achieved by using this kind of technology: (i) heavy parallelization large numbers of microtransducers can be addressed by on - chip multiplexing architectures . In this way this kind of devices can be exploited to study the emerging connectivity in large - scale neuronal networks; (ii) signal quality the signal is conditioned right at the transducer by means of dedicated circuitry units; (iii) ease of handling and use both devices and signals are robust . In the last decades, several attempts have been made to improve the coupling between neurons and the surface of the microtransducers with the aim of increasing the amplitude of the recorded signals and achieving more stable adhesion conditions . In this sense, a significant result has been obtained by the use of carbon nanotubes (cnts), considered a promising material for the assembly of nanodevices . Recent studies have suggested the great potential of high - density cnt coated surfaces as an interfacing material with neuronal systems; moreover, cnt surfaces act as an extremely efficient biocompatible substrate on which neurons adhere and proliferate [4851]. Furthermore, the cnt - based neuroelectronic junction plays a relevant role on the extracellular neuronal signal recording and stimulation . More recently, a great step towards the possibility to enhance the coupling between electrogenic cells and microtransducers has been made by spira and coworkers who developed an innovative extracellular recording technique, based on mushroom - shaped protruding microelectrodes [55, 56]. This extracellular system allows in - cell recording not only of action potentials, but also of subthreshold synaptic inputs from individual neurons with a signal - to - noise ratio that matches that of conventional intracellular recordings . Invertebrate neurons have represented an important tool in the development of microtechnologies applied to neurosciences . Specifically, invertebrate neurons have a large cell body which facilitates the formation of high quality neuron / microtransducer interfaces; they are easily identifiably amid the ganglia and may grow in isolated culture as well as in reconstructed specific circuits . In addition, invertebrates neural circuitry is very simple when anatomically compared to mammals, but it exhibits many types of short and long - term plasticity that have been extensively studied at the behavioral, cellular, and molecular levels [17, 57]. Moreover, by exploiting the size of their somata and the amplitude of their action potentials, invertebrate neurons have also been used as testbed for innovative microtransducers . In 1991, a retzius cell of the leech hirudo medicinalis was successfully coupled for the first time to a transistor by fromherz and colleagues [37, 58], and bioelectrical signals were elicited from neurons of the pond snail lymnaea stagnalis grown on microchips and connected by gap junctions [44, 45, 5961]. A further important step has been the reconstruction on the silicon chip of a chemical synapse of lymnaea that exhibited plastic properties . In lymnaea, the respiratory neuron vd4 (visceral dorsal 4) forms a cholinergic synapse with the neuron lped1 (left pedal dorsal 1) [63, 64] and this connection can be reconstituted in culture in a soma - soma configuration [6468]. The vd4-lped1 synapse undergoes short - term plastic changes and intracellular tetanic stimulation of vd4 induces an enhancement of synaptic transmission in the postsynaptic neuron lped1 [69, 70]. Interestingly, similar potentiation was obtained when the presynaptic neuron vd4 was repeatedly stimulated by a chip capacitor and postsynaptic excitation in lped1 was recorded by a transistor, establishing for the first time a short - term plasticity in a pair of chemically connected identified cells cultured on the electronic chip . This result provided evidence that interfacing semiconductor chips and neurons may represent a direct noninvasive method for short- and long - term studies of plasticity in vitro . Simultaneous recordings from a large number of neurons of central pattern generator (cpg) networks that mediate fundamental lymnaea behaviors including feeding and respiration [7174] have been obtained from semi - intact preparations consisting of ganglia and sensory input interfaced to meas . In this preparation the mea was used to monitor learning - induced changes in the electrical responses of specific types of identified buccal feeding motoneurons [7683]. Using a protocol for in vitro single - trial classical conditioning of lymnaea feeding behavior, recordings with mea technology have allowed detecting modifications in the spatiotemporal firing patterns of a large number of feeding neurons . This proved that the feeding cpg of the pond snail is associated with another oscillating neuronal population characterized by activity alternating with quiescence during which the cpg is refractory to activation by food - associated stimuli . Similar network refractory periods have previously been observed in the rhythmic activity networks of spinal interneurons from locomotor cpg regions in culture as well as in the spinal cord of embryonic rat [86, 87] and chick . In lymnaea circuits interfaced with mea, the dynamic of network refractory periods of cpg was modulated by dopamine, a neurotransmitter known to regulate feeding behavior and reward . Recently multifunctional meas were developed for neuroelectrical and neurochemical recordings in vivo [90, 91] and in vitro that allowed the detection of neurotransmitters such as dopamine released from neurons of acute hippocampal slices and from pc12 cell lines . Neurotransmitters released from presynaptic terminals regulate neuronal communications and it is well known that alteration in electrical activity and in level of neurotransmitters underlies several disorders such as parkinson's disease, schizophrenia, and major depression [94, 95]. Multimodal probes for simultaneous activity and chemical detection appear suitable for analyzing dynamics of activity correlated to neurochemical release in complex circuits and for investigating the effects of drugs employed in treatments of neurological diseases . More details on the specific sites of neurotransmitter release from a neuron have been acquired with a planar microelectrode array that has been fabricated and characterized by patel et al . For simultaneous multisite detection of dopamine release . Electrically evoked dopamine release was observed from freshly isolated dopaminergic rped1 neurons of lymnaea stagnalis . These large neurons were plated on meas containing electrodes spatially arranged to allow the simultaneous recordings from various structural regions of an isolated cell . Evoked recordings of dopamine release induced by tetanic stimulation were obtained simultaneously from distinct locations such as the soma, the axon, and the terminals . Interestingly, repeated recordings at various time - points showed that the release of neurotransmitter varied over the structural regions of the lymnaea neuron during the reorganization of the cell following isolation from the ganglia . Mea recordings of simultaneous spatiotemporal responses of dopamine released by action potential activation from cultured large neurons could be used to study the changes in neurotransmitter release in specific regions of the neurons during formation of synapses and neuronal network activity . Many extracellular electrodes such as noninvasive extracellular meas for in vitro recordings can reliably measure action potentials but subthreshold potentials such as synaptic potentials remain undetectable . A large number of events in synaptic plasticity are associated with changes in amplitude of synaptic potentials that very often do not reach the threshold required for spike firing . In the last decade, many attempts have been performed to improve the electrical coupling between cultured cells and planar meas and to reduce the junctional membrane resistance . A novel neuron - electrode configuration (in cell recording) developed by the group of spira [55, 56, 97100] allowed recording action potentials as well as synaptic potentials with meas in aplysia neurons: it consists of an array of noninvasive gold, mushroom - shaped microelectrodes that permits simultaneous, multisite, long - term recordings of action potentials and subthreshold potentials with quality and signal - to - noise ratio comparable to that obtained with intracellular sharp glass microelectrodes or patch electrodes . Neurons from the buccal and abdominal ganglia of aplysia californica were isolated with their initial axon and maintained in culture [101, 102]. Plated aplysia neurons survive in culture for over a month, extending neurites and forming chemical and electrical synapses . Isolated aplysia neurons were manually plated directly on top of the microelectrodes that protrude from the glass substrate with three - dimensional mushroom geometry and dimensions that mimic dendritic spines in their shape and sizes . A peptide that induces phagocytotic activity was covalently linked to the microelectrodes in order to generate efficient contact between them and the neurons . Electron microscopy showed that the neuron - microelectrode has a reduced cleft width with increased contact area and within a few minutes of contact there was a restructuring of the actin cytoskeleton to form an actin ring around the stalk of the microelectrode that became a stable cytoskeleton structure and was maintained for several days as shown by live confocal microscopy . Ultrastructural observations revealed that other cell types such as cho, embryonic fibroblast cells nih/3t3, rat myocardium cells h9c2, and rat adrenal medulla pc12 cell lines engulf the head and stalk of the gold spines . The gold - spine matrix influences the growth of neurons but they maintain typical electrophysiological properties and form functioning synapses . These electrodes represent an improved substrate for the assembly of neuroelectronic devices well suited for the study of neuronal plasticity as they allow the detection of subthreshold potentials in aplysia neurons . Signals from single or paired invertebrate neurons have been recorded with mea devices for many years but the first long - lasting study on invertebrate neuronal networks in culture was performed in 2013 by massobrio and colleagues . They characterized the dynamics and connectivity of networks made up of neurons of the land snail helix aspersa coupled to meas during their development for several days . Previous experiments showed that c1, c3, and b2 neurons from buccal and cerebral ganglia of helix form microcircuits in vitro [22, 104107] and the serotonergic connection c1-b2 involved in the regulation of feeding behaviors of helix snails reconstructed in culture undergoes plastic changes . The large size of helix neurons (soma diameter up to 100150 m; see figure 1(b)) compared to mammalian neurons (see figure 1(b)) permits a 1: 1 coupling between neurons and microelectrodes, facilitating the study of the relationships between the electrophysiological activity of individual neurons in a network and their development of neurite outgrowth and connections in the long term . Helix neurons start to develop synaptic connections a few hours after plating, and their development is faster than cortical cultures from mammals . Figure 1 shows the growth of helix neurons that have been plated on top of the microelectrodes 24 hours earlier (1b) and of cortical neurons after 24 days in culture (1c). A peculiarity of these invertebrate neuronal networks is the absence of spontaneous activity: helix neurons are generally silent on meas [19, 22, 108, 109], and spontaneous firing was observed only occasionally . Figure 1(d) shows two examples of extracellularly recorded signals coming from stimulated b2 (top) and c1 (bottom) neurons . Typically, the signals from these neurons display amplitudes greater than 500 v, differently from mammalian spikes that, although spontaneously active, seldom are greater than 200 v . Figure 1(e) shows a typical cortical bursting sequence . Therefore, to study helix networks, neuronal activity was triggered by means of chemical treatments that induce general depolarization of the cell membrane potential (potassium chloride, kcl, figure 2(a)) or that selectively depolarize b2 neurons (serotonin, 5-ht, figure 2(b)). Thus, the neuritic outgrowth and the induced activity were followed during development of the circuits for several days, as shown in figure 2 . The first - order statistics were used to characterize neuronal dynamics such as interspike interval (isi) and firing rate . The cross - correlation function was employed to estimate the functional connections established among neurons of the network in order to reconstruct the topological connections and monitor them during development . The simplicity of these neuronal circuits allows the achievement of a good matching between morphological and functional links on mea . It has been found that both chemical stimulations were efficacious in triggering firing activity in helix circuits, but a long - lasting change in activity occurred only with 5-ht treatment, as presented in figure 2 . For as long as the network evolved, an increase with time of functional connections was detected . Moreover, the analysis of spiking activity as well as their functional linked latencies showed that networks treated with 5-ht displayed a dynamic modulated mostly by chemical synapses, while a predominance of electrical connections occurred in kcl - triggered networks . The preferential formation and strength of chemical or electrical synapses during circuit development are critically regulated by several factors including neuromodulators such as serotonin and dopamine, as recently reviewed by pereda . The prevalence of chemical connections in 5-ht - treated circuits may underline the long - term maintenance of spontaneous activity . Serotonin applications trigger activity through the depolarization of b2 neurons and the increased excitability of c1 neurons, and continuous release of 5-ht from the firing neurons may maintain it, as previously reported [112114]. In addition, it has been demonstrated that 5-ht selectively prevents the formation of electrical synapses while allowing chemical synaptogenesis between identified helisoma trivolvis neurons [115, 116], maybe due to a negative modulation of neurite elongation [117121] and a direct action on gap junctions [122124], also observed in neocortical circuits . In mammals, 5-ht has been implicated in shaping neuronal connectivity by decreasing neurite branching in rat cortical neurons during development and impairing neurite density in mouse organotypic slice cultures . The increase in neurite density induced by kcl treatments may contribute to enhancing cell - cell contact, thus promoting a higher coupling coefficient among cells . Since gap junctions likely play a fundamental role in determining network synchronization [128, 129], signals may reverberate among neurons until they return to a silent state by switching off the circuit . Following repeated stimulations, similar dynamics during the development of these invertebrate circuits were observed: network activity soon reached values of firing rates and isis which remained almost unchanged during the development despite connectivity maturation . This behavior is very distinctive, especially if compared with studies regarding the development of in vitro cortical neurons from rat embryos . Indeed cortical assemblies were found to change their electrophysiological patterns as a function of network maturation, probably associated with a much higher synapse density [130, 131]. This activity, originating from the interactions of neuronal assemblies, is a peculiar feature of the mammalian nervous system and it can be found at different levels of investigation: in the cerebral cortex, it takes the shape of oscillatory patterns which span over different rhythms; in reduced in vitro models, like dissociated cortical cultures, spontaneous activity is mainly characterized by a mixture of spikes and bursts lasting from a few to hundreds of milliseconds . Such dynamic evolves, since it changes as a function of the degree of development of the cultures: during the first stages of development, dissociated cortical assemblies display mainly irregular and asynchronous spiking activity; from the second week in vitro, spikes tend to cluster into bursts, a signature feature that persists throughout the time in culture, thus representing the mature state of the network . Those bursts can be found in both hippocampal and cortical cultures and are similar to activity patterns of in vivo systems deprived of afferent stimuli or with pathologies like epilepsy . On the other hand, synchronized bursting events and population responses recorded in vivo while animals are engaged in sensory, motor, or internal cognitive tasks . The presence of this cumbersome ongoing activity, exhibiting a high degree of variability, makes it difficult to interact with these cortical ensembles . However, several attempts to modulate these irregular dynamics by means of appropriate electrical and/or chemical stimulations can be found in the literature . In general, low - frequency, uniform, sustained electrical stimulation locks the phase of periodic bursts to the applied stimuli . Higher rates of stimulation induce a transition from synchronized bursting activity into a sparse spiking behavior, more similar to in vivo awake cortical dynamics . Conversely, an electrical stimulation pattern tailored on the network endogenous activity is able to efficiently induce modifications in the network synchronization and, in particular, it affects the network bursting properties, by increasing both firing and bursting rate . Moreover, after this kind of spontaneous activity - tailored stimulation, the strongest connections respond by further increasing their strength relative to other connections within the network . This mechanism likely preserves connections that are more informative and relevant to the overall network activity . The history of mea studies demonstrating functional plasticity in cultured mammalian networks began in the 1990s with the pioneering work of maeda and coworkers who reported that tetanic stimulation through one or more electrodes was able to induce plasticity . In their work, they found that the probability of evoking bursts by test pulses, as well as a change in the rate of spontaneous bursting, was modified after the delivery of a strong tetanic stimulation . Less than one year later, jimbo and coworkers observed similar results with a milder tetanic stimulation . Following those experiments, numerous other attempts have been performed by several mea labs worldwide aimed at finding whether peculiar features of the electrical stimulation (e.g., frequency, number of stimulated electrodes, and amplitude of the stimuli) were able to induce synaptic changes in the dynamics of the networks . However, despite the different attempts pursued during these years, a clear answer to the question of whether neuronal cultures can learn thanks to plasticity phenomena is still controversial, mainly because of two reasons: the first is the difficulty of designing a network stimulation protocol (partly linked to the nonstationary behavior of the dissociated cultures) capable of reliably inducing changes, as we will report in the next sections . The second reason lies in the lack of an electrophysiological endpoint that can be easily correlated to plasticity in dissociated networks . They proposed that not only changes in the synaptic potentials but also changes in the firing patterns of neurons should be taken into account in long - term forms of plasticity . Moreover, the neuronal input / output function of the entire network must be studied and characterized to better understand the computational effects of plasticity on a long - term perspective . According to this approach, mea could become the gold - standard tool to define long - term network plasticity (ltnp) experiments . Similarly, in 2006 potter's lab coined the expression functional plasticity (fp) to indicate those changes in stimulus - response relationships or in spontaneous patterns that are experimentally induced by electrical stimulation and lasting at least on the order of one hour . Phenomena like ltp and ltd fall within the boundary of this definition (and can thus be considered examples of functional plasticity), whereas short - lasting changes such as paired pulse facilitation and depression do not (their duration is much shorter than the one - hour limit). In 2006, the authors applied different protocols to induce plasticity to a large set of cortical cultures coupled to meas . The conclusions of their work are straightforward: bursting suppression obtained through distributed electrical stimulation is a prerequisite for inducing plasticity . Their protocol consisted in the random selection of electrodes in the pool of those evoking electrical responses, followed by stimuli delivery in cyclic order, with an interstimulus interval of 20 ms . This resulted in a complete, but reversible, cessation of spontaneous bursting . Only after this was achieved, the application of a tetanic stimulation resulted in plasticity in their experiments . The works of other groups determined the fact that complete bursting suppression is not a strict prerequisite and, through appropriate experimental precautions, different tetanic stimulation protocols resulted in significant connectivity changes even in the presence of spontaneous bursting . Stability and responsiveness of culture batches are the first and most important conditions to be assessed to induce plasticity . As stated in the previous sections, both cortical and hippocampal assemblies display a mixture of spiking and bursting activity, with a high degree of variability (e.g., percentage of random spiking activity and frequency of the bursting activity) from culture to culture . For this reason, chiappalone and coworkers developed a procedure that evaluates the level of nonstationarity of the spontaneous and stimulus - evoked activity of a neuronal network . The application of this criterion allows discarding of cultures displaying large variations of dynamics which can obscure changes in the synaptic efficacy induced by plasticity protocols . Cultures are selected on the basis of their initial spontaneous activity and on their ability to respond to low - frequency stimulation . In particular, two conditions regarding the spontaneous activity and firstly, the initial value of firing rate should be above a defined threshold (set at 3 in), and secondly the firing rate should remain stable between the phases of spontaneous activity before the plasticity protocol delivery . As for stimulus - evoked activity, a stimulated electrode is not considered for future stimulations if it is not able to evoke a global response in at least 50% of the recording electrodes . Finally, the network response to low - frequency (i.e., 0.2 hz) test stimuli has to be stable; that is, the variation of the evoked response, evaluated by means of the peristimulus time histogram (psth), has to be below a defined threshold . Spontaneous activity of each network was measured at the beginning of the experiment (mfrpre) and after the first test stimulus session (mfrpost). Cultures labeled with red circles verify the mfr stability conditions and are potentially able to show plastic behavior . On the other hand, blue circles indicate cultures with a low firing rate, while yellow and green circles represent unstable cultures exhibiting spontaneous increase (yellow) or decrease (green) of their firing rate . The two superimposed profiles of the psth represent the probability of response (y - axis:) of the network to two different sessions of stimulation (black and red) in a time window of 400 ms (x - axis: [0, 400 ms]). We can observe that (i) all the electrodes are responsive and (ii) the two traces are practically superimposed, thus indicating stability of the preparation . The protocols currently used to induce plasticity both in vitro [14, 149] and in vivo [150, 151] consist of a massively synchronous, high - frequency stimulation (40100 hz) named tetanic stimulation . Although these patterns of stimulation are extremely efficient, they have the drawback to rarely occur in nature . The pioneering works which made use of tetanic stimulation also in cortical cultures coupled to meas were carried out in the groups of maeda and jimbo . Maeda and coworkers found that tetanic stimulation delivered by means of one or several electrodes induced plasticity . They observed a change in the probability of evoking bursts by test pulses, as well as a change in the bursting rate of the spontaneous activity . Observed similar results with weaker tetani and used voltage clamp to observe inward currents associated with evoked bursts . The intriguing result was that, after tetanization, the onset latencies of these currents resulted were shorter . The following year, jimbo et al . Reported that tetanizing a single electrode resulted in changes in the responses to test pulses delivered from other electrodes . Following this approach, chiappalone and coworkers designed a more physiological experimental protocol derived from the combination of previous works on associative stimulation for ltd and ltd induction [153, 154] and on the results of the japanese groups [139, 140]. The applied tetanus was characterized by a sequence of short bursts at 20 hz every 5 s coupled to a stimulation below 1 hz for a limited period of time (less than 2 minutes). The obtained results, based on different pairing of the tetanus with the weak train of stimuli, demonstrated that reliable potentiation was obtained by using more physiological stimulation and without drastically changing the natural spontaneous dynamics of the neuronal system . Moreover the obtained changes were long - lasting since observation up to twenty - four hours after tetanization . [140, 141], according to whom the tetanic stimulation was, by itself, able to induce plasticity in the network . The main result is that the single tetanus is less reliable and it involves a smaller fraction of (effective) connections but its efficacy can be greatly increased when paired with a weak stimulation . They applied a low - frequency stimulation protocol (i.e., biphasic current pulses at a frequency of 0.20.33 hz) to cortical cultures coupled to meas . Their main findings showed that stimulation is effective in inducing changes for as long as it triggers network bursts, with very little correlation with the actual stimulation frequency used . Furthermore, stimulation changed network activity patterns from the spontaneously observed ones: stimulation - triggered network bursts originate at other points than spontaneously occurring bursts and, therefore, spreading of activity involves different pathways . The approach followed by the groups led by torre and potter [155, 156] is completely different and based on more classical protocols for inducing plasticity in vitro [14, 157]: in these works, tetanization consists of multisite bursts of stimuli at 250 hz or of continuous trains of electrical pulses at 20 hz for 15 min . By using such massive, nonphysiological stimulation, the first study reported increase in evoked firing at specific sites, without quantification of duration and amount of the changes . Madhavan et al . Reported an increase in global spontaneous activity, without specifically analyzing the evoked response . Inducing plasticity by extracellular electrical stimulation in dissociated mammalian cultures has not been as straightforward as for brain slices . The possible reason behind this could be related to the nonstationary behavior of the dissociated cultures (cf . Section 4.2). Specifically, since much of the activity in cultures is concentrated in bursts (possibly caused by lack of critical neuromodulatory input during development) moreover synapses are already saturated in culture due to the high density of the established connections . However, this last motivation could also justify why it has been possible to induce plasticity, as demonstrated by the recent findings reported in this review: assuming a random probability to establish connections and that the chance of forming monosynaptic connections with nearby neurons is quite low, there would be a large number of recurrent polysynaptic pathways, as in the intact brain . The firing of a cultured neuron hyperinnervating others can be considered to be analogous to the in vivo situation of synchronous firing of a group of neurons with common targets . For this reason, forms of heterosynaptic plasticity are more likely to occur in dense cultures than homosynaptic ones . For the same reasons, coupled stimulation (e.g., chiappalone's protocol) mimics, at the cell assembly level, the heterosynaptic pairing as reported for the hippocampus, leading to a ltnp, in the form of long - lasting plasticity (i.e., l - ltp) which can be maintained for hours or even days . Figures 4(a) and 4(c) show an example of ltnp . In figure 4(a) the psth shapes of signals from all the electrodes (blue lines) and their average (red thick line) trend are reported before the tetanus delivery (first row) and 1 (middle row) and 24 hours (bottom row) after the tetanus delivery . The tetanic protocol is sketched in panel (b). To quantify such results, figure 4(c) plots the area under the psth curves before tetanus delivery (black squares) and 1 (red squares) and 24 hours (green squares) after the tetanus delivery . A clear potentiation of the network can be observed and quantified by the slopes of the linear fittings (dashed lines). As reported in, synaptic plasticity at the network level provides a distributed mechanism to convert and store temporal information into spatially distributed patterns of synaptic modification . Closed - loop experiments on in vitro neural networks have been introduced to investigate whether such preparations could perform a learning task without the need for a separate rewarding entity: in 2001, the group of marom implemented a relatively simple activity - dependent stimulation protocol that would cease once the firing of the network met a predefined threshold: they developed an activity - dependent adaptive stimulation protocol, aimed at training a culture to produce a predefined response upon stimulation . In this way, networks could be taught to respond in specific ways to test pulses, by repeatedly stimulating them until the desired response was obtained . This approach was based on general learning theories (stimulus regulation principle). In their experiments, the reward consisted in a reduction of the driving stimulus, precluding the acquisition of any new stimulus - response associations . Similar experiments have been more recently conducted by the groups of le feber and kazantsev, in 2010 and 2013, respectively . In more detail, an electrode in a standard, 60-electrode mea layout was used to deliver low - frequency (1 hz) stimulation pulses . At the same time, the strength of functional connectivity between any pair of electrodes is estimated in real time, with stimulation protocols being interrupted when the functional connectivity between the stimulating electrode and a different arbitrarily chosen electrode in the mea showed a significant increase . The results of these experimental campaigns proved that indeed closed - loop stimulation may be used to induce specific changes in network connectivity with no or very little a priori knowledge of the network structure . Along the same line, potter's group induced random changes in synaptic connections by stimulating in quick succession from several different electrodes, in order to induce a mix of potentiation and depression . A stabilization pattern also consisted in stimulation from different electrodes, but interpulse intervals were chosen in order not to trigger spike timing dependent plasticity (stdp). In those experiments, the activity of the network resulted in the movement of an animat (i.e., an artificial animal): each time the behavior of the animat approached the intended one, the stabilization pattern was delivered; conversely, the network was stimulated with the training pattern to provoke a change of the animat behavior . The main result of that work was that the same patterns used for training did not cause any significant plasticity if delivered in open loop . However, this was not the only example of hybrid neural - artificial systems controlling a robot in closed loop . Several neurorobotic systems have been introduced and presented in the literature between 2007 and 2012 [163166]. Differently from potter's, those systems did rely on a priori knowledge of connectivity within the neural networks to successfully drive the robot past obstacles . These systems implement a closed - loop system that takes inspiration from a typical physiological sensory - motor loop: the sensors of the robot gather information about the surrounding obstacles, which is coded as a sequence of electrical stimuli delivered to the neural networks . The responses of the network are in turn decoded and used to safely drive the robot around its environment . These systems are generally intended as platforms for the study of specific aspects of neural network mechanisms, such as coding and decoding, or to test novel learning paradigms . Identification of input - output relationships even for single neurons has proven intractable for a long time, given the timescales and nonlinearities involved . A step forward in this direction has been taken in 2011, when marom's group introduced for the first time the concept of neuronal response clamp . The idea is that of taking advantage of a proportional - integral - derivative (pid) controller to modulate the amplitude of a fixed rate electrical stimulation in order to maintain a stable response ratio at a given neuron . In this way, it is possible to estimate the threshold of the neuron, a high - level, functionally relevant variable . Thanks to the closed - loop neuronal clamp, in 2012 the same group investigated the interplay between network burst and single - neuron threshold . They found the two phenomena to be deeply intertwined: the size of bursts results correlated with threshold values at the time of inset, while the dynamics of threshold recovery govern both spontaneous bursting and response to electrical stimulation . The effect of closed - loop stimulation on plasticity is presented in a more recent work by the same group . They concluded that, in open - loop conditions, networks will respond to electrical stimulation whenever they have built up enough resources to do so; on the other hand, in a closed loop, networks are forced to keep up with stimulation rate: this imposes the recruitment of resources which are generally left unused . In turn, this leads to enhanced changes in connectivity compared to those observed in open - loop experiments . Simultaneous multisite long - lasting recordings with meas have opened new perspectives in the studies of formation and dynamics of complex neural networks allowing detailed investigations at the level of single cells and at population scales both in vitro and in vivo . In the last decades, technical improvements have increased spatial resolution of mea recordings and recently the detection of subthreshold signals such as synaptic potentials has been demonstrated in invertebrate neurons . Future efforts will be focused on the development of strategies to record synaptic signals in mammalian neurons too, as well as to create more realistic connectivity, like 3d structures or the presence of heterogeneous neuronal populations . Studies of connectivity and synaptic plasticity in dissociated mammalian cultures will help to understand complex dynamics underlying both physiological behaviors and pathological alterations associated with changes in firing patterns of large populations of neurons as it happens in epileptic disorders . As reviewed in this work, the behavior of dissociated cortical networks can be shaped by the delivery of ad hoc stimulation patterns suggesting that this reduced in vitro experimental model is capable of learning or adapting to the timing of the stimuli . These conclusions have been extended in 2010 by buonamano and coworkers that found that neuronal dynamics in a complex circuit can be modified through experience and that the temporal structure of such expressed dynamics reflects the temporal interval used during training . Finally, the possibility to interface neuronal networks with meas allows the realization of neurorobotic frameworks . Such hybrid platforms are a valid tool for the study of mechanisms of neural coding and the computational and adaptive properties of neuronal assemblies . In a long - term vision, these systems could be used to better understand neural pathologies, to design neural prosthetics, and to create different types of hybrid intelligence.
Horizontal gene transfer (hgt) is very common and of great importance in bacterial evolution and is also relatively common in certain eukaryotic lineages . One consequence of hgt is incongruence between phylogenies reconstructed from genes with different histories of transfer, including of course no transfer at all . Finding and examining phylogenetically atypical genes has become a standard task in hgt studies . In cases where an entire gene has been transferred, without the complication of recombination / conversion with a native homolog, the donor lineage can in principle gene conversion enters the picture either during the act of gene transfer, when transiently - present foreign dna directly converts (replaces) part of a native locusor, after duplicative hgt, via potentially ongoing gene conversion between co - existing native and foreign copies . Overall, then, gene conversion can lead to a potentially complex and diverse set of patchwork recombinant sequences, especially if it occurs repeatedly, and differentially, over the course of speciation . Each recombinant gene, if analyzed as a whole, might or might not reflect the true evolutionary history of either or both parental sequences . When parental sequences contribute differentially to the number of informative characters in a recombinant sequence, this sequence will tend to resemble the parental sequence that contributes more informative characters (e.g., refs . 15 and 16), whereas when parental sequences contribute similar numbers of informative characters, the recombinant will potentially be quite different from both parental sequences, depending of course on the degree of divergence of the two parental sequences from each other . When properly recognized and dealt with, recombination poses few problems for phylogenetic analysis and interpretation . In practice, however, recombination detection is challenging and often subject to failure . First, it is well established that recombination detection programs perform poorly when sequence divergence is low . Unfortunately, plant mitochondrial genomes, which collectively constitute a premiere model system for eukaryotic hgt studies, usually have very low rates of nucleotide substitution . Second, gene conversion often involves very short tracts of dna, which can make recombination detection very difficult . For instance, ten previously published recombinant regions between plant mitochondrial and chloroplast genes range in length from only 14 to 79 nucleotides . Third, existing recombination detection programs are generally designed to identify a single or only a small number of recombination breakpoints . Intricate gene conversion during the process of duplicative hgt and differential gene conversion (dh - dc) can, however, lead to mosaic gene structures, with multiple foreign regions interspersed with native regions on a fine scale . We recently reported such mosaicism in mitochondrial atp1 and matr genes belonging to different groups of flowering plants (angiosperms). We show that these mosaic genes largely escaped detection by recombination - detection programs and were recognizable only by direct visual inspection of dna sequence alignments . In this report, we explore the effects of chimeric sequences on phylogeny reconstruction by conducting phylogenetic analyses on simulated sequences and on an augmented set of the atp1 sequences analyzed in reference 12 . In a recent study, we reported the presence of three differentially mosaic types of mitochondrial atp1 genes in the angiosperm genus ternstroemia (pentaphylaceae, ericales) and concluded that they arose via dh - dc, with the blueberry genus vaccinium (ericaceae) the best candidate to be the donor group in the initiating hgt event . 12), each of the three major clades within ternstroemia possesses a differentially mosaic atp1 gene, each with multiple (four to five) foreign regions interspersed with native regions . In the one atp1 phylogeny presented in reference 12, the mosaic ternstroemia genes were all placed within the eriaceae, in a paraphyletic relationship with respect to vaccinium . Black vertical lines represent the 38 nucleotide positions inferred12 to have differed between donor and recipient atp1 genes at the time of atp1 transfer from vaccinium to a common ancestor of ternstroemia . Lines at the top of the boxes and red shading indicate sites and regions, respectively, of putatively foreign, vaccinium ancestry, while bottom lines and blue shading represent native sites and regions . White lines centered within the boxes represent the only two sites that otherwise differ within the ternstroemia clade . T - ips refers to the ternstroemia subclade containing t. impressa, t. peduncularis and t. stahlii) and t - glj to the subclade containing t. gymnanthera, t. longipes and t. japonica (see also fig . (a) chronogram showing organismal relationships and divergence times of relevant taxa belonging to the ericales . As described in reference 12, the chronogram was constructed by the beast program using a eurya reference fossil calibration of 86 myr ago . (b - f) maximum likelihood phylogenies of mitochondrial atp1 genes from the taxa shown in (a), with these analyses varying as to which members of ternstroemia (shown in red), whose atp1 gene is differentially mosaic, were included . A total of 1000 bootstrap iterations were performed, with all bootstrap values 50% shown on the trees . Phylogenies were rooted using fouquieria, marcgravia and pentamerista as unshown outgroups (hence the stub branch at the base of each gene tree). To better understand how mosaic genes affect phylogeny reconstruction, we sequenced the mitochondrial atp1 gene of chamaedaphne calyculata, a close relative of vaccinium, using the same set of primers and method as in reference 12, and employed it together with varying subsets of previously sequenced ericales atp1 genes in maximum likelihood phylogenetic analyses . Consistent with our recent study, and in contrast to organismal phylogeny (fig . 2a), in an analysis that included all relevant genes, the three types of mosaic atp1 genes in ternstroemia formed a paraphyletic assemblage, with t. fragrans sister to the vaccinium / chamaedaphne clade, the t - glj clade the most distant from the vaccinium / chamaedaphne clade and the t - ips clade in an intermediate position (fig . Remarkably, when only one type of mosaic atp1 gene was included in a given analysis, each of the three types fell in a different phylogenetic position (fig . 2c e). This shows that the phylogenetic position of a mosaic gene can vary depending on the inclusion of additional, related mosaic genes and emphasizes that this position provides little or no reliable information on the nature of the gene s parental sequences . 2b f) involves chamaedaphne, which was weakly placed (41% bootstrap support) within vaccinium when all mosaic genes were included (fig . 2b), but was placed as sister (with 6892% support) to a monophyletic vaccinium in the other four gene trees . This result raises the possibility that the inclusion of mosaic sequences in phylogenetic analyses can affect not only the placement of related mosaic sequences, but also the placement of apparently native sequences . We used simulation studies (conducted using seq - gen) to further explore the effects of chimeric sequences on phylogeny reconstruction . The following simulation parameters were chosen to be the same as those used in the above analysis of atp1 sequences: (1) sequence length, 1200 nucleotides; (2) substitution model, gtr; (3) gamma shape parameter, 0.218; (4) proportion of invariant sites: 0.371; (5) nucleotide frequencies, 0.271 (a), 0.207 (c), 0.261 (g) and 0.261 (t); and (6) gtr relative rate parameters, a <-> c = 0.818, a <-> g = 1.938, a <-> t = 0.244, c <-> g = 0.884, c all but the first of these parameters are based on phyml estimates derived from the mitochondrial atp1 alignment shown in figure s1, except with the mosaic ternstroemia genes excluded (as in fig . 2f) because recombinant genes have been shown to alter the estimation of substitution rate heterogeneity . The remaining simulation parameters were independent of the atp1 data and include the number of sequences, their topology, relative branch lengths and absolute amount of divergence (fig . 3a). For simplicity, only one recombination breakpoint was allowed in each chimeric sequence, with these chimerics constructed to contain varying proportions (from 50:50 to 10:90) of two of the 16 parental sequences generated by the simulations . The 16 purely - simulated sequences together with the artificially constructed chimeric sequence were used in phylogenetic analyses performed using raxml version 7.0.4 . Chimeric sequences were generated by combining the 5 and 3 portions of sequences 1 and 9, respectively (both circled in red), with different length ratios (10:90, 30:70 or 50:50) of the two parental sequences . Is based (for computational ease) on the concatenated sequences of the first 100 iterations, while the bootstrap support values are from all 1000 trees . Two sets of simulation analyses were performed . In the first set (fig . 3), we varied the parental proportions that comprise the chimeric sequence(s) and the number of chimeric sequences included in a given analysis . In analyses with a single chimeric sequence, this sequence grouped with 100% bootstrap support with its majority parental sequence when the parental ratio was 10:90 (i.e., when the chimeric sequence consisted of 10% of sequence 9 and 90% of sequence 1; fig . 3d), it went to the base of the tree, in between the two main clades of simulated sequences, and with bootstrap support reduced along the branches leading to both parental sequences . These results thus show that the phylogenetic position of chimeric genes can vary substantially as the proportion of parental sequences that comprise the chimerics varies . The phylogenetic position of the 50:50 chimeric sequence also varied substantially depending on whether it was the only chimeric sequence in the analysis (fig . 3d) or whether the 30:70 and/or 10:90 sequences were also included (fig . 3e g). The 50:50 from the base of the tree to its periphery, together with the 30:70 and parental sequence 1 (and with the 10:90 when included) and with strong support (96% and 92%, respectively). This peripheral attraction was more subdued when the 50:50 was paired with the 10:90 (fig . 3f), presumably because of the greater proportion of sequence length shared by the 30:70 and 50:50 (80%) relative to the 10:90 and 50:50 (60%). Also, there is evidence for a mutual attraction between the 10:90 and 50:50 (but not between the 30:70 and 50:50), in that the bootstrap support for the 10:90 grouping with parental sequence 1 was reduced from 100% (fig . 2) in showing that the phylogenetic position of a chimeric gene can vary substantially when different additional chimeric genes are sampled . We also found that chimeric genes can perturb phylogenetic analysis by producing branch length bias . First, certain chimeric genes were directly associated with elongated branch lengths . In the single - chimeric analyses, the 10:90 chimera had a notably longer branch length than sequence 1 (fig . 3c), with the (homoplasious) substitutions contributed by the 30% of the chimeric sequence originating from sequence 9 presumably responsible for this greatly extended branch length . Similar results were obtained in figure 3e h, where multiple chimeric sequences were included in each analysis . Second, the presence of the 50:50 chimeric in the single - chimeric analysis of figure 3d resulted in the loss of a molecular clock among the non - recombinant sequences in this analysis, with the branch leading to the (14) clade only 60% of the length leading to the (58) clade and the branch leading to the (912) clade only 58% of the length leading to the (1316) clade . There are consistently two additional albeit much less pronounced sets of branch length differences in the six trees (fig . 3b, c and e h) in which one or more chimeric sequences are sister to sequence 1 . The second set of simulations showed that chimeric sequences can also confound phylogenetic analysis by altering the placement of non - recombinant (native) sequences . In these simulations (fig . 4), we varied the absolute amount of sequence divergence across the tree, with the 50:50 sequence the only chimeric sequence in each analysis . Figure 4a shows the same tree as figure 3d, while figure 4b d has expanded divergence by a factor of 2, 5 and 10, respectively . As the simulated sequences become more divergent, the parental sequences show an increased and pronounced, tendency to be attracted toward the base of the tree by the chimeric gene . Also, the branch leading to the chimeric sequence becomes increasingly short, approaching zero in figure 4candd . It is important to note that this effect is not simply the result of there being increasingly more informative characters from figure 4a d . In analyses with 5 or 10 divergence (data not shown), but only 1/10th the sequence length (120 nucleotides rather than the 1200 in the simulations shown in figure 4), the topology and bootstrap values were essentially identical with those in figure 4candd, respectively, with these being substantially different from those in figure 4aandb . The different topologies shown in figure 4 must therefore result from deterministic effects arising from the varying levels of divergence in these trees . These simulations thus show that inclusion of chimeric sequences can distort the branching pattern of nonchimeric, native sequences and that the extent of this distortion varies directly with the absolute level of sequence divergence . (b d) maximum likelihood analysis of the same simulated sequences, but with increasing branch - length scales across the set of sequences: (b) 2 the scale in (a); (c) 5; and (d) 10 . Is based (for computational ease) on the concatenated sequences of the first 100 iterations, while the bootstrap support values are from all 1,000 trees . In a recent study, we reported the presence of three differentially mosaic types of mitochondrial atp1 genes in the angiosperm genus ternstroemia (pentaphylaceae, ericales) and concluded that they arose via dh - dc, with the blueberry genus vaccinium (ericaceae) the best candidate to be the donor group in the initiating hgt event . 12), each of the three major clades within ternstroemia possesses a differentially mosaic atp1 gene, each with multiple (four to five) foreign regions interspersed with native regions . In the one atp1 phylogeny presented in reference 12, the mosaic ternstroemia genes were all placed within the eriaceae, in a paraphyletic relationship with respect to vaccinium . Black vertical lines represent the 38 nucleotide positions inferred12 to have differed between donor and recipient atp1 genes at the time of atp1 transfer from vaccinium to a common ancestor of ternstroemia . Lines at the top of the boxes and red shading indicate sites and regions, respectively, of putatively foreign, vaccinium ancestry, while bottom lines and blue shading represent native sites and regions . White lines centered within the boxes represent the only two sites that otherwise differ within the ternstroemia clade . T - ips refers to the ternstroemia subclade containing t. impressa, t. peduncularis and t. stahlii) and t - glj to the subclade containing t. gymnanthera, t. longipes and t. japonica (see also fig . (a) chronogram showing organismal relationships and divergence times of relevant taxa belonging to the ericales . As described in reference 12, the chronogram was constructed by the beast program using a eurya reference fossil calibration of 86 myr ago . (b - f) maximum likelihood phylogenies of mitochondrial atp1 genes from the taxa shown in (a), with these analyses varying as to which members of ternstroemia (shown in red), whose atp1 gene is differentially mosaic, were included . A total of 1000 bootstrap iterations were performed, with all bootstrap values 50% shown on the trees . Phylogenies were rooted using fouquieria, marcgravia and pentamerista as unshown outgroups (hence the stub branch at the base of each gene tree). To better understand how mosaic genes affect phylogeny reconstruction, we sequenced the mitochondrial atp1 gene of chamaedaphne calyculata, a close relative of vaccinium, using the same set of primers and method as in reference 12, and employed it together with varying subsets of previously sequenced ericales atp1 genes in maximum likelihood phylogenetic analyses . Consistent with our recent study, and in contrast to organismal phylogeny (fig . 2a), in an analysis that included all relevant genes, the three types of mosaic atp1 genes in ternstroemia formed a paraphyletic assemblage, with t. fragrans sister to the vaccinium / chamaedaphne clade, the t - glj clade the most distant from the vaccinium / chamaedaphne clade and the t - ips clade in an intermediate position (fig . Remarkably, when only one type of mosaic atp1 gene was included in a given analysis, each of the three types fell in a different phylogenetic position (fig . 2c e). This shows that the phylogenetic position of a mosaic gene can vary depending on the inclusion of additional, related mosaic genes and emphasizes that this position provides little or no reliable information on the nature of the gene s parental sequences . 2b f) involves chamaedaphne, which was weakly placed (41% bootstrap support) within vaccinium when all mosaic genes were included (fig . 2b), but was placed as sister (with 6892% support) to a monophyletic vaccinium in the other four gene trees . This result raises the possibility that the inclusion of mosaic sequences in phylogenetic analyses can affect not only the placement of related mosaic sequences, but also the placement of apparently native sequences . We used simulation studies (conducted using seq - gen) to further explore the effects of chimeric sequences on phylogeny reconstruction . The following simulation parameters were chosen to be the same as those used in the above analysis of atp1 sequences: (1) sequence length, 1200 nucleotides; (2) substitution model, gtr; (3) gamma shape parameter, 0.218; (4) proportion of invariant sites: 0.371; (5) nucleotide frequencies, 0.271 (a), 0.207 (c), 0.261 (g) and 0.261 (t); and (6) gtr relative rate parameters, a <-> c = 0.818, a <-> g = 1.938, a <-> t = 0.244, c <-> g = 0.884, c <-> t = 2.219 and g all but the first of these parameters are based on phyml estimates derived from the mitochondrial atp1 alignment shown in figure s1, except with the mosaic ternstroemia genes excluded (as in fig . 2f) because recombinant genes have been shown to alter the estimation of substitution rate heterogeneity . The remaining simulation parameters were independent of the atp1 data and include the number of sequences, their topology, relative branch lengths and absolute amount of divergence (fig . For simplicity, only one recombination breakpoint was allowed in each chimeric sequence, with these chimerics constructed to contain varying proportions (from 50:50 to 10:90) of two of the 16 parental sequences generated by the simulations . The 16 purely - simulated sequences together with the artificially constructed chimeric sequence were used in phylogenetic analyses performed using raxml version 7.0.4 . Chimeric sequences were generated by combining the 5 and 3 portions of sequences 1 and 9, respectively (both circled in red), with different length ratios (10:90, 30:70 or 50:50) of the two parental sequences . Is based (for computational ease) on the concatenated sequences of the first 100 iterations, while the bootstrap support values are from all 1000 trees . Two sets of simulation analyses were performed . In the first set (fig . 3), we varied the parental proportions that comprise the chimeric sequence(s) and the number of chimeric sequences included in a given analysis . In analyses with a single chimeric sequence, this sequence grouped with 100% bootstrap support with its majority parental sequence when the parental ratio was 10:90 (i.e., when the chimeric sequence consisted of 10% of sequence 9 and 90% of sequence 1; fig . 3d), it went to the base of the tree, in between the two main clades of simulated sequences, and with bootstrap support reduced along the branches leading to both parental sequences . These results thus show that the phylogenetic position of chimeric genes can vary substantially as the proportion of parental sequences that comprise the chimerics varies . The phylogenetic position of the 50:50 chimeric sequence also varied substantially depending on whether it was the only chimeric sequence in the analysis (fig . 3d) or whether the 30:70 and/or 10:90 sequences were also included (fig . The 50:50 from the base of the tree to its periphery, together with the 30:70 and parental sequence 1 (and with the 10:90 when included) and with strong support (96% and 92%, respectively). This peripheral attraction was more subdued when the 50:50 was paired with the 10:90 (fig . 3f), presumably because of the greater proportion of sequence length shared by the 30:70 and 50:50 (80%) relative to the 10:90 and 50:50 (60%). Also, there is evidence for a mutual attraction between the 10:90 and 50:50 (but not between the 30:70 and 50:50), in that the bootstrap support for the 10:90 grouping with parental sequence 1 was reduced from 100% (fig . 2) in showing that the phylogenetic position of a chimeric gene can vary substantially when different additional chimeric genes are sampled . We also found that chimeric genes can perturb phylogenetic analysis by producing branch length bias . First, certain chimeric genes were directly associated with elongated branch lengths . In the single - chimeric analyses, the 10:90 chimera had a notably longer branch length than sequence 1 (fig . 3c), with the (homoplasious) substitutions contributed by the 30% of the chimeric sequence originating from sequence 9 presumably responsible for this greatly extended branch length . Similar results were obtained in figure 3e h, where multiple chimeric sequences were included in each analysis . Second, the presence of the 50:50 chimeric in the single - chimeric analysis of figure 3d resulted in the loss of a molecular clock among the non - recombinant sequences in this analysis, with the branch leading to the (14) clade only 60% of the length leading to the (58) clade and the branch leading to the (912) clade only 58% of the length leading to the (1316) clade . There are consistently two additional albeit much less pronounced sets of branch length differences in the six trees (fig . 3b, c and e h) in which one or more chimeric sequences are sister to sequence 1 . The second set of simulations showed that chimeric sequences can also confound phylogenetic analysis by altering the placement of non - recombinant (native) sequences . In these simulations (fig . 4), we varied the absolute amount of sequence divergence across the tree, with the 50:50 sequence the only chimeric sequence in each analysis . Figure 4a shows the same tree as figure 3d, while figure 4b d has expanded divergence by a factor of 2, 5 and 10, respectively . As the simulated sequences become more divergent, the parental sequences show an increased and pronounced, tendency to be attracted toward the base of the tree by the chimeric gene . Also, the branch leading to the chimeric sequence becomes increasingly short, approaching zero in figure 4candd . It is important to note that this effect is not simply the result of there being increasingly more informative characters from figure 4a d . In analyses with 5 or 10 divergence (data not shown), but only 1/10th the sequence length (120 nucleotides rather than the 1200 in the simulations shown in figure 4), the topology and bootstrap values were essentially identical with those in figure 4candd, respectively, with these being substantially different from those in figure 4aandb . The different topologies shown in figure 4 must therefore result from deterministic effects arising from the varying levels of divergence in these trees . These simulations thus show that inclusion of chimeric sequences can distort the branching pattern of nonchimeric, native sequences and that the extent of this distortion varies directly with the absolute level of sequence divergence . (b d) maximum likelihood analysis of the same simulated sequences, but with increasing branch - length scales across the set of sequences: (b) 2 the scale in (a); (c) 5; and (d) 10 . Is based (for computational ease) on the concatenated sequences of the first 100 iterations, while the bootstrap support values are from all 1,000 trees . The analyses reported in this study show that the inclusion in phylogenetic analyses of chimeric sequences arising from hgt and gene conversion can produce a variety of spurious phylogenetic results . These include the misplacement of both chimeric and native sequences, as well as branch length distortions . Accordingly, we introduce the term hgt turbulence as a general moniker for this category of phylogenetic artifacts . Mutually reinforcing evidence for these types of hgt turbulence was apparent in the phylogenetic analyses of both simulated sequences and a naturally occurring set of native and chimeric mitochondrial sequences, with the simulations providing greater it is also important to realize that while these simulations were framed and presented in the context of hgt, their results apply equally well to conversion between paralogs arising from internal gene duplication as to xenologs arising from hgt . Hgt turbulence is probably relatively common in bacteria, given the prevalence of hgt and recombination during bacterial genome evolution . For example, such diverse bacteria as neisseria meningitidis, streptococcus pneumoniae, helicobacter pylori and wolbachia have been found to be so recombinogenic that scientists have resorted to using multiple loci (e.g., multilocus sequence typing) as opposed to a single locus to identify clones . Surprisingly, however, the phenomenon of hgt turbulence has never been explicitly addressed in the bacterial literature . One reason for this is that these studies have mainly focused on minimizing the effect of recombination and thereby inferring accurate evolutionary relationships, or on quantifying the number of recombinant genes, rather than actually exploring the topological alterations caused by hgt turbulence . Also, the precise origins of horizontally transferred genes (or gene fragments) in bacterial genomes can be extremely difficult to recover, especially when transfer and/or subsequent recombination have occurred on a fine scale . Several other studies have used recombinant sequences in phylogenetic simulations, but most of these have focused on the issue of whether recombinants are detectable and/or how to detect them . Perhaps most relevant to our study is the 2002 study by posada and crandall, which also explored the relationship between the location of recombination breakpoints and the phylogenetic placement of recombinant sequences, reaching similar conclusion to ours on this point . However, none of these studies explored the effects of combining multiple, related chimeric sequences in the same analysis, nor did they show that chimeric sequences can, under certain conditions, substantially alter the phylogenetic behavior of native sequences . Further simulation studies on the effects of recombination on phylogenetic inference would therefore appear to be called for . Recognition of the remarkable frequency and extent of horizontal gene transfer, and its often great evolutionary importance, is arguably the greatest accomplishment of the past 15 years of comparative genomics research . Because hgt is so common and important, recognizing and properly dealing with hgt turbulence is likewise important . This is so not only because of the obvious need for obtaining accurate estimates of gene and species phylogeny, but also because otherwise too many cases of chimeric hgt, including complex situations involving dh - dc, will continue to go overlooked.
Breast cancer is the most frequently diagnosed nondermatological malignancy in women and ranks second only to lung in cancer - related deaths . While the incidence has increased over the past decade, (figures 1(a) and 1(b)) the mortality rate of breast cancer has gradually declined [2, 3] (figure 2). This improved survival may stem from earlier detection as well as improved therapies [2, 3]. Surgical resection was one of the first effective treatments for breast cancer and continues to play a critical role in the treatment of this disease . A multidisciplinary approach is now standard of care, involving a coordinated effort with the surgeon working in concert with the medical and radiation oncologist to achieve the best possible outcome for each individual . Improvements in both the quality and quantity of life for victims of breast cancer can be attributed to the advances made in each of these disciplines . As with all cancers, it is these early - stage cancers in which the most significant improvements in the operative management has occurred . Adoption of breast conservation surgery has allowed an increased focus on the cosmetic outcome, during a time that has also witnessed improved survival . This represents a clear victory for breast cancer patients, which needs to be extended to breast cancer of all stages . The greek physician galen is considered to be one of the earliest advocates of surgical treatment, recommending wide excision of breast tumors nearly 2000 years ago . Galen, like his predecessor hippocrates, also recognized that breast cancer should be considered a systemic disease . Hippocrates proposed that cancers were the result of an imbalance of the four basic humours - blood, phlegm, and yellow and black bile . He attributed an excess of black bile for postmenopausal women having a greater incidence of breast cancer, as premenopausal women were relieved of this excess black bile with regular menstruation . Although primitive, this concept can be extended to the current breast cancer treatment paradigm: systemic control of the disease at a molecular level, with local control by surgical intervention . While we now know that black bile does not result in breast cancer, the most effective breast cancer management embodies this concept of breast cancer as a systemic disease . These procedures consisted of amputation followed by cauterization, performed as rapidly as possible to minimize hemorrhage . Unfortunately, patients surviving the initial surgical procedure would all too frequently die of fulminant sepsis . In the late 19th to early 20th century, some of the most dramatic changes in surgical therapy for breast cancer were pioneered by william steward halstead . His approach to the mastectomy helped change the surgical therapy of the breast from a simple amputation to a formal procedure . His technique, now termed the radical mastectomy, involved en bloc resection of the breast, the pectoralis muscle, and the axillary contents . This procedure was as effective at initial local tumor control as any early technique, with the significant advancement of a dramatically decreased rates of recurrence that plagued halstead's predecessors . During halstead's era, prior to any understanding or capacity for early diagnosis, initial presentation of profoundly advanced tumors was the norm . Accepting halstead's basic principles, this evolved into dissection of the neck, abdomen, and even the mediastinum to remove diseased lymph nodes . Around the same period, early methods for surgical staging were developed, yielding a basic classification of patients with tumors in which radical mastectomy was potentially curative and those with disseminated cancer not appropriate for attempted resection . However, it would not be until the 1940s when evidence from preoperative staging brought the futility of what had become superradical mastectomies into question . Initial deviation from the tenets of halstead began in the late 1930s with an initial push for preservation of the nondiseased breast tissue during cancer resection . Shortly thereafter, postoperative radiotherapy was added for control of local tumor recurrence, laying the groundwork for breast conservation therapy (bct) as we know it today . Although bct was not significantly implemented in clinical practice until the 1980s, the stage was set for the current surgical treatment of breast tumors utilizing either bct or mastectomy . Optimal management of a patient with breast cancer includes establishing a pathologic diagnosis prior to any definitive operative intervention . Formal surgical excision in the operating room is rarely required to establish the diagnosis of breast cancer, as there are many alternative techniques to obtain tissue for diagnosis . For example, much pathologic information can be gained from small, 1 - 2 mm core the diagnosis of breast cancer is confirmed by histological evaluation, and the tumor is assessed for grade as well as human epidermal growth factor receptor 2 (her2), estrogen, and progesterone receptor status . This information is critical for optimal decision making regarding treatment options, most importantly allowing for coordination of care for those patients that will benefit from neoadjuvant chemotherapy prior to operative intervention . After the diagnosis of breast cancer is established, patients are evaluated to determine the extent of the disease . Standard of care includes bilateral mammography to identify any suspicious areas in either breast that will impact surgical management . Laboratory values that will assist in treatment recommendations include complete blood count, liver function tests, and alkaline phosphatase . There are not established tumor markers for breast cancers, although cancer antigen (ca) 15 - 3 and ca 27 - 29 may be helpful when elevated . Additional imaging studies to evaluate for metastatic disease are obtained depending on signs and symptoms of the patient, as well as the clinical stage at presentation . A bone scan is indicated if the patient has localized bony pain or elevated alkaline phosphatase, chest imaging is indicated for pulmonary symptoms, and abdominal imaging by computerized tomography is indicated for abnormal liver functional tests or abdominal symptoms . A review of the acquired data, including pathology, laboratory assessment, and imaging, allows the multidisciplinary team to make recommendations for definitive management of the patient with breast cancer . Those patients with evidence of advanced disease are typically managed medically with preoperative chemotherapy, prior to any definitive surgical management . Surgical treatment should allow the patient to be involved in the decision - making process, with the surgeon providing information about all surgical options available . Local excision alone is at times acceptable, usually in the setting of elderly or otherwise debilitated patients without adjuvant radiation . This decision must be carefully weighed and based on evaluation of tumor aggressiveness and comorbid conditions of the patient . First, tumors must be resectable with a pathologically clear margin, that is, a surrounding margin of breast parenchyma without disease . Secondly, patients undergoing partial mastectomy typically receive whole breast irradiation to achieve local control in the breast . Tumor size must be sufficiently small relative to the entire breast, such that the appearance of the breast is cosmetically acceptable following partial mastectomy . Pregnancy and a history of previous chest irradiation do not allow bct, as they are contraindications to the requisite postoperative radiotherapy . Positive margins after bct require a repeat attempt at excision or completion mastectomy to achieve clear margins . Findings of involved margins with partial mastectomy significantly increase the chance of disease recurrence . Mastectomy is indicated for the curative resection of tumors (i.e., absence of metastatic disease) not amenable to bct, and for those patients that do not want to consider conservation even though they meet criteria . The modern version of this procedure is termed the modified radical mastectomy, which entails removal of the breast, its underlying pectoralis fascia, and axillary contents, performed for more extensive disease . In addition to resection of the primary tumor, all invasive breast cancers require assessment of axillary lymph nodes for tumor invasion . The ipsilateral axillary lymph nodes are theoretically the first site that breast cancer is expected to spread, with the sentinel nodes representing the first group of nodes at risk for invasion . Assessment of the axillary nodes includes sentinel lymph node biopsy (slnb) during lumpectomy, or at the time of mastectomy . Injection of a dye and/or radio - isotope into the breast allows the surgeon to identify the first (sentinel) lymph node draining the tumor basin . Involvement of axillary nodes is considered regional disease (not metastatic) and is usually followed by complete axillary node resection . Furthermore, negative findings after a properly performed slnb allow a patient to avoid the potential for significant morbidity after axillary dissection . An all too common and often debilitating complication of this procedure is upper extremity lymphedema . In situ breast cancer this early neoplasm can be derived from a duct or lobule and is, therefore, referred to as lobule carcinoma in situ (lcis) or ductal carcinoma in situ (dcis). Lcis of the breast requires special consideration, as it is considered a marker for the future development of invasive breast cancer . The risk of developing invasive cancer is low, and if it occurs, histology tends to be favorable . For this group of women, lcis is managed by appropriate monitoring without additional intervention . The potential adverse reactions of these medications must be considered and balanced with the presumed risk reduction . In contrast to lcis, the diagnosis of dcis requires treatment for local control at the time of diagnosis . With the development of techniques for the earlier diagnosis of breast cancer, dcis is the only diagnosis in approximately 15% of newly diagnosed breast cancer patients . This finding must be addressed, as the survival rates for treated dcis are near 100%, but the development of invasive disease occurs in up to 30% of patients with untreated dcis . Although dcis is often found in conjunction with an invasive carcinoma, treatment for the invasive component takes precedence and dictates both surgical and medical management . In contrast to management of invasive disease, those patients with dcis usually do not require axillary dissection, as axillary nodal involvement in patients with pure dcis is unusual . As a small number will have axillary involvement, sentinel node evaluation should be performed if mastectomy is the chosen operation for local control . Starting in the mid - twentieth century, most notably in the lab of bernard fisher, early chemotherapeutic agents were being analyzed for use in the preoperative setting . The use of neoadjuvant chemotherapy (nact) prior to an attempted surgical resection represents a dramatic improvement in breast cancer therapy, addressing the systemic aspect of this disease . Locally advanced breast cancer entails large tumors or those that invade the chest wall or skin (t4) or have spread to the axillary nodes (n2 or n3). An excellent response to chemotherapy merits reassessment of the patient to ensure a concomitant clinical and radiological response . Eradication of all tumor after neoadjuvant chemotherapy is termed pathological complete response (pcr), strictly defined as the absence of invasive cancer from the breast and axilla on pathological assessment in response to chemotherapy . While achieving pcr has been found to increase long - term survival, a wide range of local recurrence rates (2.622.6%) after bct following neo - adjuvant therapy has been noted . One recent study indicates that her2 positive and positive axillary lymphadenopathy may predict this recurrence after pcr . While high risk populations certainly merit close postoperative surveillance for recurrent disease . Appropriately placing those patients achieving excellent response to chemotherapy into the algorithm for the surgical management of breast cancer requires further assessment . Improved methods are needed to predict those tumors best amenable to downstaging to bct, as certain patients may in fact be better candidates for mastectomy . Molecular tests such as the 21 gene (oncotype dx) and 70 gene (mammaprint) assay, that provide tumor - specific scores reflecting risk of recurrence, may become useful in this scenario . The effectiveness of nact for locally advanced disease eventually led to the use of pre - operative treatment in an attempt to downstage even more advanced cancer to a scope amenable to treatment by mastectomy . A recent extension of these principles is the use of chemotherapy to downstage tumors, in order to avoid mastectomy altogether in lieu of bct . Nact is indicated for tumors meeting all criteria for breast conservation (see above) except for tumor size . An excellent response in this scenario has now allowed the option for bct in a patient who would have required a mastectomy . Most of the recent advances in the surgical management of breast cancer follow the basic template of ever more conservative surgical resections . The first involves operative breast cancer therapy with a concomitant focus on breast reconstruction, known as oncoplastic breast surgery . This trend represents another advancement made possible by the refinements in the use of postoperative radiation, the same concept that led to the advent of bct . Oncoplastic surgery entails the use of plastic surgery techniques to restore cosmesis and natural symmetry, ideally during cancer resection . Plastic surgery techniques utilized include breast augmentation and reduction, flaps, implants, and expanders, on both the diseased and the normal breast if necessary to achieve the desired symmetry . Indications are still widely debated, but appropriate candidates are those that have sufficient residual breast after the oncological resection to facilitate the necessary reconstruction . One of the most recent advances in surgical therapy involves management of the positive sentinel lymph node biopsy (slnb). Substantial morbidity, not unlike that which was seen in the days of halstead, all too often follows . However, a recent study has demonstrated that high - risk patients with small tumors (t1-t2) and limited lymph node spread, who are able to receive radiotherapy, do not benefit further from complete axillary lymph node removal . Simply stated, survival for small breast tumors with limited spread does not improve after axillary dissection in older individuals or those with significant medical problems . This early work has found that this subset of patients suffer more from the complications of the procedure than benefit . The adjuvant radiotherapy therapy given for this early - invasive disease seems to provide most of the survival benefit . A recent trend including surgery as cancer prevention has gained wide acceptance . Contralateral prophylactic mastectomy (cpm) has been found to decrease the risk of development of a cancer in the disease - free breast in women at high risk . Those women harboring a brca mutation or a strong family history of breast cancer may be considered candidates for prophylactic bilateral mastectomy . As mentioned previously, with the diagnosis of lcis, the risk of developing an invasive breast cancer is equal in both breasts, such that bilateral mastectomy may be necessary for true risk reduction . Many women, in an otherwise low - risk category, also opt for cpm after a newly diagnosed breast cancer . While recent data suggests an increased overall as well as disease - free survival after cpm, the debate is ongoing regarding the appropriate indications for cpm . Similarly, the quest to identify the population benefiting the most from this intervention must be equally rigorous . The most successful operative management of metastasis is prophylactic: appropriate screening for detection of suspicious lesions of the breast, followed by appropriate local control to minimize the potential for metastatic dissemination . This is reflected in recent trends showing improved survival of breast cancer patients, as screening and early intervention has translated into improved outcomes . After the diagnosis and completion of treatment of a primary breast cancer, surveillance for recurrence or metastatic spread ensues . Followup entails focused clinical and laboratory assessment, and mammography to detect new or recurrent lesions . The discovery of metastatic disease at any point merits a complete reevaluation . Traditionally, surgical intervention was avoided in the patient harboring metastatic disease, due to a perceived lack of benefit . Only those patients with extremely limited metastatic lesions were considered for therapeutic resection . For the most part, patients found to have metastatic disease were deferred to induction chemotherapy in the hopes of an excellent response and prolongation of life . Most traditional use of surgical intervention in the setting of metastatic disease was for palliative purposes, at either the primary tumor site or any distant metastatic lesions . For example, resection of the primary tumor was considered for persistent infection, bleeding, or general difficulty maintaining cleanliness . However, many recent studies have been able to challenge this practice of avoiding intervention on the primary tumor in the setting of metastatic disease . Early studies indicate that resection of a primary breast lesion may increase survival in the setting of limited metastasis . This effect probably stems from more effective and specific chemotherapy, but randomized trials are needed to define both the optimal candidates and indications for this intervention . However, the significance of the early findings of reduced need for chemotherapy, improved quality of life, and even long - term cures with the concomitant resection of (limited) metastatic lesions cannot be overstated . Operative intervention for metastasic lesions is typically palliative, involving the treatment of a symptomatic mass . This may entail bypassing an obstructing metastatic lesion in the bowels, utilizing a normal segment of bowel to allow free flow of intestinal contents . However, aggressive resection of metastatic lesions for curative intent has gained favor in recent years . The best studied is the resection of metastatic lesions to the lung, in which long - term success and even some cures have been reported . The patients most amenable to metastasectomy are those with limited metastatic burden (oligometastases) with hormonally responsive tumors . It is a well - known fact that the most common site of breast cancer metastasis is the bone, with breast cancer being the leading cause of bone metastasis of any cancer in women . However, it has recently been demonstrated that the basic breast cancer subtypes (luminal a, luminal b, her-2 positive, and basal) differentially target certain sites for metastasis . For example, the her-2 positive and triple negative subtypes have been shown to preferentially metastasize to the brain over the other subtypes . While this represents an interesting finding, further investigation is needed to translate this data into clinical practice . For example, knowledge of the presence of a basal phenotype in a high risk patient may merit more aggressive, organ - specific followup . Surgical resection of breast cancer is absolutely curative if performed while the primary tumor is contained . Escape of tumor cells from the primary lesion completely changes therapeutic management, expectations, as well as outcomes . Interestingly, some early stage tumors, all of which were previously assumed to be self - contained, have been shown to harbor the capacity for systemic tumor dissemination . While there is no method to accurately predict which tumors have this devastating capacity, certain factors such as large tumors, younger age at diagnosis, vascular invasion, and nodal involvement have been found to be associated with a high risk of developing distal metastasis after appropriate treatment [22, 23]. The best treatment option currently available is effective loco - regional control of the primary tumor . Most studies have found that obtaining at least a 2 millimeter margin for invasive and in situ breast cancer best minimizes the chance of local recurrence [24, 25]. This threshold has consistently led to reduced local recurrence rates, while balancing the potential for an overly aggressive resection . Effective local control removes the nidus for both local and distant recurrence, emphasizing the management of the primary tumor on the systemic aspect of the disease . This effect is exemplified by the significant increase in distant metastasis rates and subsequent survival with the development of a local recurrence of a resected breast tumor [2226]. Further evidence that breast cancer, even at its early stages, can be a systemic disease can be found in animal studies and early analysis in cancer patients . Utilizing pcr and immunohistochemistry, increased cancer - related cells have been demonstrated in the systemic circulation due to surgical manipulation [2730]. Needle biopsies of primary tumors have even been found to result in increased rates of nodal metastasis [31, 32]. Tumor cells that break off from the primary site and enter the systemic circulation are referred to as circulating tumor cells (ctcs). While the ctcs were first described over a century ago, current methods allow for the enrichment of ctcs by antibody - mediated targeting of the epithelial cell adhesion marker (epcam). While the clinical usefulness of ctc assessment is controversial, some consider that greater than five ctcs is the breaking point for a poor prognosis in breast cancer [33, 34]. Detection of ctc has been used to demonstrate significant shedding of putative tumor cells into the systemic circulation during surgical manipulation . While this shedding is known to occur in both breast and lung cancers, the functional result and ability of these cells to successfully migrate and seed distant sites is not known . Furthermore, some hypothesize that the tissue trauma resultant from needle or operative manipulation may lead to the expression of an invasive or metastatic phenotype . This alteration may lead to cancer progression or the release of ctcs, respectively . Pathways implicated in these effects are normal and appropriate wound healing responses, such as those involved in inflammation and angiogenesis . With the continued technological improvement for the detection of ctcs, determining the clinical relevance of these effects may become possible . The assessment of ctcs could one day provide the basis for highly specific real - time biopsies, yielding a strong potential for the modification of surgical techniques and traditional indications . The capacity to harvest and analyze ctcs could become a key feature of individual tumor profiling, allowing for patient - specific therapies to further reduce the current complication profile of today's interventions [8, 40]. Even so, recent advances represent significant steps away from the extensive resections performed by halstead and his predecessors . While these early attempts successfully decreased local recurrence rates, advances in the treatment of breast cancer as a systemic disease were needed to facilitate long - term cures . Continued improvements in early diagnosis via breast imaging, advanced prognostic tests, patient - specific molecular diagnosis, and the development of targeted chemotherapeutic agents, breast cancer therapy will become more focused, increasing efficacy and reducing complications of all the treatment disciplines . This will move the bar closer to the ultimate goal of transforming breast cancer into an easily targeted, readily manageable disease.
Rare fungi have recently been implicated in human infections ranging from colonisation to invasive fungal infections (ifis) in immunocompromised patients, accounting for <10% of all isolated fungal pathogens.1 pseudozyma species (spp .) Are basidiomycetous yeast classified in the family ustilaginaceae, and its members are close relatives of ustilago maydis and other smut fungi . Infections in humans have rarely been reported after the first description as a human pathogen in 2003.3 data regarding the clinical characteristics and pathogenicity in humans remain insufficient . Recently, we experienced a case of pseudozyma aphidis fungaemia with invasive fungal pneumonia after reinduction chemotherapy for acute myeloid leukaemia (aml). Here, we describe this case and review the global literature . Mary's hospital approved this case report and waived the need for patient consent (no . A 51yearold man who was diagnosed with aml and had not experienced remission after the first induction chemotherapy started reinduction chemotherapy with 100 mg m cytarabine for 7 days and 90 mg m daunorubicin for 3 days . On day seven after reinduction chemotherapy (d7), neutropenic fever (up to 38.0 c) developed as measured using an axillary thermometer . Laboratory data included a white blood cell count of 220 l (absolute neutrophil count, 0 l) and creactive protein level of 8.60 mg dl . Empirical antibiotic therapy with ceftazidime (2 g twice a day) and isepamicin (400 mg once a day) was initiated after performing blood cultures . On d8, the results of the blood culture revealed presumptive growth of grampositive cocci (gpc). Teicoplanin (12 mg kg a day after loading with 12 mg kg every 12 h for three doses) was added based on the culture results . Although the patient had no respiratory symptoms, infiltration was suspected in the right lower lung field on the chest radiograph on d9 . Lowdose computed tomography of the lung was performed, which showed consolidation with surrounding ground glass opacity at the medial segment of the right middle lobe (rml) (fig . The patient received fluconazole instead of posaconazole as the primary antifungal prophylaxis; because he had participated in a clinical trial using a thrombopoietin receptor agonist during the same period, a drug interaction was possible . Then, the antifungal prophylaxis was empirically changed to caspofungin (50 mg a day after the loading dose) for the possibility of fungal pneumonia according to the revised definition of ifi from the european organization for the research and treatment of cancer / mycoses study group (eortc / msg).4 low dose computed tomography of the lung . Consolidation with surrounding ground glass opacity at the medial segment of the right middle lobe . The gpc from the blood culture was identified as vancomycinresistant enterococcus faecium (3 of 4 bottles), using vitek 2 (biomrieux, hazelwood, mo, usa). However, the neutropenic fever persisted, and yeastlike organisms were noted from central blood culture (1 of 2 bottles) performed on the same day (d11). This culture result was reported after 2 days of incubation, using bd bactec fx blood culture system (bd diagnostics, sparks, md, usa). Colonies observed on the blood agar plate were white, dry or wrinkled (fig . The species could not be identified using either vitek 2 or api 20c (biomrieux). Therefore, further identification was performed using rdna gene sequencing analysis with the following primers: internally transcribed spacer (its)1 (forward primer [5tcc gta ggt gaa cct gcg g3] and reverse primer [5gct gcg ttc atc gat3]), its2 (forward primer [5gca tcg atg aag aac gca3] and reverse primer [5tcc tcc gct tat tga tat3]), and d1/d2 domain (forward primer [5gca tat caa taa gcg gag3] and reverse primer [5ggt ccg tgt ttc aag acg g3]).5 the isolated gene sequence showed 100% concordance with the p. aphidis strain (genbank accession number: kf443199.1 and kf443201.1). Because the fungaemia developed during the caspofungin therapy and pneumonia was aggravated with persistent neutropenic fever, caspofungin was changed to liposomal amphotericin b (5 mg kg per day) on d15 . Yeastlike colonies that are dry, creamy, brightly coloured, and glabrous in texture; (b) gram stain showing yeast with branching pseudohyphae (arrow). The followup blood culture performed on transbronchial lung biopsy and bronchial washing and brushing were performed at the rml bronchus to identify the pathogens of fungal pneumonia . Pathology specimens showed inflammatory changes with necrosis and dichotomous hyphae with a septum, suggestive of organising pneumonia with a fungal infection (fig . As the neutropenia recovered, the patient improved clinically and was discharged with itraconazole capsules (200 mg twice a day). At the outpatient clinic, chest radiography revealed little change in the rml consolidation despite 3 weeks of continued itraconazole . Considering the possibility of both proven invasive pulmonary aspergillosis and fungal pneumonia due to pseudozyma spp . The patient sequentially received consolidation chemotherapy and allogeneic stem cell transplantation (sct) while continuing the voriconazole . During the voriconazole treatment, serum level of voriconazole was within the therapeutic range . The pneumonia resolved after 4 months of voriconazole treatment, with complete remission of aml after successful sct . (a) haematoxylin and eosin stain, 100; (b) haematoxylin and eosin stain, 400; (c) silver stain, 400 . Invasive fungal infections remain a major cause of significant morbidity and mortality in immunocompromised patients, especially those with hematologic malignancies . Of the ifis, a rare fungus is difficult to treat in the aspects of the early diagnosis and appropriate treatment, which might be related to the severity of the patient's condition and often challenging intrinsic susceptibility pattern of the pathogens.6 pseudozyma spp . Was first described as a possible human pathogen in 2003, when it was identified from blood cultures from three thai patients, as p. antarctica, p. parantarctica, and p. thailandica.3 the first case of p. aphidis human infection was reported in a 7yearold girl with short gut syndrome in 2008.7 pseudozyma spp . Is classified under the family ustilaginaceae, phylum basidiomycota, subphylum ustilaginomycotina, class ustilaginomycetes, and order ustilaginales.2, 8 ustilaginales are plant pathogens that can infect corn plants to produce tumourlike galls . Of the pseudozyma spp . Aphidis is known as the most common human pathogen . However, due to the rare isolation of p. aphidis in human infections, this rare fungus species cannot be identified using commercial systems that are available in routine diagnostic laboratories . However, sequencing and phylogenetic analysis can help with the direct detection of a fungus from blood or tissues because yeast taxonomy is continually evolving . We retrospectively reviewed the global literature to identify the possible risk factors, clinical presentation, and optimal treatment strategies for pseudozyma infection; in addition to the present case, 14 case reports were found (table 1).3, 7, 8, 9, 10, 11, 12, 13, 14, 15 since 2014 when previous literature review was reported by prakash et al . Therefore, we present a updated literature review with some modifications and adding recent cases . Of the 15 cases, level identification, and the remaining six cases were nonaphidis pseudozyma isolates that were all different spp . From thailand . Of the nine cases with reported underlying medical conditions, three had gastrointestinal (gi) tract problems such as short bowel syndrome or intestinal surgery,4, 9, 13 and three had neutropenia7, 14, 15 which can damage the gut mucosa . Of the seven patients for whom the presence or absence of a central venous catheter (cvc) was reported, six patients had a cvc . The risk factors are thought to be similar to those of other less common yeast infections including gi tract problems, the presence of a cvc, and neutropenia . We could not identify the exact social history or dietary history to determine potential exposure to plants or crops . However, crop exposure was identified in two cases: a farmer with mycetoma of the leg and a paediatric patient who had eaten corn chips.8, 10 in the present case, the possible port of entry for the p. aphidis fungaemia is uncertain . While the fungaemia met the definition of a catheterrelated bloodstream infection because p. aphidis was isolated only from central blood, the origin of p. aphidis is unclear . Literature review of pseudozyma species infections in human amb, amphotericin b; aml, acute myeloid leukaemia; cas, caspofungin; cvc, central venous catheter; flc, fluconazole; itc, itraconazole; lamb, liposomal amphotericin b; mic, minimal inhibitory concentration; n / a, not available; tpn, total parenteral nutrition; vrc, voriconazole; 5fc, flucytosine . Histopathology of deep tissue from the foot showed grains surrounded by inflammatory cells, periodic acidschiff stain showed clustered yeastlike cells, and tissue cultures showed septate hyaline hyphae on a wet mount . The major manifestation of pseudozyma infection is fungaemia (12 of 15 cases, 80%); others (n = 3) have been isolated from a brain abscess that developed after brain surgery, deep biopsy of mycetoma of the leg, and pleural fluid.9, 10, 11 in our case, we proved p. aphidis fungaemia with fungal pneumonia from lung tissue . However, our case has a limitation, in that we could not identify the fungal pathogen from the lung tissue . Antifungal susceptibility testing was performed in 11 cases of human infections caused by pseudozyma spp ., p. aphidis was susceptible to itraconazole, voriconazole, and amphotericin b; had varying susceptibility to fluconazole; and was resistant to echinocandines and flucytosine.7, 8, 11, 14, 15 nonaphidis pseudozyma spp . Seemed to have susceptibility to amphotericin b only.13 in all reported cases, pseudozyma spp ., we described a case of a 51yearold male patient with aml who suffered from neutropenic fever during chemotherapy with a defined bacterial and fungal infection that was finally diagnosed as p. aphidis fungaemia and concurrent invasive fungal pneumonia without genus level identification . Many other fungal pathogens show subtle morphological differences between forms found in tissue and in culture this case is worth reporting in the aspect that p. aphidis fungaemia developed during neutropenic fever with concurrent invasive fungal pneumonia in an aml patient.
Concomitant chemo - radiotherapy, mainly with cisplatin is the standard combined modality approach for the treatment of patients with locally advanced squamous cell carcinoma of the head and neck (scchn) region, because it prolongs survival and increases the chance of organ preservation compared to radiotherapy (rt) alone [13]. Several potential mechanisms, through which cisplatin acts as a radiosensitizer, have been reported reviewed in . Single - agent cisplatin (100 mg / m) administered every 3 weeks concomitantly with rt is widely used since this high dose confers a systemic effect and at the same time acts as a radio - sensitizer . However, the therapeutic benefit derived from the combined modality is counterbalanced in many cases by prohibitive toxicity, mainly neurotoxicity, ototoxicity, emesis, and stomatitis . In order to reduce cisplatin - related toxicity, several investigators tested alternative schedules of cisplatin administration, such as daily or weekly infusions . The use of these different schedules is supported by in vitro data showing that low doses of cisplatin and rt, when combined, act synergistically in cell killing . During the last few years, investigators within the hellenic cooperative oncology group (hecog) had adopted the weekly schedule of cisplatin concomitantly with rt for the treatment of patients with locally advanced scchn . It is well documented that epidermal growth factor receptor (egfr) is overexpressed in 42% to 80% of scchn cases egfr plays a pivotal role in proliferation and survival of scchn cells and its overexpression is associated with advanced stages and poor outcome [10, 11]. In previous studies egfr expression was proposed as an even stronger predictor of locoregional control than t stage . Furthermore, egfr is an important determinant of response to rt and confers protection of cancer cells from the lethal dna damage induced by ionizing radiation [1214]. The main mechanisms through which egfr confers radio - protection have recently been reviewed . In vitro studies suggest that tumors could be sensitized to irradiation by blocking the radiation - induced nuclear import of egfr, either through the expression of egfr tyrosine kinase domain activating mutations or the use of cetuximab (erbitux, merck - serono). Cetuximab binds egfr, sequesters the receptor in the cytoplasm and eventually targets it for degradation . It has been demonstrated in vitro that this antibody enhances the radio - sensitivity in scchn cells [16, 17] through several processes reviewed in [18, 19]. Because patients with locally advanced scchn recur locally more often than in distant sites [20, 21], it seems reasonable for patients with egfr overexpressing tumors to receive more effective locoregional treatments . This rationale is supported by preclinical models, in which cetuximab acts synergistically with rt . In a pivotal randomized phase iii trial the concomitant administration of cetuximab and rt improved locoregional control and prolonged survival compared to rt alone in patients with locally advanced scchn . Following the introduction of cetuximab concomitantly with rt for the treatment of locally advanced scchn, a number of greek oncologists used rt with concomitant administration of cetuximab and weekly cisplatin (herein named ccrt), as a treatment strategy for such patients . The background behind this approach was the fact that cetuximab increased both locoregional control and survival of such patients . Therefore, it seems logical to add cisplatin to this active combined therapeutic approach to further improve outcome, especially since this empirical approach is supported by in vitro studies . It has been shown in vitro and in tumor specimens that the expression of the ligand hepatocyte growth factor (hgf) scatter factor and its receptor hgfr (met) increase during invasive growth of scchn and this pathway, by constitutively co - activating other important pathways, may play a critical role in the metastatic process of scchn cells . The ercc1 (excision repair cross - complementation group 1), gene is one of 16 genes encoding for proteins of the nucleotide excision repair complex, which removes cisplatin - induced dna adducts . Ercc1 was shown in a randomized study to be a significant predictive factor in patients with completely resected non - small - cell lung cancer (nsclc) treated with cisplatin - based adjuvant chemotherapy . In the above study polymorphisms in the 3-utr of ercc1 and in the coding regions of the ercc2/xpd and xrcc1 genes have been associated with disease prognosis and response to cisplatin in scchn patients . Matrix metalloproteinases (mmps) are a family of zinc - dependent proteinases that play an important role in the destruction and repair of the extracellular matrix and basement membranes in various physiological and pathological processes, including gastrointestinal inflammation and carcinogenesis [29, 30]. Importantly, the activation of the mmps liberates growth factors from the extracellualr matrix, including egfr, fgfr and pdgfr ligands . Preclinical studies have demonstrated that mmp9 plays an important role in tumor - induced angiogenesis as well, with tumor - associated inflammatory and stromal cells being the main source of the proteinase . Mmp9-mediated release of vascular endothelial growth factor (vegf) and recruitment of pericytes to the angiogenic vasculature have been postulated to be the major processes involved in mmp9-stimulated angiogenesis . In the present retrospective analysis we report our experience with the use of ccrt in patients with locally advanced scchn . To our knowledge furthermore, we evaluated the association of a variety of potential tumor biomarkers with the observed response to ccrt . The medical records of 37 patients with newly diagnosed, histologically confirmed locally advanced nonnasopharyngeal scchn tumors, treated with ccrt in four centers, in which the aforementioned therapeutic strategy was adopted, were retrospectively reviewed . Patients amenable for this type of treatment had to have an age of> 18 years, performance status (ps) 0 - 1 on the eastern cooperative oncology group (ecog) scale and adequate bone marrow, hepatic and renal function to tolerate treatment . According to our standard practice, a written informed consent was obtained from each patient before the acquisition of biological material for research purposes . All patients were treated with a linear accelerator with the intention to receive definitive rt (70 gy to the tumor area and 45 gy to the rest of the neck) concomitantly with weekly cisplatin 40 mg / m and weekly cetuximab 400 mg / m, as a loading dose during the first week and 250 mg / m on weeks 27 . Before treatment administration, all patients were hydrated and given standard premedication . Drug doses were modified according to the grade of side effects as previously described [7, 33]. Details on the rt technique, as routinely used in our centers, have been previously described as well . All adverse events were graded for this analysis according to the national cancer institute common toxicity criteria (nci - ctc, version 3.0). The radiation therapy oncology group (rtog) criteria were used to assess rt - related toxicities . Approximately three months after the completion of ccrt, all patients underwent a work - up including endoscopic examination, chest x - ray, an ultrasound or computer tomography (ct) scan of the liver, and a ct scan or mri of the head and neck region . In selected patients, especially those with a partial response (pr), an [f] fluoro - deoxy - d - glucose (fdg) positron emission tomography (baseline and post ccrt scans were retrospectively collected and reviewed by a radiologist (a. k - f .) Formalin - fixed paraffin - embedded (ffpe) tumor tissue from 36 patients was used for protein and gene analysis . Representative slides (h&e) from the tissue blocks were reviewed by two experienced pathologists (g. k. and m. B.) For confirmation of the diagnosis, adequacy of material and calculation of the percentage of tumor in each case . Thirty - two specimens were arrayed (2 cores per case, 1.5 mm in diameter) into a recipient paraffin block (paraplast, mccormick, saint louis, mo, usa) using a manual arrayer (beecher instruments, sun prairie, wi, usa). The tma block also included tissue cores, in the first and the last column, from skin, tonsil, placental, kidney, thyroid, ovarian, prostate, and urothelial carcinoma that served as positive and negative controls . Immunohistochemical labelling was performed according to standard protocols with slight modifications on serial 3 m thick sections, form the original blocks or the tma block . As previously reported, the reproducibility of tma immunostaining of different proteins compared to that obtained from whole sections of the original paraffin blocks is very high . The deparaffinization, antigen retrieval and staining procedures for egfr [clone 31g7, zymed (invitrogen), carlsbad, ca, usa; dilution 1: 50], ercc1 (clone 8f11, neomarkers, fremont, ca, usa; dilution 1:450), p16 (clone spm304, spring bioscience, fremont, ca, usa; dilution 1: 150), and p-53 (clone do-7, dako, glostup, denmark; dilution 1: 50) were performed using a bond max autostainer (leica, wetzlar, germany). The hepatocyte growth factor receptor (hgfr / met) protein was investigated using an antibody specific for the external domain of the beta chain of the met protein (clone 8f11, novocastra, newcastle upon tyne, uk). After deparaffinization and antigen unmasking, the slides were incubated for 1 hour at room temperature with the met antibody at a dilution of 1: 50 . After washing the primary antibody, the slides were incubated with a nonbiotin polymer detection system (biogenex, san ramon, ca) for a total of 40 minutes . The antigen antibody complex was visualized using diaminobenzidine (biogenex) as a chromogen . Slides were counterstained with mayer's hematoxylin for 5 min (leica), washed in fresh water, dehydrated, and mounted . The evaluation of all ihc sections was done simultaneously by two pathologists (g. k. and m. B.) Blinded as to the patients' clinical characteristics and survival data, according to previously proposed / established criteria with slight modifications . Egfr intensity of reactivity was scored using a four - tier system; 0 (negative), no staining or background staining; 1 +, definitive cytoplasmic staining and/or weak discontinuous membranous staining; 2 +, moderate complete or incomplete membranous staining; 3 +, strong complete membranous staining . Cases were considered positive when more than 10% of tumor cells showed at minimum 1 + staining, while 2 + or 3 + staining was classified as egfr protein over - expression . Ercc1 evaluation of nuclear staining was done according to the criteria proposed by olaussen et al . . The above system was based on a semi - quantitative h score, which combines the stain intensity and the percentage of positive tumor cells . The median of all h scores was chosen as the cut off point for separating positive from negative cases . Hgfr (met) protein expression was evaluated using an intensity - adjusted scoring system (combining percentage and intensity of staining) according to nakajima et al . . Briefly, intensity scores ranged from 0 to 3 (0 = no staining, 1 = weakly positive, 2 = moderately positive, and 3 = strongly positive staining), and the staining pattern based on the percentage of positive tumor cells ranged from 03 (0 = 0 to 5%, 1 = 6 to 25%, 2 = 26% to 50%, and 3 = 51% to 100%). Cases with a total score of at least 2 were considered positive (expressing tumors), whereas cases with a total score of 0 - 1 were grouped together and considered to be negative or low expressing tumors . For p-53 protein expression, cases were scored as negative or positive, if 10% of nuclei or> 10% of nuclei were stained, respectively . Fish was performed on 4.5 m thick tma sections or whole sections of ffpe archival tissue samples using the lsi egfr / cep7 dual color probe, (abbott molecular, des plaines, il, usa), the lsi d7s486/cep7 dual color probe, (abbott molecular) and the specific for the hgfr / met gene at region 7q31, poseidon repeat free met / se7 probe (kreatech diagnostics, amsterdam, nl). The egfr probe, detecting a 300 kbp genomic region spanning the egfr locus on 7p12, and the lsi d7s486 detecting a 200 kbp genomic region at region 7q31, were labelled with spectrumorange, while the centromere 7 specific probe (cep7) was labelled with spectrumgreen . The lsi d7s486/cep7 dual color probe was used to identify deletions in 7q31 that have frequently been detected in scchn patients, suggesting the existence of tumor suppressor genes . The hgfr / met gene probe was directly labeled with platinumbright550 and the se7 (chromosome 7 satellite enumeration) probe with platinumbright495 . Fish was performed according to the manufacturer's protocol with minor modifications . Briefly, for all probes the deparaffinized tissue sections were incubated in citric acid solution, ph 6.0 for 10 min at 98c . After washing twice for 2 min in dh2o, slides were treated with a proteinase k solution for 10 min at 37c in a hybridizer (dako), washed for 5 min in 2xssc solution and 1 min in dh2o, and dehydrated (75, 85 and 100% ethanol, each for 1 min). Five to 15 l of the probe mixture were then applied to each slide, slides were covered by cover slips, sealed with fixogum rubber cement, heat denatured for 5 min at 72c (lsi egfr / cep7 and lsi d7s486/cep7) and 80c (met / se7) on a hot plate, and hybridized for at least 16 h at 37c in a humidity chamber . After removing the cover slips by incubation in wash buffer (ssc, 0.3% np-40), slides were washed for 7 min with wash buffer at 72c . Subsequently, slides were dehydrated in 70%, 90% and 100% ethanol, each for 1 min, air dried protected from light, and finally nuclear counter staining was carried out with dapi / antifade solution (zytovision). In 3 cases, due to inadequate material for the fish assays we perform sequential multilocus fluorescence in situ hybridization (sml - fish) according to walch et al ., with slide modifications . After image acquisition, the slides previously hybridized with the lsi d7s486/cep7 were washed by heating the section in ssc solution at 75c for 16 hours, followed by denaturation at 73c for 5 minutes in 70% formamide / ssc . Then, the slides were counterstained with dapi and examined under fluorescence (x100 oil lens) to ensure absence of fluorescent signals . The hybridization, posthybridization and nuclear counterstaining procedure for the met / se7 probe was performed as mentioned above . Slides hybridised with the egfr / cep7 probe were analyzed using a zeiss fluorescence microscope (axioskop 2 plus hbo 100) equipped with high quality objectives and an appropriate filter set . Slides hybridized with the lsi d7s486/cep7 and met / se7 probes were analyzed using the nikon 80i fluorescence microscope (nikon gmbh, dusseldorf, germany) with a motorized 4 slide stage, equipped with high quality objectives (all form nikon), an appropriate four filter set [dapi, doublepath firc / tritc, zygreen that is similar to abbott molecular spectrumgreen and kreatech's platinumbright550, and zyorange that is similar to abbott molecular spectrumorange and kreatech's platinumbright495 (all from chroma technology corp, rockingham, vt, usa)] and an ultrasensitive black and white camera (qimaging, surrey, bc, canada). As a source of fluorescence illumination, the x - cite 120 (exfo photonic solutions inc, ontario, canada) equipped with a long - life 120-watt metal halide short arc lamp was used . For the assessment of the fish assays, in the majority of the cases, over 10 fields (x100) were captured by a computer - controlled digital camera and processed by commercially available software systems (fish imager metasystems, altlussheim, germany for egfr / cep7 and xcyto - gen, alphelys, plaisir, france for lsi d7s486/cep7 and met / se7). For the latter probes, sequential, digital images were captured by a stack motor for the dapi (1 or 2 planes at 0.5 m), zygreen (5 planes at 0.85 m or 4 planes at 1.15 m) and zyorange (5 planes at 0.85 m or 4 planes at 1.15 m) filter settings, and the resulting images were reconstructed with blue, green and red pseudo - colors . Sixty nonoverlapping intact nuclei from the invasive part of the tumor were evaluated for each case according to morphological criteria using dapi staining . The evaluation of the fish sections was done simultaneously by two observers (g. k and m. b). For each specimen, the absolute and mean copy number per cell of each dna probe, the total number and percentage of cells with zero, one, two, three, and> 4 copies of the respective probe, homozygous and heterozygous deletions, trisomies and polysomies, as well as the gene / cep7 ratios were calculated . The status of the d7s486 locus was evaluated as follows: deletion if> 35% of tumor nuclei contained one signal; trisomy / polysomy if> 10% of tumor cells showed two or more copies of the d7s486 locus and chromosome 7 . Hgfr / met gene status was classified according to cappuzzo et al . By six fish strata as follows: (1) disomy (2 copies in> 90% of the cells); (2) low trisomy (2 copies in 40% of cells, 3 copies in 1040% of the cells, 4 copies in <10% of cells); (3) high trisomy (2 copies in 40% of cells, 3 copies in 40% of cells, 4 copies in <10% of cells); (4) low polysomy (4 copies in 1040% of cells); (5) high polysomy (4 copies in 40% of cells); and (6) gene amplification (defined by the presence of tight egfr gene clusters and a ratio of egfr gene to chromosome of 2 or 15 copies of egfr per cell in 10% of analyzed cells). For this retrospective study, intact rna of high quality, as determined by analysis of the housekeeping gene rpl37a, was isolated from 33 ffpe tumour tissue samples employing an experimental method based on proprietary magnetic beads from siemens healthcare diagnostics (cologne, germany), as previously described . The number of malignant cells represented at least 30% of all nucleated cells per section, as verified by hematoxylin - eosin staining . Kinetic reverse transcription - polymerase chain reaction (krt - pcr) was applied for the assessment of messenger rna (mrna) expression of egfr, ercc1 and mmp9 using the following taqman based primer / probe sets: egfr probe ccttgccgcaaagtgtgtaacggaat forward primer cgcaagtgtaagaagtgcgaareverse primer cgtagcatttatggagagtgagtct forward primer cgcaagtgtaagaagtgcgaa reverse primer cgtagcatttatggagagtgagtct ercc1 probe tcctcgcctggagccccga forward primer aggagctggctaagatgtgtatcctreverse primer ccaggtaccgcccagctt forward primer aggagctggctaagatgtgtatcct reverse primer ccaggtaccgcccagctt mmp9 probe caggcagctggcagaggaatacctgtac forward primer ccctggagacctgagaaccareverse primer ccacccgagtgtaaccatagc forward primer ccctggagacctgagaacca reverse primer ccacccgagtgtaaccatagc rpl37a and gapdh were used as housekeeping (normalization) genes . Forty cycles of nucleic acid amplification were applied and the cycle threshold (ct) values of the target genes were identified . Ct values were normalized by subtracting the ct value of the housekeeping gene rpl37a from the ct value of the target gene (ct). Rna results were then reported as 40-ct values, which correlated proportionally to the mrna expression level of the target gene . Human reference total rna pooled from ten human cell lines (stratagene, la jolla, ca) was used as a positive control . Dna from peripheral blood and ffpe tissues was normalized at 20 ng / ul . The following taqman snp genotyping assays were used [applied biosystems, biosolutions, athens, gr]: c_3145050_10, detecting the ercc2 asn312asp (aac / gac) polymorphism [rs1799793]; c_3145033_10, detecting the ercc2 lys751gln (aag / cag) polymorphism [rs13181]); c_622564_10, detecting the xrcc1 gln399arg (cag / cgg) polymorphism [rs25487]; and c_2532948_10, detecting the ercc1 c8092a / cd3eap q504k (gln / lys) polymorphism [rs3212986]. Of note, the sequence detected by this assay (cacaggccgggacaagaagcggaag[c / a]agcagcagcagcagcctgtgtagtc), which matches previous reports, includes a polymorphism in the 3-utr of the ercc1 gene, which is simultaneously located at the 3end of the cd3eap coding region (http://www.ncbi.nlm.nih.gov/snp/snp_ref.cgi?rs=3212986), since these genes are located in opposite directions at 19q13.3 . Thus, ctg> ctt (g / t change) is the forward sequence in ercc1, corresponding to the reverse cag> aag (c / a change) in cd3eap . Runs were performed in duplicates in 10 l reactions with 40 ng dna input, amplified for 40 cycles under standard conditions in an abi7500 real time pcr system equipped with the sds v1.4 software keeping the default parameters (applied biosystems, biosolutions, athens, gr). Negative control did not provide amplification curves, while sample amplification curves were considered for further analysis if the cycle threshold (ct) for the detected products was <38 . Differences of the mean cts (dct) for the two alleles detected by each assay were: 1.93 for ercc1 c8092a, 0.47 for ercc2 n312d, 1.55 for ercc2 k751q, and 1.34 for xrcc1 q399r, all within the acceptable limits for this type of assays (2) (applied biosystems). Samples consisting of> 75% tumor cells were considered as eligible for dna extraction and sequence analysis, otherwise macrodissection was performed to increase the tumor cell content to> 75% . We amplified exons 18, 19, 20, and 21 of the egfr tyrosine kinase domain from genomic dna (primary tumor tissue dna) and germline dna (peripheral blood dna) that was extracted with the invisorb spin blood midi kit (invitek gmbh, berlin, germany) according to the manufacturers instructions . Exons 18, 19, 20, and 21 were reconfirmed in all patients identified as harboring mutations . Germline dna was analyzed on two separate occasions for exons 18, 19, 20, and 21 for all patients with mutations, in order to confirm egfr mutations as somatic or germline in origin . All pcr products were purified by solid - phase reversible immobilization chemistry followed by bi - directional dye - terminator fluorescent sequencing . Sequences were analyzed by blast and chromatograms by manual review, and compared to: egfr mrna reference sequence accession number nm 005228 and/or the egfr gene sequence accession number af288738; ras mrna gi 34485723 and/or the ras gene sequence gi 14277199 (http://www.ncbi.nlm.nci/). The egfr exon 21 mutation, l858r, was also analyzed by pcr / rflp based on the presence of a new sau96i restriction site created by the mutation . Deletions in exon 19 were also analyzed for using high performance gel electrophoresis (> 2.5% agarose). Detection of hpv-16 and hpv-18 dna was performed by one of the authors (a. l.) and was based on amplification of the e6 region as adopted from ogura et al ., with minor modifications . Briefly, each reaction contained 0.20.4 g dna template in 10 mm tris, ph 8.3, 50 mm kcl, 1.5 mm mgcl2, 200 mm dntps, 1.5 units taq dna polymerase (fermentas), and 100 pm of each of the primers in a total volume of 50 l . Sense and antisense primer sequences for hpv-16 e6 were 5-aagggcgtaaccgaaatcggt-3 and 5-gtttgcagctctgtgcata-3, respectively . The antisense primer sequence for hpv-18 e6 was 5-gtgttcagttccgtgcaca-3. The reaction mixure was subjected to pcr amplification using the geneamp pcr system 9700 thermal cycler (abi). Pcr cycling conditions consisted of 7 min at 96c and 1 min at 72c, followed by 35 cycles, including a denaturation step at 94c for 30 s, an annealing step at 55c for 30 s and an elongation step at 72c for 45 s. the final extension step was carried out at 72c . To avoid false positive and/or negative results a control (no template dna) and an hpv positive dna sample data on selected patient or tumor characteristics, and acute toxicity were obtained from the records . Comparisons of the number of responders according to biomarkers were performed using the fisher's exact test . Overall survival (os) was measured from treatment initiation to patient's death or last contact . Progression - free survival (pfs) was measured from treatment initiation to verified disease progression, death or last contact . In the analysis of pfs, death without prior verified progression there were 27 men and 10 women with a median age of 60 years (table 1). One patient discontinued ccrt after the completion of the 6th week of treatment due to grade 3 thrombocytopenia . One patient, a 74-year - old man, with a history of angina and atrial fibrillation died from acute myocardial infarction during the second week of rt . In the process of reviewing the clinical data, 5 more patients were identified to have had fatal events during the 3-month period post ccrt . More analytically, one of the patients from progressive disease, while a second patient, a 60-year - old man with an unremarkable medical history, from cardiac arrest, one week after the completion of ccrt . Autopsy was refused by his relatives . A third patient, a 46-year - old man, died from massive haemorrhage of the upper aerodigestive truck, 11 weeks post ccrt . Autopsy suggested that the fatal event was attributed to bleeding from a mucosal ulceration on the right pyriform sinus . The latter patient, even though a post ccrt scan was not performed, was considered in the present analysis to be complete responder . The fourth patient, a 60-year - old man, alcoholic and heavy smoker, was at the initiation of ccrt on treatment for pulmonary tuberculosis with isoniazid and rifambicin . The fifth patient, a 56-year old man with alcoholic cirrhosis died 12 weeks post ccrt from massive bleeding due to the rupture of esopharyngeal varices . The above patients were included in the analysis for response on an intent to treat basis . Severe side effects most commonly noticed were leukopenia (70%), dysphagia (62%), skin rash (65%), and anemia (51%) (table 2). Following the completion of ccrt, response was evaluated according to the recist criteria for 24 out of 37 patients (figure 1). For 6 of these patients response was evaluated by pet as well . For one of the patients, response was classified as partial by recist, while pet was free of tumor, thus this patient was considered to be a complete responder in the overall response evaluation . In one additional case, response was evaluated by pet only . Of the remaining 12 non - evaluable patients, one did not have a ct examination, for 5 patients the ct examinations were not available for central review, while 6 patients died before their response evaluation . However, for one of the latter patients an autopsy was performed and no evidence of tumor was found . Overall, 11 patients (30%, 95% ci 16%47%) achieved a cr and 11 (30%, 95% ci 16%47%) a pr . Stable disease was seen in 3 patients (8%, 95% ci 2%22%) and progressive disease in 5 patients (14%, 95% ci 5%29%). For one patient notably, among three patients with radiological pr that underwent an fdg - pet / ct, one of them had a negative examination . Taking into account the one patient with no evidence of tumor in the autopsy, 13 patients were considered as having achieved a cr (35%, 95% ci 8%52%) and 10 as having achieved a pr (27%, 95% ci 14%44%). After a median follow - up of 21.3 months, 15 patients had a pfs event (10 patients demonstrated disease progression and 5 died of other causes), while a total of 9 patients had died . One - year progression - free and overall survival was 63% and 80%, respectively . Individual egfr, ercc1, met, p16, and p-53 ihc and fish data along with selected patient characteristics and responses are presented in tables 3 and 4 . In summary, thirty - one of 32 tumor samples (97%) were found to be egfr positive, while in 22 samples (69%) egfr was overexpressed (figures 2(a) and 2(b)). No association between egfr overexpression and complete response was identified (9/22 crs among patients with egfr overexpression versus 2/10 crs among patients without egfr overexpression; p = .425). The ercc1 protein was expressed (figures 2(c) and 2(d)) in 27 out of 33 tumor samples (82%). No association between ercc1 expression and response was found (9/27 responders among ercc1 positive patients versus 2/6 responders among ercc1 negative patients; p = .999). The met protein was expressed (figures 2(e) and 2(f)) in 14 out of 33 tumor samples (42%). The met protein was detected as membraneous discontinuous or complete staining and/or cytoplasmic staining . In a small number of cases no association between met protein expression and complete response was found (4/14 complete responders among met positive patients versus 7/19 complete responders among met negative patients; p = .719). However, when considering objective response (cr or pr), a significant association was identified with met protein expression (5/14 responders among met positive patients and 15/19 responders among met negative patients; p = .029). Met gene gain was observed in 23 of 31 cases (74%). More specifically, low trisomy was detected in 16 cases, low polysomy in 6 cases, while high polysomy was identified in 1 case (figures 3(c) and 3(d)). Met gene status was not found to be associated with response (2 responders among 8 patients with normal met gene status versus 9 responders among 23 patients with met gene gain, p = .676). The p16 protein was detected in 8 out of 30 cases examined (27%). In addition, in 5 of the 22 negative cases, p16 was highly expressed in the dysplastic squamous epithelium . Two of them showed p16 expression mainly in the dysplastic epithelium and to a small degree in scattered infiltrative neoplastic cells . Furthermore, p16 was not found to be associated with response (4 responders among 8 patients with positive p16 status versus 7 responders among 22 patients with negative p16 status, p = .417). The p-53 protein was found to be expressed (figures 2(g) and 2(h)) in 22 of 33 patients (67%). No significant association with complete response was identified (6/22 complete responders among p-53 positive patients versus 5/11 complete responders among p-53 negative patients; p = .437). Moreover, no significant association between the status of the d7s486 locus (figures 3(e) and 3(f)) and response was identified . Individual egfr, ercc1 and mmp9 mrna data along with selected patient characteristics and responses are presented in tables 3 and 4 . For all three genes the median was used as a pre - defined cut - off in order to classify tumors with high (above the median) or low (below the median) mrna expression . High egfr mrna expression, was not found to be associated with complete response (4/17 complete responders among patients with low egfr mrna expression, versus 8/16 complete responders among patients with high egfr mrna expression; p = .157). Similarly, the median normalized ercc1 mrna expression was 34.8 (30.039.5), while no association between high ercc1 mrna expression and complete response was identified . Specifically, in the group of 17 patients with low ercc1 mrna expression 4 patients achieved a complete response, versus 8 complete responders among the 16 patients with high ercc1 mrna expression (p = .157). Only 4 of the 17 patients with low mmp9 mrna expression achieved a complete response, while 8 of the 16 patients with high mmp9 mrna expression demonstrated a complete response to treatment (p = .157). Although mmp9 mrna expression was not found to be significantly associated with complete response, a significant association with the objective response (cr or pr) was identified (6/17 responders among patients with low mmp9 mrna expression versus 14/16 responders among patients with high mmp9 mrna expression, p = .004). Samples from 36 patients were considered for allelotyping, including 10 from tumor tissue only, 3 from peripheral blood (germline) only and 23 from matched peripheral blood and tumor tissue . The incidence of allelic combinations in germline and tumor tissues is shown in table 5, while individual data on ercc1, ercc2 and xrcc1 gene polymorphisms are presented in table 4 . Briefly, heterozygous polymorphic alleles were common for all targets; concerning homozygous combinations, c8092c was the most frequent genotype for ercc1, asp312asp and lys751lys for ercc2/xpd and arg399arg for xrcc1 . In 2/10 unmatched tumor tissue samples, allelotyping data could be obtained for ercc1 but not for ercc2 and xrcc1, probably due to poor ffpe dna quality . Overall, the incidence of allelic variants observed in the present study was in accordance with relevant previous data . The germline genotype did not always match the tumor genotype in the same patient, as deduced from the high dcts (5.8, 7.3, and 7.9 in three cases) in the respective tumor samples or from the amplification of allele targets that were negative in the matching peripheral blood samples . Changes in tumor genotypes were observed upon repeated testing in 4/23 patients (17%) with matched peripheral blood and tumor samples available for comparison (table 4). Germline heterozygocity was replaced in one case by homozygocity for the rare a / a allele for ercc1 c8092a / cd3eap q504k, indicating a lys / lys genotype for cd3eap in the tumor . In two additional cases, germline a / g was replaced by g / g for ercc2 - 312 (change of asn / asp into asp / asp in the tumor). In another case, germline ercc2 - 312 asp / asp (no amplification of the asn target) was replaced by asn / asp (dct = 1.1) in the matched tumor tissue . Only one patient had a somatic egfr mutation on exon 20, a d770insgf insertion . Additionally, no patients were identified with an l858r egfr mutation or codon 19 deletion by alternative methods . Totally, 6 out of 30 samples (20%) tested were hpv-16 positive (one laryngeal, 3 oral cavity and 2 oropharyngeal tumors). Interestingly, 4 of the 6 hpv-16 positive patients, who were evaluable for response, achieved a cr post ccrt . The present report describes our collective experience with ccrt in patients with locally advanced scchn . Interestingly, one patient with a pr had a negative fdg - pet / ct after the completion of ccrt and was considered as having a cr . It is well known that assessment of response to chemo - radiotherapy in patients with scchn is not accurate, since a number of them are considered by radiologists as having partial response, because of residual abnormalities in posttreatment ct scans . During the last few years fdg pet / ct scans had been increasingly used for initial staging and assessment of tumor response in scchn . Several investigators have shown that fdg - pet / ct can more accurately predict the lack of residual disease both at the primary site and the neck (negative predictive value 100%, sensitivity 100% and specificity 96%) [50, 51] and it has therefore been considered to be a valuable clinical tool in the management of scchn . The review of our clinical data showed that the treatment was feasible and that the compliance of the patients was satisfactory, since all except two completed rt . It is well known that most patients with scchn belong to low social - economic status, are alcoholic, heavy smokers, and bear serious co - morbidities . Furthermore, serious toxic sequelae of chemo - radiotherapy, such as dehydration, infections, malnutrition, and excessive weight loss may deteriorate their general heath status and contribute to fatal events . A high incidence of unexpected severe adverse events, including fatal events, was described by pfister et al . In a phase ii study and was confirmed in our retrospective analysis of an unselected scchn population . These patients should therefore be closely monitored during ccrt and the immediate period following ccrt . The discovery of predictive factors in treatments, such as rt concomitantly with cetuximab, is of paramount importance, since this regimen is emerging as the new standard for patients with scchn . Unfortunately, to date the identification of such molecular predictors remains elusive . In the present analysis, we evaluated potential associations of egfr, met, ercc1, and mmp9 with response to ccrt . Even though high egfr protein expression has been reported to be predictive for increased tumor response in patients with scchn treated with conventional fractionated or accelerated [53, 54] rt, this finding has not been confirmed in randomized studies in patients with recurrent and/or metastatic scchn treated with gefitinib or cisplatin and cetuximab . Contrary to what would be expected, patients with low to moderate egfr protein expression demonstrated a higher response rate to the combination of cisplatin and cetuximab than those with high egfr expression . In our retrospective analysis, we were not able to find a correlation between egfr protein expression and response to ccrt . We found that in most of the tumors egfr polysomy but not amplification was evident; however, it was not correlated with response . These findings are in agreement with other trials, showing that the prevalence of egfr amplification in scchn is low [57, 58] and that egfr gene copy numbers are not correlated with tumor response in patients with recurrent / metastatic scchn, who nevertheless responded to the egfr tyrosine kinase inhibitors (tkis) erlotinib or gefitinib [59, 60]. It has been reported that in nonsmall cell lung cancer (nsclc), mutations within the egfr tyrosine kinase domain, mainly in exons 18, 19 and 21, confer sensitivity to tkis . However, such mutations are rare in scchn, ranging from 1% to 7% in caucasian / white and asian patients, respectively [60, 62, 63]. In a study of 134 scchn tumors, direct dna sequencing could not identify any mutations . In line with these findings, we screened 31 tumors for egfr mutation in exons 18, 19 and 21 and were able to identify only one patient harboring an egfr mutation . Apparently, due to the very low prevalence, egfr mutations cannot be used as predictors of response to anti - egfr treatment in scchn . Clearly, further studies are needed to fully elucidate the mechanisms of sensitivity and resistance to cetuximab or egfr tkis . It is possible that other factors that are further downstream in the egfr pathway and/or the interplay of the egfr pathway with other activated pathways are more important than egfr alone in modulating responses to anti - egfr treatments . Additionally, we assessed met protein expression by ihc and gene copy number by fish . To our knowledge, this is the first study attempting to correlate met with response to concomitant rt with cisplatin and cetuximab . Met protein expression was noted in 14 of 33 of tumors studied and the gene was amplified in 5 of the patients . It appears that, as in the case of nsclc [64, 65], met gene amplification is an infrequent event in scchn as well and is not associated with responses to ccrt . Interestingly, the present retrospective analysis is one of a few studies that have investigated a potential association between ercc1 protein expression and response to ccrt in patients with scchn . It is noteworthy, that knowledge regarding the role of ercc1 in scchn is very limited . Recently, handra - luca et al . Reported that low ercc1 protein expression was associated with higher rates of tumor response (79% versus 56%, p = .04) and lower risk of cancer - specific death (risk ratio 0.42, p = .04) in patients with scchn treated with cisplatin - based induction chemotherapy . However, this positive association was not confirmed in a similar study recently conducted by our group and in the present analysis . The reasons for this discrepancy, regarding the predictive role of ercc1, are not clear . Small sample size, differences in the treatment regimens, lack of standardization of the ihc methodology for assessing ercc1 protein expression, and differences in patient characteristics, stage and tumor location maybe a few, but certainly not the only factors responsible for the conflicting results . An important finding of the present retrospective analysis was that high mmp9 mrna expression, assessed by krt - pcr, was significantly associated with objective response . Positive correlations have been observed between mmp9 mrna expression levels and metastatic spread of scchn tumors . Overexpression by mmp9 may in part be regulated via nuclear factor kappa b (nf - kb). In addition, inflammatory processes induced by hpv infections could activate mmps, which would in turn liberate egfr ligands from the extracellular matrix, thereby promoting hnscc tumor progression through increased egfr signalling . It appears therefore, that mmp9 positive tumors could be particularly sensitive to egfr inhibition . This notion is in complete agreement with our finding that high mmp9 mrna expression is significantly associated with objective response to cetuximab containing chemotherapy . However, further analysis is needed in noncetuximab treated scchn patients, to evaluate whether mmp9 might be a poor prognosis marker turned onto an improved response marker by the addition of cetuximab to rt or ccrt . Regarding four commonly studied polymorphic sites in ercc1, ercc2/xpd, and xrcc1, it was interesting to identify discordant tumor tissue / peripheral blood genotypes . This may be worthy considering when assessing polymorphisms as prognostic / predictive markers in oncology, since most such available data, including polymorphisms in excision repair genes, derive from determinations in peripheral blood (germline) dna [28, 45, 70]. As indicated by the diminished presence of one allele with real time pcr, discordant genotypes in 3 out of 4 cases might correspond to loss of heterozygosity (loh) of the corresponding alleles in the tumor . This finding needs further validation, while its biological impact, if any, is presently unknown, since loh in ercc1 and ercc2/xpd has not been studied in scchn . Nevertheless, other than previously reported, we did not observe an association between tumor excision repair gene polymorphisms and patient outcome, possibly due to the small sample size, while the investigated polymorphism in ercc1 was not related to the corresponding mrna and protein expression . Importantly this is the first report on the sensitivity of hpv - associated scchn to cetuximab - containing ccrt . There is a large body of molecular evidence suggesting that hpv (mainly hpv-16 and hpv-18) plays an important role in the pathogenesis of scchn and particularly of oropharyngeal tumors [73, 74]. Hpv-16 is the most prevalent genotype in scchn, accounting for more than 90% of positive cases . We assessed the presence of hpv by pcr, since this detection method is probably more sensitive than other methods, such as in situ hybridization . The frequency of the presence of hpv, predominantly the hpv-16 genotype, in greek patients with oropharyngeal or laryngeal cancer was 43% and 40%, respectively [77, 78]. Finally there are several lines of evidence suggesting that, hpv - associated scchn has a better prognosis than scchn in hpv - negative patients, possibly due to enhanced radio - sensitivity or the absence of field cancerization . These data are in complete accordance with the findings of our study, in which exclusively hpv-16 dna was detected in 6 (20%) of our patients . Notably, 4 of these patients were evaluable for response and all of them demonstrated a cr after the completion of ccrt . The observed high responsiveness of the hpv - positive patients might possibly be due to activation of mmp9 . Activation of mmp9 could liberate egfr ligands from the extracellular matrix, thereby promoting hnscc tumor progression through increased egfr signalling . Mmp9 positive tumors could therefore be, as discussed earlier, particularly sensitive to egfr inhibition with cetuximab . The p16 overexpression reported here was not associated with presence of hpv-16, in contrast to previous studies [80, 81]. As previously shown, p16 overexpression is not limited to hpv-16 positive cases, since a small number of cases with hpv negative genotype showed very high p16 expression . Furthermore, the finding of p16 overexpression in hpv-16 negative tumors may be the result of oncogene - driven cellular senescence or infection with other viruses that down - regulate retinoblastoma protein expression . The above combined with the small number of positive cases could explain the lack of association between p16 and hpv-16 positivity reported in our study . However, other contributing factors, such as differences in antibody specificity and limitations of the immunohistochemical and pcr assays cannot be excluded . As shown in patients with nsclc, in colorectal or pancreatic cancer patients treated with anti - egfr targeted treatments reviewed in, there is a subgroup of patients that is particularly benefited from such treatments, that is, those who develop the typical acne - like or maculopapular rash . In the present analysis, likewise, lack of a correlation between the development of rash and response to cetuximab was reported in two other studies in patients with recurrent / metastatic scchn [84, 85]. However, in both of these studies, rash was a predictor for survival and in one of them for time to progression (ttp), as well . Whether rash will be found to be significantly correlated with ttp or survival remains to be seen with longer followup . Notably, none of our patients discontinued ccrt due to severe rt - induced dermatitis, which has occasionally been reported in patients with scchn treated with rt concomitantly with cetuximab . Nevertheless, intensive medical treatment should be offered to these patients by experienced dermatologists, since in several cases there is a considerable risk for secondary skin infections . In conclusion, it appears from the present retrospective analysis that, ccrt is feasible in patients with locally advanced scchn . However, extremely close monitoring is required for patients with serious co - morbidities, during ccrt and the 3-month posttreatment period, because such patients are at high - risk for dying from nontreatment related causes . The status of all the genes evaluated in this analysis, except mmp9, was not of predictive value to ccrt . High mmp9 mrna expression, assessed by krt - pcr, was found to be significantly associated with objective response . It appears that mmp9 might be of predictive value in scchn patients treated with cetuximab . However, it has to be kept in mind that, given the retrospective nature of the present analysis and the relatively small number patients, a selection bias cannot be excluded . Therefore, our findings should by no means be considered as definitive, but rather as hypothesis generating for future prospective trials.
Diabetes is a chronic, debilitating disease that requires life - long treatment and greatly increases the risk of serious, long - term complications . Offering the long - term monitoring and treatment needed is not easy for the health - care systems of sub - saharan africa, which are more focused on managing acute infections . Sub - saharan region has been reported with a growing incidence of diabetes; in which the number of diabetic people which was 7.1 million in 2003, raised to 12.1 million in 2010, and is projected to be 23.9 million with a prevalence of 3.7% in 2030 . In currently emerging studies comorbidity of mental health problems among diabetic patients, most commonly depression and anxiety has been reported . A person with depression might have frequent and persistent low mood, lost interest, a change in appetite, sleep, and motor activity . As well decreased energy, poor concentration / thinking capacity / decision - making, worthlessness, and sometimes death wish or attempt are common presentations . A higher rate of depression is found among diabetic people than the general population as stated in recent studies . Depression among diabetic people has led to poor treatment adherence poor treatment outcome and consequently worsened quality of life . This coexistence of depression has a higher rate in low- and middle - income countries than high - income countries . In another way distinct, prevalence rates have been reported on depression among diabetic patients; this includes higher figures of 59.8%, 5060% in asia, 54.1% in nepal, 45.2% in bangladesh to (25.335.4%) in india, 17% in poland, and substantially lower rate of 11.2% in peru . There are a number of factors which are associated with cooccurrence of depression among diabetics; these include women, non - married, older age, low socioeconomic, and higher body mass index; besides that smoking habit, increased number of comorbidities, higher level of cholesterol, and poor glycemic control are also related with depression in contrary to most studies, a survey conducted at the united states reported that a baseline diabetic control is not an independent predictor for depressive disorder; one more study from china reported that college level education and having a job were related to depression among diabetics . Based on pubmed cited articles, in africa, we found the following studies . In maroc 41.2%, 27.8%, and 21.9% of major depression, persistent depressive disorder (less form of depression for 2 or more years), and double depression (both major depression and persistent depressive disorder) were reported among diabetic patients, respectively; whereas similar studies reported the prevalence of depression 34.4% in guinea and 27.8% in nigeria; besides this, anxiety and suicidal behavior were reported among 58.7% of guinean and 6.3% of nigerian subjects . The factors associated with depression were similar with those reported from other continents that include low education, low socioeconomic status, older age, higher level of cholesterol, urban residence, being nonmarried, diabetic complications, and longer duration of follow - ups . Another study in algeria found out that frequent occurrence of type - two diabetes was associated with depression . In ethiopia, there were over 1.33 million cases of diabetes in 2015 . According to pubmed indexed reports, less prevalence of depression was reported (relative to other african nations) with about 16.319.2% range . In general diabetes mellitus is becoming the emerging challenge to developing nations which can be complicated by the cooccurrence of depression . There are limited studies which showed the prevalence of depression and associated factors among people living with diabetes mellitus in sub - saharan region, particularly in ethiopia . The aim of this study was to determine the prevalence and associated factors among diabetes mellitus . Hence, the findings might have vital to stakeholders and policy makers working in diabetic and psychiatric areas by showing its prevalence and the factors associated with it . A cross - sectional study was conducted at ayder referral and mekelle hospitals from july to september 2015 . The study was conducted at the city of mekelle, the capital of tigray region with a total population of more than 300,000 . There are three public hospitals in the city, and the study was conducted at two of them . The source population was all diabetic patients who have medical follow - up at mekelle city, and diabetic patients who had follow - up at ayder referral / mekelle hospital during the study period was study population . Those patients with age 18 years and above with follow up for 6 months or more were included in the study . Sample size and sampling technique was calculated with single proportion population formula, 34% level of depression, 95% confidence interval (ci), and 5% margin of error . The sample size becomes 344; as the study population is <10,000, correction formula is employed; thus with 10% nonresponse rate the final sample size is 244 . The data were collected using a pretested structured questionnaire developed in english and translated to local language by expertise . To assess comorbid depression and anxiety, beck depression inventory ii (bdi) and beck anxiety inventory (bai) tool were used, respectively . Mild depression is a score of 1120 and moderate is scoring 2130, whereas severe depression is a score of above 41 . Score of 16 or more on bai tool indicate anxiety; mild, moderate, and severe anxiety is a score of 815, 1625, and above 25, respectively . One day training was given to orient data collectors and supervisor on the questionnaire to be used, the purpose of the study and how to approach respondents and obtain consent . Data collectors' capability to gather consistent and appropriate data were assured before the data collection period through role plays in the training and in the pretest . In addition, pretest on 5% of the sample size was carried out in a private clinic . During the data collection time, they were supervised daily . The data were coded, checked, cleaned, and entered into computers using software epi info (this software was developed by centers for disease control and prevention - cdc, atlanta, usa) and then exported into spss window version 20 for analysis (spss was developed by international business machines corporation; ibm corp . Logistic regression was performed to assess the association between binary outcomes and different explanatory variables . Bivariate analysis was first conducted for each potentially explanatory risk factor; then, multivariate logistic regression analysis was done . P <0.05 was considered statistically significant in this study . After obtaining ethical clearance from college of health sciences, mekelle university, study settings were informed through official letter; and with their approval, the study was conducted . After discussing the purpose of the study, assuring informed consent, privacy, and confidentiality were kept . Those subjects who were screened to be depressed or develop anxiety a cross - sectional study was conducted at ayder referral and mekelle hospitals from july to september 2015 . The study was conducted at the city of mekelle, the capital of tigray region with a total population of more than 300,000 . There are three public hospitals in the city, and the study was conducted at two of them . The source population was all diabetic patients who have medical follow - up at mekelle city, and diabetic patients who had follow - up at ayder referral / mekelle hospital during the study period was study population . Those patients with age 18 years and above with follow up for 6 months or more were included in the study . Sample size and sampling technique was calculated with single proportion population formula, 34% level of depression, 95% confidence interval (ci), and 5% margin of error . The sample size becomes 344; as the study population is <10,000, correction formula is employed; thus with 10% nonresponse rate the final sample size is 244 . The data were collected using a pretested structured questionnaire developed in english and translated to local language by expertise . To assess comorbid depression and anxiety, beck depression inventory ii (bdi) and beck anxiety inventory (bai) tool were used, respectively . Score of 21 or more on bdi ii tool indicate depression . Mild depression is a score of 1120 and moderate is scoring 2130, whereas severe depression is a score of above 41 . Score of 16 or more on bai tool indicate anxiety; mild, moderate, and severe anxiety is a score of 815, 1625, and above 25, respectively . One day training was given to orient data collectors and supervisor on the questionnaire to be used, the purpose of the study and how to approach respondents and obtain consent . Data collectors' capability to gather consistent and appropriate data were assured before the data collection period through role plays in the training and in the pretest . In addition, pretest on 5% of the sample size was carried out in a private clinic . During the data collection time, they were supervised daily . The data were coded, checked, cleaned, and entered into computers using software epi info (this software was developed by centers for disease control and prevention - cdc, atlanta, usa) and then exported into spss window version 20 for analysis (spss was developed by international business machines corporation; ibm corp . Released 2011 . Logistic regression was performed to assess the association between binary outcomes and different explanatory variables . Bivariate analysis was first conducted for each potentially explanatory risk factor; then, multivariate logistic regression analysis was done . After obtaining ethical clearance from college of health sciences, mekelle university, study settings were informed through official letter; and with their approval, the study was conducted . After discussing the purpose of the study, assuring informed consent, privacy, and confidentiality were kept . Those subjects who were screened to be depressed or develop anxiety were referred to psychiatry clinics . Among the 264 study subjects, the mean age and standard deviation are 43.2 16.6 with a range of 1782 years; also 135 (51.1%), 180 (68.2%), 87 (33%), 242 (91.7) are women, married, have no formal education, and orthodox christian by religion, respectively [table 1]. Socio demographic characteristics of diabetic patients, mekelle, north ethiopia, apr 2016 (n=264) on the clinical data, from the total diabetic patients we interviewed, 146 (53%) take injection, 23.5% have other chronic medical illness, and 22% of them are taking other medication for their chronic medical problems . Those with mild to moderate depression were 87 (33%), moderate to sever 39 (14.7%), severe depression 6 (2.3%). The most severe depressive symptoms reported are lost interest in sex completely by 42 (15.9%), being too tired in 34 (12.9%), and severe sleep disturbance among 18 (6.8%) [table 2]. Characteristics of depressive symptoms on bdi -ii tool among diabetic patients, mekelle city, north ethiopia, apr 2016 (n=264) as well the prevalence of anxiety is 18.2% (95% ci: 14%, 23.9%); mild anxiety among 82 (31%), moderate anxiety in 32 (14%), and severe anxiety among 11 (4.1%). Furthermore, from the study participants according to mmas, 28% (95% ci: 22.7%, 33.1%) has poor medication adherence . From which 32 (12.1%), 158 (59.8%), and 74 (28%) has high, medium, and low level of adherence, respectively . Multivariate regression shows that anxiety disorder (aor = 10.52, 95% ci (4.56, 24.28)), poor medication adherence (aor = 4.38, 95% ci: [1.98, 9.64]), and coexistence of other physical illness (aor = 3.04, 95% ci: [1.11, 8.34]) are risk factors for depression [table 3]. Multivariate analysis among different factors and depression among diabetic patients, mekelle, north ethiopia, apr 2016 (n=264) our finding of depression among diabetic patients which is 17% is comparable with prior studies conducted at black lion hospital (16.3%), addis ababa, ethiopia (19%), and poland (17%). Although it is higher than a study peru (11.2%). In general, our finding is smaller than distinct discoveries from maroc, guinea, nigeria, asia, nepal, bangladesh, and india . These distinctions can be due to the differences in sample size, sociodemographic condition, and others . This is supported by an earlier study which reported that in the primary health - care facility 50% of patients with depression have a comorbid anxiety disorder . This in turn can lead to increased medical service utilization, chronicity, worse treatment outcome, and multiple relapse of the illnesses . Comparable prior meta - analysis declared that depressed patients across a wide array of chronic illnesses such as diabetes and heart disease had 76% greater odds of being non - adherent with their medications compared to patients who were not depressed . Diabetic patients are more prone to other physical illnesses, and this condition is enabling factor for depression . This was also found out in prior studies at poland, china, india, and iran . Almost one in six diabetic patients have depression which associates with coexisting anxiety, poor medication adherence, and other chronic medical illnesses . Therefore, it is better to formulate a mechanism to detect and manage depression early.
Malignant thymic neoplasms can be broadly divided into thymomas and thymic carcinomas, both of which exist almost exclusively in the anterior mediastinum . Thymomas have also been described in the neck, posterior mediastinum, lungs, base of the skull and pleural cavity [25]. Very few case reports have described thymomas occurring in the middle mediastinum [25]. Unlike thymomas, thymic carcinomas have only been observed in the anterior mediastinum . To our knowledge, this report will describe the first case of thymic carcinoma in the middle mediastinum . A 55-year - old caucasian female presented with productive cough, dyspnea, chest pain and weight loss . The patient's medical history was significant for hypertension, hypercholesterolemia, dyslipidemia, chronic renal failure, gastroesophageal reflux disease and chronic anemia . She was a 30 pack - year smoker and her mother was diagnosed with lung cancer . An initial chest x - ray showed a large subcarinal mass . On computed tomography (ct), a 6.2 5 cm tumor was detected in the subcarinal area (figs 1 and 2). A bronchoscopy with transbronchial biopsy was performed, and the resulting pathological analysis was suspicious for malignant cells; however, no specific tumor type was identified . A positron emission tomography scan showed a large hypermetabolic subcarinal lesion with a standard uptake value of 14.3, consistent with malignancy . The differential diagnosis at the time included an infected bronchogenic cyst, esophageal duplication cyst or a malignant subcarinal lymph node . Thoracoscopic surgical resection was planned for diagnostic and therapeutic purposes . Figure 1:subcarinal tumor on preoperative ct of the chest, coronal cuts . Prior to surgical resection, esophagoscopy and bronchoscopy documented the absence of any communication of this mass to the esophagus and airway . One port was made at the mid - axillary line of the eighth intercostal space for the camera, in addition to two anterior and two posterior ports . The dissection of the tumor began at the level of the inferior pulmonary ligament and posterior mediastinum, all the way to the azygous vein . The esophagus was found completely adherent to the tumor, necessitating an esophageal myotomy for en bloc resection . The anterior dissection proceeded at the level of the posterior atrial wall, the inferior and superior pulmonary veins, the main trunk of the pulmonary artery, and the membranous areas of the right and left main stem bronchi . Complete gross resection was observed at the conclusion of the operation . At the end of the procedure, air was insufflated into the esophagus to confirm the absence of any leaking from the mucosa . The specimen consisted of an encapsulated red - brown tissue weighing 57 g, and measuring 5.5 4.5 5 cm . Some sheets of viable tumor cells were present, and these contained pleomorphic nuclei, vesicular chromatin, and prominent nucleoli . The tumor cells were strongly positive for cam 5.2, but negative for ck7, ck5/6, ck19, calretinin, ttf1, cea, afp, hcg, plap, cd5 and cd56 . Thus, thymic carcinoma was determined to be the most fitting diagnosis based on the morphology and staining . The patient was referred for adjuvant radiation . At the most recent follow - up visit 9 months after surgery, the patient was well with no evidence of recurrence on ct scan . All thymic carcinomas reported to date have been located in the anterior compartment of the mediastinum . To the best of our knowledge, this is the first case report of a thymic carcinoma occurring in the middle mediastinum . The differential diagnosis of middle mediastinal tumors usually includes bronchogenic cysts, enterogenous cysts, neuroenteric cysts, pericardial cysts and lymphangiomas . Very selected cases of thymoma have been reported in the middle mediastinum [25]. These are attributed to the presence of ectopic thymic tissue in the subcarinal area due to failure of the thymus to migrate into the anterosuperior mediastinum during embryological development [25]. By way of the same process, it is therefore theoretically possible for these cells to undergo malignant degeneration into thymic carcinoma, although this has not been previously described . When compared with thymomas, thymic carcinomas have considerably worse prognosis . When possible, complete surgical resection is the treatment of choice for thymic carcinomas [1, 6]. Therefore, when planning surgical resection, it is important to consider malignant neoplasms as part of the differential diagnosis of middle mediastinal tumors . Although rare, thymic carcinomas and other malignant tumors of the middle mediastinum should be resected with negative margins, in order to decrease the risk of local recurrence and improve prognosis . This is the first case report of a malignant thymic carcinoma occurring in the middle mediastinum at the subcarinal location . This pathology, although rare, should be added to the differential diagnosis of middle mediastinal tumors . When planning surgical resection of such tumors, complete excision with negative margins should be attempted to minimize chances of local recurrence and improve prognosis.
The hundred trillions of cells which make up our bodies are continually exposed to various mechanical stimuli, including muscle contraction, ongoing blood flow, blood pressure, distension of visceral organs, etc ., which initiate a wide range of cellular responses . These responses include ca mobilization,1,2 protein phosphorylation,3 - 5 rearrangement of the cytoskeleton,6,7 transcriptional regulation,8 apoptotic cell death,9,10 and cell differentiation11 and so on . Mechanical forces are sensed by mechanosensors that presumably undergo change in their enzymatic activity or interaction with signaling molecules in response to forces . However, the particular molecular entities and the underlying biophysical mechanisms of these mechanosensing molecules are largely unknown except for the mechanosensitive (ms) channels.12 - 14 a major reason for this slow progress is that mechanosensors, by their nature, do not possess the specific chemical ligands such as agonists, antagonists and inhibitors, which are used as biochemical tools to detect and purify receptor molecules . An alternative way toward the molecular identification of mechanosensors relies on an idea that putative mechanosensors are most likely localized at cellular sites of high concentrations of stress . The cell membrane is such a structure due to its high lateral elastic modulus, and is actually endowed with ms channels, although the correlation between the highly stressed membrane region and the ms channel localization has yet to be demonstrated . Here we focus on adhesive structures, including focal adhesions, the actin cytoskeleton, and the molecular apparatus connecting these structures, where stress is presumably highly concentrated . Generally focal adhesions comprise a high stress concentration site, linking extracellular matrices and the actin cytoskeleton.15 mechanical forces imposed from inside or outside of the cell are transmitted through the focal adhesions bidirectionally, i.e., in an outside - in or inside - out direction.16 exogenous mechanical forces are exerted on integrins, an extracellular matrix receptor enriched in focal adhesions that activate a variety of intracellular signaling cascades.17 - 19 the activities of actin modulating proteins20 are also influenced by endogenous cell contractile force21 or exogenous mechanical stimuli.6,7 thus, mechanosensors22 and directly associated signaling molecules15 are thought to be involved in the focal adhesion, the actin cytoskeleton and/or cellular structures linking focal adhesions and the actin cytoskeleton . A recent in vitro biophysical study has shown that the apparent actin filament severing activity of cofilin and the rates of binding of cofilin to actin filaments are both affected by the tension present in the actin filaments,23 implying that the actin filament itself works as a mechanosensor . Here, we review the recent progress in the study of tension - sensing by focal adhesion proteins and actin filaments, and evaluate the possible physiological roles of such tension - sensing by actin filaments . Mounting evidence suggests that focal adhesion proteins are involved in the mechanically triggered activation of intracellular signaling molecules,15 including map kinases,24 akt,25,26 and pi3 kinase.27 direct manipulation and imaging of single protein molecules enables an application of mechanical forces to a target protein while monitoring its response, using these methods talin28 and possibly p130cas29 have been proposed to work as a mechanosensor . The focal adhesion protein talin has a head domain that binds to the cytoplasmic tail of the integrin subunit, while its rod domain contains actin - binding sites, each of which locates adjacent to a vinculin - binding site . When mechanical force was applied to talin through the manipulation of a small bead attached on a focal adhesion, integrin - cytoskeleton linkage at the focal adhesion was strengthened30 and vinculin was translocated to the focal adhesion underneath the bead in vivo,31 suggesting that talin acts as a mechanosensor in focal adhesions.30,32 a recent in vitro study demonstrated tension - sensing by the talin rod domain . The recombinant talin rod domain was extended approximately 100 nm by direct application of force (20 pn)28 with an afm tip (fig . 1a), resulting in an increase in the number of vinculin head domains bound to the talin rod domain . Combining molecular and cellular level studies, the authors have proposed that the force applied through the integrins in the focal adhesions extends the talin rod domain and exposes its binding sites for vinculin, which reinforces the actin - integrin linkage in vivo . (a) structure of the talin rod domain consisting of 12 helices (upper panel). The rod domain which is unfolded under force28 (lower panel) is shown by the black arrows in the upper panel . (b) schematic drawing of the experimental setup to apply force to a single actin filament.23 one end of an actin filament (red) was tethered to a bead fixed on a coverslip, and the other end of the filament was tethered to a small bead manipulated by optical tweezers . (c) (i), schematic drawing of the experimental setup to trace the torsional fluctuations of a single actin filament . An actin filament is tethered on the coverslip via gelsolin, and a bead was attached to the lower end of the actin filament . Rotation of the bead is monitored using fluorescent small beads that are attached on the large bead . (ii), rotational angular fluctuations of a bead attached to an actin filament during the time the large bead was trapped, but not stretched, by optical tweezers . The rotational angular fluctuations were decreased when the actin filament was stretched by moving the trapping point in downward direction . The data show the results at zero and ca . 5 pn stretch force; one can change the applied force by increasing the laser power of the optical tweezers . Panels a and c are based on studies (28) and (23), respectively . P130cas, a substrate for p60src,29 is a scaffolding protein that localizes at focal adhesions . Stretching of the cell substrate induces tyrosine phosphorylation of p130cas, followed by the activation of the p38 map kinase cascade via small gtpase rap133 in intact cells, suggesting that p130cas is involved in mechanically - induced signal transduction . A recent biophysical study using the purified p130cas substrate domain for p60src suggested that p130cas might work as a mechanosensor . Mechanical extension of the elastic substrate, to which the purified recombinant p130cas substrate domain is adhered, induces tyrosine phosphorylation of the p130cas substrate domain by p60src, implying that the mechanical unfolding of the p130cas substrate domain increases the phosphorylation level of the p130cas not only in vitro but also in vivo.34 however, further studies are needed to confirm this phenomenon actually takes place in live cells . In intact spreading cells, the staining pattern made by an antibody against the extended p130cas substrate domain shows a similar staining pattern to that made by an antibody against phosphorylated p130cas in the cell periphery,34 suggesting that the p130cas substrate domain is extended by force, and tyrosine - phosphorylated by p60src.33 in these mechanosensing processes, the unfolding of the sensor molecules (talin and p130cas) is presumably required to sense forces and to transmit them to the downstream signaling molecules . Titin, a giant elastic muscle protein connecting the z - disc and m - line in the sarcomere, is unfolded by force in its kinase domain.35 the improper unfolding of the kinase domain is thought to be involved in muscle disuse atrophy.36 fibronectin, an extracellular matrix protein, is mechanically unfolded by cell contractile forces,37 and the unfolding may be involved in accelerated fibronectin assembly, resulting in an enhancement of the fibronectin - integrin linkage.38,39 a recent in vitro study revealed that the actin filament itself functions as a mechanosensor.23 one end of a single actin filament was tethered to a myosin - coated bead fixed on a coverslip, while the other end was tethered to a small myosin coated bead manipulated with optical tweezers so as to tense the filament (fig . When the filament was tensed (~30 pn), it was severed by cofilin with a larger delay compared with the filament when it was not tensed, or was not severed within the observation period (ca . Additionally, the binding of cofilin to the bundles of actin filaments was imaged with fluorescein labeled cofilin, which showed that the rate of the binding of cofilin to the actin bundles decreased when the bundles were tensed . Approximately 2 pn of force is sufficient to decrease the apparent severing activity of cofilin,23 which is comparable to the force generated by a single myosin head . A single actin stress fiber is composed of 1030 actin filaments,40 and the contractile force in a single stress fiber is estimated to be on the order of nn,41 suggesting that the contractile force in stress fibers (> 2 pn for each actin filament, assuming the stress in the stress fiber is evenly distributed among the actin filaments) is high enough to prevent cofilin from binding to the actin filaments in vivo . There are enormous numbers of biochemical,42,43 structural,44,45 and computational46 studies on the binding of cofilin to actin filaments . Electron microscopic analyses revealed that the twist of the actin filament is increased when the filament is fully decorated by cofilin.44,45 on the other hand, the rotational angular conformation of actin protomers in native actin filaments is variable47; the angle between neighboring actin protomers reportedly ranges from 156 to 170.45 based on these observations, it is hypothesized that cofilin preferentially binds to actin filaments in solution when the protomers of the actin filament are in the twisted state; i.e., large torsional fluctuations are required for the binding of cofilin to the filament . The torsional fluctuations of single actin filaments were visualized by monitoring the rotation of a bead attached on one end of the filament (fig . Application of a force of approximately 5 pn reduced the torsional fluctuations of the filament (fig . 1c), indicating that the actin filament fluctuates less when the filaments are tensed, supporting the hypothesis that tension in the actin filament reduces torsional fluctuations of the actin filament, which decreases the effective number of cofilin binding sites so as to prevent the binding of cofilin, resulting in an inhibition of the cofilin severing of the filament ., the sensor molecule actin filament senses the applied force and transduces it into changes in the fiber fluctuation that in turn modulates the activity (binding here) of the signaling molecule cofilin, eventually regulating the fiber dynamics by itself . The tension - dependent local disassembly of actin filaments by cofilin presumably works under certain specific physiological conditions . The distribution of cofilin in living cells was examined using a gfp - cofilin fusion protein . Gfp - cofilin translocated to the stress fibers within a period of one minute when tension in the stress fibers was reduced by relaxing the pre - stretched elastic cell substratum (fig . 2a), followed by disassembly of the stress fibers,23 suggesting that cofilin mediates disassembly of the stress fibers with a decline in tension in living cells . Bdm, a myosin atpase inhibitor, reduces tension in the stress fibers, and induces stress fiber disassembly in living cells . Stress fiber disassembly by bdm is reportedly enhanced in cells overexpressing cofilin.21 by contrast, stress fiber disassembly was not detected in the cells without bdm, strongly supporting the proposal that cells make use of the tension - dependent local disassembly of actin filaments by cofilin . (a) when a certain amount of tension was generated in the stress fibers in adherent cells, the binding of cofilin to the stress fibers was reduced (upper panel). When the tension was reduced by relaxing the cell substratum (the direction is indicated by the black arrows), cofilin bound and started to disassemble the stress fibers (lower panel). The prominent transverse stress fibers generating a large amount of contractile force are not disassembled . (c) schematic drawing of the actin cytoskeleton in an adherent cell during migration . The actin filaments are disassembled in the trailing region of the cell, where the tension in the stress fibers is low, while the stress fibers generating tension in the middle region of the cell are not disassembled . The double - headed arrows indicate the width of the lamellipodia . In accord with the above hypothesis, a tension decline in the actin stress fibers leads to the disassembly of the stress fibers, however, the possibility cannot be excluded that it is the disassembly that leads to the decline in tension in the stress fibers . To resolve this problem, simultaneous measurement of the tension decline and the disassembly of the actin stress fibers is required . We recently examined the relationship between the tension decline and stress fiber disassembly in living cells.48 fibronectin - conjugated beads were adhered to the endothelial cells in that study . Actin stress fibers were formed between focal adhesions underneath the bead and the focal adhesions at the cell bottom . The force (35 nn generated by 1 m displacement of the bead) applied to the stress fibers and to the connected focal adhesions was estimated from the displacement of the beads embedded in the elastic substrate of the cells . When the attached bead was displaced, the force applied to the focal adhesions transiently rose, and then declined in less than a few seconds, indicating a tension decline in the stress fibers, probably due to a partial destruction of the linkage among the actin fibers within the stress fiber, which would decrease its elastic modulus . Subsequently, the same stress fibers were gradually disassembled within a period of 10 min, indicating that the decrease in tension in a particular stress fiber is followed by its disassembly, though the involvement of cofilin with this arrangement has not been examined yet . The potential roles of the tension - dependent local disassembly of actin stress fibers in migrating cells can be discussed in cells such as keratocyte and osteocarcinoma cells, in which the magnitude and distribution of the intrinsic contractile force generated by the actin cytoskeletons were quantitatively analyzed.49 - 51 the traction forces in migrating keratocytes were estimated from the local distortion in the elastic substratum of the cells . The traction forces generated beneath the front area of a migrating keratinocyte cell are relatively small, while the forces beneath the lateral area of the cell are substantial.49 in locomotive keratocytes, actin filaments are polymerized near the leading edge of the cells and then disassembled within a few minutes, thereby maintaining a filament length of a few m, while, in contrast, the prominent transverse stress fibers that connect both the lateral sides of the cell are not disassembled.50 similar prominent stress fibers connecting the lateral sides of the cells are also found in migrating osteosarcoma cells, and are disassembled with a decline in tension by the myosin inhibitor, blebbistatin.51 the width of lamellipodia (shown by the double - headed arrow in figure 2b) is almost proportional to the length of the actin filaments extending at the leading edge, and knockdown of cofilin by rnai increases the width of lamellipodia,52 suggesting that cofilin mediates the actin filament disassembly near the leading edge . These findings fit the hypothesis that the disassembly of stress fibers by cofilin is inhibited when the filaments are tensed . The tension across vinculin, a focal adhesion protein, has been assessed in the migrating endothelial cells using a vinculin - fusion protein named a tension sensor module53 that was designed based on the fret mechanism . The fret signal is high at disassembling or sliding focal adhesions near the trailing edge of migrating cells, implying that the tension sensed by the sensor is low (<2.5 pn) where stress fibers are disassembled . This also agrees with the above hypothesis, and suggests that a force as small as in a pn range can presumably be sensed by actin filaments, and, when decreased, initiates the stress fiber disassembly in living cells . Proper disassembly of stress fibers is crucial for cell migration, because actin stabilization by phalloidin,54 and enhancement of stress fiber formation55 both inhibit cell migration . Thus, the selective disassembly of non - tensed stress fibers is crucial for cell migration; e.g., cell migration is partly realized by the continual processing of actin fiber dynamics, including disassembly at the trailing edge and assembly at the leading edge of cells . The invasion of cancer cells is enhanced by mechanical stimulation; the number of cancer cells that invaded the three dimensional matrix gel was increased when the gel was deformed by twisting small magnet beads embedded in the gel by an application of an external magnet field (i.e., mechanical stimulation to the cells in the gel). In addition, cofilin is involved in the mechanically stimulated invasion,56 suggesting that the mechanosensing by actin filaments plays an important role in cancer cell invasion . Elucidating the role of the tension sensing performed by actin filaments in combination with cofilin binding / unbinding will ultimately provide great insights into cell behaviors under not only physiological, but also pathophysiological conditions.
Subjects for this nested case - controlled study were selected from ongoing clinical investigations of skeletal muscle insulin resistance . Only female subjects were included to provide a sex - controlled analysis . Women aged 6075 years were recruited through advertisements in the pittsburgh, pa, area . A brief phone screening initially determined eligibility for study participation . Potential subjects who were determined to be sedentary (exercise 1 day / week), weight stable (3 kg in the previous 6 months), with a bmi> 30 kg / m, and nonsmokers were further evaluated at the clinical translational research center (ctrc) at the university of pittsburgh . Exclusionary criteria included uncontrolled hypertension (> 150/95 mmhg), anemia (hematocrit <34%), elevated liver enzymes (25% above normal), proteinuria, or hypothyroidism (sensitive thyroid - stimulating hormone [tsh] 8 potential subjects were also excluded if they reported taking chronic medications known to affect glucose homeostasis . After the medical screening, potential subjects then completed a 2-h 75-g oral glucose tolerance test to determine glucose tolerance status . Subjects with type 2 diabetes determined by fasting glucose> 126 mg / dl were excluded . All subjects gave written consent to the protocol, which was approved by the university of pittsburgh's institutional review board . Insulin sensitivity was determined by a 4-h hyperinsulinemic (40 mu m min) euglycemic clamp and [6,6-h2]glucose infusion as previously described (28). Briefly, subjects reported to the ctrc the evening before the clamp and after a 48-h period, in which they refrained from any vigorous physical activity . A continuous intravenous infusion of insulin (humulin; eli lilly, indianapolis, in) was begun at 7:00 a.m., and euglycemia (target 90 mg / dl) was maintained using an adjustable infusion of 20% dextrose . To measure rate of insulin - stimulated glucose disposal and residual endogenous glucose production, a primed (0.22 mol / kg) continuous (17.6 mol kg min) infusion of [6,6-h2]glucose was administered (29). [6,6-h2]glucose enrichment in plasma was determined by gas chromatography / mass spectrometry (6890 network/5973 series; agilent, santa clara, ca) as previously described (30). Plasma glucose was measured by the glucose oxidase method (2300 stat plus; yellow springs instruments, yellow springs, oh). Fasting plasma insulin concentration was determined by an enzyme - linked immunosorbent assay (millipore, billerica, ma). Rate of glucose disposal (rd) was calculated using the tracer: tracee method with a modified version of the steele et al . Percutaneous muscle biopsy samples were obtained in the fasted state before the glucose clamp, as described previously (32). Briefly, muscle biopsies were obtained from the vastus lateralis, 15 cm above the patella . A portion of the specimen (30 mg) was snap - frozen in liquid nitrogen and stored at 80c for sphingolipid and diacylglycerol analysis . A second portion (20 mg) was snap - frozen and stored at 80c for gene expression analysis . A third portion of the specimen for histochemistry was mounted on a small piece of cork with mounting medium (shandon cryochrome; thermo electron, pittsburgh, pa), frozen in isopentane cooled with liquid nitrogen for 23 min (160c), and then placed into liquid nitrogen . Briefly, liquid nitrogen frozen samples (30 mg) were homogenized in ice - cold buffer (250 mmol / l sucrose, 25 mmol / l kcl, 50 mmol / l tris, and 0.5 mmol / l edta, ph 7.4). Total content as well as the various molecular species of diacylglycerol and sphingolipid were measured by high - performance liquid chromatography tandem mass spectrometry as previously described in detail (33). Plasma free fatty acid concentrations were determined by gas chromatography with flame ionization detection (6890n; agilent, santa clara, ca) using heptanoic acid as an internal standard . Free fatty acids were derivatized with dimethylamine using deoxo - fluor reagent (sigma - aldrich, st . Histochemical analysis was performed on serial sections using a modified version of methods previously used in our laboratory (32). Briefly, mounted biopsy samples were sectioned (10 m) on a cryostat (cryotome e; thermo shandon, pittsburgh, pa) at 20c and placed on a glass slide . Sections were then stained in a filtered solution of oil red o (300 mg / ml in 36% triethylphosphate) for 30 min at room temperature . Thereafter, sections were incubated with primary antibodies for anti - human myosin heavy chain (myh)-7 (type i myocytes) and myh2 (type iia myocytes) overnight at room temperature and subsequently incubated with fluorescein (fitc) (type iia myocytes) and rhodamine (type i myocytes) conjugated secondary antibodies (santa cruz biotechnology, santa cruz, ca). Images were visualized using a leica microscope (leica dm 4000b; leica microsystems, bannockburn, il), digitally captured (retiga 2000r camera; q imaging, surrey, canada), and analyzed using specialized software (northern eclipse, v6.0; empix imaging, cheektowaga, ny). Oil red o staining intensity and cross - sectional area were determined in type i and type ii myocytes . Gene expression analysis was carried out in a subset of subjects from each group, based on availability of vastus lateralis biopsy specimen (six ir and six is). Isolated rna was then further purified using a silicon - membrane spin column including an on - column dnase i treatment (qiagen, valencia, ca). Total rna was reverse - transcribed using moloney murine leukemia virus (mmlv) reverse transcriptase (sabiosciences, frederick, md). Gene expression was determined by quantitative real - time pcr (qrt - pcr) using sybr green - based custom rt profiler pcr arrays (sabiosciences, frederick, md). Qrt - pcr was performed on an abi prism 7900 (applied biosystems, foster city, ca). Baseline, threshold cycle (ct) and threshold were determined and set for all samples . The relative level of mrna expression for each gene in each sample was normalized to the average expression of 2-microglobulin, hypoxanthine phosphoribosyltransferase (hprt1), glyceraldehydes-3-phosphate dehydrogenase (gapdh), and -actin (actb) and expressed as 2 . Total body fat and lean mass were assessed using dual - energy x - ray absorptiometry (ge lunar prodigy and encore 2005 software v9.3). Subjects performed a vo2 peak test on an electronically braked cycle ergometer to determine aerobic fitness (sensor medics, yorba linda, ca) as previously described (34). Insulin sensitivity was determined by a 4-h hyperinsulinemic (40 mu m min) euglycemic clamp and [6,6-h2]glucose infusion as previously described (28). Briefly, subjects reported to the ctrc the evening before the clamp and after a 48-h period, in which they refrained from any vigorous physical activity . A continuous intravenous infusion of insulin (humulin; eli lilly, indianapolis, in) was begun at 7:00 a.m., and euglycemia (target 90 mg / dl) was maintained using an adjustable infusion of 20% dextrose . To measure rate of insulin - stimulated glucose disposal and residual endogenous glucose production, a primed (0.22 mol / kg) continuous (17.6 mol kg min) infusion of [6,6-h2]glucose enrichment in plasma was determined by gas chromatography / mass spectrometry (6890 network/5973 series; agilent, santa clara, ca) as previously described (30). Plasma glucose was measured by the glucose oxidase method (2300 stat plus; yellow springs instruments, yellow springs, oh). Fasting plasma insulin concentration was determined by an enzyme - linked immunosorbent assay (millipore, billerica, ma). Rate of glucose disposal (rd) was calculated using the tracer: tracee method with a modified version of the steele et al . Percutaneous muscle biopsy samples were obtained in the fasted state before the glucose clamp, as described previously (32). Briefly, muscle biopsies were obtained from the vastus lateralis, 15 cm above the patella . A portion of the specimen (30 mg) was snap - frozen in liquid nitrogen and stored at 80c for sphingolipid and diacylglycerol analysis . A second portion (20 mg) was snap - frozen and stored at 80c for gene expression analysis . A third portion of the specimen for histochemistry was mounted on a small piece of cork with mounting medium (shandon cryochrome; thermo electron, pittsburgh, pa), frozen in isopentane cooled with liquid nitrogen for 23 min (160c), and then placed into liquid nitrogen . Briefly, liquid nitrogen frozen samples (30 mg) were homogenized in ice - cold buffer (250 mmol / l sucrose, 25 mmol / l kcl, 50 mmol / l tris, and 0.5 mmol / l edta, ph 7.4). Total content as well as the various molecular species of diacylglycerol and sphingolipid were measured by high - performance liquid chromatography tandem mass spectrometry as previously described in detail (33). Plasma free fatty acid concentrations were determined by gas chromatography with flame ionization detection (6890n; agilent, santa clara, ca) using heptanoic acid as an internal standard . Free fatty acids were derivatized with dimethylamine using deoxo - fluor reagent (sigma - aldrich, st . Histochemical analysis was performed on serial sections using a modified version of methods previously used in our laboratory (32). Briefly, mounted biopsy samples were sectioned (10 m) on a cryostat (cryotome e; thermo shandon, pittsburgh, pa) at 20c and placed on a glass slide . Sections were then stained in a filtered solution of oil red o (300 mg / ml in 36% triethylphosphate) for 30 min at room temperature . Thereafter, sections were incubated with primary antibodies for anti - human myosin heavy chain (myh)-7 (type i myocytes) and myh2 (type iia myocytes) overnight at room temperature and subsequently incubated with fluorescein (fitc) (type iia myocytes) and rhodamine (type i myocytes) conjugated secondary antibodies (santa cruz biotechnology, santa cruz, ca). Images were visualized using a leica microscope (leica dm 4000b; leica microsystems, bannockburn, il), digitally captured (retiga 2000r camera; q imaging, surrey, canada), and analyzed using specialized software (northern eclipse, v6.0; empix imaging, cheektowaga, ny). Oil red o staining intensity and cross - sectional area were determined in type i and type ii myocytes . Gene expression analysis was carried out in a subset of subjects from each group, based on availability of vastus lateralis biopsy specimen (six ir and six is). Isolated rna was then further purified using a silicon - membrane spin column including an on - column dnase i treatment (qiagen, valencia, ca). Total rna was reverse - transcribed using moloney murine leukemia virus (mmlv) reverse transcriptase (sabiosciences, frederick, md). Gene expression was determined by quantitative real - time pcr (qrt - pcr) using sybr green - based custom rt profiler pcr arrays (sabiosciences, frederick, md). Qrt - pcr was performed on an abi prism 7900 (applied biosystems, foster city, ca). Baseline, threshold cycle (ct) and threshold were determined and set for all samples . The relative level of mrna expression for each gene in each sample was normalized to the average expression of 2-microglobulin, hypoxanthine phosphoribosyltransferase (hprt1), glyceraldehydes-3-phosphate dehydrogenase (gapdh), and -actin (actb) and expressed as 2 . Total body fat and lean mass were assessed using dual - energy x - ray absorptiometry (ge lunar prodigy and encore 2005 software v9.3). Subjects performed a vo2 peak test on an electronically braked cycle ergometer to determine aerobic fitness (sensor medics, yorba linda, ca) as previously described (34). Ten insulin - sensitive (is) and 12 insulin - resistant (ir) women were matched for age, body mass, bmi, and physical fitness (vo2 peak) (table 1). There was no significant group difference in fasting plasma glucose, insulin, or free fatty acid levels . However, by design, rd during the hyperinsulinemic - euglycemic clamp was greater (p <0.01) in the is group when compared with the ir group (table 1). The 2-h plasma glucose levels during the oral glucose tolerance test were also significantly higher in the ir group compared with the is group (p = 0.016). The ir (n = 6) and is (n = 6) subgroups for gene expression analysis had similar characteristics as their respective groups overall (data not shown). Type i and ii myocyte content and myocyte average cross - sectional area are presented in table 2 . The is group had a higher proportion of type i myocytes (p = 0.002) and a lower proportion of type iia (p = 0.014 and type iix (p = 0.02) than the ir group . When data from both groups were combined, there was a higher proportion of type iia compared with type iix myocytes (p = 0.008). Both groups combined, there was a significant positive correlation between the proportion of type i myocytes and insulin sensitivity and a negative correlation between the proportion of type ii myocytes (type iia and iix combined) and insulin sensitivity (table 3). Muscle fiber type distribution and surface area in vastus lateralis muscle * significantly different from is group, p <0.05 . Data generated from analysis of subgroup (ir, n = 10; is, n = 5). Correlation of rate of glucose disposal (ml kg fat - free mass min) with other study variables when data from both ir and is groups were combined * correlation is significant at the level p <0.01 . Correlation is significant at the level p <0.05 . The data for muscle content of sphingolipid and diacylglycerol species is presented in fig . We observed higher total levels of ceramide (555 53 vs. 293 54 pmol / mg protein, p = 0.004), total unsaturated ceramide (198 29 vs. 114 21 pmol / mg protein, p = 0.034), and total saturated ceramide (361 29 vs. 179 34 pmol / mg protein, p = 0.001) in the ir group compared with the is group . We also observed higher levels of specific ceramide species containing the following fatty acids: myristic (c14:0) (4.0 0.8 vs. 1.9 0.4 pmol / mg protein, p = 0.044), palmitic (c16:0) (58 14 vs. 18 5 pmol / mg protein, p = 0.023), and stearic (c18:0) (72 10 vs. 40 7 pmol / mg protein, p = 0.02) in ir compared with is muscle . There also tended to be greater content of sphingolipids containing palmitoleic (c18:1) (43 11 vs. 19 3 pmol / mg protein, p = 0.077) and lignoceric (c24:0) (201 25 vs. 123 29 pmol / mg protein, p = 0.06) acids and sphingosine (3.4 0.6 vs. 2.2 0.3 pmol / mg protein, p = 0.08) in ir muscle . When data were combined from both groups, we observed a significant negative correlation between total unsaturated, total saturated, and total ceramide content and insulin sensitivity (table 3). Total ceramide (r = 0.517, p <0.05) and total saturated ceramide (r = 0.523, p <0.05) were positively correlated with type ii myocyte percentage . However, no significant differences in total or individual diacylglycerol species were observed between is and ir subjects . Sphingolipid (a) and diacylglycerol (b) content in vastus lateralis of ir and is subjects . Ir data are expressed relative to is group, which was set to a value of 1 . * significantly different from is group, p <0.05 total muscle imtg was greater in the ir group compared with the is group (p = 0.009). Type i myocyte specific imtg content was also greater in the ir group compared with the is group (p = 0.005). Specific imtg content between is and ir groups, nor was imtg content different in ir within subtypes of type iia and type iix myocytes . When both groups were combined, we observed a significant negative correlation between type i myocyte imtg content and insulin sensitivity, whereas there was no relationship between insulin sensitivity and type ii myocyte (type iia and iix combined) imtg content (fig . E: imtg content in type i myocytes, type ii myocytes, and total imtg in vastus lateralis from ir and is groups . * significantly different from is, p <0.05 . (a high - quality color digital representation of this figure is available in the online issue .) Expression levels of key genes, including facilitated glut member 4 (glut4), insulin receptor substrate (irs)-1, and irs2 were lower in the ir group, indicating insulin resistance in this group at the tissue level in accord with their insulin resistance assessed in vivo . The expression of genes relating to oxidative phosphorylation transcription factors, fatty acid metabolism, ceramide metabolism, and lipid droplet associated proteins were examined . We found lower expression of the transcription factors peroxisome proliferator activated receptor (ppar)- and ppar- in the ir group compared with the is group . Also, expression of ppar- coactivator 1 (pgc-1) and nuclear respiratory factor 1 (nrf1) tended to be lower in ir muscle . Furthermore, we observed a lower expression of carnitine palmitoyltransferase 1b (cpt1b) and malonyl - coa decarboxylase (mlycd), genes that are related to fatty acid metabolism . Gene expression of lipid droplet associated proteins hormone - sensitive lipase (hsl), adipose differentiation related protein (adrp), adipose triglyceride lipase (atgl), and synaptosomal - associated protein 23 (snap23) was lower in the ir group compared with the is group . Interestingly, the expression of genes relating to ceramide metabolism was not different between groups . The expression of tumor necrosis factor (tnf)- tended to be higher in the ir group compared with the is group (p = 0.09). Gene expression in vastus lateralis of ir and is subgroups . Ir gene expression is expressed relative to is group, which was set to a value of 1 . Abhd5, abhydrolase domain containing 5; acac, acetyl - coa carboxylase; asah, n - acylsphingosine amidohydrolase; cerk, ceramide kinase; cpt, carnitine palmitoyltransferase; mlycd, malonyl - coa decarboxylase; nrf, nuclear respiratory factor; s3 - 12, plasma membrane associated protein kiaa1881; sptlc, serine palmitoyltransferase, long - chain base . * significantly different from is group, p <0.05 . Type i and ii myocyte content and myocyte average cross - sectional area are presented in table 2 . The is group had a higher proportion of type i myocytes (p = 0.002) and a lower proportion of type iia (p = 0.014 and type iix (p = 0.02) than the ir group . When data from both groups were combined, there was a higher proportion of type iia compared with type iix myocytes (p = 0.008). Both groups combined, there was a significant positive correlation between the proportion of type i myocytes and insulin sensitivity and a negative correlation between the proportion of type ii myocytes (type iia and iix combined) and insulin sensitivity (table 3). Muscle fiber type distribution and surface area in vastus lateralis muscle * significantly different from is group, p <0.05 . Data generated from analysis of subgroup (ir, n = 10; is, n = 5). Correlation of rate of glucose disposal (ml kg fat - free mass min) with other study variables when data from both ir and is groups were combined * correlation is significant at the level p <0.01 . We observed higher total levels of ceramide (555 53 vs. 293 54 pmol / mg protein, p = 0.004), total unsaturated ceramide (198 29 vs. 114 21 pmol / mg protein, p = 0.034), and total saturated ceramide (361 29 vs. 179 34 pmol / mg protein, p = 0.001) in the ir group compared with the is group . We also observed higher levels of specific ceramide species containing the following fatty acids: myristic (c14:0) (4.0 0.8 vs. 1.9 0.4 pmol / mg protein, p = 0.044), palmitic (c16:0) (58 14 vs. 18 5 pmol / mg protein, p = 0.023), and stearic (c18:0) (72 10 vs. 40 7 pmol / mg protein, p = 0.02) in ir compared with is muscle . There also tended to be greater content of sphingolipids containing palmitoleic (c18:1) (43 11 vs. 19 3 pmol / mg protein, p = 0.077) and lignoceric (c24:0) (201 25 vs. 123 29 pmol / mg protein, p = 0.06) acids and sphingosine (3.4 0.6 vs. 2.2 0.3 pmol / mg protein, p = 0.08) in ir muscle . When data were combined from both groups, we observed a significant negative correlation between total unsaturated, total saturated, and total ceramide content and insulin sensitivity (table 3). Total ceramide (r = 0.517, p <0.05) and total saturated ceramide (r = 0.523, p <0.05) were positively correlated with type ii myocyte percentage . However, no significant differences in total or individual diacylglycerol species were observed between is and ir subjects . Sphingolipid (a) and diacylglycerol (b) content in vastus lateralis of ir and is subjects . Ir data are expressed relative to is group, which was set to a value of 1 . * total muscle imtg was greater in the ir group compared with the is group (p = 0.009). Type i myocyte specific imtg content was also greater in the ir group compared with the is group (p = 0.005). Specific imtg content between is and ir groups, nor was imtg content different in ir within subtypes of type iia and type iix myocytes . When both groups were combined, we observed a significant negative correlation between type i myocyte imtg content and insulin sensitivity, whereas there was no relationship between insulin sensitivity and type ii myocyte (type iia and iix combined) imtg content (fig . Myocyte - specific imtg content in vastus lateralis of ir and is groups . A: representative image of oil red o stain (20 objective). E: imtg content in type i myocytes, type ii myocytes, and total imtg in vastus lateralis from ir and is groups . * significantly different from is, p <0.05 . (a high - quality color digital representation of this figure is available in the online issue .) 3 . Expression levels of key genes, including facilitated glut member 4 (glut4), insulin receptor substrate (irs)-1, and irs2 were lower in the ir group, indicating insulin resistance in this group at the tissue level in accord with their insulin resistance assessed in vivo . The expression of genes relating to oxidative phosphorylation transcription factors, fatty acid metabolism, ceramide metabolism, and lipid droplet associated proteins were examined . We found lower expression of the transcription factors peroxisome proliferator activated receptor (ppar)- and ppar- in the ir group compared with the is group . Also, expression of ppar- coactivator 1 (pgc-1) and nuclear respiratory factor 1 (nrf1) tended to be lower in ir muscle . Furthermore, we observed a lower expression of carnitine palmitoyltransferase 1b (cpt1b) and malonyl - coa decarboxylase (mlycd), genes that are related to fatty acid metabolism . Gene expression of lipid droplet associated proteins hormone - sensitive lipase (hsl), adipose differentiation related protein (adrp), adipose triglyceride lipase (atgl), and synaptosomal - associated protein 23 (snap23) was lower in the ir group compared with the is group . Interestingly, the expression of genes relating to ceramide metabolism was not different between groups . The expression of tumor necrosis factor (tnf)- tended to be higher in the ir group compared with the is group (p = 0.09). Gene expression in vastus lateralis of ir and is subgroups . Ir gene expression is expressed relative to is group, which was set to a value of 1 . Abhd5, abhydrolase domain containing 5; acac, acetyl - coa carboxylase; asah, n - acylsphingosine amidohydrolase; cerk, ceramide kinase; cpt, carnitine palmitoyltransferase; mlycd, malonyl - coa decarboxylase; nrf, nuclear respiratory factor; s3 - 12, plasma membrane associated protein kiaa1881; sptlc, serine palmitoyltransferase, long - chain base . Despite a preponderance of evidence from cell culture and animal models suggesting a role for both ceramide and diacylglycerol in skeletal muscle insulin resistance (7,8), there is actually no consensus as to whether this is relevant to human insulin resistance (12,13,15,17,19). This study was conducted for three purposes: 1) to determine whether diacylglycerol or sphingolipid species are elevated in ir human skeletal muscle, 2) to investigate whether the associations between intramyocellular lipids are dependent on muscle fiber type, and 3) to explore whether the skeletal muscle expression of several key genes relating to lipid metabolism are altered in ir muscle corresponding to intramyocellular lipid content . A primary finding of our study was that total as well as saturated and unsaturated ceramide content was approximately twofold higher in ir skeletal muscle in human subjects independent of obesity, physical fitness, and plasma free fatty acid concentration . (13), who observed elevated ceramide content in skeletal muscle of obese subjects . (12,14) also found that ceramide accumulation in skeletal muscle was inversely related to insulin sensitivity . They also suggested that higher ceramide content in lean offspring of patients with type 2 diabetes was due to decreased ceramide degradation, whereas ir of obesity was caused by an increase in de novo ceramide synthesis (12,14). Not all studies, however, have observed an association between muscle ceramide content and insulin resistance (18,19). These discrepant results could be attributed to differences in the subject population studied, e.g., age, sex, physical activity, and methodological differences, in assessing ceramide content and insulin sensitivity (11). Thus, our study provides important new information about the relationship between elevated ceramide content and muscle insulin resistance . This is the first to a comprehensive profile of the content of the various molecular species of ceramide in human ir muscle using tandem mass spectrometry while controlling for obesity, physical fitness, and age . This is the first study to demonstrate elevated levels of both saturated and unsaturated ceramides, as well as specific ceramides containing c14:0, c16:0, and c18:0 fatty acids in ir human muscle . None of the prior studies examining ceramide in human muscle have accounted for heterogeneity in muscle type that could account for differences in insulin sensitivity . Our novel finding that ceramide content was associated with a higher percentage of type ii myocytes suggests that ceramide accumulation may be fiber - type dependent . In addition, the complementary observations that both the imtg content in type i myocytes and the lower proportion of type i myocytes are related to insulin resistance provide insight into muscle heterogeneity in lipid metabolism in insulin resistance . These data suggest a possibility that type i myofibers may have a greater capacity to buffer increases in free fatty acids by partitioning to lipid droplet imtg, whereas type ii fibers have a reduced capacity to incorporate excess fatty acids into imtg and are more inclined to partition to lipotoxic mediators such as ceramide species . An impairment of skeletal muscle oxidative capacity has been suggested to initiate or potentiate insulin resistance (35). Our data indicate that the proportion of type i and type ii myocytes is associated with higher ceramide content and insulin resistance and that the expression levels of several genes related to mitochondrial biogenesis and fatty acid metabolism are lower in insulin resistance . Therefore, our complementary results support the concept that a low oxidative capacity of muscle may be associated with ceramide accumulation and insulin resistance . This is consistent with previous reports that the increase in whole muscle imtg content in obesity or type 2 diabetes is primarily due to increased imtg in type i myocytes (25) and that differences in fiber type proportion also play a role in insulin resistance of obesity and type 2 diabetes (36,37). These observations are supported by a number of reports suggesting that type i myocytes are more insulin responsive than type ii myocytes (26,27,38). Yet, differences in fiber type proportion between obese subjects either with or without type 2 diabetes have been reported in some (36,37), but not all previous studies (22,24). Despite evidence in ir animal models supporting a role for dag in insulin resistance (8,9), we did not observe an increased level of dag in insulin - resistant muscle . (12) have also reported elevated levels of ceramide, but not dag, in obese impaired glucose tolerant versus obese normal glucose tolerant (ngt) subjects . A possible reason for lipid - induced insulin resistance by ceramide and not dag, and visa versa, may be that higher levels of palmitate result in greater ceramide accumulation, while unsaturated fatty acids partition toward dag (39). Thus, both ceramides and dag can potentially induce insulin resistance depending on the degree of saturation of the lipid overload . Our finding that c16:0 ceramide was more than threefold higher in ir muscle is consistent with this . Thus, it is plausible that basal levels of ceramide and dag in muscle are influenced by the degree of saturation and palmitate content in the diet of obese individuals . We also examined the differential expression of several other genes relating to lipid metabolism, which could underlie accumulation of imtg and other bioactive species, i.e., dag and ceramide . We found that many genes involved in ceramide synthesis and degradation were not differentially expressed in ir muscle with increased ceramide content . A recent report suggests that over expression of acid ceramidase prevents the inhibitory effect of saturated fatty acids on insulin signaling (40). Also, inhibition of serine palmitoyltranseferase in zucker diabetic fatty (zdf) rats, by treatment with the amino acid antibiotic myriocin, prevented the onset of type 2 diabetes and inhibited an increase in ceramide content in muscle, when compared with nontreated zdf rats (41). Our results suggest that factors other than increased enzyme content, possibly increased enzyme activity or fatty acid flux, contribute to ceramide accumulation in ir muscle . In support of this, straczkowski et al . (12) demonstrated that the activity of neutral sphingomyelinase, the enzyme that converts sphingomyelin to ceramide, is increased in muscle of obese impaired glucose tolerant subjects compared with obese normal glucose tolerant subjects, concomitant with higher ceramide content . Finally, the observation that gene expression of tnf- tended to be elevated in ir muscle, albeit statistically nonsignificant, concomitant with elevated ceramide content is consistent with data demonstrating that tnf- can stimulate de novo ceramide biosynthesis (42). To further characterize intramyocellular lipid content and metabolism in ir skeletal muscle, we determined the expression of selected genes coding for lipid droplet proteins and proteins involved in lipid droplet hydrolysis . Atgl and hsl expression / activity have been demonstrated to contribute to adipose tissue and skeletal muscle triacylglycerol lipolysis, elevated plasma fatty acid levels, and accumulation of ectopic lipid deposits associated with type 2 diabetes (43). Our observation that atgl and hsl mrna are lower in ir muscle is in line with reports of lower expression of these lipases in obesity and/or insulin resistance (44,45). Consistent with this, phillips et al . Showed that skeletal muscle protein expression of adrp was upregulated in response to improvements in insulin action induced by weight loss and insulin sensitizer pharmacotherapy (46). Furthermore, atgl and adrp have been reported to be more highly expressed in type i muscle fibers (47,48). The fiber type specific expression of atgl and adrp, and our observation of reduced type i fibers in obese ir subjects, potentially explains the lower level of atgl and adrp observed in whole muscle in the present study . It is tempting to speculate the same may be true for other lipases and that fiber type composition plays a greater role in insulin resistance than previously thought . Furthermore, the trend toward higher tnf- gene expression in ir muscle is in line with reports that tnf- represses atgl expression (49). We also observed for the first time in human muscle that the expression of snap23, a member of the snare family of proteins whose function is to mediate intracellular vesicle fusion events including glut4 transport to the plasma cell membrane and lipid droplet fusion (50), is lower in ir muscle . This novel finding potentially linking intramyocellular lipid droplets and glucose transport is supported by others describing an association between snap23 and fatty acid induced insulin resistance (50). Future studies should be conducted to examine whether or not interventions such as exercise or weight loss affect oxidative capacity, dag, ceramide, and insulin sensitivity to better understand these associations in humans . Although we substantiated our insulin resistance phenotype with expression of key genes involved in insulin signaling and glucose transport, additional studies are needed to link intramyocellular lipids, fiber type, oxidative capacity, and activation of specific insulin - signaling proteins . Taken together, however, these results suggest a role for muscle fiber type proportion and/or the oxidative capacity of muscle in insulin resistance, possibly through partitioning muscle lipids into either triglycerides or ceramides . In summary, ceramide but not diacylglycerol is elevated in ir human skeletal muscle independent of obesity, physical activity, or aerobic fitness . Moreover, muscle fiber type as well as fiber type specific lipid content is associated with insulin resistance in muscle . Importantly, key genes associated with fatty acid metabolism and lipid droplet regulation are decreased in ir muscle . Together, these data suggest that mechanisms underlying the associations between intramyocellular lipids and insulin resistance likely involve ceramide, which in turn may depend on the muscle fiber type or its oxidative capacity.
Effective pain control with the help of diclofenac sodium as preemptive analgesic agent in third molar impaction surgery provides better patient compliance following surgery, and prevents occurrence of chronic postoperative pain experience . For ideal postoperative pain management this should be achieved with simple, easily available and economical measure which has very minimum or no adverse effect . Effective postoperative pain control is achieved by preventing the initial neural cascade which leads to hypersensitivity produced by noxious stimuli.efficient analgesic agent before the onset of the noxious stimulus to prevent central sensitization and preventing typically painless sensations to be experienced as pain (allodynia). Preventing the initial neural cascade which leads to hypersensitivity produced by noxious stimuli . Efficient analgesic agent before the onset of the noxious stimulus to prevent central sensitization and preventing typically painless sensations to be experienced as pain (allodynia). We have used oral tablet of diclofenac sodium in 50 mg dose one hour before surgery which is given as a preemptive analgesic agent in experimental group . While in control group placebo it is given one hour before surgery . With the help of our prospective randomized triple blind placebo - controlled clinical trial, we have evaluated efficacy of diclofenac sodium as preemptive agent in cases of third molar impaction surgery . Sixty patient, both male and female attending the dept . Of of oral and maxillofacial surgery, for removal of impacted third molars had been enrolled in this study . All patients were explained about the study in detail, and the possible complications of the surgery and the drug were discussed with the patient . One group (control group) consist of patients receiving placebo in the preoperative setting (one hour prior to surgery) followed by diclofenac sodium in the postoperative setting three times daily for a period of five days . Second group (experimental group) had patients receiving diclofenac sodium in the preoperative (one hour prior to surgery) and postoperative settings . The patient, the operating surgeon as well as the evaluating surgeon, all were blinded during the study process . Each patient was assessed at 1 hour postoperatively followed by 3 and 5 days for swelling, tenderness, trismus and any other complications like nerve injury, infection etc, these findings were recorded on separate form and taken for evaluation after the suture removal . Pain on a scale of 0 to 10, 0 being absence of pain and 10 being severe pain (vas). Swelling, recorded as a following scale: absence of swelling - 0, mild swelling - 1, moderate swelling - 2 and severe swelling - 3 . Trismus, recorded as following scale: absence of trismus - 0, mouth opening> 76% - 1, <75% mouth opening> 51% - 2, <50% mouth opening> 26% - 3 and mouth opening <25% - 4 . At each stage, tenderness, trismus and swelling (figures 3, 4, 5) were compared between experimental and control group, (figures 1, 2). Table 1 gives the mean and sd values of these variables for both groups . To compare the tenderness, trismus and swelling between experimental and control groups, non - parametric test mann - whitney mean rank of outcomes in control group mean rank of outcomes in experimental group comparison of rank of tenderness of control and experimental groups comparison of rank of trismus of control and experimental groups comparison of rank of swelling of control and experimental groups comparison between experimental and control groups using mann - whitney test table 1 shows significant difference in tenderness at 3 and 5 post operative day between experimental and control groups (p - value <0.05). Trismus and swelling, at any stage, did not see any difference between experimental and control groups (p - value> 0.05). Table 2 shows the comparison of tenderness, trismus and swelling between consecutive two post - operative follow ups at the 3 and 5 day of surgery . Comparison between consecutive two follow - ups: wilcoxon signed - rank test tables 1 and 2 give the comparison between 1 post - operative hour and 3 post - operative day as well between 3 and 5 post - operative day . Tenderness, trismus and swelling shows significant difference between two post - operative follow - ups (p - values are less than 0.05). Pain on a scale of 0 to 10, 0 being absence of pain and 10 being severe pain (vas). Swelling, recorded as a following scale: absence of swelling - 0, mild swelling - 1, moderate swelling - 2 and severe swelling - 3 . Trismus, recorded as following scale: absence of trismus - 0, mouth opening> 76% - 1, <75% mouth opening> 51% - 2, <50% mouth opening> 26% - 3 and mouth opening <25% - 4 . At each stage, tenderness, trismus and swelling (figures 3, 4, 5) were compared between experimental and control group, (figures 1, 2). Table 1 gives the mean and sd values of these variables for both groups . To compare the tenderness, trismus and swelling between experimental and control groups, non - parametric test mann - whitney mean rank of outcomes in control group mean rank of outcomes in experimental group comparison of rank of tenderness of control and experimental groups comparison of rank of trismus of control and experimental groups comparison of rank of swelling of control and experimental groups comparison between experimental and control groups using mann - whitney test table 1 shows significant difference in tenderness at 3 and 5 post operative day between experimental and control groups (p - value <0.05). Trismus and swelling, at any stage, did not see any difference between experimental and control groups (p - value> 0.05). Table 2 shows the comparison of tenderness, trismus and swelling between consecutive two post - operative follow ups at the 3 and 5 day of surgery . Comparison between consecutive two follow - ups: wilcoxon signed - rank test tables 1 and 2 give the comparison between 1 post - operative hour and 3 post - operative day as well between 3 and 5 post - operative day . Tenderness, trismus and swelling shows significant difference between two post - operative follow - ups (p - values are less than 0.05). Post - operative score of tenderness shows highly significant difference, between both the groups (p = 0.00) with suggestive low score in the experimental group . Derived data were also suggestive of no significant change (p> 0.04) in both the swelling and trismus . Preemptive analgesia has been defined as treatment that: (1) starts before surgery; (2) prevents the establishment of central sensitization caused by incisional injury (covers only the period of surgery) and (3) prevents the establishment of central sensitization caused by incisional and inflammatory injuries (covers the period of surgery and the initial post - operative period). Prospective study design is a valid method for this kind of research work, so we have designed this study accordingly . There might be chances of biased results from patients as well as from investigator's side if they are aware of time period of consumption of diclofenac sodium but, in this study we have minimized all such bias by making patient, surgeon and investigator blinded and also with and with use of randomization of the patient was done to minimize bias using a software . Diclofenac sodium is used as preemptive analgesic agent because of its easy ability, economic effective pain control and and relatively safe drug with minimal reported allergy . The plasma half - life of diclofenac sodium is also 12 hours, so we can achieve ideal optimal concentration if we provide it in 1-hour preoperatively . Visual analogue scale (vas) scale is an accepted method for assessment of post - operative pain . Comfort level of the patients are also superior in experimental group than control group as shown with help of derived vas score . The mean scores of tenderness in our study at 1-hour post - operatively in the experimental group and control group are 1.86 and 2.16, respectively, with p - value of 0.099 which is less significant; however, the mean scores for 3 days post - operatively for the experimental group and control group are 3.5 and 5.1, respectively, with p - value of 0.001 which is highly significant . Score mean of tenderness on the 6 post - operative day for experimental group is 1.6 and for control group is 3.6 with p value of 0.001 which shows a highly significant difference . And for trismus mean score at 1-hour post - operatively for experimental group is 0.36 and control group 0.66 with p value of 0.02, which shows a significant difference . Ong, et al . In 2004 conducted a double - blind, randomized, placebo - controlled study where 34 patients had each of their identical - impacted mandibular third molars removed under local anesthesia on two occasions . Throughout the 12-h investigation period, patients reported significantly lower pain intensity scores in the ketorolac pre - treated sides when compared with the post - treated sides . Aoki et al . In 2006 compared the efficacy of the selective cyclooxygenase-2 (cox-2) inhibitor meloxicam for treatment of postoperative oral surgical pain by assessing in a randomized - controlled trial . Patients undergoing unilateral mandibular 3 molar extraction surgery were allocated to 3 groups, a, b and c. after oral premedication of meloxicam 10 mg in group a, ampiroxicam 27 mg in group b and placebo in group c., post - operative pain was evaluated at the clinic on the 1, 7 and 14 postoperative day (pod) using a vas and concluded that cox-2 inhibitor, meloxicam 10 mg, used for premedication reduced post - operative pain compared with control in oral surgery . Pozos - guillen, et al . In 2007 compared the efficacy of tramadol given before or immediately after surgical extraction of an impacted mandibular third molar under local anesthesia . In this prospective, randomized - controlled, double - blind pilot study, 3 groups of 20 patients each were included: tramadol preoperative, 100 mg intramuscularly (i m) 1 hour before surgery (group a); tramadol postoperative, 100 mg i m immediately after surgery (group b); and saline (group c). This study suggests the preemptive use of tramadol as an alternative for the acute pain treatment after the removal of an impacted mandibular third molar that is carried out under local anesthesia . Whereas some of the studies show contradictory results from our study ., in 1990 conducted a clinical trial for comparison of preoperative and postoperative naproxen sodium for suppression of pain in dental surgery cases . In their trial, they had given naproxen sodium 550 mg 30 min postop in control group while in preemptive group naproxen sodium 550 mg 30 min preop was given . Kaczmarzyk, et al . In 2010 conducted a prospective, randomized, double - blinded clinical trial preemptive effect of ketoprofen on postoperative pain following third molar surgery . Ninety six patients were placed into three groups: pre - group (ketoprofen 60 min preoperatively); post - group (ketoprofen 60 min postoperatively); and no - group (placebo) and resulted that initial onset of pain was significantly delayed only in the post - group . Ketoprofen administered after third molar surgery provides more effective pain control than ketoprofen administered before the surgery or placebo . Preemptive analgesia has been defined as treatment that: (1) starts before surgery; (2) prevents the establishment of central sensitization caused by incisional injury (covers only the period of surgery) and (3) prevents the establishment of central sensitization caused by incisional and inflammatory injuries (covers the period of surgery and the initial post - operative period). Prospective study design is a valid method for this kind of research work, so we have designed this study accordingly . There might be chances of biased results from patients as well as from investigator's side if they are aware of time period of consumption of diclofenac sodium but, in this study we have minimized all such bias by making patient, surgeon and investigator blinded and also with and with use of randomization of the patient was done to minimize bias using a software . Diclofenac sodium is used as preemptive analgesic agent because of its easy ability, economic effective pain control and and relatively safe drug with minimal reported allergy . The plasma half - life of diclofenac sodium is also 12 hours, so we can achieve ideal optimal concentration if we provide it in 1-hour preoperatively . Visual analogue scale (vas) scale is an accepted method for assessment of post - operative pain . Comfort level of the patients are also superior in experimental group than control group as shown with help of derived vas score . The mean scores of tenderness in our study at 1-hour post - operatively in the experimental group and control group are 1.86 and 2.16, respectively, with p - value of 0.099 which is less significant; however, the mean scores for 3 days post - operatively for the experimental group and control group are 3.5 and 5.1, respectively, with p - value of 0.001 which is highly significant . Score mean of tenderness on the 6 post - operative day for experimental group is 1.6 and for control group is 3.6 with p value of 0.001 which shows a highly significant difference . And for trismus mean score at 1-hour post - operatively for experimental group is 0.36 and control group 0.66 with p value of 0.02, which shows a significant difference . Ong, et al . In 2004 conducted a double - blind, randomized, placebo - controlled study where 34 patients had each of their identical - impacted mandibular third molars removed under local anesthesia on two occasions . Throughout the 12-h investigation period, patients reported significantly lower pain intensity scores in the ketorolac pre - treated sides when compared with the post - treated sides . Aoki et al . In 2006 compared the efficacy of the selective cyclooxygenase-2 (cox-2) inhibitor meloxicam for treatment of postoperative oral surgical pain by assessing in a randomized - controlled trial . Patients undergoing unilateral mandibular 3 molar extraction surgery were allocated to 3 groups, a, b and c. after oral premedication of meloxicam 10 mg in group a, ampiroxicam 27 mg in group b and placebo in group c., post - operative pain was evaluated at the clinic on the 1, 7 and 14 postoperative day (pod) using a vas and concluded that cox-2 inhibitor, meloxicam 10 mg, used for premedication reduced post - operative pain compared with control in oral surgery . Pozos - guillen, et al . In 2007 compared the efficacy of tramadol given before or immediately after surgical extraction of an impacted mandibular third molar under local anesthesia . In this prospective, randomized - controlled, double - blind pilot study, 3 groups of 20 patients each were included: tramadol preoperative, 100 mg intramuscularly (i m) 1 hour before surgery (group a); tramadol postoperative, 100 mg i m immediately after surgery (group b); and saline (group c). This study suggests the preemptive use of tramadol as an alternative for the acute pain treatment after the removal of an impacted mandibular third molar that is carried out under local anesthesia . Whereas some of the studies show contradictory results from our study ., in 1990 conducted a clinical trial for comparison of preoperative and postoperative naproxen sodium for suppression of pain in dental surgery cases . In their trial, they had given naproxen sodium 550 mg 30 min postop in control group while in preemptive group naproxen sodium 550 mg 30 min preop was given . Kaczmarzyk, et al . In 2010 conducted a prospective, randomized, double - blinded clinical trial preemptive effect of ketoprofen on postoperative pain following third molar surgery . Ninety six patients were placed into three groups: pre - group (ketoprofen 60 min preoperatively); post - group (ketoprofen 60 min postoperatively); and no - group (placebo) and resulted that initial onset of pain was significantly delayed only in the post - group . Ketoprofen administered after third molar surgery provides more effective pain control than ketoprofen administered before the surgery or placebo . Use of diclofenac sodium orally in 50 mg dose one hour preoperatively as preemptive analgesic agent is economical, effective, easy and safe method of postoperative pain control in mandibular third molar impaction surgery cases.
Amyloidoses can be classified into three categories: primary localized cutaneous amyloidosis (plca), secondary localized cutaneous amyloidosis, and systemic amyloidosis with cutaneous involvement . In the plca group, three types can be distinguished: macular, papular (lichenoid) and nodular forms . The first two are mainly located on the trunk, and cytokeratins serve as the amyloid precursors . Here, amyloid deposition is limited to the papillary dermis [1, 2, 3, 4, 5]. However, in the rare cases of nodular plca, amyloid consists of aggregated kappa and lambda light chains, which can be found both in the dermis and the subcutaneous tissue [1, 2, 3, 4, 6]. Furthermore, nodular plca can originate from systemic amyloidosis or progress to systemic disease [3, 4]. Here, we present a case of nodular plca on the temple of a 52-year - old woman . A 52-year - old lady presented with a soft, shiny, partially yellow, erythematous tumor (3.5 4.5 cm) with telangiectasia on her right temple (fig . She recalled having had this tumor for about 4 years and that it had significantly grown lately . The diagnosis was confirmed by electron microscopy, and the typical amyloid fibrils (710 nm in diameter) were found (fig . A punch biopsy taken during follow - up showed some remaining amyloid so that the patient is now scheduled to undergo a second surgery via curettage . The diagnosis of plca requires histological analysis of a skin specimen, complemented by immunohistochemistry and electron microscopy . Histologically, eosinophilia as well as positivity in periodic acid - schiff, congo red, and thioflavin t stainings are characteristics of amyloid deposits [1, 8]. Immunohistochemistry with antibodies directed against cytokeratin and immunoglobulin light chains (lambda and kappa) allows to further distinguish between the different forms of plca . Electron microscopy confirms the diagnosis of amyloidosis when the typical amyloid fibrils (710 nm in diameter) are found . Image quality improves significantly when the skin sample is fixed in karnofsky's fixative (glutaraldehyde) instead of paraformaldehyde . For patients with nodular plca, it is recommended to asses for progression to systemic amyloidosis on a regular basis . This should include a full history and physical examination along with electrocardiogram, complete blood count, serum creatinine levels, serum liver - associated enzyme levels, serum electrophoresis, and urine examination . Furthermore, an abdominal fat biopsy has been suggested as an easy method to detect a potential progression to systemic disease [3, 7]. It has to be mentioned though that nodular plca is more frequent in asia and south america when compared to europe or north america.
This condition can range from mild discomfort to severe pain that limits activities of daily living . Conservative management of hip pain includes paracetamol, nonsteroidal anti - inflammatory drugs (nsaids), narcotics, and physical modalities.1,2 patients who fail to respond to conservative treatment usually undergo surgery . Often, surgery is not an option for patients with multiple comorbidities and conventional drugs either have many side effects or are ineffective.3,4 percutaneous pulsed radiofrequency (prf)1 or conventional radiofrequency (crf)26 of the articular branches of the obturator and femoral nerves is a novel alternative treatment for hip pain that has been previously reported in literature . However, the efficacy of prf or crf in hip pain is not well established because comparative studies with conservative management have not been conducted . There are only anecdotal evidences in the literatures.16 prf is a new method in rf treatment of pain . It is a non - neurolytic lesioning method for pain relief and can relieve pain without evidence of neural damage.7,8 in the present prospective, nonrandomized, open - label study, we attempt to compare the efficacy of prf relative to conservative management for chronic hip pain . Patients suffering from chronic hip pain for> 3 months with radiographic osteoarthritis of the hip (tnnis grades i and ii) were approached for this study . Patients presented with pain on a range of motions, groin and thigh pain, and limitation of range of motion, especially internal rotation . Patients also underwent various combinations of imaging studies (plain films, computed tomography, or magnetic resonance imaging) to diagnose and exclude other causes of pain originating from spine, sacroiliac joint, or other sources . Between august 2011 and july 2013 exclusion criteria comprised refusal to participate, extrinsic source of hip pain (eg, lumbar radiculopathy), pain related to bony fracture, avascular necrosis of hip, postsurgical pain, anticoagulation therapy, local infection over buttock and hip, systemic sepsis, allergy to local anesthetics, psychiatric illness, and inability to comprehend pain scoring . The patients were divided into two groups (prf and conservative treatment) according to consent or refusal to undergo prf procedure . Fourteen patients who declined prf because of the possibility of prf complications were managed conservatively . These patients received exercise programs and medications, including paracetamol, nsaids, and/or narcotic drugs for chronic hip pain . Patients who declined prf were evaluated longitudinally and served as controls . In the prf group patients who received conservative treatment but who still had severe pain could receive prf procedure after 12 weeks treatment if they wanted to cross over . The techniques for radiofrequency (rf) lesioning of the articular branches of the femoral and obturator nerves are described elsewhere.1,9,10 prf was performed under strict sterile conditions in an operating room . Each patient was placed in a supine position, and the skin overlying the operation area was prepared and draped . A standard rf lesion generator (neurotherm jk 25 t) was used for the whole procedure . After administration of local anesthesia (2% lidocaine), a 22-gauge 10-mm active tip rf cannula (neurotherm) 10 cm in length was inserted and advanced toward the articular branches of the obturator and femoral nerves (figure 1). Denervation of the sensory branches of the obturator and femoral nerves using prf was performed in all the patients . Sensory stimulation covering the painful region was obtained (50 hz; 1 ms pulse width; <0.6 v). The rf current was delivered at a width of 20 ms at 45 v. the tip temperature was no more than 42c . Patients were observed for 30 minutes after the prf procedure . If no significant complications (including pain, numbness, bleeding, hematoma, and leg weakness) were observed, the patient was discharged . Pain intensity, physical functioning, and pain medication were assessed before treatment, at 1 week, at 4 weeks, and at 12 weeks after treatment . All patients were independently assessed by a nurse who was blinded to the treatment undertaken . Pain intensity was recorded by using a visual analog scale (vas) ranging from zero (no pain) to ten (extremely severe pain). Pain and physical functioning of the hip were also evaluated by the oxford hip scores (ohs) questionnaire, a self - reported 12-item questionnaire.11,12 the range of scores is from 12 to 60, with a higher score indicating worsening pain and poor function . Pain medication after treatment was assessed using a scale ranging from 0 to 4 (0= no medication; 1= use of paracetamol; 2= use of nsaids; 3= use of opiate derivatives; 4= routinely scheduled opiate derivatives). Differences between groups were evaluated using, fisher s exact test, or mann whitney u - test, as appropriate . Data were analyzed using spss version 12.0 (spss inc, chicago, il, usa). Patients suffering from chronic hip pain for> 3 months with radiographic osteoarthritis of the hip (tnnis grades i and ii) were approached for this study . Patients presented with pain on a range of motions, groin and thigh pain, and limitation of range of motion, especially internal rotation . Patients also underwent various combinations of imaging studies (plain films, computed tomography, or magnetic resonance imaging) to diagnose and exclude other causes of pain originating from spine, sacroiliac joint, or other sources . Between august 2011 and july 2013 exclusion criteria comprised refusal to participate, extrinsic source of hip pain (eg, lumbar radiculopathy), pain related to bony fracture, avascular necrosis of hip, postsurgical pain, anticoagulation therapy, local infection over buttock and hip, systemic sepsis, allergy to local anesthetics, psychiatric illness, and inability to comprehend pain scoring . The patients were divided into two groups (prf and conservative treatment) according to consent or refusal to undergo prf procedure . Fourteen patients who declined prf because of the possibility of prf complications were managed conservatively . These patients received exercise programs and medications, including paracetamol, nsaids, and/or narcotic drugs for chronic hip pain . Patients who declined prf were evaluated longitudinally and served as controls . In the prf group, patients received the prf procedure and exercise programs . Patients who received conservative treatment but who still had severe pain could receive prf procedure after 12 weeks treatment if they wanted to cross over . The techniques for radiofrequency (rf) lesioning of the articular branches of the femoral and obturator nerves are described elsewhere.1,9,10 prf was performed under strict sterile conditions in an operating room . Each patient was placed in a supine position, and the skin overlying the operation area was prepared and draped . A standard rf lesion generator (neurotherm jk 25 t) was used for the whole procedure . After administration of local anesthesia (2% lidocaine), a 22-gauge 10-mm active tip rf cannula (neurotherm) 10 cm in length was inserted and advanced toward the articular branches of the obturator and femoral nerves (figure 1). Denervation of the sensory branches of the obturator and femoral nerves using prf was performed in all the patients . Sensory stimulation covering the painful region was obtained (50 hz; 1 ms pulse width; <0.6 v). The rf current was delivered at a width of 20 ms at 45 v. the tip temperature was no more than 42c . Patients were observed for 30 minutes after the prf procedure . If no significant complications (including pain, numbness, bleeding, hematoma, and leg weakness) were observed, the patient was discharged . Pain intensity, physical functioning, and pain medication were assessed before treatment, at 1 week, at 4 weeks, and at 12 weeks after treatment . All patients were independently assessed by a nurse who was blinded to the treatment undertaken . Pain intensity was recorded by using a visual analog scale (vas) ranging from zero (no pain) to ten (extremely severe pain). Pain and physical functioning of the hip were also evaluated by the oxford hip scores (ohs) questionnaire, a self - reported 12-item questionnaire.11,12 the range of scores is from 12 to 60, with a higher score indicating worsening pain and poor function . Pain medication after treatment was assessed using a scale ranging from 0 to 4 (0= no medication; 1= use of paracetamol; 2= use of nsaids; 3= use of opiate derivatives; 4= routinely scheduled opiate derivatives). Descriptive statistics were used to characterize the patients . Pre- and posttreatment ranges, means, and standard deviations were calculated . Differences between groups were evaluated using, fisher s exact test, or mann whitney u - test, as appropriate . Data were analyzed using spss version 12.0 (spss inc, chicago, il, usa). Patients in both groups were comparable in terms of demographic and baseline characteristics, with no signifi - cant differences between the two groups (tables 1 and 2). The flow diagram demonstrates study recruitment, allocation, and follow - up (figure 2). After 1 week, changes in vas scores (p<0.001) and revised ohs values (p<0.001) were significantly greater in the prf group than in the conservative group . The vas scores in the prf group were signifi - cantly lower than those in the conservative group at 1 week (p<0.001), 4 weeks (p<0.001), and 12 weeks (p=0.017). The ohs values were also lower in the prf group at 1 week (p<0.001), 4 weeks (p<0.001), and 12 weeks (p=0.04). Friedman analysis indicated that for both groups, there were significant differences (p<0.001) in the vas scores after treatment . However, the differences in ohs were only significant in the prf group (p<0.001). However, only prf could provide improvement in the physical functioning of hip pain patients . The pain medication scores were significantly lower in the prf group at 1 week (p=0.01), 4 weeks (p=0.007), and 12 weeks (p=0.01). Thus, prf could provide not only better effect (112 weeks) in terms of pain relief and physical functioning improvement but also less medication requirement . Eight participants in the control group switched to the prf treatment group after 12 weeks . Six (75%) of them had an improvement of> 50% with the pain, whereas two patients (25%) had no improvement . Patients received assessment of adverse events at 1 week, 4 weeks, and 12 weeks after the procedure . No major complications related with prf were observed, except for one subcutaneous hematoma related to rf needle puncture, which presented for 1 week . Eight participants in the control group switched to the prf treatment group after 12 weeks . Six (75%) of them had an improvement of> 50% with the pain, whereas two patients (25%) had no improvement . Patients received assessment of adverse events at 1 week, 4 weeks, and 12 weeks after the procedure . No major complications related with prf were observed, except for one subcutaneous hematoma related to rf needle puncture, which presented for 1 week . The present study compared prf with conservative treatment and demonstrates that at 1 week, 4 weeks, and 12 weeks after treatment initiation, improvements in pain are significantly greater with prf . Improvements of ohs were significantly greater in the prf group at 1 week, 4 weeks, and 12 weeks . Prf provides prompt pain relief, rapid improvements in physical functioning, and a decline in pain medication use . The sensory nerves supplying the hip joint include the articular branches of the obturator, femoral, and superior gluteal nerves from the sciatic nerve.10 major symptoms of chronic hip pain include groin, thigh, and trochanteric pain . Groin and medial thigh pain often arises from the articular branches of the obturator nerve, whereas trochanteric and lateral thigh pain arises from the articular branches of the femoral nerve.1 in the present study, all the subjects received prf of both articular branches of the femoral and obturator nerves . Lesioning on both nerves provides better pain relief than selecting one nerve according to pain location . Two studies using nerve blocks of the obturator nerve or femoral nerve revealed that each nerve block could only alleviate pain in the arthritic hip for 2 weeks, but the pain subsequently increased to preblock levels.13,14 flanagan et al15 found that intra - articular injection of local anesthetic alone or local anesthetic plus steroid provided short - term pain relief, but no long - term benefit . Anesthetic obturator / femoral nerve blocks and intra - articular blocks were effective for hip pain, but long - term benefits were not observed . The results support the hypothesis that the articular branches of the femoral and obturator nerves are important mediators of hip pain . To obtain longer effects, kawaguchi et al2 performed crf ablation of sensory branches of the obturator and femoral nerves in 14 patients and found significant pain relief (at least 50%) in 12 patients . The duration of pain relief was 111 months (mean: 4.2 months). In the past 10 years several studies have reported similar results and pain relief for several months.26 crf in which a constant high temperature (60c80c) is applied to target tissue reduces chronic pain by nerve ablation . It can provide long - lasting pain relief; however, irreversible damage to neural tissue could occur.16 although crf has been widely used for spinal pain, some have questioned the utility of thermal lesioning in the presence of neuropathic pain as a result of nerve damage.17,18 numbness of the hip related with thermal coagulation during crf and subcutaneous hematoma at the puncture site were the complications.3,4 prf is a new method in rf treatment of pain . Although the mechanism of action is not completely understood, some reports support its long - term efficacy and safety in pain relief.7,8 wu et al1 reported prf of the articular branches of the obturator and femoral nerves in 2 patients with chronic hip pain and demonstrated at least 50% pain relief for 3.5 months . In the present study, prf provides better pain relief and rapid improvements in physical functioning than conservative treatment . Eight subjects in the conservative treatment group finally received prf treatment after 12 weeks; and of these, six got> 50% pain relief . Exactly, it produces little tissue destruction but lasting inhibition of evoked synaptic activity.19 prf induces cellular distress, as measured by expression of neuron activation transcription factor-3, and both c and a delta sensory fibers appear to be selectively targeted by it.20 ultrastructural changes include abnormal membranes and mitochondria morphology and disrupted and disorganized microfilaments and microtubules.21 these changes are greater in c fibers than in a - beta fibers . Some studies have examined electrical fields on upregulation of immediate early gene and c - fos.22,23 prf lesioning to the rat dorsal root ganglion was associated with a significant increase of c - fos immunoreactive cells in the dorsal horn of the spinal cord.22,23 the expression of the c - fos gene encourages the formation of preprodynorphin, which is the second rna messenger . This results in an increased production of endorphin that modulates analgesic action, which may cause a prolonged analgesic effect.24 the present study has some limitations . A nonrandomized study with patients recruited according to consent or refusal to have prf could have some self - selection bias . Participants agreeing to undergo the prf procedure are more likely to believe in the benefit of the procedure, and this may significantly affect results . However, the nonsignificance of the statistical results in the pretreatment variables and the baseline vas and ohs (tables 1 and 2) values argue against this concern . However, the observation period for anesthesia for hip pain using prf is no more than 4 months.1 further studies are needed for elucidating the long - term efficacy and safety of prf . Although several studies have reported that prf and crf on sensory branches of the obturator and femoral nerves are effective for chronic hip pain,16 none used a control group . Prf of the articular branches of the femoral and obturator nerves offers a treatment option with good outcomes for patients suffering from chronic hip pain . When compared with conservative treatment, it offers greater pain relief and can augment physical functioning . Although this study produced promising results, caution is advised in drawing conclusions from this single study . Controlled, randomized investigations with longer observation periods are necessary to further clarify the role of prf in the treatment of chronic hip pain.
Plastic, the lightweight and long - lived material, has become a serious environmental hazard (thompson et al ., 2009). The annual global production of the organic polymer has rapidly increased from 1.7 to 280 million tonnes within the last 60 years (plastics europe, 2012) resulting in the accumulation of plastic litter in virtually all habitats (browne et al ., 2011). Marine systems are sinks for pre- and post - consumer plastic and the multifaceted negative impacts of plastic pollution on wildlife (reviewed in cole et al ., 2011; derraik, 2002; 2009) as well as several aspects of debris composition, distribution and abundance have been described here (reviewed in ryan et al ., 2009). Although accumulation of plastic in the ocean is prevalent, there is scarce data on plastic inputs in the oceans (law et al ., 2010). Marine plastics originate from ship or land - based sources (coe and rogers, 1997) with the latter to be of greater relevance (andrady, 2011). Nevertheless, quantifications of plastic loads in rivers found in primary literature are minimal (moore et al ., 2011). Realistic estimations of the plastic flow from rivers to oceans are very important in helping to raise the awareness of the sources of plastic debris and ultimately to drive measures to reduce it . In this article, we present results from a two - year (2010, 2012) survey on plastic litter transport in europe's second largest river, the danube . The main aim of the study was to categorize and to quantify drifting plastic items . In a second step we compare plastic abundance and plastic mass in the river with those of ichthyoplankton (drifting fish larvae and juveniles). Adverse health effects may arise when small fish confuse plastic particles with food items (zooplankton, fish eggs) and ingest them (carpenter et al ., 1972). Finally we give a rough estimate of the input of plastic litter via the river danube into the black sea . To our knowledge, this is the first report on plastic transport in a large river . The whole study was embedded in a scientific project that highlights larval dispersal and the conservation of riverine fish populations . All sacrificed individuals were handled according to applicable regulations and used for comprehensive analysis (lechner et al ., 2013b). The study was conducted in a free flowing stretch of the austrian danube between vienna and bratislava . All sampling sites were situated within the danube alluvial zone national park which preserves the last remaining major wetlands environment in central europe (http://www.donauauen.at). Here, the average river width is 350 m and the discharge at mean flow is 1930 m s. featuring the world's most international river basin (19 countries, 800.000 km, 81 million people), the danube is a special case study regarding conservation and management issues (sommerwerk et al ., 2009). As the main tributary (input of 6444 m s at mean flow) and major nutrient pathway, the danube directly affects the black sea (bsc, 2009). Beside eutrophication, the vulnerable ecosystems of this continental water face an increasing threat of plastic litter pollution (topcu et al ., 2013). Inputs from land - based sources have gained less attention but are supposed to be high, especially via the danube river system (lebreton et al ., 2012). The sampling procedure has been accurately described elsewhere (lechner et al ., 2013b). Briefly, we utilized stationary conical driftnets (0.5 m diameter, 1.5 m long, 500 m mesh) that were fixed to iron rods driven into the riverbed and sampled the top 0.5 m of the water column . The mesh size we used is in the range of other studies that quantified suspended plastics (reviewed in hidalgo - ruz et al ., was attached to the lower third of each net entrance to measure the volume of filtered water . In this volume - reducing approach, the filtered sample (containing plastics, fish larvae, organic debris and other items) is collected in a jar attached to the net - end and can be taken to laboratory for further processing . Duplicates (2010) and triplicates (2012) of driftnets were simultaneously exposed at three (2010) to four (2012) sampling stations along both river margins with maximum distances of 1 km between the single stations and 25 m between the shoreline and driftnets . In 2010, we sampled circadian (24 h) periods with hourly intervals between single sample events . In 2012, sampling started 2 h before sunset (according to ephemeris) and was continued in hourly intervals until midnight . Collecting day and night samples was essential in consideration of realistic comparisons between ichthyoplankton and plastics abundance: larval fish drift is known to exhibit a distinct diurnal rhythm with nocturnal peaks in individual numbers (pavlov et al ., 2008). Therefore, exclusive daytime sampling would have underestimated fish densities by far . The sampling period (apr jul) was chosen to comprise the entire drift season (lechner et al ., 2013a). Before preservation in 96% alcohol, all fish were overdosed (500 mg / l) with the anesthetic tricaine methanesulfonate . In the laboratory, plastic items and fish larvae were separated from the samples in a two - step process . Each sample was suspended in a water bath and a density separation (buoyant plastic particles and larvae with intact swim bladders were removed), was followed by a careful visual sorting of the remaining material by the naked eye . A subsample (n = 500) of fish larvae was taken and all individuals were weighed to the closest 0.01 g (moist mass). Each plastic particle was allocated to one of the categories shown in fig . 1 . Pellets, spherules and flakes characterize different types of industrial raw material that serve as precursors for plastics production . The category a subsample (n = 500) of each category was taken and all containing items were weighed to the closest 0.01 g and measured to the closest 0.01 mm (zeiss axio imager m1 with axio vision 4.8.2 software for image analysis). Referring to the size - ranges of the defined groups, the collected plastic may be termed mesodebris (220 mm; pellets, flakes, big spherules, others) or microdebris (<2 mm, small spherules) (ryan et al ., 2009) though different nomenclatures have been used in the literature (cole et al ., 2011; hidalgo - ruz et al ., the abundance of fish larvae and plastics, below named drift density, is given as individuals and items per volume of filtered water (1000 m). Additionally mass values of plastic and larvae are given in grams per volume (1000 m). Whitney u - tests (spss 20.0, ibm corp ., armonk, ny, usa). The plastic input (grams per 1000 m) into the black sea (bs) was estimated using the simple formula, inputbs = loadnpfpwhere the average plastic load (all categories combined) in the national park (loadnp) at mean flow (data derived from both sampling years) is multiplied by a factor reflecting the downstream increase in population in the danube basin (fp) (icdpr, 2009; http://www.icpdr.org). Refining the result of this approximation by exploring the potential of applying an appropriately adapted sediment transport model coupled with hydrodynamic simulations (e.g. Tritthart et al ., 2011) in both years 951 drift samples were taken (day: 293, night: 658) containing a total of 24,049 young fish and 17,349 plastic items . Both plastic densities and composition displayed distinct differences between sampling years (table 1): not only the overall plastic density but also the mean and maximum drift densities of all categories were clearly higher in 2010, with industrial plastics comprising 86% of the total load . Other plastic litter revealed higher drift densities in 2012 (69% of the total load) and dominated plastic mass in both years due to the higher mean weight . Combining both years of observation the average plastic load of the river danube amounts to 316.8 4664.6 items per 1000 m (79.4% industrial, 20.6% others) which equates to 4.8 24.2 g per 1000 m (29.7% industrial, 70.3% others). Pre - production plastics have been found to increasingly contribute to the plastic debris problem in marine habitats (barnes et al ., 2009). Our results identify the danube as a transport route for plastic raw material and suggest that environmental pollution by this category is a crucial factor in river systems as well . Considerable inter and intra - annual differences in drift densities may be attributed to the pulsed, accidental release of the material during processing, packaging and transport (moore, 2008). There are dozens of plastic production sites and an unknown number of processing companies in germany and austria . Furthermore, inland navigation is a popular transport mode and cargo ships frequently cruise the danube (on average 1000 per month at the sampling sites; kucera - hirzinger et al ., 2009). In both years of observation, more plastic items than fish larvae were drifting in the danube at daytime (fig . 2). However, differences in plastic versus ichthyoplankton were statistically significant only in 2010 (n = 182, z = 3.22). Increasing larval densities after dusk exceeded those of plastic in 2010 (n = 99, z = 4.59) and 2012 (n = 559, z = 13.94). Overall, the danube transported more plastic in 2010 and more ichthyoplankton in 2012 (n = 669, z = 13.19). Pooling all samples, mean larval densities in the danube were 275.3 745.0 individuals per 1000 m and hence lower than mean plastic densities . In addition, average biomass of drifting larval fish was lower than plastic mass in both years (table 2). The fish to plastic ratios indicate a high availability of harmful, unsuitable food items to potential consumers (moore et al ., 2001). The input of plastic litter in the black sea via the danube is estimated to average about 7.5 g per 1000 m s at mean flow (6444 m s). This yields a total entry at the mouth of 48.2 g per second (fig . 3), 173.6 kg per hour, 4.2 t per day and 1533 t per year . This is more than the estimated total amount of plastic in the north atlantic gyre (1100 t; law et al ., 2010). For several reasons, our values must be regarded as an underestimation of the total plastic load into the black sea:1)the amount of filtered microplastics is negatively correlated with the mesh size . Norn (2007) found the abundance of small plastic fibres in a 80 m net to be five orders of magnitude higher than in a 450 m net . Therefore we suppose microscopic fragments (<500 m) to be underrepresented in our samples.2)the same holds true for large floating items (> 5 cm), which did not enter driftnets through the small gap between net - frame and water surface . But especially large material contributes to the plastic mass in oceans (lattin et al ., 2004).3)compared to germany and austria, all other neighbouring countries of the danube feature lower standards in their wastewater and sewerage treatment (http://www.icpdr.org). Their potentially higher contributions to the danube's plastic load should considerably cumulate and increase the average input at the mouth . Norn (2007) found the abundance of small plastic fibres in a 80 m net to be five orders of magnitude higher than in a 450 m net . Therefore we suppose microscopic fragments (<500 m) to be underrepresented in our samples . The same holds true for large floating items (> 5 cm), which did not enter driftnets through the small gap between net - frame and water surface . But especially large material contributes to the plastic mass in oceans (lattin et al ., 2004). Compared to germany and austria, all other neighbouring countries of the danube feature lower standards in their wastewater and sewerage treatment (http://www.icpdr.org). Their potentially higher contributions to the danube's plastic load should considerably cumulate and increase the average input at the mouth . Plastic is the dominant debris in the black sea with a high percentage of items (47%) sourcing in neighbouring countries (among them several of the danube basin), potentially introduced by river currents (topcu et al . There is rare information about land based litter sources and the development and improvement of the existing monitoring system to provide comparable data sets for pollutant loads (from direct discharges and river inputs) is a high priority task of the black sea strategic action plan (bsc, 2009). Giving first answers on abundance and composition of plastic litter in the river danube we hope to serve the cause and help to strengthen the enforcement of national and international regulations on land - based pollution sources (i.e. Operation clean sweep, http://www.opcleansweep.org) furthermore, our results shall give impetus to continuative studies on freshwater plastic pollution . All harmful consequences of plastic contamination described in marine systems (ranging from ingestion of plastic particles by a wide range of organisms to introduction of alien species which raft plastic litter) may operate in rivers and lakes and deserve closer attention.
Electronically excited states play a prominent role in many different areas of chemical and condensed matter physics and organic chemistry . While nonadiabatic processes, such as irradiation induced dna damage and repair mechanisms, are the hallmark of photochemical and photobiological reactions, the fluorescent properties of excited state systems are increasingly being employed as biomolecular probes . Despite their obvious importance, a detailed investigation of the excited state remains a challenge to experimentalists and theoreticians alike . Recent developments in laser chemistry have afforded significant advances in the study of light - induced dynamic phenomena . However, due to the short excited state lifetime, the information obtained from such experiments is limited to a very small region of the excited state energy landscape . For those systems exhibiting longer excited state lifetimes, the interpretation of emission spectra is complicated by the fact that a detailed configurational representation of the experimental data requires knowledge of both the excited state and ground state energy surfaces . From a theoretical perspective, the accurate and proper computation of the excited state polyelectronic wave function is a decisive step to obtaining an accurate representation of the photophysical properties of the system at hand . In light of this, a variety of post - hartree fock methods including coupled cluster, configuration interaction, and multiconfigurational self - consistent field theory have been developed . In comparison to the ground state analogue, a single slater determinant is no longer appropriate to describe the excited state wave function, and a multiconfigurational description is required . Due to the intensive cpu time and large memory requirements, the above methods are often limited to static single point energy calculations for small molecular systems . The advent of approximate density - functional theory (dft)-based methods for the calculation of the excited state wave function, such as restricted open - shell kohn sham (roks) theory and, more recently, time - dependent dft, has facilitated the development of efficient excited - state ab initio molecular dynamics (aimd) simulations . Such aimd simulations are readily employed to study the detailed molecular motions of small isolated molecules and complex systems in the excited state . Nevertheless, despite the substantial increase in available computational resources and the development of more efficient simulation algorithms, such as the well - known car parrinello approach, aimd simulations are generally limited to time - scales of tens to hundreds of picoseconds . This is often too short to fully sample the ground and excited state surfaces . Recently, we implemented the accelerated molecular dynamics method (amd) in the framework of ab initio molecular dynamics . Accelerated ab initio molecular dynamics, a - aimd, represents a highly efficient and robust configurational space sampling method that allows for the study of slow molecular motions and rare events . A - aimd has successfully been applied to study both slow conformational transitions and chemical reactions in the ground state occurring on time scales many orders of magnitude longer than those accessible using standard aimd methods . In the present work, we extend the application of a - aimd to the study of excited state systems and their photophysical properties . We first demonstrate that a - aimd can be readily implemented as an efficient tool for studying the excited state energy surface, identifying both stable and metastable local energy minima and quantifying the magnitude of the associated energy barriers that separate these states . We then demonstrate how the excited state a - aimd method can be used to efficiently map out the photophysical topology of the system of interest (i.e., characterizing the variation in the vertical de - excitation energy gap as a function of the relevant internal degrees of freedom of the system). This information provides a detailed insight into the photophysical properties of the system, allowing the prediction of both excited state reactions and relaxation phenomena . The work presented in this paper is divided into two sections: in the first section, we focus on systems exhibiting fast radiationless decay processes, focusing on the identification of conical intersections (cis) and extended crossing seams . In the second section, we demonstrate how a - aimd can be used to describe the thermally averaged solvent effect on the fluorescence spectra of molecular systems, most notably making use of the enhanced configurational space sampling obtained by a - aimd to accurately describe both the prominent features and line - shapes of absorption and emission spectra . A comprehensive account of the accelerated ab initio molecular dynamics (a - aimd) approach is available in the literature, and we only provide a brief outline of the essential details here . In the standard amd formalism, a continuous non - negative bias potential, v(r), is defined such that when the true (underlying) potential of the system, v(r), lies below a certain, predefined threshold boost energy, eb, the simulation is performed on a modified potential, v(r) = v(r) + v(r), but when v(r) eb, the simulation is performed on the true potential [v(r) = v(r)]. The modified potential, v*(r), is related to the true potential, v(r), bias potential, v(r), and boost energy, eb, by1and the bias potential, v(r), is defined as:2 in the framework of aimd, the true potential, v(r), is defined as the density functional energy . The application of the bias potential results in a raising and flattening of the pes, thus enhancing the exchange rate between low energy states . The extent of acceleration (i.e., how aggressively we enhance the configurational space sampling) is determined by the choice of the boost energy, eb, and the acceleration parameter, . Configurational space sampling can be enhanced by either increasing the boost energy or decreasing . The reader is referred to ref (13) for more details . As the bias potential destabilizes low energy regions of conformational space on the potential energy landscape, the population statistics on the modified potential are inherently incorrect . However, as it is known at each step in the simulation exactly how much the system is destabilized, one can readily retrieve the correct population statistics by reweighting each point in the configuration space on the modified potential by the strength of the boltzmann factor of the bias energy, exp[v(r)], at that particular point . As a result, a - aimd yields a canonical average of an observable such that thermodynamic and other equilibrium properties can be accurately determined . Using the canonical boltzmann reweighting formulism described above, representative free energy surfaces for the system of interest can be obtained as follows: having defined an appropriate set of internal degrees of freedom (see the results and discussions section for specific details), the configurational subspace is divided into bins, and the structures collected across the a - aimd trajectories are allocated to their respective bin (j). The effective population statistic for each structure, i, is given by exp[v(i)]. For each bin, the population statistics are summed across all a - aimd trajectories to give an effective total population in that bin, pop(j), and the free energy surface, g(j), is obtained as3where pop(j)max is the effective total population of the most populated bin . In the case of fd, we show that the ground and excited state free energy surfaces obtained from the a - aimd simulations are directly compared to a metadynamics reference (see the computational details section). Having efficiently and exhaustively sampled the configurational space of the molecular system of interest in the excited state, the photophysical topology of the system was mapped out by identifying the appropriate internal degrees of freedom and dividing this configurational subspace into bins . Each structure in the a - aimd simulations was then allocated to a given bin . Given the large number of structures obtained from the a - aimd trajectories, 10 structures in each bin were randomly chosen, and a ground state energy calculation was performed . The vertical de - excitation energy gap associated with each bin was then averaged over the 10 representative structures . The specific internal degrees of freedom used for each system are defined explicitly in the results and discussions section . All molecular dynamics simulations were performed using an in - house modified version of the aimd 3.13 package . In the case of formaldimine (fd), the system was placed at the center of an orthorhombic box with side lengths (17.6 18.3 14.0 au). Similarly, for salicylidenaniline (sa), the system was placed at the center of a box with side lengths (22.9 35.6 14.0 au). In all ground state (s0) simulations, the electronic structure problem was solved with density functional theory (dft), and the restricted open - shell kohn sham (roks) method was implemented for simulations in the singlet (s1) excited state . For all systems, the becke (b) exchange and lee, yang, parr correlation functional were employed . Core electrons were treated using the norm - conserving pseudopotentials of troullier and martins, and the valence orbitals were expanded in a plane - wave basis up to an energy cutoff of 70 ry . In all ground and excited state (accelerated and nonaccelerated) simulations, a fictitious mass of 400 au was ascribed to the electronic degrees of freedom, and the coupled equations of motion were solved using the velocity verlet algorithm with a time step of 4 au . All aimd simulations (accelerated and nonaccelerated) were carried out at t = 300 k. standard aimd simulations were performed using a nos hoover chain thermostat on the ions, while in the case of the accelerated aimd simulations, a nos hoover thermostat was applied to both the electronic and nuclear degrees of freedom . The ground and excited state metadynamics simulations used for comparative analysis in the fd study (see results and discussions) were performed under exactly the same physical conditions as the standard aimd simulations described above . The angular and torsional coordinates (,) were employed as the collective variables . Metadynamics trajectories were run for 1 000 000 md steps (100 ps) and gaussian hills with a half - width of 2.5 and a depth of 0.2 kcal / mol were added every 200 md steps . Before proceeding to the results and discussions section, it should be noted that there are several limitations to the method presented in this work: first, it is clear that the accuracy of the relevant excited state free energy surfaces and photophysical topologies, including the identified cis and extended conical intersection seams, is strongly dependent on the integrity of the employed polyelectronic wave function representation . In the present examples, we have used the restricted open - shell kohn sham (roks) method to describe the excited state . The enhanced configurational space sampling afforded by a - aimd obviously does not have any effect on the accuracy of the polyelectronic wave function representation, and, as in all cases when using dft - based methods, it is important to validate the results using more sophisticated post - hartree fock methods (see introduction). Indeed, we would like to point out that for the two systems investigated here, fd and sa, the accuracy of the roks approach has already been validated by comparison to more sophisticated multireference configuration interaction methods . Second, the excited state a - aimd trajectories presented here are strictly performed under adiabatic conditions, and therefore explore the adiabatic excited state energy surface . As a result, the excited state populations and the corresponding free energies in the absence of relaxation are only approximations that do not have a direct physical meaning . In addition, no direct information is obtained concerning the specific dynamic processes that occur after vertical excitation that drive the system toward the conical intersection . Nevertheless, a - aimd simulations provide important information about the topology of the excited and ground state surfaces and allow converged sampling of both surfaces . Finally, it is also well - known that radiationless decay processes occur not only close to the crossing seam, where the energy gap between the intersecting states is small, but also in regions of configurational space away from it . For these cases, a variety of theoretical approaches, such as the method of fewest switches (mfs), which involve the calculation of a transition probability between the relevant electronic states have been developed to address such relaxation mechanisms . With specific regard to the msf approach, the transition probability is strongly dependent on the temporal velocity of the wave function, and as the evolution of the system in a - aimd occurs on a nonlinear time scale, the application of such methods is beyond the scope of the present study . Formaldimine (fd), the smallest unprotonated schiff base, is the prototypical system for studying cis trans photoisomerization around a double bond . The photophysical properties and associated nonadiabatic photoisomerization mechanism for this system have been rigorously studied using both nonadiabatic ab initio md and high - level static multireference configuration interaction (mrci) calculations . In the ground state, after vertical excitation to the lowest excited singlet state, s1, the system rapidly relaxes toward the local energy minimum on the excited state pes and the n h bond vector twists out of the molecular plane . On approaching the orthogonal twist geometry, the system enters the ci region resulting in strong nonadiabatic coupling between the s1 and s0 states . After a surface hop from the s1 to the s0 state, fd returns to a planar geometry, leading either to the photoisomerized product or to the regeneration of the reactant state (see figure 1b). The degrees of freedom (1,r1) and (2,r2) discussed in this work are indicated (dihedral angles highlighted in red). (d) scheme representing the photochemical landscape of salicylideneaniline, including the esipt and the nonadiabatic pathways . In order to study the configurational space sampling properties of fd, a multiple - copy ab initio md simulation strategy was employed: after performing a standard geometry optimization and equilibration procedure, five independent aimd simulations were performed for 500 000 md steps (the equivalent of 50 ps) at 300 k in both the ground and excited state . Analysis of the resulting trajectories revealed that the most significant variations in the configurational geometry involved the h c = n h dihedral angle,, and the c = n h angle, . Using these two internal degrees of freedom, the configurational space sampling obtained from all five independent aimd simulations in the ground and excited state are depicted in green in figure 2a and b, respectively . Notably, in both electronic states, the configurational space sampling afforded by the standard aimd simulations is rather limited: in the ground state, the h c = n h dihedral angle varies between 25 and + 25 and the c = n h angle varies between 100 and 125. these variations are the product of local thermal fluctuations at 300 k about the geometry - optimized structure with coordinates [,] = [0.0,111.36]. The observed thermal fluctuations in the excited state are slightly more pronounced with the angle varying by 40 and the angle varying by 20 about the geometry - optimized structure located at [,] = [124.69,101.71]. (a, b) conformational space sampled in formaldimine by standard aimd (green) and a - aimd (red) simulations, on the ground (left) and first singlet excited (right) electronic states . (c, d) free energy surfaces derived from the conformational space sampled by a - aimd simulations in a and b, respectively . The standard aimd trajectories described above served as the initiation point for the accelerated ab initio md simulations . Using a fixed value for the acceleration parameter, = 0.01 au, a series of short [100 000 md step] a - aimd simulations were performed across a broad range of acceleration levels in both the ground and excited state . The acceleration level was controlled by varying the boost energy, [eb v0], where v0 is the average density functional energy obtained from the standard aimd simulations . The choice of the acceleration level is exceedingly important: if the acceleration level is too low, ostensibly no enhanced configurational space sampling is observed . In contrast, applying too high an acceleration level results in a molecular explosion or dissociation of the system . In the present case of fd, [eb v0] the optimal acceleration levels for enhanced configurational space sampling were found to be [eb v0] = 0.085 au and [eb v0] = 0.060 au for the ground and excited state, respectively . These optimal acceleration levels afforded the most efficient configurational space sampling, while not rendering dissociation of the system . Once the optimal acceleration levels in the ground and excited state had been determined, five independent a - aimd simulations were performed for 500 000 md steps . The configurational space sampling obtained from the five independent a - aimd simulations in the ground and excited state clearly, the accelerated md simulations provide a much more complete and robust description of the conformational space sampling properties of fd compared to the standard aimd trajectories . Most importantly, in the a - aimd simulations, we observe multiple isomerization events in both the ground and excited state . Interestingly, the a - aimd simulations reveal significant differences in the specific adiabatic isomerization pathways in the two electronic states: in the ground state, as the angle flips from 0 to 180, the c = n h angle,, is seen to significantly increase . At the orthogonal twist geometry (= 90), the c = n h angle adopts values between + 140 and + 170. by contrast, in the excited state adiabatic isomerization process, the angle adopts values between 90 and 140 at = 0 . The associated free energy surfaces in the (,) configurational subspace (see theory and computational details) for the ground and excited state of fd are depicted in figure 2c and d, respectively . The lowest free energy barrier for adiabatic isomerization on the ground state surface was found to be 0.052 au, and the associated transition state is located at [,] = [100,150]. Similarly, in the s1 excited state, the lowest free energy barrier for isomerization is 0.037 au, and the associated transition state is located at [,] = . The free energy barriers obtained from the a - aimd simulations presented here are in excellent agreement with previous theoretical and experimental studies, where the free energy of isomerization in the s0 and s1 states was found to be 0.048 au and 0.040 au, respectively . In order to provide a reference to validate the a - aimd free energy surfaces shown in figures 2c and d, we performed two metadynamics simulations using the and internal degrees of freedom as the collective variables (see theory and computational details). The free energy surfaces for the ground and excited state obtained from the metadynamics simulations are depicted in figure 2e and f, respectively . Clearly, the adiabatic free energy surfaces provided by both methods are very similar, and the extent of configurational space sampling obtained from the a - aimd and metadynamics simulations is also similar . This is an encouraging result when one considers that in the accelerated molecular dynamics approach there is no a priori definition of a reaction coordinate or a set of collective variables . The comparative analysis of the present a - amd approach and the more well - known metadynamics method clearly demonstrates that one can obtain an accurate energetic description of the excited state energy surface, which is both an important and necessary prerequisite to acquiring a detailed picture of the photophysical topology of the system . The excited state free energy surface and associated population statistics acquire much more significance when studying a system with considerably longer excited state lifetimes, such as in the case of the acetone - in - water system presented later in this paper . The efficiency of the configurational space sampling obtained from the a - aimd simulations can be readily inferred from the magnitude of the free energy barriers that are traversed during the simulations of fd in the ground and excited state . According to transition state theory (tst), the predicted rate constant, k, for a transition between two states separated by a free energy barrier, g, is given by4where is the transmission coefficient and kb is the boltzmann constant . As discussed above, the free energy barrier for adiabatic isomerization of fd in the ground state is 0.052 au . In the fast limit (= 1), the tst predicted rate constant for this process is therefore 1.62 10 s. given that a 50-ps ground state a - aimd trajectory produces 45 isomerization events, on average, in the a - aimd simulations, an isomerization event is observed every 100 000 md steps (10 ps). In light of this observation, the application of the bias potential enhances the configurational space sampling rate by a factor of 10 . In order to map out the photophysical topology of fd, the configurational subspace (,) shown in figure 1b was divided into bins; the vertical de - excitation energy gap across the entire excited state configurational space was calculated (see theory and computational details). Two large crossing seam regions are clearly visible, located at [50 <<150, 70 <<120]. Notably, outside of these two regions, the vertical de - excitation energy gap significantly increases to values on the order of 2030 kcal / mol . Closer inspection of figure 3a reveals that there exists a considerable amount of fine - structure on the vertical deactivation energy surface . This observation raises the important question as to whether this fine structure is really a physical phenomenon of the system or whether it is merely statistical noise invoked by the application of the bias potential in the a - aimd simulations . In order to address this issue, 200 excited state structures along the coordinate were selected from the a - aimd simulations with a fixed c = n h angle, = 90 . A partial geometry optimization procedure was performed for each structure, in which the internal (,) coordinates were constrained and the vertical de - excitation gap was then recalculated . Figure 3b depicts the s1s0 energy profile along the coordinate obtained from the a - aimd structures collected on - the - fly and their geometry - optimized counterparts . The two resulting energy profiles are remarkably similar, confirming the fact that small local molecular distortions arising from the application of the bias potential in the a - aimd simulations do not compromise the accuracy of the vertical deactivation energy statistics . A very interesting feature in the energy gap profile depicted in figure 3b is observed deep in the crossing seam region: between coordinates [110 <<75] and again at [75 <<110], the vertical deactivation energy gap is seen to increase by 2 kcal / mol . This small variation in the energy gap is due to a change in the pyramidalization angle about the c atom, which reaches its maximum at a pyramidalization angle of 27. this result is in agreement with a previous study by doltsinis et al ., who observed a loss of degeneracy of the crossing seam at a pyramidalization angle of 30. this result provides additional validation to the degree of detail that can be achieved in both the conformational space and free energy sampling, otherwise not possible using standard md or single point electronic calculations . A second interesting feature shown in figure 3a and b is the observation of negative [s1s0] energy gaps for a limited region of the a - amd - sampled configurational space for fd . Such small negative energy gaps have been observed previously and are invariably the result of an error arising from the fact that the ground and excited electronic state calculations are performed independently . As such, we would like to point out that these small artifacts are not a result of the application of the a - amd biasing potential but rather a product of the polyelectronic wave function representation employed in this work . (a) variation in the energy gap [s1s0] for formaldimine as a function of the internal coordinates and, obtained from single point calculations in randomly chosen structures sampled across the a - aimd trajectory (see theory and computational details). The solid line indicates the cut of the surface for which the direct relaxed difference has been computed . (b) direct (dashed line) and relaxed (solid line) s1s0 energy gap profiles along the surface cut at = 90. energies are expressed in kcal / mol . Using our a - aimd approach on the fd system, we were able to exhaustively investigate the photophysical properties of the system and identify crossing seams from the data collected in s1 at a higher sampling rate compared to standard aimd approaches . In light of this successful initial study the aromatic schiff base salicylideneaniline (sa) represents a classic example of an excited state intramolecular proton transfer (esipt) reaction . The reactant and product forms of sa, corresponding to the enol and cis - keto isomeric forms, respectively, are connected by an esipt event after photoexcitation to s1, as shown in figure 1c . At this point, the electronically excited cis - keto tautomer can either undergo a cis trans isomerization to form a trans - keto tautomer or directly deactivate to s0 . Despite this simple chemical scheme, much controversy has arisen in the past 40 years concerning the experimental determination of the time scale for the esipt process in sa, with measurements ranging from 750 fs to less than 50 fs . The reader is referred to ref (36) for an updated list of references on the sa studies . Sekiya and collaborators proposed the presence of two nonadiabatic processes competing with the proton transfer event: the first process involves a highly deformed enol conformation, while the second relaxation mechanism is associated with the cis trans isomerization path of the cis - keto tautomer, as depicted in figure 1d . Very recently, static tddft calculations (validated with high - level multiconfigurational ab initio calculations) and quantum dynamical simulations confirmed the presence of two ci regions associated with both the enol and cis - keto states . In order to study the competition between the two relaxation pathways on the excited state surface, we performed a series of aimd and a - aimd simulations similar to those described previously for fd . A standard geometry optimization and equilibration procedure was performed on the enol tautomer in the excited state . The geometry optimization led directly to the cis - keto tautomer of sa, indicating that the enol state is not a stable species in s1 . Five independent aimd simulations were performed for a total of 1 500 000 md steps (150 ps) at 300 k on the cis - keto tautomer in s1 . The system remained in the cis - keto state during the simulations, and we were not able to observe a reverse esipt event . H atomic distance was seen to fluctuate around the cis - keto geometry - optimized value (2) in all the 150 ps trajectories, as depicted in green in figure 4a . The principal geometrical fluctuations observed in the simulations can be described by two independent variables: the c c = c n dihedral angle (highlighted in red in figure 1c), 2, which varies between 50 and + 50 degrees, and the c = c bond distance, r2, which varies between 1.32 and 1.53 . Notably, although large amplitude vibrations were seen along the 2 coordinate (figure 4c), cis h distance of salicylideneaniline during 150 ps of standard aimd (green) and a - aimd (red) simulations in the s1 state . (b, c) conformational space sampled in salicylideneaniline using standard aimd (green) and a - aimd (red) simulations in the s1 state in the enol and cis - keto regions, respectively . The intersection of the solid lines indicates the location of the two mecps described in ref (36). In order to improve the conformational space sampling, a set of short a - aimd simulations were initiated . Using a fixed value of = 0.01 au for the acceleration parameter, a series of 500 000 md - step a - aimd simulations were performed across a broad range of acceleration levels for the cis - keto state in s1, whereby [eb v0] was varied between 0.050 au and 0.200 au in steps of 0.05 au . The optimal acceleration level for enhanced configurational space sampling was found to be [eb v0] = 0.150 au for the excited state . This optimal acceleration level was employed for five independent accelerated ab initio md simulations, each performed for a total of 1 500 000 md steps (150 ps). The analysis of our a - aimd simulations indicated that the configurational space sampled within 150 ps covered both the cis - keto and the enol states . H bond distance presented large fluctuations during the first 100 ps, ranging between 1.2 and 5.5 . After 110 ps, a reverse esipt event was observed, which led to a decrease of the o a difference of 10 kcal / mol between the enol and cis - keto regions in the excited state was estimated, which explains why we did not observe a reverse esipt event during the standard aimd simulations . By contrast, however, the application of the bias potential in the a - aimd simulations facilitated the observation of a reverse esipt event after only 110 ps (see figure 4a). The newly formed enol tautomer remained stable for the last 40 ps of the simulation, affording both ample conformational and energy statistics for the enol state . As such, two chemically different but relevant sections of the pes were successfully sampled from a single molecular geometry . The configurational space sampled in the enol region revealed significant variations in both the c c = n c dihedral angle (highlighted in red in figure 1c), 1, and the c = n bond distance, r1, which may be compared directly to the prominent internal degrees of freedom identified for the cis - keto state [2, r2]. Interestingly, the rotation and stretching along double bonds in excited electronic states has been previously proposed as a common feature in nonadiabatic deactivation pathways for complex organic compounds . The variation of these degrees of freedom sampled in the five independent a - aimd simulations in the excited state are depicted in red in figure 4b and c. as expected, the accelerated md simulations provide considerably more exhaustive configurational space sampling compared to their aimd counterparts . In the a - aimd simulations, we observed multiple rotation events around the dihedral angles 1 and 2 in the enol and cis - keto regions, respectively, and complete rotation events through 360 were observed in both cases . Simultaneously, rather large fluctuations in the bond distances (1.221.67 for r1 and 1.231.75 for r2) were also observed . The intersection of the two straight lines depicted in figure 4b and c defines the coordinates for the two mecps described in a previous study of sa . These two mecps are located at the coordinates (92, 1.37) and (89, 1.47) for the enol and cis - keto regions, respectively . Notably, the conformational space sampled in the standard aimd simulations for the cis - keto state (figure 4c) does not include these coordinates, while the a - aimd simulations readily encompass a considerably larger region of the configurational subspace including the associated mecp coordinates . The variation in the underlying pes explored in our a - aimd simulations indicates that the rotational barriers associated with the dihedral angles 1 and 2 are 16.75 and 18.03 kcal / mol, respectively . As such, the twisted conformations for both the enol and cis - keto tautomers are clearly inaccessible in the standard aimd simulations but can be readily observed in the a - aimd trajectories . The vertical de - excitation energy gaps mapped across the entire excited state configurational subspaces (1, r1) and (2, r2) for the enol and cis - keto tautomeric states are depicted in figures 5a and b. two large conical intersection regions are clearly visible on each plot, located at [75 <1 <110, 1.40 <r1 <1.55] and [60 <2 <120, 1.40 <r2 <1.65] for the enol and cis - keto states, respectively . These results show that a complete characterization of both crossing seams can be obtained from the a - aimd simulations, even though they belong to very different regions of the pes . (a, b) variation in the energy gap [s1 s0] of salicylideneaniline, in the enol and cis - keto regions, respectively . The surfaces are projected on the (1,r1) and (2,r2) subspaces and have been obtained from single point calculations in randomly chosen structures sampled in the a - aimd trajectories (see theory and computational details). The extended crossing seams present in the de - excitation energy maps (figures 4 and 5) obtained from the a - aimd simulations clearly suggest that there exist two competing radiationless relaxation decay processes which completely describe the photophysical properties of sa after vertical excitation: in the first of these relaxation decay mechanisms, the vertical excitation energy initiates a spontaneous proton transfer event which leads directly to the formation of the (excited) cis - keto state (figure 1d), and a subsequent rotation in 2 brings the system to the extended conical intersection seam (ci2) depicted in figure 5b, resulting in either a cis - keto or trans - keto ground state photoisomerized product . In a second competing relaxation mechanism, the vertical excitation energy induces a rotation about the 1 dihedral angle which breaks the hydrogen bond and results in the formation of a highly twisted enol conformation . In the twisted enol state, the c = n bond is weakened, and the r1 bond length increases up to 1.67 (see figure 4b), bringing the system into the conical intersection region (ci1). Notably, the correlation between the 1 and r1 coordinates assists the evolution of the enol tautomer toward the extended ci seam, an observation that cannot be ascertained from the mecp result but is readily confirmed by the exhaustive configurational space sampling provided by the a - aimd simulations . The existence of two competing radiationaless relaxation decay processes predicted from this study readily explains the experimental observation that the quantum yield of the cis / trans - keto products is lower than one would expect when only considering a single nonadiabatic relaxation mechanism associated with the enol - to - cis - keto proton transfer event . In this paper, we have performed excited state accelerated ab initio molecular dynamics (a - aimd) to explore the excited state energy landscape and photophysical properties of a variety of systems . In an initial case study on formaldamine, we have found that a - aimd can be readily employed to enhance configurational space sampling for the study of molecular systems in the excited state, crossing energy barriers on the excited state energy landscape of up to 30 kcal / mol and affording a quantitative description of the excited state free energy surface . Notably, in comparison to other popular enhanced sampling methods that involve the specific definition of a reaction coordinate, a - aimd does not require any a priori understanding of the underlying free energy surface . The method was subsequently used to study the photophysical topologies of salicylideneaniline (sa). It allowed the identification and characterization of conical intersections (cis) and extended conical intersection seams and the prediction of two different, competing radiationless decay processes . For acetone in water, we demonstrated that the enhanced configurational space sampling obtained by a - aimd may be used to compute converged absorption and emission spectra . The a - aimd method is general and may be implemented in combination with any methodological representation of the polyelectronic wave function . Given the rapid and sustained increase in available computational resources, it may soon be possible to combine a - aimd with more sophisticated post - hartree fock representations of the polyelectronic wave function in order to efficiently obtain an accurate and complete description of both ground and excited state energy surfaces.
Based on recent basic and clinical studies, it has been shown that adipocytokines may contribute to the induction of carcinogens and progression of tumors (1). Visfatin was initially recognized as a growth factor for proliferation of b - cell lymphocyte, called the pre - b cell colony - enhancing factor . Subsequently, it was found as a cytokine present in a variety of cells and tissues with metabolic and inflammatory effect . Visfatin have also been shown to correlate with pro - inflammatory cytokines such as il-1, il-6, and tnf . It stimulates il-6 and il-8 and may be associated with oxidative stress parameters . Modulation of insulin by binding to the insulin receptor is another recognized function for visfatin (2,3). Previously, we reported the levels of various adipocytokines in patients with colorectal cancer and we found a significant increase in the visfatin serum level in colorectal cancer patients comparing to controls (4). Therefore, we examined if this cytokine increases in patients with colorectal adenoma as a precursor of colorectal cancer . To the best of our knowledge, in addition to a previous study done by nakajima et al . (1), the present study is among the first reports to evaluate the visfatin level in patients with colorectal adenoma comparing to healthy controls . This case - control study was conducted at the department of surgery of imam medical complex affiliated to tehran university of medical sciences . Between january 2014 and june 2015, a total of 34 patients diagnosed with colorectal adenoma and 35 disease - free controls were included in case and control groups, respectively . Patients with a previous history of any colorectal disease including polyps, adenoma, irritable bowel disease or cancerous lesion were excluded from the study . Disease - free controls were selected from participants in the persian gulf healthy heart study (5). This study was carried out between march 2013 and march 2015 in colorectal surgery department of tehran university of medical sciences . All the patients were informed about the study and written informed consent was taken from each patient . For each patient, systolic and body mass index (bmi) and waist - to - hip ratio (whr) were calculated after measuring height, weight, waist circumference (midway level between the costal margins and the iliac crests) and hip circumference (at the level of the greater trochanters). In order to measure serum markers, fasting venous blood samples were obtained from all patients and the disease - free controls . Serum biochemical parameters including blood glucose, triglyceride, and cholesterol levels were measured on the day of sampling using selectra 2 autoanalyzer (vital scientific, spankeren, netherlands). Serum cholesterol (hdl and total) and triglyceride levels were measured using cholesterol oxidase / phenol aminoantipyrine and glycerol-3-phosphate oxidase phenol aminoantipyrine enzymatic methods, respectively . In cases with triglycerides level of less than 400 mg / dl, serum ldl was calculated using the friedewald formula . Enzyme - linked immunosorbent assay kits (adipogen, seoul, korea) were utilized in order to measure visfatin levels . The assay sensitivity for visfatin was 0.10 ng / ml; the intra- and inter - assay coefficients of variance were 3.85.5% and 6.49.5%, respectively . Descriptive values were expressed as the mean sd . In order to compare visfatin levels between groups a two - tailed t - test was considered . Pearson s correlation was also used to assess the relationship between visfatin levels and other measured variables . This case - control study was conducted at the department of surgery of imam medical complex affiliated to tehran university of medical sciences . Between january 2014 and june 2015, a total of 34 patients diagnosed with colorectal adenoma and 35 disease - free controls were included in case and control groups, respectively . Patients with a previous history of any colorectal disease including polyps, adenoma, irritable bowel disease or cancerous lesion were excluded from the study . Disease - free controls were selected from participants in the persian gulf healthy heart study (5). This study was carried out between march 2013 and march 2015 in colorectal surgery department of tehran university of medical sciences . All the patients were informed about the study and written informed consent was taken from each patient . For each patient, systolic and body mass index (bmi) and waist - to - hip ratio (whr) were calculated after measuring height, weight, waist circumference (midway level between the costal margins and the iliac crests) and hip circumference (at the level of the greater trochanters). In order to measure serum markers, fasting venous blood samples were obtained from all patients and the disease - free controls . Serum biochemical parameters including blood glucose, triglyceride, and cholesterol levels were measured on the day of sampling using selectra 2 autoanalyzer (vital scientific, spankeren, netherlands). Serum cholesterol (hdl and total) and triglyceride levels were measured using cholesterol oxidase / phenol aminoantipyrine and glycerol-3-phosphate oxidase phenol aminoantipyrine enzymatic methods, respectively . In cases with triglycerides level of less than 400 mg / dl, serum ldl was calculated using the friedewald formula . Enzyme - linked immunosorbent assay kits (adipogen, seoul, korea) were utilized in order to measure visfatin levels . The assay sensitivity for visfatin was 0.10 ng / ml; the intra- and inter - assay coefficients of variance were 3.85.5% and 6.49.5%, respectively . Descriptive values were expressed as the mean sd . In order to compare visfatin levels between groups a two - tailed t - test was considered . Pearson s correlation was also used to assess the relationship between visfatin levels and other measured variables . In this study a total of 69 cases including 34 patients with colorectal adenoma and 35 disease - free controls were enrolled . Patients included 18 males (53%) and 16 females (47%) and controls were 18 male (51%) and 17 female (49%). Patients and controls were also matched regarding their age as well . Demographic information of both groups and other studied variables including systolic and diastolic blood pressures, body mass index (bmi), waist to hip ratio and lipid profile of patients have been summarized in table 1 . As can be seen in table 1, there was no significant statistical difference among the patients and the controls in terms of these variables (p>0.05 in all comparisons). * p <0.05 were considered significant . * * two - tailed t - test was used to compare visfatin levels between groups . Pearson s correlation was used to evaluate the relationship between visfatin levels and other measured variables . Meansd of visfatin levels in male and female patients were 6.33.01ng / ml and 7.13.05ng / ml, respectively . The visfatin level in the control group was 7.22.41ng / ml and 6.42.59ng / ml for males and females, respectively . Moreover, there was no significant difference in terms of the visfatin level between both gender in each group (p=0.482 for patients and p=0.375 for controls). We also tried to analyze any possible correlation between the visfatin levels and each of the mentioned studied variables . Except for a significant correlation between the bmi value and visfatin level (p=0.041), visfatin levels were analyzed separately based on the location of the adenoma within the large intestine in the patient group (table 2). We found no significant difference between the levels of visfatin in each location comparing the healthy controls (p>0.05 in all comparisons). There was no statistical difference between the locations groups in terms of visfatin level as well (p=0.068). * values show possible differences between visfatin levels of patients suffering from adenoma in each part of colon or rectum comparing to the control levels . Visfatin can be found in significant amounts in adipose tissue and it is produced primarily by visceral adipose tissue . Therefore, visfatin serum levels may be affected by a change in body weight and relationship between obesity, bmi and serum levels of visfatin has also been documented (2,6). Although the visfatin level had a significant relation with the bmi value in our adenoma patients, we found no statistical significant relation in the healthy controls . Metabolic syndrome is a group of harmful metabolic abnormalities, including visceral obesity, hyperglycemia, dyslipidemia, and hypertension . Increased circulating visfatin levels have also been found in patients with metabolic syndrome (7,8). Therefore, we tried to depict any relation between visfatin level and metabolic abnormalities involved in metabolic syndrome in patients with colorectal adenoma . Although we found a significant relation between the visfatin level and bmi of patients, we did not detect any relation for hyperglycemia, hypertension (systolic and diastolic) and dyslipidemia (hyper cholesterolemia or hypertriglyceridemia). Sigmoid (13 patients, 38.2%) and rectum (13 patients, 38.2%) were the most common site followed by ascending colon (6 patients, 17.6%). Ascending (3.923.25 ng / ml) and transverse colon (8.551.34 ng / ml) had the lowest and highest mean serum levels of visfatin, respectively . Nevertheless, our analysis revealed no significant difference between these levels and the value for the visfatin level in normal controls . Nakajima et al . (1) analyzed the possible relations between the size and number of colorectal adenomas and some adipocytokines including the visfatin . They found that except for adiponection, other cytokines including the visfatin has no relation with these two factors . Consequently, according to this study and our findings, it seems that size, number and location of colorectal adenoma are not influential factors affects the adipocytokine levels . Low number of cases was the major limitation in our study . Designing another study with higher number of patients although visfatin level has been shown to be increased in serums of patients with colorectal cancer, it does not significantly increase in cases with colorectal adenoma . Site of adenoma within the colon or rectum does not seem to play an important role in this regard as well.

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.