Split (1)

train · 133k rows

text stringlengths 0 868k
A 17-year - old girl presented with painless swelling of the right neck and supraclavicular lymph nodes accompanied with fever and fatigue in february 2007 . The pathology report after lymph node biopsy indicated that the normal lymph node structure had disappeared and scattered distributions of reed - sternberg (rs) cells and hodgkin disease (hd) cells occurred . Immunohistochemical staining showed that these cells were positive for cd30 (figure 1a), paired box protein 5 (pax5) (figure 1b), and epstein - barr virus (ebv), and negative for cd15 and anaplastic lymphoma kinase (alk). Treatment with 4 cycles of abvd was conducted as induction chemotherapy followed by bilateral neck and supraclavicular radiation therapy (36 gy). The patient achieved complete remission (cr) but, after about 1 year, relapsed with inguinal and mediastinal lymph node involvement, as detected by positron emission tomography (pet)/computed tomography (ct) scan . Afterwards, 8 cycles of salvage chemotherapy with cyclophosphamide, vindesine, epirubicin, and prednisone (chop) were performed, and the patient achieved cr again . A pet / ct scan in april 2010 indicated relapse, with mediastinal, left axillary, retroperitoneal, pelvic cavity, and inguinal lymph node involvement and multiple nodules at the thoracolumbar vertebrae, right iliac crest, and right ischium . The patient was diagnosed with hl of nodular sclerosis subtype after a left inguinal lymph node biopsy . She then underwent 2 cycles of salvage chemotherapy with rituximab, cyclophosphamide, vindesine, epirubicin, prednisone, and etoposide (r - chope) and underwent asct in december 2010 . A pet / ct scan in june 2011 subsequently demonstrated relapse once more, with nodules in the liver, spleen, and lung (figure 2a). Consequently, 2 cycles of salvage chemotherapy with gemcitabine, dexamethasone and nedaplatin (gdp) were given, but the disease persisted at the end of therapy . On october 20th, 2011, results of ct scan showed that the number and size of nodules in the lung significantly increased (figure 2b). The patient exhibited persistent fever and systemic failure, and showed an eastern cancer oncology group (ecog) score of 3 . In october 2011, the patient began brentuximab monotherapy, with a dose of 1.8 mg / kg, once every 3 weeks . Following the first course of brentuximab, the patient's body temperature dropped gradually after 4 days of treatment and returned to normal 1 week later . Because of bone marrow involvement, white blood cell, hemoglobin, and platelet counts decreased markedly before treatment . However, the patient continued with brentuximab therapy without interruption under the support of granulocyte colony - stimulating factor (g - csf), thrombopoietin (tpo), and interleukin-11 (il-11). Following the first course of brentuximab, ct scan showed that the lung nodules were significantly reduced in size and number (figure 2c). After the second treatment, the patient began to recover from pancytopenia and regain physical strength, and her condition improved significantly . After the third course of treatment, the patient was capable of self - care, indicating an ecog score of 2 . Pet / ct scan suggested partial remission (pr). After the fourth course of treatment, anemia began to improve, with hemoglobin increasing from 60 to 100 g / l . After physical activity palpitations disappeared, the patient's heart rate fell from 110130 to 7080 beats / min . Shrinkage was noted in multiple nodular shadows in double lung fields (figure 2d). After the sixth course of treatment, hemoglobin count had nearly returned to normal, and lesions in the lungs, liver, spleen, bones, mediastinum, and abdomen significantly decreased . A pet / ct scan showed that the lung nodules had disappeared, and the maximum standard uptake values (suvmax) of thoracolumbar vertebral nodules and liver and spleen nodules had decreased to normal (figure 3). The patient encountered reversible adverse reactions during treatment, including peripheral neuropathy, elevated aminotransferases, hair loss, and dry cough, and these adverse effects were controlled with symptomatic treatments . At the time this paper was submitted tissue specimens were collected after lymph node biopsy, sectioned, and stained to detect cd30 and pax5 . A, reed - sternberg (rs) cells show cd30-positive membrane (white arrow). A, nodules before treatment with gemcitabine, dexamethasone, and nedaplatin (gdp) in june 2011 . C, in november 2011, after the first course of brentuximab, significant shrinkage of lung nodules was noted . D, in february 2012, after the fourth course of brentuximab, the nodules had nearly disappeared . We introduced brentuximab therapy to a patient with hl refractory to chemotherapy, radiotherapy, and asct . The patient's most recent relapse involved several organs, including the liver, lungs, bones, bone marrow, and mediastinal and retroperitoneal lymph nodes . To the best of our knowledge, this is the first patient with hl in the mainland of china who underwent brentuximab treatment . Brentuximab, a new targeted therapy for lymphoma, is an antibody - drug conjugate which consists of the anti - cd30 monoclonal antibody cac10 conjugated with the cytotoxic agent monomethyl auristatin e (mmae). As a monoclonal antibody moreover, chemotherapeutic drugs can also be coupled to the monoclonal antibody to directly target tumor cells, resulting in more specific and effective anti - tumor action . This new drug has shown dramatic efficacy on a number of relapsed and refractory hl patients . Our data showed that brentuximab's efficacy on this refractory and relapsed case appeared quickly . Further, after 6 courses of brentuximab, all lesions disappeared and cr was achieved . Adverse effects including peripheral neuropathy, elevated aminotransferases, hair loss, and dry cough appeared but could be controlled with symptomatic treatments.
Eponymous glaucoma recognizes a group of ocular conditions characterized by progressive optic nerve damage associated with loss of visual function and, frequently, with elevated intraocular pressure (iop). Iop increase is due either to a very infrequent rise of aqueous humor (ah) production or to a more frequent impairment of ah outflow . The balance between the rate of ah production (inflow) and the resistance that it encounters in its egress away from the eye (outflow) generates the level of iop; however, in normal subjects equilibrium exists between aqueous humor production and drainage . Aqueous humor leaves the eye through two main pathways: one sensitive to eye pressure, the conventional route (trabecular meshwork, schlemm's canal (sc), collector channels (ccs), aqueous veins (av), and episcleral veins (ev)), and the other independent of eye pressure, the nonconventional route (uveal meshwork, ciliary muscle, suprachoroidal space, and sclera). In human, about 80%90% of aqueous outflow takes place through the conventional outflow, whereas about 10%20% passes through unconventional outflow . The major function of the conventional outflow pathway is to maintain the intraocular pressure within the critical range by modulating the outflow resistance of the aqueous humor . Structural modifications in this pathway can lead to raised intraocular pressure, greatly increasing the risk for developing glaucoma . Despite the importance of verifying the healthy functioning of this system, especially in light of its implication in both medical and surgical approaches, no defined technique exists to visualize in vivo the structure responsible for the ah outflow . A wide range of imaging techniques to visualize the aqueous outflow system have been developed . Wessely, followed by schulte, goldmann, and benedikt, described the aqueous pathway by injecting fluorescein directly into the anterior chamber (ac). The fluorescein, injected into the ac, becomes visible in ultraviolet light making the recording of aqueous humor outflow by photography possible . The drawbacks of this technique are due to the large volumes and high concentration of the fluorescein employed, to the delayed filling of the episcleral venous network, and to the leakage from scleral vessels . More recently, grieshaber et al . Proposed a new approach by using a flexible microcatheter through which fluorescein is injected . . Limitations of the method consist of the immediate dye diffusion into channel network and the uveoscleral pathway . Noninvasive methods to display the outflow pathway from sc to the superficial vasculature comprise high frequency ultrasound (ubm 50 mhz), time domain optical coherence tomography (oct) [9, 10], and, more recently, swept source fourier domain (sd) oct systems . The limitations of this method are the following: (1) it does not allow the evaluation of all the structures involved in the ah outflow pathway; (2) it does not allow both distinguishing arteries from veins and giving a quantitative comparison of vessel number and vessel diameter; (3) sd - oct images are not real, being rather a 3d virtual casting of the aqueous outflow vasculature; thus oct anatomical images do not reveal the functional status; and, lastly, (4) the in vivo 3d imaging acquisition is disturbed by eye movements [9, 10]. The purpose of the present study is to assess the aqueous outflow system in patients affected by primary open angle glaucoma (poag) undergoing canaloplasty, using a flexible microcatheter filled with indocyanine green (icg) diluted in viscoelastic solution . We thought that icg, being a larger molecule than fluorescein and coupled to a viscous carrier, might be less prone to leak from the sc, therefore better visualizing the outflow pathway . Surgical procedures were performed at the s. giuseppe moscati hospital, avellino, italy, by one surgeon (l. zeppa). Ten patients affected by poag undergoing canaloplasty (four males and six females, mean sd ages of 51 8 and 47 9 years, resp .) Were included in this pilot study . All patients were under maximum tolerated medical therapy and had been followed up at least 60 months before surgery . Exclusion criteria were narrow or closed iridocorneal angle, evidence of any secondary glaucoma, pigmentary dispersion, pseudoexfoliation, history of trauma, history of uveitis, any type of corneal disease, or previous refractive surgery . Informed consent was obtained from each patient after a detailed description of the procedure used and of the aim - work . The study was approved by the local institutional ethics committees and followed the tenets of the declaration of helsinki . The preparation of the icg tracer was done under sterile conditions . A solution composed of icg (icg - pulsion 25 mg/50 mg, pulsion medical systems se, germany) and commercially available viscoelastic solution with high viscosity and high density (discovisc, alcon laboratories inc ., usa) and with a final icg concentration of 25 g / ml was used . The cartridge of the viscoinjector was filled with such mixed solution and attached to the microcatheter . The commercial viscoelastic solution is a mixture formed by 1.6% of hyaluronic acid and 4% of chondroitin sulfate, with zero - shear viscosity of 75 mpas . Arshinoff and jafari proved that the zero - shear viscosity correlates well with cohesiveness; therefore, the viscoelastic solution soon dissipates into the canal after injection . Icg is a negatively charged tricarbocyanine dye with strong absorbing properties in the near - infrared range and is only weakly fluorescent in its unbound state . The uv - vis spectrum of aqueous solution 25 m is displayed in figure 1(a), whereas figure 1(b) shows its fluorescence spectrum . The excitation and emissions wavelengths utilized for this spectrum were 778 nm and 810 nm, respectively . The microcatheter used (itrack 250a, iscience interventional, menlo park, ca, usa) consists of 3 parts: an optical fiber which allows illumination of the distal tip for transscleral visualization, a support wire to provide pushing ability during catheterization, and a lumen through which fluids can be delivered . The overall diameter of the shaft of the microcatheter is 200 m with a blunt distal tip (250 m) to minimize potential tissue damage . A screw - driven syringe is connected to the proximal end of the microcatheter and delivers a precise volume of solution . One - eighth (1/8) of a turn on injector knob equals 150 l volume fluid injected . Visualization of the tracer in the outflow pathway was accomplished using the microscope opmi pentero 900 (carl zeiss meditec, germany) taking advantage of the fluorescence application flow 800 which allows the visual analysis of vascular blood flow dynamics in the range of infrared wavelengths (~800 nm). Preliminary dissection of superficial and deep scleral flaps and subsequent unroofing of the sc were performed . Both ostia of the sc were dissected forward to the descemet membrane to expose the trabeculo - descemet window and facilitated the insertion of the microcatheter into the sc . The microcatheter was positioned in plane and in line to the sc and advanced into complete circumference while the location of the red blinking tip was observed through the sclera . During advancement of the tip, a fixed volume of icg tracer (150 l) was gently injected through the microcatheter by 1/8 of a turn on the viscoinjector . Soon after injection of the dye, there was impregnation of the borders of the scleral flap due to partial reflux caused by the intrachannel resistance; progression of the dye along the sc starting from the site of injection was then visualized (figure 2). In some eyes, the filling proceeded along 360 degrees whereas in others only a portion of the canal was visualized . In 3 patients, the percentage of filling was 70%, whereas in the remaining 7 patients this percentage decreased up to 50% . The filling of the collector channels occurred only in correspondence of the patent portions of the sc (figure 3). However, even in presence of a patent sc over 360 degrees, the filling of the collector channels was not simultaneously visualized in all four quadrants . Furthermore, the collector ccs closer to the site of injection did not necessarily fill up before the farther ones . On the contrary, the filling seemed to be influenced by the resistance encountered by the dye to progress; in fact, after increasing the volume / pressure of infusion, visualization of some ccs, initially not perfused, occurred . The only noticeable aqueous veins were located in correspondence of the quadrants in which both the sc and the ccs were patent (figure 4). The upper quadrants were more affected than the lower ones, and, between the lower ones, the temporal quadrant was more affected as compared to the nasal one . Simultaneously a retrograde filling, of glomerular - shaped structures, furthest in schlemm's canal occurred in the quadrants where the pathway was functioning (figure 5). We hypothesize that these structures might be located in the iris rather than in the trabecula, since they did not show any leakage of dye in the anterior chamber in the late phases of the exam . Finally the aqueous veins, easily recognizable for their larger caliber, appeared . From the dye injection, the outflow structures remained visible for a period of 2.5 hours . Herein we showed that injection of a mixture composed of icg and viscoelastic solution into the sc allows clear visualization of the portions of the conventional outflow pathway in patients affected by poag . In addition, a retrograde filling of structures presumably located at the iris level was also noted . Various techniques have been employed in the past to visualize the outflow pathway [711]. In these previous studies, disadvantages of fluorescein, due to its small molecular weight, include the need of large volumes and high concentration when injected directly into the ac, delayed filling of the episcleral venous network, and leakage from scleral vessels . More recently, grieshaber et al . Injected fluorescein dye directly into schlemm's canal using a flexible microcatheter during the canaloplasty . However, visualization of the intrascleral (deep) channel network and of the uveoscleral pathway was hindered by the immediate dye diffusion in the ac and perilimbal tissue and by the staining of the corneal endothelium and the anterior lens capsule . Furthermore, fluorescein passed the trabecular meshwork in the direction opposite that of the physiologic pathway, thus possibly not reflecting true permeability . Imaging of the sc is particularly complex due to the small size of the outflow structures and, even more, by the location which is several hundred microns beneath the sclera . High frequency ultrasound (ubm 50 mhz), oct, and, more recently, sd oct systems are the noninvasive procedures utilized to visualize the sc and the tm [811]. The weakness of these methods is due to the small size of the aqueous humor outflow structures and, even more, to the acquired images processing that further alters their size [9, 16]. Lastly, sd oct presents static images, in which small vessels, differences among vessels, narrowing, and partial blockage of flow are not always evidenced or noticeable . Conversely, icg plus viscoelastic solution used in the present study allowed a dynamic examination of the aqueous humor conventional outflow pathway . These in vivo results confirm previous in vitro histopathologic changes; in fact, teng and coworkers, about 60 years ago, found in poag eyes a degeneration of collagen and elastic fibers in the wall of the anterior chamber angle . The degeneration histologically began in the external trabecular region and spreads along these fibers internally or externally to schlemm's canal, to the collector channels, and sometimes to the intrascleral plexus . The same research group, two years later, identified other important histopathologic variations: increased collapse of sc and narrowing of collector channels . These modifications identify sc and ccs as important anatomic structures responsible, together with tm, for the resistance to aqueous outflow in poag eyes . In our series, the filling of the ccs was somewhat independent of the patency of the sc since ccs might not be visualized in 4 quadrants despite perfusion of the sc over 360 degrees . In addition, the ccs closer to the site of injection did not necessarily fill up earlier than the farther ones . Actually, the filling seemed to be influenced by the resistance encountered during the dye progression within the lumen of the canal . In fact, after increasing the volume / pressure of infusion, visualization of some of the ccs, initially not perfused, occurred . Both of these findings further confirm that ccs themselves may represent a critical site in the outflow pathway [1820]. Up to 50% of the resistance to aqueous humor flow occurs in the aqueous outflow pathway distal to tm, namely, at the level of sc and the ccs that join schlemm's canal to intrascleral and episcleral vessels . In keeping with this observation, we noted that the only noticeable aqueous veins were located in correspondence of the quadrant in which both the sc and the collectors were patent . The upper quadrants were more affected that the lower ones, and, between these, the temporal quadrant was more affected than the nasal one . They are most commonly present in the inferior nasal quadrant, less in the inferior temporal quadrant, and more less in the upper quadrant . This may suggest that shunt or collateral vessels bypassing blockage of the pathway at this level do not exist . In our glaucomatous patients, icg plus viscoelastic solution canalography makes the visualization of the resistance site beyond tm possible . This could theoretically manage the surgical approach in a more rational way, intervening as close as possible to the site of impaired drainage, with the more appropriate choice . Thus, a customized glaucoma surgery, in keeping with the site of obstruction, might be considered to enhance the chances of success . Another intriguing finding was the active retrograde filling of glomerular - shaped structures, furthest in the sc, observed in the quadrants where the pathway was functioning . We hypothesize that these structures might be located in the iris rather than in the trabecula, since they did not show any leakage of dye in the anterior chamber in the late phases of the exam . It is unlikely that they represent new vessels, as they were not visualized on ophthalmoscopy and the patients examined did not have a history positive for ischemic retinal diseases; moreover, no leakage from them at any time of the exam occurred . Contrarily, they could be lymphatic new vessels, whose development might be promoted by the increase in iris hydrostatic pressure secondary to poag . In conclusion, this study shows that the use of icg coupled with viscoelastic solution, injected through the sc, is a useful tool to detect site of resistance in the outflow pathway . Research is ongoing to find a dye formulation that might be topically applied to visualize conventional ah outflow pathway in a noninvasive fashion.
Elevation of the maxillary sinus floor before implant placement may be necessary when the bone height of the posterior maxilla is insufficient . Maxillary sinus floor augmentation can be achieved by a crestal or lateral approach, but when the residual alveolar bone height (rbh) is insufficient, the lateral window approach is the preferred method . When performing maxillary sinus floor augmentation, the risk of complications must be considered and foreseen . One of the complications reported during surgery is excessive bleeding from the bony window, which occurs when a small artery that supplies the sinus is severed . Because of the reactive contraction of the cut vessels, transection of the artery is not life - threatening, but visualization of the schneiderian membrane may be impaired, making the membrane elevation far more difficult and interfering with the placement of the graft materials . The lateral maxilla is supplied by branches of the posterior superior alveolar artery (psaa), also known as the alveolar antral artery and the infraorbital artery (ioa); these arteries form an anastomosis in the bony anterolateral wall, which also supplies the schneiderian membrane . To avoid severing these arteries, it is important to anticipate the location of the anastomosis during bony window preparation . Earlier reports on the location of this anastomosis have been based mostly on cadaver studies or radiographic studies . Most previous studies measured the distance from the alveolar ridge crest to the anastomosis; however, progressive atrophy of the alveolar ridge with age and tooth loss results in changes to the position of the crest, which complicates the implant placement . Only a few studies have investigated the intraosseous anastomosis location with respect to the tooth position and the position of the maxillary sinus floor . Computed tomography (ct) and cone - beam computed tomography (cbct), which provide sectional views, ct and cbct are considered more accurate than intraoral or extraoral radiography and can provide 3-dimensional information about maxillary sinus structures . Hence, our aims in this study were first, to measure the distance of the intraosseous anastomosis in the anterolateral wall of the maxillary sinus from different reference points, and second, to correlate the location of the intraosseous anastomosis with the residual bone height of the maxilla and the tooth positions obtained using ct scans . This study was approved by the institutional review board for clinical research at samsung medical centre (irb no . 2010 - 02 - 002). We collected information from 283 patients scheduled for implant - supported restorations in the posterior edentulous maxilla . Of these 283 patients, 186 were men and 97 were women, ranging in age from 18 to 84 years (mean, 57.1 years). Ct images were obtained using a ge lightspeed vct (general electric medical systems, milwaukee, wi, usa) with an 18- to 20-cm field of view operated at 120 kv and 300 ma . The scanning time was 4 - 6 seconds, the rotation time was 0.6 second, and the slice thickness was 0.625 mm . After the ct images were obtained, they were analyzed using a specialized software program (10dr co., seoul, korea). The anastomosis of the psaa and the ioa was located, and the distances from the anastomosis at the edentulous sites from the first premolar to the second molar area were measured in 283 patients . All patients had radiographic stents placed before undergoing ct, and the central section of each designated tooth in the edentulous area was chosen for measurement . To ensure accurate measurements, the images were colorized to simplify the evaluation of the hard and soft tissue interface (fig ., the rbh was measured from the ridge crest to the lowest point of the maxillary sinus floor and then, categorized by distance: less than 4 mm (group 1), between 4 and 8 mm (group 2), and greater than 8 mm (group 3). The distance of the anastomosis position from the ridge crest was measured as follows: three horizontal lines were drawn at the ridge crest, the maxillary sinus floor, and the position of the anastomosis . A vertical second line at the center of each tooth was drawn perpendicular to the horizontal lines . The distance from the ridge crest to the maxillary sinus floor (a) and the distance from the maxillary sinus floor to the bony canal (b) were measured from the intersections of the horizontal and vertical lines (fig . All measurements were expressed as meanstandard deviation . In this study, we collected data from tooth positions at the left or right side of maxillary sinuses in each patient and regarded our data as the correlated data of the patients because the observations measured on the left or right side of each tooth position from each patient were correlated . Therefore, we applied a linear mixed model with the adjustment of the side of each tooth for the hypotheses of interest . Statistical analyses, including a linear mixed model with bonferroni correction and post hoc tests to compare the difference between groups or teeth, were performed using sas 9.3.1 (sas institute, cary, nc, usa). The difference in the location of the anastomosis from the residual alveolar ridge crest or the maxillary sinus floor between sexes was also compared using a linear mixed model with a bonferroni correction . The anastomosis between the psaa and the ioa was discernible in 92 out of 283 patients (32.5%). The mean distance from the alveolar ridge crest to the intraosseous vascular anastomosis (iva) at each tooth position was 19.65.64 mm at the first premolar (p1), 19.95.87 mm at the second premolar (p2), 15.64.06 mm at the first molar (m1), and 16.54.75 mm at the second molar (m2) site (table 1). In this study, there were only 6 images at the first premolar site; therefore, for the p1 site, only the measurements were described . The number of sites for the statistical analysis of the second premolar, first molar, and second molar groups was sufficient (table 1). The residual alveolar ridge heights (rbhs) of different tooth types were significantly different (p=0.0002). The rbh at p2 is greater than that of m1 (p=0.0002) and m2 (p=0.0018). There was no statistical difference in the distance from the sinus floor to the iva position according to the teeth position (table 1). The distance of the iva position from the alveolar ridge crest equals the sum of rbh and the distance from the maxillary sinus floor to the iva . Therefore, the distances from the alveolar ridge crest to the iva between p2 and m1 (p=0.0003) and between p2 and m2 (p=0.0018) were statistically different (table 1). The relationship between the rbh and the iva from the maxillary sinus floor is shown in table 2 . When analyzed with a post hoc test, the distance from the maxillary sinus floor to the iva was the smallest in group 3 . The correlation between the rbh and iva from the maxillary sinus floor according to the tooth position is shown in fig . 2 and table 3 . At the p2 site, there was no correlation between rbh and the distance from the maxillary sinus floor to the iva . However, at the molar sites, there was a moderate negative correlation and the regression coefficient was -0.4788 and -0.5772 at m1 and m2 . The distance among the alveolar ridge crest, maxillary sinus, and the iva position was not statistically different between the sexes (table 4). It was not possible to perform a statistical analysis for the first premolar site due to an insufficient sample size (only one female). Therefore, no first premolar site was included in group 1 (table 3). An anastomosis between the psaa and the ioa in the sinus anterolateral wall was found in 100% of the cases by cadaver dissection, while the bony canal was identified in 47%-55% of cases with ct images . With ct images, it is difficult to identify anastomoses that have a very small diameter or when they travel along the sinus membrane . In this study 61% of the bony canals identified in this study were partially covered with bone and could easily be missed . Another possibility for vessels less than 0.5 mm in diameter could not be identified with ct scans in most of the cases although the diameter of the vessels was not measured in this study . We found that the average distance from the residual alveolar ridge crest to the intraosseous anastomosis was 18.3 mm (data were not shown); this is in accordance with earlier studies that reported that the anastomosis between the psaa and the ioa was located at an average distance of 18.0 mm and 18.9 mm from the alveolar crest of the posterior maxilla . However, other studies reported a shorter mean distance, which ranges from 11.25 to 16.9 mm, than that of our study . Previous research mentioned that such data could be misleading because the height of the residual bony ridge, the maxillary atrophy class, and the presence of teeth play a relevant role in determining the location of the vessel . In this study, we used both the residual bony ridge and the maxillary sinus floor as reference points for measuring the intraosseous anastomosis position (table 1). From the residual alveolar bone crest, the mean distance to the intraosseous anastomosis was the greatest at the first premolar tooth with 21.05.41 mm and the shortest at the first molar tooth with 15.64.06 mm although there were only limited data for p1 sites . Our findings were in accordance with recent papers, which showed that the mean distance from the alveolar crest and the sinus floor to intraosseous anastomosis is related to the tooth position . The course of the bony canal is curved, with the most inferior site in the first molar tooth position; this agrees with the anatomic studies of other researchers (table 1). The maxillary sinus floor resembled the course of the vessel, lowest in the first molar and highest in the first premolar area of edentulous patients . However, in a dentate cadaver study, although a slight height increase from the first molar to the first premolar regions existed, the sinus floor height variation according to the tooth position was minimal . In this study, the mean distance from the maxillary sinus floor to the intraosseous anastomosis position was not significantly different among different tooth positions; this agrees with the results from the study on dentate cadavers, although in our study, the sample size for the p2 site was relatively small (table 1). A few studies have described the relationship between the intraosseous anastomosis position and the remaining alveolar bony height . These previous studies used the descriptive definition of the jaw shape from lekholm, but we decided to classify groups according to the remaining alveolar bone height . Our study divided the height of the residual bony ridge into 3 groups to investigate the distance from the maxillary sinus floor to the intraosseous anastomosis . According to the results of this study, the higher the residual bony ridge is, the shorter is the distance from the maxillary sinus floor to the intraosseous anastomosis (table 2). However, when we evaluated the correlation between the distance from the maxillary sinus floor to the intraosseous anastomosis and the rbh at each tooth position, there was a correlation only in the case of the molar teeth (table 3). We found a moderate negative correlation between the rbh and the distance from the maxillary sinus floor to the intraosseous anastomosis position . We also found that the greater the rbh is, the shorter is the distance from the maxillary sinus floor to the intraosseous anastomosis in the case of the molar teeth (table 3). Other studies reported that 20%-31% of arteries were located less than 15 mm from the alveolar crest . Therefore, it is recommended that the bony window should be planned to be elevated no higher than 15 mm above the alveolar crest . The location of the bony window for a lateral augmentation of the maxillary sinus is dependent on the height of the residual alveolar ridge, the length of the implant to be placed, and the position of vascular anastomosis . On the basis of the results of this study, we can conclude that a greater height of the residual alveolar ridge and a higher position of the bony canal do not mean a higher risk of severing the artery during the window preparation in the p2 site; however, in the molar regions, sites with a greater remaining alveolar ridge height have a relative high risk during the window osteotomy preparation due to the correlation between the rbh and the distance from the maxillary sinus floor to the intraosseous anastomosis position . There was no statistically significant difference between teeth positions and between sexes with respect to the distance from the maxillary sinus to the bony canal position; this is in accordance with previous findings . They found that the height of the bony canal reference to the maxillary sinus floor is more reliable than the use of the residual bony ridge in dentate cadavers . Therefore, measuring the distance from the alveolar crest to the intraosseous anastomosis would not help in designing osteotomy windows for a sinus grafting procedure to place longer implants in the resorbed posterior maxilla . Our previous paper reported that the lateral wall of the sinus was thinner in women . It would thus be prudent to pay attention to the thickness of the lateral wall of the maxillary sinus in window osteotomy preparation in women instead of the intraosseous anastomosis position from the alveolar ridge crest or the maxillary sinus floor . In this study, however, with this method, the amount of ridge resorption could not be measured at each tooth position . The distance from the alveolar bone crest and the maxillary sinus floor to the intraosseous anastomosis in an edentulous patient (table 1) is smaller than that of the dentate cadaver . Further research is needed that would include the amount of ridge resorption as a variable to predict the position of the intraosseous anastomosis of the psaa and the ioa . The findings of this study will help enable clinicians to perform safe osteotomy window preparation.
A lymphoepithelioma - like carcinoma (lelc) is a tumor which mimics lymphoepithelioma in terms of its pathological features . The primary lesion of lelc occurs in the stomach, lungs, thymus, salivary glands or urinary bladder . Lelc of the urinary bladder (lelcb) is a rare variant of infiltrating urothelial carcinoma and was first described by zukerberg et al . In 1991 . Including this case, there are merely 105 cases in the english language medical literature, with only 8 cases reported as originating from asian countries [3, 4, 5, 6]. In 1994, amin et al . Pure (100%), predominant (5099%) and focal (<50%), with the three types determining a patient's prognosis . We herein report a case of lelcb, with a preoperative diagnosis of an undifferentiated carcinoma, in which radical cystectomy and systemic chemotherapy were successfully undertaken . Based on previous case reports of lelcb in the english language medical literature, we examined the prognosis for lelcb . In addition, we analyzed the preoperative diagnostic characteristics of this lelcb by measuring its apparent diffusion coefficient (adc) value by magnetic resonance imaging (mri) and compared this to those of past cases of urothelial carcinoma of the urinary bladder at our institution . On cystoscopy, two bladder tumors were observed, one on the left side of the trigone and the other on the right side of the trigone . A total body computed tomography (ct) scan was performed and the presence of distant metastases or lymph node involvement was excluded . Mri revealed that the tumor on the left side of the trigone had invaded the perivesical soft tissue of the bladder, but not the prostate or seminal vesicles (fig . Pathological findings revealed undifferentiated atypical epithelial cells with enlarged nuclei that had formed into sheets to invade the muscle layer . Pathological findings revealed large, undifferentiated carcinoma cells with pleomorphic nuclei and prominent nucleoli, the infiltration of inflammatory cells consisting predominantly of lymphocytes, and the reach of their invasion to the perivesical soft tissue of the bladder (fig . The final pathological diagnosis was an invasive urothelial carcinoma, lymphoepithelioma - like variant, pt3 . Tumor cells were positive for cytokeratin (ae1/ae3) (fig . 2c) and e - cadherin (fig ., cisplatin - based systemic chemotherapy was performed, and cancer recurrence was not apparent at the usual follow - up as determined by ct scan and cytological analysis . According to the who classification criteria, lelcb is defined as a subtype of undifferentiated carcinomas . To date 105 cases, including this one, have been described in the english language medical literature . Lelcb shows carcinomatous components contrasting with lymphocyte infiltration and mimics chronic inflammation or malignant lymphoma; immunohistochemical stains such as for cytokeratin are helpful in distinguishing between these diseases [6, 7]. Between 1991 and june 2015, 84 cases of lelcb, according to the classification of amin et al . We allocated the 84 cases to two groups pure / predominant and focal and investigated their prognoses based on previous reports . Seventy patients (83%) formed the pure / predominant group and 14 patients (17%) formed the focal group . Kaplan - meier curves of overall survival rates of the pure / predominant and focal groups are shown in figure 3 . As a result, the pure / predominant group had as significantly better prognosis than the focal type group (log - rank test, p <0.001) (fig . The predominant or focal types of lelcb include squamous cell carcinoma, adenocarcinoma and urothelial carcinoma . Containing only lelc, this case seemed to have the characteristics of a pure type of lelcb . Unfortunately, there is at present no established treatment for lelcb because of its rarity as a bladder tumor subtype, with few reports existing for this disease . Some reports describe lelcb as being sensitive to cisplatin, while others suggest that it is possible to preserve the bladder in the case of a pure or predominant type, even if the tumor has invaded the muscle [4, 8, 9, 10]. Adjuvant cisplatin - based chemotherapy was also instituted because radical cystectomy yielded a diagnosis of lelcb pt3 . The combination of external beam radiotherapy and chemotherapy to preserve the bladder may be considered a suitable treatment option if the diagnosis prior to radical cystectomy is accurate . Epstein - barr virus (ebv) is associated with lymphoepithelioma or lelc of several tissues (lung, stomach and salivary glands), except the bladder . A close reading of the literature suggests that if tumor cells are positive for ebv rna, the tumor might be a metastasis from another tissue . Therefore, we performed ebv - encoded small rna in situ hybridization (eber - ish), but this did not reveal a relationship between ebv and lelcb in this case (fig . However, in treating lelcb, eber - ish is useful and necessary to rule out the tumor as being a metastasis from another tissue . Mri is widely used in local staging or to detect lymph node metastases, and is essential for determining suitable treatments for bladder tumors . Recently, measuring adc values has been suggested to be helpful in diagnosing bladder tumors . To further improve preoperative diagnostic accuracy, we retrospectively measured the adc value of this case . The mean value was found to be 782 10 mm / s (fig . 1c), which was relatively lower than the mean values we found for muscle - invading urothelial carcinomas studied at our institution (56 cases, median 1,047 10 mm / s; see online suppl . Material, www.karger.com/doi/10.1159/000445049). In urothelial carcinoma, in 2014 yamada et al . Reported a correlation between high adc values and good histopathological features of bladder tumors which is the case for urothelial carcinoma . However, in spite of the relatively low adc value, the prognosis of this case was relatively good as previously described . The low adc value calculated in this case may be due to the fact that the observed lymphocyte infiltration probably caused an increase in cell density and a decrease in diffusion capacity . There are several pitfalls and limitations in detecting pathological characteristics of tumors, and further consideration will have to be given to the usefulness of measuring adc values of bladder tumors . Regardless, though lelcb is a rare tumor, measuring adc values may be useful in predicting the histopathological characteristics of such bladder tumors . We treated a rare case of lelcb, classed as a pure type and with a better prognosis than the focal type according to the classification of amin et al . . It is necessary to consider a diagnosis of lelcb when turbt indicates an undifferentiated carcinoma . Additionally, measuring the adc value of a urinary bladder tumor may be helpful in predicting its pathological features . Written informed consent was obtained from the patient for publication of this case report and accompanying images . A copy of the written consent is available for review from the editor - in - chief of this journal . The authors received no financial support for the research, authorship and/or publication of this paper.
In most cancer metastases, cancer cells migrate from the primary tumor to other parts of the body through the near regional lymph nodes . The first lymph node or group of lymph nodes in the direct lymphatic drainage pathway that extends from the site of the tumor is called the sentinel lymph node (sln), and is used to represent the status of lymphatic spread.13 decisions as to the extent of surgical treatment are usually based on whether or not patients have sln involvement . Therefore, sln mapping and biopsy are important techniques in cancer therapy . Reactive blue dye staining, radiocolloid tracers, and a combination of both, are techniques that are widely used for sln mapping in the clinic . However, blue - dyed slns located in deep tissue can only be observed after they have been exposed to air, and more extensive surgery is therefore required to find them . The disadvantages of radiocolloid tracers include exposure of the patient to radioactivity and painful peritumoral injections of radiocolloid.4,5 in comparison with the above three commonly used techniques, noninvasive in vivo near infrared fluorescence imaging when used for sln mapping has several advantages . For example, slns in deep tissue can be observed directly due to near infrared fluorescence without the need for excessive excision of skin and muscle, which enables rapid detection of slns by surgeons . In addition, the surgeon can conveniently confirm through visual inspection that all of the slns have been removed from the node field.6 near infrared fluorescent reagents for sln mapping include organic dyes (eg, indocyanine green79 and methylene blue)10,11 and inorganic nanoparticles (eg, quantum dots1215 and carbon dots16). Organic dyes may be favored over inorganic nanoparticles because the former have lower toxicity and quicker in vivo clearance speeds . In the present study, we report the first use of chlorophyll extracted from the leaf of chimonanthus salicifolius for mouse axillary sln mapping . The choice of this chinese herb (which is usually used to getting rid of heat in summertime and stimulating appetite) is based on its nontoxic properties . In addition, c. salicifolius has a wide distribution in the south of china . C. salicifolius is a shrub that grows up to 4 m tall . It has been found that chlorophyll a and b are the most common types of chlorophyll in almost all of the higher plants.17 chlorophyll is structurally similar to porphyrin (a fluorescent dye) and has near infrared fluorescence . Additionally, chlorophyll has been registered as a food additive, and a variety of foods and beverages are permitted to contain cholorophyll.18 therefore, chlorophyll is a safe fluorescent material which has great potential for in vivo bioimaging . However, chlorophyll is a poorly water - soluble dye . To improve its water solubility and enable it to target slns for imaging, chlorophyll in this study liposomes are spherical vesicles made up of a lipid bilayer, and are often used as a drug delivery system . It has been reported that liposomes can serve as carriers for the delivery of diagnostic and therapeutic drugs (or agents) targeted to the lymphatic system.1922 in our study, we used low - cost soybean lecithin as the lipid membrane when preparing the liposome - coated chlorophyll nanocomposites for sln mapping . The dry leaves of c. salicifolius were obtained from tongji university - lishui institute (lishui, zhejiang province, china). Soybean lecithin (purity> 90%) and cholesterol were acquired from sinopharm chemical reagent co, ltd (shanghai, china). Nude mice aged 56 weeks and weighing 1822 g were purchased from the shanghai sipper - bk lab animal co ltd (shanghai, china). The mice were used in accordance with approved institutional protocols established by the shanghai department of experimental animal management . Normal human liver cells (qsg-7701) and mouse macrophage cells (ana-1) were ordered from the chinese academy of sciences (shanghai, china). Rpmi-1640 culture medium and fetal calf serum were obtained from gibco (carlsbad, ca). 3-(4,5)-dimethylthiahiazo(-z - y1)- 3,5-diphenytetrazoliumromide (mtt) was bought from shanghai haoran biological technology co, ltd (shanghai, china). We mixed 10 g of dry leaves of c. salicifolius with 100 ml of ethanol and this was subsequently shaken in a sealed conical flask for 10 hours . The mixture was filtered under vacuum and the percolating solution was centrifuged to remove impurities . According to the molecular structure of chlorophyll, one chlorophyll molecule contains one magnesium atom . Therefore, the chlorophyll concentration can be accurately detected by means of its magnesium content using inductively- coupled plasma atomic emission spectrometry, and calculated using the following equation: where c and c are the concentrations of chlorophyll and magnesium, respectively, mchlorophyll is the molecular weight of chlorophyll a, and mmg is the molecular weight of magnesium . Soybean lecithin 90 mg, cholesterol 45 mg, and 2.4 ml of chlorophyll dissolved in ethanol (approximately 2.0 mg / ml) were dissolved in a round - bottomed flask containing 1 ml of chloroform, and dried using a rotary evaporator (re52cs, shanghai yarong chemical equipment co, ltd, shanghai, china) to remove the last traces of chloroform with nitrogen flow . Next, 2 ml of distilled water was added to the flask to hydrate the dry lipid film, and the mixture was gently shaken for about 10 minutes, followed by sonication for at least 90 minutes . The precipitate of free chlorophyll in the flask bottom could be observed during the 20 hours of storage period due to its poor solubility . The upper suspension (about 1.5 ml) was collected and the liposome - coated chlorophyll was thus obtained . Ultraviolet - visible absorption spectra were obtained using a diode array spectrophotometer (uv-2102pc, unico, beijing, china) with a deuterium lamp source . Fluorescence spectra excited by 400 nm were measured using a fluorescence spectrometer (f-2500, hitachi, japan) equipped with a xenon lamp source . For the detection of fluorescence stability, the samples were placed in 1 cm quartz cuvettes and continuously excited at 365 nm over a period of one hour using an ultraviolet detector (zf, kanghua, shanghai, china). During the irradiation process, the fluorescence spectra of the samples were measured . The bright fields of the chlorophyll dissolved in ethanol, chlorophyll dispersed in water, and liposome - coated chlorophyll were taken using a digital color camera (coolpix 4300, nikon, japan). The fluorescent images of the aqueous samples were obtained using an in vivo imaging system (maestro, cri inc, woburn, ma). The excitation and emission band pass filters were 605 and 645 nm (long - pass), respectively . The liposome - coated chlorophyll aqueous suspensions were air - dried onto carbon - coated grids, and then examined at 80 kv using a transmission electron microscope (tem, jsm-6360 lv, jeol, tokyo, japan). The size distributions were measured by means of tem analysis of 122 particles . To measure the hydrodynamic size of the liposome - coated chlorophyll nanocomposites in serum, the nanocomposite precipitate was dispersed in 100% fetal calf serum, and the size was ascertained using photon correlation spectroscopy (3000hs, malvern instruments, worcestershire, uk). Normal liver cells (qsg-7701) were cultured on a 96-well plate using rpmi-1640 as the culture medium . The medium contained 10% fetal calf serum and 1% antibiotic - antimycotic at 37c and culture plates were maintained in an incubation chamber containing 5% co2 . For the mtt assay, 10 l of chlorophyll and liposome - coated chlorophyll aqueous suspensions containing 0, 5.8, 11.6, 23.1, and 46.2 g / ml of chlorophyll were added to the cells . After a 2-hour incubation, 10 l of mtt (5 mg / ml) was added to the cells . After an interval of 4 hours, the suspensions were replaced with 100 l of dimethyl sulfoxide and the cell viabilities were determined by measuring their absorbance at 490 nm using a flexstation iii enzyme - labeled instrument (molecular devices, sunnyvale, ca). To detect viability of the macrophage cells (ana-1), these cells were incubated with 10 l of chlorophyll and liposome - coated chlorophyll (containing 0, 5.8, 11.6, 23.1, and 46.2 g / ml of chlorophyll) for 24, 48, and 72 hours, respectively, and their viabilities chlorophyll 40 l and liposome - coated chlorophyll aqueous suspensions (containing 1.5 mg / ml of chlorophyll) were injected into two nude mice through the tail vein . Mouse fluorescence images were obtained using the in vivo imaging system (nightowl lb983, berthold technologies, bad wildbad, germany). The excitation wavelength was 630 nm and the emission filter was 700 nm (long - pass), and the exposure time was 0.1 seconds . Chlorophyll 80 l and liposome - coated chlorophyll aqueous suspensions (containing 1.48 mg / ml of chlorophyll) were injected intradermally into the paws of two nude mice . All of the injection methods (including injection depth and angle related to the plane of the paw) were the same . The excitation wavelength was 635 nm and the emission wavelength was 675 nm (long - pass). All of the collected images were analyzed using the maestro software provided with the system . After the in vivo imaging had been completed, the lymph nodes in the axillary location at the injection sites were resected for fluorescence imaging . As a control, a lymph node in the axillary location of a mouse that had not been injected with chlorophyll the dry leaves of c. salicifolius were obtained from tongji university - lishui institute (lishui, zhejiang province, china). Soybean lecithin (purity> 90%) and cholesterol were acquired from sinopharm chemical reagent co, ltd (shanghai, china). Nude mice aged 56 weeks and weighing 1822 g were purchased from the shanghai sipper - bk lab animal co ltd (shanghai, china). The mice were used in accordance with approved institutional protocols established by the shanghai department of experimental animal management . Normal human liver cells (qsg-7701) and mouse macrophage cells (ana-1) were ordered from the chinese academy of sciences (shanghai, china). Rpmi-1640 culture medium and fetal calf serum were obtained from gibco (carlsbad, ca). 3-(4,5)-dimethylthiahiazo(-z - y1)- 3,5-diphenytetrazoliumromide (mtt) was bought from shanghai haoran biological technology co, ltd (shanghai, china). We mixed 10 g of dry leaves of c. salicifolius with 100 ml of ethanol and this was subsequently shaken in a sealed conical flask for 10 hours . The mixture was filtered under vacuum and the percolating solution was centrifuged to remove impurities . According to the molecular structure of chlorophyll, one chlorophyll molecule contains one magnesium atom . Therefore, the chlorophyll concentration can be accurately detected by means of its magnesium content using inductively- coupled plasma atomic emission spectrometry, and calculated using the following equation: where c and c are the concentrations of chlorophyll and magnesium, respectively, mchlorophyll is the molecular weight of chlorophyll a, and mmg is the molecular weight of magnesium . Soybean lecithin 90 mg, cholesterol 45 mg, and 2.4 ml of chlorophyll dissolved in ethanol (approximately 2.0 mg / ml) were dissolved in a round - bottomed flask containing 1 ml of chloroform, and dried using a rotary evaporator (re52cs, shanghai yarong chemical equipment co, ltd, shanghai, china) to remove the last traces of chloroform with nitrogen flow . Next, 2 ml of distilled water was added to the flask to hydrate the dry lipid film, and the mixture was gently shaken for about 10 minutes, followed by sonication for at least 90 minutes . The precipitate of free chlorophyll in the flask bottom could be observed during the 20 hours of storage period due to its poor solubility . The upper suspension (about 1.5 ml) was collected and the liposome - coated chlorophyll was thus obtained . Ultraviolet - visible absorption spectra were obtained using a diode array spectrophotometer (uv-2102pc, unico, beijing, china) with a deuterium lamp source . Fluorescence spectra excited by 400 nm were measured using a fluorescence spectrometer (f-2500, hitachi, japan) equipped with a xenon lamp source . For the detection of fluorescence stability, the samples were placed in 1 cm quartz cuvettes and continuously excited at 365 nm over a period of one hour using an ultraviolet detector (zf, kanghua, shanghai, china). During the irradiation process, the fluorescence spectra of the samples were measured . The bright fields of the chlorophyll dissolved in ethanol, chlorophyll dispersed in water, and liposome - coated chlorophyll were taken using a digital color camera (coolpix 4300, nikon, japan). The fluorescent images of the aqueous samples were obtained using an in vivo imaging system (maestro, cri inc, woburn, ma). The excitation and emission band pass filters were 605 and 645 nm (long - pass), respectively . The liposome - coated chlorophyll aqueous suspensions were air - dried onto carbon - coated grids, and then examined at 80 kv using a transmission electron microscope (tem, jsm-6360 lv, jeol, tokyo, japan). The size distributions were measured by means of tem analysis of 122 particles . To measure the hydrodynamic size of the liposome - coated chlorophyll nanocomposites in serum, the nanocomposite precipitate was dispersed in 100% fetal calf serum, and the size was ascertained using photon correlation spectroscopy (3000hs, malvern instruments, worcestershire, uk). Ultraviolet - visible absorption spectra were obtained using a diode array spectrophotometer (uv-2102pc, unico, beijing, china) with a deuterium lamp source . Fluorescence spectra excited by 400 nm were measured using a fluorescence spectrometer (f-2500, hitachi, japan) equipped with a xenon lamp source . For the detection of fluorescence stability, the samples were placed in 1 cm quartz cuvettes and continuously excited at 365 nm over a period of one hour using an ultraviolet detector (zf, kanghua, shanghai, china). During the irradiation process, the fluorescence spectra of the samples were measured . The bright fields of the chlorophyll dissolved in ethanol, chlorophyll dispersed in water, and liposome - coated chlorophyll were taken using a digital color camera (coolpix 4300, nikon, japan). The fluorescent images of the aqueous samples were obtained using an in vivo imaging system (maestro, cri inc, woburn, ma). The excitation and emission band pass filters were 605 and 645 nm (long - pass), respectively . The liposome - coated chlorophyll aqueous suspensions were air - dried onto carbon - coated grids, and then examined at 80 kv using a transmission electron microscope (tem, jsm-6360 lv, jeol, tokyo, japan). The size distributions were measured by means of tem analysis of 122 particles . To measure the hydrodynamic size of the liposome - coated chlorophyll nanocomposites in serum, the nanocomposite precipitate was dispersed in 100% fetal calf serum, and the size was ascertained using photon correlation spectroscopy (3000hs, malvern instruments, worcestershire, uk). Normal liver cells (qsg-7701) were cultured on a 96-well plate using rpmi-1640 as the culture medium . The medium contained 10% fetal calf serum and 1% antibiotic - antimycotic at 37c and culture plates were maintained in an incubation chamber containing 5% co2 . For the mtt assay, 10 l of chlorophyll and liposome - coated chlorophyll aqueous suspensions containing 0, 5.8, 11.6, 23.1, and 46.2 g / ml of chlorophyll were added to the cells . After a 2-hour incubation, 10 l of mtt (5 mg / ml) was added to the cells . After an interval of 4 hours, the suspensions were replaced with 100 l of dimethyl sulfoxide and the cell viabilities were determined by measuring their absorbance at 490 nm using a flexstation iii enzyme - labeled instrument (molecular devices, sunnyvale, ca). To detect viability of the macrophage cells (ana-1), these cells were incubated with 10 l of chlorophyll and liposome - coated chlorophyll (containing 0, 5.8, 11.6, 23.1, and 46.2 g / ml of chlorophyll) for 24, 48, and 72 hours, respectively, and their viabilities were measured using the same methods as described above . Chlorophyll 40 l and liposome - coated chlorophyll aqueous suspensions (containing 1.5 mg / ml of chlorophyll) were injected into two nude mice through the tail vein . Mouse fluorescence images were obtained using the in vivo imaging system (nightowl lb983, berthold technologies, bad wildbad, germany). The excitation wavelength was 630 nm and the emission filter was 700 nm (long - pass), and the exposure time was 0.1 seconds . Chlorophyll 80 l and liposome - coated chlorophyll aqueous suspensions (containing 1.48 mg / ml of chlorophyll) were injected intradermally into the paws of two nude mice . All of the injection methods (including injection depth and angle related to the plane of the paw) were the same . The excitation wavelength was 635 nm and the emission wavelength was 675 nm (long - pass). All of the collected images were analyzed using the maestro software provided with the system . After the in vivo imaging had been completed, the lymph nodes in the axillary location at the injection sites were resected for fluorescence imaging . As a control, a lymph node in the axillary location of a mouse that had not been injected with chlorophyll the final extract dissolved in ethanol was green in color (figure 1a), which indicates that it absorbed blue and red light . Its absorption spectrum exhibited two main absorption bands, ie, <500 nm (blue) and 600700 nm wavelengths (figure 1b), and three peaks located at 666, 615, and 415 nm which were well matched with the absorption spectra of chlorophyll a.17,23 c. salicifolius is a taller plant, and such plants have abundant chlorophyll a and b.17 the bright field colors of the liposome - coated chlorophyll aqueous suspensions were deeper than those of the chlorophyll aqueous suspensions alone (figure 2a). Inductively - coupled plasma atomic emission spectrometric analysis showed that 1 mg of liposomes could load 21.9 g of chlorophyll . An interesting finding was that the fluorescent intensities of liposome - coated chlorophyll were obviously higher than those of chlorophyll alone (figure 2b). For example, when the concentrations of chlorophyll were 46.2, 23.1, and 11.6 g / ml, the fluorescent intensities of liposome - coated chlorophyll nanocomposites were 22.2, 20.8, and 25.0 times higher, respectively, than those of the chlorophyll alone (figure 2b). However, chlorophyll molecules can be highly dispersed within the long chains of fatty acids in the lipid membrane of the liposome . Therefore, when the chlorophyll was dispersed in water, we found that the aqueous suspensions of chlorophyll contained visible particles that would precipitate in several hours . On the other hand, the aqueous suspensions of the liposome - coated chlorophyll nanocomposite were uniform, and no obvious precipitates could be observed over a week . Chlorophyll when dispersed in water has near infrared fluorescence at a wavelength of 679 nm . After liposome encapsulation, the fluorescent peaks of liposome - coated chlorophyll nanocomposites shifted to blue by only 12 nm, as compared with those of chlorophyll alone (figure 2b). This suggests that the liposome coating did not obviously affect the near infrared fluorescence of chlorophyll when penetrating deep animal tissue . Since the chlorophyll tends to precipitate in water, here we only measured the fluorescent stability of the liposome - coated chlorophyll nanocomposites in water . After being continuously excited by a 365 nm light for 60 minutes, the fluorescent spectrum of the nanocomposites did not shift, and the fluorescent intensity decreased by only 8.2% (figure 3). This indicated that the liposome - coated chlorophyll nanocomposites have potential for comparatively long - term imaging, which is of benefit for biomedical applications . The tem image shows that the liposome - coated chlorophyll nanocomposites are spherical in shape and have a comparatively narrow size distribution (average diameter 21.7 6.0 nm, figure 4a and b). Nanocomposites with such a small diameter are suitable for sln mapping because the ideal contrast agent should be 1050 nm in size.24,25 the chlorophyll molecules may be well dispersed in the liposome vesicles because chlorophyll exists in water as crystals, and virtually no free crystals could be observed around the liposome- coated chlorophyll nanocomposites . Although the average hydrodynamic size of the liposome - coated chlorophyll nanocomposites in 100% fetal calf serum is 263.4 24.0 nm (figure 4c), liposomes are limp nanoparticles and may penetrate small pores in vivo . For example, to prepare different - sized liposomes, large liposomes are usually extruded in turn through polycarbonate membrane filters with different pore diameters (eg, 450, 220, and 150 nm). As shown in figure 5, the mtt assay demonstrated that normal liver cell (qsg-7701) viability did not decrease obviously after the cells had been incubated with either chlorophyll or liposome - coated chlorophyll nanocomposites for 2 hours . The viability of the macrophages (ana-1) was also not obviously affected by the chlorophyll and liposome - coated chlorophyll nanocomposites after the ana-1 cells had been incubated with these materials for 24 and 48 hours . It should be noted that ana-1 cell viability was between 83.1% 4.4% and 88.7% 2.3% when the cells were incubated with chlorophyll and liposome - coated chlorophyll nanocomposites, respectively, for 72 hours . This indicates that the chlorophyll may exhibit low toxicity if this material exists in cells for 3 days ., we found that many liposome- coated chlorophyll nanocomposites might be removed from the mouse body 94 minutes after intravenous injection via the tail . This elimination process can be observed clearly through the fluorescence of liposome - coated chlorophyll nanocomposites in vivo (figure 6). This suggests that the liposome - coated chlorophyll nanocomposites may be safely used in clinical imaging because they can be metabolized by the animal body . In addition, the near infrared fluorescence of liposome - coated chlorophyll nanocomposites inside the mouse body could be seen at different sites through the skin and muscle after the mouse had been injected with these nanocomposites via the tail vein (figure 7). For example, the fluorescence of these nanocomposites in the mouse liver could be captured by the in vivo imaging system from the right recumbent, left recumbent, supine, and prone positions . Therefore, the depth of tissue penetration of chlorophyll near infrared fluorescence may be at least 35 mm . Axillary and cervical lymph nodes are usually located at deeper subcutaneous positions, so that near infrared fluorescence imaging is suitable for mapping of these lymph nodes . In this work, we injected 80 l of liposome - coated chlorophyll aqueous suspension containing 1.5 mg / ml of chlorophyll intradermally into a nude mouse paw . We then monitored migration of the chlorophyll into the axillary sln by means of near infrared fluorescence using an in vivo imaging system . As a control, the paw of another nude mouse was synchronously injected with 80 l of liposome - free chlorophyll aqueous suspension, also containing 1.48 mg / ml of chlorophyll, and then monitored using the same methods as described above . As shown in figure 8, the axillary region emitted bright fluorescence one minute after injection of liposome- coated chlorophyll nanocomposites . This fluorescent spot could still be observed clearly in real time at 60 minutes after injection, without the need to excise skin and muscle . The axillary region of another mouse also emitted fluorescence a short time after being injected with the liposome - free chlorophyll, but the intensity of the fluorescence was lower than that in the axillary region of the mouse injected with the liposome - coated chlorophyll nanocomposite . To verify whether the fluorescent spots were slns, we resected the slns at approximately 2 hours after injection and then imaged them using the in vivo imaging system (figure 9). The sln from the mouse injected with liposome - coated chlorophyll was brighter than that from the mouse injected with chlorophyll alone . This may have been because the liposome - coated chlorophyll nanocomposites had brighter fluorescence than the chlorophyll alone, and more chlorophyll was targeted at the axillary lymphatic system due to liposome delivery . This phenomenon may be very important for the surgeon because the slns can be observed clearly in real time . The bright red fluorescence emitted by the slns must originate from the chlorophyll, because the sln of a control mouse that was not injected with chlorophyll did not emit red fluorescence . In summary, chlorophyll extracted from the leaves of c. salicifolius was encapsulated into liposomes and used for the first time in sln mapping . Due to the fact that the lipophilic chlorophyll can be well dispersed in liposomes, the liposome - coated chlorophyll nanocomposites not only improved the solubility of the poorly water - soluble chlorophyll, but also significantly improved the near infrared fluorescence of the chlorophyll . No or low toxicity was detected after incubation of cells with chlorophyll for 3 days, whether alone or encapsulated in liposomes . Although the mouse axillary slns can be observed to fluoresce rapidly after injection of either chlorophyll or liposome - coated chlorophyll nanocomposites, the sln of the mouse injected with liposome - coated chlorophyll emitted brighter fluorescence than that of the mouse injected with chlorophyll alone . The slns embedded in deep tissues could be observed directly through near infrared fluorescence without the need for exposure of the slns to air . On the basis of these findings, it is believed that the use of near infrared fluorescence from liposome - coated chlorophyll nanocomposites has clinical promise for sln mapping.
Blindness following a le fort i osteotomy, though rare, is an extremely serious complication . (laniganet al ., bendor - samuel et al ., girotto et al ., wilson et al ., lo et al ., cruz et al ., cheng et al . ). These include: lachrymal gland injuries; cranial nerve iii, iv and vi palsies; traumatic aneurysms; and arteriovenous fistulae (lanigan et al ., girotto et al ., cruz et al ., steel and cope) it is generally agreed that optic neuropathy is the mechanism that leads to loss of vision in a le fort i osteotomy, but exactly how this occurs in an elective surgery is a question of debate . Direct injury to the nerve from atypical fractures of the base of skull or orbital walls has been found to account for only 3 of the 10 reported cases in the literature (lanigan et al ., bendor - samuel et al ., cruz et al . ), while indirect trauma to the optic nerve or its blood supply has been considered in the other 7 cases (lanigan et al . We report the first 2 documented cases of complete loss of vision that was restored, following le fort i osteotomies . The reported cases were in cleft patients and were presumably straightforward cases with no untoward difficulties intraoperatively . In one case, full vision was regained, while near - complete vision has been recovered in the second, more recent case . A 19-year - old male with bilateral cleft lip and palate presented to the centre in february 2006 for correction of his maxillary regression . A le fort i osteotomy with advancement was performed under controlled hypotensive anaesthesia with the mean arterial pressure maintained at about 70 mmhg . The osteotomy, pterygoid dysjunction and down - fracture of the maxilla were done without any difficulty . The estimated blood loss for the procedure was 500 ml and the duration of surgery was 90 min . On the second postoperative day, the patient complained of loss of vision in the right eye . On examination, there was no perception of light in the right eye, while the visual acuity for the left eye was 6/6 . The patient was immediately started on intravenous methylprednisolone 500 mg, twice daily . Meanwhile, an emergent computed tomography (ct) scan of the orbits, base of skull and brain, and doppler study of the carotid and vertebral arteries were done . Except for opacities seen in all the paranasal sinuses suggestive of haemorrhage and the left pterygoid separation that had occurred anterior to the pterygomaxillary fissure, the ct scans were normal . The doppler study of the carotid and vertebral arteries was also normal [figure 1a and b]. (a and b) coronal section of the first patient showing blood in the spheno - ethmoidal and maxillary sinuses (c) sagittal section of the first patient showing intact optic canal the patient's vision in the right eye began to improve gradually from hand movements on the 11 postoperative day, to a visual acuity of 6/9 by 1 month postoperatively . Fundus examination later showed disc pallor in the right eye, with normal findings in the left eye . Several months postoperatively, 6/6 vision was reported for the right eye and has remained so, to date . A 22-year - old male patient with unilateral cleft lip and palate presented with maxillary regression . The procedure was uneventful and the pterygoid dysjunction and down - fracture were done without any difficulty . Controlled hypotensive anaesthesia was given for less than 20 min, with the mean arterial pressure maintained at 70 mmhg . The duration of surgery was 45 min and the estimated blood loss was approximately 700 ml . Postoperatively in the recovery room, he complained of complete loss of vision in the left eye . Eye examination revealed defective vision in the left eye, while the right eye was normal . Ct scans showed no atypical fractures to the base of skull or orbits, but showed opacities in the spheno - ethmoidal air cells . (a and b) coronal section showing blood in the spheno - ethmoidal and maxillary sinuses of the second patient (c) sagittal section of second patient showing intact optic canal the patient's left eye vision improved gradually, with a visual acuity of 1/60 on the 6 postoperative day to 4/60 by 4 months postoperatively . Disc pallor of the left eye was noted on fundoscopy 1 month postoperatively, and a diagnosis of ischaemic optic neuropathy was made . A 19-year - old male with bilateral cleft lip and palate presented to the centre in february 2006 for correction of his maxillary regression . A le fort i osteotomy with advancement was performed under controlled hypotensive anaesthesia with the mean arterial pressure maintained at about 70 mmhg . The osteotomy, pterygoid dysjunction and down - fracture of the maxilla were done without any difficulty . The estimated blood loss for the procedure was 500 ml and the duration of surgery was 90 min . On the second postoperative day, the patient complained of loss of vision in the right eye . On examination, there was no perception of light in the right eye, while the visual acuity for the left eye was 6/6 . The patient was immediately started on intravenous methylprednisolone 500 mg, twice daily . Meanwhile, an emergent computed tomography (ct) scan of the orbits, base of skull and brain, and doppler study of the carotid and vertebral arteries were done . Except for opacities seen in all the paranasal sinuses suggestive of haemorrhage and the left pterygoid separation that had occurred anterior to the pterygomaxillary fissure, the ct scans were normal . The doppler study of the carotid and vertebral arteries was also normal [figure 1a and b]. (a and b) coronal section of the first patient showing blood in the spheno - ethmoidal and maxillary sinuses (c) sagittal section of the first patient showing intact optic canal the patient's vision in the right eye began to improve gradually from hand movements on the 11 postoperative day, to a visual acuity of 6/9 by 1 month postoperatively . Fundus examination later showed disc pallor in the right eye, with normal findings in the left eye . Several months postoperatively, 6/6 vision was reported for the right eye and has remained so, to date . A 22-year - old male patient with unilateral cleft lip and palate presented with maxillary regression . The procedure was uneventful and the pterygoid dysjunction and down - fracture were done without any difficulty . Controlled hypotensive anaesthesia was given for less than 20 min, with the mean arterial pressure maintained at 70 mmhg . The duration of surgery was 45 min and the estimated blood loss was approximately 700 ml . Postoperatively in the recovery room, he complained of complete loss of vision in the left eye . Eye examination revealed defective vision in the left eye, while the right eye was normal . Ct scans showed no atypical fractures to the base of skull or orbits, but showed opacities in the spheno - ethmoidal air cells . (a and b) coronal section showing blood in the spheno - ethmoidal and maxillary sinuses of the second patient (c) sagittal section of second patient showing intact optic canal the patient's left eye vision improved gradually, with a visual acuity of 1/60 on the 6 postoperative day to 4/60 by 4 months postoperatively . Disc pallor of the left eye was noted on fundoscopy 1 month postoperatively, and a diagnosis of ischaemic optic neuropathy was made . The complication of blindness following an elective surgery is indeed devastating to both the patient and the surgeon, especially when one cannot explain to the patient exactly how it has occurred . We report 2 cases of blindness out of 690 le fort i surgeries done from 1996 to 2012 by the same surgeon, for an overall incidence of 0.29% . Reported an incidence of 0.25% in a survey of north american oral and maxillofacial surgeons, while lo et al . Reported an incidence of 2.1% for a centre in taiwan . In the 7 cases in literature, and in our 2, where unfavourable fractures are absent, adverse transmission of forces to the base of skull during pterygoid separation and downfracture has been proposed as the mechanism of injury (cruz et al . Transmitted forces have been postulated to cause contusion or contrecoup type injuries to the nerve or compression of the nerve from haemorrhage and/or oedema around the optic canal, causing ischaemia of the nerve . It has also been considered that hypoperfusion of the optic nerve due to the controlled systemic hypotension might have a significant role in causing blindness (lanigan et al . Injury to the ophthalmic artery from transmitted forces could be responsible for the haemorrhage within the spheno - ethmoidal sinuses in the ct scans of both our cases . The resultant hypoperfusion to the nerve, made worse by the hypotensive anaesthesia, may have caused the ischaemic optic neuropathy that led to unilateral loss of vision . We believe that loss of vision occurred unilaterally because the forces transmitted to the nerves and therefore the degree of injury inflicted on the nerves was unequal, as evidenced by the fracture pattern seen following both our osteotomies . The fractures had occurred anterior to the pterygomaxillary fissure, type f separation (ueki et al . ), on the opposite side of the affected nerves . Lanigan et al ., stated that evidence of spheno - ethmoidal sinus haemorrhage should make one suspicious of the possibility of optic nerve injury, though they did not elucidate on the mechanism of injury . We believe that the optic nerve and the ophthalmic artery suffer some degree of injury following this elective surgery due to their proximity to the surgical site . However, from our 2 cases, it appears that the nerve can recover from this insult, as long as it is not exposed to additional and prolonged ischaemic injury from controlled systemic hypotensive anaesthesia . Fortunately for our 2 cases, the duration of hypotensive anaesthesia was short and this was perhaps the reason the blindness was reversible . Lanigan et al ., reported a case of blindness where the patient had been on hypotensive anaesthesia for 3 h; lo et al . Reported that both their cases had been under hypotensive anaesthesia for 75 min and 95 min; and wilson et al ., though they did not mention the duration of hypotensive anaesthesia, had a 14-h surgery with a lowest recorded blood pressure (bp) of 80/40 . Cheng et al ., also reported a case of blindness where hypotensive anaesthesia had been used for 8 h. all these patients suffered irreversible blindness . Controlled hypotensive anaesthesia in isolation does not cause blindness; it seems to aggravate the insult to an already injured nerve . (2004), who reported a case of blindness following spinal surgery due to compression of the globe by the head rest in the prone position . Cheng et al . Also reported a case of blindness where the effects of a hypoplastic carotid artery may have been made worse by hypotensive anaesthesia following le fort osteotomy . It has also been shown from animal studies that the optic nerve will not recover from ischaemia of over 60 min (yoon and marmor, tsukahara et al . ). The duration of tolerable ischaemia to the optic nerve is quite possibly much lower in humans . We therefore strongly recommend that hypotensive anaesthesia be avoided for this procedure or, if used at all, be used for a very short period of time . Proper surgical technique should also be employed to avoid unfavourable fractures and excessive haemorrhage, hence circumventing the need for hypotensive anaesthesia . It is also suggested that all patients undergoing le fort osteotomies undergo a preoperative ophthalmic assessment of vision.
However, studies have shown that surgery is best done during normal working hours . Given the pressures on theatre use it is important to be able to assess the retinal detachment and to ascertain the urgency of planning surgical intervention . One of the most important features is the involvement of the macula and fovea that is macula on or macula off . In cases of macula - off retinal detachments, macula - on retinal detachments, however, should have their surgery expedited, the main concern being the conversion to a macula - off situation which has a much poorer visual prognosis . The assessment of rhegmatogenous retinal detachments is multifactorial; in an otherwise normal eye visual acuity is an easy measure of macula involvement with the 6/60 patient being macula off and 6/6 macula on . Similarly the onset of symptoms and the age of the retinal detachment is important, as chronic detachments can be more stable and surgery can be safely delayed . Also the extent of detachment and position of the retinal break can also help predict the progression of an acute macula on retinal detachment . However, in certain situations the macula - on or macula - off question is not easily answered; visual acuities may be misleading; examination of the detachment may be difficult due to poor views often due to vitreous hemorrhage and chronicity may be difficult to ascertain in patients with vague histories . High - speed spectral domain optical coherence tomography (oct) offers a noninvasive tool to evaluate retinal microstructural changes in a number of eye pathologies . Newer systems using spectral domain calculations have improved data acquisition speeds compared with conventional time - domain oct equipment allowing much greater axial resolution . Given the greater resolution a number of characteristic changes seen in retinal detachment have been observed . In this paper, we discuss two cases where spectral domain oct and an understanding of the histological changes have enabled a clearer diagnosis and planning of treatment . Our first case is a seventy - five - year - old gentleman who presented with a vague history of blurred vision for six weeks . Visual acuity was 6/24 and examination revealed a pseudophakic inferotemporal macula - off retinal detachment . The reduction in visual acuity was thought to be secondary to vitreous haemorrhage as biomicroscopy assessment showed the detachment stopping inferior to the macula (figure 1). To confirm the macula status, contrary to the biomicroscopy examination (figure 1), this revealed a macula - off retinal detachment (figure 2). Changes seen in the oct scan were characteristic of an old retinal detachment with the presence of intraretinal cysts, undulation of outer retinal layers, and the hyper - reflectivity in the photoreceptor layer (figure 2). Secondary to these oct findings, the surgical session was deprioritised and performed five days later . The surgical repair consisted of a three - port pars plana vitrectomy with perfluoropropane tamponade and cryotherapy . Subsequent spectralis oct one year following the retinal detachment shows restoration of normal retinal morphology with resolution of the intraretinal cysts, flattening of the retinal layers, and no hyperreflectivity seen (figure 3). Our next case was a fifty - year - old myopic female who presented on a friday with a several - month history of floaters and visual distortion described as microstructural analysis of the macula was performed using a heidelberg spectralis oct scan which confirmed a macula - off retinal detachment; however, the oct scan revealed that the fovea was bisected by this detachment (figure 4). Moreover, the macula microstructure seen in the oct scan showed no retinal folds or hyperreflectivity present near the fovea . Indeed, the only morphological retinal detachment changes observed which indicated any chronicity were small intraretinal cysts present peripherally away from the fovea (figure 4). Given the oct findings, she was treated as a macula - on retinal detachment patient, and surgery was expedited such that an emergency theatre session was organised within 24 hours on a saturday morning . The surgical repair was a three - port pars plana vitrectomy using a sulphur hexaflouride tamponade and cryotherapy . After subsequent cataract surgery, vision had returned to 6/6 with normal oct findings (scan not shown). The morphological changes seen in retinal detachment have previously been evaluated by oct and are becoming clearer with newer systems using spectral domain calculations, which have improved data acquisition speeds to ~40 000 a - scans per second allowing much greater axial resolution to approximately 3.5 m tissue resolution . The transformations seen in retinal detachment include intraretinal cyst formation, intraretinal separation, and undulation of outer retinal layers [3, 4]. The disruption of the photoreceptor inner and outer segment junction in macula - off rhegmatogenous retinal detachments is also seen both preoperatively and postoperatively [6, 7]. Murine models comparing histology and oct confirm these findings and also highlight the hyperreflectivity in the photoreceptor layer which may represent a cellular immune infiltration or misalignment of the photoreceptor layer . These changes were all seen in our first case (figure 2) proving that the retinal detachment had been present for a period of time prior to arrival in our unit and enabling appropriate de - prioritisation within a busy vitreoretinal service . In our second case, in which the fovea was bisected by a retinal detachment, time of onset was in some doubt . Retinal thickness of the detached retina has been shown to be time dependent initially thickening then thinning with time [8, 9]; however the subfovea thickness was normal when scanned suggesting a recent event along with the absence of any intraretinal cysts, retinal undulations, and hyper reflectivity of the photoreceptor layer (figure 4). Onset of retinal detachment is of importance, as experimental retinal detachments in cats have shown that although alterations in the outer nuclear layer occur after 1 hour, progressive loss of photoreceptors continues up to 1330 days, with limited atrophy in cat retinas detached 3 to 7 days . However, patients that have no tomographic structural changes presumably due to recent foveal involvement have better clinical prognosis . This is most likely secondary to less atrophy and death of the photoreceptors which has histopathologically been shown to be present in prolonged detachment of the retina [1014]. Finally, the height of retinal detachment, which appears to affect the formation of multiple cystic cavities in the detached inner and outer neuronal layers, correlates with poor visual outcome [15, 16]. All of these features when taken into account suggested a good prognostic outcome for our second patient and hence prompt surgery resulting in an excellent visual recovery; an outcome that could have been considerably poorer if surgery had been delayed and fovea atrophy had occurred . The morphological changes in retinal detachment seen in oct scans give prognostic factors pertaining to visual outcome and thus help anticipate surgical outcomes . This paper has shown the two scenarios where surgical prioritisation is reversed, that is, from macula on to macula off and secondly, from macula off to macula on . In our first case, a chronic detachment was identified by oct and allowed planning within the department for higher priority operations to take place . Conversely, the lack of subfoveal morphological changes in our second case led to the conclusion that the detachment was recent and prognosis good, thus surgery was expedited . We suggest that if any doubt regarding the status of the macula exists, a routine noninvasive oct should be performed to help clarify the situation prior to surgery.
Acute respiratory tract infection (arti) is one of the leading causes of morbidity and mortality in children and adults worldwide . The mortality rate is higher in children under five years of age, the elderly, and immunocompromised individuals (1, 2). Influenza a virus (ifv - a), influenza b virus (ifv - b), respiratory syncytial virus (rsv), parainfluenza viruses (pivs), adenovirus (adv), and rhinovirus (rv) are the most frequently reported viruses associated with artis in the general population . However, their distribution varies by season, geographic region, and age group (3, 4). The clinical presentations of different pathogens, either viral or bacterial, are similar and therefore the accurate etiologic diagnosis of artis relies entirely on laboratory investigations . Early detection of related causative agents is crucial for providing an appropriate treatment regimen, decreasing the use of unnecessary antibiotics, limiting the spread of infection, and shortening the hospitalization duration (2, 3, 5). The conventional methods, such as viral cell cultures and antigen detection tests (such as enzyme immunoassays and direct fluorescent antibody tests), are effective and often complementary, but they have some limitations . Although the cell culture technique is considered to be the gold standard for virus detection, the process is laborious and time - consuming, and it is almost impossible to obtain results during the acute phase of the disease . Antigen - detection tests can provide more rapid results, but are less sensitive and/or specific compared to cell culture techniques (5, 6). Molecular diagnostic methods allow the identification of a wide range of viral and bacterial pathogens within hours, with excellent sensitivity and specificity . Multiplex real - time polymerase chain reaction (pcr) assays provide simultaneous amplification of several viruses or bacteria in a single reaction and make it easy to detect the common causative agents of artis (5, 7). In addition, these tests are able to detect emerging respiratory viruses, such as human metapneumovirus (hmpv), human coronavirus (hcov) nl63, hcov hku1 and human bocavirus (hbov), which are difficult to grow in cell cultures (3, 8 - 10). The aim of this cross - sectional study was to determine the prevalence and seasonal distribution of causative viral agents over a one - year period in children and adults who were living in istanbul and had a pre - diagnosis of arti . A total of 845 nasopharyngeal swab specimens were obtained from patients with a clinical pre - diagnosis of arti between september 1, 2014, and august 31, 2015 . The specimens were transferred from healthcare institutions in istanbul to gelisim medical laboratories, and analyzed directly or stored at -80c until tested . The samples were analyzed for respiratory viruses and bacteria by using the respifinder smart 22 assay (pathofinder bv, the netherlands). Each sample was simultaneously tested for the following 22 pathogens: ifv - a, ifv - a (h1n1)pdm09, ifv - b, piv-1, piv-2, piv-3, piv-4, rsv - a, rsv - b, hmpv, rhinovirus / enterovirus (rv / ev), hbov, adv, hcov nl63, hcov hku1, hcov 229e, hcov oc43, bordetella pertussis (bp), chlamydophila pneumoniae (cp), legionella pneumophila (lp), and mycoplasma pneumoniae (mp). First, viral and bacterial nucleic acids (dna or rna) were extracted according to the kit protocol . Next, amplification, detection, and data analysis were performed with the rotor - gene 6000 real - time pcr system (qiagen, germany) according to the manufacturer s instructions (11, 12). The statistical analysis was performed using statistical package for the social sciences (spss inc ., chi - square or fisher s exact tests were used for comparisons between groups in terms of categorical variables, wherever appropriate . A total of 845 nasopharyngeal swab specimens from 309 children and 536 adults with arti were analyzed . The median age was 29 years (range 0 - 91 years); 444 (52.5%) of the patients were male and 401 (47.5%) were female . In 233 (27.6%) of the specimens, no pathogen was detected, while 612 (72.4%) of the specimens were positive for one or more pathogens (table 1). The positive detection rate in children (232/309, 75.1%) was found to be higher than in adults (380/536, 70.9%), but the difference was not statistically significant (p = 0.190). Similarly, the positive detection rate in male patients (326/444, 73.4%) was higher than in female patients (286/401, 71.3%), but the difference was not statistically significant (p = 0.495). Overall, 902 pathogens were detected; of these, 821 (91%) were viruses and 81 (9%) were bacteria . Among the viruses, ifv - a (n = 219) was the most commonly detected pathogen (table 2). Seventy (32%) of the ifv - a viruses were identified as the (h1n1) pdm09 subtype . Among the bacteria, 49 were identified as mp, 15 were bp, 11 were lp, and six were cp . The distribution of respiratory viruses in children (aged 0 - 15 years) is shown in table 2 . The detection rates of rsv a / b, adv, and pivs in children were significantly higher than in adults (all p <0.05). In the 0 - 4-year - old subgroup, the most commonly detected viruses were rsv a / b (n = 26), ifv - a (n = 23), rv / ev (n = 21), adv (n = 16), ifv - b (n = 14), pivs (n = 13), hbov (n = 11), hcovs (n = 7), and hmpv (n = 7), respectively . In the 5 - 15-year - old subgroup, the most commonly detected viruses were ifv - a (n = 37), ifv - b (n = 29), rv / ev (n = 28), hbov (n = 24), rsv a / b (n = 17), adv (n = 17), pivs (n=12), hcovs (n = 11), and hmpv (n = 4), respectively . The distribution of respiratory viruses in adults (> 15 years old) is shown in table 2 . The detection rates of ifv - a and ifv - b in adults were significantly higher than in children (all p <0.05). In the 16 - 64-year - old subgroup, the most commonly detected viruses were ifv - a (n = 112), ifv - b (n = 81), hbov (n = 37), rv / ev (n = 36), hcovs (n = 24), adv (n = 17), rsv a / b (n = 16), hmpv (n = 13), and pivs (n = 9), respectively . In the 65-year - old subgroup, the most commonly detected viruses were ifv - a (n = 47), ifv - b (n = 33), rv / ev (n = 22), hbov (n = 19), hmpv (n = 12), hcovs (n = 9), adv (n = 6), pivs (n = 6), and rsv a / b (n = 5), respectively . Co - infection was seen in 215 specimens, with detection rates of 25.4% (215/845) of all specimens and 35.1% (215/612) of positive specimens . Co - infection was more common in male patients (124/444, 27.9%) than in female patients (91/401, 22.7%), but the difference was not statistically significant (p = 0.081). The co - infection rate in children (84/309, 27.2%) was found to be higher than in adults (131/536, 24.4%), but the difference was not statistically significant (p = 0.378). The most frequently detected co - infection combinations were ifv - a / hbov (n = 26) and ifv - a / ifv - b (n = 20), respectively . Ifv - a / hbov co - infections (n = 20) in adults and ifv - a / ifv - b co - infections (n = 8) in children were the most common combinations . Among the respiratory viruses, ifv - a (133/219, 60.7%), rsv a / b (36/64, 56.2%), and ifv - b (82/157, 52.2%) were more commonly detected as single pathogens, whereas adv (46/56, 82.1%), hcovs (36/51,70.6%), hbov (59/91, 64.8%), hmpv (23/36, 63.9%), rv / ev (68/107, 63.6%), and pivs (21/40, 52.5%) were predominantly detected in co - infections . Among the bacteria, 17 mp, nine bp, seven lp, and five cp pathogens were detected as single pathogens, while 32 mp, six bp, four lp, and one cp pathogen were detected in co - infections . The monthly and seasonal distribution of respiratory viruses detected in 2014 - 2015 are shown in table 4 and figure 1, respectively . Ifv - a, rv / ev, rsv a / b, adv, and hcov were seen throughout the year, with different peak months . The total detection rate of respiratory viruses was found to be highest in march (197/821, 24%) and april (105/821, 12.8%), and lowest in september (31/821, 3.8%). Seasonally, the total detection rates for respiratory viruses in spring, summer, autumn, and winter were 43.7%, 20.8%, 13.7%, and 21.8%, respectively . Among the bacterial pathogens, mp was more frequently detected in summer (22/49, 44.9%) and winter (11/49, 22.4%), lp was more frequent in winter (11/11, 100%), and bp was more frequent in winter (6/15, 40%). The co - infections were more frequently detected in spring (98/215, 45.6%) and winter (47/215, 21.9%) than in summer (40/215, 18.6%) and autumn (30/215, 14%). A total of 845 nasopharyngeal swab specimens from 309 children and 536 adults with arti were analyzed . The median age was 29 years (range 0 - 91 years); 444 (52.5%) of the patients were male and 401 (47.5%) were female . In 233 (27.6%) of the specimens, no pathogen was detected, while 612 (72.4%) of the specimens were positive for one or more pathogens (table 1). The positive detection rate in children (232/309, 75.1%) was found to be higher than in adults (380/536, 70.9%), but the difference was not statistically significant (p = 0.190). Similarly, the positive detection rate in male patients (326/444, 73.4%) was higher than in female patients (286/401, 71.3%), but the difference was not statistically significant (p = 0.495). Overall, 902 pathogens were detected; of these, 821 (91%) were viruses and 81 (9%) were bacteria . Among the viruses, ifv - a (n = 219) was the most commonly detected pathogen (table 2). Seventy (32%) of the ifv - a viruses were identified as the (h1n1) pdm09 subtype . Among the bacteria, 49 were identified as mp, 15 were bp, 11 were lp, and six were cp . The distribution of respiratory viruses in children (aged 0 - 15 years) is shown in table 2 . The detection rates of rsv a / b, adv, and pivs in children were significantly higher than in adults (all p <0.05). In the 0 - 4-year - old subgroup, the most commonly detected viruses were rsv a / b (n = 26), ifv - a (n = 23), rv / ev (n = 21), adv (n = 16), ifv - b (n = 14), pivs (n = 13), hbov (n = 11), hcovs (n = 7), and hmpv (n = 7), respectively . In the 5 - 15-year - old subgroup, the most commonly detected viruses were ifv - a (n = 37), ifv - b (n = 29), rv / ev (n = 28), hbov (n = 24), rsv a / b (n = 17), adv (n = 17), pivs (n=12), hcovs (n = 11), and hmpv (n = 4), respectively . The distribution of respiratory viruses in adults (> 15 years old) is shown in table 2 . The detection rates of ifv - a and ifv - b in adults were significantly higher than in children (all p <0.05). In the 16 - 64-year - old subgroup, the most commonly detected viruses were ifv - a (n = 112), ifv - b (n = 81), hbov (n = 37), rv / ev (n = 36), hcovs (n = 24), adv (n = 17), rsv a / b (n = 16), hmpv (n = 13), and pivs (n = 9), respectively . In the 65-year - old subgroup, the most commonly detected viruses were ifv - a (n = 47), ifv - b (n = 33), rv / ev (n = 22), hbov (n = 19), hmpv (n = 12), hcovs (n = 9), adv (n = 6), pivs (n = 6), and rsv a / b (n = 5), respectively . Co - infection was seen in 215 specimens, with detection rates of 25.4% (215/845) of all specimens and 35.1% (215/612) of positive specimens . Co - infection was more common in male patients (124/444, 27.9%) than in female patients (91/401, 22.7%), but the difference was not statistically significant (p = 0.081). The co - infection rate in children (84/309, 27.2%) was found to be higher than in adults (131/536, 24.4%), but the difference was not statistically significant (p = 0.378). The most frequently detected co - infection combinations were ifv - a / hbov (n = 26) and ifv - a / ifv - b (n = 20), respectively . Co - infections (n = 20) in adults and ifv - a / ifv - b co - infections (n = 8) in children were the most common combinations . Among the respiratory viruses, ifv - a (133/219, 60.7%), rsv a / b (36/64, 56.2%), and ifv - b (82/157, 52.2%) were more commonly detected as single pathogens, whereas adv (46/56, 82.1%), hcovs (36/51,70.6%), hbov (59/91, 64.8%), hmpv (23/36, 63.9%), rv / ev (68/107, 63.6%), and pivs (21/40, 52.5%) were predominantly detected in co - infections . Among the bacteria, 17 mp, nine bp, seven lp, and five cp pathogens were detected as single pathogens, while 32 mp, six bp, four lp, and one cp pathogen were detected in co - infections . The monthly and seasonal distribution of respiratory viruses detected in 2014 - 2015 are shown in table 4 and figure 1, respectively . Ifv - a, rv / ev, rsv a / b, adv, and hcov were seen throughout the year, with different peak months . The total detection rate of respiratory viruses was found to be highest in march (197/821, 24%) and april (105/821, 12.8%), and lowest in september (31/821, 3.8%). Seasonally, the total detection rates for respiratory viruses in spring, summer, autumn, and winter were 43.7%, 20.8%, 13.7%, and 21.8%, respectively . Among the bacterial pathogens, mp was more frequently detected in summer (22/49, 44.9%) and winter (11/49, 22.4%), lp was more frequent in winter (11/11, 100%), and bp was more frequent in winter (6/15, 40%). The co - infections were more frequently detected in spring (98/215, 45.6%) and winter (47/215, 21.9%) than in summer (40/215, 18.6%) and autumn (30/215, 14%). Rapid and accurate identification of the viral agents of artis is critically important in order to initiate appropriate antiviral therapy and to prevent the overuse of antibiotics, nosocomial transmission, and lengthy hospital stays (7, 13). Molecular techniques with higher sensitivity and rapidity play a critical role in the early identification of respiratory viral pathogens, particularly during epidemics (13). However, the virus - detection rate varies depending on the specimen type, the method used, the working group, and when the study was performed (2). In our study, nasopharyngeal swabs were tested for 18 respiratory viruses and four bacteria by using a multiplex real - time pcr assay, and at least one agent was identified in 72.4% of the samples . This high positive detection rate is similar to the rates reported in other studies, in which molecular methods were performed (13 - 18). The results indicated that individuals in all age groups were susceptible to multiple respiratory viruses that simultaneously circulate in the community . Moreover, despite no significant differences, the detection rate of pathogens in children (75.1%) was slightly higher than in adults (70.9%) (table 1). Previous reports suggested that positive detection rates (in the range of 30.9% - 96.1%) for respiratory viruses in pediatric groups were higher than in adult groups (19). Viral artis have been suggested to occur more frequently in males (15, 20). Our data also showed a slight male preponderance (53.4%) among the positive cases, but the overall positive detection rate was not significantly different between male and female patients . Among the respiratory viruses, ifvs are some of the most important genera due to their epidemic and pandemic potential in terms of public health . Ifvs can have different clinical manifestations, from mild upper respiratory tract infections to severe pneumonia resulting in death (21). In this study, ifv - a was the most commonly detected agent, both in children over 5 years of age and in adults (table 2). In addition, the detection rates of ifv - a and ifv - b in adults were found to be significantly higher than in children . (2) detected the most common agents as rv in the 0 - 4-year - old age group and ifv - b in the 5 - 50-year - old age group in iran . In another study conducted in the united states, hbov (in the 0 - 4-year - old age group) and rv (in the 5 - 50-year - old age group) were found to be the most prevalent agents (22). (23) found the most common agent in adults in china to be ifv - a, which was similar to our findings . These results support that the prevalence of respiratory viruses changes based on geographic region and age group . Rv and ev are both members of the enterovirus genus, and the kit used in this study was not designed for the identification of these two viruses at species level . Rv, once thought to cause only the common cold in children and adults, is now considered to be a major cause of lower artis and asthmatic exacerbations (3, 15). In our study, rv / ev were the second most frequent agents following ifvs, comprising 13% of the detected viruses (table 2) 24) found the most common agent to be ifvs and the second most common to be rv / ev . Respiratory syncytial virus is known as the most common cause of bronchiolitis and pneumonia in infants and young children worldwide, and is divided into two subgroups, a and b, depending on the antigenic and genetic variety (3). In this study, the detection rate of rsv a / b in children was significantly higher than in adults, and rsv a / b was the most commonly detected pathogen in the 0 - 4-year - old age group . Our results confirmed the previous observations regarding the importance of rsv a / b in children under 5 years of age . In the current study, two or more pathogens were detected in 25.4% of all samples, with a higher rate in children and in male patients . In a systematic review, goka et al . (19) reported that co - infection rates ranged from 5% to 62%, and rsv has been found to be the most predominant co - infecting virus in many studies . 10) detected the most prevalent viral agents in co - infections to be ifvs and rv . In another study conducted in our country, hbov and hmpv were found to be the most common co - infecting viruses (20). In this study, adv, hbov, hmpv, rv / ev, and hcovs were more frequently found in co - infections, and the most commonly detected co - infections were ifv - a / hbov and ifv - a / ifv - b (table 3). It was reported that the high co - infection prevalence of adv and hbov may have resulted from asymptomatic persistence, prolonged nasopharyngeal shedding, or a tendency to infect or colonize in the presence of other viruses (9, 14, 18, 25). (22) found that the detection of hbov was not associated with clinical symptoms in 54% of cases . On the other hand, although nasopharyngeal samples were suggested to reveal reliable results for detecting viral agents, the findings described above may indicate that pathogen detection in the nasopharynx may not accurately represent the situation in the lower respiratory tract (14, 17, 18). Moreover, the possibility of contamination during sample collection or analysis could not be excluded, and this should be kept in mind in clinical evaluations . Assessment of viral load may be a better choice in the interpretation of positive co - infection results, but it has been reported that more studies would be required to clarify the potential value of quantitative test results (9). In addition, in most studies, it has been suggested that the presence of more than one pathogen in a respiratory sample did not affect the clinical presentation of artis, but the relationship between co - infection and severity of disease remains debatable (4, 13 - 15, 19). It is known that viral artis have a seasonal character, particularly in regions with temperate climates, and the peak periods may change from year to year . In many studies, respiratory viruses have been reported to be active during the cold seasons (generally from november to march) in the northern hemisphere (20). In our study, interestingly, ifv - b was not detected in the autumn months or in december; it began to appear in january (table 4, figure 1). In contrast, ifv - a was seen throughout the year, with peak activity in march and april . Rv / ev was most frequently seen in the autumn and winter months, rsv a / b and hmpv in the winter and spring months, hcovs in the spring months, adv in the spring and summer months, and hbov and pivs in the summer months . The differences in the peak periods, compared to previous reports, could be explained by the smaller number of cases in our study (particularly for hcovs, pivs, and hmpv), regional differences, or annual variability, which has been demonstrated in other studies (13, 20, 25). First, we were unable to obtain accurate inpatient or outpatient data of the cases and thus we could not present the distribution of respiratory viruses according to inpatient and outpatient groups . However, most of our contracted healthcare institutions consisted of local outpatient polyclinics in istanbul, and a high proportion of the samples may have been collected from outpatients and a minority from inpatients . Second, although multiplex real - time pcr assays are reported to have excellent sensitivity and specificity, there is a possibility of false - positive or false - negative results . As mentioned above, it may be difficult to diagnose whether a positive nasopharyngeal swab shows the etiology or evidence of nasopharyngeal colonization . Lastly, one year may be considered too short a time for an epidemiologic study, but we think that our preliminary data could provide useful findings for further investigations . In conclusion, ifv - a was found to be the most prevalent respiratory pathogen in all age groups except for children under 5 years of age, in whom rsv a / b was the most common agent . In our region, respiratory viruses were generally active in the early spring and winter, and the peak months for these agents were different from each other over a one - year period . Early detection and monitoring of respiratory pathogens is essential in order to avoid the unnecessary use of antibiotics, to control the spread of infection, and to contribute to public health surveillance efforts, and the multiplex real - time pcr assay could be a suitable and effective method in this regard.
Symptomatic adrenal adenoma usually presents with systemic symptoms . Depending on the function of the adenoma, the patient can present with pheochromocytoma - like symptoms; primary hyperaldosteronism and cushing syndrome (weight gain, weakness, depression, and bruising). A 41 year - old lady presented with multiple metatarsal and phalangeal fractures of the both feet without significant injury . Laproscopic r adrenalectomy was performed and histological study confirmed adrenal cortical adenoma with adjacent cortical atrophy suggestive of a functioning adenoma . Symptomatic adrenal adenoma usually presents with systemic symptoms . Depending on the function of the adenoma, the patient can present with pheochromocytoma - like symptoms (palpitations, sweating, headache, abdominal pain and labile hypertension); primary hyperaldosteronism (hypertension and unprovoked hypokalemia) and cushing syndrome (weight gain, weakness, depression, and bruising). We reported a case of bilateral adrenal adenoma who presented with multiple insufficiency fracture of both feet . A 41 year - old lady presented to us with fracture of the base of her left fifth metatarsal after an inversion sprain (fig 1). She had sudden onset of left forefoot pain eight months later without any preceding injury . Radiographs showed fracture of her left second metatarsal with callus formation (fig 2). Radiographs showed old fractures of bases of bilateral fifth metatarsals, proximal phalanges of bilateral third toes, left second metatarsal with callus formation and crack fracture of the proximal phalanx of the left fourth toe (fig 3). She was newly diagnosed to have diabetes mellitus but the sensation of the feet was still intact . Overnight dexamethasone suppression test (ondst) was 660nmol / l which was non suppressible . The serum cortisol reached peak level of 699 in low dose short synacthen test (ldsst) and the acth level was less than 1.6 . Computed tomogram showed bilateral adrenal adenoma (fig 4). In order to plan for surgery, the functionality of the adenomas needed to be determined . Radiographs showed old fractures of bases of bilateral fifth metatarsals, proximal phalanges of bilateral third toes, left second metatarsal with callus formation and crack fracture of the proximal phalanx of the left fourth toe . Multiple metatarsal and phalangeal fractures of the foot of different ages without any significant injury are uncommon . This lady is a housewife and not involved in any activity that can contribute to fatigue fracture . Dexa scan was performed as insufficiency fracture was suspected and the result confirmed the presence of osteoporosis . Overnight dexamethasone suppression test (ondst), urine cortisol level, low dose short synacthen test (ldsst) and the acth level was compatible with adrenal cushing syndrome . Adrenal adenoma is a cause of cushing syndrome that is surgically treatable . The presence of adenoma in both adrenal glands needs further study of the functionality of the tumours for surgical planning . Histological study confirmed adrenal cortical adenoma with adjacent cortical atrophy suggestive of a functioning adenoma . The clinical significance of this report is that it demonstrates the multiple phalangeal and metatarsal fractures can be the sole presentation of adrenal adenoma . Causes of secondary osteoporosis should be investigated in pre - menopausal patient with insufficiency fracture of the feet.
Most prostate cancers are slow growing, but aggressive prostate cancers are also seen (2, 3). Prevalence of prostate cancer varies widely across the world, but it is more common in developed countries (4, 5). It is the second leading cause of cancer - related death in men in the united states and the sixth cause of cancer - related death globally (4, 6, 7). Many cases of prostate cancers remain subclinical and never have symptoms (8) or have been symptomatically in progressive stage of disease (9). Therefore, using screening method to detect cancer in curable stage of disease is very important . Prostate cancer screening options include digital rectal examination (dre) and prostate specific antigen (psa) blood test (10, 11). These screening may lead to biopsy, which is the only test able to confirm the diagnosis of prostate cancer performed via transrectal ultrasonography (trus) (11 - 15). The common protocol used in trus guided prostate biopsy is sextant biopsy proposed by hodge et al . In the late eighties (16, 17). However in the last decade, several studies were designed to evaluate prostate cancer detecting performance by trus guided prostate biopsy with more than six biopsies either from other sites of prostate or repeating biopsy in the six previous areas (18 - 21). The results of studies confirmed the hypothesis that greater numbers of biopsies increases the diagnostic power . On the other hand, each biopsy leads to complications such as hematuria (14.5%), hematospermia (6.5%-74.4%), dysuria (minor complications) and severe complications such as infection and fever episode (6.6%), urinary retention (0 - 4.6%) and septicemia (rarely) (22), so increasing the number of biopsies increases the adverse effects (23). In this study, we evaluated three most popular biopsy protocols: 6-core prostate biopsy, 12-core prostate biopsy and 18-core prostate biopsy to determine which protocol has the most diagnostic value for detection of prostate cancer with least adverse effects . This study was performed as a randomized clinical trial study between april 2011 and march 2012 on patients suspicious for prostate cancer candidate for trus guided prostate biopsy due to abnormal digital rectal examination (dre) and/or elevation of prostate specific antigen (psa) referred from urology ward to radiology department of hazrat rasoul akram hospital . Patients who had a history of previous biopsy, history of prostatic tur due to bph, symptoms and signs of urinary tract infections and receiving antibiotic treatment for any reason were excluded from the study . The ultrasound machine was esaote mylab 70 xvg (genoa, italy) with a multifrequency endocavitary transducer (ec123, 7 - 10 mhz) equipped with biopsy guide and biopsy specimens obtained with automatic biopsy gun with 18 gauge tru - cut needle . In total, 180 patients entered the study and divided into three groups by block randomization: 1) in the first group, six specimens obtained from the prostate gland considering the following protocol: dividing the prostate to six segments and obtaining biopsies from base, middle and apex of the peripheral zone at both sides of prostate . 2) in the second group, 12 specimens obtained from the prostate gland considering the following protocol: dividing the prostate to eight segments including base, upper - mid, lower - mid and apex in either sides of prostate and obtaining one biopsy specimen from base and apex segments and obtaining two specimens in middle segments; one more medially (including the peripheral zone and inner gland) and one more laterally (pure peripheral zone). 3) in the third group, 18 specimens obtained from the prostate gland considering the following protocol: dividing the prostate to eight segments similar to the second group and obtaining two biopsy specimens from each segment plus additional biopsies from periurethral inner gland in each side . All patients received antibiotic prophylaxis as follows: metronidazole 250 mg every eight hours and ciprofloxacin 500 mg every 12 hours, from two days before to five days after the biopsy, also 500 mg of amikacin was administered by intravenous infusion, 6 and 1 hour before biopsy . Forty - eight hours after biopsies, patients were asked about signs of urinary tract infection and prostatitis especially dysuria . Patients temperature was checked and urine sample was collected for urine analysis (u / a) and urine culture (u / c). The frequency of positive cancer patients and infectious complications were compared between the three groups . The objectives and methods of the study were explained to all subjects and a written informed consent was obtained . Comparison between groups was performed using analysis of variance [anova] and chi - square tests . Comparison between groups was performed using analysis of variance [anova] and chi - square tests . Patients mean age in 6-core biopsy group was 58.4 7.8 years, in 12-core biopsy group was 57.6 8.6 years and in 18-core biopsy group was 58.7 8 years . There was no significant difference in mean age between the groups (p = 0.731). Mean psa level of patients in 6-core biopsy group was 8.7 4.6 ng / ml, in 12-core biopsy group was 7.9 4.3 ng / ml and in 18-core biopsy group was 8.6 4.2 ng / ml . There was no significant difference in mean psa level between the groups (p = 0.617). Histological results obtained from trus guided prostate biopsy showed that in 6-core biopsy group, eight (13.3%) of 60 patients had positive biopsy results for prostate cancer . In 12-core biopsy group, 21 (35%) of 60 patients had positive biopsy results for prostate cancer . In 18-core biopsy group, 24 (40%) of 60 patients had positive biopsy results for prostate cancer (p = 0.003) (figure 1). Binary comparison of prostate biopsy results between each two groups indicated a significant difference in the detection of prostate cancer between 6-core biopsy and 12-core biopsy (p = 0.006). Besides, there was a significant difference in detection of prostate cancer between 6-core biopsy and 18-core biopsy (p = 0.001), but there was no significant difference in the detection of prostate cancer between 12-core biopsy and 18-core biopsy (p = 0.572). In this study, infection rate as one of the most important adverse effects of prostate biopsy was evaluated . In 6-core biopsy group, infection occurred in 17 patients (28.3%); in 12-core biopsy group infection occurred in 23 (38.3%) patients and in 18-core biopsy group infection occurred in 35 (58.3%) patients (p = 0.003) (figure 2). Pair wise comparison of infection rate between each two groups indicated no significant difference in infection rate between 6-core biopsy group and 12-core biopsy group (p = 0.254), but there was a significant difference in infection rate between 12-core biopsy group and 18-core biopsy group (p = 0.028) as well as 6-core biopsy group and 18-core biopsy group (p = 0.001). The desirable number of obtained biopsies to detect all, or at least most prostate cancers has not yet ratified . In the early 1990s, use of sextant biopsies involving six cores, three from each side of the prostate gland, became the standard approach for the diagnosis of prostate cancer (24 - 26); but as studies showed that this strategy misses a significant number of prostate cancer (high false - negative rates), hypotheses were proposed to increase the number of biopsies since the late 1990s . While there is disagreement about the optimal strategy, several studies showed that more number of biopsies resulted in detection of about 10 - 30% more cancers than the conventional sextant biopsy (27 - 31). On the other hand by increasing the number of biopsies, increasing adverse effects, especially infection and prostatitis as the major and life - threatening complications were unavoidable (32). In our study, we tried to minimize confounding factors that may interfere with the study results, therefore effective factors of malignancy such as age and psa level became identical in all the three groups of study . There was no statistically significant difference between age as well as psa level between the three group of patients (p = 0.731, p = 0.617, respectively). Results of our study showed that detecting rate of prostate cancer in 12-core biopsy protocol was more than 6-core biopsy protocol with a significant statistical difference between the results . Although 18-core biopsy protocol detected prostate cancer more than 6-core biopsy, but the difference between 12-core and 18-core biopsy protocols was not statistically significant . In a similar study by thiesler et al . (33) on 241 patients suspicious for prostate cancer, diagnostic power of 12-core biopsy method was evaluated compared with standardized six - core biopsy method . In this study, the amount of psa level was less than 4 ng / ml, while the average of psa level in our study was 8.4 4.3 ng / ml . Results of this study showed that 34% (81/241) of patients who underwent 6-core trus guided biopsy had prostate cancer; whereas, an additional 23.5% (19/81) of cancers were diagnosed using the 12-core biopsy protocol, so in low psa level (<4 ng / ml), 12-core biopsy is more appropriate than six core biopsy . Our study expressed that increasing the number of biopsies from 6 to 12 increased cancer detection rate (35% versus 13.3%), but increasing 12 to 18-core biopsy resulted in no statistically significant difference for detection of cancer (p = 0.572). (20) in a study designed prospectively evaluated the diagnostic yield of 6-core biopsy, 12-core biopsy, 18- core biopsy and 21 core biopsy protocol in prostate cancer . In his study, cancer detection rates using 6-core biopsy protocol was 31.7%, for 12-core biopsy was 38.7% and for 18 and 21 core biopsies were 41.5%, and 42.5%, respectively . The 12-core protocol improved the cancer detection rate by 22% compared with the 6-core protocol (p = 0.0001). 18-core biopsy compared with 12-core biopsy scheme increased the diagnostic yield by 7.2% (p = 0.023). In guichard study, there were statistically significant differences between 12 and 18 core biopsies, which is in contrast with our study . This difference may be due to difference of psa level distribution in both studies . In our study, mean psa level was almost the same in each three groups, but in guichard study patients were divided into three subgroups according to psa level (psa 4 ng / ml, 4 <psa <20, psa 20 ng / ml). In recent years, increasing the number of biopsies played such an important role in detection of prostate cancer in such a way that saturation biopsy was used to detect prostate cancer with a more accuracy (in general, saturation biopsy is considered as a minimum of 20 cores taken from the prostate). Although, the usefulness of this approach is unset (34). (35), matsumoto et al . (36), terris et al . (37), stamatiou et al . (18), taylor et al . (30) studies, which all have consensus on usefulness of increasing the number of specimens more than 6-core biopsy to increase the power of prostate cancer detection . However, the optimum number of biopsies required to detect prostate cancer is still largely unknown . In contrast, there are a few studies in which there are not statistically significant differences between 6-core biopsy, 12-core and 18-core biopsy in prostate cancer detection (39, 40). Furthermore, our study investigated the most important complication of biopsy as infection; 12-core biopsy protocol resulted in 38.3% urinary tract infection and fever versus 28.3% infection rate in 6-core biopsy protocol, which was not statistically significant (p = 0.254). Nevertheless, infection rate in 18-core biopsy protocol was 58.3%, which had a statistically significant difference with 12-core and 6-core biopsy protocols, respectively (p = 0.028 and p = 0.001). Eichler in his systematic review of cancer detection rates and complications of various prostate biopsy approaches in 20698 patients stated that 12 core biopsy approach seems to have optimum balance between the cancer detection rate and biopsy complications (27). In addition, the study designed by simon and colleagues demonstrated that adding the number of biopsy did not improve detection rate of cancer, it leads to increased morbidity and adverse effects, especially infection (41). Our study results showed that increasing the number of obtained biopsies from 6 to 12 is logical and increased the detection rate of prostate cancer significantly, but further increase in the number of biopsy specimens from 12 to 18 only increased post biopsy infectious complications without significant increase in cancer detection rate . We concluded that the optimum number of obtained prostate biopsies to reach acceptable diagnostic power with least infection rate is 12-core biopsy.
Thirty - five male sprague - dawley rats weighing 200 - 250 g were used for this study . Animals were provided with commercially available rat feed and drinking water, and were subjected to a 1-week accommodation period prior to the experimental procedure . Rats were divided into two groups: the control group and the experimental group, each of which comprises five rats . Rats of the experimental group were exposed to sidestream smoke in smoking chambers that we have designed ourselves . We made a model of sidestream smoke using plastic chambers where experimental rats can inhale the sidestream smoke from the cigarette end rather than can direct aspirate the mainstream smoke of cigarettes after the cigarette was lighted . Rats of the control group were only provided with commercial rat feed and drinking water, but not exposed to the cigarette smoke . Rats of the experimental groups were exposed to the sidestream smoke as follows: group 1: a 1-month exposure to three cigarettes a daygroup 2: a 1-month exposure to five cigarettes a daygroup 3: a 1-month exposure to seven cigarettes a daygroup 4: a 3-month exposure to five cigarettes a daygroup 5: a 6-month exposure to five cigarettes a day group 1: a 1-month exposure to three cigarettes a day group 2: a 1-month exposure to five cigarettes a day group 3: a 1-month exposure to seven cigarettes a day group 4: a 3-month exposure to five cigarettes a day group 5: a 6-month exposure to five cigarettes a day morphologic changes of the bronchioles and alveolar cells were examined on the lm and the em after both short- and long - term exposure to cigarette smoke . Tissue specimens were prepared for the lm, transmission em (tem) and scanning em (sem) with the routine procedures . Em findings were analyzed semi - quantitatively and then assessed by a relative comparison with the control group based on the following criteria: minimal (+ /-) (similar to slight change as compared with the control group), mild (+) (focal and mild change on em at a magnification of 10,000), moderate (+ +) (focal but distinct change on em at a magnification of 5,000) and prominent (+ + +) (diffuse and prominent change on em at a magnification of 5,000). We performed immunohistochemical stainings of tnf-, tgf-1, il-1, il-1, ki-67, and ck14 in bronchioles and alveolar cells . Formalin - fixed, paraffin - embedded lung tissue sections (5-m thick) were placed in a 60 oven for 30 minutes and then were deparaffinized in xylene three times for 20 minutes each . The deparaffinized sections were then rehydrated by passage through a graded series of ethanol to water . The sections were then heated for 25 minutes in citrate - buffered saline (ph 6.0) for antigen retrieval . Endogenous peroxidases were blocked with a solution of 3% h2o2 in water for ten minutes . The tissue sections were incubated with primary antibodies against tnf-, tgf-1, il-1, il-1, ck14, and ki-67 (table 1). Diaminobenzidine (dab, dako, carpinteria, ca, usa) was used as the chromogen . We analyzed the immunohistochemical expressions of available slides for interpretation in each group, and evaluated using a 5-point scoring system based on the percentage of cells expressing antigen with 0, 5%; 1, 6 - 20%; 2, 21 - 40%; 3, 41 - 70%; and 4,> 70% where 5% was set at the cut - off value for positivity . The ck14 and ki-67 antigens are expressed in the nuclei of bronchiolar basal cells and alveolar epithelial cells . We examined apoptosis in bronchiolar and alveolar cells on the lm and em to detect the dna fragments by the tunel technique . This method is based on the ability of terminal deoxynucleotidyl transferase (tdt) to catalyze the template - independent addition of biotinylated dutp to the 3'-oh ends of double- or single - stranded dna . In addition, we used the apoptag peroxidase in situ apoptosis detection kit (intergen, new york, ny, usa) to detect apoptosis in situ . Paraffin - embedded tissue sections were cut into sections 5-m thick, mounted on silane - coated glass slides and incubated for an hour at 60. the slides were deparaffinized in xylene three times for five minutes each, and then rehydrated through a graded alcohol series (100%, 95%, 70%, and 50%) for five minutes each . After washing with 0.01 m phosphate buffered saline (pbs) for five minutes, we digested the sections with proteinase k (20 g / ml) at room temperature for 20 minutes, and washed them twice with distilled water for two minutes each . Sections were treated with 3% h2o2 and reacted with dnase i (1 or 2 u) at 37 for 30 minutes . The slides were covered with tdt buffer 75 l and tdt / dutp 50 l and then left undisturbed for ten minutes . The sections were covered with plastic cover slips and incubated in a humidified chamber at 37 for 1.5 hours . For negative controls, the slides were dipped into coplin jars containing the stop buffer, agitated for 15 seconds and incubated for ten minutes at 37. then the slides washed three times with pbs for five minutes each . The sections were covered with a peroxidase - coupled anti - digoxigenin antibody and incubated for 30 minutes at 37 in a humidified chamber . The slides were washed three times with pbs for two minutes each, and covered with 100 l of dab solution . The sections were counterstained with hematoxylin for one minute, washed with tap water, and dehydrated with a graded ethanol series . The total number of alveolar cells, tunel - positive alveolar cells, total bronchiolar epithelial cells and tunel - positive bronchiolar epithelial cells were counted . The percentage of tunel - positive cells was calculated for each slide, of which mean values were obtained for each experimental group . The lung tissues were removed from rats of the experimental groups, sliced into small pieces (441 mm), and were fixed in periodate lysine paraformaldehyde solution at 4 overnight . After washing with 0.01 m pbs, we immersed the lung tissues in graded concentrations of sucrose in pbs (10% for an hour, 15% for two hours, and 20% for four hours) at 4. the tissues were then embedded in optimal cutting temperature (oct) compound and frozen in a dry ice / acetone bath . The oct - embedded tissue blocks were stored at -80, and then cut into 6 m sections in a cryostat and mounted on silane - coated glass slides . The sections were air - dried and stored at -20 until for further laboratory procedure . After washing in 0.01 m pbs for five minutes, we incubated the sections with proteinase k (20 g / ml) at room temperature for 15 minutes, and then washed them with distilled water (dw) five times, for two minutes each . The slides were rinsed five times with dw for two minutes each, and incubated with 50 l tdt reaction solution for three hours . The reaction was stopped by addition of 2 saline - sodium citrate for 15 minutes at room temperature . The sections were washed five times with 0.01 m pbs for two minutes each and then incubated with blocking solution containing 1% bovine serum albumin in pbs at room temperature for 20 minutes . Then the sections were treated with peroxidase - conjugated streptavidin for an hour at 37. the slides were washed in six changes of 0.01 m pbs for five minutes each . This was followed by the incubation of slides in the dark at room temperature for 3 - 5 minutes . The slides were placed in a coplin jar and washed in 0.01 m pbs five times for two minutes each . For lm tunel staining, the sections were counterstained lightly with hematoxylin for one minute and washed with tap water . Following this, paraffin - embedded tissue samples were prepared in a stepwise manner . For em tunel staining, the sections were reacted with 1% oso4 in 0.01 m cacodylate buffer for an hour in a humidified chamber, and washed in three changes of 0.01 m pbs for five minutes each . Then, the sections were dehydrated completely in a graded ethanol series, and embedded in inverted polyethylene embedding capsules filled with polybed mix resin (poly / bed 812, polysciences inc . This was followed by a 3-day polymerization at 60. the gelatin capsules were removed from the glass slide, which was followed by the lm examination . Then we selected a portion for the em examination . After trimming the polybed mix resin blocks, we performed ultrathin sections (100 nm) and examined the grids on a hitachi h-7100 electron microscope (tokyo, japan) at 75 kv without routine double stains of uranyl acetate and lead citrate (fig . Lung tissues were homogenized in cell lysis buffer (0.05 m tris, 0.15 m nacl, 0.05 m ethylenediaminetetraacetic acid, 0.5% np-40, 1 m dithiothreitol, 10 g leupeptin, and 10 g aprotinin; all from sigma, st . The homogenate was incubated for 30 minutes on ice and centrifuged at 12,000 g for 30 minutes . The protein content of the supernatant was determined using the bradford protein assay (bio - rad, hercules, ca, usa). Samples were denatured by boiling with 4 sodium dodecyl sulfate (sds) sample buffer for ten minutes . Proteins (50 g per lane) were resolved by electrophoresis on an 8 - 12% sds - polyacrylamide gel electrophoresis gradient gel at 100 v for three hours and transferred to nitrocellulose membrane (millipore co., bedford, ma, usa). The membrane was further incubated with primary antibodies such as a polyclonal rabbit anti - parp antibody (santa cruz biotechnology, santa cruz, ca, usa) and -actin (santa cruz biotechnology). The membrane was subsequently incubated with appropriate secondary antibodies conjugated to horseradish peroxidase and developed in the ecl western detection reagents (amersham pharmacia biotech, piscataway, nj, usa). Thirty - five male sprague - dawley rats weighing 200 - 250 g were used for this study . Animals were provided with commercially available rat feed and drinking water, and were subjected to a 1-week accommodation period prior to the experimental procedure . Rats were divided into two groups: the control group and the experimental group, each of which comprises five rats . Rats of the experimental group were exposed to sidestream smoke in smoking chambers that we have designed ourselves . We made a model of sidestream smoke using plastic chambers where experimental rats can inhale the sidestream smoke from the cigarette end rather than can direct aspirate the mainstream smoke of cigarettes after the cigarette was lighted . Rats of the control group were only provided with commercial rat feed and drinking water, but not exposed to the cigarette smoke . Rats of the experimental groups were exposed to the sidestream smoke as follows: group 1: a 1-month exposure to three cigarettes a daygroup 2: a 1-month exposure to five cigarettes a daygroup 3: a 1-month exposure to seven cigarettes a daygroup 4: a 3-month exposure to five cigarettes a daygroup 5: a 6-month exposure to five cigarettes a day group 1: a 1-month exposure to three cigarettes a day group 2: a 1-month exposure to five cigarettes a day group 3: a 1-month exposure to seven cigarettes a day group 4: a 3-month exposure to five cigarettes a day group 5: a 6-month exposure to five cigarettes a day morphologic changes of the bronchioles and alveolar cells were examined on the lm and the em after both short- and long - term exposure to cigarette smoke . Tissue specimens were prepared for the lm, transmission em (tem) and scanning em (sem) with the routine procedures . Em findings were analyzed semi - quantitatively and then assessed by a relative comparison with the control group based on the following criteria: minimal (+ /-) (similar to slight change as compared with the control group), mild (+) (focal and mild change on em at a magnification of 10,000), moderate (+ +) (focal but distinct change on em at a magnification of 5,000) and prominent (+ + +) (diffuse and prominent change on em at a magnification of 5,000). We performed immunohistochemical stainings of tnf-, tgf-1, il-1, il-1, ki-67, and ck14 in bronchioles and alveolar cells . Formalin - fixed, paraffin - embedded lung tissue sections (5-m thick) were placed in a 60 oven for 30 minutes and then were deparaffinized in xylene three times for 20 minutes each . The deparaffinized sections were then rehydrated by passage through a graded series of ethanol to water . The sections were then heated for 25 minutes in citrate - buffered saline (ph 6.0) for antigen retrieval . Endogenous peroxidases were blocked with a solution of 3% h2o2 in water for ten minutes . The tissue sections were incubated with primary antibodies against tnf-, tgf-1, il-1, il-1, ck14, and ki-67 (table 1). Diaminobenzidine (dab, dako, carpinteria, ca, usa) was used as the chromogen . We analyzed the immunohistochemical expressions of available slides for interpretation in each group, and evaluated using a 5-point scoring system based on the percentage of cells expressing antigen with 0, 5%; 1, 6 - 20%; 2, 21 - 40%; 3, 41 - 70%; and 4,> 70% where 5% was set at the cut - off value for positivity . The ck14 and ki-67 antigens are expressed in the nuclei of bronchiolar basal cells and alveolar epithelial cells . We examined apoptosis in bronchiolar and alveolar cells on the lm and em to detect the dna fragments by the tunel technique . This method is based on the ability of terminal deoxynucleotidyl transferase (tdt) to catalyze the template - independent addition of biotinylated dutp to the 3'-oh ends of double- or single - stranded dna . In addition, we used the apoptag peroxidase in situ apoptosis detection kit (intergen, new york, ny, usa) to detect apoptosis in situ . Paraffin - embedded tissue sections were cut into sections 5-m thick, mounted on silane - coated glass slides and incubated for an hour at 60. the slides were deparaffinized in xylene three times for five minutes each, and then rehydrated through a graded alcohol series (100%, 95%, 70%, and 50%) for five minutes each . After washing with 0.01 m phosphate buffered saline (pbs) for five minutes, we digested the sections with proteinase k (20 g / ml) at room temperature for 20 minutes, and washed them twice with distilled water for two minutes each . Sections were treated with 3% h2o2 and reacted with dnase i (1 or 2 u) at 37 for 30 minutes . The slides were covered with tdt buffer 75 l and tdt / dutp 50 l and then left undisturbed for ten minutes . The sections were covered with plastic cover slips and incubated in a humidified chamber at 37 for 1.5 hours . For negative controls, sections the slides were dipped into coplin jars containing the stop buffer, agitated for 15 seconds and incubated for ten minutes at 37. then the slides washed three times with pbs for five minutes each . The sections were covered with a peroxidase - coupled anti - digoxigenin antibody and incubated for 30 minutes at 37 in a humidified chamber . The slides were washed three times with pbs for two minutes each, and covered with 100 l of dab solution . The sections were counterstained with hematoxylin for one minute, washed with tap water, and dehydrated with a graded ethanol series . The total number of alveolar cells, tunel - positive alveolar cells, total bronchiolar epithelial cells and tunel - positive bronchiolar epithelial cells were counted . The percentage of tunel - positive cells was calculated for each slide, of which mean values were obtained for each experimental group . The lung tissues were removed from rats of the experimental groups, sliced into small pieces (441 mm), and were fixed in periodate lysine paraformaldehyde solution at 4 overnight . After washing with 0.01 m pbs, we immersed the lung tissues in graded concentrations of sucrose in pbs (10% for an hour, 15% for two hours, and 20% for four hours) at 4. the tissues were then embedded in optimal cutting temperature (oct) compound and frozen in a dry ice / acetone bath . The oct - embedded tissue blocks were stored at -80, and then cut into 6 m sections in a cryostat and mounted on silane - coated glass slides . The sections were air - dried and stored at -20 until for further laboratory procedure . After washing in 0.01 m pbs for five minutes, we incubated the sections with proteinase k (20 g / ml) at room temperature for 15 minutes, and then washed them with distilled water (dw) five times, for two minutes each . The slides were rinsed five times with dw for two minutes each, and incubated with 50 l tdt reaction solution for three hours . The reaction was stopped by addition of 2 saline - sodium citrate for 15 minutes at room temperature . The sections were washed five times with 0.01 m pbs for two minutes each and then incubated with blocking solution containing 1% bovine serum albumin in pbs at room temperature for 20 minutes . Then the sections were treated with peroxidase - conjugated streptavidin for an hour at 37. the slides were washed in six changes of 0.01 m pbs for five minutes each . This was followed by the incubation of slides in the dark at room temperature for 3 - 5 minutes . The slides were placed in a coplin jar and washed in 0.01 m pbs five times for two minutes each . For lm tunel staining, the sections were counterstained lightly with hematoxylin for one minute and washed with tap water . Following this, paraffin - embedded tissue samples were prepared in a stepwise manner . For em tunel staining, the sections were reacted with 1% oso4 in 0.01 m cacodylate buffer for an hour in a humidified chamber, and washed in three changes of 0.01 m pbs for five minutes each . Then, the sections were dehydrated completely in a graded ethanol series, and embedded in inverted polyethylene embedding capsules filled with polybed mix resin (poly / bed 812, polysciences inc ., this was followed by a 3-day polymerization at 60. the gelatin capsules were removed from the glass slide, which was followed by the lm examination . Then we selected a portion for the em examination . After trimming the polybed mix resin blocks, we performed ultrathin sections (100 nm) and examined the grids on a hitachi h-7100 electron microscope (tokyo, japan) at 75 kv without routine double stains of uranyl acetate and lead citrate (fig . Lung tissues were homogenized in cell lysis buffer (0.05 m tris, 0.15 m nacl, 0.05 m ethylenediaminetetraacetic acid, 0.5% np-40, 1 m dithiothreitol, 10 g leupeptin, and 10 g aprotinin; all from sigma, st . The homogenate was incubated for 30 minutes on ice and centrifuged at 12,000 g for 30 minutes . The protein content of the supernatant was determined using the bradford protein assay (bio - rad, hercules, ca, usa). Samples were denatured by boiling with 4 sodium dodecyl sulfate (sds) sample buffer for ten minutes . Proteins (50 g per lane) were resolved by electrophoresis on an 8 - 12% sds - polyacrylamide gel electrophoresis gradient gel at 100 v for three hours and transferred to nitrocellulose membrane (millipore co., bedford, ma, usa). The membrane was further incubated with primary antibodies such as a polyclonal rabbit anti - parp antibody (santa cruz biotechnology, santa cruz, ca, usa) and -actin (santa cruz biotechnology). The membrane was subsequently incubated with appropriate secondary antibodies conjugated to horseradish peroxidase and developed in the ecl western detection reagents (amersham pharmacia biotech, piscataway, nj, usa). On gross examination, there were mild patchy discoloration and congestion on the lung surface in rats of groups 1 and 2 . In group 3, the lungs showed multifocal discoloration and congestion . In rats of groups 4 and 5, however, there were a patchy pale brown discoloration and a centrilobular patchy consolidation (fig . After a 1-month exposure to sidestream smoke, rats of group 1 showed a mild bronchiolar luminal dilatation, an irregular arrangement of the bronchiolar epithelial cell cilia and a patchy peribronchiolar inflammatory infiltrates . In rats of groups 2 and 3, there were more distinct changes in the bronchiolar cells as compared with the control group . In rats of groups 1, 2, and 3, there were patchy inflammatory infiltrates in the alveolar walls and air spaces around the respiratory bronchioles . But there were no notable differences in these findings between the three groups . In rats of group 2 and 3, there were a focal alveolar collapse and patchy emphysematous changes in the lung parenchyma (fig . 2g - i, there were morphological changes in the bronchiolar and alveolar cells after a 1-month exposure to sidestream smoke in group 2, after a 3-month exposure in group 4 and after a 6-month exposure in group 5 . In rats of group 2, there was a bronchiolar dilatation with a mild proliferation of the bronchiolar epithelial cells accompanied by a focal, alveolar emphysematous change . In rats of group 4, there was a mild proliferation of the bronchiolar epithelial cells and this was accompanied by a peribronchiolar mild inflammatory infiltrate and a focal emphysematous change . In rats of group 5, there were a mild peribronchiolar thickening due to inflammation, multiple patchy areas of alveolar collapse and an emphysematous change . The ultrastructural changes following an exposure to the smoke in the cilia of the bronchiolar epithelial cells, clara cells, and alveolar epithelial cells are summarized in tables 2 and 3 . There were fewer terminal and respiratory bronchial mucosal cells, which was accompanied by the shortening or loss of the cilia of the epithelial cells . Clara cells were reduced in number, which showed an irregular distribution and a loss of surface microvilli . These findings were more prominent in rats of groups 4 and 5 which were exposed to a long - term sidestream smoke as compared with those of groups 1 to 3 which were exposed to a short - term one (fig . On the tem examination of the lung parenchyma, there were an alveolar wall collapse with type i and type ii epithelial cell injury, cytoplasmic bleb formation, free - floating cellular debris and mild endothelial cell swelling (fig . In addition, on the sem examination, there were a dilatation of the respiratory bronchiole and alveolar duct lumina, irregular dilatation of the pores of kohn and the alveolar wall collapse and thickening . The sem findings were more prominent in rats of group 3 as compared with those of group 1 (fig ., there was an irregular dilatation of the alveolar structures and this was accompanied by the wall thickening and a focal emphysematous change . The focal expression of tnf- was found in the alveolar epithelial cells of rats of groups 2 and 3 (score, 1). Besides, there were the multiple patchy expression in group 4 (score, 3) and the diffuse expression along the alveolar epithelial cells in group 5 (score, 4) (fig . There were no expression in rats of groups 1 and 3 and the weak expression of tnf- in the bronchiolar epithelial cells of those of groups 4 and 5 . The expression of tgf-1 was found in the alveolar macrophages but was not seen in the alveolar cells of rats of group 1 . In rats of groups 2 and 3, there was a multifocal expression (score, 2) of tgf-1 in the alveolar endothelial and epithelial cells . In rats of groups 4 and 5, there was a diffuse expression of tgf-1 (score, 4) in the alveolar endothelial and epithelial cells (fig . The expression of tgf-1 is not generally seen in the bronchiolar epithelial cells and clara cells . There were positive findings for the expression of il-1 in the alveolar macrophages of groups 2, 3, 4, and 5, there was a diffuse expression of ck14 (score, 3 and 4) mainly in the bronchiolar epithelial cells and basal cells and a focal expression in the alveolar cells . However, there was only a focal expression of ki-67 (score, 1) in the bronchiolar cells of groups 3, 4, and 5 (fig . 4i) (table 4). In rats of groups 1 and 2, on the lm tunel staining, there was evidence demonstrating that a few alveolar epithelial and endothelial cells, as well as alveolar macrophages, were scattered to undergo apoptosis . In the alveolar cells of groups 3, 4, and 5, the alveolar macrophages with cytoplasmic tunel staining were observed in rats of groups 4 and 5 . But, there was no significant difference in the number of tunel - positive cells between groups 3, 4, and 5 (fig . 5a - c). On the em tunel staining, there were moderately electron dense apoptotic nuclei in the bronchiolar cells, alveolar epithelial cells, alveolar capillary endothelial cells, and in some scattered interstitial cells . On the em tunel staining, there was also cytoplasmic expression in the alveolar macrophages . Apoptotic nuclei were occasionally seen in rats of group 2 but were frequently seen in those of groups 3 and 4 (fig . This showed that the expression of proform - parp was decreased in groups 1, 2, and 3 . Besides, there was a correlation between the decreased expression of proform - parp and the volume of smoke exposure . In groups 4 and 5 where the experimental rats were exposed to a long - term sidestream smoke, the degree of the expression of proform - parp was lower as compared with the control group (fig . 6). On gross examination, there were mild patchy discoloration and congestion on the lung surface in rats of groups 1 and 2 . In group 3, the lungs showed multifocal discoloration and congestion . In rats of groups 4 and 5, however, there were a patchy pale brown discoloration and a centrilobular patchy consolidation (fig . After a 1-month exposure to sidestream smoke, rats of group 1 showed a mild bronchiolar luminal dilatation, an irregular arrangement of the bronchiolar epithelial cell cilia and a patchy peribronchiolar inflammatory infiltrates . In rats of groups 2 and 3, there were more distinct changes in the bronchiolar cells as compared with the control group . In rats of groups 1, 2, and 3, there were patchy inflammatory infiltrates in the alveolar walls and air spaces around the respiratory bronchioles . But there were no notable differences in these findings between the three groups . In rats of group 2 and 3, there were a focal alveolar collapse and patchy emphysematous changes in the lung parenchyma (fig . As shown in fig . 2g - i, there were morphological changes in the bronchiolar and alveolar cells after a 1-month exposure to sidestream smoke in group 2, after a 3-month exposure in group 4 and after a 6-month exposure in group 5 . In rats of group 2, there was a bronchiolar dilatation with a mild proliferation of the bronchiolar epithelial cells accompanied by a focal, alveolar emphysematous change . In rats of group 4, there was a mild proliferation of the bronchiolar epithelial cells and this was accompanied by a peribronchiolar mild inflammatory infiltrate and a focal emphysematous change . In rats of group 5, there were a mild peribronchiolar thickening due to inflammation, multiple patchy areas of alveolar collapse and an emphysematous change . The ultrastructural changes following an exposure to the smoke in the cilia of the bronchiolar epithelial cells, clara cells, and alveolar epithelial cells are summarized in tables 2 and 3 . There were fewer terminal and respiratory bronchial mucosal cells, which was accompanied by the shortening or loss of the cilia of the epithelial cells . Clara cells were reduced in number, which showed an irregular distribution and a loss of surface microvilli . These findings were more prominent in rats of groups 4 and 5 which were exposed to a long - term sidestream smoke as compared with those of groups 1 to 3 which were exposed to a short - term one (fig . On the tem examination of the lung parenchyma, there were an alveolar wall collapse with type i and type ii epithelial cell injury, cytoplasmic bleb formation, free - floating cellular debris and mild endothelial cell swelling (fig . In addition, on the sem examination, there were a dilatation of the respiratory bronchiole and alveolar duct lumina, irregular dilatation of the pores of kohn and the alveolar wall collapse and thickening . The sem findings were more prominent in rats of group 3 as compared with those of group 1 (fig ., there was an irregular dilatation of the alveolar structures and this was accompanied by the wall thickening and a focal emphysematous change . The focal expression of tnf- was found in the alveolar epithelial cells of rats of groups 2 and 3 (score, 1). Besides, there were the multiple patchy expression in group 4 (score, 3) and the diffuse expression along the alveolar epithelial cells in group 5 (score, 4) (fig . 4a - c). There were no expression in rats of groups 1 and 3 and the weak expression of tnf- in the bronchiolar epithelial cells of those of groups 4 and 5 . The expression of tgf-1 was found in the alveolar macrophages but was not seen in the alveolar cells of rats of group 1 . In rats of groups 2 and 3, there was a multifocal expression (score, 2) of tgf-1 in the alveolar endothelial and epithelial cells . In rats of groups 4 and 5, there was a diffuse expression of tgf-1 (score, 4) in the alveolar endothelial and epithelial cells (fig . The expression of tgf-1 is not generally seen in the bronchiolar epithelial cells and clara cells . There were positive findings for the expression of il-1 in the alveolar macrophages of groups 2, 3, 4, and 5, there was a diffuse expression of ck14 (score, 3 and 4) mainly in the bronchiolar epithelial cells and basal cells and a focal expression in the alveolar cells . However, the bronchiolar expression of ck14 did not vary among the groups (fig . There was only a focal expression of ki-67 (score, 1) in the bronchiolar cells of groups 3, 4, and 5 (fig . In rats of groups 1 and 2, on the lm tunel staining, there was evidence demonstrating that a few alveolar epithelial and endothelial cells, as well as alveolar macrophages, were scattered to undergo apoptosis . In the alveolar cells of groups 3, 4, and 5, the alveolar macrophages with cytoplasmic tunel staining were observed in rats of groups 4 and 5 . But, there was no significant difference in the number of tunel - positive cells between groups 3, 4, and 5 (fig . 5a - c). On the em tunel staining, there were moderately electron dense apoptotic nuclei in the bronchiolar cells, alveolar epithelial cells, alveolar capillary endothelial cells, and in some scattered interstitial cells . On the em tunel staining, there was also cytoplasmic expression in the alveolar macrophages . Apoptotic nuclei were occasionally seen in rats of group 2 but were frequently seen in those of groups 3 and 4 (fig . This showed that the expression of proform - parp was decreased in groups 1, 2, and 3 . Besides, there was a correlation between the decreased expression of proform - parp and the volume of smoke exposure . In groups 4 and 5 where the experimental rats were exposed to a long - term sidestream smoke, the degree of the expression of proform - parp was lower as compared with the control group (fig . 6). Copd is defined as chronic inflammation of the airways and progressive destruction of lung parenchyma.2 its pathogenesis is characterized by the abnormal enlargement of airspaces of the lung accompanied by destruction of the walls.14 cigarette smoking is the main etiologic factor in copd, of which emphysema and small airway disease are important pathologic manifestations.15 oxidative stress caused by cigarette smoking is thought to induce a chronic inflammatory response in the lungs, which destroys the alveolar walls and induces emphysema . The alveolar cell damage and loss are caused by a mechanism that involves inhibition of cell proliferation and/or induction of cell death (apoptosis).16 sidestream smoke originates directly from the cigarette, and it has the same deleterious health effects as direct smoke . This causes both a medical and environmental concern.6,7 sidestream smoke is associated with bronchial asthma, sudden infant death syndrome, chronic lung disease, lung cancer, ischemic heart disease and many other health problems.7 - 9,17 despite the documented adverse effects of sidestream smoke on the lungs, only a limited number of objective methods and studies have analyzed the airway damage due to sidestream smoke . Similarly, there are few in vivo studies on the effects of passive smoking on the lung parenchyma and small airway.12,13 to date, however, no studies have reported the cytokine and protein molecular changes are associated with alveolar and bronchiolar cell injuries following an exposure to sidestream smoke . In the current study, we observed morphologic changes in bronchiolar and alveolar cells following an exposure to sidestream smoke . In addition, these findings were correlated the degree of damage with the duration and volume of an exposure to sidestream smoke in a vivo setting . We also analyzed the expression of tnf-, tgf-1, il-1, il-1, ck14, and ki-67 in the current study . Microscopically, the more prominent morphological changes in the respiratory bronchioles and alveolar structure were present in the animals that were exposed to greater quantities of smoke and for longer duration . The animals exposed to smoke for only one month showed mainly dilatation of the respiratory bronchioles and alveolar ducts, with patchy alveolar wall collapse . In contrast, the animals exposed to smoke for three and six months showed a peribronchiolar patchy inflammatory thickening, as well as irregularity and expansion of the alveolar ducts and alveolar spaces . Such microscopic changes were similar to our previous findings with passive smoking.13 our results therefore suggest that sidestream smoke induces remodeling of the respiratory bronchioles and alveolar parenchymal structure and this leads to early phase bronchiolocentric emphysematous change . The bronchioles showed an epithelial cell injury with an irregular arrangement, which was accompanied by the shortening and loss of cilia and the abnormalities of clara cells . In the clara cells whose number was reduced, there were an irregular distribution and a lack of the surface microvilli . As we have expected, our results showed that these bronchiolar changes were more prominent in the animals exposed to the sidestream smoke for longer periods . The alveolar cell damage included alveolar wall collapse with type i and type ii epithelial cell injuries, endothelial cell swelling, and dilatation of the alveolar ducts and pores of kohn . In the animals exposed to smoke for one month, rats exposed to smoke for longer times showed irregularly patchy dilatation of the alveolar spaces with wall thickening and destruction . Damages to the bronchiolar cilia and clara cells were identified on the ultrastructural examination, which may adversely affect the defense mechanism in the lungs and then lead to development of small airway and lung parenchymal diseases.13,18 on immunohistochemistry, little or no expression of tnf- was detected in rats of groups 1, 2, and 3 . In rats of group 4, the multifocal patchy expression was increased . In rats of group 5, there was a diffuse expression along the alveolar walls . Watanabe et al.19 reported that smoke has pro - inflammatory effects and stimulates tnf- release by alveolar macrophages and possibly by pulmonary alveolar cells . The smoke - induced activation of tnf- secretion usually requires a significant amount of smoke exposure.19 this is consistent with the reports made by zoppini et al.20 who showed markedly increased levels of tnf- in response to increased or long - term cigarette smoking . As a pro - inflammatory cytokine, tnf- is believed to play a central role in the induction and maintenance of airway inflammation in copd.21 zhang et al.15 reported that alveolar cell damage mediated by tnf- may have an important role in the development of emphysema, and tnf inhibitors such as rhtnfr: fc can reduce the level of alveolar cell apoptosis in smoking rats . In the current study, there was a multifocal expression of tgf-1 (40%) in groups 2 and 3 where the experimental rats were subjected to a short - term exposure to sidestream smoke . In addition, in groups 4 and 5 where the experimental rats were subjected to a long - term exposure to sidestream smoke, there was a more diffuse expression of tgf-1 (80%) in the alveolar endothelial and epithelial cells . The expression of tgf-1 is generally seen in the bronchiolar epithelial cells and clara cells . Tgf-1 inhibits cell proliferation by inducing growth arrest in the g1 phase of cell cycle and regulating the activities of several inhibitors of cyclin - dependent kinases (cdks).22 in addition, tgf-1 induces oxidative stress that may regulate cell proliferation and the cell cycle.22 tgf-1 gene expression is increased in the alveolar walls of smokers, particularly those who develop copd.22 marwick et al.16 reported that cigarette smoke - induced oxidative stress and tgf-1 may inhibit cellular proliferation by the cdk inhibitor p21 in human alveolar epithelial type ii cells, and this may be relevant to the loss of alveolar cells in emphysema . Despite the known effects of direct tobacco smoke on the expressions of tnf- and tgf-1, no previous in vivo studies have shown that long - term sidestream smoking can induce activation of tnf- and tgf-1 in pulmonary alveolar and bronchiolar epithelial cells . Our results also showed that there was a focal expression of ck14 (40%) in the bronchiolar epithelial cells but no expression in the alveolar cells of the control rats . In the experimental rats which were not exposed to sidestream smoke, there were a multifocal expression of ck14 in the alveolar epithelial cells (15 - 20%) and a diffuse expression in the bronchiolar epithelial and basal cells (60 - 80%). Singh et al.23 reported that ck14 selectively labeled the basal cells of the normal esophageal epithelium and all the esophageal squamous carcinoma cells and adjacent carcinoma in situ . Xue et al.24 reported that ck14 was expressed in the mild to moderate dysplastic areas, and was diffusely expressed in the areas of carcinoma in situ and squamous cell carcinoma . In the current study lee et al.25 have reported not only that the ki-67 labeling index is strongly associated with heavy smoking or a long - term exposure to smoke but also that it is abnormally higher in the bronchioles of smokers despite a lack of the squamous metaplasia or dysplasia . Our results showed that the ki-67 labeling index was slightly increased in the alveolar cells in the experimental groups (20 - 30%) compared to the control group (10%). But there was no significant difference in the degree of the expression of ki-67 among the experimental groups . In rats of groups 1 and 2, on the lm tunel staining, there was evidence demonstrating that a few alveolar epithelial and endothelial cells, as well as alveolar macrophages, were scattered to undergo apoptosis . In the alveolar cells of groups 3, 4, and 5, apoptotic nuclei were seen in the bronchiolar and alveolar epithelial cells . In groups 4 and 5, the lm tunel stain also revealed cytoplasmic expression of the alveolar macrophages, suggesting an active phagocytosis of the apoptotic nuclear debris . Moreover, on the em tunel staining, there were moderately electron dense apoptotic nuclei in groups 2, 3, and 4 . This clarified the equivocal appearances of tunel - positive cells in rats of group 2 on the lm . On the em tunel staining, the early phase of apoptosis was also observed . Chronic exposure of rats to mainstream cigarette smoke induces a significant and time - dependent increase in the appearance of apoptotic cells in the bronchial, bronchiolar epithelium, and alveolar macrophages.26 it has also been reported that cigarette smoking - induced oxidative stress is associated with apoptosis of lung epithelial cells in vitro.27 oxidative damage from cigarette smoke is likely the initial insult, which is then followed by inflammation, apoptosis, and enlarged air space indicating emphysematous change.28 to date, many studies have reported that mainstream cigarette smoking induces apoptosis of bronchiolar and alveolar epithelial cells . Our results established that sidestream smoke induces apoptosis in bronchiolar and alveolar epithelial cells on the lm and em tunel staining . Cleavage of parp protein is a marker that is commonly found to detect the apoptosis . In addition, it has also been reported that levels of cleaved parp are significantly higher in smokers than in ex - smokers or non - smoking glaucomatous groups of the same gender.29 our results showed that the increased levels of parp cleavages were associated with the increased volume of an exposure to sidestream smoke in groups 1, 2, and 3 . In groups 4 and 5 where the experimental rats were subjected to a long - term sidestream smoke, the level of parp cleavage were increased compared to the control group on the western blot analysis . In conclusion, our results indicate that sidestream smoke causes bronchiolar and alveolar epithelial cell injury and this leads to alterations in bronchiolar mucosal cells as well as the early bronchiolocentric emphysematous change . Moreover, it was also shown that the severity of bronchiolar and alveolar damage was correlated with the volume and the duration of exposure to sidestream smoke.
Cancer remains one of the leading causes of death in the world . Despite advances in our understanding of molecular and cancer biology, discovery of cancer biomarkers and conventional surgical procedures, radiotherapy, and chemotherapy, the overall survival rate from cancer has not significantly improved in the past two decades (jemal et al 2008). The development of novel approaches for early detection and cancer marker - specific and personalized treatment of cancers is urgently needed to increase patient survival . Recent advances in nanoscience and nanotechnology have led to the development of nanomaterials for molecular and cellular imaging, cancer therapy, and integrated nanodevices for cancer detection and screening (jain 2005; nie et al 2007; sengupta and sasisekharan 2007; wang et al 2007). It is highly desirable that nanoparticles cannot only provide sensitive and specific imaging information in cancer patients but also selectively deliver anticancer drugs to tumor sites . Currently, there is limited knowledge of suitable biomarkers for imaging, selection of the imaging target and contrast enhance materials, and the chemistry required to assemble the bioactive imaging probe . In addition, numerous obstacles are faced in developing cancer - specific imaging agents, such as 1) delivery of the probe to the targeted tissue / tumor; 2) biocompatibility and toxicity; 3) stability of the probe and effective signal enhancement in vivo; 4) adequate imaging methods and strategies . During chemotherapy, pharmacologically active cancer drugs reach the tumor tissue with poor specificity and induce dose - limiting toxicities . Nanoparticle drug delivery may provide a more efficient, less harmful solution to overcome these problems . Magnetic resonance imaging (mri) provides superb image resolution and exquisite soft tissue contrast for revealing tissue morphology and anatomical details, while allowing for whole body imaging of animals and humans . Although mri has become one of the primary oncology imaging modalities, its sensitivity is challenged when applied to molecular and cellular imaging (bradbury and hricak 2005; ito 2006). Although gadolinium diethylenetriaminopentaacetic acid (gd - dtpa), which shows a strong t1 shortening effect, is widely accepted in clinical use, it has relatively low contrast effects and a very short retention time in vivo . In addition, the toxicity and biocompatibility of gadolinium during and after endocytosis by cells are still largely unknown (bird et al 1988; bulte and kraitchman 2004; kim et al 2007). Recently, magnetic iron oxide (io) nanoparticles have emerged as a new generation of target - specific mri t2 contrast agents . Magnetic io nanoparticles are much more efficient than gd - dtpa as relaxation promoters and their magnetic properties can be manipulated by controlling the sizes of core and coating surface (rogers and basu 2005). More importantly, io nanoparticles have a long blood retention time, biodegradability and low toxicity (harisinghani et al 2003; funovics et al 2004; jain et al 2005; bradbury and hricak 2005; montet et al 2006). In this review, we focus on recent advances in the development of targeted io nanoparticles for tumor imaging and therapy . The most commonly used are precipitation - based approaches, either by coprecipitation or reverse micelle synthesis (shen et al 1993; nitin et al 2004). Io nanoparticles without any surface coating are not stable in aqueous media and readily aggregate and precipitate . For in vivo applications, the particles often form aggregates in blood and are sequestered by macrophages (lee et al 2006). Therefore, the surface of io nanoparticles should be coated with a variety of different moieties that can eliminate or minimize their aggregation under physiological conditions . Usually, two main approaches are used for coating magnetic io nanoparticles, including in situ coatings with which the magnetic nanoparticles are coated during the synthesis process and post - synthesis coatings (berry et al 2004; jodin et al 2006; horak et al 2007). In addition, magnetic io nanoparticles can also be encapsulated in liposomes to create magnetoliposomes (de cuyper and joniau 1988). The amphiphilic polymeric surfactants such as poloxamers, poloxamines and poly(ethylene glycol) (peg) derivatives are usually used for coating the surface of io nanoparticles, since they can minimize or eliminate opsonization of io nanoparticles . Among them, peg is the most used chemical material, which confers on io nanoparticles several important properties such as high solubility and stability in aqueous solutions, biocompatibility, and prolonged blood circulation time . More importantly, the functional groups of modified peg allow for bioconjugation of various ligands or therapeutic agents to io nanoparticles (kohler et al 2004; mikhaylova et al 2004; nitin et al 2004; gupta and gupta 2005; veiseh et al 2005; lee et al 2006, 2007a; kumagai et al 2007). However, peg - coated io nanoparticles may have limited binding sites available for further ligand binding, since the number of functional groups on the surface of each io nanoparticle is limited (gupta and gupta 2005). Laconte and colleagues (2007) reported that the molecular weight of the peg portion of the micelle coating is related to the overall io nanoparticle diameter, while coating thickness can significantly affect their relaxivity . Our group recently observed that the molecular weight of peg could significantly affect the distribution of peg - coated io nanoparticles in vivo . Thus, it is critical to select the ratio and molecular weight of peg when designing io nanoparticle probes for targeted imaging and therapy in vivo . In addition to peg coating, other materials such as antibiofouling poly(tmsma - r - pegma) (lee et al 2006), hyaluronic acid (ha) layers (kumar et al 2007) and carboxyl - functionalized poly(amidoamine) (pamam) dendrimers of generation 3 (g3) (shi et al 2007) have also been used to coat the surface of io nanoparticles for either increasing circulation time in the blood or delivering peptides at high efficiency . Recently, we have developed a new class of superparamagnetic iron particles that have uniform sizes ranging from 530 nm and can be further functionalized through surface coating with amphiphilic triblock polymers, which provide functional groups for conjugating tumor - targeting biomolecules such as peptides or antibodies . The triblock polymer developed in our group has surface reactivity for introducing various or multiple functional groups including the carboxylate group that can be used to cross - link probe molecules for biomarker - targeted specific binding (gao et al 2004). Despite significant efforts in developing mri contrast agents based on io nanoparticle formulations, several obstacles remain to be overcome . The major challenge is to develop a surface coating material that cannot only stabilize the nanoparticle but also provide active functional groups for controllable bioconjugation of probe ligands . Traditional ligands (eg, dextran) used for the stabilization of magnetic nanocrystals often have weak ligand - particle interactions and can be easily detached from the surface of the nanocrystals, leading to the aggregation of nanoparticles and eventually their precipitation under physiological conditions or simply during storage times . When further derivatization is needed, such a weak interaction between ligand and particle may not sustain the required reaction conditions . The magnetism of io nanoparticles and its effect on mr imaging can depend significantly on their morphology, crystal structure, size and uniformity . Currently, most studies using io nanoparticles to develop molecular imaging probes utilize commercially available formulations such as ferumoxtran, which offers limited control over particle size and morphology, critical to the mass magnetization value and potential effect on imaging contrast . When specifically considering their use in imaging applications in vivo, io nanoparticles with small size (5150 nm) and high mass magnetization value are desired, in addition to the proposed target specificity, for which easy conjugation with biomolecules is required . Different sizes of io nanoparticles including spio (superparamagnetic io, 60150 nm), uspio (ultrasmall spio, 1050 nm), and mino (monocrystalline io) can lead to different magnetic properties and function differently in various applications (wang et al 2001; thorek et al 2006). Although the feasibility of using io nanoparticles for cancer detection and drug delivery has been demonstrated (corot et al 2006; thorek et al 2006), a major obstacle limiting their clinical application is that nontumor - targeted nanoparticles are unable to reach sufficient concentrations in the tumor site to either produce a strong signal for tumor imaging or to carry optimal amounts of therapeutic agents into tumor cells . One approach to overcome this problem is to develop tumor - targeted io nanoparticles that are highly sensitive imaging probes and/or are capable of conjugating large amounts of therapeutic agents (rhyner et al 2006) (figure 1). Development of human cancer is a multistage process involving various genetic alterations and cellular abnormalities that provide advantages for growth and progression of tumors . Differences in the expression of cellular receptors between normal and tumor cells represent a great opportunity for targeting imaging probes to those cellular surface molecules . For engineering tumor targeted - io nanoparticles, different ligands such as antibodies, peptides and small molecules targeting the related receptors that are highly expressed in tumor cells a few studies using targeted io nanoparticles for tumor imaging have been evaluated in vitro and in animal experiments (table 1). Antibody - based targeted io nanoparticles for in vitro or in vivo imaging have been studied in several laboratories (cerdan et al 1989; remsen et al 1996; tiefenauer et al 1996; artemov et al 2003; funovics et al 2004; huh et al 2005; toma et al 2005; serda et al 2007) and were found to maintain both the properties of the antibody and the magnetic particles . Among these studies, conjugation of the magnetism - engineered iron oxide (meio) nanoparticles with herceptin, a well - known antibody against the her2/neu receptor which is overexpressed in breast cancer cells, showed in vivo cancer targeting and imaging of her2/neu with high sensitivity which enables the mr detection of tumors as small as 50 mg (lee et al 2007b). Although the efficacy of monoclonal antibody - targeted io nanoparticles has been demonstrated, the size of antibodies used in these studies is very large and is not ideal for efficient conjugation to the surface of io nanoparticles . The large size of the intact antibody also limits the ability of the io nanoparticle to permeate through the vasculature into areas with tumor cells . In addition, the interaction of antibody with fc receptors on normal tissues can alter the specificity of tumor - targeted nanoparticles . To solve those problems, peptides or single chain antibodies with small molecular weight can be used as target moieties for engineering targeted io nanoparticles . In this review, peptides that target related receptors on tumor cells surface can be internalized via receptor - mediated endocytosis, which will increase the uptake of conjugated io nanoparticles and provide persistent mri contrast enhancement, therefore, such types of peptides are ideal ligands for constructing targeted io nanoparticles for tumor imaging . Chlorotoxin (cltx) is a 36-amino acid peptide that can specifically bind to matrix metalloproteinase-2 (mmp-2) on the surface of cells . Mmp-2 is overexpressed in gliomas and other related cancers and degrades the extracellular matrix during cancer invasion (soroceanu et al 1998; deshane et al 2003; veiseh et al 2007). Sun and colleagues (2008) conjugated cltx to io nanoparticles with covalently bound bifunctional peg polymer and showed that internalization of the cltx - conjugated io nanoparticles by 9l glioma cells was 10-fold higher than that of the nontargeted nanoparticles after 2hrs incubation . The r2(1/t2) relaxivity was 5.20mms and 0.22mms for the tumor cells after incubation with the cltx - targeted io nanoparticles and nontargeted io nanoparticles, respectively . In vivo mri showed that the tumor contrast enhancement in the superimposed r2 change was significantly higher in the mouse injected with cltx - targeted io nanoparticles than in the mouse receiving the nontargeted nanoparticles (sun et al 2008). Underglycosylated mucin-1 antigen (umuc-1) is an early tumor marker that is overexpressed on almost all human epithelial cell adenocarcinomas . Some important features render umuc-1 a promising target for tumor imaging, 1) expressed in over 50% of all human cancers and remained homogeneously upregulated during the life growth of the tumor, 2) underglycosylated in tumor tissues but heavily glycosylated in normal tissues, make it possible to design probes that discriminate between normal and adenocarcinoma cells, 3) ubiquitously expressed on the cell surface, making it an accessible target for binding and imaging . Moore and colleagues (2004) synthesized eppt1 peptide which specifically recognizes umuc-1 and conjugated it to the dextran coat of crosslinked superparamagnetic iron oxide nanoparticles (clio). As shown in figure 2, 24 hours after injection of targeted clio nanoparticles, a significant t2 signal reduction was observed in some regions of umuc-1-positive ls174 t tumors, while no significant change was seen in umuc-1-negative u87 tumors . In addition, these results were further demonstrated by near - infrared fluorescence (nirf) imaging . In this study, nirf cy5.5 dye - labeled clio nanoparticles were used both as mr- and nirf - imaging contrast agent . This unique imaging probe produced a high - resolution signal on mr images and real - time nirf imaging data, providing comprehensive information on tumor localization, environment, and status . This agent may have the potential to be applied for early tumor detection (moore et al 2004). To date, tumor metastasis is still one of the main causes of death for breast cancer patients . Approximately 37% of breast cancer patients have tumor metastases in the bone and lymph nodes at the time of diagnosis, and the 5-year survival rates for these patients is only 27% (jemal et al 2008). Development of targeted io nanoparticles that could be used for the detection of early metastasis may improve the 5-year survival rates of breast cancer patients . About 52% of human breast cancers express binding sites for receptors for luteinizing hormone - releasing hormone (lhrh) (chatzistamou et al 2000). Lhrh - spio nanoparticles specifically accumulated in primary tumor cells and metastatic cells through receptor - mediated endocytosis, and the concentration of targeted spio nanoparticles was 12-fold higher than that of spio nanoparticles in vitro . In vivo data showed that the expression of lhrh - spio nanoparticles was 7.5-fold higher in tumors and 11-fold higher in lung metastatic cells than that of nontargeted nanoparticles . After conjugating lhrh to spio nanoparticles, in addition to receptor targeting, lhrh may render the nanoparticles neutral, further increasing their circulation time and decreasing their recognition by the res in vivo . This study demonstrated that lhrh - conjugated spio nanoparticles could be used as an mri contrast agent to detect metastatic breast cancer cells in vivo with high sensitivity (leuschner et al 2006). One of the interesting results was that lhrh - spio nanoparticles were found by tem study to accumulate in the cytosol and the nucleus in the breast cancer cells; this may be an advantage for delivering drug in the future, since it seems this unique targeted io nanoparticle could escape from the endosome . Angiogenesis plays a critical role in the development of tumors; the v3 integrin is a marker of angiogenesis and its expression correlates with tumor grade . Therefore, v3 integrin is an ideal target for in vivo tumor imaging since the target is present on the surface of the vessels and can directly be accessed from the blood . Zhang and colleagues (2007) used 3-aminopropyltrimethoxysilane (aptms) with functional amino groups as a coating material for modification of io nanoparticles . Aptms can form a very thin monolayer on the surface and can be used to covalently attach related ligands . The arg - gly - asp (rgd) peptide which binds to the v3 integrin receptor was conjugated to aptms - coated uspio nanoparticles . Following systemic administration of the rgd - uspio nanoparticles in nude mice bearing tumors with different levels of v3 integrin - positive vessels, results showed that rgd - uspio nanoparticles targeted to the tumor vessels and the change in t2 relaxation was related to the degree of expression of v3 integrin detected by 1.5-t mr scanner (zhang et al 2007). To increase the sensitivity of in vivo tumor imaging of nanoparticles, it is necessary to deliver large amounts of the nanoparticles not only into the tumor cells but also to a tumor mass . Most of the currently used target molecules, such as her-2/neu, v3 integrin, pmsa and muc-1, are expressed in subpopulations of tumor tissues or specific tumor types . Recently, simberg and colleagues (2007) synthesized the tumor - homing peptide creka (cys - arg - glu - lys - ala), which can form a distinct meshwork in the tumor stroma specifically . A creka - conjugated nanoparticle accumulated in both tumor vessels and stroma, resulting in intravascular clotting in tumor blood vessels which attracted more nanoparticles into the tumor, amplifying the targeting . There are several advantages of such targeted - spio nanoparticles, 1) high specificity for tumor homing, 2) enhanced mr imaging in tumor, 3) physical blockade of tumor vessels by local embolism . The clotting caused by creka - spio nanoparticles in tumor vessels may improve tumor detection by optical imaging techniques . Another potential application of the nanoparticle is for constructing drug delivery nanoparticles which can deliver drugs in tumor vessels and slowly release them (simberg et al 2007). The low molecular weight vitamin folic acid (fa), whose receptor is overexpressed on the surface of many human tumor cells, has been studied as a targeting agent . The advantages of using fa as a targeting ligand for tumor imaging include: 1) relatively higher binding affinity for its receptor (= 10 m), 2) low cost, easy conjugation with both therapeutic and imaging agents, 3) compatibility in both organic and aqueous solvents, 4) lack of immunogenicity (low et al 2008). Sun and colleagues (2006) used heterobifunctional peg 600 to coat the surface of io nanoparticles and subsequently attached fa to the nanoparticles through an amide linkage at the free terminus of peg . Their results showed that folate receptor - positive human cervical carcinoma hela cells took up about 12-fold more fa - io nanoparticles than nontargeted io nanoparticles (sun et al 2006). One recent study showed by mri that spio - peg - fa could target human nasopharyngeal epidermoid carcinoma (kb) cells both in vitro and in vivo (chen et al 2007). In vivo tumor imaging with mri pinkernelle and colleagues (2005) reported that single io nanoparticle - labeled human colon carcinoma cells can be detected using mri techniques in vitro, the lowest concentration of iron needed is about 45 g/10 cells (pinkernelle et al 2005). For imaging by targeted io nanoparticles, the sensitivity depends on the target concentrations in tumor cells, for example, some targets are often quite weakly expressed (10 folate receptors in brain glioma cells) (saul et al 2003) while others are very highly expressed (3 10 epidermal growth factor receptors in a431 human squamous carcinoma cells) (jinno et al 1996). In addition, the targeting of io nanoparticles to cells depends on a number of factors including extracellular io nanoparticle concentration, particle size, surface coating, and incubation time . There remain many problems to be addressed in the study of io nanoparticles for tumor imaging, including 1) the optimal number of targeted ligands on io nanoparticles must be investigated and determined in each application, since excessive amounts of targeting ligands on the io nanoparticles may not necessarily increase binding of the io nanoparticles to specific cells, but can increase the size of the nanoparticles and further affect the r2 characteristics . The ideal ratio of ligands and io nanoparticles may be dependent on the number of receptors on targeted cells, the binding affinity of ligands to receptors and the molecular weight and size of ligands, 2) the fate of targeted io nanoparticles after cell internalization is still controversial, with most reports showing that nanoparticles enter into endosomes and are then degraded in lysosomes, while other studies have shown that they can escape from the endosome and locate in the cytoplasm or around the nucleus . It seems that conjugated ligands and surface coating affect the distribution of particles within the cells, 3) the range of the concentration of io nanoparticles used for animal studies is large, from 1 mg to 250 mg of fe / kg, making it difficult to compare results from different research groups, 4) the quantification of io nanoparticle levels in vivo is still a challenge . In this case, mri can be combined with other specific labeling technologies such as radio- and nir - labeling, which may offer the possibility of multimodal imaging for measuring the biodistribution of targeted io nanoparticles . Although recent advances have demonstrated the feasibility of using targeted io nanoparticles for noninvasive imaging in animal models, one of the main problems is that io nanoparticles are usually taken up by macrophages in the liver (kpffer cells), spleen and bone marrow, thus affecting their specificity and sensitivity and rendering them less than ideal for this application . Previous studies have reported the uptake of dextran - coated monocrystalline iron oxide nanoparticles (mion) ranging from 0.011 to 0.118 pg of iron per cell (1 hr of incubation) by various tumor cells, and a maximum load of 0.97 pg in mouse macrophages (moore et al 1997). A biodistribution study of mnmeio - herceptin conjugates labeled with radioactive in by -counter analyses showed that in addition to being distributed in the tumor (3.4% injected dose (id)/g), nanoparticles were also found in the liver (12.8% id / g), spleen (8.7% id / g) and muscle (1.0% id / g) (lee et al 2007b). There are many different pathways that can regulate the internalization of io nanoparticles by macrophage cells because of the diversity in particle size, tendency to aggregate and surface coating . Several studies have sought to minimize the non - specific uptake of io nanoparticles by macrophages (zhang et al 2002; rogers and basu 2005; leuschner et al 2006; lee et al 2006). Rogers and basu (2005) reported that pretreatment of macrophages with the mg - coa reductase inhibitor lovastatin (1m) could significantly reduce spio uptake by activated macrophages to 61% of untreated cells . Lovastatin downregulates class a types i and ii macrophage scavenger receptors, and may bind to other related receptors in macrophages and reduce receptor recycling, thus partially abolishing io internalization . The uptake rates of io nanoparticles by liver and spleen can be decreased by limiting phagocytosis, leading to longer blood half - lives which provide favorable conditions for nanoparticles to reach their targets . Pretreatment with lovastatin before the injection of targeted io nanoparticles may provide a new method to decrease the nonspecific uptake of targeted io nanoparticles by the liver or spleen but increase their concentration in the tumor site (rogers and basu 2005). Another method to decrease nonspecific uptake of io nanoparticles is to eliminate plasma opsonins by injecting decoy particles . Simberg and colleagues (2007) found that this treatment caused 5-fold prolongation in particle half - life and that ni - liposome pretreatment greatly increased tumor homing of the nanoparticles, which primarily localized in tumor blood vessels . However, toxicity limits the further application of this agent . In general, positively charged nontargeted io nanoparticles bind to cells through electrostatic interaction with the negatively charged cell membranes and are then internalized by cells, while endocytosis of negatively surface - charged io nanoparticles may occur through both protein - mediated phagocytosis and diffusion . A change in io nanoparticle surface charge can be induced by covalently coupling different chemical materials such as amino, peg and carboxyl groups . It has been reported that albumin - io nanoparticles with a neutral charge showed a reduced phagocytic uptake in comparison with negatively or positively charged particles (roser et al 1998). Fang and colleagues (2006) found that the charge of nanoparticles strongly affects both the blood circulation time and the bioavailability of particles within the body . The surface charge of io particles should ideally be maintained at neutral or close to neutral for imaging and drug delivery (shi et al 2007). In addition, the size of io nanoparticles will potentially affect their distribution in vivo . Intravenously injected nanoparticles with diameters greater than 200 nm are usually taken up by the liver and spleen, and are eventually removed by the cells of the res, resulting in decreased blood circulation times (remsen et al 1996). Smaller particles with diameters less than 5 nm are rapidly removed through the kidney (gupta and gupta 2005), therefore, io nanoparticles ranging from 5 to 150 nm may offer the most effective distribution in certain tissues, especially in tumors . To develop tumor targeted - io nanoparticles that have both high sensitivity and specificity remains challenging . Despite many recent advances in the development of targeted io nanoparticles for tumor imaging, we are still limited in our ability to detect tumors at their early stages of development, to monitor their invasion and metastasis and to assess their responses to therapy . Firstly, specific antibodies can be conjugated to the io nanoparticles to selectively bind to related receptors and inhibit tumor growth (huh et al 2005). Secondly, targeted io nanoparticles can be used for hyperthermia for tumor therapy (denardo et al 2005; sonvico et al 2005; jordan et al 2006). Thirdly, drugs can be loaded onto the io nanoparticles for targeted therapy . In this review, increasing evidence shows that the selective delivery of therapeutic agents into a tumor mass may minimize toxicity to normal tissues and improve bioavailability of cytotoxic agents (shenoy et al 2005; gang et al 2007; bae et al 2007; lee et al 2007c). Drugs can be linked to the carrier coating, deposited in the surface layer, or trapped within the io nanoparticles themselves (chen et al 2007). They can be released by diffusion, vehicle rupture, dissolution or endocystosis of the formulation (lanza et al 2004; atri 2006). The imaging signals produced by io nanoparticles detected by mri combined with the amount of specific drug contained per particle can be used to estimate the tissue drug levels . In addition, radio- or organic dye - labeled drugs can be loaded into the io nanoparticles for more accurate quantification of drug distribution in vivo . Unfortunately, only a few studies have used targeted io nanoparticles as drug delivery carriers, especially for in vivo applications . Methotrexate (mtx) is an analogue of fa, which can exhibit both a targeting role as fa and a therapeutic effect in cancer cells that overexpress folate receptor on their surface . Kohler and colleagues (2005) conjugated mtx to io nanoparticles through amidation between the carboxylic acid end groups on mtx and the amine groups on the particle surface . Their results showed that cells expressing the human folate receptor internalized a higher level of mtx - io nanoparticles than negative control cells . This mtx - conjugated io nanoparticle has several advantages, 1) high drug loading efficiency, the average number of mtx molecules per io nanoparticle with a 10 nm diameter was about 418.9, 2) selective internalization of the targeted io nanoparticles in tumor cells overexpressing the folate receptor, 3) mtx released only from the io nanoparticles within lysosomes inside the targeted cells at low ph by cleavage of the amide, 4) drug delivery to the tumor sites may be monitored in vivo by mri in real - time (kohler et al 2005). Polymeric micelles are self - assembled nanoparticles from amphiphilic block copolymers, which have unique characteristics such as high water - solubility, high drug loading capacity and low toxicity . Nasongkla and colleagues (2006) developed novel multifunctional polymeric micelles by loading spio nanoparticles inside the micelles at 6.7 w / w% . The chemotherapeutic agent doxorubicin (doxo) was also loaded at 2.7 w / w% in the micelles and could be released through a ph - dependent mechanism . One of the advantages of the multifunctional nanoparticles is that the encapsulation of doxo and spio nanoparticles inside the hydrophobic micelle cores can avoid potential exposure of hydrophobic spio surfaces and adsorption of blood proteins, thus decreasing nonspecific uptake by res . In addition, the crgd ligand that can target v3 integrins on tumor endothelial cells was attached to the micelle surface via a covalent thiol - maleimide linkage . Once internalized by targeted cells, high concentrations of doxo were released in cell nuclei . This integrated nanomedicine platform may be an ideal contrast agent for targeted tumor therapy and noninvasive imaging in vivo (nasongkla et al 2006). Yang and colleagues (2007) developed a new multifunctional hybrid nanosystem by combining magnetic nano - crystals, anticancer drugs and biodegradable amphiphilic block copolymers . In this study, there were about 41.7 wt% (mnfe2o4) and 40.9wt% (fe3o4) magnetic nanoparticles in the multifunctional magneto - polymeric nanohybrids (mmpns), and the amount of doxo in the her - mmpns and entrapment efficiency were 3.3 wt% and 71.4%, respectively . In addition, anti - her antibody was conjugated to the mmpns by utilizing the carboxyl group on the surface of the particles . As shown in figure 3, the injected her - mmpns were delivered in a target - specific manner to overexpressed her2/neu receptors on nih3t6.7 cells in vivo and were taken up by a receptor - mediated endocytosis process . The her - conjugated mmpns showed significant synergistic effects on inhibition of tumor growth by doxo . The antibody - conjugated nanoparticles also demonstrated ultrasensitive targeted detection by mri in both in vitro and in vivo models (yang et al 2007). However, there are still many obstacles for successfully using tumor - targeted io nanoparticles as drug carriers in vivo, 1) functional group modification of the drugs during conjugation may change their chemical properties, 2) lower drug loading efficiency, 3) quick release of conjugated or encapsulated drugs from io nanoparticles in the blood before entering into tumor mass, 4) drugs usually released in the endosome or lysosome but not in the cytoplasm within targeting cells, 5) embedding part of the ligand binding site in io nanoparticles may decrease the targeting ability, 6) loss in magnetization of the core magnetic material during multistep chemical reaction (jain et al 2005). Io nanoparticles combined with other nanoparticles such as biodegradable and biocompatible polymeric micelles may overcome some of the above obstacles . Proper surface coating of io nanoparticles and methods for the more effective loading of anticancer drugs will facilitate drug release profiles . Although recent advances have demonstrated the feasibility of using targeted magnetic io nanoparticles for tumor imaging and therapy, methods and strategies to produce tumor - targeted imaging probes with a high specificity and sensitivity are still greatly needed . There are many obstacles encountered to the in vivo application of targeted magnetic io nanoparticles for tumor imaging, including heterogeneous expression levels of the targeted receptor in human tumor cells, various physiological barriers preventing the nanoparticle from reaching the targeted cells, and a lack of information on the intratumoral distribution and imaging capability of targeted nanoparticles within tumor sites that are relevant to the locations of most human primary and metastatic tumors . For tumor - targeted therapy, methods to increase the loading capacity of anticancer drugs in the nanoparticles and control their release at target cells remain quite challenging . Since io particles have been used in clinical settings for many years, there is a high potential that these targeted probes will be applicable in clinical applications in the future.
Cd1 female mice (3035 g bw) were purchased from harlan (italy) and kept under standard laboratory conditions (22 0.5 c, 5060% relative humidity, 12 h dark light alternation with 1214 air changes / h) with water and food (4rf25 glp top certificate diet purchased from mucedola, milan, after 1 week of acclimatization, females were bred with cd sires of proven fertility . A sperm - positive vaginal plug served to define the gestational day (gd) 0 . Pregnant mice were treated daily p.o . By gavage with 0 (vehicle only = olive oil; sigma - aldrich, milan, italy), 0.5 or 50 mg / kg bw pro die of bpa (cas 80 - 05 - 7, purity 99%, sigma - aldrich), named bpa05 and bpa50 respectively, dissolved in olive oil, from gd1 to gd11, a period covering implantation through early placentation phase . On gd 12 the dams were sacrificed by asphyxiation with co2, followed by cervical dislocation . Four placentae per litter / group were flash frozen in liquid nitrogen then stored at 80 c . Placenta samples were homogenized and total rna was extracted by using the rnaeasy mini kit (qiagen), containing -mercaptoethanol diluted 1:100 . Rna quantity was assessed with nanodrop (nanodrop, wilmington, de, usa), purity was assessed by uv absorbance ratio measurement at 260 nm and 280 nm whereas integrity was evaluated by 1% agarose gel electrophoresis . Cdna and crna synthesis, amplification and labeling were performed using the quick amp labeling kit, two colors (agilent, santa clara, ca, usa) with spike - in internal controls (agilent) following manufacturer's protocol . Labeled samples and controls were co - hybridized following a dye swap experimental protocol (control and treatment samples alternatively labeled with cy5 and cy3) on agilent 4 44k whole mouse genome microarray g4122f at 65 c for 17 h, with a 10 rpm rotation in an agilent hybridization oven . After washing with gene expression wash buffers (agilent), slides were scanned by the agilent g2505b microarray scanner system, extracting data through the agilent feature extraction 9.5 software . Normalization and differential expression analysis were performed using the r bioconductor package limma,, . 1a) and background subtracted, then a global loess was performed to normalize each array . A quantile between - array normalization was performed to obtain the same distribution of probe signal intensities across arrays (fig . Arrays quality was also evaluated and obtained array weights were applied to the statistical model, a simple linear model fit and moderated t - statistic, thus obtaining two lists of significant differentially expressed genes in the bpa - treated placentas at the two doses in comparison to controls . A total of 1220 genes were found differently expressed with a p - value <0.01; in particular 582 were modulated by bpa05 and 701 by bpa50; only 77 genes were shared by the two groups (fig . 2). Hierarchical clustering with euclidean distance and average linkage was performed to discriminate between the two gene expression profiles . Functional analysis of enriched go terms and kegg pathways was performed to determine the biological significance of the differentially expressed genes . Transcription factor binding analysis was performed using five different tools to minimize false positives to identify potential gene expression regulators . Real - time pcr was performed on critical differentially expressed genes to validate microarray data . Cd1 female mice (3035 g bw) were purchased from harlan (italy) and kept under standard laboratory conditions (22 0.5 c, 5060% relative humidity, 12 h dark light alternation with 1214 air changes / h) with water and food (4rf25 glp top certificate diet purchased from mucedola, milan, after 1 week of acclimatization, females were bred with cd sires of proven fertility . A sperm - positive vaginal plug served to define the gestational day (gd) 0 . Pregnant mice were treated daily p.o . By gavage with 0 (vehicle only = olive oil; sigma - aldrich, milan, italy), 0.5 or 50 mg / kg bw pro die of bpa (cas 80 - 05 - 7, purity 99%, sigma - aldrich), named bpa05 and bpa50 respectively, dissolved in olive oil, from gd1 to gd11, a period covering implantation through early placentation phase . On gd 12 the dams were sacrificed by asphyxiation with co2, followed by cervical dislocation . Four placentae per litter / group were flash frozen in liquid nitrogen then stored at 80 c . Placenta samples were homogenized and total rna was extracted by using the rnaeasy mini kit (qiagen), containing -mercaptoethanol diluted 1:100 . Rna quantity was assessed with nanodrop (nanodrop, wilmington, de, usa), purity was assessed by uv absorbance ratio measurement at 260 nm and 280 nm whereas integrity was evaluated by 1% agarose gel electrophoresis . Cdna and crna synthesis, amplification and labeling were performed using the quick amp labeling kit, two colors (agilent, santa clara, ca, usa) with spike - in internal controls (agilent) following manufacturer's protocol . Labeled samples and controls were co - hybridized following a dye swap experimental protocol (control and treatment samples alternatively labeled with cy5 and cy3) on agilent 4 44k whole mouse genome microarray g4122f at 65 c for 17 h, with a 10 rpm rotation in an agilent hybridization oven . After washing with gene expression wash buffers (agilent), slides were scanned by the agilent g2505b microarray scanner system, extracting data through the agilent feature extraction 9.5 software . Normalization and differential expression analysis were performed using the r bioconductor package limma,, . 1a) and background subtracted, then a global loess was performed to normalize each array . A quantile between - array normalization was performed to obtain the same distribution of probe signal intensities across arrays (fig . Arrays quality was also evaluated and obtained array weights were applied to the statistical model, a simple linear model fit and moderated t - statistic, thus obtaining two lists of significant differentially expressed genes in the bpa - treated placentas at the two doses in comparison to controls . A total of 1220 genes were found differently expressed with a p - value <0.01; in particular 582 were modulated by bpa05 and 701 by bpa50; only 77 genes were shared by the two groups (fig . 2). Hierarchical clustering with euclidean distance and average linkage was performed to discriminate between the two gene expression profiles . Functional analysis of enriched go terms and kegg pathways was performed to determine the biological significance of the differentially expressed genes . Transcription factor binding analysis was performed using five different tools to minimize false positives to identify potential gene expression regulators . Real - time pcr was performed on critical differentially expressed genes to validate microarray data . We describe here a data set relative to gene expression profiles of mice placenta samples upon exposure to two different doses of bpa, namely 0.5 or 50 mg / kg bw day, during early gestation (gd1gd11). The two doses altered two quite distinct patterns of genes which were associated with different effects on placental morphology and development, as supported by histological, histomorphometrical and immunohistochemical analyses as reported in detail in.
Warfarin is the most commonly used oral anticoagulant both for prophylaxis as well as treatment for arterial and venous thromboembolic conditions . It has a narrow therapeutic index and is metabolized by hepatic cytochrome p450 2c9 enzyme (cyp2c9). Various polymorphisms exist in the gene that code for cyp2c9, of which * 1 is the wild form expressing normal activity . Amongst the variants, * 2 and * 3 are more common than the rest and exhibit lesser enzymatic activity . The anticoagulant effect of warfarin is measured by prothrombin time - international normalized ratio (pt - inr). Warfarin exerts its anticoagulant effect by reducing the regeneration of active vitamin k through inhibition of vitamin k epoxide reductase, encoded by vitamin k epoxide reductase complex subunit 1 gene (vkorc1). Increased risk of deranged inr or bleeding has been reported in patients harboring mutant form of either cyp2c9 or vkorc1 . This case report describes a patient on low - dose warfarin, who succumbed to a subdural hematoma and was found to have polymorphic cyp2c9 (* 1/3). A 49-year - old male patient, who was a known case of superior sagittal sinus thrombosis for the past 8 years on tablet warfarin 2.5 mg every night, was brought to the hospital unconscious . The patient was non - compliant in not following up with his physician nor did he check his pt - inr levels regularly for the past 1 year . The patient's relative, however, maintained that the patient was regular in taking the prescribed dose of warfarin (2.5 mg) every night . On physical examination, he was found to be unconscious (glasgow coma scale score of 3), pulse was feeble and the blood pressure was not recordable . A plain computed tomography (ct) brain revealed 24.2 mm hyperdense cresentic subdural hematoma in left fronto - temporo - parieto - occipital region with subfalcine extension and midline shift [figure 1]. His pt - inr was found to be 9 [normal (in the absence of anticoagulation therapy) is 1 and it has to be maintained between 2 and 3 for an appropriate therapeutic effect for warfarin]. Fresh frozen plasma was initiated at a dose of 15 ml / kg / day . Blood (5 ml) was collected from the patient and genotyping was done for both cyp2c9 and vkorc1 . Cyp2c9 was found to be polymorphic for 3 (* 1/3) and vkorc1 was found to be wild - type (normal). Plain ct brain revealing 24.2 mm hyperdense cresentic subdural hematoma (red arrow) in left fronto - temporo - parieto - occipital region pharmacogenetics is the study of genetic influence on inter - individual variation in the response of a drug . Pharmacogenetics has been shown to be of value in detecting an optimal response as well as in preventing adverse reactions following drugs such as warfarin, clopidogrel, and phenytoin . Warfarin is metabolized by cyp2c9 and over 30 polymorphic alleles have been identified in the gene coding for cyp2c9 . The wild form of the gene is 1 and the most common polymorphic forms include * 2 and * 3 . Allelic frequency of cyp2c9 * 2 and * 3 in various populations including indians were found to be in the range of 0 - 20% . A recent systematic review concluded that in comparison to the patients with cyp2c9 * 1/1 genotype, the cyp2c9 1/2, cyp2c9 1/3, cyp2c9 2/2, cyp2c9 2/3, and cyp2c9 3/3 patients required warfarin doses that were 19.6, 33.7, 36.0, 56.7, and 78.1% lower, respectively . Similarly, in the vkorc1 gene, two alleles have been identified in vkorc1 namely g and a. patients with gg (wild type) are resistant requiring a higher dose of the drug whereas aa are sensitive requiring a lesser dose and ga requires intermediate . A randomized clinical trial has also shown that pharmacogenetic - based dosing of warfarin was associated in maintaining the pt - inr levels within the acceptable range for a longer time than by the standard dosing . United states food and drug administration (fda) has recently modified the warfarin labeling by suggesting cyp2c9 and vkorc1 genotyping before initiating the drug to ensure warfarin safety . Our patient had a fatal subdural hematoma despite low - dose (2.5 mg hs) of warfarin . He had massively deranged inr of 9, was brought in with glasgow coma scale of 3 . The 1/3 variant cyp2c9 explained this serious adverse event with low - dose warfarin . The 3 variant is less than 5% as active as the wild type whereas * 2 retains around 12% of the activity . A recent indian review of oral anticoagulant use revealed lack of proper laboratory facilities, with irregular pt - inr monitoring in 25% patients and deranged inr values in a high proportion of patients . Pharmacogenetic testing needs to be done only once and hence can be considered cost - effective . Studies have shown that along with age, gender, body weight, cyp2c9 and vkorc1 polymorphisms account for almost 64% of the variability in the dose of warfarin required for an individual . Hence, by doing these genetic testing a priori to the treatment initiation, there is a high possibility that the patients may receive an appropriate dose than just by routine practice . Even, several international algorithms for predicting dose of warfarin have been developed with these predicting factors of which, gage's and wadelius algorithms have been shown to be the most accurate . Recently, an algorithm for indian patients has also been developed, which was found to be more accurate, sensitive and significantly reduced the risk of overestimation of dose of warfarin . This algorithm can be used for predicting the appropriate dose of warfarin in our population with the genotype details of cyp2c9 and vkorc1 . To conclude, this case highlights the necessity of adopting the practice of routine genetic testing for cyp2c9 and vkorc1 while initiating warfarin therapy.
Spinal epidural abscess (sea) is a rare severe infection and accounts for 2.53.0 cases per 10,000 admissions in general hospitals . Several sea risk factors, such as injection - drug use, diabetes mellitus, and several illnesses have been identified, however, no report has described sea associated with abortion . We report a case of post - abortion sea caused by the bacteroides fragilis group, which was managed successfully with antibiotics and surgical drainage . A 30-year - old woman was transferred to our hospital for fever and posterior cervical pain . Two weeks before admission, dilation and curettage (d and c) under intravenous anesthesia was performed for incomplete abortion . After d and c, her obstetrician prescribed ampicillin (750 mg / day), however, she took them only one day . Three days later, she developed posterior cervical pain, which worsened and caused difficulty in flexing and extending the neck . Ten days after the operation, she was admitted to the emergency department of another hospital . Physical examination revealed body temperature of 39.3c; blood pressure, 147/91 mmhg; pulse, 101 beats / min; and respiratory rate, 18 breaths / min . She experienced severe pain and stiffness in the neck . Neither abdominal nor pelvic signs were seen . Her leukocytes were elevated to 8100/l and the c - reactive protein (crp) was positive . Physical examination revealed mild weakness in the right upper limb [medical research council (mrc) grade 4]; deep tendon reflexes were slightly decreased . The liver - function test results and electrolyte levels were normal; however, leukocytes had elevated to 8400/l, and the crp level had elevated to 9.87 mg / dl . She was seronegative for hepatitis b virus surface antigen, and hepatitis c virus and human immunodeficiency virus (hiv) antibodies . Analysis showed elevated cell count (266/l) and total protein concentration (1,311 mg / dl). Chest radiography revealed normal results, and a transthoracic echocardiography showed no vegetation on the valves . Magnetic resonance imaging (mri) of the cervical spine showed infectious spondylodiscitis at the c5/c6 level and anterior epidural abscesses at c4-th3 with spinal cord compression [figure 1]. Sagittal t2-weighted image shows an anterior epidural mass associated with c5 spondylodiscitis at the c4-th3 level intravenous injections of ampicillin (12 g / day) and ceftriaxone (4 g / day), and hyperbaric oxygen therapy were administered . Seven days after admission, weakness in the right upper and lower limbs increased (mrc grade 2) and the numbness extended to the right lower limb . Mri showed enlarged epidural abscesses and increased spinal cord compression; therefore, urgent orthopedic surgery was performed . After the anterior discectomy of c5 and c6, pus was drained . Since pus culture revealed b. fragilis group, oral metronidazole (1 g / day) the weakness in her limb muscles were improved (mrc grade 4), and the numbness gradually resolved after the operation . In most causes of sea, at least one predisposing factor such as intravenous drug use, diabetes mellitus, invasive spinal procedures, penetrating spinal trauma, and immunosuppressive therapy is present; however, d and c for abortion as one of the risk factors for sea has not reported previously . Bacteremia occurs in approximately 5% of the patients who undergo d and c, and progresses to intrauterinal abscess in most cases . However, some forms of extrauterinal abscess after d and c, such as anaerobic breast abscess, septic arthritis and thigh abscess caused by -haemolytic streptococci, psoas abscess caused by staphylococcus aureus and bacterial sacroliliitis and gluteal abscess caused by streptococcus agalactiae have been rarely reported . These manifestations were not associated with any underlying diseases, and most of them eventually required surgical drainage . Although the role of antimicrobial prophylaxis in postprocedural pelvic inflammatory disease prevention has been extensively discussed, there is no evidence supporting the use of antibiotics for subacute bacterial endocarditis prophylaxis . A large variety of causative agents for sea have been indentified; however, two - thirds of the causes of pyogenic bacteremia were caused by staphylococcus aureus, and only 2% of the cases were caused by anaerobic bacteria . The b. fragilis group, which includes organisms such as b. fragilis, b. ovatus, b. thetaiotaomicron, b. uniformis, and b. vulgatus, contains anerobic bacteria . These bacteria can produce a wide variety of infections with a tendency to form abscesses . Female genital tract infections caused by these bacteria include bacterial vaginosis, endometritis, and postsurgical obstetric and gynecologic infections . On the other hand, except for extragenital procedures involving d and c, endodonic procedure and vertebroplasy might be one of the risk factors of anerobic spondylodiscitis, which were resulted from hematogenous spreading from a distant primary site of infection . In our case, d and c for incomplete abortion might have caused transient bacteremia resulted in spondylodiscitis and hematogenous sea . Micro - organism in vagina might reach cervical discs through hematogenous spreading from pelvic venous plexus (batson's plexus) and cause spondylodiscitis and sea in early days . The patient did not have any risk factors other than the d and c procedure . Early imaging could play a crucial role in the treatment of sea, and a careful history taking and physical examination could allow detection of the infectious source . Although the use of prophylactic antibiotics in intrauterinal procedures and in cases of incomplete abortion is controversial at present, further clinical trials to assess the necessity of antibiotic prophylaxis after d and c for abortion is necessary should be considered.
All case - patients were 58- to 73-year - old married men, farmers or retirees, and long - term residents of shanghai (fengxian, baoshan, songjiang, and pudong districts, respectively). Case - patient 1 had a history of coronary heart disease and hepatic schistosomiasis; case - patient 2 had no history of chronic disease; case - patient 3 had a history of hypertension and gout; and case - patient 4 had a history of hypertension and repetitive cough for> 10 years during spring and autumn . * na, not applicable; shphcc, shanghai public health clinical center; ct, computed tomography scan; ggo, ground - glass opacity; bid, 2 times a day; ecmo, extracorporeal membrane oxygenation . Case - patients 24 had no clear history of close contact with poultry; however, each had visited various farmers markets that sold live poultry . None of the patients raised pigeons or live in or near a heavily pigeon - infested area . Before being transferred to shphcc on april 6, 2013 (patients 1 and 2) and april 7, 2013 (patients 3 and 4), the 4 patients had been treated in local hospitals; infection with influenza a(h7n9) virus had been confirmed by real - time reverse transcription pcr of nasopharyngeal swab samples before transfer . The case - patients had cough and fever and had been expectorating sputum for 67 days before admittance to shphcc . In addition, all had experienced cold - like symptoms and fatigue before influenza - like symptoms developed . Case - patient 4 had cough and fever for 18 and 10 days, respectively, before being transferred to shphcc; his case was the most serious of the 4, and the disease progressed rapidly after he was transferred to shphcc . Total leukocyte counts for case - patients 14 were within or slightly below reference values: 5.50, 5.95, 3.50, and 4.60 10/l, respectively (reference value 4.0010.00 10/l). The proportions of neutrophils were normal or slightly high: 79.6%, 62.6%, 72.4%, and 68.0%, respectively (reference value 50.0%70.0%). Radiograph findings mainly included ground - glass opacity and consolidation (figures 1, 2; technical appendix figures 1, 2). Computed tomography (ct) scans and radiograph findings chest computed tomography (ct) scan and radiograph images of patient (case - patient 1) in a study of 4 persons with early cases of influenza a(h7n9) virus infection, shanghai, china . Images were taken 1, 5, 7, and 11 days after illness onset . A, b) ct scan images on day 1, showing bilateral pleural effusion but no obvious lesions . C) ct scan image on day 5, showing extensive ground - glass opacity and consolidation . D, e) x - ray images on days 7 and 11, respectively, showing reduced light transmittance on both sides of the lung . Chest computed tomography scan images of patient (case - patient 2) in a study of 4 persons with early cases of influenza a(h7n9) virus infection, shanghai, china . A) image taken 6 days after illness onset shows ground - glass opacity in the left lower and right upper lobes . B) image taken 16 days after illness onset shows absorption of ground - glass opacity . To ensure proper treatment / management of the patients, an emergency team was established; the team followed the procedures shown in technical appendix figure 3 . Case - patient 1 began treatment 6 days after the onset of hypoxia, when large areas of lung inflammation were seen on radiographs . Case - patient 2 was treated 4 days after the onset of fever, when ct scan results revealed inflammation in the left upper lung lobe . Case - patient 3 began treatment 4 days after the onset of cough, sputum, and shortness of breath and after ct scan results revealed inflammation in the left lower lung lobe . Case - patient 4 began treatment 16 days after onset of high fever, dyspnea on exertion, and hypoxemia . Additional details for each patient are included below, and results of viral testing done at admission and 5 days later are shown in technical appendix table 1 . Disease characteristics for infections caused by influenza virus subtypes h1n1, h5n1, and h7n9 are shown in technical appendix table 2 . Case - patient 1 was receiving noninvasive ventilator - assisted breathing when he arrived at shphcc . His oxygen saturation remained at 95%, and he was given continuous intravenous dopamine infusion . He had acute respiratory failure, coronary heart disease (stage 2 heart failure), and renal function insufficiency at admission . On april 11, 11 days after the onset of the symptoms and 2 hours after endotracheal intubation and mechanical ventilation began, he died from respiratory failure . Case - patient 2 arrived at shphcc with a nasal cannula inserted to maintain oxygen saturation at 95% . His general condition improved steadily after commencing antiviral drug treatment, and he was discharged 18 days after illness onset . Case - patient 3 arrived at shphcc with a nasal cannula inserted to maintain oxygen saturation at 95% . He was treated with oseltamivir, antimicrobial drugs, and steroids to suppress lung inflammation . Case - patient 4 arrived at shphcc in critical condition: oxygen saturation was 88%, and he had shortness of breath (3035 breaths / min). One day after admission, his condition deteriorated; multiple organ dysfunctions in lung and kidney developed . Two days after admission, invasive mechanical ventilation and then extracorporeal membrane oxygenation were implemented . Clinical manifestations of disease in the 4 case - patients were consistent with those reported for other persons infected with influenza a(h7n9) virus (3). Case - patients 1 and 4 had a more severe disease course than case - patients 2 and 3 . All patients sought medical care for unresolved fever, cough, expectoration of sputum, and shortness of breath . The severe cases progressed rapidly: body temperature was mostly sustained> 39c, and breathing was difficult and sometimes accompanied by hemoptysis . A rapid progression of acute respiratory distress syndrome occurred in case - patients 1 and 4, along with mediastinal emphysema, shock, disturbed consciousness, and acute kidney injury . The currently available drug treatment for influenza a(h7n9) virus infection is neuraminidase inhibitors (e.g., oseltamivir). Case - patient 4 only began neuraminidase inhibitors 16 days after the onset of symptoms, by which time he was in a severe condition . Case - patient 1 was treated with oseltamivir 6 days after the onset of symptoms and, despite treatment, died 6 days after admission to shphcc . Earlier, higher doses combined with continuous treatment might improve patient outcomes (5). On the basis of clinical judgment, we now use 150 mg of oseltamivir twice daily for severe cases, monitoring for toxicity . The benefits of oseltamivir treatment of influenza a(h7n9) virus infections are debatable; for example, case - patients 2 and 3 remained positive for the virus after 911 days of oseltamivir treatment (technical appendix table 1). Thus, it is essential to determine whether the virus has developed resistance to oseltamivir . Ineffectiveness of the oral oseltamivir formulations may also have contributed to treatment failure, especially for case - patients 1 and 4: the drug may not have been well absorbed, especially by patients in severe condition . If available in the future, systemic delivery of oseltamivir may be superior . Of the 4 patients reported here, however, it is not clear that this contact contributed to the rapid progression of disease in case - patient 1, especially given the fact that case - patient 4, who is still in critical condition, also had rapid progression of disease . The other patients did not raise birds at home, but they visited live poultry markets . Prompt and early communication of the clinical features of persons infected with avian influenza a(h7n9) virus is crucial to the development of effective treatment strategies (6). Research to understand the transmission pattern and effective control of this virus is urgently needed (79). Virus detection in 4 influenza a(h7n9) virus infected persons in shanghai, china; variables for infection with influenza a subtypes h1n1, h5n1, and h7n9; computer tomography scan and radiograph findings for case - patients 3 and 4; and outline of procedures followed by emergency team managing / treating case - patients 14.
Ridge augmentation using soft tissue solely to correct the esthetic problem of an anterior vertical ridge defect was reported by meltzer 1979.1 later in 1980 and 1982, langer and calagna2 demonstrated ridge augmentation using connective tissue . Gingival recession and root exposure along with soft tissue defect in adjacent edentulous space often pose a therapeutic problem to the clinician . To obtain root coverage in areas with localized or generalized soft tissue recessions, miller's class i and ii, particularly if the recessions create aesthetic or root sensitivity problems or shallow root caries lesions, and to augment alveolar ridge, soft tissue allografts such as alloderm can be successfully used . This material can also be used in miller's class i and ii gingival recessions . Acellular dermal matrix graft (adm) was used in this case report for ridge augmentation and for root coverage . Alloderm is a donated human soft tissue that is processed to remove its dermal cells, leaving a regenerative collagen matrix behind . It provides components needed to allow the body to restore the missing tissue, with fast healing and excellent cosmetic results . Alloderm is ideal for the patients either lack adequate harvestable tissue or are not willing to undergo a palatal surgery . Adm is widely used in ridge augmentation and is also used as a substitute for free gingival graft, root coverage and cell occlusive barrier for bone grafting around dental implants, septal perforation repair, and guided tissue regeneration (gtr) matrix . This allograft is a freeze dried cell free dermal matrix comprised of structurally integrated basement membrane complex and extra cellular matrix, in which collagen bundles and elastic fibers are main components . It is available in two different ranges of thicknesses 0.9 - 1.6 mm (alloderm), and 0.5 - 0.9 mm (alloderm gbr). It has two distinct surfaces; the basement membrane surface (bm) is smooth and does not absorb blood, whereas the connective tissue side (ct) is rough and absorbs blood . A healthy 30 year old male reported to the department of periodontics, rajah muthiah dental college and hospital, tamilnadu, india with a chief complaint of missing teeth along with unpleasant look in relation to lower anteriors . Dental history revealed that he had extracted his teeth due to trauma before 10 years of age . Presurgical examination showed a class iii ridge defect, 3 mm in height (seibert 1983)1 with a ridge thickness of 3 mm (figure 1a). Grade ii gingival recession had the following characteristics: recession width of 3 mm in lower left lateral incisors, recession depth of 5 mm in lower left lateral incisor and 3 mm width and depth in right lower lateral incisor . Phase i therapy was performed of complete scaling and root planning (figure 1b). The case was taken up for ridge augmentation and root coverage using adm graft (alloderm- regenerative tissue matrix, biohorizon, lifecell). The acellular dermal matrix graft was placed against the root surfaces with its connective tissue side facing the overlying gingival flap . It was sutured using a sling suture technique with a synthetic 5 - 0 bioabsorbable suture . After placement of the acellular dermal matrix graft, the flap was coronally positioned and sutured using a sling suture technique . The releasing incisions were closed with interrupted sutures and periodontal dressing was given using coe pak (figures 2 g and 2h). Patient was instructed to discontinue tooth brushing for 30 days around surgical site, but rinse with 0.12% chlorhexidine solution twice a day . Systemic antibiotics were prescribed along with analgesics for 5 days postsurgically (amoxicillin 500 mg, plus aceclofenac and paracetamol combination). Again he was recalled after 2 weeks (figure 3b), 3 weeks, 1 month (figure 3c) and 3 month (figure 3d). After 3 months, the patient was referred to department of prosthodontics for fixed prosthesis . A gain in thickness of ridge for 6 mm (3 mm gain compared to the baseline), and a gain in height for 5 mm (2 mm gain compared to the baseline) were obtained using acellular dermal matrix graft . There were gains in both buccolingual and apicocoronal directions of the ridge (gain in both height and width). Recession depth was reduced to 3 mm in left lower lateral incisor and 2 mm in right lower lateral incisor when compared to baseline using acellular dermal matrix graft . Ridge augmentation using soft tissue solely to correct the esthetic problem of an anterior vertical ridge defect was published by meltzer in1979.1 later, many clinicians contributed further by modifying the procedures . Ridge augmentation using connective tissue was described by langer and calagna in 1980 and 19821 . Griffin et al.3, studied the use of acellular dermal matrix to correct soft and hard tissue defects in implants . Correction of ridge deformity caused by a root fracture, submerging of an existing implant, correction of recession defects around adjacent teeth, and ridge preservation for implant placement were presented ., various studies have been done to obtain predictable root coverage in patients with gingival recession defects, subpedicle acellular dermal matrix graft and autogenous connective tissue graft in the treatment of gingival recession . Luczyszyn et al.4 used acellular dermal matrix and hydroxyapatite in prevention of ridge deformities after tooth extraction . Mehlbauer and greenwell5 studied the complete root coverage at multiple sites using an acellular dermal matrix allograft . Adm was used as an alternative source to donor tissue site in this type of surgery . Shin et al.6 carried out a comparative study of root coverage using acellular dermal matrix with and without enamel matrix derivative and concluded that the use of emd in conjunction with adm results in a statistically significant effect on keratinized tissue increase, but had no significant effects on probing attachment level or percentage of root surface coverage . Recently, adm was used as a substitute for free gingival graft to increase the width of keratinized tissue around the teeth for treatment of alveolar ridge defects, and for root coverage to overcome the need of second surgical site to harvest graft.7 woodyard et al.8 studied the effects of the use of adm on gingival thickness and root coverage amount compared to coronally positioned flap (cpf) alone and concluded that cpf plus adm allograft significantly increased the gingival thickness when compared with cpf alone . Cortes et al.9 studied the use of coronally positioned flap with or without acellular dermal matrix graft in the treatment of class i gingival recessions in a randomized controlled clinical study . They aimed to clinically evaluate the outcome of the treatment of class i gingival recession by coronally positioned flap procedure with or without adm and concluded that both techniques can provide significant root coverage in class i gingival recessions; however, a greater keratinized tissue thickness might be expected with adm . There was a gain in ridge in both buccolingual and apicocoronal directions, both in height and width . The use of acellular dermal matrix prevents the need of a second surgical site for donor material . . However, further studies involving more defects and longer follow up periods are required to ascertain the efficacy of acellular dermal matrix in the management of ridge augmentation and root coverage.
It represents less than 1% of all melanomas and accounts for less than 4% of anal malignancies.1 arm is documented as the third most common location of melanoma, after cutaneous and ocular . Patients with arm often present with local symptoms such as rectal bleeding (55%), rectal masses (34%), and anal pain (13%).2 arm has been shown to result in worse prognoses than cutaneous melanoma, with a median survival of 24 months and a 5-year survival rate of 10%.3 in the rectum, melanocytes are located at the anal transitional and squamous zones . Most arms arise from the dentate line, and 65% are located within the anal canal or at the anal verge.4 arm spreads along submucosal planes, and is often too widespread for complete resection at the time of diagnosis and almost all patients die because of metastases.5 although there are various treatment strategies for arm, surgical treatment remains the main therapeutic modality due to its relative rarity, with abdominoperineal resection (apr) and wide local excision (wle) being performed in most cases . The role of adjuvant chemotherapy and immunotherapy in the treatment of arm is yet to be established . Several studies have reported cases of long - term survival with treatment consisting of only local surgical excision,6,7 and there have been other cases removed by endoscopic mucosal resection (emr) alone in japan.8 here, we present a case of arm treated with emr with adjuvant interferon therapy . A 77-year - old man was admitted to our emergency department with anal bleeding . He had a 4-month history of anal bleeding and recent aggravation . His medical history included cerebral infarction with right sided weakness and hypertension . On admission, he was hemodynamically stable and his hemoglobin level was 11.4 g / dl . Urgent colonoscopy demonstrated a dark - colored, polypoid mass with a diameter of 1.5 cm and oozing hemorrhage adjacent to the anal verge . Analysis of the resected specimen, measuring 1.51.2 cm in size, revealed a black - pigmented solid tumor with a short stalk (fig . Microscopic findings revealed diffuse infiltration of round or spindle - shaped tumor cells, and the contained melanin and tumor cells were immunohistochemically positive for human melanin black-45 (hmb-45) (fig . After polypectomy, the resection margin contained positive tumor cells and it was difficult to confirm the depth of tumor invasion because of the presence of a short stalk . Neither lymphatic nor vascular invasion were noted . To evaluate systemic metastases, a fluorine-18-fluorodeoxyglucose (fdg) the pet / ct scan demonstrated increased fdg uptake in the distal rectum (fig . Though this finding might have indicated a remnant lesion of arm, there was also the possibility of false positivity associated with initial polypectomy . However, the pet / ct scan showed no positive regional lymph nodes or systemic metastases (fig . We recommended surgical treatment, such as apr or wle, to the patient and his family because of the poor prognosis of malignant melanoma and the positive resection margin . However, they refused surgery due to the patient's old age and general weakness secondary to cerebral infarction . Therefore, we designed and performed additional emr for the positive resection margin (fig . Tumor cells were not observed in the resected specimen . Since there was a positive resection margin after the first polypectomy, and difficulty in evaluating the depth of tumor invasion, we decided on and recommended adjuvant therapy . The patient was treated with interferon 2b injection, 2010 iu / m, five times per week for four weeks, then 1010 iu / m, three times per week for 24 weeks subcutaneously . During the 5-year follow - up period, the patient was asymptomatic and abdominal ct scans and sigmoidoscopic examinations at 3 - 6-month intervals revealed no evidence of recurrence (fig . 3c and 4b). Melanoma of the anorectal region is a relatively rare neoplasm with a poor prognosis . The overall 5-year survival rates in patients with arm range from 4 - 31% even if radical surgery and chemotherapy are performed, while median survival varies from 16 - 28 months.3,9,10 treatment strategies have varied, from the radical apr to the conservative wle, but the main controversy has been whether apr is needed or wle is adequate for complete treatment . Apr, although associated with a high rate of morbidity, has long been thought to be the best means of management for arm . In 1997, however, there was a paradigm shift after two major studies found minimal improvements in survival . Retrospective studies were performed, which looked at 135 patients with anal melanoma.2,11 patients in both studies had uniformly poor survival rates and the apr group had a longer survival rate, but this was not statistically significant.11 in a study from thibault et al.,2 37 patients had curative resection but no significant survival difference was found between wle and apr when comparing disease stage and 5-year survival.12 before 1997, 70% of all patients underwent apr, and after 1997, 80% would undergo wle.13 furthermore, because the completion of lymphadenectomy in apr may not affect survival,13 wle with or without adjuvant therapy seems to offer good locoregional control without reducing the survival rate, and may be a therapeutic modality for patients with small, superficial arms.14 apr should be offered for patients with locally advanced disease or as a salvage therapy following recurrence.14,15 there is no current adjuvant therapy dictated as the standard of care in arm, particularly in cases involving metastatic disease . However, it is clear that chemotherapy alone without surgery provides no benefit.12 radiation therapy has not been shown to provide any benefit, except occasionally for palliative care in cases of unresectable tumors.16 some patients with metastatic melanomas have been shown to respond to therapy with interferon and interleukin-2, suggesting that metastatic melanoma is susceptible to immune assault.16 emr is not a " wide " but a " local excision " method . In japan, emr for malignant melanoma in the gastrointestinal tract has been performed in only five cases, and there are no reported cases from other countries.8 relatively long - term survival was achieved in all cases (> 6 years). Among these cases, however, two were melanomas in the esophagus, another two required additional surgical treatment and chemotherapy, and the other involving a 85-year - old male with a 2218 mm - sized tumor and submucosal invasion, needed repeated emrs because local recurrence had occurred four times previously.8 in cases of arm in which a shallow depth of the invasion and a small tumor size, long - term survival is expected even if less invasive surgery such as emr is performed.8 for the assessment of invasion depth in arm, the preferred modality is mri . Anatomical and functional diagnostic imaging, such as ct, mri, and pet / ct scans are available to assess lymph node involvement and to exclude or confirm the presence of distant metastases, as well as loco - regional recurrences.17 until now, however, pet / ct scans have been reported rarely in cases of arm for the detection of distant metastasis or recurrent disease.17 in the present case, emr with adjuvant interferon therapy lead to 5-year disease free survival . Even though emr in this case was not the ideal treatment modality and it the depth of tumor invasion was unclear, there was no local recurrence, distant metastases, or additional intervention needed after the first treatment for 5 years . Worse histological prognoses have been found to be associated with tumor thickness, tumor necrosis, and perineural invasion.2,11 in our case, there was no necrosis and perineural invasion, and though it was difficult to assess the depth of invasion exactly, we suspected superficial invasion confined to the submucosal layer because emr removes only mucosa and superficial portions of the submucosa . The resection margin of the tumor in the first polypectomy was positive, but negative in the second emr . However, because the resection margin was positive and the depth of tumor invasion was not clear in the initial polypectomy, we needed adjuvant interferon therapy after polypectomy and emr . In conclusion, arm has a poor prognosis and needs surgical treatment . Nevertheless, if there is a shallow depth of invasion and the general condition of the patient is not good enough to justify surgery, less invasive surgical methods such as emr with or without adjuvant therapy may be performed.
Medical residents receive most of their training within hospital programs . In brazil, after completing a medical undergraduate education, students enroll in residency programs that involve three (basic) to seven years of training . Resident physicians undertake supervised training in areas of the hospital that include the ambulatory care facilities, surgical centers, laboratories, radiology departments, and in - patient wards . Previous efforts to study effective learning environments resulted in the development of a questionnaire for undergraduates . The 50-item dundee ready education environment measure (dreem) used a standard methodology grounded in education theory together with a delphi panel of nearly 100 professional health educators from around the world . It was translated into a variety of languages and has been used worldwide.1,2 the dreem was translated and adapted for portuguese and has been used with brazilian undergraduate medical students as well as residents . This is typically done in brazil to introduce students to the concept of patient interaction at an early stage in their training.3 the version of dreem used in this study also featured a psychometric performance evaluation component . This questionnaire was given to medical residents from different programs at six institutions in three brazilian cities.4 a similar methodology to dreem was used to develop the pheem postgraduate hospital educational environment measure questionnare.5 this elegant 40-question survey assesses metrics of the level of autonomy, quality of teaching and social support during the hospital - based training period undertaken by all new physicians . Pheem can identify specific strengths and weaknesses within a certain educational environment . Because medical residency programs in brazil have rarely been comprehensively evaluated to date, we aimed to assess pheem as a possible tool for performing future evaluations.5 the objective of this investigation was to validate the pheem questionnaire translated into portuguese and to study its reliability . We also aimed to compare pheem results among residents from the internal medicine, surgery and anesthesiology departments at a university teaching hospital in brazil . The method used to translate the pheem questionnaire was based on the modified brislin back - translation technique.6 briefly, two brazilian teachers of english independently translated the original pheem into portuguese . A second translation was independently undertaken to generate a second portuguese draft copy from the en1 version, and the resulting document was again back - translated by a native english speaker (en2). A final portuguese version was generated by comparing the two back - translated english versions (en1 and en2) with the original and the two portuguese drafts . Our study was approved by the appropriate institutional review board and all participants were required to sign an informed consent document . Each questionnaire featured an anonymity barcode which was not linked to the identity of the participant . The 40-question portuguese pheem survey was given to a randomized sample of medical residents from the hospital das clnicas, university of so paulo medical school . Our test group included physicians finishing their first year (n=174) or at the end of their second year of residency (n=89). In addition, we gave the survey to a number of medical residents who had entered a local competition in two main areas: internal medicine (n=459) and surgery (n=298). Respondents were asked to indicate their agreement with each statement using a five - level likert - type scale, which went from strongly disagree 0 to strongly agree 4 . Higher levels of agreement were correlated with more beneficial educational environments . In order to determine the needed sample size, a pilot study was conducted with the dreem questionnaire to identify the impacts of differences in means . It suggested that a sample of 27 questionnaires across three groups would yield a statistical power of 80% and a significance level of 5%.4,7 cronbach s alpha coefficients were used to assess reliability and internal consistency . The hotelling s t - squared test was used as a multivariate analysis tool to evaluate the null hypothesis that all of the items on the scale would have the same mean . Anova was used to compare pheem - derived data from residents in the surgery, anesthesiology and internal medicine departments . A subsample of medical residents (n=50) from the clinics hospital at the university of so paulo medical school answered the pheem twice in a period of 30 days . The kappa coefficient was used as a measure of agreement between these two samples . In general, excellent agreement was indicated by> 0.74; good agreement, = 0.60 to 0.73; fair agreement, = 0.40 to 0.59 and poor agreement, <0.40.8 the spearman correlation test was used to assess equivalence between the two samples . These medical residents completed an additional survey to assess their experience in completing the pheem questionnaire . This additional survey is known as the whoqolbref.9 we evaluated correlations across data from the two questionnaires . Principal component factor analysis was applied across the three sections in the original pheem questionnaire . This analysis aimed to explain a considerable amount of the variance that was present in the 40-item survey . Our study was approved by the appropriate institutional review board and all participants were required to sign an informed consent document . Each questionnaire featured an anonymity barcode which was not linked to the identity of the participant . The 40-question portuguese pheem survey was given to a randomized sample of medical residents from the hospital das clnicas, university of so paulo medical school . Our test group included physicians finishing their first year (n=174) or at the end of their second year of residency (n=89). In addition, we gave the survey to a number of medical residents who had entered a local competition in two main areas: internal medicine (n=459) and surgery (n=298). Respondents were asked to indicate their agreement with each statement using a five - level likert - type scale, which went from strongly disagree 0 to higher levels of agreement were correlated with more beneficial educational environments . In order to determine the needed sample size, a pilot study was conducted with the dreem questionnaire to identify the impacts of differences in means . It suggested that a sample of 27 questionnaires across three groups would yield a statistical power of 80% and a significance level of 5%.4,7 cronbach s alpha coefficients were used to assess reliability and internal consistency . The hotelling s t - squared test was used as a multivariate analysis tool to evaluate the null hypothesis that all of the items on the scale would have the same mean . Anova was used to compare pheem - derived data from residents in the surgery, anesthesiology and internal medicine departments . A subsample of medical residents (n=50) from the clinics hospital at the university of so paulo medical school answered the pheem twice in a period of 30 days . The kappa coefficient was used as a measure of agreement between these two samples . In general, excellent agreement was indicated by> 0.74; good agreement, = 0.60 to 0.73; fair agreement, = 0.40 to 0.59 and poor agreement, <0.40.8 the spearman correlation test was used to assess equivalence between the two samples . These medical residents completed an additional survey to assess their experience in completing the pheem questionnaire . This additional survey is known as the whoqolbref.9 we evaluated correlations across data from the two questionnaires . Principal component factor analysis was applied across the three sections in the original pheem questionnaire . This analysis aimed to explain a considerable amount of the variance that was present in the 40-item survey . Principal component factor analysis was applied across the three sections in the original pheem questionnaire . This analysis aimed to explain a considerable amount of the variance that was present in the 40-item survey . The pheem portuguese questionnaire was answered by 30.7% of the internal medicine residents (n=141) and by 20.5% of the surgery residents (n=61) who had entered a local competition . In addition, the survey was competed by 19.5% (n=34) of the first year residents at clinics hospital and by 17.9% (n=16) of the second year residents . Residents from governor celso ramos hospital achieved a higher response rate of 69.2% (n=54). The pheem survey in portuguese (n=306) showed a cronbach s alpha of 0.899 . The alpha value did not vary by more than 5% across groups and genders . As expected, the null hypothesis was deemed invalid according to hotelling s t - squared test . Contract of employment; item seven, racism; item thirteen, sexual discrimination; and item 25, no - blame culture, as essentially uncorrelated with the total score . The weighted kappa coefficient was used as a measure of the agreement in responses over an interval of 30 days . The majority of questions were in excellent agreement, while items one, contract of employment; two, clear expectations; eight, inappropriate tasks; ten, good communication skills; and 26, catering facilities, had coefficients that suggested good agreement . The spearman correlation index r was greater than 0.8 in all cases except for question sixteen, the lowest recorded score was 1.2 (for item 26: there are adequate catering facilities when i am on call) while the highest was 3.6 (the opposite of item 7: i can sense the existence of racism in my position). Question numbers 1, 14, 17 and 32 within the autonomy section were found to have relatively low ratings . Social support showed low ratings for question numbers 20, 25, 26, and 38 (table 1). The questionnaire presented four items that featured negative statements (items 7, 8, 11 and 13); the scores for these items were inverted in order to calculate total score and percentile results from the questionnaire . The autonomy section total score was 33.9 8.6 (60.5% 15.3%), the teaching quality score was 35.0 10.0 (58.3% 16.6%) and results from the three sections of the pheem survey were compared among residents from internal medicine, surgery and anesthesiology programs by anova followed by the holm - sidak test . The level of autonomy was generally perceived to be higher by residents in internal medicine than by those in surgery (p=0.000001). However, there was no difference in perception between internal medicine and anesthesiology residents (p=0.0573). Perceived levels of teaching quality were higher for residents in anesthesiology as compared with internal medicine (p=0.017) or surgery (p=0.00048). Internal medicine residents also rated quality of teaching significantly higher than surgery residents (p=0.0308). There were no differences in the perception of social support among any of the groups (table 2). Exploratory factor analysis followed by varimax rotation identified nine factors with eigenvalues higher than 1 (table 3). The first factor had an eigenvalue of 12.0, which accounted for 30.0% of the variance . The next eight factors had eigenvalues lower than 2.3; these factors accounted for 58.9% of the variance in the data . The first factor included questions 10, 28, 23, 6, 2, and 22 from the teaching quality section of the pheem questionnaire, and items 26 and 35 from the social support section . The whoqol s domains were considered adequate, reaching 60% for the environmental and greater than 70% for the psychological, social and physical domains . This study evaluated the applicability of the pheem survey translated into portuguese with a sample of resident physicians in brazil . Our pheem results suggest that the teaching quality section was the most important part of the questionnaire . Five items (1, 7, 13 and 25) did not correlate well with the total score and, from a statistical point of view, they were found to not influence the overall results . Despite the observed lack of influence, we suggest that these statements be retained to allow for comparisons between programs or institutions . Indeed, items 7 and 13 deal with racial and gender discrimination, respectively, and this sample of residents indicated that these issues were not problematic during their training programs . On the other hand, items 1 (information about hours of work) and 25 (no - blame culture) reached a mean of just below 2.0, which suggests that these issues constituted an educational obstacle . The kappa coefficient suggests excellent inter - sample agreement . The good agreement observed for five items may be attributed to the fact that they queried different areas of the residency workload . More specifically, during the 30-day test interval, many residents switched between programs and this may have impacted their answers to these questions.10 pheem can be used to identify strengths and weaknesses of a medical residency program . When the published guide suggested for this questionnaire is applied to interpret mean scores, all residents had a more positive perception (33.9/56) with regard to the level of autonomy; teaching quality seemed to be moving in the right direction (35.0/60) and there were more pros than cons (26.6/44) in terms of the provision of social support.5 such results should be taken into account by curriculum planners as they consider improvements to educational programs . Nevertheless, we note very positive responses in terms of the statements that confirmed minimal discrimination (items 7 and 13). Relevant items showed that residents were given appropriate levels of responsibility (item 5) and opportunities (item 30). Items with a mean of between 2 and 3 identify elements of the educational program that could be enhanced.5 it is interesting, albeit disappointing, to note that 28 out of 40 questions for this sample fit in this classification . Specifically, the net perception of teaching quality was within this range or, in some cases, below 2 (question 3 educational time is safeguarded and significant attention should be directed to those questions with means below 2 as they may indicate serious problem areas . In addition to the two items that pertain to perception of teaching quality, those in the most urgent need of improvement were related to social support . Certain specific responses pointed to a lack of personal and sometimes professional support (question 25 no - blame culture, 26 catering facilities and 38 available counseling for junior doctors who fail). Similar shortcomings were seen with regard to the level of autonomy (question 1 i receive adequate information about my work hours; 14 i am always clear on which clinical protocols are acceptable and 17 my working hours are in accordance with the limits specified by the national board). Residency training is often correlated with stress, depression and burnout due mainly to excessive work hours, sleep deprivation, challenging patients and an aggressive and challenging work environment.1115 the pheem did not ask questions that directly addressed these aspects, but respondents suggested that their social life during residency could be uninspiring, and that their level of social interaction was unsatisfactory . Other researchers have evaluated how medical residents experience personal growth and have highlighted the need for an environment that fosters supportive relationships and encourages reflection.16 on the basis of our study, it would be interesting to further investigate the positive associations of teaching achievement and social interactions . The pheem teaching quality section identified two problem areas: safeguarded educational time and feedback from instructors . Certainly, these two elements are important to obtaining a meaningful learning experience during medical residency . Indeed, in order to acquire learning skills, an apprentice needs safeguarded time away from the institutional schedule . In the same way, feedback from instructors is critical to the learning process.17, 18 the item related to work hours being consistent with limits specified by the national board requires discussion, at least in the case of brazil s system of medical residency . It has been observed that violations of residency program requirements correlate with very low perceptions of quality of life and a poor educational environment.19 . However, this study did not identify a low quality of life, considering the results of whoqolbref, but did identify a weak educational environment . It has been suggested that reliance on such data is not appropriate when studying associations of working hours with quality of life and patient care.20 educational as well as management theories support the understanding that the development and maintenance of a learning - oriented culture should be a high priority for residency programs and their institutions.21 it has been suggested that a lack of supervision can contribute to medical errors, but despite this fact, best practices in medical communication and supervision skills have received little evaluation.22 it would also be interesting to consider how network analysis may facilitate the mapping of ties between residents peers and supervisors and the nature and rules of their relationship in order to best understand how to create and maintain an appropriate academic environment.23 finally, the factor analysis of this sample supports boor et al . Who suggest use of pheem as a one - dimensional scale instead of the three original sub - scales.5,24 the main factor that explains 30% of the variance includes seven items that are related to the perception of teaching quality and one that relates to social support and instructor mentoring skills . Even more interesting, these eight items are strongly linked to the role of the instructor . Our factor analysis is consistent with other published data in which four of seven items composed a one dimensional scale that also treated the importance of the instructor during residency.25 considering various other studies that have also used this questionnaire, we would reemphasize that pheem should be used in its original format with all 40 basic questions in order to allow for comparisons between programs and to permit evaluations of the three sections during different phases of a physician s medical residency . The results from this study support the use of pheem as a reliable instrument to identify issues related to the clinical educational environment . Our data suggest that the results from the section on teaching quality are very important.
Ovarian hyperstimulation syndrome is an iatrogenic condition resulting from an excessive ovarian response to superovulation medication (1), potentially resulting in death in its extreme manifestation (2). It was shown that administration of human chorionic gonadotrophin (hcg) either exogenously, to induce the final maturation of the follicle prior to oocyte retrieval, or endogenously, from an establishing pregnancy can lead to this situation (3). In order to manage this mortality condition in art, many preventive strategies have been evaluated but none of the described methods has consistently demonstrated efficacy in preventing the syndrome except for the cancellation of the treatment cycle before hcg administration (4). Since the duration of severe ohss is greatest in those patients who conceive, elective cryopreservation of all embryos has been proposed (5). The use of different cryopreservation techniques and protocols revealed that cryopreservation of all produced embryos in ohss cases has been adopted with variable and contradictory results (6, 7). Therefore, more research is needed to determine whether using elective cryopreservation of embryos can reduce the rate of severe ohss in in vitro insemination (ivf)/intracytoplasmic sperm injection (icsi) cycles . In this study, we presented the efficacy of elective cryopreservation of all embryos in patients at risk of ohss in comparison to the fresh embryo transfer cycles in patients with similar potential risk of developing the syndrome . All couples entering our center were thoroughly checked during the stimulation induction period in order to select those who were at high risk for developing ohss . Each patient was identified as being at high risk of ohss based on serum oestradiol 3000 pg / ml on the day of hcg administration and 15 follicles of intermediate (1215 mm) and large (16 mm) size . All patients were given 10.000 iu of hcg (gonasi, ibsa, switzerland) 3436hr before oocyte retrieval . The oocytes were inseminated with the husbands spermatozoa and then incubated in the standard condition . After 1418hr from insemination, the fertilization was assessed by the presence of two pronuclei . In group a, patients zygotes were immediately cryopreserved, while the zygotes of group b couples were kept in culture medium for a subsequent 72hr . In group a, according to vitrification method, embryos were equilibrated in solution composed of 750 l dmso (sigma, germany), 750 l ethylene glycol (sigma, germany), hams f10 (gibco, paisely, uk) or htf+10% serum albumin (gibco, paisely, uk) up to 10 ml for 8 or 10 min at room temperature . Embryos were then exposed to the vitrification solution composed of 1.5 ml dmso, 1.5 ml ethylene glycol, 0.5 m sucrose (sigma, germany), hams f10 or htf + 10% serum albumin up to 10 ml for 1 min at room temperature, and then immediately loaded into cryotop and plunged in liquid nitrogen . First, the embryos were released from the straw into solution1:1 m sucrose, hams f10 or htf+ 10% serum albumin up to 10 ml for 1 min, and then the embryos were transferred into a solution 2: 0.5msucrose, hams f10 or htf+10% serum albumin up to 10 ml for 3 min at room temperature . In the next step, finally, embryos were deposited in a culture dish medium (quinn's advantage cleavage medium; sage ivf) and observed under the inverted microscope to confirm survival and to assess their morphology . Embryos that presented one or more viable cells were incubated at 37c, 5% o2 and 7.3% co2 . After 24hr in culture and previous to vaginal embryo transfer (vet), embryos were observed and classified in three developmental stages: embryos with no cell division (the number of cells was the same as 24hr before), cleavage cell stage embryos (embryos with more cells after 24hr in culture) and embryos that had developed into morula or early blastocyst stage . Embryo glue media (vitrolife, sweden) was used for embryo transfer . Transfer was guided with an abdominal scan using a wallace catheter (smith medical international ltd.uk). Ovarian down regulation was achieved using a gnrh agonist (ginecrin depot, abbott laboratories, spain) in the lutheal phase . With menstruation, patients treatment began with 2 oestradiol patches/2 days (estradot 75 mg; novartis, spain). After 8 to 10 days, a transvaginal scan and a serum oestradiol measurement were performed . Endometrium was assumed to be prepared when its thickness was over 7 mm and serum oestradiol was above 100 pg / ml . From that moment, 200 mg/8hr of progesterone could be used (utrogestan, seid, or progeffik, effik, spain) and embryo transfer program was initiated . Both oestradiol patches and progesterone were used until the pregnancy test was carried out 15 days after commencement of progesterone use . If the pregnancy test was positive, hormonal treatment could be continued until 12th week of gestation . Clinical pregnancy was defined by the ultrasound observation of an intrauterine sac four weeks after embryo transfer . Generalized linear model was used to adjust the confounding factors to compare the clinical pregnancy rates between the two groups . Ovarian down regulation was achieved using a gnrh agonist (ginecrin depot, abbott laboratories, spain) in the lutheal phase . With menstruation, patients treatment began with 2 oestradiol patches/2 days (estradot 75 mg; novartis, spain). After 8 to 10 days, a transvaginal scan and a serum oestradiol measurement were performed . Endometrium was assumed to be prepared when its thickness was over 7 mm and serum oestradiol was above 100 pg / ml . From that moment, 200 mg/8hr of progesterone could be used (utrogestan, seid, or progeffik, effik, spain) and embryo transfer program was initiated . Both oestradiol patches and progesterone were used until the pregnancy test was carried out 15 days after commencement of progesterone use . If the pregnancy test was positive, hormonal treatment could be continued until 12th week of gestation . Clinical pregnancy was defined by the ultrasound observation of an intrauterine sac four weeks after embryo transfer . Generalized linear model was used to adjust the confounding factors to compare the clinical pregnancy rates between the two groups . There was no significant difference in demographic data between the two groups (table 1). Mean (sd) ages of these patients were 26.783.5 and 28.424.2 yrs and combinations of male and female factors were 28.3% and 32.1% in fresh (a) and frozen (b) embryo transfer groups respectively . Demographic data of group a and group b patients significant difference with group a average numbers of oocytes retrieved in these groups were 22.144.3 and 21.024.9, and after fertilization, embryos cryopreserved per patient yielded averages of 13.823.5 and 12.54.3 in fresh (a) and frozen (b) embryo transfer groups respectively . Thaw and et generalized linear model confirmed that clinical pregnancy and delivery rates in ohss patients were significantly higher in frozen embryo transfer, 63.1% and 45.6%, compared with fresh embryo transfer, 55.1% and 35.4%, respectively (table 1). In spite of the above - mentioned facts, the incidence of severe forms of ovarian hyper- stimulation syndrome is only 1% to 2% (8, 9); ohss remains the major significant source of morbidity and mortality in patients undergoing assisted reproduction technologies . The incidence and the duration of the syndrome are strictly related to the surge of pregnancy hormones and the number of implanted embryos (10, 11). Because no method of treatment has been able to eliminate severe ohss from the practice of assisted reproduction technologies, prevention of such risk or cycle cancellation remain the best strategies . Cryopreservation of all derived embryos has been successfully adopted to reduce the onset of the severe form of ohss (8). Avoiding fresh embryo transfer in patients at high risk of developing ohss prevents the late onset of the syndrome by simply eliminating the rise of hcg associated with successful embryo implantation . In this manner, some papers highlighted the reduction in the pregnancy chances because frozen - thawed embryo replacement may be associated with a lower pregnancy rate (12). Skaiker confirmed the results of intravenous albumin and transfer of fresh embryos with cryopreservation of all embryos for subsequent transfer in prevention of ovarian hyperstimulation syndrome (13). Queen et al . Showed that transfer of cryopreserved- thawed zygotes in 15 patients yields excellent pregnancy rates with reduction of ohss symptoms (7). For comparison between transfer of cryopreserved and fresh embryo, a prospective randomized study was designed by ferraretti and et al . Their results suggest that elective cryopreservation of zygotes prevents the risk of ohss and does not affect live birth and pregnancy rates . The last study in which elective cryopreservation of all embryos was compared with fresh et was done by fitzmaurice et al . Although several studies have indicated that cryopreservation of all embryos reduced the risk of ohss while achieving acceptable pregnancy rates (9, 16, 17), cochrane review concluded that there was insufficient prospective evidence to conclude that cryopreservation prevented ohss, compared with albumin administration or no cryopreservation (18). One reason why the paper published on this topic reached different conclusions could be the fact that embryo cryopreservation practice varies widely among assisted conception units . The variation includes policies regarding identification of the specific stage and the protocol used to freeze embryos, identification of the stage for thawing and replacing them, and consequently significant differences in success rates . Our results showed that cryopreservation of embryos reduces the patient's risk of developing the severe form of ohss, and conserves the pregnancy potential in the form of stored embryos . To explain the different outcomes between the fresh and thawed embryo transfers, multiple factors can be considered . First, the improved techniques of vitrification result in better survival and developmental potential after thawing (19). Also, as we know, natural endometrial preparation is manipulated hormonally; several studies have revealed that ovarian stimulation severely decreased endometrial receptivity for embryo (20, 21). In addition, embryo transfer during implantation window is a critical factor in the success of pregnancy but it is usually missed in most fresh cycles, although it is achievable through post - thaw embryo cycles (22). Checa also explained that the multiple eggs generated by ovarian stimulation would increase the release of estradiol from the ovary, which affect the receptivity of endometrial tissue . Some recent studies have shown that ovarian stimulation causes changes to the endometrial dna pattern, which are not evident in the normal receptive endometrium (23). Therefore, the developmental potential of cryo - thawed embryos is a concern due to synchronization of endometrial receptivity . It was shown that better synchronization was achieved between the embryo and endometrium in frozen - thawed natural cycles than in stimulated cycles (20, 22). In conclusion, for the patients who are at risk of ohss, the embryos would be vitrified for frozen embryo transfer in order to reduce complication of fresh embryo transfer in ohss cycle and improve the pregnancy rate.
Jean - martin charcot used handwriting samples to aid in differentiation of essential tremor (et) and parkinson s disease (pd), with et demonstrating tremulous handwriting and pd demonstrating bradykinesia.1 today s clinician may be confronted with cases on the borderzone of et and pd as some symptoms may overlap . For example, rest tremor and mild bradykinesia have been reported in et.2 we present three cases with overlapping symptoms along with clinical, electrophysiological, and nuclear imaging findings used to make the diagnosis . Alternating flexor and extensor muscle contraction has been demonstrated in rest tremor of pd.3 re - emergent tremor has been described by jankovic et al4 as a possible analogue of rest tremor in pd patients, with similar frequency characteristics . Postural tremor in et has been initially thought to be solely synchronous,3 but sabra and hallett5 described a less common asynchronous or alternating form of et postural tremor . Pd rest tremor has been shown to be alternating on short term recordings in multiple studies.3 long term tremor monitoring of et and pd tremor without differentiating rest vs. postural tremor by spieker et al6 revealed a more variable pattern in both disorders, with alternating tremor still dominating in pd and having a 78% predictive value for pd vs. et.6 in a series of 15 patients with et and 15 patients with pd, nistic et al7 showed that all et patients had synchronous rest tremor while all pd patients had alternating rest tremor on short term recordings.7 to our knowledge, synchronicity characteristics of re - emergent tremor in pd have not been previously evaluated . Other clinical findings that may help with pd diagnosis include bradykinesia with fatigable or decrementing amplitude, facial hypomimia, and decreased arm swing, but rarely even their presence is not fully consistent with idiopathic pd.8 patients with clinical diagnosis of pd who have normal nuclear imaging are termed subjects without evidence of dopaminergic deficit (swedds)8 and their tremor is thought to be due to dystonic tremor.9 the patient were examined and videotaped with written consent while seated with arms at rest as well as in the outstretched position . Case 2 was also evaluated with elbow flexed at 30 degrees to demonstrate crescendo postural tremor that occurs when she holds a telephone handset to her ear . Patients were asked to perform activation maneuvers consisting of serial seven subtractions or foot tapping to demonstrate upper extremity tremor . Regions of interest in video clips corresponding to each tremulous limb were analyzed via fast fourier transform in treman software to obtain tremor frequency.10 rest and postural tremor was also analyzed in both positions via surface electromyography (emg) electrodes of appropriate muscles . A dual channel recording was made via teca synergy emg (carefusion, san diego, ca). Tremor frequency was obtained from muscle contraction frequency on emg tracing in addition to data from treman . For rapid clinical evaluation of tremor synchronicity, visual assessment of simultaneous dual channel agonist and antagonist muscle contraction the more complex mathematical evaluation of tremor synchronicity presented by spieker et al6 was not used given challenges in data acquisition and processing during a brief clinical visit . Dopamine transporter imaging of cases 2 and 3 was performed via i - n - fluoropropyl-2b - carbomethoxy-3b-(4-iodophenyl) nortropane (i - fp - cit) single photon emission tomography (spect) with image acquisition 3 hours post intravenous injection of radionuclide (datscan; ge healthcare, usa). Nuclear imaging of dopamine transporter allows for evaluation of presynaptic dopaminergic terminal loss in the caudate and putamen . The first case is a 73 year old patient with a five year history of left upper extremity rest tremor, mild left upper and lower extremity bradykinesia, mild left upper and lower extremity rigidity without activation, and decreased left arm swing who carried a diagnosis of pd . The rest and re - emergent tremors had 3 + moderate amplitude wrist flexion / extension and pronation / supination components in addition to milder thumb flexion / extension . Video analysis via treman software showed a 4.53 hertz (hz) rest tremor and a 4.87 hz re - emergent tremor with 13 second latency (supplemental video). A ten second recording of flexor and extensor carpi radialis longus muscle activity of re - emergent tremor was performed via surface emg . A five second emg recording of rest tremor of the same muscles in the left upper extremity showed asynchronous contraction with 5 hz frequency . Given classic clinical features and asynchronous tremor, pd diagnosis was maintained . The patient is a 71-year - old right - handed female who developed a right hand postural tremor forty years ago . This tremor was of a very mild amplitude and was noticed when she was holding a piece of paper . About five years ago, she was discovered to have thyroid disease and its treatment improved tremor amplitude . Two years ago, she developed a left lower extremity tremor, much more prominent than right while standing . This tremor seemed to improve after changing the position of her leg . At that time, she also developed a marked crescendo amplitude right upper extremity tremor first noticed when holding a telephone handset . The tremor was also present with other activities that required holding the elbow in a flexed position . She took rasagiline for a year and a half and switched to selegiline due to cost issues . Examination was performed about 5 hours after the patient took immediate release pramipexole and selegiline . There was a mild 1 + amplitude bilateral upper extremity thumb flexion / extension postural tremor with no latency . In addition, she demonstrated no latency crescendo to 3 + moderate amplitude right elbow flexion / extension postural tremor most prominent with elbow flexion to 30 degrees, as if holding a telephone handset to her right ear . There was a metacarpophalangeal (mcp) joint abduction / adduction and wrist flexion / extension rest tremor of the bilateral upper extremities . She had normal arm swing and stride length as well as no upper extremity tremor during ambulation . Video analysis via treman revealed 6.12 hz frequency crescendo right elbow postural tremor without latency . Treman evaluation of rest tremor with activation by foot taps was contaminated with 2.95 hz video noise, but 4.9 hz frequency peaks were demonstrated in the upper extremities bilaterally . Surface emg evaluation showed 6 hz biceps / triceps synchronous postural tremor of the right elbow (fig . Diagnosis of et was confirmed and she was tapered off from her pd medications without significant worsening of clinical features . The patient is a 68 year old right handed woman who first noticed action tremor in both hands at age 30 . Bupropion has been tried five months prior to office presentation and was stopped after four months due to increased amplitude of action tremor of the hands as well as truncal tremor . The patient also tried a combination of sertraline and experimental selective norepinephrine reuptake inhibitor ly2216684 for two weeks prior to presentation . On examination while on sertraline, she had a bilateral 1 + amplitude thumb flexion / extension rest tremor with a frequency of 7 hz . There was also a no - latency 1 + amplitude postural tremor of the bilateral upper extremities with thumb flexion extension and metacarpophalangeal joint abduction / adduction . There was mild bilateral upper extremity bradykinesia on finger taps hand grips, hand pronation / supination as well as on foot taps and heel taps . Emg evaluation of the left flexor and extensor pollicis brevis muscles revealed a 7 hz synchronous postural tremor (fig . The first case is a 73 year old patient with a five year history of left upper extremity rest tremor, mild left upper and lower extremity bradykinesia, mild left upper and lower extremity rigidity without activation, and decreased left arm swing who carried a diagnosis of pd . The rest and re - emergent tremors had 3 + moderate amplitude wrist flexion / extension and pronation / supination components in addition to milder thumb flexion / extension . Video analysis via treman software showed a 4.53 hertz (hz) rest tremor and a 4.87 hz re - emergent tremor with 13 second latency (supplemental video). A ten second recording of flexor and extensor carpi radialis longus muscle activity of re - emergent tremor was performed via surface emg . A five second emg recording of rest tremor of the same muscles in the left upper extremity showed asynchronous contraction with 5 hz frequency . Given classic clinical features and asynchronous tremor, pd diagnosis was maintained . The patient is a 71-year - old right - handed female who developed a right hand postural tremor forty years ago . This tremor was of a very mild amplitude and was noticed when she was holding a piece of paper . About five years ago, she was discovered to have thyroid disease and its treatment improved tremor amplitude . Two years ago, she developed a left lower extremity tremor, much more prominent than right while standing . This tremor seemed to improve after changing the position of her leg . At that time, she also developed a marked crescendo amplitude right upper extremity tremor first noticed when holding a telephone handset . The tremor was also present with other activities that required holding the elbow in a flexed position . She took rasagiline for a year and a half and switched to selegiline due to cost issues . Examination was performed about 5 hours after the patient took immediate release pramipexole and selegiline . The lower extremity tremor could not be observed . There was a mild 1 + amplitude bilateral upper extremity thumb flexion / extension postural tremor with no latency . In addition, she demonstrated no latency crescendo to 3 + moderate amplitude right elbow flexion / extension postural tremor most prominent with elbow flexion to 30 degrees, as if holding a telephone handset to her right ear . There was a metacarpophalangeal (mcp) joint abduction / adduction and wrist flexion / extension rest tremor of the bilateral upper extremities . She had normal arm swing and stride length as well as no upper extremity tremor during ambulation . Video analysis via treman revealed 6.12 hz frequency crescendo right elbow postural tremor without latency . Treman evaluation of rest tremor with activation by foot taps was contaminated with 2.95 hz video noise, but 4.9 hz frequency peaks were demonstrated in the upper extremities bilaterally . Surface emg evaluation showed 6 hz biceps / triceps synchronous postural tremor of the right elbow (fig . Diagnosis of et was confirmed and she was tapered off from her pd medications without significant worsening of clinical features . The patient is a 68 year old right handed woman who first noticed action tremor in both hands at age 30 . Bupropion has been tried five months prior to office presentation and was stopped after four months due to increased amplitude of action tremor of the hands as well as truncal tremor . The patient also tried a combination of sertraline and experimental selective norepinephrine reuptake inhibitor ly2216684 for two weeks prior to presentation . On examination while on sertraline, she had a bilateral 1 + amplitude thumb flexion / extension rest tremor with a frequency of 7 hz . There was also a no - latency 1 + amplitude postural tremor of the bilateral upper extremities with thumb flexion extension and metacarpophalangeal joint abduction / adduction . There was mild bilateral upper extremity bradykinesia on finger taps hand grips, hand pronation / supination as well as on foot taps and heel taps . Emg evaluation of the left flexor and extensor pollicis brevis muscles revealed a 7 hz synchronous postural tremor (fig . These cases demonstrate the challenge experienced by clinicians when attempting to diagnose cases with features that may be present in both et and pd . Electrophysiological evaluation assisted in diagnosing case 1, while spect scan was useful in properly diagnosing cases 2 and 3 . In case 1, presence of distal interphalangeal joint flexion due to striatal hand deformity and re - emergent tremor helped confirm pd diagnosis . Our results in case 1 agree with previous demonstration of alternating rest tremor in pd3 and support the concept of re - emergent tremor as an analogue of pd rest tremor.4 to our knowledge, the alternating characteristic of re - emergent tremor in pd has not been previously demonstrated . While re - emergent tremor has been thought to be almost pathognomonic for pd as opposed to swedd,11 a case of re - emergent tremor, rest tremor, and decreased arm swing with normal dopaminergic function has been reported.12 it would have been of interest to see if the re - emergent tremor in the reported swedd case was synchronously similar to rest tremor in present cases 2 and 3 . Bajaj et al8 found no difference in re - emergent tremor between tremor dominant pd and swedd groups, with median tremor latency 0.79 s and 0.82 s respectively, with interquartile range of 00.5 s and 02 s respectively.8 this is in stark contrast to data from schwingenschuh et al11 which found pd patients to have postural tremor latency of 2.8 seconds (range 2.66.4). Jankovic et al4 reported postural tremor latency average 0.06 s (0.28) range 01.29 s for et and average 6.25 s (9.76), range 047.0 s for pd . Given this data, it is likely that brief re - emergent postural tremor latencies (especially 2 s or below) are not useful for differentiating between pd and et / swedd, while latencies of 2.6 s and above provided good separation between the groups with 56% sensitivity and 100% specificity in schwingenschuh s data set . Cases 2 and 3 emphasize that presence of some parkinsonian features in the setting of et does not automatically imply a simultaneous pd diagnosis . In case 2, relatively slow tremor frequency (about 6 hz), bilateral rest tremor, and mild bilateral bradykinesia led to an inappropriate diagnosis of pd and unnecessary treatment with monoamine oxidase b (maob) inhibitors as well as dopamine agonist pramipexole . Crescendo right upper extremity postural tremor without latency was probably confused with re - emergent tremor of pd . Presence of normal arm swing bilaterally, lack of bradykinesia with decrementing amplitude, and synchronous pattern of tremor (more typical of et6) were clues to et diagnosis . Given asymmetric tremor with exacerbation in flexed elbow position, differential diagnosis includes dystonic tremor . This patient may also be labeled as swedd . In case 3, normal i - fp - cit spect scan confirmed et, with possible contribution of drug induced tremor from sertraline . Pd was ruled out via nuclear imaging even though there was slow tremor frequency (7 hz), bilateral upper extremity bradykinesia, and mildly decreased right arm swing during ambulation . Fmr1 gene contains a tract of cgg repeats which is expanded to 200 repeats or more in full mutation leading to fragile x syndrome . Fragile x - associated tremor ataxia syndrome (fxtas) occurs in the setting of 55 to 200 repeats, manifests with intention tremor and ataxia, and may occur in females.13 parkinsonism with and without evidence of dopaminergic loss on i - fp - cit spect was seen in 64% of 22 fxtas patients evaluated by apartis et al.13 the patients in that group were classified into et - like tremor with average 5.3 hz frequency distal postural tremor and absent rest tremor or cerebellar tremor prominent slow frequency (3.5 hz) proximal upper extremity postural tremor and higher amplitude intention tremor, with complete absence of rest tremor . Our case 2 does not fit into either of these categories, as rest tremor was present and the frequency of biceps / triceps tremor was 6 hertz . Tremor frequency in case 3 was also higher than frequency reported for et - like tremor in fxtas . Hence we do not believe that cases 2 and 3 were caused by fmr1 premutation . Hall et al reported two female subjects with parkinsonism who had gray zone fmr1 expansions consisting of 4154 cag repeats as well as one male subject with premutation consisting of 60 cgg repeats.14 tremor frequency data was not provided for these patients . They presented with parkinsonism as well as atypical features for pd including head tremor in 2/3 cases and difficulty with tandem gait in 1/3 cases . Our cases did not present with these additional features of head tremor or tandem gait difficulty and were unlikely to be caused by fmr1 premutation . In our cases, mild discrepancy in tremor frequency between emg and video evaluation may be due to error introduced by video capture and conversion process . It is of interest for future discussions of whether or not there is a mechanistic relationship between et and pd that our synchronous tremor et cases had no dopaminergic terminal loss one to two years after the development of multiple parkinsonian features and up to forty years after the initial onset of et . In summary even presence of classic findings such as re - emergent tremor, decreased arm swing, and bradykinesia with decrementing amplitude does not guarantee idiopathic pd diagnosis via spect scanning . Out of these clinical signs, re - emergent tremor has the highest specificity.11 demonstration of asynchronous re - emergent tremor may provide additional diagnostic information in complicated cases . Video 1 . Re - emergent tremor at the left wrist of pd case 1, consisting of crescendo postural tremor with latency of 13 seconds.
Three fruiting bodies of t. matsutake were used to measure the number of spores produced from each fruiting body . The samples used for the enumeration of spores were similar in size used for the investigation of spore dispersion, and their veils under each pileus had just started to open . We cut the stem of each mushroom and set the pileus above a piece of aluminum foil for 4 days to obtain spore prints . All of the spores on the foil were collected and measured for weight, and the numbers of spores in a serial - diluted solution were enumerated using a haemacytometer . The experimental site was mainly composed of 65-year - old japanese red pines (pinus densiflora s. et z. ), although a few oaks (quercus variabilis bl .) Occupied less than 20% . The site had been surveyed for mushroom growth for more than 4 yr, and the locations of pine mushroom had been thoroughly documented . Only one fruiting body of t. matsutake remained within each site; all others, including other mycorrhizal mushrooms, were thoroughly removed . We established three sites for study, and the distances from each site were more than 50 m. we established 48 slide glasses coated with glycerin nearby each fruiting body in four directions separated by four different distance intervals at three heights . The distances were set as 50, 100, 200 and 500 cm from the fruiting body . At each point, we installed a stick containing three slide glasses that were 0, 50 and 100 cm above the ground . The dispersed spores were collected from the time immediately after the veils of pileus were torn out . We installed the collecting glasses when the fruiting body was hemispherical and stopped when it became planar, a total of 4 days as described by ka et al . . The slide glasses were installed at 10 am every day and were replaced by a new one after 24 hr . The number of spores on each slide was enumerated by the line - transect method under a microscope (400) using an image analyzer (leica, sasem onairtv). The plate was overlapped by grids of 116 m118 m for counting, and triplicates were applied for the enumeration . Three fruiting bodies of t. matsutake were used to measure the number of spores produced from each fruiting body . The samples used for the enumeration of spores were similar in size used for the investigation of spore dispersion, and their veils under each pileus had just started to open . We cut the stem of each mushroom and set the pileus above a piece of aluminum foil for 4 days to obtain spore prints . All of the spores on the foil were collected and measured for weight, and the numbers of spores in a serial - diluted solution were enumerated using a haemacytometer . The experimental site was mainly composed of 65-year - old japanese red pines (pinus densiflora s. et z. ), although a few oaks (quercus variabilis bl .) Occupied less than 20% . The site had been surveyed for mushroom growth for more than 4 yr, and the locations of pine mushroom had been thoroughly documented . Only one fruiting body of t. matsutake remained within each site; all others, including other mycorrhizal mushrooms, were thoroughly removed . We established three sites for study, and the distances from each site were more than 50 m. we established 48 slide glasses coated with glycerin nearby each fruiting body in four directions separated by four different distance intervals at three heights . The distances were set as 50, 100, 200 and 500 cm from the fruiting body . At each point, we installed a stick containing three slide glasses that were 0, 50 and 100 cm above the ground . The dispersed spores were collected from the time immediately after the veils of pileus were torn out . We installed the collecting glasses when the fruiting body was hemispherical and stopped when it became planar, a total of 4 days as described by ka et al . . The slide glasses were installed at 10 am every day and were replaced by a new one after 24 hr . The number of spores on each slide was enumerated by the line - transect method under a microscope (400) using an image analyzer (leica, sasem onairtv). The plate was overlapped by grids of 116 m118 m for counting, and triplicates were applied for the enumeration . The fruiting bodies used for spore counting were 230 22 g in fresh weight, 12 0.3 cm in pileus diameter, 15 0.3 cm in stipe length and 3.5 0.1 cm in stipe diameter . Although the fruiting bodies were relatively larger and heavier than generally harvested mushrooms as goods, they could be considered as representative fruiting bodies of overmatured mushrooms . The spores collected from each fruiting body reached about 150 mg in total mass and were counted as 4.5~5 billion, which varied depending on the size of the mushroom . Although we set the slide glasses at three heights (0, 50 and 100 cm above the ground), the data collected from the slides located at 50 and 100 cm above the ground were unusable due to sparseness with large variation . As deering et al . Showed for the airflow surrounding a simulated mushroom, the spores of t. matsutake did not fly at high elevations but instead streamed down along the forest floor . Thus, we only used the data from the slides set on the ground for the enumeration . The number of spores increased with time but rapidly dropped as the pileus turned over (on the fifth day); 475 spores / cm on the first day, 497 spores / cm on the second day, 599 spores / cm on the third day and 836 spores / cm on the fourth day after the veils of pileus opened . Ogawa noted that the most abundant time for spore production is 3~4 days after the veil of pileus is torn down . He noted that spores are immature if the veil is not torn down or the pileus turned over, and the amount of spores also becomes smaller . Thus, we used the cumulative numbers of spores over 4 days to compare the differences in the amount of spores among directions and/or distances . The spores dispersed more along the slope compared to those within the slope (table 1). Although we did not measure the intensity of the wind within the forest, the intensity of the wind was stronger along the slope than that within the slope . Thus, we estimated that the difference in intensity of the wind resulted in the differences in spore dispersion . The number of spores dispersed downward was about 1.5 times greater than that dispersed upward, which indicates that gravity was another key factor in the dispersion of spores, as noted by deering et al . . Although spores may usually spread more toward the lower part of mountains, pine mushrooms are mainly produced on the upper parts . This implies that the decline in the productivity of pine mushroom was not due to an insufficient number of spores but actually other factors, such as unsuitable site conditions for growth . Further, the number of spores decreased exponentially as the distance increased from each fruiting body (fig . 1). More than 95% of the spores dropped within a meter of the fruiting body, with about 75% of them within 0.5 m (table 2). However, the spores dispersed over 5 m from the fruiting body could not be discounted as they numbered more than 50 million, considering that the number of spores produced by a fruiting body is about 5 billion . The pattern of spore dispersion was also dependent upon the stand density and other micro - environmental factors (table 3). As stand density increased, the number of dropped spores on the sampled slides decreased (2,605 spores / cm for dense, 2,089 spores / cm for middle and 1,670 spores / cm for sparse), which indicates that stand density might have affected air flow and therefore spore dispersion . Ogawa reported that spore dispersion is largely dependent upon the climatic conditions or fructification time . He mentioned that the amount of mature spores would be quite few if the air temperature is very high or low . In addition, he stated that relative humidity is a key factor in spore dispersion; for example, colonized spores are high in number after rain or fog . In some cases, a spore print was formed on the surface of litter, which indicates that the spores were not widely spread out . Thus, stand density and other site factors could be major factors in the dispersal of spores, but microclimatic factors such as wind are more important in spore dispersion . The fruiting bodies used for spore counting were 230 22 g in fresh weight, 12 0.3 cm in pileus diameter, 15 0.3 cm in stipe length and 3.5 0.1 cm in stipe diameter . Although the fruiting bodies were relatively larger and heavier than generally harvested mushrooms as goods, they could be considered as representative fruiting bodies of overmatured mushrooms . The spores collected from each fruiting body reached about 150 mg in total mass and were counted as 4.5~5 billion, which varied depending on the size of the mushroom . Although we set the slide glasses at three heights (0, 50 and 100 cm above the ground), the data collected from the slides located at 50 and 100 cm above the ground were unusable due to sparseness with large variation . As deering et al . Showed for the airflow surrounding a simulated mushroom, the spores of t. matsutake did not fly at high elevations but instead streamed down along the forest floor . Thus, we only used the data from the slides set on the ground for the enumeration . The number of spores increased with time but rapidly dropped as the pileus turned over (on the fifth day); 475 spores / cm on the first day, 497 spores / cm on the second day, 599 spores / cm on the third day and 836 spores / cm on the fourth day after the veils of pileus opened . Ogawa noted that the most abundant time for spore production is 3~4 days after the veil of pileus is torn down . He noted that spores are immature if the veil is not torn down or the pileus turned over, and the amount of spores also becomes smaller . Thus, we used the cumulative numbers of spores over 4 days to compare the differences in the amount of spores among directions and/or distances . The spores dispersed more along the slope compared to those within the slope (table 1). Although we did not measure the intensity of the wind within the forest, the intensity of the wind was stronger along the slope than that within the slope . Thus, we estimated that the difference in intensity of the wind resulted in the differences in spore dispersion . The number of spores dispersed downward was about 1.5 times greater than that dispersed upward, which indicates that gravity was another key factor in the dispersion of spores, as noted by deering et al . . Although spores may usually spread more toward the lower part of mountains, pine mushrooms are mainly produced on the upper parts . This implies that the decline in the productivity of pine mushroom was not due to an insufficient number of spores but actually other factors, such as unsuitable site conditions for growth . Further, the number of spores decreased exponentially as the distance increased from each fruiting body (fig . 1). More than 95% of the spores dropped within a meter of the fruiting body, with about 75% of them within 0.5 m however, the spores dispersed over 5 m from the fruiting body could not be discounted as they numbered more than 50 million, considering that the number of spores produced by a fruiting body is about 5 billion . The pattern of spore dispersion was also dependent upon the stand density and other micro - environmental factors (table 3). As stand density increased, the number of dropped spores on the sampled slides decreased (2,605 spores / cm for dense, 2,089 spores / cm for middle and 1,670 spores / cm for sparse), which indicates that stand density might have affected air flow and therefore spore dispersion . Ogawa reported that spore dispersion is largely dependent upon the climatic conditions or fructification time . He mentioned that the amount of mature spores would be quite few if the air temperature is very high or low . In addition, he stated that relative humidity is a key factor in spore dispersion; for example, colonized spores are high in number after rain or fog . In some cases, a spore print was formed on the surface of litter, which indicates that the spores were not widely spread out . Thus, stand density and other site factors could be major factors in the dispersal of spores, but microclimatic factors such as wind are more important in spore dispersion.
The global burden of cancer continues to rise with about 14.1 million new cancer cases, 8.2 million cancer deaths, and about 32.6 million people living with the disease worldwide (within 5 years of diagnosis) in 2012 . Also, about 57% (8 million) of the new cancer cases, 65% (5.3 million) of the cancer deaths, and 48% (15.6 million) of the 5-year prevalent cancer cases were recorded in less developed countries in 2012 [1, 2]. One of the major contributors to the growth in cancer incidence is prostate cancer, the second most common cancer among men and fourth among both sexes . Although developing countries account for less than 30% of all cases of prostate cancer, they have the highest estimated mortality from the disease [3, 4]. Similarly, even though sub - saharan africa (ssa) has low prevalence of prostate cancer, it has one of the highest estimated incidence of the disease in the world [5, 6]. Although it is already a major public health concern, the burden of prostate cancer in ssa is expected to grow mainly due to growth and aging of population, changing diets, lifestyles, and socioeconomic conditions [5, 7, 8]. Some studies have even argued that the somewhat relatively lower trends in ssa understate the true magnitude of the disease due to low detection rate as many prostate cancer cases go undiagnosed due to lack of medial knowledge, diagnostic facilities, trained health personnel, and prostate - specific antigen (psa) testing [911]. Consequently, prostate cancer is said to be a leading cause of mortality in resource - poor settings [1114]. While prostate cancer is the most common kind of cancer among men of african descent, testing among african men is uncommon . Low uptake of testing is linked to barriers related to access to cancer - related health care, including diagnosis and treatment and general lack of medical information on risk factors . Yet screening can significantly reduce morbidity and death from prostate cancer [11, 1417]. For instance, prostate cancer screening may lead to early diagnostics and treatment that could reduce the risk of advanced disease, reduce the risk of dying from prostate cancer, and increase life expectancy [16, 18]. Even though the absolute reduction in the risk of death due to prostate cancer screening may be small, the reductions in the risks of metastasis and local tumor progression are substantial if cases are detected early . To evaluate the efficacy of prostate cancer screening, two large randomized trials were initiated in the early 1990s: the european randomized study of screening for prostate cancer (erspc) in europe and the prostate, lung, colorectal, and ovary (plco) trial in the united states . The erspc trial showed a significant reduction in the risk of death from prostate cancer in the screening group indicating about 21% and about 29% for men that actually were screened after a median follow - up of eleven years and a substantial increase in absolute effect . The second trial (goteborg trial) showed that, after a median follow - up of 14 years, one center of the erspc trial showed a 44% reduction in prostate cancer mortality among men in the screening group and a 56% reduction for men screened at least once . The plco reported no reduction in mortality in the screening group, even though there have been concerns of high contamination in the control arm [22, 23]. An adverse effect of screening is overdiagnosis the detection of cancers that would not have been diagnosed during a persons' lifetime if they had not been screened . Psychologically, men with screen - detected prostate cancer may have to live the rest of their lives with the knowledge that they have prostate cancer [24, 25]. Furthermore, those who opt for curative treatment risk living many years with the side effects of treatment, which would otherwise be symptom - free years [24, 26]. Targeted screening, whereby a person with a family history of the disease are screened, would be necessary to reduce incidence of false positives and the burden of overdiagnosis and overtreatment . However, population level testing may be useful in revealing at - risk populations for active surveillance, watchful waiting among patients with clinically confined low - risk pc, and active public health sensitization . The identification of at - risk populations might inform preventive efforts, by advocating for individual lifestyle changes to reduce the incidence of disease . This approach is referred to as the high - risk approach to prevention because it targets high risk individuals and has dominated preventive efforts in developed countries over decades [26, 27]. However others are of the view that a population level strategy that seeks to control the determinants of incidence in the general population as a whole may hold larger promise in terms of health promotion overall . In namibia, it also accounts for 21.2 per 100,000 of overall cancer incidence and 21.5 per 100,000 of all cancer mortalities among adult men . Further, the country has a 5-year prevalence rate of 28 per 100,000 . Despite being the leading cause of cancer - related death among men and second among both sexes, however, this situation has somewhat changed in the recent years, especially following the introduction of the national awareness, screening, and early treatment campaign, aimed at screening men mostly using prostate - specific antigen (psa) or rectal exam . The namibian cancer society as well as the canadian society recommends that men in their 40s should be screened annually [29, 30]. Despite these laudable efforts, factors such as inadequate public health infrastructure and other health concerns such as hiv / aids and malaria compete for scarce health resources and likely undermine the provision of prostate cancer services . These challenges have similarly been observed in cervical cancer screening in namibia and in other regions such as south africa . For example, it has been suggested that factors that contribute to the low levels of screening largely stem from differences in health care access, lack of knowledge and information, and unavailability of early detection services [4, 32, 33]. In the united states, health insurance coverage has been shown to be associated with increased testing, early detection, and effective treatment of cancer cases [10, 3436], echoing the vital role of health insurance as a major predictor of cancer screening . Namibia's health insurance (medical aid) scheme relies on government and private not - for - profit organisations to manage health financing . The private not - for - profit organisations mostly provide high - option products and extensive coverage for inpatient and outpatient services to their voluntarily registered members under two main schemes referred to as open and closed schemes . The closed scheme limits membership to a particular industry whilst the open scheme sells medical aid policies to any company or individual that wishes to purchase coverage . Each scheme typically offers numerous policies with diverse benefit packages and premiums with the namibian financial institutions supervisory authority (namfisa) providing oversight and regulatory roles on the activities of these schemes . Overall, approximately 51% of namibians who are employed in the formal sector have health insurance with roughly 1618% of total population under medical insurance . This leaves the unemployed citizens and the majority of the population (82%) without health insurance . This creates a situation where they must rely on out - of - pocket payments or seek care from the public sector, where only basic services are delivered largely free of charge and at low quality . In a comparative study of canada and united states, it was also found that socioeconomic status as measured by education or occupation status played an important role in cancer screening . This implies that even if cancer services were widely available, not all individuals would have equal access to screening services . While there are several studies in western countries on access to prostate cancer testing and treatment, this is not the case in ssa where only a few studies have hitherto been conducted . Nonetheless, the few studies from the ssa region suggest that, overall, there is low level of public awareness about prostate cancer and associated risk factors . This study contributes to knowledge in this regard by examining the correlates of prostate cancer screening among men aged 4064 years in namibia . The results, as we hope, will only influence policy in namibia and ssa . This study used the 2013 namibia demographic and health survey (ndhs), a nationally representative dataset collected jointly by the national statistical bureau and ministry of health of namibia and measure dhs program in calverton, maryland, usa . The ndhs is administered face to face to men aged between 15 and 64 years and collected periodically to provide data on basic national demographic and health indicators to guide policy makers, planners, and researchers . It is one of the few national surveys in ssa which has recently introduced a set of indicators on prostate cancer screening in order to assess the prevalence and risk factors in the general population . The outcome variable of this study, prostate cancer screening, is a binary dependent variable measured with the question have you ever been examined for prostate cancer?, coded 0 for no and 1 for yes . Health insurance coverage was constructed from the question are you covered by health insurance?, coded 0 for not covered and 1 for covered . To capture the role of capacity for health literacy, the study also included a variable on education 0 for no education, 1 for primary, 2 for secondary, and 3 for higher and whether men discussed family planning issues with a health worker in the last 12 months 0 for no and 1 for yes . The role of health literacy was further explored by the variable tapping into exposure to media in which men were asked as to whether they listen to radio coded 0 for not at all, 1 for often, and 2 for very often or watch television coded 0 for not at all, 1 for often, and 2 for very often . This was important given the use of mass media in the dissemination of medical information in namibia and other ssa countries . Wealth is a composite index created based on a household's ownership of a number of consumer items which the ndhs deems to be poorest, poorer, middle, richer, and richest quintiles and recoded 0 for poorest and poorer; 1 for middle; and 2 for richer and richest . Demographic variables included in the analysis are age of respondents in 5-year categories, marital status coded 0 for single; 1 for married, and 2 for separated, and religion coded 0 for catholics; 1 for protestants; 2 for elcin (a type of christian religion practiced in namibia); and 3 for other religious groups . Locational factors controlled for include place of residence coded 0 for urban, 1 for rural and geographic region of residence coded 0 for caprivi, 1 for erongo, 2 for hardap, 3 for kara, 4 for kavango 5 for khomas, 6 for kunene, 7 for ohangwena, 8 for omaheke, 9 for omusati, 10 for oshana, 11 for oshikoto, and 12 for otjozondjupa . We used complementary log - log models instead of binary logit model to analyze our outcome variable given the highly uneven split of the outcomes in the dependent variable (see table 1). Standard logit models are also built under the assumption of independence of respondents, but the ndhs has a hierarchical structure with respondents nested within survey clusters with a possibility of biasing our standard errors . To avoid bias in the standard errors and parameter estimates, a random effects regression analysis that corrects for these biases sample characteristics of our dependent and main independent variables with some selected variables are depicted in table 1 . Table 2 presents our bivariate associations between our dependent variable (prostate cancer screening) and each of the independent variables . Our findings indicate that only 16% of men reported ever screening for prostate cancer in namibia . About 32% of our sample reported having health insurance and only 5% of men reported ever discussing family planning issues with a health worker in the last 12 months before the survey . About 39% of men had a secondary education, 72% reported being married, with a mean age of 49, and about 41% of the sample were identified with the elcin religion . The distribution of men with regard to place of residence was near even between urban and rural areas, 49% of men residing in urban areas and approximately 51% in rural areas . About 50% of men were within the richest and richer wealth quintiles whilst about 31% were in the poorest and poorer categories . Men with health insurance coverage (or = 6.77, p = 0.01) were highly likely to undergo screening for prostate cancer compared to men with no insurance coverage . Similarly, compared to men who reported not discussing reproductive issues with a health personnel in the 12 months prior to the survey, men who reported such a discussion (or = 1.67, p = 0.01) were more likely to report testing for prostate cancer . Men in the age categories, 5054 (or = 1.87, p = 0.01), 5559 (or = 2.08, p = 0.01), and 6064 (or = 2.10, p = 0.01), were more likely to test for prostate cancer compared to men in the 4044 age category . Relative to catholics, men who identify with protestant christian denominations (or = 1.71, p = 0.05) and other religions (or = 2.14, p = 0.01) were more likely to report screening for prostate cancer . Currently married (or = 3.85, p = 0.01) and separated men (or = 2.83, p = 0.01) were more likely to report testing compared to never married men . Men residing in rural namibia were less likely (or = 0.49, p = 0.01) to test for prostate cancer compared to their urban counterparts . Regionally, residents in erongo (or = 2.49, p = 0.10), karas (or = 3.00, p = 0.05), khomas (or = 2.63, p = 0.10), and otjozondjupa (or = 2.44, p = 0.10) were more likely to test for prostate cancer compared to men resident in caprivi region . Socioeconomically, men in the richer (or = 4.03, p = 0.01) and richest (or = 13.61, p = 0.01) wealth categories were significantly more likely to test for prostate cancer compared to poorer men . Two multivariate results are presented in table 3 . In the first model we estimated the effects of health insurance, knowledge, and access to information on men's decision to test for prostate cancer . Like in the bivariate analysis, men with health insurance coverage (or = 4.11, p = 0.01) were more likely to be examined for prostate cancer compared to those uninsured . Also, men with secondary education (or = 4.03, p = 0.01) or higher (or = 8.13, p = 0.01) were more likely to have been screened for prostate cancer compared to men with no formal education . We found that the association between health insurance coverage and prostate cancer testing attenuated after adjusting for socioeconomic and demographic variables but remained significant and robust . Other variables associated with screening included level of education, age of respondent, contact with health personnel, region of residence, and wealth category . Compared to men without formal education, men with secondary (or = 3.32, p = 0.01) or higher (or = 6.34, p = 0.01) level of education were all more likely to test for prostate cancer . Remarkably, the findings suggest a steady gradient across successive levels of education, where men with higher than secondary level of education are more like to test for prostate cancer than men with secondary education, who are more likely to test than men with primary education, who in turn are more likely to test for cancer than men without formal education . Like in the bivariate analysis, men who reported having contact with a health worker in the 12 months prior to the survey (or = 2.02, p = 0.05) were more likely to report testing for prostate cancer compared to those without such contact . As is the case with education, there is steady gradient across age where men in a given age group are more likely to test for prostate cancer than men in the age category immediately below them . Thus, compared to the 4044 age category, men aged between 50 and 54 (or = 2.05, p = 0.01); 55 and 59 (or = 2.06, p = 0.01); and 60 and 64 (or = 3.30, p = 0.01) were all more likely to test . Also, male residents in ohangwena (or = 5.10, p = 0.01) were more likely to test for prostate cancer compared to male residents in caprivi, the poorest and underserved region in namibia . In contrast to men in the poorest wealth quintile, those in the richer (or = 2.41, p = 0.10) and richest (or = 4.95, p = 0.01) wealth quintile were more likely to test for prostate cancer . We examined the determinants of prostate cancer screening among men of 40 years and over, considered to be the age group at risk of prostate cancer . Our findings show that namibian men with health insurance coverage, having access to information, having contact with health workers, and residing in richer and richest wealth quintiles, were more likely to screen for prostate cancer . The effect of health insurance on testing for prostate cancer remained robust even after controlling for access to information and socioeconomic and demographic factors, suggesting the disproportionate influence that having insurance coverage might have on an individual's access to cancer screening . This particular finding is generally consistent with the literature on the effect of insurance coverage on health utilisation in different places [10, 31, 35]. One key explanation might be that in namibia health insurance coverage has a significant potential to reduce out - of - pocket health expenses, increase the frequency of hospital visits and quality of interacting with doctors, and reduce payment for health care at the point of service, including screening for prostate cancer . Invariably, given the relative contribution of insurance coverage and wealth to prostate cancer screening in this context, it means that the poor face a dual burden of poverty and inequity in health access . Hence, the poor are more likely to be uninsured and are also more likely to face barriers to preventive information on prostate cancer screening . This may be due to access disparities among insured and uninsured individuals, often rooted in income inequalities that may translate into health inequalities in the area of prostate cancer screening . The majority of namibians rely on low - quality health services provided by the public health system which is already overburdened by the hiv / aids epidemic . Overall, only 51% of namibians employed in the formal sector are covered by health insurance, with only 1618% of the total population under medical insurance . This leaves the unemployed and majority of the population (82%) without health insurance . These uninsured individuals may have to rely on out - of - pocket payments or to seek care from the public sector, where only basic services are delivered largely free of charge and at low quality . This suggests that the adoption of a universal health insurance scheme that ensures equity may improve testing or screening levels in namibia . However, we must also acknowledge that universal insurance coverage would not automatically result in equitable access to prostate cancer screening unless efforts are made to improve preventative health information and the availability and accessibility to health services . An interesting finding of this study is the positive relationship between discussing health issues with a health worker and screening for prostate cancer . This suggests that the appropriate promotion of prostate cancer screening through health workers will be useful to encourage men to test especially in a context where reproductive health services have historically been directed at women . There is the need to push for more openness and awareness in order to promote dialogue between health professionals and men on relevant issues around prostate cancer and encourage them to screen for prostate cancer . Our results are consistent with those of other studies which have reported that individuals who make regular visits or are in regular contact with health worker(s) tend to be better informed about health issues, are familiar with medical settings, are more receptive to medical advice, and are more likely to undergo testing [47, 48]. The significant association between men discussing health issues and screening for prostate cancer reflects more positive attitudes and social motivation toward learning about prostate cancer and engaging in healthy behaviours that may lead to early detection and prevention of the disease . Thus, the finding especially draws attention to the need for increased emphasis on promoting awareness about prostate cancer in order to equip the public with relevant knowledge and encourage men to adopt preventive behaviours including screening . The positive relationship (steady gradient) between education and screening for prostate cancer might also reflect positive attitudes where educated men who are most likely to be aware of or comprehend health risks levels are more likely to take appropriate actions such as testing . The progressive association between age and testing for prostate cancer may be a reflection of more positive behaviours to learn about risk factors and willingness to adopt preventive measures such as screening in order to seek treatment . This particular finding is generally consistent with other studies that have singled out age as one of the widest known risk factors for developing prostate cancer alongside ethnicity and race [25, 49, 50]. The richer and richest categories were more likely to report testing for the disease, reemphasising the notion that it is mostly those who have the financial means to overcome barriers to health care services . This is similarly the case in the context of health insurance coverage where the richer and richest tend to have better access to prostate cancer testing . The relatively low likelihood of testing among the poor highlights the issue of socioeconomic inequalities to cancer screening and underscores the kinds of barriers that poor people face in terms of access to testing . Since testing is a gateway to treatment, the findings of this study also suggest potential socioeconomic disparities in morbidity and mortality from cancer in namibia . Furthermore, even though prostate cancer screening is generally low in namibia, the findings of this study suggest existence of wide geographical variations in terms of screening . For instance, residents in ohangwena region were more likely to screen for prostate cancer, compared to caprivi, one of namibia's poorest and underserved regions . Namibia is a vast country and in such remote regions, such as caprivi, up to 60% of the population live more than 5 km from the nearest health facility . Addressing these barriers to screening will prove useful for the government's efforts to curb prostate cancer incidence . However, despite the potential public health benefits of screening, in setting such as namibia, screening outcomes are likely to be poorer and even when correctly diagnosed patients may not receive treatment due to lack of appropriate resources . It is therefore important for public health officials and policy makers to obtain local context evidence of screening as well as weigh the cost and benefits of expanded prostate cancer screening to other public health interventions . First, due to the cross - sectional nature of the dataset, we are unable to make causal linkages between prostate cancer screening and any of our independent variables . Also, due to the self - reported nature of the data, some biases may have been introduced into the data during data collection as men are more likely to provide socially satisfactory responses and the ndhs could not physically validate these responses . We do also acknowledge that globocan data on mortality are projections and may overstate or understate the burden of prostate cancer in namibia . Furthermore, even though prostate cancer is deserving public health attention, it should be noted that there still remain other more common noncancer causes of mortality and that knowing one's prostate cancer status will not necessarily prevent death . Such considerations should be factored in when prioritizing public health policies in such limited resources settings that have to prioritize their objectives . To a large extent our results are generalizable to other resource - poor countries in sub - saharan africa, even though one must not lose sight of the contextual influence of culture, norms, health behaviours, and the political support of namibian government in prioritizing population based screening . In conclusion, this paper has examined the determinants of prostate cancer among men aged 4064 years in namibia . The significant role played by health insurance coverage in influencing screening highlights the need for a national health insurance strategy that ensures equity in health access, especially screening for cancer . Currently, namibia does not have a universal health insurance policy although discussions are currently underway to introduce a national scheme to reduce out - of - pocket health expenses and inequities in access to health services . It is hoped that this may impact positively on health care utilisation including prostate screening . We also urge that for such a scheme to be effective in increasing screening for prostate cancer, it has to be accompanied by a strong health promotion campaign to promote the public awareness about the disease . The study also points to the role played by regular contact with health workers in promoting testing for prostate cancer among men, underscoring the need for the government to reduce barriers that make it difficult for people to get in touch with health personnel or to have a regular doctor . It also suggests the need for a cultural shift that would promote more dialogue on men's reproductive health issues in a context where women have traditionally been the subject of such debates . The current recommendations for prostate cancer screening are more appropriate for developed country contexts as they have the resources and technical expertise to handle the burden of prostate cancer . In a resource limited setting such as namibia, outcomes are likely to be poorer and there is also the strong likelihood that many patients that would be correctly diagnosed may not receive treatment due to lack of appropriate resources . This is especially the case in namibia where, due to a lack of previous testing, the national rollout of screening is likely to uncover many cases of advanced prostate cases which may be difficult to treat . As a public health consideration, the namibian government should carefully consider likely benefits from the national screening program with respect to its capacity to provide appropriate care for those who test positive . Those making decisions about commitment of public health resources need to weigh the costs associated with prostate cancer against those of other public health interventions, such as hiv / aids, malaria, or even cervical cancer, whose diagnostics and interventions are relatively low cost . Cervical and breast cancer are also other important and competing public health problems in namibia . Screening for prostate cancer remains low in namibia with only 16% of men reporting having ever tested.men with health insurance and those who discuss their health issues with a professional were more likely to screen for prostate cancer; the findings suggest that expanding health insurance coverage together with prostate cancer screening education could improve the outcomes.the study contributes to the current field of knowledge of prostate cancer testing among resource - poor populations given the high risk of prostate cancer within these settings . Screening for prostate cancer remains low in namibia with only 16% of men reporting having ever tested . Men with health insurance and those who discuss their health issues with a professional were more likely to screen for prostate cancer; the findings suggest that expanding health insurance coverage together with prostate cancer screening education could improve the outcomes . The study contributes to the current field of knowledge of prostate cancer testing among resource - poor populations given the high risk of prostate cancer within these settings.
Mushroom poisoning is a major health risk in rural areas, and it is presumed that over 5,000 species of mushrooms are present worldwide.1 in more than 90% of cases of ingestion, the type of mushroom is unknown because of difficulties in the exact identification of mushroom species.2 most of the ingested mushrooms are either nontoxic or only gastrointestinal irritants, resulting in mild to moderate toxic effects.3 cyclopeptide toxins are responsible for the pathogenicity of mushrooms . Among these toxins, amatoxins have their most serious effect on the liver and account for 90% of fatal mushroom poisonings.4 this process is characterized by an asymptomatic incubation period followed by the gastrointestinal and hepatotoxic phases which progress to multiorgan failure and death . A 63-year - old male patient was admitted to the emergency room with weakness, nausea, vomiting, and diarrhea . Also, he had no metastasis in the liver, he did not consume alcohol, and he did not use any medication . On admission, he was awake and fully oriented, and all vital signs were normal . Hepatitis b surface antigen, hepatitis b core antibody, immunoglobulin m, and antihepatitis c antibody were found to be nonreactive . A hepatitis b virus dna analysis was performed using the polymerase chain reaction and was determined to be negative . The patient was then admitted to the internal medicine intensive care unit . After performing a gastric lavage via a nasogastric tube, activated charcoal was initiated and continued at a dose of 50 grams every 6 hours . The patient was rehydrated via intravenous (iv) administration with 0.9% sodium chloride and 5% dextrose to guard against the risk of hypoglycemia . Simultaneously, silibinin, at a bolus dose of 5 mg / kg iv, was initiated and followed by a continuous iv infusion of 20 mg / kg / day . Acetylcysteine was given by continuous iv infusion for 21 hours, with a total dose of 300 mg / kg (150 mg / kg over 1 hour, followed by 50 mg / kg over 4 hours, followed by 150 mg / kg over 16 hours). Infusion of penicillin g in doses of 1,000,000 u / kg / day, multivitamin, and alpha lipoic acid were started . Complete blood count, biochemistry measurements, and blood gas monitoring were performed every 6 hours (tables 2 and 3). At 6 hours after his admission, aspartate aminotransferase (ast) was 880 u / l; alanine aminotransferase (alt) 665 u / l; lactate dehydrogenase (ldh) 1,028 u / l; total bilirubin 4.9 mg / dl; direct bilirubin 1.9 mg / dl; prothrombine time (pt) 36.5 seconds; and international normalized ratio (inr) 3.11 . Vitamin k (menadion 20 mg / day, iv) and metilprednisolone in doses of 1 mg / kg / day were started . At 12 hours from admission, ast was 1,836 u / l; alt 1,232 u / l; ldh 1,471 u / l; total bilirubin 7.2 mg / dl; direct bilirubin 3.1 mg / dl; pt 73.1 seconds; and inr 6.86 . Upon arterial blood gas analysis, the patient had metabolic acidosis with a normal anion gap (ag) and respiratory alkalosis (ph 7.38; partial pressure of carbon dioxide [pco2] 26.5 mmhg; partial pressure of oxygen [po2] 49.5 mmhg; bicarbonate [hco3] 17.8 mmol / l; base excess [be] 8.8 fresh frozen plasma were administrated at a dose of 15 ml / kg, and hemodialysis was performed for 3 hours . At 30 hours his ast level was 1,900 u / l; alt 1,473 u / l; ldh 2,582 u / l; pt 76.5 seconds; inr 7.22; hemoglobin (hb) 12.5 g / dl; and platelets (plts) 123,000/mm . We consulted the committee for liver transplantation, but because of the patient s colon carcinoma, our application was not accepted . Hemodialysis was performed again for 4 hours, and fresh frozen plasma was given again . U / l; alt 984 u / l; ldh 3,826 u / l; pt 42.6 seconds; and inr 3.71 . At 48 hours from the time of admission, ast was 1,207 u / l; alt 1,797 u / l; ldh 4,318 u / l; total bilirubin 9.8 mg / dl; direct bilirubin 3.3 mg / dl; pt 47.7 seconds; inr 4.21; hb 11.8 g / dl; and plts 33,000/mm . Arterial blood gas analysis revealed high ag metabolic acidosis with respiratory alkalosis (ph 7.36; pco2 20.3 mmhg; po2 52.3 mmhg; hco3 14.7 mmol / l; be 13 mmol / l; and ag 25.3 his fibrinogen level was in the normal range (200400 mg / dl) and d - dimer concentration was elevated (> 2000 g hepatic encephalopathy treatment, including 500 ml of branched chain amino acid solution (hepatamine; b. braun medical inc, irvine, ca, usa) over a 12-hour period and infusion of ornithine - aspartate at a dose of 20 g / day and lactulose at a dose of 45 g / day, was started . At 54 hours u / l; total bilirubin 12.4 mg / dl; pt 111 seconds; inr 11.05; and plts 29,000/mm . Hemodialysis was performed for 4 hours and fresh frozen plasma was given again . At 60 hours, pt was 34.6 seconds; inr 2.92; hb 8.6 g / dl; and plts 12,000/mm . One unit of erythrocyte suspension was given . At 72 hours after admission, the patient lost consciousness . His body temperature was 38.2c, pulse rate 112 beats per minute, respiratory rate 32 breaths per minute, and blood pressure 89/57 mmhg . Meropenem was started at a dose of 500 mg every 12 hours for sepsis . At 78 hours 2,004 u / l; ldh 1,615 u / l; pt 100.6 seconds; inr 9.87; and plts 7,000/mm . Hemodialysis was performed for 4 hours, and fresh frozen plasma and platelet infusion at a dose of 1 u/10 kg were given . Arterial blood gas analysis showed pure respiratory alkalosis (ph 7.54; pco2 23.8 mmhg; hco3 24.1 mmol / l; be 1.6 the patient s serum lactate was 16.59 mg / dl, ammonia 415 g / dl, and serum creatinine was 2.6 mg / dl, so he was considered to have developed hepatorenal syndrome . His arterial blood gas values were ph 7.39; pco2 8.4 mmhg; po2 86.8 mmhg; hco3 10.4 mmol / l; be: 20.2 the patient went into cardiac arrest and was revived after resuscitation . On arterial blood gas analysis; ph 7.07, pco2 32.6 mmhg, po2 94.7 mmhg, hco3 9.9 mmol / l, be 18.9 mmol / l and then intravenous sodium bicarbonate, was given . At 96 hours, u / l; alt 855 u / l; pt 77.3 seconds; inr 7.31; plts 13,000/mm; hb 8.3 g / dl; serum creatinine 3.3 mg / dl; serum lactate 112 mg / dl; ph 7.36; pco2 22.3 mmhg; hco3 15.3 mmol / l; and be 12 mmol / l . At 98 hours after his admission, the patient went into cardiac arrest again and died . There are various types of wild mushrooms growing in forests and meadows which are often eaten by the local population.5 over 5,000 species of mushrooms are presumed to be found worldwide.1 poisonous and nonpoisonous mushrooms can be distinguished via previous experiences and observations.5 among mushrooms, only 20%25% have been named and only 3% of these are poisonous.1 because of the relatively high number of underreported cases, the exact incidence of mushroom poisoning cannot be precisely estimated, however, amatoxin poisoning is a worldwide problem . In western europe, approximately 50100 fatal cases are reported every year.6 this is less common in the united states; however, cases of amatoxin poisoning in africa, asia, australia, and central and south america have been also described.6 in turkey, the main portion of plant toxicities comprises mushroom poisoning . The adverse effects, which range from mild gastrointestinal symptoms to major cytotoxic effects (organ failure and death), depend on the type of mushroom . It has been reported that the amatoxin - related symptoms of mushroom poisonings began at 624 hours after the initial ingestion, and the most common first - noticed symptoms were gastrointestinal disturbance.7 determination of the latency period of symptoms after ingestion is very important in the treatment of mushroom poisoning because late toxicities (symptom onset more than 6 hours after ingestion) due to liver and renal failure are life - threatening and even fatal . Amatoxin poisoning must be suspected especially in patients who have jaundice after an acute gastrointestinal episode . Our patient was admitted to emergency service 36 hours after ingestion, so we observed the late toxicities . Alpha - amanitin (-ama) constitutes the main component of amatoxins, and it is presumably responsible for the toxic effect, along with beta - amanitin.8 cooking does not destroy these amatoxins, and they can exist in the mushroom even after long periods of cold storage.9 the lethal dose may be as little as 0.1 mg / kg body weight in adults, and this amount can be adsorbed even by ingesting a single mushroom . A considerable portion of amatoxin is taken up by hepatocytes, excreted into the bile, and reabsorbed by the enterohepatic cycle.10 the amatoxins inhibit the hepatic formation of mrna by binding to rna polymerase ii.11 hepatocellular uptake of -ama, the major amatoxin, is followed by significant hepatocyte damage and causes acute liver failure (alf) in amanita phalloides intoxications.12 as a result of hepatocyte damage in the poisonings with amanita species, ast and alt levels increase in the serum.13 eren et al14 showed that the patients who died had very high ast (2,0753,464 u / l) and alt (2,3454,048 u / l) levels . It was reported that patients developed hepatic coma after ast and alt values rose, demonstrating a significant relationship between mortality and ast and alt levels . As a result of this, ast and alt levels can be used as a prognostic marker of mushroom poisoning or an indication for liver transplantation.14 increases in ldh levels, as a result of leakage, can be used as a good marker of cell damage because it is located almost entirely in the cytoplasm.15 thus, it can be concluded that decreased viability of hepatocytes treated with -ama was related to significant morphological derangements (disruption of cell membrane). In our case, after receiving hemodialysis and fresh frozen plasma replacement on the twelfth hour these values showed a slight decrease, and then increased again . The clinical picture of amanita phalloides poisoning can range from a mild subclinical presentation to a lethal fulminant course . As a result, not all patients with amanita phalloides poisoning develop alf and have a fatal outcome . Amanita phalloides intoxication has four consecutive phases in the classical course: lag phase, gastrointestinal phase, apparent convalescence, and alf . Alf is the last phase in which the transaminases rise dramatically and liver and renal function deteriorate . This process results in hyperbilirubinemia, coagulopathy, hypoglycemia, acidosis, hepatic encephalopathy, and hepatorenal syndrome.16 multiorgan failure, disseminated intravascular coagulation, mesenteric thrombosis, convulsions, and death may result within 13 weeks after ingestion.17 our patient was diagnosed with alf because of high ammonia levels, flapping tremor, and hepatorenal syndrome . Despite our quick contact with the liver transplantation center, the patient was refused because of the colon carcinoma.18 the contraindications of liver transplantation in acute liver failure is mentioned in table 4 . Metabolic acidosis is associated with substantial morbidity and mortality, and it is a frequent acid base disturbance seen in hospitalized patients.19 lactic acidosis is the most frequent cause of metabolic acidosis in hospitalized patients . It is characterized by a high ag metabolic acidosis (ag> 12 mmol / l) with increased serum lactate concentrations (> 5 meq / l) and carries a significant risk for mortality . Tissue hypoperfusion and hypoxia encountered in metabolic acidosis commonly result in clinical situations such as shock and sepsis.19 however, the present patient developed this acid base abnormality in the presence of normal tissue perfusion and oxygenation . Many drugs have been implicated in the pathogenesis of lactic acidosis.20 moreover, toxicity of amatoxin (the toxin isolated from amanita phalloides) is commonly characterized by severe normal ag metabolic acidosis, which has been attributed to fulminant hepatic failure and tubular necrosis.21 although amatoxin is rapidly cleared by the kidneys, its direct nephrotoxicity to the proximal and distal convoluted tubules may lead to acute tubular necrosis.21 lactic acidosis progresses despite hemodialysis when blood lactate is produced faster than it can be cleared . As shown in a previous case report, if the clinical and biochemical evaluation of the patient shows signs of acidosis, hemodialysis must be performed quickly and for a prolonged period of time.22 the rising lactate level and high ag metabolic acidosis in our patient were attributed to lactic acidosis and so hemodialysis was performed . The presence of lactic acidosis and hepatorenal syndrome was directly related with the mortality of the patient . Severe mushroom intoxication caused by amanitin remains an unresolved problem in clinical toxicology because no specific and fully efficient antidote is readily available . Several substances (steroids, cimetidine, thioctic acid, etc) which were widely used in the past have been documented to be completely ineffective in the treatment of mushroom poisoning . Moreover, a retrospective analysis revealed that the current, most commonly used antidote, benzylpenicillin, shows poor clinical efficacy.23 overall results of a meta - analysis indicate that silibinin or acetylcysteine are found to be more effective in mushroom poisoning therapy in humans.24 however, acetylcysteine, silibinin, and benzylpenicillin were found to be ineffective in limiting hepatic injury after -ama poisoning in a murine model.25 our patient did not respond to the combination therapy of acetylcysteine, silibinin, benzylpenicillin, steroids, thioctic acid, and multivitamins . The major parameter in the treatment of mushroom poisoning is the time of admission to hospital after ingestion . The accidental consumption of poisonous mushrooms picked from their natural source presents a significant health problem, and clinicians should attempt to raise public awareness.
However, cognitive function tends to decline with age, which can affect the ability to drive safely . The accident rate per mile driven among drivers over the age of 65 has been found to be higher than that among middle - aged drivers, and when injured in a collision, these older drivers are also more likely to die or to sustain serious injuries2 . Cognitive psychologists have demonstrated that the anterior attention system plays a major role in higher - level executive control of attention during more complex cognitive tasks, such as problem - solving and decision - making, especially when multi - tasking3 . For example, stephens and tunney5 provided evidence that chewing gum increases scores in immediate, delayed recall, and working memory tests . Similarly, johnson and miles6 confirmed that chewing gum during learning and/or recall improves subsequent memory . The cognitive processes improved by chewing have been systematically investigated and include memory, attention, and executive function5 . Specifically, gum - chewing during cognitive testing has been found to improve verbal working memory and immediate episodic long - term memory, sustained attention and language - based attention . The results for gum - chewing s effects on word - association executive function are conflicting7 . On the basis of these previous reports thus, the purpose of this study was to determine the effects of chewing gum on driving performance . To assess this, the subjects comprised 26 young drivers (10 females) who held valid driving licenses (mean driving distance, 87,200 31,134 km / year; possession of driver s license, 3.40 2.20 years). All subjects were informed of the purpose and methods of the study prior to participation and provided their informed consent, following the ethical principles of the declaration of helsinki . Exclusion criteria were (i) inability to chew gum for a period of approximately 30 min, (ii) age younger than 18 or older than 40 years, (iii) consumption of more than 40 units of alcohol per week, (iv) smoking more than 10 cigarettes per day, (v) currently taking medication, (vi) currently experiencing medical problems (including dental problems) or serious medical conditions, and (vii) allergies to gum6 . A stisim drive m400 driving simulator (system technology inc ., hawthorne, ca, usa) was used to provide subjects with various driving environments and to estimate their driving performance . The simulator consists of a car unit with adjustable car seats with a dashboard, a steering wheel, turn signals, and brake and gas pedals, and provides a 135 field of view of a simulated environment . Realistic roadway scenery is projected on a wide computer monitor, placed in front of the center of the steering wheel . Speed and gear numbers are displayed on the screen . Auditory feedback is provided through speakers and includes the sound of the engine, braking, speeding around curves, wheels, and driving off the road . Before assessment in the simulator, subjects practiced for 5 min . If a participant demonstrated comfortable performance in the driving trial, he or she was allowed to participate in the test trials . A 3-day break was provided after each trial: not chewing gum and chewing spearmint sugar - free gum . The order of the conditions was randomized . In the chewing - gum condition, participants chewed gum at their normal speed (1 hz) during driving . In the control condition, the ~30-min driving scenario consisted of a two - lane highway in each direction, with a lane width of 3.5 m. subjects were instructed to drive in a steady lateral position in the right (slower) traffic lane, following a lead vehicle, while maintaining a steady speed of 80 km / h . Participants were required to maintain speed limits, comply with traffic rules, and negotiate surrounding traffic . Mean distance driven above the speed limit, lane position, mean distance driven across the center line, and mean distance driven off the road were estimated by the simulator equipment and used as estimates of the driver s abilities of brake, accelerator, and steering control . Differences in driving performance between the no - chewing condition and the chewing gum condition and between genders were assessed using the paired t - test . The kolmogorov - smirnov test confirmed the data had a normal distribution; therefore, parametric statistics were used . A p value <0.05 was considered to indicate statistical significance in all tests . While chewing gum, drivers drove significantly shorter distances at speeds exceeding the speed limit (26.61% shorter) and off the road (31.99% shorter) than those while not chewing (p <0.05). However, lane position and mean distance driven across the center line did not differ significantly (p> 0.05; table 1table 1.effect of gum - chewing on driving capacity (n=26)chewing gum condition (mean sd)no gumchewing gummean distance driven above speed limit (m)609.9 190.9456.5 166.9lane position (m)6.79 0.466.81 0.54mean distance driven across center line (m)59.2 34.343.5 32.9mean distance driven off road (m)127.0 77.586.4 47.9p <0.05), and there was no effect of gender in either condition . Safe driving demands the capacity to concentrate and to divide attention over multiple sensory events, including visual and auditory modalities; it also requires high - level cognitive decisions in a rapidly changing environment8 . In other words, driving skills require the simultaneous integration of many types of information while coordinating movements3 . Simulated driving studies indicate that measures of driving behavior, such as speed, lane position, and time / distance across the center line and off the road edge, correlate with a driver s comfort with the given driving conditions . Driving is a complex task requiring appropriate responses to hazardous situations on the road, and research has shown that attention and executive function correlate with driving status . The stisim driving simulator is widely used to examine the driving abilities of drivers with poor performance9 . This study assessed mean speed, mean distance driven above the speed limit, lane position, mean distance driven across the center line, and mean distance driven off the road edge as proxies for driving performance . Chewing previous studies have indicated that chewing gum during specific tasks improves reaction times10 and has positive impacts on activities requiring cognitive function . Gum chewing may improve cognitive function by promoting regional cerebral blood flow and glucose delivery and by increasing the efficiency of attention and concentration11, 12 . Poor performance in a task requiring divided attention is frequently observed in adults with dementia, and previous studies have shown that divided attention problems also exist in many individuals with mild cognitive impairment13 . Cognitively impaired older drivers often do not intend to restrict or stop driving in the future, and do not consider their cognitive problems to be serious; thus, gum - chewing may reduce the risk of accidents among these individuals while their impairments remain mild3 . Our conclusion is that chewing gum enhances alertness and attention while driving, because it makes drivers feel more comfortable during driving activities . Also, this study has provided further evidence that driving simulators can be used to assess responses to road hazards in a safe environment . Driving simulator recordings have previously been used to assess age - related changes in driving performance and cognition14, and to predict potential future crashes by older drivers15 . Further research may clarify the mechanism by which chewing gum improves performance in a task, such as driving, that requires sustained attention and executive function.
Is found in india as an evergreen tree in the temperate himalayas at altitudes between 1800 and 3300 m and in the hills of meghalaya and manipur at an altitude of 1500 m. taxus is distributed in europe, north america, north india, pakistan, china, and japan . It is a small medium - sized evergreen tree growing from 10 to 28 m in height . The leaves are flat, dark green, and arranged spirally on the stem . In asia, its distribution stretches from afghanistan through the himalayas to the philippines, and it is widely distributed in pakistan and india . In india, it grows in its natural habitat in nanda devi biosphere reserve (ndbr) of garhwal himalayas, particularly on the north to north - west slopes . The himalayan yew, known as thuner in western himalayas, has high medicinal value and ethnobotanical importance . The plant holds an important place in traditional medicine and its products are used by the local populations for treating common infections . It received wide attention recently because its leaves and bark were found to be the prime source of taxol, a potent anticancer drug which has a unique property of preventing the growth of cancerous cells and is used in the treatment of breast and ovarian cancers . Taxol was first isolated from the bark of taxus brevifolia, and since then, taxol and related bioactive taxoids have been reported from various other species of the genus taxus . Excellent clinical results with taxol in the treatment of various cancers, particularly in refractory ovarian and breast cancers, have led to substantial demand for this drug . The leaves and bark of t. brevifolia, t. wallichiana, and other taxus species have been used for the extraction of taxol . Due to overexploitation, moreover, several species are disappearing at an alarming rate mainly at higher altitudes due to over - harvesting, habitat destruction, and abrupt climate change . Available literature on t. wallichiana shows its analgesic, antipyretic, anti - inflammatory, immunomodulatory, antiallergic, anticonvulsant, anticociceptive, antiosteoporotic, antibacterial, antifungal, antiplatelet, and antispasmodic activities and vasorelaxing effect . The himalayan yew has a remarkable history of its usage in the traditional system of medicine . The indigenous people live in nearby forests and possess substantial amount of traditional wisdom on plant utilization . Himalayan medicinal plants form important constituents of alternative medicinal systems such as amchi, ayurveda, han chinese, unani, and other traditional medicine systems that are prevalent in this region . Native populations and the inhabitants of the buffer zone villages of ndbr use these plants and their products in folk medicine for the treatment of common infections . Himalayan yew has been used traditionally for the treatment of high fever and painful inflammatory conditions . It is consumed as decoctions, herbal tea, and juice for treating cold, cough, respiratory infections, indigestion, and epilepsy . Its bark and leaves are used in steam baths to treat rheumatism, and the paste made from its bark is used to treat fractures and headaches . The bark and leaves of t. wallichiana are used in unani medicine as a source of the drug zarnab, which is prescribed as a sedative, aphrodisiac, and as a treatment for bronchitis, asthma, epilepsy, snake bite, and scorpion stings . Young shoots of the plant are used in ayurveda to prepare a tincture for the treatment of headache, giddiness, feeble and falling pulse, coldness of extremities, diarrhea, and severe biliousness . The analgesic and anti - inflammatory properties of the t. wallichiana bark extract have been studied . Tasumatrol b, 1,13-diacetyl-10-deacetylbaccatin iii (10-dad), and 4-deacetylbaccatin iii (4-dab) were isolated from the bark extract of t. wallichiana zucc . The compounds were assessed for anti - inflammatory and analgesic activities using an acetic acid induced writhing model, carrageenan - induced paw edema model, and in vitro lipoxygenase inhibitory assay . All the compounds, especially tasumatrol b, showed significant anti - inflammatory activity in carrageenan - induced paw edema model, which is used extensively to determine the anti - inflammatory effect of new investigational agents . Taxusabietane a, isolated from the bark extract of t. wallichiana, was analyzed for in vivo and in vitro anti - inflammatory activities using the lipoxygenase inhibitory assay and the carrageenan - induced paw edema model, where taxusabietane a showed significant anti - inflammatory activity . Using the acetic acid induced abdominal writhing model, all compounds, particularly tasumatrol b, revealed significant analgesic activity . Acetic acid plays a critical role in nociception . Involving the prostaglandin and cyclooxygenase biosynthetic pathway, it releases arachidonic acid . Analgesic properties of t. wallichiana extract may be due to its inhibitory effects on the biosynthesis of arachidonic acid metabolites . The potential of tasumatrol b as a new lead compound for the management of pain and inflammation can be further explored . It was found that the methanol extracts of t. wallichiana possess potent anticonvulsant and antipyretic activities . The plant extract, when administered in doses of 100 mg / kg and 200 mg / kg, significantly inhibited myoclonus and clonus, while inhibition of tonus and hind limb tonic extension were found to be more significant . In the same study, the antipyretic activity of the plant extract was also shown, where in yeast - induced pyrexia model, a 200 mg / kg dose caused a significant inhibition . However, in doses of 50 mg / kg and 100 mg / kg, it caused less significant inhibition . The anticociceptive and antipyretic activities may be attributed to the presence of phenols, polyphenols, tannins, saponins, anthraquinones, alkaloids, steroids, and especially, the diterpenes found in the crude extract of the plant . After the discovery of the anticancer drug taxol (paclitaxel) from the bark of pacific yew tree t. brevifolia, in 1971, lot of work was carried out on the chemical investigation of almost all parts (needles, bark, root, seed, heartwood) of several yew species, resulting in the isolation and characterization of 300 taxoids . Systemic studies conducted on the chemical constituents acquired from different parts of t. wallichiana revealed several taxoids of different structural types, with five of them being novel molecules . Taxiresinol 1, isotaxiresinol 2, and ()-secoisolariciresinol 3, from the heartwood of the plant, which possess anticancer activity . Among these, taxiresinol 1 showed notable in vitro anticancer activity against liver, colon, ovarian, and breast cancer cell lines . It inhibits cell proliferation by promoting the stabilization of microtubules at the g2-m phase of the cell cycle, due to which the depolymerization of microtubules to soluble tubulin is blocked . Bilobetin, a biflavone obtained from the needles of t. buccata, has also been reported to possess antifungal activity . Methanol extracts of the leaf, bark, and heartwood of t. wallichiana were tested against six bacterial and six fungal strains using the hole diffusion and microdilution methods . All extracts and fractions from the plant displayed significant antimicrobial effects, and the minimum inhibitory concentration (mic) values for the bacterial strains ranged from 0.23 to 200 mg / ml and from 0.11 to 200 mg / ml for fungi . Taxol and related bioactive taxoids from t. wallichiana may be responsible for the antimicrobial activities . These activities may also be attributed to the presence of phenols, polyphenols, tannins, saponins, anthraquinones, alkaloids, steroids, and especially, the diterpenes found in the plant extract . The extracts of t. wallichiana zucc . Have been found to possess therapeutic potential, and the plant has its important place in traditional medicine . However, traditional knowledge, which passes orally from generation to generation, is on the verge of extinction due to the disruption of cultural set - ups, caused by rapid socio - economic transformation and modernization of society . The diverse biological activities demonstrated by researchers open the door for its potential use in modern medicine . The extracts from various parts of the plant have significant activity against pain, inflammation, fever, fungal and bacterial infections, convulsions, and cancer . Further elaborative studies can lead to development of the safe actives for therapeutic use in modern medicine and will offer better understanding of its mechanism of action.
As a medical specialty, pathology generates and interprets laboratory data on fluid and tissue specimens . The data generated and interpretations rendered must be accurate, reproducible, and presented in a clearly understandable format, as clinical decisions will be made based on this information . To manage an ever - increasing volume and complexity of data, informatics solutions have been sought to more effectively analyze, track, integrate, and communicate this important clinical information . Pathology informatics focuses on pathology information, analysis tools, and processes . Due to the recent exponential growth in medical data, discoveries, and diagnostic technologies; some pathology informatics applications include the storage of intralaboratory data, test triage and utilization, electronic communication of test orders and results between locations, digital image libraries, search engines for biorepositories, and bioinformatics, which itself is a subset discipline of biomedical informatics that seeks to analyze large biologic datasets and develop computational algorithms . Despite the view of informatics as a distinct subspecialty, its roots are embedded within all pathology disciplines, as the entire specialty seeks to optimize its ability to manage information . Pathologists utilize nucleic acid - based techniques and clinical correlation to diagnose, determine prognosis, predict response to therapy, and manage family care and decisions . The rapid growth of molecular pathology has left the field vulnerable to potential errors in communication, disorganized data storage, and inefficient workflows . Moreover, molecular pathology laboratories must perform comprehensive validation and quality assurance / quality control (qa / qc) of both the wet - lab laboratory developed tests and the dry lab bioinformatics pipelines . Despite these challenges, in many molecular laboratories, the steps of accessioning, intralaboratory workflow, and interpretation and resulting remain a largely paper - driven (or excel spreadsheet - driven) process . With the high complexity of both the testing performed and the data generated, these manual error - prone processes must be addressed by informatics solutions across the entire testing cycle for molecular diagnostics . Current molecular assay techniques such as quantitative reverse transcriptase polymerase chain reaction (qrt - pcr) and fragment analysis by capillary electrophoresis require software and computational algorithms to accurately determine the results of these technical assays . The ongoing clinical implementation of next generation sequencing (ngs) will result in dramatic increases of data generated by molecular pathology laboratories . Current manual curating methods for novel genetic variants are extremely time - consuming, cannot scale with the increasing volume and complexity of cases, and will require automated and intelligent computational methods to streamline variant analysis . The speed of molecular innovation and the need to integrate genetic data with other pathology and clinical data pose informatics challenges unique to the discipline . Furthermore, in light of recent federal mandates and upcoming changes in reimbursements, molecular pathologists will need to leverage informatics to adapt the testing environment of a molecular laboratory to these new regulations . In this paper, we will discuss informatics training in molecular pathology based on our clinical fellowship in pathology informatics experience over the past 5 years . Our pathology informatics clinical fellowship program is based in a large diversified healthcare system and operates in two large academic medical centers and a community hospital with a strong outreach program . It has approximately 20 active faculty members, has graduated 12 fellows since 2009, and has seven active clinical fellows . The customizable arm (which represents approximately two - thirds of a fellow's time) involves rotations, mentorships, research projects, and didactic activities aligned to the fellow's interests and career goals . The required arm involves largely didactic activities across the entire breath of pathology informatics domains . The goal of the required arm is to expose the fellow to all major components of informatics, while the customized area allows deep specialization . The foundation of the required arm of the fellowship is a weekly session of readings, lectures, and faculty - led discussions termed the the core didactic attempts to present informatics as the study and management of information, information systems, processes, and governance . The details of the core didactic course and other components of the educational structure have been published previously . Initially the fellowship was designed as a 1 or 2-year experience for pathologists interested in becoming director of pathology informatics in a pathology department or healthcare system . Very quickly, however, it became clear that there was another, larger group of pathologists with a different career goal . These trainees were interested in becoming a director other pathology laboratories, such as surgical pathology, microbiology, clinical chemistry, etc ., and were interested in learning how to apply informatics principles to those more traditional disciplines . Today, this type of trainee represents over two - thirds of our fellows . To support this demand, director of pathology informatics track (for those interested in becoming directors) and a 1 + 1 track in which a trainee does two coordinated fellowships: 1 year of clinical informatics and a 1- or 2-year fellowship in another pathology domain . Of the 17 fellows graduated or active in our program, five have done or are currently doing fellowships in both informatics and molecular pathology, making molecular pathology the most popular 1 + 1 combination . Those five pathologists / trainees are authors on this paper (dm, rl, mp, gr, and wl). For teaching purposes, our fellowship program divides pathology informatics into four main divisions: information fundamentals, information systems, workflow and process, and governance and management . Within this framework, we will describe some of the pathology informatics challenges that are important to molecular pathology, highlight informatics disciplines of particular relevance to molecular pathology [tables 14], propose possible rotations and/or research projects to provide informatics fellows with vital practical experience in molecular pathology [table 5], and outline a suggested curriculum for training pathology informatics fellows with a career interest in molecular pathology . Information fundamentals governance and management suggested curriculum areas and fellow rotations for fellowship training in pathology informatics and molecular pathology our pathology informatics clinical fellowship program is based in a large diversified healthcare system and operates in two large academic medical centers and a community hospital with a strong outreach program . It has approximately 20 active faculty members, has graduated 12 fellows since 2009, and has seven active clinical fellows . The customizable arm (which represents approximately two - thirds of a fellow's time) involves rotations, mentorships, research projects, and didactic activities aligned to the fellow's interests and career goals . The required arm involves largely didactic activities across the entire breath of pathology informatics domains . The goal of the required arm is to expose the fellow to all major components of informatics, while the customized area allows deep specialization . The foundation of the required arm of the fellowship is a weekly session of readings, lectures, and faculty - led discussions termed the the core didactic attempts to present informatics as the study and management of information, information systems, processes, and governance . The details of the core didactic course and other components of the educational structure have been published previously . Initially the fellowship was designed as a 1 or 2-year experience for pathologists interested in becoming director of pathology informatics in a pathology department or healthcare system . Very quickly, however, it became clear that there was another, larger group of pathologists with a different career goal . These trainees were interested in becoming a director other pathology laboratories, such as surgical pathology, microbiology, clinical chemistry, etc ., and were interested in learning how to apply informatics principles to those more traditional disciplines . Today, this type of trainee represents over two - thirds of our fellows . To support this demand, director of pathology informatics track (for those interested in becoming directors) and a 1 + 1 track in which a trainee does two coordinated fellowships: 1 year of clinical informatics and a 1- or 2-year fellowship in another pathology domain . Of the 17 fellows graduated or active in our program, five have done or are currently doing fellowships in both informatics and molecular pathology, making molecular pathology the most popular 1 + 1 combination . Those five pathologists / trainees are authors on this paper (dm, rl, mp, gr, and wl). For teaching purposes, our fellowship program divides pathology informatics into four main divisions: information fundamentals, information systems, workflow and process, and governance and management . Within this framework, we will describe some of the pathology informatics challenges that are important to molecular pathology, highlight informatics disciplines of particular relevance to molecular pathology [tables 14], propose possible rotations and/or research projects to provide informatics fellows with vital practical experience in molecular pathology [table 5], and outline a suggested curriculum for training pathology informatics fellows with a career interest in molecular pathology . Information fundamentals governance and management suggested curriculum areas and fellow rotations for fellowship training in pathology informatics and molecular pathology the partners pathology informatics fellowship has the unique advantage of having five former or current 1 + 1 fellows in both pathology informatics and molecular pathology . All five of these pathologists (dm, rl, mp, gr, and wl) worked to evaluate the current program's core curriculum topics and subtopics for relevance to molecular pathology . Topics pertinent to the molecular pathologist, but currently not well covered by the curriculum were also identified . Focusing on this overlap between pathology informatics and molecular pathology, we developed a draft curriculum for those with interest in both fields . Informatics and molecular pathology faculty with diverse backgrounds at brigham and women's hospital, massachusetts general hospital, and north shore medical center then reviewed and edited the proposed curriculum . Information fundamentals include the subdomains of information architecture, information quality, information manipulation, cognition and human- computer interaction, software design principles, and special domains [table 1]. Importantly, information fundamentals focuses mostly on the underlying concepts; for example, information manipulation focuses . Mostly on algorithms and algorithm design rather than actual programming . Of particular significance to a molecular pathologist is a fundamental understanding of database design, information quality and manipulation, and algorithm basics . Some of the fundamentals that need to be the focus of informatics training for molecular pathologists are highlighted by specific challenges facing molecular diagnostics described below . A basic understanding and appreciation of computational algorithms is becoming increasingly critical for a practicing molecular pathologist . These techniques are currently used in a number of contexts, ranging from molecular test utilization to the management and analysis of large datasets . For instance, with the sheer volume of data generated by ngs technology, we rely on computationally intensive bioinformatics algorithms to apply quality scores and filters to the sequence data, align individual sequences to a reference genome, and identify variants . All these processes occur before the molecular pathologist gets a list of variants to interpret for a given patient . Understanding the limits of the technology and associated informatics will inform the pathologist about the accuracy of the variant calls and the limitations of the clinical test (i.e. Capacity to detect insertions / deletions or translocations and difficulty with genes with high homology) and translate into a higher quality, actionable pathology report for the clinician . A predicament facing genetic analysis large databases such as human gene mutation database (hgmd), online mendelian inheritance in man (omim), and catalogue of somatic mutations in cancer (cosmic) attempt to establish disease - gene associations in a categorical fashion . As the variants found in a patient's sample are cross - referenced against these databases, the quality, and breadth of the database entry and metadata are vital to a molecular pathologist's interpretation of their given case . However, there is currently a lack of standards in information content for genetic databases and the existing data is only as good as the original studies and any subsequent curating . Often, the underlying research data may be poor or inadequate and not interpreted to a high clinical standard, though large consortium efforts such as the clinvar database are being developed to address this issue . In addition to public databases, many molecular labs will have local databases, including those containing sequence variants and annotations or images of fluorescence in situ hybridization fish) cases and tumor slides used for molecular testing . A molecular pathologist must be able to critically analyze the quality of the archived data before applying it to his or her case interpretation . Moreover, this interpretation would be assisted tremendously by an informatics solution that can gather all relevant data from published literature, genetic databases, protein computational analysis programs, etc ., and present it to the molecular pathologist in a format conducive to case sign - out and subsequent integrated reporting . Sample archiving in molecular pathology is becoming more important as biobanking of deoxyribonucleic acid (dna) is becoming increasingly commonplace at many academic medical centers for future clinical and research uses . These biorepositories require a strong understanding of specimen inventory control, consent tracking database design, and basic information retrieval concepts (such as ontologies and natural language processing). Information retrieval from these biobanks is complicated by a lack of consensus medical terminology, a problem that affects all healthcare informatics . For example, a query for the terms colon cancer, colorectal carcinoma, and bowel cancer, all must be reconciled and return the same search results . The uniform use of medical ontologies such as snomed - ct or the national library of medicine's unified medical language system (umls) is therefore essential for applications where the quality of the search engine is crucial . For training purposes, some examples of projects that fall under the information fundamentals umbrella [table 5] may include work with laboratory database developers or administrators . For a fellow, understanding the structure of a molecular lab's database of genetic information, the metadata captured, and the ability to query, is invaluable . Our fellowship divides information systems into infrastructure, laboratory information systems (liss), interfaces, system life cycle, health information systems (electronic health records (ehrs), billing, admission transfers discharges systems (adt), etc . ), and imaging information systems [table 2]. These information systems are interwoven into major healthcare systems today, with pathologists utilizing both the lis as well as the ehrs . Currently in the vendor market, there is a shortage of lis and ehr systems with the ability to appropriately track and store genetic data in a satisfactory manner for laboratory professionals . A fundamental understanding of the lis and the ehr, the interfaces between them, and their dynamic capabilities will help molecular pathologists manage the unique aspects of the data generated by the molecular laboratory . One pressing issue facing molecular pathology is the relationship between genomic data and the patient's ehr . Germline genomic data is unique in that it is a static block of information that needs to be dynamically accessed and bioinformatically reanalyzed as clinical scenarios change and genetic data evolves . For example, some models of the future of genetic testing predict that all newborn babies will have their genomes sequenced and stored, perhaps at an annual fee . In this scenario should we store the raw sequencing data for all 3 billion base pairs of the genome, or just the single nucleotide, copy number, and structural variant calls (approximately 3 - 4 million variants)? Storing simply the variant calls requires a confidence in today's reference sequences and aligners, while storing the raw data allows for realignment as knowledge and informatics evolve . The lis / ehr could update the annotation of an individual's variants as more knowledge becomes available . While germline assays need only be performed once in a patient's lifetime, microbiome, and cancer assays likely require acquisition of new data in the form of retesting with a more current specimen . For example, at the point of disease recurrence or metastasis, sequencing the emerging tumor clone would be preferable to relying on the sequence of the primary tumor . Tracking this data and being able to assess temporal changes becomes critical . In addition, any genetic data should not be stored in isolation, but must be in a system that supports integration for pharmacogenetic support, and integration with other laboratory data . Finally, security of genomic data is imperative, since unlike other laboratories test results such as a white blood cell count, a patient's genetic sequence contains inherent sample identity . Two - way decision support that can guide both clinician test ordering and pathologist interpretation is a key component of today's lis optimized for genetic testing . Molecular tests are expensive relative to traditional laboratory tests and inappropriate orders by clinicians can potentially cost a laboratory hundreds of thousands of dollars per year . For instance, one recent report suggests that approximately 30% of complex genetic tests are ordered in error, adding unnecessary costs and delaying proper diagnosis . While many laboratories employ genetic counselors to review test orders, manual test order review is a time - consuming and expensive process . Furthermore, with the upcoming changes in medicare reimbursement and federally mandated value - based healthcare on the horizon, cost containment will become critical to a molecular laboratory's financial sustainability . Many payors (insurance companies) have developed and implemented preapproval requirements for expensive genetic tests . These preapproval processes can be complicated and confusing, involving online questionnaires and embedded algorithms to triage orders and enable insurance company approval . Much of this confusion and uncertainty could be alleviated by implementing electronic decision support directly in the ehr for computerized provider order entry (cpoe). This embedded decision support would allow a clinician to enter a patient phenotype or condition, and then suggest an appropriate genetic test (i.e. Single gene test vs gene panel vs exome vs genome). For the pathologist, once a test is technically completed, the patient phenotype could guide analysis by selecting candidate genes and variants in mendelian disease cases, driver mutations in tumor cases, or relevant bacterial sequences in microbiome cases . A molecular pathologist with a keen understanding of their lis could guide effective development of a system tailored for such a workflow, and assist clinical colleagues in implementing test selection and algorithmic / tiered testing directly in the ehr . Such a system would optimize molecular test utilization and facilitate timely and accurate test interpretations . Due to the rapid pace of medical discoveries and technological advances, new molecular assays are developed at a much faster rate than other pathology tests . This accelerated pace of test development magnifies several challenges faced by the lis . For healthcare systems that have a nonintegrated lis and ehr, adding new test definitions to the lis that cross over to the ehr is a time - consuming process that could strongly benefit from workflow optimization . Moreover, for molecular reference labs, electronic test order codes that differ between hospital locations need to be consolidated . The processes surrounding the lis must evolve to keep pace with an ever - changing molecular test menu . Although the difficulties stemming from the rapid growth of molecular tests and their subsequent test definitions in a lis / ehr could be alleviated with integrated systems that contain both anatomic and clinical pathology databases, many healthcare systems today rely on the best of breed approach, consisting of multiple, nonintegrated systems from different vendors . Additionally, different hospitals within the same healthcare system may use a different lis / ehr system or run on separate installations / deployments of the same software, resulting in differing medical record number schemes and different test codes for the same test . This rapid growth in molecular tests poses a unique problem for healthcare systems . For training considerations, experience with information systems can be obtained through operational rotations with the lis team, where the fellow can gain practical experience with the capabilities and limitations of an institution's lis and ehr . Specific projects will be influenced by an institution's information technology (it) priorities, but one area where a pathology informatics fellow could lend key clinical expertise is building genetic testing decision support tools and reporting templates into the lis . These test utilization projects are exceptionally timely given recent reports that many complex genetic tests are ordered in error, and the consequences of genetic test misinterpretation by clinicians . Workflow and process theory as applied to pathology seeks to optimize the efficiency and effectiveness of a laboratory's practices and procedures . Subdivisions of this area of study include process and quality improvement, process management, workflow analysis, automation, and decision support [table 3]. While workflow is critical to the functioning of any clinical laboratory, molecular pathologists are faced with challenges that make training in workflow design and engineering particularly important [figure 1]. The test ordering process with molecular testing can be complicated as they may be placed by either the original ordering clinician or internally by the pathologist (add - on testing), and multiple tests may be ordered on the same sample both within molecular and in other pathology subspecialties . Furthermore, a molecular laboratory must be able to collect, accession, and work with a variety of specimen types, including frozen tissue, paraffin - embedded tissue, cytology fine needle aspirate specimens, cerebral spinal fluid, bone marrow, blood, amniotic fluid, and other body fluids . Each specimen type may have different associated methodologies even for the same test (i.e. A pcr - based test requires a different dna extraction protocol for formalin - fixed paraffin embedded tissue as compared to blood). Once a sample is in the lab, important to molecular pathology is the concept of unidirectional workflow . Given the sensitivity of nucleic acid amplification methods, samples are tracked through the laboratory with the designation of pre or post pcr to minimize contamination . Molecular specimen tracking is nontrivial because the system needs to differentiate between the original specimen and the specimen tested (post dna extraction / purification), while also efficiently tracking shared specimens (e.g. Clinical microbiology and molecular microbiology). Locating misplaced specimens, wastes personnel time and finally, workflows amongst molecular tests vary widely in turnaround times, ranging from hours / days (molecular microbiology) to weeks / months (array comparative genomic hybridization and sequencing panels). The testing cycle for a molecular diagnostic test is outlined with key informatics and workflow considerations highlighted for each step for genomic testing involving direct sequence analysis, after the technical component is complete, hours to days of informatics processing is required . Including time for interpretation moreover, a single genomic test may require technical confirmation using an orthogonal technology (e.g. Sanger sequencing for sequence variants) or functional confirmation of a variant of unknown significance ., with poorly covered regions of the genome that cannot be evaluated unless the data gaps are filled in with an additional assay . All these steps add to the clinical sensitivity of genetic testing, but unfortunately also increase turnaround time . Furthermore, as molecular diagnostics evolves, the total testing cycle may actually be considered to be the lifetime of the patient, with reinterpretation being performed on a previously performed assay at appropriate intervals . With these variables, it is clear that formal workflow analysis and strong sample tracking mechanisms are critical to the optimal functioning of a molecular pathology lab . Additionally, send - out testing poses a particular challenge for molecular pathology . Many new esoteric molecular tests are being developed and offered by private companies . At our institutions, many molecular send - out tests are ordered once by a clinician and may never be ordered again that year . There may be hundreds of these individual tests ordered at an extremely low frequency . From the laboratory's perspective, there remains a need for optimal test ordering and utilization and the requirement to store results within the local lis that may or may not have the particular send - out test defined . Regulatory requirements exist for handling results of send - out tests in the laboratory . Also, defining lis test codes for these tests can improve information quality by storing the data as discrete elements as opposed to free - text elements, thus more effectively communicating with the ehr . Furthermore, the common practice of returning complex genetic data in paper form limits the capabilities of integrating this information with other systems . Although many of these issues are not unique to molecular pathology, they become exponentially more complicated in the realm of molecular testing and need to be addressed with better informatics solutions . Formal workflow and process training may begin by working with a laboratory's director of operations . Ideally, a fellow could be involved in developing the workflow for a new assay being implemented in the lab, or a process improvement for a current suboptimal workflow, such as the introduction of electronic sign - out . Analysis of a particular test workflow to identify turnaround time bottlenecks is also a potentially valuable learning experience . Moreover, participation in college of american pathologist (cap) proficiency testing and/or laboratory inspections would be highly beneficial . Our fellowship's governance and management section focuses on the principles of leadership, management, and regulation . These skills are difficult to teach, yet particularly vital for a molecular pathologist who oversees a diverse clinical, technical, it, and bioinformatics staff [table 4]. All clinical laboratory systems must comply with regulatory requirements dictated by the centers for medicare and medicaid services (cms), with regulatory inspections carried out by agencies such as the joint commission (tjc), the cap, or state - run agencies . The regulatory environment for molecular laboratories is rapidly evolving and requires knowledge of ethical, legal, and regulatory statutes . One pressing ethical and legal issue facing molecular pathology is the need to develop policies regarding consent and return of incidental findings during genomic testing ., a patient may undergo genomic testing for cardiomyopathy and be found to have a cancer susceptibility variant . This past march, the american college of medical genetics and genomics (acmg) released a list of 57 genes that should be interrogated for incidental findings . However, policies regarding reporting these incidental findings vary between molecular laboratories, and pathologists and geneticists must develop a cohesive strategy for both obtaining informed consent and reporting these findings . In addition, when developing an informed consent form, an institution's legal department and the molecular laboratory must be in agreement, and state laws vary regarding informed consent regarding genomic testing . Unlike many clinical laboratories, molecular pathology tests are largely laboratory developed tests requiring diligent validation and qa / qc measures . While many labs are accustomed to performing technical qa / qc, the bioinformatics pipeline must also be validated, versioned, and maintained . Likewise, formal documentation not only of the wet - lab validation, but also of the code underlying the informatics analysis, is mandatory . Bioinformatics proficiency testing is beginning to emerge and ever - changing algorithms may split the revalidation of technical components from the revalidation of wet - lab components . We may soon see proficiency testing samples in the form of emailed digital files instead of traditional vials filled with a biological analyte . This presents an added management difficulty because most bioinformaticians are academically trained and less familiar with it industry standards and practices, such as strict software versioning control platforms (such as git and mercurial) and documentation practices, both important in clinical production environments . Additionally, bioinformaticians possess a different skillset than traditional informatics analysts such as a lis manager or a project manager . Therefore, even if a molecular pathology laboratory director is not formally trained in pathology informatics or bioinformatics, a basic understanding of the two disciplines will be helpful in guiding and managing specialized teams with diverse backgrounds . For example, a fellow could be charged with overseeing all technical, informatics, and personnel components associated with a specific laboratory assay . We also continue to participate in focused case - based retreats using simulated business school style case studies to expose exposing trainees to real - life practical scenarios . Information fundamentals include the subdomains of information architecture, information quality, information manipulation, cognition and human- computer interaction, software design principles, and special domains [table 1]. Importantly, information fundamentals focuses mostly on the underlying concepts; for example, information manipulation focuses . Mostly on algorithms and algorithm design rather than actual programming . Of particular significance to a molecular pathologist is a fundamental understanding of database design, information quality and manipulation, and algorithm basics . Some of the fundamentals that need to be the focus of informatics training for molecular pathologists are highlighted by specific challenges facing molecular diagnostics described below . A basic understanding and appreciation of computational algorithms is becoming increasingly critical for a practicing molecular pathologist . These techniques are currently used in a number of contexts, ranging from molecular test utilization to the management and analysis of large datasets . For instance, with the sheer volume of data generated by ngs technology, we rely on computationally intensive bioinformatics algorithms to apply quality scores and filters to the sequence data, align individual sequences to a reference genome, and identify variants . All these processes occur before the molecular pathologist gets a list of variants to interpret for a given patient . Understanding the limits of the technology and associated informatics will inform the pathologist about the accuracy of the variant calls and the limitations of the clinical test (i.e. Capacity to detect insertions / deletions or translocations and difficulty with genes with high homology) and translate into a higher quality, actionable pathology report for the clinician . A predicament facing genetic analysis large databases such as human gene mutation database (hgmd), online mendelian inheritance in man (omim), and catalogue of somatic mutations in cancer (cosmic) attempt to establish disease - gene associations in a categorical fashion . As the variants found in a patient's sample are cross - referenced against these databases, the quality, and breadth of the database entry and metadata are vital to a molecular pathologist's interpretation of their given case . However, there is currently a lack of standards in information content for genetic databases and the existing data is only as good as the original studies and any subsequent curating . Often, the underlying research data may be poor or inadequate and not interpreted to a high clinical standard, though large consortium efforts such as the clinvar database are being developed to address this issue . In addition to public databases, many molecular labs will have local databases, including those containing sequence variants and annotations or images of fluorescence in situ hybridization fish) cases and tumor slides used for molecular testing . A molecular pathologist must be able to critically analyze the quality of the archived data before applying it to his or her case interpretation . Moreover, this interpretation would be assisted tremendously by an informatics solution that can gather all relevant data from published literature, genetic databases, protein computational analysis programs, etc ., and present it to the molecular pathologist in a format conducive to case sign - out and subsequent integrated reporting . Sample archiving in molecular pathology is becoming more important as biobanking of deoxyribonucleic acid (dna) is becoming increasingly commonplace at many academic medical centers for future clinical and research uses . These biorepositories require a strong understanding of specimen inventory control, consent tracking database design, and basic information retrieval concepts (such as ontologies and natural language processing). Information retrieval from these biobanks is complicated by a lack of consensus medical terminology, a problem that affects all healthcare informatics . For example, a query for the terms colon cancer, colorectal carcinoma, and bowel cancer, all must be reconciled and return the same search results . The uniform use of medical ontologies such as snomed - ct or the national library of medicine's unified medical language system (umls) is therefore essential for applications where the quality of the search engine is crucial . For training purposes, some examples of projects that fall under the information fundamentals umbrella [table 5] may include work with laboratory database developers or administrators . For a fellow, understanding the structure of a molecular lab's database of genetic information, the metadata captured, and the ability to query, is invaluable . Our fellowship divides information systems into infrastructure, laboratory information systems (liss), interfaces, system life cycle, health information systems (electronic health records (ehrs), billing, admission transfers discharges systems (adt), etc . ), and imaging information systems [table 2]. These information systems are interwoven into major healthcare systems today, with pathologists utilizing both the lis as well as the ehrs . Currently in the vendor market, there is a shortage of lis and ehr systems with the ability to appropriately track and store genetic data in a satisfactory manner for laboratory professionals . A fundamental understanding of the lis and the ehr, the interfaces between them, and their dynamic capabilities will help molecular pathologists manage the unique aspects of the data generated by the molecular laboratory . One pressing issue facing molecular pathology is the relationship between genomic data and the patient's ehr . Germline genomic data is unique in that it is a static block of information that needs to be dynamically accessed and bioinformatically reanalyzed as clinical scenarios change and genetic data evolves . For example, some models of the future of genetic testing predict that all newborn babies will have their genomes sequenced and stored, perhaps at an annual fee . In this scenario should we store the raw sequencing data for all 3 billion base pairs of the genome, or just the single nucleotide, copy number, and structural variant calls (approximately 3 - 4 million variants)? Storing simply the variant calls requires a confidence in today's reference sequences and aligners, while storing the raw data allows for realignment as knowledge and informatics evolve . The lis / ehr could update the annotation of an individual's variants as more knowledge becomes available . While germline assays need only be performed once in a patient's lifetime, microbiome, and cancer assays likely require acquisition of new data in the form of retesting with a more current specimen . For example, at the point of disease recurrence or metastasis, sequencing the emerging tumor clone would be preferable to relying on the sequence of the primary tumor . Tracking this data and being able to assess temporal changes becomes critical . In addition, any genetic data should not be stored in isolation, but must be in a system that supports integration for pharmacogenetic support, and integration with other laboratory data . Finally, security of genomic data is imperative, since unlike other laboratories test results such as a white blood cell count, a patient's genetic sequence contains inherent sample identity . Two - way decision support that can guide both clinician test ordering and pathologist interpretation is a key component of today's lis optimized for genetic testing . Molecular tests are expensive relative to traditional laboratory tests and inappropriate orders by clinicians can potentially cost a laboratory hundreds of thousands of dollars per year . For instance, one recent report suggests that approximately 30% of complex genetic tests are ordered in error, adding unnecessary costs and delaying proper diagnosis . While many laboratories employ genetic counselors to review test orders, manual test order review is a time - consuming and expensive process . Furthermore, with the upcoming changes in medicare reimbursement and federally mandated value - based healthcare on the horizon, cost containment will become critical to a molecular laboratory's financial sustainability . Many payors (insurance companies) have developed and implemented preapproval requirements for expensive genetic tests . These preapproval processes can be complicated and confusing, involving online questionnaires and embedded algorithms to triage orders and enable insurance company approval . Much of this confusion and uncertainty could be alleviated by implementing electronic decision support directly in the ehr for computerized provider order entry (cpoe). This embedded decision support would allow a clinician to enter a patient phenotype or condition, and then suggest an appropriate genetic test (i.e. Single gene test vs gene panel vs exome vs genome). For the pathologist, once a test is technically completed, the patient phenotype could guide analysis by selecting candidate genes and variants in mendelian disease cases, driver mutations in tumor cases, or relevant bacterial sequences in microbiome cases . A molecular pathologist with a keen understanding of their lis could guide effective development of a system tailored for such a workflow, and assist clinical colleagues in implementing test selection and algorithmic / tiered testing directly in the ehr . Such a system would optimize molecular test utilization and facilitate timely and accurate test interpretations . Due to the rapid pace of medical discoveries and technological advances, new molecular assays are developed at a much faster rate than other pathology tests . This accelerated pace of test development magnifies several challenges faced by the lis . For healthcare systems that have a nonintegrated lis and ehr, adding new test definitions to the lis that cross over to the ehr moreover, for molecular reference labs, electronic test order codes that differ between hospital locations need to be consolidated . The processes surrounding the lis must evolve to keep pace with an ever - changing molecular test menu . Although the difficulties stemming from the rapid growth of molecular tests and their subsequent test definitions in a lis / ehr could be alleviated with integrated systems that contain both anatomic and clinical pathology databases, many healthcare systems today rely on the best of breed approach, consisting of multiple, nonintegrated systems from different vendors . Additionally, different hospitals within the same healthcare system may use a different lis / ehr system or run on separate installations / deployments of the same software, resulting in differing medical record number schemes and different test codes for the same test . This rapid growth in molecular tests poses a unique problem for healthcare systems . For training considerations, experience with information systems can be obtained through operational rotations with the lis team, where the fellow can gain practical experience with the capabilities and limitations of an institution's lis and ehr . Specific projects will be influenced by an institution's information technology (it) priorities, but one area where a pathology informatics fellow could lend key clinical expertise is building genetic testing decision support tools and reporting templates into the lis . These test utilization projects are exceptionally timely given recent reports that many complex genetic tests are ordered in error, and the consequences of genetic test misinterpretation by clinicians . Workflow and process theory as applied to pathology seeks to optimize the efficiency and effectiveness of a laboratory's practices and procedures . Subdivisions of this area of study include process and quality improvement, process management, workflow analysis, automation, and decision support [table 3]. While workflow is critical to the functioning of any clinical laboratory, molecular pathologists are faced with challenges that make training in workflow design and engineering particularly important [figure 1]. The test ordering process with molecular testing can be complicated as they may be placed by either the original ordering clinician or internally by the pathologist (add - on testing), and multiple tests may be ordered on the same sample both within molecular and in other pathology subspecialties . Furthermore, a molecular laboratory must be able to collect, accession, and work with a variety of specimen types, including frozen tissue, paraffin - embedded tissue, cytology fine needle aspirate specimens, cerebral spinal fluid, bone marrow, blood, amniotic fluid, and other body fluids . Each specimen type may have different associated methodologies even for the same test (i.e. A pcr - based test requires a different dna extraction protocol for formalin - fixed paraffin embedded tissue as compared to blood). Once a sample is in the lab, important to molecular pathology is the concept of unidirectional workflow . Given the sensitivity of nucleic acid amplification methods, samples are tracked through the laboratory with the designation of pre or post pcr to minimize contamination . Molecular specimen tracking is nontrivial because the system needs to differentiate between the original specimen and the specimen tested (post dna extraction / purification), while also efficiently tracking shared specimens (e.g. Clinical microbiology and molecular microbiology). Locating misplaced specimens, wastes personnel time and unnecessarily prolongs the testing cycle . Finally, workflows amongst molecular tests vary widely in turnaround times, ranging from hours / days (molecular microbiology) to weeks / months (array comparative genomic hybridization and sequencing panels). The testing cycle for a molecular diagnostic test is outlined with key informatics and workflow considerations highlighted for each step for genomic testing involving direct sequence analysis, after the technical component is complete, hours to days of informatics processing is required . Including time for interpretation, the total testing cycle can take weeks to months to complete . Moreover, a single genomic test may require technical confirmation using an orthogonal technology (e.g. Sanger sequencing for sequence variants) or functional confirmation of a variant of unknown significance ., with poorly covered regions of the genome that cannot be evaluated unless the data gaps are filled in with an additional assay . All these steps add to the clinical sensitivity of genetic testing, but unfortunately also increase turnaround time . Furthermore, as molecular diagnostics evolves, the total testing cycle may actually be considered to be the lifetime of the patient, with reinterpretation being performed on a previously performed assay at appropriate intervals . With these variables, it is clear that formal workflow analysis and strong sample tracking mechanisms are critical to the optimal functioning of a molecular pathology lab . Additionally, send - out testing poses a particular challenge for molecular pathology . Many new esoteric molecular tests are being developed and offered by private companies . At our institutions, many molecular send - out tests are ordered once by a clinician and may never be ordered again that year . There may be hundreds of these individual tests ordered at an extremely low frequency . From the laboratory's perspective, there remains a need for optimal test ordering and utilization and the requirement to store results within the local lis that may or may not have the particular send - out test defined . Regulatory requirements exist for handling results of send - out tests in the laboratory . Also, defining lis test codes for these tests can improve information quality by storing the data as discrete elements as opposed to free - text elements, thus more effectively communicating with the ehr . Furthermore, the common practice of returning complex genetic data in paper form limits the capabilities of integrating this information with other systems . Although many of these issues are not unique to molecular pathology, they become exponentially more complicated in the realm of molecular testing and need to be addressed with better informatics solutions . Formal workflow and process training may begin by working with a laboratory's director of operations . Ideally, a fellow could be involved in developing the workflow for a new assay being implemented in the lab, or a process improvement for a current suboptimal workflow, such as the introduction of electronic sign - out . Analysis of a particular test workflow to identify turnaround time bottlenecks is also a potentially valuable learning experience . Moreover, participation in college of american pathologist (cap) proficiency testing and/or laboratory inspections would be highly beneficial . Our fellowship's governance and management section focuses on the principles of leadership, management, and regulation . These skills are difficult to teach, yet particularly vital for a molecular pathologist who oversees a diverse clinical, technical, it, and bioinformatics staff [table 4]. All clinical laboratory systems must comply with regulatory requirements dictated by the centers for medicare and medicaid services (cms), with regulatory inspections carried out by agencies such as the joint commission (tjc), the cap, or state - run agencies . The regulatory environment for molecular laboratories is rapidly evolving and requires knowledge of ethical, legal, and regulatory statutes . One pressing ethical and legal issue facing molecular pathology is the need to develop policies regarding consent and return of incidental findings during genomic testing . For example, a patient may undergo genomic testing for cardiomyopathy and be found to have a cancer susceptibility variant . This past march, the american college of medical genetics and genomics (acmg) released a list of 57 genes that should be interrogated for incidental findings . However, policies regarding reporting these incidental findings vary between molecular laboratories, and pathologists and geneticists must develop a cohesive strategy for both obtaining informed consent and reporting these findings . In addition, when developing an informed consent form, an institution's legal department and the molecular laboratory must be in agreement, and state laws vary regarding informed consent regarding genomic testing . Unlike many clinical laboratories, molecular pathology tests are largely laboratory developed tests requiring diligent validation and qa / qc measures . While many labs are accustomed to performing technical qa / qc, the bioinformatics pipeline must also be validated, versioned, and maintained . Likewise, formal documentation not only of the wet - lab validation, but also of the code underlying the informatics analysis, is mandatory . Bioinformatics proficiency testing is beginning to emerge and ever - changing algorithms may split the revalidation of technical components from the revalidation of wet - lab components . We may soon see proficiency testing samples in the form of emailed digital files instead of traditional vials filled with a biological analyte . This presents an added management difficulty because most bioinformaticians are academically trained and less familiar with it industry standards and practices, such as strict software versioning control platforms (such as git and mercurial) and documentation practices, both important in clinical production environments . Additionally, bioinformaticians possess a different skillset than traditional informatics analysts such as a lis manager or a project manager . Therefore, even if a molecular pathology laboratory director is not formally trained in pathology informatics or bioinformatics, a basic understanding of the two disciplines will be helpful in guiding and managing specialized teams with diverse backgrounds . For example, a fellow could be charged with overseeing all technical, informatics, and personnel components associated with a specific laboratory assay . We also continue to participate in focused case - based retreats using simulated business school style case studies to expose exposing trainees to real - life practical scenarios . Informatics is an increasingly important component of pathology practice and several programs, including our own, have developed fellowship training to support that need . In our experience, however, while some informatics fellows envision a career as a full time informatics specialist, the majority do a second fellowship in a diagnostic pathology specialty in addition to their clinical informatics fellowship . The career goal of these fellows is to become a subspecialty pathologist with the ability to use informatics to enhance that subspecialty . Because these trainees typically do 1 year of clinical informatics fellowship and 1 year of a diagnostic specialty, our program designates this model the 1 + 1 tract . The rise of the 1 + 1 fellow raises an important issue for pathology informatics training programs . It is important that all fellows learn a core set of informatics knowledge (otherwise there is no real definition of the pathology informatics domain); however, different parts of the core informatics curriculum (and different parts of the informatics specialty) will have different degrees of relevance to different fellows depending on their long - term career goals . The fellowship structure must be both flexible enough to accommodate the career goals of each trainee and structured enough to be meaningful . Our fellowship balances the competing interests of a large, defined domain, and individual trainee interests through a required, didactic common core and customizable mentorships, projects, and research experiences . In this context, this paper addresses the training needs of the pathology informatics fellow who is headed for a career as a molecular pathologist . We have defined the most relevant parts of an informatics curriculum and have suggested specific areas for projects and research . We felt this was an important topic as this combination is common in our program (five out of 17 fellows since 2009). We also feel that our work could inform molecular pathology programs wanting to introduce their trainees to pathology informatics . An examination of our current educational structure finds that it generally works well for informatics fellows who wish to subspecialize in molecular pathology . While a broad informatics curriculum remains essential and didactics as a teaching modality for pathology informatics have been discussed and published previously, we recognize that the fellowship structure must be flexible enough to accommodate the varied career goals of each fellow . Therefore, those interested in molecular pathology may choose to focus more deeply on the most relevant aspects of our curriculum, outlined in this paper . While each fellow's individual experience will vary based upon the institutions active projects, every fellow should seek to leverage informatics approaches any time an issue involving data inherent to molecular testing arises . Such reciprocal molecular and informatics training would be enhanced by the continuity provided by pursuing both fellowships at the same institution . A discussion of informatics in the context of molecular pathology raises questions regarding the nature and scope of pathology informatics . Are molecular centric techniques such as bioinformatics part of the study (or domain) of pathology informatics? Should all pathology informaticians be expected to be competent in bioinformatics? Or, is bioinformatics a discipline distinct from pathology informatics and the exclusive domain of the molecular lab? These are obviously important questions for a pathology informatics fellowship program and ones that we have thought extensively about . Bioinformatics in molecular pathology is just one emerging subspecialty discipline . While pathology informatics developed in the age of traditional anatomic pathology, clinical pathology, and classical lis systems, over the past several years we have seen a number of large, complex, quantitative domains becoming increasingly important in laboratory medicine, including bioinformatics, big data statistical analysis, optics, disease modeling, population modeling, image analysis, business analytics, etc ., are all of these part of pathology informatics and if so, how can one teach (or be an expert in) a field that is expanding so fast, in so many directions? As discussed above, the educational structure of the fellowship has two main arms: one arm is fixed, required for all fellows, and includes a core informatics course . The purpose of the core is to provide exposure, for all the fellows, to the full scope and breadth of pathology informatics, which we define as the study and management of the information, information systems, workflows, and (human and machine) processes of pathology practice . The core does provide exposure to bioinformatics (we feel it is an important domain and technique in pathology), but it is only an exposure . The other arm involves rotations, projects, mentorships, clinical activities, and even courses customized to each fellow to create expertise in the fellow's area of interest and career path . Therefore, while a broad clinical informatics fellowship cannot focus heavily on bioinformatics, a more formal and focused handling of bioinformatics within this curriculum is warranted for those pathology informatics fellows with a focus in molecular pathology . We strongly recommend that these joint fellows pursue projects in collaboration with an institution's bioinformaticians or biostatisticians in order to gain valuable practical experience in the field . Note that fellows planning a career in anatomic pathology or clinical pathology would almost certainly not pursue extensive training in bioinformatics, but may choose to focus, for example, on imaging or statistical analysis . This fellowship structure is in accordance with our view that pathology informatics is both something intrinsic to all of pathology and is evolving its own subspecialties to serve the growing informatics needs of an increasingly subspecialized pathology practice . For molecular pathology, as the testing performed and data generated by these labs becomes more vast and complex, informatics will naturally become interwoven with the specialty . In this paper, we have defined areas of molecular pathology that could benefit from informatics approaches, and by extension, areas in which pathology informatics fellows could develop relevant and useful molecular pathology operational and research projects . This integrated approach is designed to prepare molecular pathology fellows for the informatics challenges that they will certainly face in their future practice.
Neurodegenerative conditions, such as dementia, multiple sclerosis (ms), parkinson s disease, and huntington s disease, are often characterized by significant neuro - psychological deficits that interfere significantly with patient s abilities and quality of life.14 cognitive impairment is a common feature in ms affectin43%72% of patients5,6 and is characterized as other signs and symptoms of the disease by variability and heterogeneity . However, dementia is rare, and the more common clinical presentation is one of the specific and subtle cognitive deficits.7 the most frequently affected cognitive functions are attention, speed of information processing, memory, executive functions, and visuospatial abilities,8 although new domains such as theory of mind have also been identified.9 involvement of cognitive functions such as language, praxis, and gnosis is rare and less well studied . The influence of the duration of the illness on cognitive functioning is still a matter of controversy . As regards clinical presentation, the progressive forms of ms (both secondary progressive ms and primary progressive ms) are more involved in both degree and altered domains as compared to relapsing - remitting multiple sclerosis (rrms).10,11 some authors point out that impairments are almost invariably a complication of the later stages of the disease when there is axonal loss with the involvement of large areas of white matter, disconnection between several cortical areas of association, and disconnection between cortical and subcortical areas, but impaired cognitive function appears to be present even in the early stages of the disease . Studies with long - term follow - up indicate that cognitive function decreases as the disease progresses.12,13 the degree of neurological impairment is shown as a predictor of cognitive decline in the follow - up studies.14 in the case of fatigue, this can interfere negatively, especially in tasks that require sustained mental effort such as working memory tests or sustained attention.15 neuropsychological dysfunction severely affects the patients lives16 in terms of their ability to keep their jobs,17 and they require greater assistance with daily living activities . Cognitively compromised patients are also more likely to have problems with socialization than cognitively intact ms patients.18 cognitive impairment has been associated with nonsomatic symptoms of depression in rrms, and this finding supports the importance of evaluating depressive symptoms when cognitive impairment is suspected in patients with rrms.19 anxiety has been less studied than depression in ms patients, although there is evidence that high levels of anxiety are associated with poor performance in cognitive tasks, especially processing speed, working memory, and visual spatial memory.20,21 this study was conducted in lanzarote, the easternmost landmass of the canary islands, spain (figure 1). The only study of the prevalence of ms on this island was published in 1980s, which reported a low prevalence of 15/100,000.22 the population of the island at that time was 60,000 inhabitants, and the authors concluded that the rate was higher than expected because of the geographical situation of the island . More recently, a study presented at the lxv annual meeting of the spanish society of neurology identified a total of 70 patients with ms on the island . This figure gives a prevalence of 49/100,000.23 other epidemiological studies conducted in the region have found that the canary islands is a medium - to - high risk area like spain and other mediterranean countries.24,25 thus, the canary islands, despite being closer to the equator, are still a medium risk area . The aim of this study was to describe the extent and pattern of the involvement of cognitive impairment and the psychological status in all patients of a ms cohort . A study of the full ms population, which rules out a possible selection bias, should provide a more comprehensive view of the cognitive impairment spectrum in ms . The study protocol was approved by the ethics committee for clinical research of the university hospital of the canary islands and the medical director of hospital doctor jos molina orosa . The study was conducted in accordance with the declaration of helsinki.26 all patients signed written informed consent . Seventy patients with ms or clinically isolated syndrome (cis) treated at the doctor jos molina orosa hospital in lanzarote (the hospital sees all the ms or cis patients on the island) and 56 healthy controls (hcs) matched by sex, age, and schooling were included in the study . The inclusion criteria for the patients were as follows: willing and able to sign written informed consent;ms diagnosed according to the mcdonald criteria 200527 or cis; andneurologically stable ms (with no evidence of relapse or steroids treatment in the last 4 weeks preceding the enrollment). Willing and able to sign written informed consent; ms diagnosed according to the mcdonald criteria 200527 or cis; and neurologically stable ms (with no evidence of relapse or steroids treatment in the last 4 weeks preceding the enrollment). The inclusion criterion for the control group (cg) was willing and able to sign the written informed consent . The exclusion criteria for the cg were as follows: no history of psychiatric or neurological disorders andno history of drug abuse or any major medical illness . No history of psychiatric or neurological disorders and no history of drug abuse or any major medical illness . Six patients did not participate in the study: three patients were not on the island at the time, one patient could not attend due to severe physical disability, and two patients refused to participate in the study . The spanish version of the brief repeatable battery of neuropsychological test (brb - n)6 is used to assess the cognitive status of all the participants . The brb - n includes the following tests: selective reminding test (srt)28 as a measure of verbal learning and delayed recall . This test gives three different scores: srt - long - term storage (srt - lts), srt - consistent long - term retrieval (srt - cltr), and srt - delayed (srt - d).10/36 spatial recall test (spart), an extended version of the original form the 7/24 spart to assess visuospatial learning and delayed recall.29 this test gives two scores: spart - total and spart - delayed (spart - d).symbol digit modalities test (sdmt)30 as a measure of complex attention and processing speed.paced auditory serial addition test (pasat)31 as a measure of sustained attention and working memory.controlled oral word association test32 as a measure of verbal fluency . This test gives three different scores: srt - long - term storage (srt - lts), srt - consistent long - term retrieval (srt - cltr), and srt - delayed (srt - d). 10/36 spatial recall test (spart), an extended version of the original form the 7/24 spart to assess visuospatial learning and delayed recall.29 this test gives two scores: spart - total and spart - delayed (spart - d). Symbol digit modalities test (sdmt)30 as a measure of complex attention and processing speed . Paced auditory serial addition test (pasat)31 as a measure of sustained attention and working memory . The multiple sclerosis neuropsychological questionnaire (msnq),33 the hospital anxiety and depression scale,34 and the fatigue severity scale35 were administered to the patients . All evaluations were performed by a neuropsychologist who was an expert in ms and familiar with the administration of all tests . These tests were administered in a single session of ~1 hour . A z score (direct score mean / standard deviation [sd]) was created for each cognitive domain according to standard practice to obtain a global cognitive - performance score . Verbal memory = z - lts+z - cltr+z - srt - d3(1) visuospatial memory = z - spart total+z - spart - d2(2) processing speed = z - total correct responses of sdmt(3) working memory = z - total correct responses of pasat3+pasat22(4) verbal fluency = z - semantic+z - phonetic total correct responses2(5) finally, a global cognitive function score (z - global) was obtained by calculating the mean of the z scores from the five cognitive domains . Different cognitive impairment criteria were used: <1.0 sd, <1.5 sd, and <2.0 sd (compared to the cg) in one, two, or three subtests of the battery, respectively . Interviews were also conducted with family members about their level of functionality (food preparation, medication management, use of money, travel outside home) in the case of patients with suspected dementia . Dementia was diagnosed following the fourth edition of the diagnostic and statistical manual of mental disorders, text revised (dsm - iv - tr).36 categorical variables were expressed as frequencies and percentages . All the variables analyzed followed a normal distribution except pasat 3, and the scores were log transformed before analysis of covariance . Analysis of covariance was performed, including cognitive domains such as dependent variables and controlling for age and schooling . Correlation between the cognitive domains and the patient s clinical variables and questionnaires were assessed using the pearson s correlation test . Statistical analysis was performed with spss v20.0 software (ibm corporation, armonk, ny, usa). P - values were corrected for multiple testing problem using the bonferroni correction method (/k: 0.05/6=0.008), considering p - values <0.008 as statistically significant . Seventy patients with ms or clinically isolated syndrome (cis) treated at the doctor jos molina orosa hospital in lanzarote (the hospital sees all the ms or cis patients on the island) and 56 healthy controls (hcs) matched by sex, age, and schooling were included in the study . The inclusion criteria for the patients were as follows: willing and able to sign written informed consent;ms diagnosed according to the mcdonald criteria 200527 or cis; andneurologically stable ms (with no evidence of relapse or steroids treatment in the last 4 weeks preceding the enrollment). Willing and able to sign written informed consent; ms diagnosed according to the mcdonald criteria 200527 or cis; and neurologically stable ms (with no evidence of relapse or steroids treatment in the last 4 weeks preceding the enrollment). The inclusion criterion for the control group (cg) was willing and able to sign the written informed consent . The exclusion criteria for the cg were as follows: no history of psychiatric or neurological disorders andno history of drug abuse or any major medical illness . No history of psychiatric or neurological disorders and no history of drug abuse or any major medical illness . Six patients did not participate in the study: three patients were not on the island at the time, one patient could not attend due to severe physical disability, and two patients refused to participate in the study . The spanish version of the brief repeatable battery of neuropsychological test (brb - n)6 is used to assess the cognitive status of all the participants . The brb - n includes the following tests: selective reminding test (srt)28 as a measure of verbal learning and delayed recall . This test gives three different scores: srt - long - term storage (srt - lts), srt - consistent long - term retrieval (srt - cltr), and srt - delayed (srt - d).10/36 spatial recall test (spart), an extended version of the original form the 7/24 spart to assess visuospatial learning and delayed recall.29 this test gives two scores: spart - total and spart - delayed (spart - d).symbol digit modalities test (sdmt)30 as a measure of complex attention and processing speed.paced auditory serial addition test (pasat)31 as a measure of sustained attention and working memory.controlled oral word association test32 as a measure of verbal fluency . This test gives three different scores: srt - long - term storage (srt - lts), srt - consistent long - term retrieval (srt - cltr), and srt - delayed (srt - d). 10/36 spatial recall test (spart), an extended version of the original form the 7/24 spart to assess visuospatial learning and delayed recall.29 this test gives two scores: spart - total and spart - delayed (spart - d). Symbol digit modalities test (sdmt)30 as a measure of complex attention and processing speed . Paced auditory serial addition test (pasat)31 as a measure of sustained attention and working memory . The multiple sclerosis neuropsychological questionnaire (msnq),33 the hospital anxiety and depression scale,34 and the fatigue severity scale35 were administered to the patients . All evaluations were performed by a neuropsychologist who was an expert in ms and familiar with the administration of all tests . These tests were administered in a single session of ~1 hour . A z score (direct score mean / standard deviation [sd]) was created for each cognitive domain according to standard practice to obtain a global cognitive - performance score . Verbal memory = z - lts+z - cltr+z - srt - d3(1) visuospatial memory = z - spart total+z - spart - d2(2) processing speed = z - total correct responses of sdmt(3) working memory = z - total correct responses of pasat3+pasat22(4) verbal fluency = z - semantic+z - phonetic total correct responses2(5) finally, a global cognitive function score (z - global) was obtained by calculating the mean of the z scores from the five cognitive domains . Different cognitive impairment criteria were used: <1.0 sd, <1.5 sd, and <2.0 sd (compared to the cg) in one, two, or three subtests of the battery, respectively . Interviews were also conducted with family members about their level of functionality (food preparation, medication management, use of money, travel outside home) in the case of patients with suspected dementia . Dementia was diagnosed following the fourth edition of the diagnostic and statistical manual of mental disorders, text revised (dsm - iv - tr).36 all the variables analyzed followed a normal distribution except pasat 3, and the scores were log transformed before analysis of covariance . Analysis of covariance was performed, including cognitive domains such as dependent variables and controlling for age and schooling . Correlation between the cognitive domains and the patient s clinical variables and questionnaires were assessed using the pearson s correlation test . Statistical analysis was performed with spss v20.0 software (ibm corporation, armonk, ny, usa). P - values were corrected for multiple testing problem using the bonferroni correction method (/k: 0.05/6=0.008), considering p - values <0.008 as statistically significant . Table 1 shows the clinical and demographical characteristics of hc (n=56) and patients (ms; n=60; both groups had similar distributions of sex, age, and schooling). The patients scored less than controls, in the controlling for age and schooling, on all variables of the brb - n except visuospatial memory (table 2). A high prevalence of cognitive impairment (75.0%) was obtained when using a lenient criterion (<1.0 sd in one sub - test). The prevalence was 35.0% with a moderately stringent criterion (<1.5 sd in two subtests), and the prevalence was 16.6% when using the most stringent criterion of cognitive impairment (<2 sd in three tests; table 3). The most frequently affected domain was working memory with an impairment in 43.8% of the patients (28 patients), followed by verbal memory in 21.7% (13 patients), processing speed in 15.0% (nine patients), verbal fluency in 13.3% (eight patients), and finally, visuospatial memory in 11.7% (seven patients). When clinical variables were analyzed, disease duration had a moderate correlation with visuospatial memory and processing speed (r=0.400 and r=0.370, p<0.008). The expanded disability status scale (edss) score showed correlations with verbal memory, processing speed, and global cognitive index (r=0.344 to 0.395, p<0.008; table 4). Symptoms of anxiety were present in 18.3% of patients, and depression symptoms were present in 33.3% of patients . Msnq score and anxiety symptoms were not associated with performance in any of the cognitive domains . Verbal memory correlated with symptoms of depression (r=0.415, p=0.001) and fatigue (r=0.383, p=0.003). Msnq correlated with depression (r=0.405, p=0.001) and anxiety (r=0.255, p=0.049). The aim of this study was to describe the extent and pattern of cognitive impairment in all the population affected by ms on a small island located in the southwest of europe . Lanzarote is an interesting place for ms study because its geographical location confers a high exposure to uv radiation for most of the year and patients probably have an optimal vitamin d serum level . Low vitamin d status is a possible environmental risk factor for ms development and outcome.37,38 severe cognitive impairment, with clear criteria for dementia (dsm - iv - tr), was found in four patients in the study sample (6.3% of the total). All these four patients had an obvious neuropsychological deficit, and they were unable to perform all the selected tests . Interviews with family members revealed significant functional impairment with an impact on activities of daily living . The mean age of the dementia patients was 71 years (6078 years), and they obtained an edss score between 6.0 and 8.0 as well as had progressive forms of the disease . The remaining nondementia patients formed a population with a low moderate degree of disability (<3.0 on the edss), and most patients had an rrms . The patient group underperformed the (demographically equivalent) cg in most of the battery tests after controlling the results for age and schooling, suggesting an overall performance deficit . The range of variability observed in the prevalence of cognitive impairment is possibly associated with the methodological differences between the studies such as the study design and setting, as well as the neuropsychological tests selected for the study . However, the biggest difference could be due to the consideration of the concept of cognitive impairment . For example, a performance <1.0 sd in one subtest may reflect the fluctuant nature of the disease and does not necessarily reflect the real pattern of cognitive impairment . The concept of cognitive impairment proposed by amato et al12 as a failure in two or more brb - n subtests with scores at least 1.5 sd below the scores of hc is suggested for use here . Using similar figures were found by nogales - gaete et al39 with a sample of chilean patients with rrms, but the finding here differs from other studies conducted in oslo (norway) and the uk and from another study in spanish speaking patients in argentina,40 where the prevalence of cognitive impairment was> 45% . The pattern of involvement found suggests that working memory and verbal memory are the most affected areas . Physical disability has been associated with cognitive impairment in some studies,6,14 while others found no such association.41 in the present work, a negative correlation between edss score and verbal memory, processing speed, and a global cognitive index was found . These data could indicate that deficit in processing speed might be a good predictor of disease progression and, therefore, constitutes a key deficit in time monitoring . However, the involvement of other domains such as working memory or verbal fluency could start in any stage of the disease and does not evolve in parallel with other symptoms of this disease . Msnq - self report (as opposed to msnq - informant report) is not considered a sensitive screen for neuropsycho - logical impairment in ms, and indeed, no correlation with this test was found here, suggesting that it is not an effective screening method for detecting cognitive impairment . Depressive symptoms were less (present in 33.3% of the sample) than those found in the literature,42 and higher scores on the depression scale were correlated with poorer performance in verbal memory . This finding has been associated with the mineralocorticoid expression in the brain that diminishes during depression, especially in the hippocampus and the prefrontal cortex, which are critical brain areas for memory.43 anxiety (present in 18.3% of patients) was not associated with cognitive performance . This confirms findings of another study that has linked cognitive functioning with the state of fatigue in patients with ms44 and more specifically with memory.45 as a limitation of the study, the use of a more extensive evaluation protocol could provide more information about the true neuropsychological profile of studied patients . At least 35% of the study population had mild - to - moderate cognitive impairment relative to a control sample . The results of this study confirm the high prevalence of cognitive impairment in an ms cohort . The most affected domains were working memory and verbal memory . Working memory, verbal memory, and verbal fluency did not deteriorate as the disease progressed, and therefore could not be used as a means of monitoring it . Cognitive decline was frequently related to clinical variables (disease duration and edss score). Verbal memory was associated with depression and fatigue, but none of the cognitive domains showed a strong correlation with anxiety and subjective perception of cognitive impairment.
Ketoprofen is a peripherally acting nonsteroidal anti - inflammatory drug (nsaid) belonging to the group of substituted 2-phenylpropionic acids.1 nsaids have the potential to cause gastrointestinal (gi) side effects such as gi bleeding in a dose - related manner . One approach to reducing these side effects has been to apply nsaids to the skin overlying affected joints and muscles.25 diractin (ketoprofen in transfersome gel) is a new, carrier - based formulation for local application that has shown to reduce pain comparable to oral celecoxib in patients with knee osteoarthritis.6 transfersome carriers are ultra - deformable lipid vesicles loaded with an active substance and applied epicutaneously in an aqueous preparation . Once the transfersome carriers are on the skin, water from the preparation starts to evaporate and deprives carriers of their suspending medium . Transfersome vesicles reaching their solubility limit are attracted by the higher water content in the skin, resulting in spontaneous migration of the drug - loaded carriers through the skin barrier.7 the cutaneous microcirculation cannot clear transfersome carriers due to their large size, resulting in high drug concentrations in local tissue with low systemic drug exposure.8 diractin showed substantially higher drug concentration in target tissues such as muscle as compared to conventional topical products and oral ketoprofen, respectively, in muscle biopsy studies conducted in pigs.8 eccentric exercise causes delayed - onset muscle soreness (doms) with pain peaking 24 to 48 hours after exercise.9,10 an acute inflammatory reaction is considered one of the underlying mechanisms of doms.11,12 the muscle strain injury caused by eccentric contractions is characterized morphologically by microscopic damage to the muscle fibers (microtrauma).13 neutrophils and tissue macrophages migrate to the damaged muscle tissue, clean up the debris of broken proteins, and then initiate the regeneration phase . Besides a classical inflammatory response, other mechanisms of muscle adaptation and immunological responses in the muscle as well as epimysium might contribute to exercise - induced pain.14 the use of nsaids seems a reasonable therapeutic approach to treat muscle pain induced by eccentric contractions . This paper reports results from studies investigating the effect of epicutaneously applied diractin on pain induced by eccentric muscle contractions after single and multiple applications . The results of three pilot single - center, single - dose, randomized, double - blind, double - dummy, parallel - group, placebo- and active - controlled studies using the model of exercise - induced muscle pain were pooled for a meta - analysis as the individual studies were underpowered to compare efficacy and safety of diractin with placebo and oral ketoprofen . All three pilot studies used the same study design, equipment, and application instructions . Studies were performed in accordance with the declaration of helsinki and the international conference on harmonization of good clincial practice . Two hundred ninety - five healthy men and women aged 18 to 45 years were enrolled in the studies . They had to refrain from any strenuous or new physical activities and comply with the respective study protocol while participating in the studies . Moreover, subjects had to be nave to the exercise so that they could not have resistance trained or performed work that required similar exercise for six months before enrolling in the study . Exclusion criteria focused on avoiding any untoward risk for the study participants and potential interference with the study objectives . Studies used comparable inclusion / exclusion criteria . Within two weeks after visit 1, subjects completed the exercise regimen (visit 2) consisting of 50 consecutive maximal eccentric contractions of the elbow flexor muscles of the nondominant arm . For exercise, subjects were seated on a modified preacher s bench with the nondominant upper arm resting on a padded support, the wrist fixed between two padded rollers of the exercise lever and the forearm in a fully flexed position . For each eccentric action, the investigator staff had pulled down on the lever, forcing the subjects forearm into a fully extended position as the subjects exerts maximum resistance . Subjects reporting pre - exercise soreness / pain of 10 mm on a visual analogue scale (vas) at visit 2 were excluded from the study . Approximately 32 hours later, at visit 3, following an overnight fast, subjects meeting all continuation criteria and reporting at least 50 mm vas post - exercise soreness / pain received either topical or oral ketoprofen (25 mg each) and oral or topical placebo, respectively . Subjects were fed a standardized meal and remained at the study center for the entire observation period . Subjects rated their muscle soreness / pain intensity prior to performing the exercise, immediately prior to treatment, and at hourly intervals for 12 hours after treatment . At the end of these assessments, subjects provided an overall rating of the study medication . At the final visit (visit 4), approximately four days after visit 3, safety and tolerability of the treatments were assessed . No primary efficacy parameters were specified in the protocols due to the exploratory nature of the studies . Muscle soreness / pain intensity was assessed using vas and categorical scale (cat) by completing two actions of elbow flexion and relaxation while holding a 2-lb dumbbell (approximately 0.9 kg). Results for categorical pain intensity difference (catpid) and visual analogue scale pain intensity difference (vaspid) from baseline (immediately prior to treatment at visit 3) to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12 hours after treatment were determined in the same way in all three studies . The 100 mm horizontal vas line was labeled no soreness / pain on the left (corresponding to 0) and very, very sore / painful on the right (corresponding to 100). Categorical ratings of muscle soreness / pain were obtained on a 10-point ordinal rating scale from 0 = none to 9 = extremely intense . The meta - analysis was performed for the intent - to - treat populations, ie, all subjects that received study medication . The overall statistics were obtained from a meta - analysis of catpid and vaspid scores with treatment and baseline pain as fixed effects, and study as a random effect . Homogeneity in mean responses of the studies was assessed by testing the significance of study variance component in the random effect model . In matters of least - squares (ls) means comparison, the interaction terms drug - by - study and drug - by - baseline were not significant (p> 0.05), and subsequently dropped from the final model . Ls means and standard errors are obtained from an analysis of covariance model with treatment and baseline pain as factors . P - values are unadjusted, and obtained from testing the equality of two groups . Nineteen subjects were included in this pilot study to investigate the efficacy of multiple dosages of diractin (bid over seven days) for the treatment of exercise - induced muscle pain . To induce muscle pain, the subjects walked down stairs using twelve consecutive runs of 18 m difference in total altitude per run (120 stairs with each stair 15 cm high). This corresponds to a total altitude of approximately 200 m. eligible subjects came in at the day after exercise and were randomly allocated to two subgroups which received 100 mg ketoprofen in diractin bid either on the left or right target muscle (thigh). The subjects were asked to apply the product open (nonocclusively) over the entire surface of either the left or the right thigh . If in some subjects the calf became symptomatic, diractin was also administered epicutaneously to the entire surface of the left or right calf . Categorical ratings of muscle soreness / pain were recorded on a 10-point ordinal rating scale (0 = none to 9 = extremely) twice daily in a diary, immediately before study drug application . For statistical testing, the sum of categorical pain scores for the treated muscle were compared to the untreated control muscle using the wilcoxon test . Nonparametric testing was chosen due to the small sample size and since it was assumed prospectively that normal distribution of data is not guaranteed . The results of three pilot single - center, single - dose, randomized, double - blind, double - dummy, parallel - group, placebo- and active - controlled studies using the model of exercise - induced muscle pain were pooled for a meta - analysis as the individual studies were underpowered to compare efficacy and safety of diractin with placebo and oral ketoprofen . All three pilot studies used the same study design, equipment, and application instructions . Studies were performed in accordance with the declaration of helsinki and the international conference on harmonization of good clincial practice . Two hundred ninety - five healthy men and women aged 18 to 45 years were enrolled in the studies . They had to refrain from any strenuous or new physical activities and comply with the respective study protocol while participating in the studies . Moreover, subjects had to be nave to the exercise so that they could not have resistance trained or performed work that required similar exercise for six months before enrolling in the study . Exclusion criteria focused on avoiding any untoward risk for the study participants and potential interference with the study objectives . Studies used comparable inclusion / exclusion criteria . Within two weeks after visit 1, subjects completed the exercise regimen (visit 2) consisting of 50 consecutive maximal eccentric contractions of the elbow flexor muscles of the nondominant arm . For exercise, subjects were seated on a modified preacher s bench with the nondominant upper arm resting on a padded support, the wrist fixed between two padded rollers of the exercise lever and the forearm in a fully flexed position . For each eccentric action, the investigator staff had pulled down on the lever, forcing the subjects forearm into a fully extended position as the subjects exerts maximum resistance . Subjects reporting pre - exercise soreness / pain of 10 mm on a visual analogue scale (vas) at visit 2 were excluded from the study . Approximately 32 hours later, at visit 3, following an overnight fast, subjects meeting all continuation criteria and reporting at least 50 mm vas post - exercise soreness / pain received either topical or oral ketoprofen (25 mg each) and oral or topical placebo, respectively . Subjects were fed a standardized meal and remained at the study center for the entire observation period . Subjects rated their muscle soreness / pain intensity prior to performing the exercise, immediately prior to treatment, and at hourly intervals for 12 hours after treatment . At the end of these assessments, subjects provided an overall rating of the study medication . At the final visit (visit 4), approximately four days after visit 3, safety and tolerability of the treatments were assessed . No primary efficacy parameters were specified in the protocols due to the exploratory nature of the studies . Muscle soreness / pain intensity was assessed using vas and categorical scale (cat) by completing two actions of elbow flexion and relaxation while holding a 2-lb dumbbell (approximately 0.9 kg). Results for categorical pain intensity difference (catpid) and visual analogue scale pain intensity difference (vaspid) from baseline (immediately prior to treatment at visit 3) to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12 hours after treatment were determined in the same way in all three studies . The 100 mm horizontal vas line was labeled no soreness / pain on the left (corresponding to 0) and very, very sore / painful on the right (corresponding to 100). Categorical ratings of muscle soreness / pain were obtained on a 10-point ordinal rating scale from 0 = none to 9 = extremely intense . The meta - analysis was performed for the intent - to - treat populations, ie, all subjects that received study medication . The overall statistics were obtained from a meta - analysis of catpid and vaspid scores with treatment and baseline pain as fixed effects, and study as a random effect . Homogeneity in mean responses of the studies was assessed by testing the significance of study variance component in the random effect model . In matters of least - squares (ls) means comparison, the interaction terms drug - by - study and drug - by - baseline were not significant (p> 0.05), and subsequently dropped from the final model . Ls means and standard errors are obtained from an analysis of covariance model with treatment and baseline pain as factors . P - values are unadjusted, and obtained from testing the equality of two groups . Nineteen subjects were included in this pilot study to investigate the efficacy of multiple dosages of diractin (bid over seven days) for the treatment of exercise - induced muscle pain . To induce muscle pain, the subjects walked down stairs using twelve consecutive runs of 18 m difference in total altitude per run (120 stairs with each stair 15 cm high). This corresponds to a total altitude of approximately 200 m. eligible subjects came in at the day after exercise and were randomly allocated to two subgroups which received 100 mg ketoprofen in diractin bid either on the left or right target muscle (thigh). The subjects were asked to apply the product open (nonocclusively) over the entire surface of either the left or the right thigh . The primary target area for all subjects was the thigh . If in some subjects the calf became symptomatic, diractin was also administered epicutaneously to the entire surface of the left or right calf . Categorical ratings of muscle soreness / pain were recorded on a 10-point ordinal rating scale (0 = none to 9 = extremely) twice daily in a diary, immediately before study drug application . For statistical testing, the sum of categorical pain scores for the treated muscle were compared to the untreated control muscle using the wilcoxon test . Nonparametric testing was chosen due to the small sample size and since it was assumed prospectively that normal distribution of data is not guaranteed . The demographic data between the three treatment groups was comparable with an age range of 18 to 45 and the majority of subjects being males (table 1). Also baseline pain was comparable between the treatment groups with cat scores around 6.4 and vas scores between 70.5 and 73.7 mm (table 2). The estimated hourly vaspid and catpid results from one to 12 hours after treatment for diractin (idea-033) versus placebo are presented in figures 1a and 1b, for diractin (idea-033) versus oral ketoprofen in figures 2a and 2b, and for oral ketoprofen versus placebo in figures 3a and 3b . Mean vaspid for 25 mg ketoprofen in diractin versus placebo increased over time reaching a plateau of significant differences between diractin and placebo from five to 12 hours after treatment (figure 1a). Mean vaspid for 25 mg ketoprofen in diractin versus oral ketoprofen were significantly different only at 12 hours after treatment (figure 2a), whereas mean catpid showed significant difference between diractin and oral ketoprofen from seven to 12 hours after treatment (figure 2b). No significant differences in mean vaspid and catpid between oral ketoprofen and placebo were determined at any time after treatment (figures 3a and 3b). The subjects documented higher pain scores for the calf than for the thigh, maximum pain was observed within 24 to 48 hours after exercise (average categorical pain score at time of maximum pain for untreated thigh: 2.6 2.2; for untreated calf: 5.1 1.9). The average sum of categorical pain scores documented for the treated thighs (n = 19) was 12.4 (range 0 to 29) and 14.8 (range 0 to 42) in the untreated thighs . The sum of pain scores was significantly lower in the treated thighs than in the untreated thighs (wilcoxon p - value = 0.039; table 3). For the calf (n = 9), the average sum of pain scores documented for the treated calves was 29.4 (range 13 to 55) and in the untreated 32.9 (range 6 to 65). The difference between treated and untreated areas was not statistically significant (wilcoxon p - value = 0.359) probably due to the small sample size . The demographic data between the three treatment groups was comparable with an age range of 18 to 45 and the majority of subjects being males (table 1). Also baseline pain was comparable between the treatment groups with cat scores around 6.4 and vas scores between 70.5 and 73.7 mm (table 2). The estimated hourly vaspid and catpid results from one to 12 hours after treatment for diractin (idea-033) versus placebo are presented in figures 1a and 1b, for diractin (idea-033) versus oral ketoprofen in figures 2a and 2b, and for oral ketoprofen versus placebo in figures 3a and 3b . Mean vaspid for 25 mg ketoprofen in diractin versus placebo increased over time reaching a plateau of significant differences between diractin and placebo from five to 12 hours after treatment (figure 1a). Mean vaspid for 25 mg ketoprofen in diractin versus oral ketoprofen were significantly different only at 12 hours after treatment (figure 2a), whereas mean catpid showed significant difference between diractin and oral ketoprofen from seven to 12 hours after treatment (figure 2b). No significant differences in mean vaspid and catpid between oral ketoprofen and placebo were determined at any time after treatment (figures 3a and 3b). The subjects documented higher pain scores for the calf than for the thigh, maximum pain was observed within 24 to 48 hours after exercise (average categorical pain score at time of maximum pain for untreated thigh: 2.6 2.2; for untreated calf: 5.1 1.9). The average sum of categorical pain scores documented for the treated thighs (n = 19) was 12.4 (range 0 to 29) and 14.8 (range 0 to 42) in the untreated thighs . The sum of pain scores was significantly lower in the treated thighs than in the untreated thighs (wilcoxon p - value = 0.039; table 3). For the calf (n = 9), the average sum of pain scores documented for the treated calves was 29.4 (range 13 to 55) and in the untreated 32.9 (range 6 to 65). The difference between treated and untreated areas was not statistically significant (wilcoxon p - value = 0.359) probably due to the small sample size . Different pain models have been developed for evaluating the efficacy of topical and oral nsaids . Besides defined pain situations in patients, eg, after surgery or tooth extraction, additional models were explored that would be more specific to muscular pain . Experimental pain resulting from continuous pressure infusion of phosphate - buffered low ph solution (ph 5.2) into the belly of the radial flexor carpi muscle induced a localized dull - aching or stinging muscle pain sensation.15 however, it remained unclear whether this experimental induction of muscle pain was predictive for actual muscle pain . Therefore, the induction of muscle soreness / pain by controlled, standardized eccentric contractions producing doms was explored . Doms is defined as skeletal muscle discomfort that peaks 24 to 48 hours after exercise.1 at that time, a significant increase in prostaglandin e2 was observed, suggesting that acute inflammation is one of the underlying mechanisms of doms.11,12 more recent studies indicate that a classical inflammatory reaction might not be the main reason for doms, but other mechanisms of muscle adaptation and changes in immunological parameters in the epimysium might contribute to this process.14 the controversy between several studies might also be related to the effects of muscle biopsies itself.14 the effect of nsaids on muscle pain induced by eccentric contractions is still controversial . A lack of efficacy of oral nsaid treatment was reported for flurbiprofen and ibuprofen.16,17 the influence of flurbiprofen on subjective soreness was investigated in six healthy young men.16 the subjects performed one concentric and two eccentric work bouts of 30 min at 80% of the individual maximal work load on the bicycle ergometer . No influence of 50 mg flurbiprofen tid on subjective soreness was reported . The influence of 400 mg ibuprofen tid on active range of motion, perceived pain, and peak concentric torque measurements of the nondominant arm was assessed in 40 subjects in a randomized, double - blinded, repeated measures design.17 subjects performed an eccentric exercise protocol of the elbow flexors . No differences among treatments were observed for any of the dependent variables at any time up to 96 hours after the exercise . In contrast, a randomized, double - blind, placebo - controlled crossover study of 200 mg oral naproxen tid for 10 days indicated superiority of naproxen to placebo in improving objective recovery as per magnetic resonance imaging results and effects on thigh soreness in particular during the first four days after exercise.18 subjects performed 10 sets of 710 eccentric actions with each quadriceps femoris muscle with a load equal to 85% of the eccentric one repetition maximum . Study drug treatment began immediately after exercise . In a randomized, double - blind, placebo - controlled parallel - group study, the influence of 100 mg ketoprofen in a pluronic lecithin organogel applied tid on doms was investigated in 32 young healthy men.19 subjects performed a leg extension and flexion exercise program designed to create doms in quadriceps muscles . Subjects were randomly assigned to receive any combination of topical ketoprofen or placebo gel to their right and left quadriceps immediately following the exercise . Within - subjects analysis (n = 16) showed a significant reduction in doms scores in legs receiving topical ketoprofen compared with legs receiving placebo (p = 0.002 at 48 hours, and p <0.001 at 24 and 48 hours combined). Between - subjects analysis (n = 16) showed a marginally significant reduction in doms scores at 48 hours (p = 0.05 in right legs and p = 0.053 in left legs). The studies published varied not only with respect of the nsaid investigated, but also whether study drug was applied immediately after exercise or at peak of the soreness . We therefore decided to explore the various options in different settings, eg, single and multiple dosing, using oral ketoprofen as an active comparator, or investigating the therapeutic effect of diractin at different muscular regions, ie, elbow flexor muscles or thigh and calf muscles, respectively . A single dose of 25 mg ketoprofen in diractin was significantly superior to placebo in treating muscle pain induced by eccentric contractions and as expressed by mean vaspid and catpid from five to 12 hours after treatment and also to 25 mg oral ketoprofen at some time points after treatment . In contrast, a single dose of 25 mg oral ketoprofen was statistically not different to placebo at any time after treatment . The appropriate dose and treatment regimen still needs to be confirmed in a larger randomized, controlled, prospective clinical trial . Doms was shown to be an appropriate pain model for evaluating the therapeutic effect of epicutaneous diractin on acute muscle pain . The results indicate that diractin appears to be a valuable option for treating musculoskeletal pain.
It hydrolyzes aromatic carboxylic acid esters and certain organophosphorous pesticides, especially paraoxon and nerve gas . Plasma paraoxonase (pon) activity in human population demonstrates polymorphic distribution due to an amino acid substitution in the active site of the enzyme, giving rise to low-, intermediate-, or high - activity isoenzymes . The polymorphic variation in serum pon activity may affect the metabolism of organophosphates in individuals at high risk of acute organophosphorous intoxication or of organophosphorous - induced delayed polyneuropathy . Pon is located in a subfraction of hdl containing apo a - i and clusterin (apo j). Pon is anchored to hdl by its hydrophobic n terminal end and apo a - i . After secretion into blood, they bind to hdl particles; pon2 is expressed widely in a number of tissues but is not present in the blood . The genes encoding the pon family (pon1, pon2, and pon3) are all located on the long arm of chromosome 7 (7q21.3-q22.1). It plays a significant role in delaying / inhibiting the oxidation of both low - density lipoprotein (ldl) and hdl particles . By virtue of its actions like prevention of accumulation of lipid peroxides in ldl, stimulation of breakdown by hydrolysis of lipid peroxides, and protection against lipoprotein oxidation, pon1 has a protective role against atherosclerosis and cardiovascular disease figures 1 and 2 . Pon2 and pon3 both have antioxidant properties and hydrolyze aromatic and long - chain aliphatic lactones, but lack paraoxonase or arylesterase activities . Similar to pon1, pon3 too protects against ldl oxidation and inflammation, reflecting its atheroprotective effect . Shih et al . Reported that elevated pon3 expression significantly decreases atherosclerotic lesion formation and adiposity in male mice, signifying the important role of pon3 in protection against obesity and atherosclerosis . High - density lipoproteins (hdl) is maturated from pre-migrating hdl to hdl3 by the action of lecithin - cholesterol acyltransferase and then to hdl2 which is large and rich in paraoxonase 1 anti - atherosclerotic properties of pon1 . (pon1: paraoxonase 1, ldl: low - density lipoprotein) pon1 activity is decreased in patients with diabetes mellitus (dm), cardiovascular complications, hypercholesterolemia, and renal failure . The factors that induce the activity of pon1 are drugs such as statins, fibrates, aspirin, glucocorticoids, and phenobarbital, which are classical inducers of pon1 activity . Pon1 activity is also decreased by smoking, alcohol, fat - rich diet, and aging . Obesity is associated with several alterations in the lipid metabolism, leading to changes in lipoprotein levels and composition, and greater risk of cardiovascular disease . A relationship was found between hdl - pon and lipid hydroperoxides in hdl and ldl of control and obese subjects, which suggests that subjects with lower pon activity are more exposed to oxidative damage figure 4 . In obese adults, diminished levels of pon1 activity body mass index is an independent predictor of pon1 activity . In another study involving childhood subjects, the aryl esterase activity had significant positive correlation with adipokine levels and negative correlation with leptin concentrations . These results confirm that obesity is associated with oxidative damage of lipoproteins and may explain the increased cardiovascular risk in obese people . Orlistat treatment in obese subjects increases pon1 activity and pon / hdl ratio besides altering the lipid profile . Values of paraoxonase activity in high - density lipoproteins isolated from plasma of control and obese subjects levels of lipid hydroperoxides in high - density lipoproteins (hdl) and low - density lipoprotein (ldl) isolated from plasma of control and obese subjects . P <0.001 vs. lipid hydroperoxides in hdl from control subjects; p <0.001 vs. levels of hydroperoxides in ldl from control subjects correlations between leptin levels as well as adiponectin levels and pon1 activity have been previously proven in obese adults figure 5 . These mechanisms may be the following: leptin as a hydrophobic peptide can bind to hdl and inhibit directly the pon1 enzyme . On the other hand, leptin enhances oxidative stress through the generation of reactive oxygen species (ros) and stimulates the secretion of inflammatory cytokines and other acute phase proteins which have diminishing effect on pon1 enzyme activity by the inhibitory effect on hepatic pon1 synthesis . Leptin also enhances the production of serum amyloid a protein which can replace apolipoprotein - a1 (apo a - i) in hdl . Leptin may have modulatory effect through the alteration of the lipid content in hdl particles; inverse correlation has been observed between leptin, hdl, and apo a - i in human subjects . Adiponectin might accelerate the reverse cholesterol transport and increase apo a - i - mediated cholesterol efflux through enhancing hdl assembly in the liver . Another study in male mice has demonstrated that elevated pon3 expression significantly decreases atherosclerotic lesion formation and adiposity . Women with polycystic ovarian syndrome (pcos) and obesity were found to have high insulin resistance and significantly lower pon1 levels . These findings suggest that decreased pon1 activity in pcos patients might contribute to increased insulin resistance and attendant atherosclerotic heart disease . Table 1 gives the summary of studies demonstrating the relationship between lower pon activity in obesity and associated increase in cardiovascular risk . Analysis of the studies on pon1 activity in obesity leads to the conclusion that obesity is associated with 5060% reduction in pon activity, accompanied by significant fall in ldl and increase in hdl . Studies have not yet analyzed the corresponding fall in pon with the incremental body mass index . Correlation between the levels of hdl - pon activity and leptin in the plasma of obese subjects (r= 0.90; p <0.001; n= 12) summary of studies mentioning low paraoxonase 1 activity in obesity and associated increase in cardiovascular risk pon1 activity has been studied in patients with metabolic syndrome and insulin resistance, and some contradictions were found between the studies performed in non - diabetic subjects . In non - diabetic swiss population, the significantly reduced serum pon1 concentrations and activities were associated with metabolic syndrome defined according to the world health organization (who) guidelines . Have shown that there was a positive correlation between the homeostasis model assessment (homa) index and hdl - corrected pon1 activity in non - diabetic japanese subjects . In another study on turkish population, pon1 activities were not different between non - diabetic subjects with and without metabolic syndrome . Additionally, beer et al . Found that pon1 activities and concentrations were not different in diabetic patients compared to subjects with impaired fasting glucose and controls, although postprandial hyperlipemia was associated with changes in serum pon1 in diabetic subjects . In the same study, significantly low serum pon1 concentrations in the postprandial period were demonstrated, attributed to postprandial hypertriglyceridemia, whereas the decrease in pon1 activity was not statistically significant . There was no difference in the postprandial pon1 response between diabetic and non - diabetic groups . In another study, pon1 activity was not significantly altered compared with normoglycemic controls, although oxidized ldl levels were significantly higher in glucose - intolerant and newly diagnosed diabetic subjects . All these studies suggest that pon1 activity loss may occur later in the course of diabetes mellitus and hyperglycemia, rather than in the stage of insulin resistance . Serum pon1 activity is significantly decreased in type 1 and type 2 diabetics compared to the healthy control subjects . They hypothesized that the decreased ability of hdl to protect erythrocyte membranes could be related to lipid composition of hdl and to this low pon1 enzyme activity figure 6 . The higher plasma levels of lipid peroxidation products in diabetic patients are ascribed to higher susceptibility of plasma lipoproteins to oxidation and decrease of plasma antioxidant defenses . Apart from decreased pon activity, abnormal hdl composition and altered hdl subclasses distribution are also found in type 1 diabetes patients . Activity of pon associated with hdl (hdl - pon) isolated from control subjects and type 1 diabetic patients . Activity is expressed as units per milligram of hdl protein the compositional changes in hdl lead to its altered functional activities resulting in lower protection exerted by hdl from diabetic patients against ldl oxidation and a decreased capacity to induce cholesterol efflux from biological membranes . There is also a conformational change in pon and altered availability of substrates within the hydrophobic region of hdl in which pon is active . This leads to higher susceptibility to neural damage by these environmental toxins due to low pon activity in diabetes, resulting in an increase in organophosphate - induced delayed polyneuropathy in diabetic subjects . There are propositions that other enzymes associated with hdl surface, such as plasma platelet - activating factor acetylhydrolase, lecithin cholesterol acetyl transferase (lcat), and cholesteryl ester transfer protein (cetp), might be involved in the alterations of the protective effect exerted by diabetic hdl against oxidative damage of biological membranes . In fact, previous studies have shown, in diabetic patients, modifications of the activities of enzymes involved in the antioxidant role of hdl, such as lcat . Moreover, a pon - independent inhibition of ldl oxidation by hdl has been observed by graham et al . A larger proportion of the pon protein could be inactive in diabetes either because of the presence of an endogenous circulating inhibitor or perhaps because of increased glycosylation of pon . The loss of the strong correlation between pon concentration and glycation of apo a - i in healthy subjects and in all the diabetic populations might indicate a disruption in the interaction between pon and the hdl particle . Pon1 activity is lower in type 1 and type 2 diabetic patients, coupled with higher triglyceride levels, compared to non - diabetic control subjects although pon serum levels are not significantly different . Unlike type 1 diabetes, hdl and apo a - i levels have been found to be lower in type 2 diabetic patients . There is a contradiction in the literature about the correlation between glycated hemoglobin (hba1c) and pon1 activity . A negative correlation was found in both types of diabetes, although no significant association was reported between hba1c and pon1 activity in a study performed in type 1 diabetes patients . The lower serum pon1 activity was found in diabetic patients with macrovascular complications than in those with microvascular complications . In a recent study, reduced pon1 activity in type 2 diabetic patients was found to be associated with a significant increase in the risk of cardiovascular disease (cvd) which leads to the conclusion that pon1 activity could be a predictor of cvd in type 2 diabetes . Serum pon1 activity in diabetic patients with neuropathy was significantly lower than in patients without diabetic neuropathy . Both pon1 and arylesterase enzyme activities were lower in diabetic foot patients compared to healthy control subjects . Reported that l55 m and q192r polymorphisms are more common in diabetes and are associated with macroangiopathy figure 7 . Pon1 - 55 mm and pon1 - 192qq genotypes were associated with poorer diabetes control than ll and rr genotypes . Better diabetes control was found in patients with ll genotype than with mm, and similarly, in those with rr genotype versus qq (p <0.05). Chiu et al . Have shown that l55 m polymorphism, not q192 m, was an independent determinant for beta - cell function in glucose - tolerant whites . In turkish population, pon1-r192 variant was found as an independent genetic risk factor more than three times in the development of complications in diabetes and rr genotype may be a risk factor for cardiac complications in type 2 diabetes patients . Association of ll genotype and the development of diabetic retinopathy has been reported by mackness et al . Oxidized ldl has been shown to be cytotoxic to retinal capillary endothelial cells and pericytes, leading to development of retinopathy in diabetes . Pon1 activity was significantly low in patients with non insulin - dependent diabetes mellitus and retinopathy compared to patients without complication, but was not different between patients with and without proteinuria . Other studies have reported lower pon1 activity in diabetic subjects with nephropathy . In another study by abbott et al ., paraoxonase activity was lower in both type 1 and type 2 diabetic subjects . Rather, the difference in paraoxonase activity was explained by its specific activity, which was lower in diabetics, indicating either the presence of a circulating inhibitor or disturbance of the interaction of paraoxonase with hdl, affecting its activity . Table 2 gives the summary of studies demonstrating the relationship between lower pon activity in diabetes and its complications . Analysis of the studies on pon1 activity in diabetes leads to the conclusion that diabetes is associated with 1015% reduction in pon activity . The fall in pon1 activity is significantly more when diabetes is accompanied by microvascular complications, especially neuropathy and nephropathy resulting in higher risk for atherosclerosis . The frequencies of alleles in l55 m and q192r polymorphisms in diabetic patients and healthy subjects . Statistically significant differences (p <0.05): + between t1 dm vs. control subjects; between t2 dm vs. control subjects effects of the pon1 - 55 genotype on serum pon1 activity in subjects with type ii diabetes either with retinopathy or with no complications . P <0.001 summary of studies demonstrating low paraoxonase 1 activity in diabetes and its complications the positive correlation between pon1, hdl cholesterol, and apo a - i is well known . Pon genotype is a major determinant of serum lipid and lipoprotein concentrations, particularly hdl - associated parameters . The rise in apo a - i, which plays a protective role against atherosclerosis, was associated with an increase in serum pon1 concentration . On the other hand, human apo a - ii is proatherogenic . In vitro displacement of pon1 by human apo a - ii at physiological concentrations could explain the observation that pon1 was mostly found in hdl particles containing apo a - i but not apo a - ii, and thus the lack of anti - atherogenic properties of apo a - ii enriched hdl . Studies have demonstrated susceptibility of hdl to atherogenic modifications like glycation and homocysteinylation, induced in vitro in the absence of pon1 activity . Zech et al . Have reported that pon1 may first bind to smaller hdl3 particles and then transform into a larger hdl2 particle . Studies performed with both gel filtration and electron microscopic measurements confirmed this hypothesis and pon1 would seem to be present in larger sized hdl2 particle . Some studies have demonstrated that lipid - lowering treatments improve pon1 serum activity . In a recent study performed in 164 patients with type iib hypercholesterolemia, 3 months of statin treatment (atorvastatin 10 mg / day, simvastatin 10/20 mg / day, and fluvastatin 80 mg / day) significantly increased the pon activity in the three statin - treated groups compared to controls . Reported that 3-month treatment with micronized fenofibrate 200 mg / day in patients with coronary heart disease and type iib hyperlipidemia significantly increased serum pon activity (p <0.05) and improved the antioxidant status . Opposite to this, in another study on normolipidemic rats, fenofibrate treatment dose - dependently decreased plasma pon1 activity by 2040% figure 9 . In type 2 diabetic patients, gemfibrozil (gem) 600 mg / bid for 3 months increased pon1 activity, although no difference was observed in pon1 activity with gem (600 mg / bid) and bezafibrate (400 mg / day) treatments for 8 weeks in type iib hyperlipidemic patients . Macan et al . Reported that after gem treatment, plasma pon1 activity significantly reduced in rats on high - sucrose diet or on control diet compared to rats on diet - only therapy . In conclusion, the decreasing effect of fenofibrate on pon1 activity may be potentially an adverse effect, which could be masked by the positive changes in plasma lipid profile . A recent study has demonstrated that though carriers of cyp2c192 alleles exhibited lower levels of platelet inhibition by clopidogrel and higher on - treatment platelet aggregation than noncarriers, there was no significant difference in platelet aggregation among pon1 q192r genotypes . This leads to the conclusion that pon1 (q192r) polymorphism does not appear to be a significant determinant of clopidogrel response . Paraoxonase detoxifies homocysteine thiolactone in human blood and is thus hypothesized to delay the development of atherosclerosis . In tunisian population, the low pon1 activity was associated with the pon1 192rr genotypes corresponding with the severity of cad . Pon / hdl and pon / apo a - i ratio changes before and after micronized fenofibrate treatment . P <0.05 pon1 gene therapy may play a role in the management of dyslipidemia and liver diseases in the future . Injection of plasmid containing the human pon1 gene via rat tail vein could prevent dyslipidemia and hepatic lipid accumulation by increasing antioxidant superoxide dismutase (sod) and decreasing the serum levels of ldl, total cholesterol, triglyceride, and malondialdehye (mda). These results indicate that gene therapy with plasmid coated dna / pon1 might be an effective treatment for hyperlipidemia and liver diseases like hepatosteatosis . Table 3 provides the summary of studies demonstrating the relationship between lower pon activity in dyslipidemia and the effect of hypolipidemic agents on serum pon activity . The summary of studies on paraoxonase activity in dyslipidemia depicts 5060% higher ldl and 810% lower hdl cholesterol in obese subjects, contributing to higher cardiovascular risk . Treatment with hypolipidemic agents results in improvement in pon1 activity . Summary of studies demonstrating low paraoxonase 1 activity in dyslipidemia and effect of hypolipidemic agents on serum paraoxonase activity pon1, by virtue of its antioxidant property, prevents the formation of oxidized ldl and protects phospholipids in hdl from oxidation by inactivating ldl - derived oxidized phospholipids . Serum pon1 levels decrease in states of high oxidative stress like metabolic syndrome, obesity, uncontrolled diabetes, and dyslipidemia . Serum pon1 activity was found to be lower in diabetic patients with macrovascular and microvascular complications . Numerous polymorphisms in pon1 gene have been described; however, there is still not enough evidence to support the existence of relationship between metabolic disorders and specific polymorphism in pon1 gene.
We thank all the members of the cytoskeleton and cancer group and our collaborators, who collectively participated to the original manuscripts . This work was supported by grants from anr-13-jjc - jsv10005, la ligue nationale contre le cancer and fondation arc pour la recherche sur le cancer . V.m . Is supported by funding from equipe labellise ligue nationale contre le cancer 2011.
In 2007, a 14-year - old male killer whale at a marine park in san antonio, texas, usa, died suddenly without notable premonitory signs . On gross examination, mild multifocal meningeal hyperemia and petechial parenchymal hemorrhage focally extensive tan discoloration and fibrosis were present in the right accessory lung lobe with associated hemorrhage and congestion . Tissues fixed in 10% buffered formalin were processed routinely and stained with hematoxylin and eosin for histologic examination . Inflammatory lesions of the central nervous system were focused in gray matter of the medulla oblongata, pons, mesencephalan, and cerebellum . Blood vessels demonstrated mild to moderate acute necrosis and lymphocytic and contained plasmacytic and neutrophilic infiltrates within vascular walls . Encephalitis was characterized by perivascular lymphocytes and fewer plasma cells expanding the virchow - robbins spaces . Predominant lesions in the lungs were areas of chronic and active abscessation amid a focally extensive area of mixed inflammation and fibrosis . They were characterized by central ulcerations with necrosis and a mixed inflammatory infiltrate surrounded by variable fibrosis and a rim of epithelial hyperplasia . Changes in spleen, lymph node, and kidney included acute edema, congestion, and vascular dilation . Conventional diagnostic assays were performed for aerobic, anaerobic, and fungal microbes in liver, lung, kidney, cerebrospinal fluid, and brain . The final diagnosis was fulminant peracute bacteremia and septicemia secondary to a primary viral infection associated with nonsuppurative encephalitis . Published etiologic considerations for cetacean nonsuppurative encephalitis include morbillivirus and protozoal infections (2). A dna microarray with highly conserved sequences from> 1,000 viruses was selected to screen for known and novel viruses (3). Total rna was extracted from brain tissue and hybridized to a microarray as described (4). Analysis of the resulting hybridization pattern demonstrated a strong hybridization signal to many oligonucleotide probes on the microarray from the family flaviviridae, in particular to wnv . Consensus reverse transcription pcr primers (5) targeting wnv were used to confirm the microarray results . Hq610502) yielded a sequence with 99% nt identity and 100% aa acid identity to wnv strain ok03 (genbank accession no . Eu155484.1), a strain originally identified in oklahoma, usa . To further support a wnv diagnosis, we performed immunohistochemical staining on brain tissue . Rockville, md, usa) with peroxidase - tagged goat antirabbit immunoglobulin g (dakocytomation, carpinteria, ca, usa) bridge and 3-amino-9-ethylcarbazole (dakocytomation) as the chromogen . This staining demonstrated abundant wnv antigen within the cytoplasm of a small number of neurons and glial cells and in fewer macrophages in the brain tissue (figure). Brain specimen from killer whale (orcinus orca) with west nile virus infection that died at a marine park, san antonio, texas, usa, 2007 . Neurons and glial cells demonstrate abundant intracytoplasmic west nile viras antigen . We evaluated wnv exposure within the same cohort, as well as a geographically distant cohort of whales by using serologic testing . All testing was performed at the same laboratory by using a standard plaque - reduction neutralization test . In this assay, a 90% neutralization cutoff was used (6). A 90% plaque - reduction titer serum from the affected whale and 5 cohort killer whales from the same marine park in san antonio as well as 5 whales housed at another facility in orlando, florida, usa, were evaluated . In each facility, the animals have regular contact with each other . The facilities are geographically separated so the animals do not have exposure to those in the other park . All 6 animals from texas had 90% plaque - reduction titers> 10, ranging from 40 to 80 . These findings broaden the known host tropism of wnv to include cetaceans in addition to previously known pinnipeds . Although we cannot definitively attribute the cause of death of this whale to wnv, the observed lesions are consistent with those caused by wnv in other animals . The serologic results demonstrate that subclinical infections can occur and that exposure can be variable . Both bexar county, texas, and orange county, florida, have had wnv in wildlife since 2002 . Mosquito management practices are similar in both facilities and have been expanded since this diagnosis . Differences in wnv prevalence or mosquito numbers may have played a role in the different serologic results . Health evaluations of free - ranging and captive cetaceans should include wnv serology to assess exposure rates . This report focuses on killer whales, but the loafing behavior (stationary positioning at the water s surface) is commonly seen in many coastal dolphins, thereby increasing the likelihood of mosquito bites and exposure to wnv . Serologic screening of bottlenose dolphins (tursiops truncatus) from the indian river lagoon demonstrated wnv titers (7). As with many species of birds and mammals, wnv infection carries a risk for zoonotic transmission . Until the implications of this infection in marine mammals are better understood, biologists and veterinarians working with cetaceans should consider this possibility . Potential viral shedding can occur through the oropharygeal cavity and feces as well as through blood and organs during necropsies . Finally, our study demonstrates the broad applicability of using panviral microarray - based diagnostics . Even though pcr diagnostics are well developed for wnv, the agent was not initially considered as a potential pathogen in this species . Panviral microarray can be used not only to identify novel viruses but also to detect unsuspected agents.
Cells of the innate immune system sense host invasion by detecting structural determinants that are broadly conserved among pathogens of a given phylogenetic group . The lipopolysaccharides (lps or endotoxin) that decorate the outer membrane of gram - negative bacteria are excellent examples of such determinants . In response to minute concentrations of lps derived from certain gram - negative bacteria, macrophages secrete cytokines such as tumor necrosis factor (tnf), interleukin-1 (il-1) and il-6, which contribute to the containment of infection and help to initiate a specific immune response . On the other hand, overstimulation of the innate immune system through this channel dramatic differences in lps responses are apparent between closely related species, and there are substantial differences even among genetically heterogeneous members of the same species . For example, whereas humans and chimpanzees are generally considered to be very sensitive to lps, baboons and most other primates are highly resistant . It is likely that part of the difference in sensitivity may be explained at a very proximal level, although differences in responses to cytokines (for example tnf) may also have a role . Neither interspecific differences nor interindividual differences in lps responses have, until recently, been accessible to systematic genetic analysis . Although lps was once thought to exert its effects through intercalation into biological membranes, or to bind to many different receptors on the cell surface, it has been clear for nearly three decades that there is, in fact, a single biochemical pathway for lps detection . This was indicated by the observation that allelic mutations of a single gene (lps) in mice could entirely abrogate the response to lps, and did so with great specificity . Mice of the strains c3h / hej and c57bl/10sccr are highly resistant to lps, showing none of the usual biological effects, yet respond normally to other bacterial products and to most cytokines induced by lps . We recently identified the lps locus through positional cloning and showed that the lps - resistance phenotype was caused by defects in the toll - like receptor 4 gene (tlr4). In c3h / hej mice, a point mutation (p712h; single - letter amino - acid notation) modifies the protein within the cytoplasmic domain, creating a codominant inhibitory effect on lps signal transduction . In c57bl/10sccr mice the gene is deleted, yielding a recessive abolition of the lps response . Subsequently, overexpression of the wild - type tlr4 protein was found to enhance lps signal transduction in wild - type macrophages, lowering the effective concentration (ec50) for lps by a factor of 30, whereas overexpression of the tlr4 isoform represented in c3h / hej mice almost completely suppresses signaling . Furthermore, genetic complementation studies have demonstrated that lps and tlr4 enter into close physical proximity in the course of signal transduction - tlr4 appears to bind directly to lps . Hence, the species origin of tlr4 is the sole determinant of species preference for a given lps structure . Mice of the c3h / hej and c57bl/10sccr strains are abnormally susceptible to infection by certain gram - negative bacteria, suggesting that timely recognition of lps is essential for successful containment of infection . Because deleterious mutations of tlr4 have become fixed spontaneously in two strains of mice, we considered it possible that other functionally important mutations might be identified in mice and humans . Moreover, information on the degree of tlr4 polymorphism in these and other species might allow inferences about the importance of different tlr4 domains . Accordingly, we decided to sequence the entire tlr4 gene of both humans and mice, and to survey genetic variation at the locus in each species . We also examined the tlr4 sequence from two species of subhuman primates that have dramatically different responses to lps . The mouse tlr4 gene is somewhat longer than its human counterpart tlr4, owing to the greater length of intronic sequence - 15,337 base pairs (bp) from beginning to end of the transcribed sequence in the mouse, compared with 11,467 bp in the human . There are three exons in tlr4, and each corresponds to a homologous sequence in the human gene . Rock et al . Reported a human cdna sequence (genbank accession number u88880) that includes a fourth exon, positioned between the' normal' first and second introns . When included in the processed transcript, however, this exon specifies early termination of the polypeptide chain . Although it is possible that translation is initiated distal to the added stop codon, and that a shorter product results in the human than in the mouse, this would be unusual, given the length of the 5' untranslated region (utr) that would then exist and the presence of multiple upstream initiation codons . Moreover, there is no murine sequence homologous to the alternative second exon of the human gene . The biological significance of this exon is therefore unclear and, in all likelihood, its inclusion in the mrna leads to the formation of a nonfunctional protein . Neither the human nor the mouse gene has a tata element or caat box in the proximal promoter region . A number of conserved promoter and enhancer motifs are apparent on alignment of the murine and human 5' flanking sequences, and are described in detail elsewhere . Both tlr4 and tlr4 lie amid repetitive sequences of retroviral origin, and no other genes are detected close to either of them using homology searches or the gene prediction algorithm grail . In figure 1, the grayscale images of the human and mouse genes call attention to the repetitive elements in the region and illustrate the relationship between exons and spacing in the two species . The landscape of genomic dna in the region of human and mouse tlr4 genes . Exons are numbered 1 to 3 . In the human gene model, an added exon () is also portrayed, as found in the alternative sequence of rock et al ., in which early truncation of the protein is predicted . The grayscale image was generated using x - grail, version 1.3c, and depicts gc content as well as repetitive elements (both complex and simple) identified by repeatmasker (which appear as unbroken stretches of white). Grail exons are shown in green (highest quality) and blue (intermediate quality) above each grayscale image . Restriction sites indicate enzymes that cut at single sites within the interval . Among 35 strains of mus musculus, 10 different alleles were identified on the basis of mutations at 22 sites with respect to the reference sequence . Of these the ancestry of different tlr4 alleles can be traced by haplotype analysis, as many deviations from the reference allele occur in conjunction with one another . For example, the p / j strain tlr4 gene exhibits 11 mutations the distinguish it from the most common haplotype, six of them specifying changes in the tlr4 amino - acid sequence; the sea / gnj strain differs by nine mutations, and the strains nzw / j and vm / dk, which are identical to one another, differ from the most common haplotype at six sites . Shared mutations suggest that introgression took place after mutational separation had occurred, leading to the introduction of groups of mutations by genetic recombination . Hence, mice of the p / j, nzw / j, and vm / dk strains have several mutations that are observed in the a / j and balb / c strains, but also lack some of the mutations of the latter strains and have unique mutations of their own . Polymorphisms of tlr4 in mice * strains are as follows: i, nzo / hilt; 2, si / col; 3, dba / ij; 4, a / j; 5, el / suz; 6, cba / j; 7, akr / j; 8, balb / cj; 9, ddy / jci; 10, p / j; i i, mrl / mpj; 12, sjl / j; 13, nod / ltj; 14, 129/j; 15, fl / ire; 16, ma / myj; 17, swr / j; 18, lp / j; 19, pro / irej; 20, sodi / ei; 21, sea / gnj; 22, sm / j; 23, kk / hij; 24, st / bj; 25, wb / re; 26, ybr / ei; 27, fvb / nj; 28, pl / j; 29, lt / chresv; 30, rills / j; 31, rf / j; 32, nzb / binj; 33, au / ssj; 34, nzw / lacj; 35, vm / dk . Exon i, 26041 - 26424; exon 2, 32397 - 32563; exon 3, 37732 - 41297 . Ecto, extracellular domain; cyto, cytoplasmic domain; tm, transmembrane domain . Yes implies one or two forms; no implies three to five forms among the six mammalian species examined . Mutations occurring at sites that are relatively conserved among species (only one or two forms among six species) are shown in blue; those occurring at sites that are less conserved (three to five forms among six species) are shown in black . Numbers adjacent to arrows indicate the mutational distance (number of mutations separating each strain from its presumed ancestor), with reference to both coding and noncoding substitutions listed in table 1 . Arrows point in the direction of descent, and their lengths are proportional to distance . Most of the murine mutations reside within exon 3, and only two substitutions are noted that modify the cytoplasmic domain (figure 2 .) Of these, however, one mutation (r761h) is fairly common among the strains surveyed, and the corresponding residue has been reported as an h in the hamster . A single conservative substitution (v637i) the human and chimpanzee amino - acid sequences are nearly identical over the interval studied, distinguished by only three substitutions . The baboon sequence is 93.5% identical to the human in the extracellular domain, differs in the transmembrane domain by one substitution out of 30 residues, and differs in the proximal cytoplasmic domain by only one residue in 155 . At the carboxyl terminus, however, homology is badly disrupted, so that 16 of the last 21 human residues are not replicated in the baboon protein, which is 13 amino acids shorter than the human protein . Similarly, among rodents, the carboxyl terminus of the protein is the least conserved . Overall, the order of conservation with respect to domain is: proximal cytoplasmic domain> transmembrane domain> extracellular domain> distal cytoplasmic domain (table2, figure 4). Conservation of tlr4 among six mammalian species, calculated according to region with respect to the human sequence, the extracellular domain is amino acids 1 - 624; transmembrane domain, amino acids 625 - 658; proximal cytoplasmic domain, amino acids 659 - 618; distal cytoplasmic domain, amino acids 619 - 638 . Spline curve illustrating interspecific sequence variation across the tlr4 protein . A multiple alignment of tlr4 sequences from three rodent species (mouse, rat and hamster) and three primate species (human, chimpanzee and baboon) the number of amino acids observed at each residue was plotted using the program prism 3.0 (a value of 1 was assigned if a single amino acid was observed in the six species; a value of 5 was assigned if five different amino acids were observed among the six species, and so on). Where a deletion was introduced by pileup, a single mismatch was assumed . Where the sequence was truncated, each missing residue was tabulated as a separate mismatch . The mouse tlr4 gene is somewhat longer than its human counterpart tlr4, owing to the greater length of intronic sequence - 15,337 base pairs (bp) from beginning to end of the transcribed sequence in the mouse, compared with 11,467 bp in the human . There are three exons in tlr4, and each corresponds to a homologous sequence in the human gene . Rock et al . Reported a human cdna sequence (genbank accession number u88880) that includes a fourth exon, positioned between the' normal' first and second introns . When included in the processed transcript, however, this exon specifies early termination of the polypeptide chain . Although it is possible that translation is initiated distal to the added stop codon, and that a shorter product results in the human than in the mouse, this would be unusual, given the length of the 5' untranslated region (utr) that would then exist and the presence of multiple upstream initiation codons . Moreover, there is no murine sequence homologous to the alternative second exon of the human gene . The biological significance of this exon is therefore unclear and, in all likelihood, its inclusion in the mrna leads to the formation of a nonfunctional protein . Neither the human nor the mouse gene has a tata element or caat box in the proximal promoter region . A number of conserved promoter and enhancer motifs are apparent on alignment of the murine and human 5' flanking sequences, and are described in detail elsewhere . Both tlr4 and tlr4 lie amid repetitive sequences of retroviral origin, and no other genes are detected close to either of them using homology searches or the gene prediction algorithm grail . In figure 1, the grayscale images of the human and mouse genes call attention to the repetitive elements in the region and illustrate the relationship between exons and spacing in the two species . The landscape of genomic dna in the region of human and mouse tlr4 genes . Exons are numbered 1 to 3 . In the human gene model, an added exon () is also portrayed, as found in the alternative sequence of rock et al ., in which early truncation of the protein is predicted . The grayscale image was generated using x - grail, version 1.3c, and depicts gc content as well as repetitive elements (both complex and simple) identified by repeatmasker (which appear as unbroken stretches of white). Grail exons are shown in green (highest quality) and blue (intermediate quality) above each grayscale image . Among 35 strains of mus musculus, 10 different alleles were identified on the basis of mutations at 22 sites with respect to the reference sequence . Of these the ancestry of different tlr4 alleles can be traced by haplotype analysis, as many deviations from the reference allele occur in conjunction with one another . For example, the p / j strain tlr4 gene exhibits 11 mutations the distinguish it from the most common haplotype, six of them specifying changes in the tlr4 amino - acid sequence; the sea / gnj strain differs by nine mutations, and the strains nzw / j and vm / dk, which are identical to one another, differ from the most common haplotype at six sites . Shared mutations suggest that introgression took place after mutational separation had occurred, leading to the introduction of groups of mutations by genetic recombination . Hence, mice of the p / j, nzw / j, and vm / dk strains have several mutations that are observed in the a / j and balb / c strains, but also lack some of the mutations of the latter strains and have unique mutations of their own . Polymorphisms of tlr4 in mice * strains are as follows: i, nzo / hilt; 2, si / col; 3, dba / ij; 4, a / j; 5, el / suz; 6, cba / j; 7, akr / j; 8, balb / cj; 9, ddy / jci; 10, p / j; i i, mrl / mpj; 12, sjl / j; 13, nod / ltj; 14, 129/j; 15, fl / ire; 16, ma / myj; 17, swr / j; 18, lp / j; 19, pro / irej; 20, sodi / ei; 21, sea / gnj; 22, sm / j; 23, kk / hij; 24, st / bj; 25, wb / re; 26, ybr / ei; 27, fvb / nj; 28, pl / j; 29, lt / chresv; 30, rills / j; 31, rf / j; 32, nzb / binj; 33, au / ssj; 34, nzw / lacj; 35, vm / dk . Exon i, 26041 - 26424; exon 2, 32397 - 32563; exon 3, 37732 - 41297 . Ecto, extracellular domain; cyto, cytoplasmic domain; tm, transmembrane domain . Yes implies one or two forms; no implies three to five forms among the six mammalian species examined . Mutations occurring at sites that are relatively conserved among species (only one or two forms among six species) are shown in blue; those occurring at sites that are less conserved (three to five forms among six species) are shown in black . Genetic distance and probable ancestral relationships among tlr4 genes of 35 mus musculus strains . Numbers adjacent to arrows indicate the mutational distance (number of mutations separating each strain from its presumed ancestor), with reference to both coding and noncoding substitutions listed in table 1 . Arrows point in the direction of descent, and their lengths are proportional to distance . Most of the murine mutations reside within exon 3, and only two substitutions are noted that modify the cytoplasmic domain (figure 2 .) Of these, however, one mutation (r761h) is fairly common among the strains surveyed, and the corresponding residue has been reported as an h in the hamster . A single conservative substitution (v637i) the human and chimpanzee amino - acid sequences are nearly identical over the interval studied, distinguished by only three substitutions . The baboon sequence is 93.5% identical to the human in the extracellular domain, differs in the transmembrane domain by one substitution out of 30 residues, and differs in the proximal cytoplasmic domain by only one residue in 155 . At the carboxyl terminus, however, homology is badly disrupted, so that 16 of the last 21 human residues are not replicated in the baboon protein, which is 13 amino acids shorter than the human protein . Similarly, among rodents, the carboxyl terminus of the protein is the least conserved . Overall, the order of conservation with respect to domain is: proximal cytoplasmic domain> transmembrane domain> extracellular domain> distal cytoplasmic domain (table2, figure 4). Conservation of tlr4 among six mammalian species, calculated according to region with respect to the human sequence, the extracellular domain is amino acids 1 - 624; transmembrane domain, amino acids 625 - 658; proximal cytoplasmic domain, amino acids 659 - 618; distal cytoplasmic domain, amino acids 619 - 638 . A multiple alignment of tlr4 sequences from three rodent species (mouse, rat and hamster) and three primate species (human, chimpanzee and baboon) was generated using the gcg program pileup . The number of amino acids observed at each residue was plotted using the program prism 3.0 (a value of 1 was assigned if a single amino acid was observed in the six species; a value of 5 was assigned if five different amino acids were observed among the six species, and so on). Where a deletion was introduced by pileup, a single mismatch was assumed . Where the sequence was truncated, each missing residue was tabulated as a separate mismatch . The pathway by which lps activates host innate immune defenses has been illuminated by the positional cloning of lps and establishment of its identity with tlr4, a mammalian representative of an ancient family of receptors that serve both developmental and defensive functions . The function of tlr4 as the lps signal transducer became clear when mapping and sequencing data revealed tlr4 as the only gene in a critical 2.6 megabase (mb) region and, furthermore, showed that two strains of lps - resistant mice are homozygous for mutations of tlr4 that are absent in closely related lps - sensitive strains . In drosophila, the prototypic homolog of the mammalian toll - like receptors (toll) defends against fungal infection, whereas the protein 18-wheeler defends against bacterial infection . In the case of toll, there is no evidence of direct contact between the receptor and the microbial pathogen or its components . Rather, infection activates a proteolytic cascade that leads to the production of an endogenous ligand (sptzle), which in turn engages toll . The situation is apparently different in mammals, in which tlr4 is clearly a direct interface with the microbial world . As such, the primary structure of a tlr4 molecule determines ligand specificity, accounting for the well - known observation that mouse cells can recognize tetra - acyl lipid a as an agonist whereas human cells recognize it as an antagonist . As mice of the c3h / hej strain are highly susceptible to infection by gram - negative bacteria, it would seem plausible that among human patients with gram - negative sepsis, some individuals may have been at risk by virtue of mutations in tlr4 . The first step in determining whether different isoforms of tlr4 confer added risk of, or protection against, sepsis is the assessment of genetic variability at this locus in the normal population . Whereas ablative mutations of tlr4 abolish the capacity to detect lps, the question arises as to whether less severe mutation might alter either the specificity of lps detection, as discussed above, or the magnitude of the lps signal . Our present knowledge of tlr4 structural variation in mice may permit an answer to this question, insofar as the mutations might easily be recreated, and measurements of signal - transducing activity through the modified receptors carried out in immortalized c3h / hej macrophages . Animals of the a / j and p / j strains have defective tumoricidal capacity, although in neither case is the lps locus implicated in the defect . Deleterious mutations of tlr4 might reasonably be sought in individuals who have developed serious gram - negative infections, on the premise that mice with deleterious mutations of tlr4 are rendered susceptible to such infections . Similarly, in birds, a polymorphism at the tenascin locus (which lies a few megabases proximal to tlr4 in mice) predicts susceptibility to gram - negative infection, suggesting that it may lie in linkage disequilibrium with a particular form of the avian tlr4 gene . Beyond this, it may be assumed, given the powerful pro - inflammatory activity of the receptor, that germline or somatic mutations of tlr4 could in some instances cause constitutive signal transduction (as observed with the drosophila toll locus). In fact, in the lpr model of systemic lupus erythematosus, the lps locus was believed a likely modulator of phenotype . This would seem still more likely at present, given the paucity of other candidate genes in the immediate vicinity of tlr4 . The evolutionary conservation of tlr4 is of particular interest, in that different species show preferential responses to some lps forms and not others, and have particular' set points' for responses to toxic lps molecules . An assessment of variability may be made through comparison of different species, but is complemented by the study of a large number of individuals within species . Both approaches reveal that the extracellular domain of tlr4 is highly variable compared with the transmembrane domain and proximal cytoplasmic domain of the protein . Pooling the number of mutable sites in the extracellular domain and transmembrane domain of humans and mice, 17 coding changes are observed, compared with two in the proximal cytoplasmic domain . Moreover, variability does not seem confined to any particular region of the extracellular domain, but is spread uniformly across its length . Given that the ligand is an endogenous protein, extracellular domain conservation tends to be strict, insofar as mutations affecting extracellular domain structure are likely to diminish specificity or affinity of binding . The presumed ligand for tlr4 is lps itself, presented alone or in conjunction with another protein (for example cd14), and the relatively high frequency of polymorphism observed in tlr4 may be viewed as a consequence of the protective effect rendered by lps recognition and the variability of lps structure . This is probably due to the fact that the cytoplasmic domain of tlr4 is not required to cope with a ligand of variable structure . Rather, when called upon to signal, it must do so, utilizing transducing molecules with conserved structures . On the other hand, the intensity of the lps signal has apparently been optimized for each species, perhaps ensuring that the response to lps is appropriately integrated into the immune response as a whole . Humans, ungulates and rabbits, for example, exhibit an intense response to low concentrations of lps, whereas the lower primates and most rodents are relatively more resistant . The highly variable carboxy - terminal end of the tlr4 cytoplasmic domain may be seen as the embodiment of interspecific differences in lps sensitivity, although the poor conservation of this portion of the molecule might alternatively be taken to indicate a neutral effect of mutation . It is also possible that this region of the molecule is subject to a higher rate of mutation than that applying to the rest of the protein . Although most such mutations might be removed by selection, some might be discovered in populations defined by the occurrence of gram - negative sepsis . The mouse bacterial artificial chromosome (bac) 152c16 (from the 129/j strain, research genetics) was previously shown by us to contain the tlr4 gene in its entirety, and a small fraction of tlr4 was also found in the overlapping bac 309i17 . Human tlr4 was identified in bac 110p15 (genome systems) by hybridization screening using a pcr - amplified human tlr4 cdna sequence as a probe . All three bacs were fragmented by ultrasound, shotgun cloned into the vector pbluescript - ks, and extensively sequenced using abi model 373 and 377 sequencers, using big dye terminators; 959 reads were obtained from 390i17, 1503 reads from 110p15, and 2731 reads from 152c16 . The average read length was approximately 700 nucleotides . To concentrate data acquisition efforts on the tlr4 and tlr4 genes themselves, pcr primers were fashioned to match regions flanking each gene . A 16 kb fragment was amplified from the mouse bac 152c16, and a 12 kb fragment was amplified from the human bac 110p15, each containing all exons of the respective gene . These fragments were also shotgun cloned and extensively sequenced, so that the depth of sequence reached an average of 12 reads over the area of greatest interest . Sequence assembly used the programs phred and phrap (obtained from brent ewing and phil green, university of washington genome center). Interpretation of repetitive elements was achieved with the program repeatmasker (obtained from arian smit, university of washington genome center). A contiguous high - quality sequence 18,974 bp in length, containing tlr4, was obtained from the human bac, and a contig 91,748 bp in length, containing tlr4, was obtained from the mouse bac . Over these intervals, these sequences have been posted to genbank in annotated form (accession number af177767 for the murine sequence and af177765 for the human sequence). Mouse dna, obtained from animals of 35 mus musculus strains, was ordered from the jackson laboratories . Chimpanzee and baboon dna were obtained from kurt benirschke (university of california, san diego) and gregory delzoppo (scripps research institute), respectively . The three principal exons of tlr4 were amplified independently from mouse genomic dna samples, leaving a margin of approximately 50 bp to each side of the exons so as to indentify intronic mutations that might alter splicing . All exons of the chimpanzee were amplified and sequenced using the same primers used to amplify and sequence the human exons . For the baboon, the first two exons were also amplified using these same primers; however, the third exon of the baboon was amplified with a substituted primer at the 5' end . Exons 1 and 2 were sequenced using the same primers that were used for amplification . Exon 3 was sequenced using the flanking primers as well as a collection of eight internal primers . In this manner, the entire coding region and all splice junctions of tlr4 could be covered with a total of 14 sequencing reads . All primers used for amplification and sequencing are presented in table 3; separate sets were used to amplify and sequence mouse and the primate samples . Oligonucleotide primers used to amplify and sequence mouse and human tlr4 genes primer matches + strand; primer matches - strand . Independent assembly of each sample was required as a condition for further analysis, and if such assembly failed, additional reads were executed using a secondary collection of primers . Thereafter, mutations were identified en masse, by pooling all of the reads from 25 to 30 samples at a time and reassembling with the program polyphred, using the phred - phrappoly script (obtained from natalie kolker, university of washington genome center). Consed - alpha (obtained from david gordon, university of washington genome center) was used to visualize reads and mutations . The annotated chimpanzee exon sequences have been submitted to genbank with the accession numbers af179218, af179219 and af179220 . The baboon sequences have been submitted with the accession numbers af180962, af180963 and af180694 . For genetic comparisons, rat (genbank af057025) and hamster (af153676) tlr4 sequences were also used . A 500 mhz dec - alpha system equipped with 256 mbytes of memory was used for direct analysis of sequence data as described above . In addition to the programs already mentioned, the gcg software (version 9.0) was used for alignment analysis, with the program pileup used in multiple alignments of protein sequences . The windows - based program generunner 3.0 (hastings software) was used for the design of oligonucleotide primers . A spline curve describing heterogeneity of the tlr4 polypeptide sequence from different species sequences were prepared for submission with the use of the program sequin 2.90 (obtained from the national center for biotechnological information). The mouse bacterial artificial chromosome (bac) 152c16 (from the 129/j strain, research genetics) was previously shown by us to contain the tlr4 gene in its entirety, and a small fraction of tlr4 was also found in the overlapping bac 309i17 . Human tlr4 was identified in bac 110p15 (genome systems) by hybridization screening using a pcr - amplified human tlr4 cdna sequence as a probe . All three bacs were fragmented by ultrasound, shotgun cloned into the vector pbluescript - ks, and extensively sequenced using abi model 373 and 377 sequencers, using big dye terminators; 959 reads were obtained from 390i17, 1503 reads from 110p15, and 2731 reads from 152c16 . The average read length was approximately 700 nucleotides . To concentrate data acquisition efforts on the tlr4 and tlr4 genes themselves, pcr primers were fashioned to match regions flanking each gene . A 16 kb fragment was amplified from the mouse bac 152c16, and a 12 kb fragment was amplified from the human bac 110p15, each containing all exons of the respective gene . These fragments were also shotgun cloned and extensively sequenced, so that the depth of sequence reached an average of 12 reads over the area of greatest interest . Sequence assembly used the programs phred and phrap (obtained from brent ewing and phil green, university of washington genome center). Interpretation of repetitive elements was achieved with the program repeatmasker (obtained from arian smit, university of washington genome center). A contiguous high - quality sequence 18,974 bp in length, containing tlr4, was obtained from the human bac, and a contig 91,748 bp in length, containing tlr4, was obtained from the mouse bac . Over these intervals, these sequences have been posted to genbank in annotated form (accession number af177767 for the murine sequence and af177765 for the human sequence). Mouse dna, obtained from animals of 35 mus musculus strains, was ordered from the jackson laboratories . Chimpanzee and baboon dna were obtained from kurt benirschke (university of california, san diego) and gregory delzoppo (scripps research institute), respectively . The three principal exons of tlr4 were amplified independently from mouse genomic dna samples, leaving a margin of approximately 50 bp to each side of the exons so as to indentify intronic mutations that might alter splicing . All exons of the chimpanzee were amplified and sequenced using the same primers used to amplify and sequence the human exons . For the baboon, the first two exons were also amplified using these same primers; however, the third exon of the baboon was amplified with a substituted primer at the 5' end . Exons 1 and 2 were sequenced using the same primers that were used for amplification . Exon 3 was sequenced using the flanking primers as well as a collection of eight internal primers . In this manner, the entire coding region and all splice junctions of tlr4 could be covered with a total of 14 sequencing reads . All primers used for amplification and sequencing are presented in table 3; separate sets were used to amplify and sequence mouse and the primate samples . Oligonucleotide primers used to amplify and sequence mouse and human tlr4 genes primer matches + strand; primer matches - strand . Independent assembly of each sample was required as a condition for further analysis, and if such assembly failed, additional reads were executed using a secondary collection of primers . Thereafter, mutations were identified en masse, by pooling all of the reads from 25 to 30 samples at a time and reassembling with the program polyphred, using the phred - phrappoly script (obtained from natalie kolker, university of washington genome center). Consed - alpha (obtained from david gordon, university of washington genome center) was used to visualize reads and mutations . The annotated chimpanzee exon sequences have been submitted to genbank with the accession numbers af179218, af179219 and af179220 . The baboon sequences have been submitted with the accession numbers af180962, af180963 and af180694 . For genetic comparisons, rat a 500 mhz dec - alpha system equipped with 256 mbytes of memory was used for direct analysis of sequence data as described above . In addition to the programs already mentioned, the gcg software (version 9.0) was used for alignment analysis, with the program pileup used in multiple alignments of protein sequences . The windows - based program generunner 3.0 (hastings software) was used for the design of oligonucleotide primers . A spline curve describing heterogeneity of the tlr4 polypeptide sequence from different species sequences were prepared for submission with the use of the program sequin 2.90 (obtained from the national center for biotechnological information). We thank the zoologic society of san diego, which was the source of the chimpanzee genomic dna used in these studies.
Candida species have emerged as one of the most common causes of blood stream infections (bsi) among neonates and account for 9 - 13% of such infections, with most of the surveillance studies reporting a rising trend . Although candida albicans remains the most common fungal isolate from neonatal candidemia, longitudinal studies have detected a shift towards non - albicans candida (nac) species notably candida tropicalis, candida parapsilosis, candida krusei and candida glabrata . These micro - organisms are difficult to diagnose and cause significant morbidity and mortality despite antifungal therapy . The mortality associated with candida spp . A number of factors including the use of indwelling vascular devices, broad spectrum antibiotics, low birth weight (lbw), prematurity, total parenteral nutrition (tpn), gastrointestinal surgery, artificial ventilation and/or history of fungal colonization contribute to the risk . Preterm very lbw (pvlbw); 1500 g, extremely lbw (elbw); 1000 g and critically ill neonates are at highest risk of invasive candida infections . Outbreaks of candidemia have been associated with contaminated milk bottles, parenteral nutrition, glycerin suppositories, contaminated intravenous (iv) medicines and indwelling vascular devices, syringe reutilization and also from hands of health - care workers (hcw). Many of the other investigators did not find a common source, but outbreak was controlled after optimization of infection control policies . Here we describe an outbreak of candidemia caused by a nac species, which involved six neonates over a short period of 11 days in neonatal intensive care unit (nicu) of our hospital, a rural tertiary care center in srinagar garhwal, uttarakhand state, india . All the isolates were recovered in bactec peds plus / f culture vials of an automated blood culture system (bactec 9120, becton dickinson, usa). Any growth indicated was subcultured on 5% of sheep blood agar, macconkey's agar and sabouraud's dextrose agar (sda) with chloramphenicol (0.05%) and incubated at 37c . Briefly; the identification was done by colony morphology on sda, chromogenic media (hicrome candida differential agar, himedia laboratories, mumbai, india), growth at 45c, germ tube test, chlamydospore formation, carbohydrate fermentation and assimilation tests . Though the phenotypic identification tests were carried out but all the six isolates showed distinct, but identical phenotypic characters, which were not helpful in the species identification . Due to the limited laboratory capacity and resources, we were unable to determine the species of these candida isolates and also molecular testing could not be incorporated into our investigations . The in vitro antifungal susceptibility of all the isolates was determined by e - test (ezy minimum inhibitory concentration [mic] strips, himedia laboratories, mumbai, india) on rpmi agar supplemented with 2% of glucose . The plates were incubated at 35c and were read after 40 h. the isolates were considered as resistant if they exhibited the following mics; fluconazole (flk), 64 g / ml; itraconazole (itr), 1 g / ml; amphotericin b (amb), 1 g / ml . C. albicans - american type culture collection (atcc) 90028 and c. parapsilosis - atcc 22019 (kwik - stik, himedia laboratories, mumbai, india) were used as the control strains . The present report describes six cases of neonatal candidemia among the newborns housed in the same room of a nicu at our center . The first isolation was made on the 23 august 2012 from the blood of a preterm (gestational age 29 weeks), lbw (1200 g) neonate . The baby was in nicu for 13 days before she developed candidemia, after which she had severe respiratory distress, feed intolerance and failure to thrive . Despite aggressive treatment with amb and flk, she succumbed to infection within 3 days from the diagnosis . When admitted to the nicu (1 day of hospitalization), the new born did not appear to harbor infection with the candida spp . As evidenced by the absence of yeast isolation from all the specimens taken at the time of admission . Moreover, none of the other five cases had any such infection on the day of their admittance to the same nicu room . The other five cases occurred within a period of 10 days after the patients had been in nicu for 19, 28, 8, 26 and 15 days respectively . All the patients were having central venous catheters at the time of diagnosis, received tpn and were on broad spectrum antibiotics . The characteristics of the six neonates whose blood culture yielded this nac species are presented in table 1 . Although case 3 and case 4 survived the infection, others died despite of the treatment with amb or liposomal amb (ambisome). All six cases presented more or less with the same clinical features of which most common were respiratory distress, feed intolerance, abdominal distention and failure to thrive . Characteristics of neonates with candidemia as part of the patient management strategy, the central venous catheters of the neonates were changed after the diagnosis of candidemia . It is therefore not clear, how much the removal of catheters contributed to the infection control, particularly in case 2 who did not responded to amb treatment even though the yeast was sensitive to the drug in vitro . This report is noteworthy in that it describes the emergence of diverse nac species capable of causing outbreak of candidemia . Although c. albicans remains the most frequently isolated candida spp . In several centers, the role of nac species is increasing . Various outbreaks caused by nac species in the nicu setting have been reported previously, mainly caused by c. parapsilosis and c. tropicalis . All the six neonates had central venous catheters, were on broad spectrum antibiotics and received tpn . Four neonates were premature newborns and had lbw . All these are considered as major risk factors associated with development of candidemia . Use of multiple invasive devices such as catheters, endotracheal tubes and surgery causes break in the integrity of skin / mucosa, which predisposes these sites for colonization and infection by candida spp . Broad spectrum antibiotics ranging two - four in number were being administered to all the neonates in the present study . Antibiotics promote fungal overgrowth at the expense of normal bacterial flora and encourage translocation of yeast across the intact mucosa . The risk of candidemia is also known to increase exponentially with each class of antimicrobial used . Tpn induces gut mucosal atrophy and has immunosuppressive effects, which again predisposes individual for infection . Pvlbw; 1500 g, elbw; 1000 g, and critically ill neonates are at highest risk of invasive candida infections . The risk of systemic fungal infection in premature neonates weighing <1000 g is reported to be as high as 67% with a mortality rate of around 40% . Antifungal susceptibility results showed that all isolates were resistant to the azoles (flk, itr) tested, thus posing diagnostic and therapeutic challenges as azoles are widely used antifungals for the treatment as well as for prophylaxis of fungal infections . Resistance to azole compounds have been reported previously and is rapidly increasing particularly among nac species . None of the isolates were found resistant to amb . With the exception of some c. lusitaniae and candida haemulonii strains, the occurrence of amb resistance among candida spp . Is rarely reported . Although all the isolates were sensitive to amb, one of the neonates (case 2) did not responded to the amb therapy and had unfortunate outcome . Antifungal susceptibility profile of the six non - albicans candida isolates authors speculate that horizontal transmission of the organism occurred subsequently from case one to the other five cases through direct interaction between hcw / nurses and the infants . Poor hand hygiene practices and insufficient supply of alcohol hand rubs may be the contributing factors . Various environmental sources like use of non - sterile cotton, overcrowding of the nicu, plastic bags for transportation of iv medicines etc . The environmental sources are more likely to be problematic in resource limited settings where variety of strategies are often improvised as a result of misleading cost oriented (money saving) policies . In our center only, due to lack of the supply of sterile alcohol swabs nurses used to prepare handmade alcohol swabs with small pieces of sterile cotton kept in a non - sterile cup and an arbitrary alcohol was poured on top . These cotton swabs were used to clean the iv sites and iv ports before medication . Such improvisations should be discouraged as they may favor the outbreak resulting in significant cost as well as patient morbidity and mortality . Isolated from the cases was diverse and since all the isolates were recovered over a short period of the time and exhibited nearly identical phenotypic characters, they were part of an outbreak that probably must have originated from a common source . Although no specific containment measures were taken, the outbreak subsided by strict enforcement of infection control measures . This is strong evidence in favor of outbreak control as a result of the implemented measures . Meticulous attention to hand hygiene practices, use of sterile alcohol swabs, scrupulous care of medical devices, routine glove wearing even when urgent situation arise in nicus were the measures implemented . Unfortunately, we could not undertake epidemiological studies to trace the source of this distinct nac species.
Gastrointestinal stromal tumors (gist) represent less than 1% of all primary tumors of the gastrointestinal tract (git) and commonly affect patients in the middle and older age groups with equal gender distribution . . Their sub mucosal location can produce local obstructive symptoms, particularly when arising in the esophagus or the small intestine . Most gists usually present with vague upper abdominal pain, fullness or gastrointestinal (gi) bleeding . Sometimes they are found incidentally during barium studies, endoscopy or abdominal scans performed for other reasons . A 40-year - old man presented with a history of rectal bleeding for two days, with a reported loss of more than 1 liter of fresh blood . Despite intensive fluid management with whole blood and normal saline, colonoscopy was not attempted because of continuous bleeding . Tc-99 m labeled red blood cell (rbc) scintigraphy [figure 1] showed accumulation and movement of tracer in the mid - abdomen, corresponding to the region of the jejunal loops . A diagnosis of active gastro - intestinal bleed (likely to be from the jejunum) was made, and the patient taken up for exploratory laparotomy . A polypoidal exophytic mass about 4 cm in size was found in the jejunal wall, 40 cm from the duodeno - jejunal junction . The mass along with the adjoining jejunal loops was resected, followed by end - to - end anastomosis . Gross examination of the specimen [figure 2a and b] showed a polypoidal mass (measuring 3.2 cm in its largest dimension) arising from the serosal aspect, producing a bulge in the central part of the mucosa, which was ulcerated and could be the possible source of bleeding . Microscopic examination [figure 2c] showed a well - circumscribed tumor in the submucosa . The mass showed a spindle cell tumor arranged in long interlacing fascicles with characteristic perivascular arrangement of tumor cells . The tumor cells were moderately pleomorphic with mitotic rate of 2/50 high power field (hpf). Following surgery, the patient made a satisfactory recovery and was discharged on the seventh post - operative day . Dynamic scintigraphy using tc-99 m labelled red blood cells showing accumulation and movement of tracer in the mid - abdomen (arrows) the resected specimen from the jejunum (a and b) a polypoidal mass arising from the serosal aspect, with an ulcerated bulge in the central part of the mucosa (c) microscopic examination shows a spindle cell tumor arranged in long interlacing fascicles with perivascular arrangement of tumor cells (d) immunoperoxidase staining showing cd-117 positivity gists are derived from cajal cells or their precursors and most commonly occur after the age of 50 years in the stomach (60%), jejunum and ileum (30%), duodenum (4 - 5%), rectum (4%), colon and appendix (1 - 2%), and esophagus (<1%), rarely as apparent primary extra - gastrointestinal tumors in the vicinity of the stomach or intestines . The role of labeled rbc scintigraphy in acute gastro - intestinal bleeding is well - established and its application in rare cases has also been reported . However, few authors have discussed the role of tc-99 m rbc scintigraphy in discovering a bleeding gist . Surgery is the primary treatment of choice for patients with localized or potentially resectable gist lesions and is recommended if bleeding is present . The scottish intercollegiate guidelines network (sign) recommends that nuclear scintigraphy should be considered to assist in localization of bleeding in patients with significant recent lower gi hemorrhage . Although colonoscopy is the initial diagnostic modality of choice to localize the bleeding site for patients presenting with acute severe hematochezia, it is difficult when patients present with profuse bleeding . In these situations arteriography or labeled rbc scintigraphy is warranted . As a non - invasive investigation that requires no specific patient preparation, there is also no need of any iodinated contrast that may cause contrast - nephropathy in acutely ill - patients . Since the risk of malignancy was low in our patient, he has been kept under follow - up with no adjuvant treatment . This report highlights the advantage of this non - invasive investigation in hemodynamically unstable patients by detecting and localizing the site of an active gi bleed.
Endotoxemia frequently occurs during critical phases of clinical diseases, including trauma and infectious diseases, and inevitably causes shock and organ damage contributing to poor survival rate [1, 2]. Acute kidney injury (aki) is a common complication following endotoxic shock and is associated with a high morbidity rate of up to 64% . Despite significant advances in control of endotoxemia, there remains an urgent need to promptly prevent the occurrence of aki or restore impaired renal function associated with sepsis . In sepsis, renal blood flow is frequently reduced with progressive development of renal inflammation and oxidative stress, thereby contributing to the genesis of aki [5, 6]. Early resuscitation using crystal or colloid fluids to improve tissue perfusion and inhibit oxidative and inflammatory response may provide a meaningful degree of renal protection [7, 8]. However, infusion of large - volume fluids is always limited to critically ill patients, although caution must be exercised in patients with heart dysfunction, in whom small - volume resuscitation is typically used . The potential protective effects of small - volume fluid resuscitation on kidney injury induced by endotoxemia are currently unknown . Fortunately, small - volume resuscitation with hypertonic solutions has been successfully applied in clinical rescue of hemorrhagic and septic shock [1012]. However, the debate persists regarding which solution (crystalloids or colloids) is most beneficial [13, 14]. For instance, it is reported that appropriate administration of colloids seemed to be associated with reduced mortality, while others consider that resuscitation with balanced crystalloids was associated with a lower risk of in - hospital mortality [15, 16]. In the present study, we compared the effects of small - volume resuscitation with saline, 7.5% hypertonic saline (hts), hydroxyethyl starch 130/0.4 (he s), and hypertonic saline hydroxyethyl starch 40 (hsh) at a dose of 4 ml / kg on acute kidney injury induced by endotoxemia . The potential mechanism of the hypothesized protection was further explored, focusing on renal perfusion and variations of oxidative and inflammatory mediators . The study was reviewed and approved by the research ethics committee of the third affiliated hospital of sun yat - sen university, guangzhou, china . Thirty adult male sprague - dawley (sd) rats (180250 g body weight) were provided by the experimental animal center of sun yat - sen medical school and were treated in accordance with both international and institutional guidelines . Experimental procedures on rats were performed as previously described . Briefly, after anesthesia, animals were ventilated with 4050% oxygen (rodent ventilator 638, harvard apparatus, boston, ma, usa), with proper tidal volume (7 ml / kg) and respiratory rate (approximately 30 breaths / min). A phased - array, low - frequency probe (frequency 2.05.0 mhz) was placed in the left renal door cross - sectional level for kidney color velocity imaging (cvi) detection . All animals were given intravenous administration of 1 mg lps / kg through the right internal jugular vein to establish the endotoxemia model . Sodium pentobarbital in saline was obtained from sigma chemical co. (st . Louis, mo, usa). Lps was isolated from e. coli 0111:b4 and purchased from sigma chemical co. the experimental solutions were 0.9% saline (zhejiang chimin pharmaceutical co., ltd ., taizhou, china), 7.5% hypertonic saline (hts, the third affiliated hospital of sun yat - sen university, guangdong, china), hydroxyethyl starch (he s, fresenius kabi pharmaceutical co., ltd ., bad homburg, germany), and hypertonic saline hydroxyethyl starch (hsh, shanghai huayuan chang fu co., ltd ., rats were randomized into five groups, including control and four resuscitation groups (n = 6 per group). The groups were designated as follows: (1) group c (control group): 4 ml 0.9% saline / kg; (2) group s (saline group): lps 1 mg / kg + 4 ml 0.9% saline / kg; (3) group hts: lps 1 mg / kg + 4 ml 7.5% hts / kg; (4) group he s: lps 1 mg / kg + 4 ml hes / kg; and (5) group hsh: lps 1 mg / kg + 4 ml hsh / kg . Four kinds of resuscitation solutions at a dose of 4 ml / kg were administered at 30 min after intravenous injection of lps . And fluids were administered within 5 min according to . After performing systemic hemodynamic and renal blood flow measurements, rats were euthanized, blood was collected by cardiac puncture, and the kidneys were harvested . Systolic arterial pressure (sap) was monitored from catheterized internal carotid arteries with a hewlett - packard monitor . Renal flow indices were measured by doppler ultrasound using a technos mpx du8 instrument (esaote biomedica, genoa, italy). Image - pro plus image analysis software was used to calculate the ratio of renal blood signal and the peak renal cross - section area . Sap and renal microcirculation indices (renal blood flow signals (cvi), peak - systolic velocity (vmax), and end - diastolic velocity (vmin)) were recorded before lps administration (t0, baseline), 30 min after lps administration (t1), and 10 min (t2), 30 min (t3), and 60 min (t4) after small - volume resuscitation . Renal vascular resistance index (rvri) was calculated by the formula (1)rvri = vmaxvminvmax. Blood samples were obtained from the abdominal aorta 60 min after small - volume resuscitation . Renal function was determined by assaying serum for serum creatinine (scr) and blood urea nitrogen (bun) using the av800 chemistry analyzer (hitachi, hitachi city, japan). Renal tissues were taken 60 min after small - volume resuscitation and fixed in 10% formaldehyde . After being processed in an autotechnicon, sections of 5 m thickness were cut with a microtome and stained with hematoxylin - eosin (h&e). Separated tissue samples were fixed in 2% paraformaldehyde and 2.5% glutaraldehyde in 0.1 m pbs (ph 7.4) at 4c for 1 day for electron microscopy . After being postfixed with 2% osmium tetroxide, tissues were dehydrated in graded ethanol and embedded into araldite . The stained sections were examined using a leo 906e electron microscope . Because the renal cortex is highly sensitive to lps challenge, renal cortical tissue was separated from the rest of the kidney for analyses . Levels of tnf- and no were quantified with specific elisa and no kits (boster company, wuhan, china, and nanjing jiancheng bioengineering institute, nanjing, china, resp . ). Renal cortex was homogenized for assessment of mda level and sod activity with kits based on the thiobarbituric acid reactive substance assay and xanthine oxidase method, respectively (both by jiancheng bioengineering institute, nanjing, china). Statistical analysis of data was performed by using one - way analysis of variance (anova), while repeated measurements of anova were used for cvi analyses . Small - volume resuscitation with he s and hsh markedly decreased the augmented scr and bun levels (p = 0.028 versus group s) due to lps exposure, while hts resuscitation was less effective (figures 1(a) and 1(b)). Lps caused severe renal tubular injury, manifested as significant tubular degeneration, disintegration, edema, necrosis, and abscission of renal tubular epithelium, as well as cellular debris obstructing the collecting tubules and basal membrane fracture (figures 1(d) and 1(e)). Small - volume resuscitation with colloid and hyperoncotic solutions markedly ameliorated the renal injury, showing that local epithelial and mitochondrial edema, cellular necrosis, and abscission were seen in the hts group, while kidneys in the he s and hsh groups appeared with only slight edema with occasional cellular necrosis and abscission . These changes were correlated with the paller histology grading of lps - mediated kidney damage at 60 min after resuscitation (figure 1(c)). Sap was measured to evaluate the systemic circulatory state and renal perfusion was detected through doppler ultrasound by simultaneously monitoring renal blood flow signals (cvi), vmax, vmin, and the calculated rvri . Based on the measurement of these parameters, the lps - induced deterioration of systemic and renal hemodynamics was assessed by comparisons among the five groups at the t0 time point, while improvement after small - volume resuscitation was evaluated by comparisons among the five groups at the t1 time point . Doppler ultrasound showed that renal blood flow signal (cvi) was strongly and uniformly distributed with adequate cortex perfusion before lps administration and then dramatically decreased with discrepant distribution and weak renal perfusion (cvi) under lps challenge . Small - volume resuscitation with he s and hsh markedly improved cvi, while saline and hts showed only slight improvement on renal blood flow (figure 2). The time courses for measurements of sap, vmax, vmin, rvri, and cvi throughout the five sequential study time points are presented in figures 2 and 3 . Lps caused marked decreases in sap, vmax, and vmin, and increased rvri (p = 0.012 versus t0); effects of lps continuously worsened over time in group s (p = 0.028 versus t0 and t1). Although resuscitation with he s and hsh failed to completely restore systemic and renal hemodynamics to baseline (p = 0.017, versus t0), the detected associated parameters were immediately and persistently improved (p = 0.027, versus t1), while hts only temporarily ameliorated these indices (p = 0.039; t2 versus t1). Figures 3(c) and 3(d) (line graph) illustrate date shown in figures 3(a) and 3(b) (histogram) in a different manner . Production of tnf- and production of no, two important inflammatory mediators, were both promoted by the lps treatment, demonstrating generation of an inflammatory response . In this study, the levels of renal cortical tnf- and no markedly increased after lps challenge (p = 0.001; all versus group c) and were influenced to different degrees by the four types of fluid resuscitation . In the he s and hsh groups, tnf- levels decreased (p = 0.013 versus group s) (figure 4(a)) and no levels did not change, while in the hts group both tnf- and no were maintained at high levels (figure 4(b)). Mda, a by - product of lipid peroxidation, reflects the extent of oxidative damage, while the activity of sod, a critical antioxidant, can be used to represent the antioxidative capacity . Lps challenge increased renal cortical levels of mda and inhibited activity of sod (p = 0.002; all versus group c). Small - volume resuscitation improved the renal oxidative stress state, with resuscitation with he s and hsh decreasing the augmented mda level and enhancing the sod activity (p = 0.036, versus group s or hts) (figures 4(c) and 4(d)). Severe infection causes endotoxemia and the kidney is one of the first organ systems affected by lps . Reports indicate that endotoxemia - induced renal hypoperfusion contributes to an ischemia - reperfusion insult that potentially leads to the activation of renal inflammation and oxidative stress . Fluid resuscitation has always been recognized as the primary resuscitation strategy for patients with aki after endotoxemia [7, 11, 12, 20]. Although large amounts of fluid infusion could quickly improve renal perfusion, it is strictly limited to use in some critically ill patients suffering from endotoxemia and is contraindicated in patients with heart dysfunctions . Small - volume resuscitation with hypertonic fluids has been regarded as an effective strategy for hemorrhagic shock, but it is unclear how different kinds of fluids affect kidney injury induced by lps . Hence, our purpose here was to investigate the varying ameliorating effects of small - volume resuscitation with saline, 7.5% hypertonic saline, hydroxyethyl starch 130/0.4, and hypertonic saline hydroxyethyl starch 40 on lps - induced aki . Based on the available reports, we used the intravenous resuscitation dose of 4 ml / kg as an effective and safe dose . To this end, we conducted assessments of pathology images, systemic blood pressure, and renal perfusion, as well as renal levels of tnf-, no, and mda and activity of sod . Our results showed that, as compared with saline, small - volume hydroxyethyl starch 130/0.4 and hypertonic saline hydroxyethyl starch 40 could rapidly ameliorate the severity or postpone the development of renal tubular injury in the rat model of endotoxemia . At the same time, hydroxyethyl starch 130/0.4 and hypertonic saline hydroxyethyl starch 40 immediately restored systemic and renal blood flow and even reduced the renal inflammatory response and oxidative stress . In contrast, 7.5% hypertonic saline only temporarily improved systemic circulation and renal blood flow without having effects on cytokine release . Endotoxemia has been proven to be associated with progressive renal dysfunction, even in the presence of normal or elevated blood pressure and cardiac output [13, 14]. Insight into renal microcirculation should provide more meaningful information about the underlying mechanisms of renal dysfunction . Doppler ultrasound is a precise method to evaluate renal blood flow . In the present study, we applied doppler ultrasound and showed that small - volume resuscitation with he s and hsh immediately and permanently improved the deceased renal blood flow that resulted from lps challenge, while hts showed only slight and temporary effects compared to those elicited by saline . Meanwhile, parameters for systemic blood pressure evolved in coincidence with the trend of renal blood flow and pathological damage . These results suggest that the choice of different fluids is closely related to the improvement by small - volume resuscitation of renal perfusion . Accordingly, we conclude that infusion of colloids is better for clinical small - volume resuscitation for endotoxemia patients having complications with heart dysfunction . Furthermore, because the small - volume resuscitation could not completely restore systemic circulation and renal blood flow, other strategies should be adopted to improve the protective effect, including resuscitation in combination with vasoactive or organ - protective drugs . Normal saline, an isotonic solution, is rapidly distributed around vessels, while hypertonic saline can transfer interstitial fluids into vessels to improve circulation based on its hypertonicity . However, it has a short duration of action because of the rapid reestablishment of osmotic balance between intra- and extracellular fluids . He s and hsh can elevate colloid osmotic pressure and stay longer in vessels to effectively maintain intravascular volume . This may be the main reason why small - volume resuscitation with he s and hsh alleviates kidney injury by improving renal hemodynamics and microperfusion . During the initial period of endotoxemia, it is the severity of the inflammatory response and oxidative stress that trigger microvascular dysfunction and early organ failure, and treatment during the first six to twenty - four hours is critical for patient outcome and survival [2628]. In addition to cytokine storms (e.g., tnf-, ifn-, and il), no has been increasingly recognized as a biological mediator that plays an important role in the damage process . As to sepsis, both experimental and clinical investigations have revealed enhanced no in the plasma, which correlates inversely with arterial bp . Here, we analyzed alterations to the levels of tnf-, no, and mda, as well as sod activity, and found that small - volume resuscitation with hsh and he s reduced renal cortical inflammatory response and oxidative stress, while hts did not . Several studies of fluid resuscitation have also verified that renal perfusion is closely related to local renal oxidative and inflammatory response in endotoxic and hemorrhagic shock models . Based on the previous and these current results, we conclude that hsh and he s were more effective in improving renal blood flow . Considerable controversy exists, however, about the safety and effectiveness of using colloid solutions in critical care units . Of note, one clinical trial indicated that application of he s is associated with increased rates of renal - replacement therapy . Indeed, patients in this trial repeatedly or predominantly received infusion with he s, resulting in collagen deposition in the perinephric space, contributing to the main cause of hes - associated renal injury . Similarly, another randomized controlled study found that he s provided significantly better lactate clearance and less renal injury than saline . The authors concluded that resuscitation with hydroxyethyl starch improves renal function and lactate clearance in penetrating trauma . In the present study, we showed that early single resuscitation with small - volume colloids or hyperoncotic solutions could effectively alleviate renal injury and was better than the use of crystalloids . Therefore, our results provide a rationale and valuable strategy for ameliorating renal injury in the early stage of endotoxemia using resuscitation with a single small volume of colloids or hyperoncotic solutions, especially for patients complicated with heart dysfunction . The first is that we did not assess the long - term outcome of rats, including survival rate and mortality rate observation . Secondly, albumin is another kind of colloids being considered to infuse during the early resuscitation of patients with severe sepsis . In the future study, we will replenish the detected parameters and added group albumin to make the investigation more integrated . In conclusion, our study provides the important finding that early small - volume resuscitation with single small volumes of hydroxyethyl starch 130/0.4 and hypertonic saline hydroxyethyl starch 40 leads to renal - protective effects from the damage due to lps exposure.
The introduction of acid - etch technique has opened a new era in orthodontic bonding . The increased adhesion produced by acid pretreatment, using 85% phosphoric acid was demonstrated in 1955 by buonocore.1 in 1965, with the advent of epoxy resin, newman2 began to apply this to directly bond brackets in orthodontics . Many factors affect the retention of the brackets during fixed orthodontic treatment.3 healthy enamel is also needed for the retention of the bracket, and an altered enamel surface may affect the retention.4 even though product development of adhesives is taking place at a rapid rate, decalcification of enamel around orthodontic brackets, seen clinically as white spot lesions, has remained a neglected part of orthodontic care . Decalcification is defined as loss of calcified tooth substance, and it occurs when the ph of the oral environment favors diffusion of calcium and phosphate ions out of enamel.4 preventing this decalcification that occurs during orthodontic treatment is an important concern because these lesions are unaesthetic, potentially irreversible, and cariogenic . The most important factors affecting the development of erosion during orthodontic treatment are oral hygiene, nutrition, and orthodontic bonding techniques . Sweets, carbonated fruit drinks, and other dietary acids lower the intraoral ph value below 5.5.4 - 6 factors other than ph, such as type of acid, pka, titrable acidity, buffering capacity, and temperature influence the dental erosive capacity of acidic liquids.7 enamel demineralization can occur, when the ph value in the mouth falls below 5.5 . The ph values of many soft drinks in the market are well below this value.8 soft drinks with their acidic ph and increased adhesion have the potential to demineralize enamel.8 frequent consumption of soft drinks is increasing in children, because of easy availability, increasing promotion, and sales of various commercially available soft drinks . The term soft drinks refer to all drinks except alcohol, mineral water, fruit juice, tea, coffee, or milk - based drinks, which may or may not be carbonated . They are damaging because they contain high levels of sugar and also due to low ph levels (ph <5.5). Soft drinks consumed frequently have been shown to cause extreme dental erosion.9 dental erosion is defined as the acid - induced loss of hard tissue, a chemical process in which bacteria play no part; and hence, dental erosion is not associated with dental plaque . In an in vivo study, it was found that the prevalence of dental erosion increased as the ph levels of the studied drinks decreased and as consumption increased . Other studies using scanning electron microscope (sem) have shown that soft drinks produce large areas of enamel decalcification . In general, it is concluded that after immersion in beverages with low ph, the surface microhardness of the teeth is reduced.9 the appearance of white spot lesions caused by the demineralization of tooth enamel is a clinical problem associated with orthodontic treatment . Its prevalence is between 2% and 96% in patients with fixed appliances and is the result of demineralization process occurring around and beneath the brackets due to a decrease in ph . Studies that use sem to evaluate the effect of soft drinks on enamel sealed with orthodontic adhesives have observed areas of enamel showing an adhesive loss after exposure to soft drinks . This suggests that soft drinks consumption may provoke an increase in micro - leakage beneath brackets and also compromise bond strength.10 studies5,11,12 have demonstrated that saliva forms an important defense mechanism against erosion . It has been shown that all samples exposed to an erosive solution that were stored in saliva showed less erosion . Hence, this study was undertaken to study the effects of two soft drinks (coca - cola and mirinda orange) on the shear bond strength (sbs) of brackets and their effect on intact and sealed enamel by means of sem . This study was conducted to evaluate the effect of two soft drinks, coca - cola and mirinda orange on sbs of orthodontic brackets and on the enamel surface . One hundred and twenty premolar teeth, freshly extracted for orthodontic purposes, and free from enamel cracks, caries, and fillings were used in this research . They were further subdivided into three groups: (table 1) sample grouping for testing . Group i (sbs, n = 60)group ii (sem analysis with intact enamel [ie], n = 30)group iii (sem analysis with etched and sealed enamel, n = 30). Group i (sbs, n = 60) group ii (sem analysis with intact enamel [ie], n = 30) group iii (sem analysis with etched and sealed enamel, n = 30). The teeth were cleaned in water to remove any traces of blood and then they were placed in 0.1% thymol solution . Subsequently, they were stored in distilled water, which was changed at regular intervals to avoid deterioration . Then teeth in each group were mounted vertically on three different color - coded acrylic boxes for identification (green - artificial saliva, purple - coca cola, and red - mirinda orange). The brackets were bonded on buccal surfaces with transbond xt according to manufacturer s instructions . The buccal surfaces were polished with a rubber cup and polishing paste, etched with 37% o - phosphoric acid gel for 30 s, and then washed with water . A thin layer of transbond xt primer was applied to the tooth and light cured . The paste was applied to the bracket base and then pressed firmly onto the tooth . Excess adhesive was removed with a probe from around the base of the bracket and then the adhesive was light - cured, positioning the light guide on each interproximal side for 10 s. the specimens were divided randomly into three groups: subgroup - a: controlthe specimens were submerged in artificial saliva for 15 days, renewing saliva daily.subgroup-b: coca - colathe specimens were submerged in coca - cola for 15 days, for 15 min, 3 times a day, separated by intervals of 2 h. at other times, they were kept in artificial saliva.subgroup-c: mirinda orangethe teeth were submerged in mirinda orange following the same procedure as in subgroup - b . Subgroup - b: coca - cola the specimens were submerged in coca - cola for 15 days, for 15 min, 3 times a day, separated by intervals of 2 h. at other times, they were kept in artificial saliva . Subgroup - c: mirinda orange the teeth were submerged in mirinda orange following the same procedure as in subgroup - b . While artificial saliva was kept at room temperature, both coca - cola and mirinda orange were stored at a temperature of 5c . The immersion times and schedules used in previous studies vary widely . In general, specimens were submerged in the soft drinks continuously for long periods,13 - 15 whereas in the present research an immersion schedule was used that would reproduce as closely as possible the situation in vivo . In this way, assuming that these drinks are consumed 3 times a day and that it might take around 45 min to consume one drink, the specimens were submerged in the drinks for 15 min at a time and afterward in artificial saliva, a procedure that was repeated 3 times a day . The teeth were kept in saliva between immersions in the drinks in order to reproduce normal oral environment conditions and also to allow the possible remineralizing effects of saliva on enamel to take place.16,17 group i: containing 60 specimens was subdivided into three groups, each having 20 teeth which were used to carry out sbs testing, with the universal testing machine . Group ia (n = 20): 20 samples were color - coded with greengroup ib (n = 20): 20 samples were color - coded with purplegroup ic (n = 20): 20 samples were color - coded with red . Group ia (n = 20): 20 samples were color - coded with green group ib (n = 20): 20 samples were color - coded with purple group ic (n = 20): 20 samples were color - coded with red . The percentage of the bracket base surface area covered by adhesive was determined by adhesive remnant index (ari).18 the ari scale ranges from 1 to 5: all of the adhesive remaining on the enamel, with impression of the bracket basemore than 90% of the adhesive remaining on the enamel surface<90% but more than 10% of the adhesive remaining on the enamel surface<10% of the adhesive remaining on the enamel surfaceno adhesive remaining on the enamel surface . All of the adhesive remaining on the enamel, with impression of the bracket base more than 90% of the adhesive remaining on the enamel surface <90% but more than 10% of the adhesive remaining on the enamel surface <10% of the adhesive remaining on the enamel surface no adhesive remaining on the enamel surface . The 60 teeth for sem study were further divided into two groups: group ii ie (n = 30), where the buccal surfaces were polished with rubber cup and polishing pastegroup iii enamel etched and sealed (es) (n = 30) with transbond xt primer, where the buccal surfaces were polished with a rubber cup and polishing paste, etched with 37% o - phosphoric acid gel, and primed with transbond xt, which was later light cured for 20 s. group ii ie (n = 30), where the buccal surfaces were polished with rubber cup and polishing paste group iii enamel etched and sealed (es) (n = 30) with transbond xt primer, where the buccal surfaces were polished with a rubber cup and polishing paste, etched with 37% o - phosphoric acid gel, and primed with transbond xt, which was later light cured for 20 s. of the 30 specimens that made up each group, 10 specimens of each group were placed in artificial saliva, coca - cola, and mirinda orange, respectively . All specimens were cleaned in distilled water with ultrasonic agitation for 30 min and gently air - dried . They were then affixed to sem stubs; sputter coated with gold, and the enamel surface was examined under sem, operating at 20 kv, at 100 magnification . The specimens were divided randomly into three groups: subgroup - a: controlthe specimens were submerged in artificial saliva for 15 days, renewing saliva daily.subgroup-b: coca - colathe specimens were submerged in coca - cola for 15 days, for 15 min, 3 times a day, separated by intervals of 2 h. at other times, they were kept in artificial saliva.subgroup-c: mirinda orangethe teeth were submerged in mirinda orange following the same procedure as in subgroup - b . Subgroup - b: coca - cola the specimens were submerged in coca - cola for 15 days, for 15 min, 3 times a day, separated by intervals of 2 h. at other times, they were kept in artificial saliva . Subgroup - c: mirinda orange the teeth were submerged in mirinda orange following the same procedure as in subgroup - b . While artificial saliva was kept at room temperature, both coca - cola and mirinda orange were stored at a temperature of 5c . The immersion times and schedules used in previous studies vary widely . In general, specimens were submerged in the soft drinks continuously for long periods,13 - 15 whereas in the present research an immersion schedule was used that would reproduce as closely as possible the situation in vivo . In this way, assuming that these drinks are consumed 3 times a day and that it might take around 45 min to consume one drink, the specimens were submerged in the drinks for 15 min at a time and afterward in artificial saliva, a procedure that was repeated 3 times a day . The teeth were kept in saliva between immersions in the drinks in order to reproduce normal oral environment conditions and also to allow the possible remineralizing effects of saliva on enamel to take place.16,17 group i: containing 60 specimens was subdivided into three groups, each having 20 teeth which were used to carry out sbs testing, with the universal testing machine . Group ia (n = 20): 20 samples were color - coded with greengroup ib (n = 20): 20 samples were color - coded with purplegroup ic (n = 20): 20 samples were color - coded with red . Group ia (n = 20): 20 samples were color - coded with green group ib (n = 20): 20 samples were color - coded with purple group ic (n = 20): 20 samples were color - coded with red . The percentage of the bracket base surface area covered by adhesive was determined by adhesive remnant index (ari).18 the ari scale ranges from 1 to 5: all of the adhesive remaining on the enamel, with impression of the bracket basemore than 90% of the adhesive remaining on the enamel surface<90% but more than 10% of the adhesive remaining on the enamel surface<10% of the adhesive remaining on the enamel surfaceno adhesive remaining on the enamel surface . All of the adhesive remaining on the enamel, with impression of the bracket base more than 90% of the adhesive remaining on the enamel surface <90% but more than 10% of the adhesive remaining on the enamel surface <10% of the adhesive remaining on the enamel surface no adhesive remaining on the enamel surface . The 60 teeth for sem study were further divided into two groups: group ii ie (n = 30), where the buccal surfaces were polished with rubber cup and polishing pastegroup iii enamel etched and sealed (es) (n = 30) with transbond xt primer, where the buccal surfaces were polished with a rubber cup and polishing paste, etched with 37% o - phosphoric acid gel, and primed with transbond xt, which was later light cured for 20 s. group ii ie (n = 30), where the buccal surfaces were polished with rubber cup and polishing paste group iii enamel etched and sealed (es) (n = 30) with transbond xt primer, where the buccal surfaces were polished with a rubber cup and polishing paste, etched with 37% o - phosphoric acid gel, and primed with transbond xt, which was later light cured for 20 s. of the 30 specimens that made up each group, 10 specimens of each group were placed in artificial saliva, coca - cola, and mirinda orange, respectively . All specimens were cleaned in distilled water with ultrasonic agitation for 30 min and gently air - dried . They were then affixed to sem stubs; sputter coated with gold, and the enamel surface was examined under sem, operating at 20 kv, at 100 magnification . The brackets were debonded using the universal testing machine and the sbs was evaluated for all samples . Adhesive that remained after the bracket removal was assessed using magnifying glass and scored according to modified ari proposed by bishara et al.13 following this procedure a sem study was done to compare the surface changes seen on ie surface and etched and sealed enamel . When comparing the groups, higher mean sbs was recorded in group ia group followed by group ib and group ic, respectively . The difference in mean sbs among the groups was found to be statistically significant (p <0.05) (graphs 1 and 2). Higher mean ari score was recorded in group ic followed by group ib and group ia, respectively . The difference in mean ari among the groups was found to be statistically significant (p <0.001) (graph 3). Group ii (ie) intact enamel weibull survival analysis showed maximum probability failure of 75% in group ib [coca- cola] and group ic [mirinda orange] and a minimum probability failure of 40% in group ia [control]. The results confirm that probability failure of bracket bond strength is significantly less in the control group ia [artificial saliva] than the group ib[coca- cola] and group ic [mirinda orange]. This study further confirms statistically significant decrease in shear bond strength of group ib [coca- cola] and group ic [mirinda orange] and adequate bond strength in group ia [control] (table 3). Group iia (control): the control group showed a healthier enamel surface (figure 1). Scanning electron microscope: intact enamel (artificial saliva). Group iib (coca - cola): the enamel surface in the test specimens in coca - cola group showed increased surface irregularities, areas of crater - like depression, and extensive erosion pattern (figure 2). Scanning electron microscope: intact enamel (coca - cola). Group iic (mirinda orange): the enamel surface in the test specimens in mirinda orange group showed milder surface irregularities when compared to that of the group iib (coca - cola) (figure 3). Group iii (etched and sealed enamel) group iiia (control): the control group showed healthier enamel surface with etched and sealed enamel (figure 4). Group iiib (coca - cola): the enamel surface showed a greater degree of demineralization and also erosion was seen on the sealed enamel surface (figure 5). Group iiic (mirinda orange): the enamel surface of the test specimens in mirinda orange group also showed demineralization and mild erosion in the sealed area . But, the degree of demineralization is less when compared to group iiib (coca - cola) (figure 6). Scanning electron microscope: etched and sealed enamel (mirinda). When comparing group ii (ie) and group iii (etched and sealed enamel), group ii (ie) showed greater enamel demineralization . This was, especially more in the coca - cola group than in the mirinda orange group . Group ii (ie) intact enamel weibull survival analysis showed maximum probability failure of 75% in group ib [coca- cola] and group ic [mirinda orange] and a minimum probability failure of 40% in group ia [control]. The results confirm that probability failure of bracket bond strength is significantly less in the control group ia [artificial saliva] than the group ib[coca- cola] and group ic [mirinda orange]. This study further confirms statistically significant decrease in shear bond strength of group ib [coca- cola] and group ic [mirinda orange] and adequate bond strength in group ia [control] (table 3). Group iia (control): the control group showed a healthier enamel surface (figure 1). Scanning electron microscope: intact enamel (artificial saliva). Group iib (coca - cola): the enamel surface in the test specimens in coca - cola group showed increased surface irregularities, areas of crater - like depression, and extensive erosion pattern (figure 2). Group iic (mirinda orange): the enamel surface in the test specimens in mirinda orange group showed milder surface irregularities when compared to that of the group iib (coca - cola) (figure 3). Group iii (etched and sealed enamel) group iiia (control): the control group showed healthier enamel surface with etched and sealed enamel (figure 4). Group iiib (coca - cola): the enamel surface showed a greater degree of demineralization and also erosion was seen on the sealed enamel surface (figure 5). Scanning electron microscope: etched and sealed enamel (coca - cola). Group iiic (mirinda orange): the enamel surface of the test specimens in mirinda orange group also showed demineralization and mild erosion in the sealed area . But, the degree of demineralization is less when compared to group iiib (coca - cola) (figure 6). Scanning electron microscope: etched and sealed enamel (mirinda). When comparing group ii (ie) and group iii (etched and sealed enamel), group ii (ie) showed greater enamel demineralization . This was, especially more in the coca - cola group than in the mirinda orange group . Group ii (ie) intact enamel weibull survival analysis showed maximum probability failure of 75% in group ib [coca- cola] and group ic [mirinda orange] and a minimum probability failure of 40% in group ia [control]. The results confirm that probability failure of bracket bond strength is significantly less in the control group ia [artificial saliva] than the group ib[coca- cola] and group ic [mirinda orange]. This study further confirms statistically significant decrease in shear bond strength of group ib [coca- cola] and group ic [mirinda orange] and adequate bond strength in group ia [control] (table 3). Group iia (control): the control group showed a healthier enamel surface (figure 1). Scanning electron microscope: intact enamel (artificial saliva). Group iib (coca - cola): the enamel surface in the test specimens in coca - cola group showed increased surface irregularities, areas of crater - like depression, and extensive erosion pattern (figure 2). Group iic (mirinda orange): the enamel surface in the test specimens in mirinda orange group showed milder surface irregularities when compared to that of the group iib (coca - cola) (figure 3). Group iii (etched and sealed enamel) group iiia (control): the control group showed healthier enamel surface with etched and sealed enamel (figure 4). Group iiib (coca - cola): the enamel surface showed a greater degree of demineralization and also erosion was seen on the sealed enamel surface (figure 5). Scanning electron microscope: etched and sealed enamel (coca - cola). Group iiic (mirinda orange): the enamel surface of the test specimens in mirinda orange group also showed demineralization and mild erosion in the sealed area . But, the degree of demineralization is less when compared to group iiib (coca - cola) (figure 6). Scanning electron microscope: etched and sealed enamel (mirinda). When comparing group ii (ie) and group iii (etched and sealed enamel), group ii (ie) showed greater enamel demineralization . This was, especially more in the coca - cola group than in the mirinda orange group . Bonding of orthodontic brackets has become an accepted clinical technique since 1970 (zachrisson, 1994). Bonding has largely replaced banding and is superior to banding in terms of gingival and dental health and esthetics . The bonding procedure is based on enamel alteration created by acid etching of enamel as developed by buonocore.1 the advantages of direct bonding are easy bracket placement, acceptable clinical success rate, and reduction in chairside time . Significant bond failure is reported to vary between 0.5% and 16%.19 - 22 however, the fact is that damage caused to the enamel cannot be ignored . Even though many efforts have been made to avoid enamel damage and demineralization, such as crystal growth technique for bonding,23 studies done by it was found that bond failures by other methods are higher when compared with the conventional method . This irreversible surface enamel demineralization can be further aggravated by the frequent ingestion of soft drinks . As soft drinks consumption is emerging as a social trend in urban india, asking the patient to avoid consumption of soft drinks is easier said than done . The term soft drinks refers to all kinds of drinks except alcoholic ones, either carbonated or non - carbonated.9 it consists of acidic content such as phosphoric acid, which reduces the ph of the oral cavity.24 the increased consumption of soft drinks causes enamel erosion.25 the structure of enamel surface is crucial for bracket retention . Any modification of enamel surface may affect this retention.26 in dental caries, loss of minerals from the enamel subsurface occurs due to acids released from the microbial plaque . In enamel erosion, exposure to extrinsic acids results in demineralization and the factors contributing to the progression of erosion are poor oral hygiene and inadequate bonding procedures.27,28 it is reported that consumption of acidic and alcoholic drinks causes softening of the enamel due to loss of minerals from enamel and can decrease bracket retention.29 - 31 it also causes an increase in the micro - leakage under brackets.28 sixty premolars were selected for this study, as it was easier to obtain an intact tooth of an orthodontic extraction . The brackets were debonded using a universal testing machine and sbs was evaluated for all samples . Acidic soft drinks may have two concomitant effects on the bond strength of orthodontic brackets . It can directly deteriorate the structure of adhesive materials, on the other hand, it can cause erosive lesions on the enamel surface around the brackets, and hence decrease the bond strength.21,32,33 the results indicating a minimal difference in sbs among the groups in the present research (p> 0.05) were similar to another study.34 sbs of the coca - cola group was slightly greater than the mirinda orange group . The results of the present study are contrary to the studies35,36 showing that phosphoric acid - based drinks have lower sbs potential than citric acid - based drinks . Low dose citrate increases the ph and decreases the acidogenicity of the dental plaque, and its use is recommended to reduce the cariogenicity of non - alcoholic soft drinks.37 a study38 showed that soft drinks with a low ph, a phosphoric acid base, and a citric acid base could decrease the sbs of the brackets . The values obtained by sbs testing for all groups were statistically evaluated by analysis of variance to calculate the p value . The mean sbs of group ia (control) sample was 7.33 1.72 mpa, group ib (coca- cola) was 6.24 1.59 mpa, and that of group ic (mirinda orange) was 5.30 2.74 mpa . The lowest mean resistance to shearing forces was shown by mirinda orange group (5.30 2.74 mpa) followed by coca - cola group (6.24 1.59 mpa) and highest resistance to shearing forces was by the control group, i.e., artificial saliva (7.33 1.72 mpa). In this study conducted, ph was critically low for group ib (2.5) and group ic (2.7). These groups showed significantly lower values of sbs when compared to the control group, i.e., the artificial saliva (6.7). When evaluating sbs of group ib (coca - cola) and group ic (mirinda orange) it was found that group ib (coca - cola) had a greater sbs than group ic (mirinda orange). Weibull survival analysis was done to predict the number of bonds likely to fail at a clinically acceptable strength of 7 mpa . Weibull analysis is a survival analysis, which has the ability to provide reasonably accurate failure analysis and failure forecasts with extremely small samples . Any adhesive that remained after the bracket removal was assessed and scored according to ari proposed by bishara.20 when a bonded bracket is removed, failure at one of the following interfaces must occur: between the bonding material and the bracket, within the bonding material itself, or between the bonding material and the enamel surface . Failure at the enamel surface is not desirable because the bonding material may tear the enamel surface as it pulls away from it . The interface between the bonding material and the bracket is the usual and preferred site of bracket debonding.39 in this study, after evaluating the ari score, higher mean score was recorded in group ic followed by group ib and group ia, respectively . The difference in mean ari among the groups was found to be statistically significant (p <0.001). In order to find out among which pair of groups there existed a significant difference, a mann whitney the results showed that difference in mean ari scores was found to be statistically significant between group ia and group ib (p <0.05), group ia and group ic (p <0.05) as well as between group ib and group ic (p <0.001). Chi - square test revealed that the association between ari scores and the groups was found to be statistically significant (p <0.01). Higher number of samples in group ia had an ari score of 3 and majority of the samples in group ib had an ari score of 4 . In group ic, majority of the samples had an ari score of 5 or 4 . The phosphoric acid - based coca - cola (group ib) and citric acid - based mirinda orange (group ic) with significantly low ph showed a greater number of samples with bracket bond failure between the bonding material and enamel surface . In the control (group ia), most specimens showed bracket debonding showed bracket debonding occurring mostly at the interface of bonding material and the bracket which is the most desirable way of debonding . A study23 compared the erosive capabilities of a citric acid - based orange juice drink and phosphoric acid - based diet cola drink . It was found that the phosphoric acid - based diet cola had more erosive potential than the citric acid - based juice drink . Following this procedure all samples to be examined were gold - coated and subjected to sem under magnification of 100 . The sem results were interpreted and compared within the groups . Group ii with ie showed the highest level of enamel demineralization in group iib followed by group iic . Group iib, i.e., the coca - cola drink group showed larger areas of demineralization when compared to group iic, i.e., the mirinda drink group . Group iii with etched and sealed enamel showed a greater level of enamel demineralization in group iiib followed by group iiic . Here, again enamel demineralization was more in coca - cola drink group, i.e., group iiib when compared to the mirinda orange drink group, i.e., group iiic . When coca - cola drink group and mirinda orange drink group were compared with sem, the enamel defects in coca - cola drink group were more extensive and noticeable than the mirinda orange drink group . This could be because the erosive effect of phosphoric acid in cola group was more than the citric acid in mirinda orange drink group . While mirinda orange drink group was found to be less erosive than coca - cola drink group, yet the enamel surface of etched and sealed enamel was found to be less erosive with sem when compared to the enamel surface with ie . Thus, among the two soft drinks, coca - cola drink group showed greater erosive potential than the mirinda orange . But, mirinda orange drink group had lower resistance to shearing forces when compared to coca - cola drink group . Therefore, patients should be advised to consume fewer soft drinks, the choice of drink for the prevention of dental erosion and the frequency of its consumption should be reduced as it decreases the strength of the brackets . Hence, the orthodontist should properly guide the patient and give instructions to improve the efficiency of orthodontic treatment . The present in vitro study concluded that: the maximum sbs was seen in the control group (artificial saliva), followed by coca - cola group and the minimum bond strength was recorded in mirinda orange grouphigher mean ari score was recorded in mirinda orange group followed by coca - cola group and with lowest mean ari in control group (artificial saliva), respectively . The difference in mean ari among the groups was found to be statistically significantwhen comparing group ii (ie) and group iii (etched and sealed enamel), group ii (ie) showed greater enamel demineralization, which was specially more in the coca - cola group than in the mirinda orange group . The maximum sbs was seen in the control group (artificial saliva), followed by coca - cola group and the minimum bond strength was recorded in mirinda orange group higher mean ari score was recorded in mirinda orange group followed by coca - cola group and with lowest mean ari in control group (artificial saliva), respectively . The difference in mean ari among the groups was found to be statistically significant when comparing group ii (ie) and group iii (etched and sealed enamel), group ii (ie) showed greater enamel demineralization, which was specially more in the coca - cola group than in the mirinda orange group.
Glial cells were once thought to serve as a passive scaffolding to provide support for the electrically active neurons of the brain and spinal cord . These cells are now more fully appreciated in their role as heterogeneous and dynamic homeostatic and facilitator signaling cells of the central nervous system (cns). Together with neurons, glial cells also contribute to the supportive structure of the nervous system as they produce and assemble a highly organized extracellular matrix (ecm) with adhesive and charge characteristics that enable a wide array of efficiencies in function . The ecm is found throughout gray and white matter and is principally composed of a hyaluronic acid (ha) backbone that attaches to proteoglycans and glycoproteins . It is especially enriched in chondroitin - sulfated proteoglycans (cspgs) of the lectican family (aggrecan, neurocan, versican and brevican). Additional components include tenacins, link proteins (cartilage link protein 1, crtl1, and brain link proteins bral1 and 2), and other glycoproteins, including phosphacan, reelin, thrombospondins, and heparin sulfate proteoglycans (rutka et al ., 1988; viapiano and matthews, 2006; galtrey et al ., 2008). The following review was prepared by reading and discussion of over 200 research articles in the field from searches of extracellular matrix and spinal cord injury in pubmed and selecting those with significant impact and/or controversial points . The embryonic brain and spinal cord ecm is dominated largely by non - sulfated ha and expansive extracellular space, which occupies as much as 4050% of the volume of the early cns . Structural ecm adhesive molecules including laminins and fibronectin are loosely arranged and prevalent in the early neural tube where they provide substrates and signaling ligands for progenitor cell proliferation and migration, while later expression and regulation of additional growth - permissive and growth - inhibitory molecules modulate appropriate patterns of migration and axonalguidance (meyer - puttlitz et al ., 1995; sykova and nicholson, 2008; franco and mller, 2011; mercier and arikawa - hirasawa, 2012). Postnatally, the ha concentration in the brain and spinal cord decreases, but the synthesis and expression of hyaluronan synthases increases, stabilizing ha along the cell surface . Subsequently, there is a decrease in the amount of extracellular space and decreased expression of selected early ecm components, such as full - length neurocan, brevican / v2 and tenacin - c . This is accompanied by a corresponding increase in synthesis of more mature ecm components including a cleaved form of neurocan, and increased levels of aggrecan and phosphacan (meyer - puttlitz et al ., 1995; galtrey et al ., 2008). At the same time, laminin and fibronectin expression that are prevalent early in development are down - regulated in the gray and white matter, and become primarily restricted to the basal lamina of blood vessel and pial surfaces as described below . Some examples of staining patterns of selected ecm molecules in the intact adult mouse and rat spinal cord are shown in figure 1a d . Examples of chondroitin - sulfated proteoglycan (cspg) components in the ventral horn of the normal rodent spinal cord . (a) histochemical staining of transverse section from a mouse lumbar spinal cord with wisteria fluoribunda lectin (wfa), which preferentially binds to carbohydrate structures terminating in n - acetylgalactosamine linked to galactose . The dark staining surrounding ventral neurons reveals strong cspg - glycosaminoglycan content of the perineuronal nets as well as intercellular extracellular matrix (ecm) less tightly associated with the cell soma . (b) immunostaining with monoclonal anti - neurocan antibodies show neurocan condensed around large neurons in the ventral horn of the intact rat spinal cord . Dense aggrecan - rich perineuronal net structures surround a large motor neuron containing the cholinergic enzyme, choline acetyl transferase (chat; red). Note nearby motor neurons containing chat, but lacking aggrecan staining and small aggrecan - positive profiles which appear to be larger dendrites . (d) immunostaining with antibody raised against the link protein crtl-1 reveals proximity to most large neuronal cell bodies and loosely distributed throughout the gray matter in a rat spinal cord, well - characterized glycoprotein - dense ecm structures develop in a time and experience dependent manner throughout the gray matter . Specifically, in response to high neuronal electrical activity, the ecm surrounding a subset of neuronal perikarya condenses as a net - like structure surrounding synapses on the soma and proximal dendrites (carulli et al ., 2007; dityatev et al . These networks are the perineuronal nets (pnns) initially described and drawn by santiago ramon y cajal and camillo golgi (reviewed in (celio et al ., 1998)). The pnns are highly enriched in ha, tenacin - r, and the lecticans . The complexes are then secured firmly to the linear ha sugar chain backbone by the link proteins crtl1 and brai2 (bekku et al ., 2010). The pnns exhibit slightly different lectican combinations on different cell types and in different regions . Pnns have received extensive attention recently as critical mediators of synaptic efficacy and inhibitors of sprouting and plasticity, and several reviews of pnn formation and function are published elsewhere [e.g., (wang and fawcett, 2012)]. One important function of pnns is to restrict aberrant plasticity of neural wiring, thus marking a critical period in which pathways are established in different sensory systems . In addition, pnns serve to enhance synaptic efficacy in the mature cns by providing mechanical and biochemical diffusion barriers that reduce ion and neurotransmitter cross - talk (hrtig et al ., 1999). Recent studies also suggest that pnns can protect highly active neurons from metabolic stress associated with rapid firing (cabungcal et al ., 2013). Notably, quite similar dense ecm structures are also formed at perinodal regions along axons in the white matter, where they also enhance axonal conduction efficiency . Studies using knockout mice deficient in components of the nodal ecm such as tenacin - r resulted in disrupted perinodal ecm structures and marked deficits in axonal conduction (weber et al ., 1999). The ion channel distribution was unchanged, suggesting that these structures do not simply hold membrane proteins in place, but instead implicate a role for these structures in limiting ion diffusion . Thus, throughout much of the cns, the mature ecm provides fairly stable molecular interface that enhances efficient neural communication while restricting aberrant signaling and synaptic reorganization . In the absence of injury or disease, the cns - ecm is not only relatively stable, but is also effectively separated from that of the periphery by a basal lamina sheet - type matrix . For instance, at the neurovascular junction, the blood - brain or blood - spinal cord barrier is formed by vascular endothelial cells, pericytes and astrocyte endfeet and closely adhered with layers of basement limiting membrane (abbott et al ., 2006). This matrix includes collagens, laminins, fibronectin, entactin, thromospondin, heparin sulfate proteoglycans and cspgs with differing composition in the different layers . The laminar ecm structure can be seen in electron micrographs, and is continuous with that of the pial border . A similar basal lamina is also clearly identified between astrocytes and schwann cells at the dorsal root entry zone and at the axonal exit sites in the proximal ventral roots, thus effectively separating the peripheral glial environment from that of the cns . Only very limited ecm remodeling is seen in the adult cns, with the exception of specific sites where cellular proliferation, migration, or robust axonal sprouting continues through adulthood . In regions where neurogenesis is ongoing, the ecm is highlighted by continuous expression of growth and migration - permissive basement membrane components including laminins, collagen iv and perlecan (kerever et al . There is an especially high expression of n - sulfated heparin sulfate proteoglycans and tenacin - c, which likely serve to bind and activate relevant growth and proliferation factors . In addition, regions characterized by of high levels of activity dependent plasticity, such as the hippocampus and hypothalamus, exhibit more continual and dynamic ecm remodeling (theodosis et al ., 1997) injuries to spinal cord or brain often result from a rapid displacement or fracture of the bony vertebrae or skull that directly impacts the soft cns tissue, causing compression and/or contusion . The rich capillary beds are susceptible to shearing, resulting in petechial hemorrhages and extravasation of plasma proteins, while the white matter areas are subjected to mechanical distraction and axonal injury (tator and fehlings, 1991; soares et al ., 1995). These injuries are typically modeled for reproducibility in the laboratory by using a weight drop or controlled single impact devices or by the use of handheld clips or forceps applied to the dorsal or lateral aspects of the intact dura following asurgical laminectomy or craniotomy (ex . (jakeman et al ., 2000)). After the acute impact and primary events, a multitude of secondary pathophysiological processes ensues . These include edema and vasoconstriction leading to hypoxia; electrolyte dysregulation; accumulation of biochemical toxins, and a loss of energy metabolism (reviewed in (tator and fehlings, 1991)). Many therapeutic approaches are under investigation for acute treatments with the hope of reducing or preventing these secondary injury processes . The time course of local inflammatory changes after spinal cord contusion and compression injuries has been described experimentally in rodent and human studies (popovich et al . . Following impact, microglia and astrocytes at the injury site are activated by mechanical and biochemical stimuli within minutes to hours . The microglia upregulate cell surface receptors and rapidly extend processes toward the site of injury, and astrocytes quickly increase expression of chemokines and cytokines, which recruit leucocytes to the lesion site . As early as 6 hours after injury, neutrophils (polymorphonuclear leukocytes) arrive and release toxic molecules and proteases that help to break down the damaged and dead cells . Damage - associated molecular pathogens including nucleotide and damaged ecm fragments provide potent signals for activation of these cells, which go on to develop into active macrophages with a phagocytic morphology and marked expression of the lysosomal associated membrane glycoprotein, ed-1 (also called cd68), by 34 days after injury . The macrophage response peaks at 714 dpi after spinal cord contusion or transection injury (popovich et al ., 1997)and about 4 days post - injury after controlled cortical impact (chen et al ., 2003). However, unlike the resolution of inflammation and clearance of macrophages following injuries in the periphery, macrophages that accumulate in the lesion site of the brain or spinal cord remain elevated chronically . Macrophages can be activated in vitro along divergent functional pathways . In the presence of interferon gamma (ifn or toll - like 4 receptor agonists, they exhibit a classically activated phenotype (m1), characterized by expression of oxidative metabolites and pro - inflammatory cytokines . However, when exposed to interleukin-4 (il-4) or il-13, macrophages are activated in an alternative, or m2 phenotype, which is directed toward a wound healing response; these m2 macrophages secrete il-10, il-1ra and express arginase and cd206 (reviewed in (martinez et al ., 2009)). Following peripheral injuries, the wound healing events typically include an early m1 dominated response, followed by resolution to an m2-like phenotype . However, following injury to the brain or spinal cord, the initial peak includes a heterogeneous population of macrophages, including those that are polarized to an m1 and m2 phenotypes . After about 2 weeks following cns injury in the rodent, the lesion site is dominated by m1 macrophages that create a highly neurotoxic, inflammatory environment that persists chronically, potentially preventing the spinal cord from properly repairing, and inhibiting neurite outgrowth (kigerl et al ., 2009). One current approach to improve repair after injury is to identify treatments that could tip the balance of macrophage function toward an m2 phenotype . To date, however, there is no evidence that m1-like cells within an established lesion can be redirected in this manner . Many of the chemical signals that activate and recruit inflammatory cells also have profound effects on the resident glial cells and progenitors within the injured tissue . Factors released from the blood, including thrombin and plasma fibronectin, as well as cytokines and growth factors produced by injured neurons and glial cells, such as fibroblast growth factor, promote cell proliferation (mocchetti et al ., 1996). Astrocyte precursors and oligodendrocyte precursor cells (ng2) proliferate within the first week after injury (mothe and tator, 2005; zai and wrathall, 2005). Some of these proliferating cells originate from the ependymal and subependymal regions surrounding the central canal of the spinal cord and subventricular zone of the brain, but many also arise from existing resident ng2 precursor cells and protoplasmic astrocytes that are found throughout gray matter (barnab - heider et al ., 2010). The glial cells accumulate at the lesion border, where astrocytes increase expression of markers of early development (nestin and brain lipid binding protein, blbp) and cytoskeletal proteins including nestin, vimentin and glial fibrillary acidic protein (gfap), while many ng2 cells will differentiate into oligodendrocytes (zai and wrathall, 2005; tripathi and mctigue, 2007; white et al ., 2010). In time, the microglia intermingle with and differentiate into macrophages, and ng2 cells both line and enter the lesion site . In contrast, astrocytes are typically excluded from the macrophage rich lesion center . Indeed, by 1014 days after injury, there are few astrocytes within the lesion site . The specific stimuli that exclude astrocytes from the center of a spinal cord injury lesion are not fully understood . (1999) first described an in vivo model of scar formation without hemorrhage in which a microinjection of zymosan, which induces macrophage activation, induced the formation of a glial - bound cavity in intact rat corpus callosum . This showed that macrophage activation is sufficient to induce the retraction of astrocytes to a lesion border and formation of an astrocyte scar . This was followed with an in vitro study that demonstrated that when primary astrocytes were exposed to challenge by zymosan - activated macrophages, they retracted their processes and walled the macrophages off (fitch et al ., 1999). Wanner et al ., (2008)have recently developed a different in vitro model which combines stretch - induced activation of astrocytes with exposure to mesenchymal fibroblasts . The resulting cultures develop clearly defined isolated islands of fibrotic scar tissue surrounded by astroglial cells that closely mimic the fibroblast - astrocyte scar observed following spinal cord trauma in vivo . Thus, either activated macrophages or fibroblasts are sufficient to induce the formation of an astrocyte scar lining the site of injury . The scar - forming astrocytes at the borders of inflammatory cns lesions also dramatically alter their expression of ecm molecules . Disruption of the cns barrier by penetrating injuries or vascular damage leads to the invasion by leucocytes and also other peripheral cells including schwann cells, mesenchymal cells and perivascular cells . This is followed by increased secretion of basal lamina proteins by the astrocytes and the peripherally derived cells and a re - establishment of a glial limitans, effectively restoring separation of peripheral and cns environments . The newly formed glial limitans is a critical component of the challenge associated with regeneration, as most cns axons can easily grow along the permissive substrate surface, but do not readily pass through the dense sheet without activation of specific migratory proteases . In addition to re - establishing the basal lamina, the proteoglycan network surrounding the site of damage is also dramatically altered . The best studied of the ecm alteration are changes in the expression of cspgs and their glycosaminoglycan (gag) sidechains . Cspg - gags are highly inhibitory to axonal growth in vitro, and removal of these sites with chondroitinase abc (chabc) reduces the inhibitory effect of cspgs on axonal growth (mckeon et al ., 1995). Fitch and silver (fitch and silver, 1997) first documented the distribution and time course of cs - gag expression after spinal cord hemi - crush or cortical knife cut injuries using a mouse monoclonal igm that recognizes cs - gags (avnur and geiger, 1984). This antibody, clone cs56, has been used to localize inhibitory gag chains in many lesion models with similar results (ma et al ., 2004). It is concentrated at the borders of the lesion and increases in intensity wherever the astrocyte distribution approaches that of macrophages or peripherally derived cells that are in the lesion site . Fitch and silver noted that there is no notable increase in cs56 staining in regions of astrogliosis that are not associated with macrophages, such as the denervated dorsal columns and dorsal root entry zone away from the site of direct damage . Similar findings were confirmed in human sci tissues (buss et al ., 2004). Increases in cs56 staining are most notable in areas where the blood - brain barrier is disrupted, which would correspond to those areas where peripheral inflammatory cells and molecules come in direct contact with cns astrocytes . Figure 2a and b illustrate the increased expression of cs56 at the borders of a contusion 4 weeks after injury . Distribution of chondroitin - sulfated proteoglycan (cspgs) at the borders of a rat spinal cord contusion injury . (a, b) immunofluorescence of longitudinal sections stained using the cs56 monoclonal antibody that recognizes glycosaminoglycan side chains . Staining is markedly increased at the rostral border (rb) and caudal border (cb) of the contusion injury at 28 days after initial impact (green ^). (c) low power confocal micrograph of neurocan core protein staining (red) counterstained with a polyclonal antibody raised against the glial fibrillary acidic protein (gfap) found in reactive astrocytes (green). At 14 days after contusion injury in rat, gfap - positive processes (*) line the edges of the macrophage filled lesion (macrophages not shown), while neurocan core protein is restricted to the reactive neuropil slightly retracted from the edges of the glial border (arrows). Additional studies have documented changes in the cspg core proteins surrounding the site of trauma . Immunohistochemistry and in situ hybridization studies have shown that expression of neurocan, brevican, versican and ng2 all increase directly adjacent to the lesion borders as early as 1 day after a stab or cut injury of the brain or spinal cord and then recover to near baseline by 8 weeks post injury (e.g., (tang et al ., 2003)). In contrast, aggrecan expression near the lesion is markedly reduced after injury, and phosphacan is reduced in the perilesion borders but recovers by about 4 weeks after injury (andrews et al ., western blot studies demonstrate that neurocan shows a shift in processing, such that increased amounts of full - length neurocan accumulate at the lesion site after injury (tang et al ., 2003; andrews et al ., 2011) the re - expression of the higher molecular weight neurocan species seen in early development may provide a local environment that regulates cell migration and the diffusion of growth factors . In figure 2c and d, neurocan expression can be seen near the astrocyte border at the edges of a contusion injury . While cs56 staining does not increase in regions distant to the injury site, there are changes in expression of the cspg core proteins in regions associated with wallerian degeneration after dorsal root or cns injuries . Neurocan, brevican and versican expression are all increased in the dorsal horn after rhizotomy, and entorhinal cortex lesions result in increased ng2 and neurocan expression in the denervated hippocampus (haas et al ., 1999). After dorsal column lesions, ng2, brevican, and high molecular weight neurocan are increased in the denervated dorsal column nuclei (massey et al ., 2008). Following contusion injury in the mid - thoracic spinal cord, there are long term increases in high molecular weight neurocan expression in the gray matter as far away as the cervical and lumbar spinal cord segments (andrews et al ., 2011). Have recently demonstrated that there is a profound interaction between this remote pro - inflammatory gliosis response and the efficacy of intense locomotor therapy after a mid - thoracic sci in mice . If mice are subjected to daily sessions of body - weight supported treadmill training in the first week after injury, they actually develop deficits in locomotor function compared with non - trained controls . In contrast, in genetic knockout mice lacking the inflammatory protease, mmp-9, this early training deficit was replaced by improved recovery (hansen et al ., 2013). Thus, injury induced changes in ecm composition may serve to alter plasticity at segments far from the lesion site . The signals that induce expression of inhibitory ecm molecules at the lesion site are still being identified . Activated macrophages are appropriately localized and appear to be important for initiating the reactive properties of astrocytes in the time course of scar formation . Pro - inflammatory cytokines, such as il-6, tnf and inf promote astrocyte proliferation, and several growth factors produced by neurons and astrocytes early after injury, such as egf, tgf, and pdgf stimulate proliferation, cell migration and cspg production by astrocytes (smith and strunz, 2005). However, the wound healing factor, tgf is perhaps the most potent stimulus for cspg synthesis in vitro and its expression in vivo closely correlates with the time course of scar formation after sci . Is markedly upregulated 47 days after contusion injury in rats and it is expressed by microglia, macrophages and fibroblasts (mctigue et al . Therefore, cspg upregulation can be induced by both the very acute pro - inflammatory stimuli associated with immediate secondary injury as well as delayed factors from the recruited cells that drive resolution of the lesion site . Inhibiting tgf function with antibodies also inhibits both glial and fibrotic scarring, but does not enhance regeneration, suggesting that scar tissue and inhibitory molecules alone are not responsible for the failure of regeneration (king et al ., 2004). Astrocytes and macrophages signal bi - directionally in both positive and negative feedback mechanisms in scar formation . Reactive astrocytes actively synthesize chemokines and pro - inflammatory cytokines (falsig et al ., 2006). The role of astrocyte signaling through nuclear factor kappab (nfb) in inflammation is shown as mice with a constitutively active inhibitor of kappab expressed selectively in astrocytes have significant reduction in macrophage activation, glial scar formation, and exhibit enhanced locomotor recovery after a spinal contusion injury (brambilla et al ., 2005). However, this is subjected to feedback regulation, as new studies suggest that chondroitin sulfate dissacharide expression by astrocytes could also contribute to drive macrophages toward the alternatively activated, pro - regenerative, or m2 phenotype (ebert et al ., 2008). This feedback is limited, as cspgs remain elevated in the chronic sci borders, yet the chronic lesion site is dominated by classically activated or pro - inflammatory macrophages . A historical goal of cns regeneration research has been to eliminate the inhibitory astroglial scar in order to enable regeneration of axons across the site of an injury . Approaches have included the use of ethidium bromide or x - irradiation to kill dividing cells at the lesion site (ridet et al ., 2000). These methods are not specific for astrocytes, and while they can reduce scar formation at the appropriate doses, the glial cells resume proliferation and establish a typical scar at the lesion site shortly after treatment is ended . Resection or photo ablation methods remove an established glial border, but these effects appear to have no benefit for recovery and have not translated to long - term restoration of function . Recent studies using genetic and transgenic approaches have targeted ablation of gfap - expressing cells by incorporation of a herpes thymidine kinase that is activated with oral gancyclovir . In both brain and spinal cord injury models, the targeted ablation of all dividing astrocytes caused increased inflammation and expansion of the lesion, leading to impaired recovery (faulkner, 2004). Deletion of stat3 from nestin - expressing cells (okada et al ., 2006) or from gfap - expressing cells in mice (herrmann et al ., 2008) prevents the contraction of the glial border after sci, which leads to increased lesion size and impaired recovery . Thus, astrocyte mediated reactivity and scar formation are important for neural survival and for restricting inflammation and restoration of the blood - brain barrier . In contrast to effect of astrocyte and scar ablation, treatments designed modify the ecm at the lesion border without altering proliferation and migration can facilitate axonal growth and plasticity after injury . Cspgs are the most studied of these inhibitory molecules . As described above in in vitro studies, removing cspg - gag sidechains by intrathecal and/or intraparenchymal administration of chabc can promote sprouting of axons into perilesional areas and regions of degeneration after spinal cord injury (bradbury et al . In addition, inhibiting cspg - gag expression with deoxyribozyme - mediated knockdown of the xylosyltransferase-1 (grimpe, 2004), or blocking transcription of sox9, which lies upstream of cspg synthesis (mckillop et al ., 2012), also improve the capacity for local axonal sprouting at the lesion site . The functional results of administering chabc alone are inconsistent; while some labs have reported improved recovery in spinal cord injury models (bradbury et al ., 2002; caggiano et al ., 2005), others have not (harris et al ., 2010; mountney et al ., 2013) the best evidence shows that chabc can enhance functional plasticity of spared circuitry, and when it is combined with task - specific training, this enhanced sprouting is sufficient to support improved functional recovery, especially after partial injuries (tester and howland, 2008; wang et al ., 2011). In a recent study, d - xyloside, an inhibitor of cspg - gag synthesis, was administered to the site of contusion injury in mice either immediately or 2 days after sci (rolls et al ., when administered immediately post - injury, the enzyme reduces cspg expression, but surprisingly, it exacerbated the extent of damage at the lesion site . In comparison, administration of the same drug at 2 days post - injury had no effect on the lesion size, but enabled improved recovery . The authors suggest from these data that early expression of cspgs may limit inflammatory damage, while neural plasticity is enhanced in the delay paradigm by blocking cspg production coincident with cellular repair . However, this interpretation does not explain why numerous studies have shown that chabc, when given immediately post - injury, or even if it is increased prior to injury with viral vector expression, does not exacerbate the injury, but instead increases sprouting and/or improves recovery . One explanation for the detrimental effects of early xyloside treatment in the rolls work may be due to drug interactions or off target effects . The enzyme causes increased accumulation of long xyloside - linked gags in the golgi and extracellular matrix that cannot attach to the cspg core proteins (carrino and caplan, 1994). These accumulated gags may harm repair processes or signal other vents that exacerbate the lesion early after injury . Clearly, better approaches are needed to address this time dependent hypothesis using alternative synthesis and processing inhibitors in order to identify the optimal window of intervention for targeting inhibitory cspg sites . In summary, the result of the protective glial response to inflammation associated with trauma in the cns is the formation of a structural and chemical barrier that inhibits synaptic plasticity and axonal growth, both of which will be essential for neurological repair . In the last decade, great strides have been made in understanding the dual roles of the glial response and the nature of the ecm changes following injury . New approaches, including the extensive use of chabc, have been successful for modifying the inhibitory characteristics of the perilesion environment while maintaining the protective functions of the cellular response to injury . To date, however, the functional effects of ecm targeted therapies alone have been limited largely because they do not address cellular replacement or sufficiently drive the intrinsic growth potential of injured cns neurons . Exciting results are now being reported using strategies that combine cell grafting, intrinsic axon growth activation, and rehabilitation therapies with these ecm modifications . However, by starting with a firm understanding of the structure and function of the ecm and then appreciating the basic cellular dynamics that limit repair and recovery, the ultimate goal of identifying translatable therapeutic approaches that address the highly heterogeneous repair needs of different brain and spinal cord injuries is certainly achievable.
Worldwide, prostate cancer is the most prevalent malignancy in men, with a tendency to cluster in regions that are more highly developed . Prostate cancer mortality rates are relatively low, however, because many indolent cancers are detected by serum prostate - specific antigen (psa) screening . However, deaths from prostate cancer are a significant problem owing to the high overall prevalence of the disease: mortality ranges from 2 to 40 per 100,000 . Even though prostate cancer deaths have declined in some countries that have adopted psa screening, mortality rates have been increasing in most parts of the world . In korea in addition, there are suggestions in retrospective screening and surgical cohorts that the population of korean men with prostate cancer may be enriched for high - grade (gleason score 8 - 10) disease . Thus, the paramount challenges to reduce the burden of prostate cancer deaths are 1) to correctly identify men with lethal disease while it is still curable and 2) to effectively treat this high - risk group to optimize oncologic and survival outcomes . This review addresses the definition of high - risk, localized prostate cancer; treatment options; surgical and comparative outcomes; the role of pelvic lymphadenectomy (plnd); and the benefit of radical prostatectomy (rp) in the setting of lymph node metastasis . One of the goals of risk stratification at the time of the initial diagnosis should be to identify the subset of men with lethal prostate cancers with the most pressing need for local or systemic treatment . . Introduced in 1998, d'amico high - risk prostate cancer is defined by clinical stage t2c, serum psa> 20 ng / ml, or biopsy gleason sum of 8 - 10 . The national comprehensive cancer network (nccn) and european association of urology (eau) define high - risk prostate cancer similarly, by clinical stage t3a, serum psa> 20 ng / ml, or biopsy gleason sum of 8 - 10 . Table 1 summarizes the criteria that are used to define high - risk prostate cancer according to the different classification schemes . In their original report, d'amico et al . Found that freedom from biochemical recurrence after various local therapies varied according to preoperative risk classification, with high - risk men having a shorter time to biochemical recurrence when treated with brachytherapy instead of external beam radiotherapy or rp . Prostate cancer risk can also be classified according to the chance of adverse pathologic findings or biochemical recurrence . In the partin tables, a combination of validated preoperative variables (clinical stage, serum psa, biopsy gleason score) can predict the likelihood of extraprostatic disease, seminal vesicle invasion, and lymph node metastasis . An alternative risk classification is the cancer of the prostate risk assessment (capra) score, which uses the same preoperative variables as the d'amico / nccn / eau risk strata and the partin tables but also incorporates patient age and the proportion of positive biopsy cores, resulting in a numerical score of 0 - 10 . In this classification, high - risk prostate cancer is conventionally defined as capra 6 - 10, which correlates with adverse pathologic features and biochemical recurrence . Several nomograms predict the risk of biochemical recurrence after rp or radiotherapy [14 - 16]. The advantage of these nomograms in prostate cancer is their precision and resulting utility in decision making when taking into account individual patient attitudes toward risk . The disadvantage of nomogram - defined risk is that the result is within a continuum that lacks easily - identified risk categories, which are helpful in guiding management decisions . The prevalence of d'amico high - risk prostate cancer ranges from 20 to 35% . With the widespread adoption of psa screening for prostate cancer (1992 onward) for example, compared to the pre - psa era, contemporary high - risk men are more likely to be high risk by a biopsy gleason sum of 8 - 10 but to present with lower psa and lower clinical stage . Common treatment options for high - risk, localized prostate cancer include rp with bilateral pelvic lymph node dissection; observation; monotherapy with external beam radiation, androgen deprivation therapy, or brachytherapy; and combined modalities . Table 2 summarizes society - specific guidelines from the aua, nccn, and eau for the treatment of high - risk prostate cancer . In their seminal randomized prospective trial of rp versus watchful reported 13-year follow - up results, which demonstrated a significant overall survival benefit to rp, even in the subgroup of men with high - risk disease . Combined modality treatment entails external beam radiotherapy (up to 81 gray) with long term (2 to 3 years) androgen deprivation therapy (the " preferred " high - risk treatment according to the nccn) or external beam radiotherapy with brachytherapy with short - term (4 to 6 months) androgen deprivation . In a randomized trial in which 74% of men had intermediate- or high - risk prostate cancer, d'amico et al . Found that 6 months of androgen deprivation therapy was associated with a significant benefit in overall survival when compared with 70 grays of external beam radiation alone . In a prior randomized trial of men with high - risk and locally advanced prostate cancer, bolla et al . Demonstrated significantly improved overall survival when 3 years of androgen deprivation was added to 70 grays of external beam radiation alone . Every man with high - risk prostate cancer is not a candidate for treatment, however . Although observation and expectant management are extolled more for very low - risk disease, an asymptomatic man with high - risk prostate cancer may have advanced age or be significantly frail due to comorbidities . However, it should be noted that high - risk prostate cancer can be quite lethal even in the elderly . For example, in a population - based (seer) study of men 80 years old with a gleason sum of 8 - 10 who were diagnosed in the psa era but were managed without surgery or radiation, a significant proportion (16 to 29%) died of prostate cancer, whereas rates of death from competing causes ranged from 44 to 52% . After rp for high - risk disease, 10-year outcomes reported by loeb et al . Include a 32% rate of biochemical recurrence, 16% rate of metastasis, and 8% rate of prostate cancer - specific death . Biochemical recurrence after rp is associated with preoperative psa and biopsy gleason score . In men who have only one high - risk feature, those who are high - risk by psa> 20 ng / ml have a 5-year actuarial biochemical recurrence risk of 55%, whereas high - risk patients by a gleason sum of 8 - 10 have a 62% risk . Patients who are at high risk by clinical stage t2c experience biochemical recurrence at a rate even lower than that of intermediate - risk patients . In men who have already experienced biochemical recurrence after rp, independent predictors of shorter metastasis - free survival are faster psa doubling time and high pathologic gleason sum . Given these outcomes, it is essential to determine which patients should be selected for definitive local therapy . Patient selection is critical because adverse pathologic findings at rp may commit the patient to undergoing additional therapy . For example, men with only one high - risk feature (compared with 2 or 3 features) have less biochemical recurrence, metastasis, and cancer - specific mortality, and a gleason sum of 8 - 10 is the most adversely prognostic high - risk feature . In addition, in men with high - risk prostate cancer according to a high gleason score only (8 - 10) who underwent rp, the independent predictors of unfavorable pathology (seminal vesicle invasion or lymph node metastases) were a gleason sum of 9 - 10, an increasing number of cores with a gleason sum of 8 - 10, psa> 10 ng / ml, clinical stage pt2b, and> 50% core involvement . Therefore, preoperative predictors can help to select the high - risk prostate cancer patients who are most likely to benefit from rp . The nccn guidelines recommend adjuvant radiotherapy for psa recurrence or adverse pathologic features (extracapsular extension, positive surgical margin, or seminal vesicle invasion) as long as there is no evidence of disseminated disease (table 2). No prospective randomized studies have compared rp with combined modality radiotherapy and androgen deprivation in prostate cancer . There is limited retrospective evidence to suggest that rp may have superior oncologic outcomes in high - risk disease . . Reported on a multicenter cohort of 2,400 men with high - risk prostate cancer that the 8-year unadjusted actuarial probability of death was 3.8% with rp and 9.5% with external beam radiotherapy . The 8-year rate of absolute metastasis - free survival was 7.8% higher in the rp cohort as well . Note that whereas men in the radiation cohort often received more than 81 gray, only 56% received androgen deprivation therapy, which was short - course instead of long - term . Others have shown rp to be associated with less cancer - specific mortality in high - risk disease than radiotherapy with or without androgen deprivation, with a suggestion that the benefit to surgery may be limited to men <70 years old . However, another retrospective analysis showed that in patients with a gleason sum of 8 - 10, rp has no benefit over combined modality treatment in a multivariate analysis . In light of these limited data, proper patient selection for rp is paramount and should take into account patient age, preoperative stage and grade, and patient attitudes toward treatment - specific side - effects . Plnd during rp is recommended when the nomogram - predicted probability of lymph node metastasis 2% . The rates of lymph node metastasis range from 39 to 55% in men with psa> 20 ng / ml and range from 55 to 80% in men with a gleason sum of 8 - 10 . The extent of plnd can be standard (removal of obturator and external iliac nodal packets, proceeding distally to the femoral outlet), extended (also involving the removal of internal and common iliac nodes up to the level of the iliac bifurcation proximally), or " super - extended " (involving presacral and retroperitoneal dissection as well). The morbidity of plnd is directly related to its extent . Symptomatic lymphoceles are rare (2 to 4%) and are more frequent as more nodes are removed . In a robotic rp series, extended plnd with a yield of 20 nodes was associated with worse continence and higher erectile dysfunction at 6 months . In patients undergoing super - extended lymphadenectomy, the perioperative complication rate is reported to be up to 26% and includes prolonged lymphorrhea and wound dehiscence . This is especially important given the high rate of lymph node metastasis in high - risk prostate cancer . In a retrospective study seeking to define the natural history of men found to have lymph node metastasis at rp, rates of freedom from biochemical recurrence at a median follow - up of 45 months ranged from 10 to 39% and rates of asymptomatic biochemical recurrence ranged from 18 to 30%, with better oncologic outcomes for men with only a single nodal metastasis as opposed to multiple . Others have shown improved recurrence - free survival when plnd reveals only a single positive node . . Found that men undergoing extended plnd, compared to limited plnd, have significantly improved recurrence - free survival in the subset of men with a positive node density <15% . Therefore, in high - risk prostate cancer, given the prevalence of occult nodal metastasis and encouraging freedom from recurrence of symptoms in pathologic n1 disease, extended plnd is indicated at the time of rp . Some men with high - risk prostate cancer who are if the cancer is localized (clinical stage t2a or t2b) but the biopsy gleason sum is 8 - 10, plnd can be useful insofar as positive nodes (on routine histological section after staging plnd) in this scenario would portend a poor oncologic prognosis (85% or greater progression to clinically detectable metastases within 5 years), thus minimizing the benefit of subsequent rp . Nevertheless, rp may have an oncologic benefit in the setting of lymph node metastasis . This was suggested by cadeddu et al ., who retrospectively compared men who had rp with plnd compared with staging plnd alone . Among men with clinical stage pn1 and matching patients for metastatic tumor burden, 10-year actuarial survival was 61% in men who underwent rp compared with 45% in those who underwent staging plnd only . Similarly, in a series of men found to have nodal metastasis by intraoperative frozen sections, undergoing completion rp was an independent predictor of improved cancer - specific survival in a multivariate analysis . Thus, extended plnd is indicated when rp is the treatment modality for high - risk prostate cancer given the high rate of lymph node metastasis . Conversely, rp appears to have a survival benefit even in the setting of pathologic nodal metastasis by routine or frozen histological sections . Due to high worldwide prevalence, prostate cancer deaths comprise a significant health burden despite relatively low overall mortality rates . Strategies to reduce prostate cancer deaths, therefore, must focus on correctly identifying men with lethal, high - risk profiles of disease, and once diagnosed, treating these men effectively . Clinical definitions of high - risk prostate cancer vary, and a definite biological marker of lethal prostate cancer phenotypes is not yet available . Nevertheless, studying the commonly used d'amico - nccn high - risk definition, physicians have identified patient and preoperative tumor factors that can guide treatment decisions (surgery versus combined modality radiotherapy with androgen deprivation) to optimize oncologic outcomes.
Plasmodium falciparum malaria is responsible for over 1 million deaths each year, mostly in children under the age of 5 living in sub - saharan africa . And yet the number of malaria infections which go on to become life threatening is proportionally very small, as the majority of these infections either remain asymptomatic (due to the acquisition of clinical but non - sterile immunity after repeated exposure) or progress to disease without lethal complications . Viewed in an evolutionary context, the existence of severe disease presents a population - level compromise for the parasite between the necessity of bearing factors that increase survival and transmission and the risk that these will stimulate a host immune response that will either curtail the infection or perversely cause the death of the host (thus also spelling the end for the parasite). With the aim of identifying factors that may be relevant in the evolution of this balance, long et al . In a recent article in bmc evolutionary biology have investigated the influence of the inflammatory response on the severity of disease in a rodent model of malaria, and we discuss here how their results may bear on the coevolution of parasite and host, in the context of what is known about the determinants of severe malarial disease in humans . Severe malaria can be resolved broadly into two different syndromes: cerebral malaria and severe malarial anemia . Cerebral malaria is associated with impaired consciousness and sometimes convulsions and coma, and can leave those who recover with long - term neurological problems . Its pathophysiology is not fully understood but it is probably due to a combination of the obstruction of cerebral capillaries by parasitized cells and an overactive inflammatory response . Severe malarial anemia occurs when the suppression of erythrocyte production, combined with the destruction of red blood cells by the parasite itself, leads to a particularly profound anemia which can cause shock and respiratory distress . Both host and parasite factors are likely to contribute to the processes leading to severe disease, and long et al . Have examined one possible interaction using mice infected with different clones of the rodent malaria parasite plasmodium chabaudi chabaudi . Specifically, they have shown that blockade of the receptor for the anti - inflammatory cytokine interleukin-10 (il-10) has a dramatic impact on time to death of the infected animal, particularly where the infecting parasite clones are normally avirulent . This result certainly implies that il-10 plays a fundamental role in controlling the inflammatory response to malaria and that its absence can contribute to the demise of the murine host; long et al . Propose that the ability of the parasite to stimulate il-10 production is a factor determining its relative virulence . However, whether regulation of the inflammatory response by il-10 actually plays a part in the evolution of parasite virulence remains an open question and requires a careful consideration of the population - level consequences of interactions between host susceptibility and parasite virulence factors . The best - known host factors affecting the severity of malaria are genetic disorders of hemoglobin such as the sickle - cell trait and alpha - thalassemia . Sickle - cell trait offers protection against both clinical and severe malaria, but the protective effect of alpha - thalassemia seems to be specific to severe malaria, particularly severe malarial anemia . The high frequencies of these genetic disorders seen in malarious regions testify to their significance in modulating the outcome of malarial infection, and the advantage they provide to the host; however, there is little evidence that they have had any impact on the evolution of parasite virulence . This is probably because the mechanisms of protection do not act on any variable features of the parasite . The presence of sickle hemoglobin seems to affect several membrane features of a parasitized erythrocyte that may alter the likelihood that an infected cell will be phagocytosed, and alter the surface properties that allow the parasite to adhere to blood vessel endothelium, thereby avoiding phagocytosis by host macrophages and blocking the vessels . Alpha - thalassemia is associated with microcytosis and a high erythrocyte count, and it has been suggested that this may protect against extreme hemoglobin loss during malarial infection . None of these putative mechanisms would act differentially between parasite genotypes, and they therefore cannot be expected to drive the evolution of virulence . What sort of host factors can we then expect to influence the evolution of parasite virulence? Obvious candidates are the host receptors that allow adherence to endothelial cells by infected erythrocytes a process that is thought to be fundamental to malaria pathogenesis . Polymorphisms in the endothelial adhesion receptors cd36 and icam-1 have been described in malarious areas; however, case control studies have so far given conflicting results as to whether particular alleles do in fact offer protection (reviewed in). The parasite mediator of cytoadherence is plasmodium falciparum erythrocyte membrane protein 1 (pfemp1), encoded by the var gene family, and there is evidence to suggest that the expression of particular subsets of var genes may be associated with different disease outcomes (figure 1 and reviewed in). Such variation is likely to be due to differences in the host receptor binding specificity of the pfemp1 encoded by different var genes . It is well established, for example, that var2csa is associated with binding to the placenta in pregnancy - associated malaria, and a recent study was able to show a correlation between pfemp1 amino - acid motifs and severe disease phenotypes . Whether these variations reflect the evolution of the parasite population to optimize the survival of both parasite and host remains, however, an open question . Differential binding of the p. falciparum erythrocyte membrane protein (pfemp1) to host tissues . The parasite protein pfemp1 is expressed on the surface of infected red blood cells and binds to adhesion proteins chiefly on endothelial cells . Different variants of pfemp1 bind to adhesion proteins expressed on different endothelia and lead to different disease phenotypes . The figure is figure u11 - 1.2 from the online update to immunity: the immune response in infectious and inflammatory disease by defranco, locksley and robertson (new science press, london, 2007). As highlighted by long et al ., the cytokines of the innate immune response play an extremely significant role in both the prevention and the exacerbation of severe disease . There is ample evidence that higher levels of inflammatory cytokines, such as tumor necrosis factor (tnf) are associated with a higher likelihood of fatal cerebral malaria . Various tnf polymorphisms have been associated with differing susceptibilities to severe malaria (reviewed in). Other cytokines, such as il-1 and lymphotoxin, have also been implicated; indeed, recent evidence from mice (see and references therein) suggests that lymphotoxin is more fundamental to murine cerebral malaria than is tnf . Implicate il-10 in the prevention of severe disease, and indeed the possibility that il-10 polymorphisms might affect the severity of malaria has been investigated, although with conflicting results . If the ability of the parasite to stimulate il-10 production is a determinant of its virulence, as long et al . Suggest, the parasite population might be expected to coevolve with the host towards an optimum at which the level of il-10 production is sufficient to prevent immunopathology but does not hamper the control of parasitemia through inflammatory processes . Much further work is required to validate such a hypothesis, but it does rightly draw attention to the fine balance that is required between the various arms of the innate immune response to p. falciparum in order to achieve a perfect outcome for the parasite . A further glimpse into the complexities of the immunological processes contributing to severe malaria is provided by migration inhibitory factor (mif). This pro - inflammatory cytokine was thought to be involved in the pathogenesis of severe malarial anemia, for it appeared to suppress erythropoiesis in mice; but subsequent studies in humans suffering from malarial anemia have found a negative correlation between mif level and severity of anemia . Also, a recent study of mif levels in gabonese children with differing histories of malaria showed that those children who had only experienced mild malaria tended to have higher mif levels than those who had only experienced severe malaria . Interestingly, there exists mif homologs in the genomes of a number of human parasites, including p. falciparum, and it has been demonstrated that falciparum - derived mif (pfmif) is present in the sera of malaria patients . That same study also showed that pfmif has chemotactic effects on human monocytes, at lower concentrations than human mif . This clearly raises the possibility that parasite - derived factors could act directly to modulate the host immune response and set up a coevolutionary process . To fully understand the evolution of parasite virulence, it must be recognized that the selection pressures imposed on the parasite population by protective factors within the host are likely to change with time, and may even be affected in unpredictable ways by interactions between different host traits . For example, recent work has demonstrated that the two malaria - protective genetic disorders of hemoglobin mentioned earlier (sickle - cell trait and alpha - thalassemia) may interact to cancel out the malaria protection that either affords individually . Finally, the potential for host factors to drive evolution of virulence must be considered in the context of the development of acquired immunity . The initial inflammatory response to the parasite is part of the innate immune response, which provides immediate defence against infection . There is ample evidence of a positive role for the immune response in protecting against severe disease . The primary selective force on the parasite population is thus as likely to be from the protective immune response as from incidental immunopathology . An interesting model that includes it is based on the hypothesis that certain forms of severe malaria result from an excessive t - cell - mediated inflammatory response . Exposure to the malaria parasite (or to an antigenically cross - reacting pathogen)' primes' naive t cells to recognize it in future, and secondary infection activates those primed cells to release pro - inflammatory cytokines, causing excessive and potentially damaging inflammation . Upon subsequent infections, the various factors contributing to the development of clinical immunity mean that the parasitemia tends to be lower so providing reduced antigenic stimulation for the primed t cells . In addition, as part of the development of clinical immunity, the predominant t - cell phenotype may switch from th1 cells (producing pro - inflammatory cytokines) to regulatory t cells (producing anti - inflammatory cytokines). Severe malaria thus occurs in a window of incompletely acquired immunity, where the host immune system responds overzealously to a pathogen it recognizes, without the means to effectively control the inflammation . This hypothetical framework could explain why in malaria - endemic regions, those most at risk of severe malarial disease appear to be young children (who have had some previous exposure to the malaria antigen but who have yet to develop clinical immunity), but for those who visit malarious regions from other areas the risk of severe disease increases with age . The latter could be because it is possible for t cells to be primed to recognize the malaria parasite by exposure to a cross - reacting antigen the chances of which will increase with age . It is entirely consistent with this model that the probability of severe disease could be reduced among individuals who have better ways of regulating inflammatory processes, thus providing a route by which factors such as il-10 may affect the severity of disease by modulating the actions of the acquired immune response.
Heterotopic pregnancy is the coexistence of a living or dead intrauterine pregnancy, single or multiple, and extrauterine pregnancy located in the oviduct, ovary, uterine corner, cervix or peritoneal cavity . The first case was described in 1708 at that time the diagnosis was established during autopsy . In the latter years together with assisted reproductive techniques and the ultrasound techniques improvement, the incidence of heterotopic pregnancies increased from 1:500 to 1:100 of pregnancies . In this study the case of the coexistence of inter- and extrauterine pregnancies has been presented in a patient, who had been stated no increased risk of heterotopic pregnancy and who conceived in the course of natural menstrual cycle . A 25-year - old primipara in 6 week of the second pregnancy (the first one ended with miscarriage in 6 week 6 months before) came do the clinic at night (1 november 2007) because of lasting for 24 hours vaginal bleeding and abdominal pain . In medical interview regular menstrual cycles every 30 days, quite abundant, lasting 5 days, with accompanying abdominal pain . The patient had not undergone surgeries, suffered from no chronic diseases, no extrauterine pregnancy risk factors were stated in the medical interview . On admission do the clinic satisfactory general condition, arterial blood pressure 130/70 mm hg, pulse 78/min, body temperature 36.5c . The patient before the admission to the ward had been consulted by a surgeon who did not state indications for urgent surgical procedure . In physical examination the abdomen was soft, tender to palpation, mainly in the right hypogastric area, with no pathological resistance and surgical abdomen symptoms, peristalsis slow . In gynecological examination: perineum and vulva as in nullipara, smooth - walled vagina, brownish discharge in vagina visible in speculum examination, with no symptoms of active bleeding from cervix canal . Bimanual examination: uterus in retroflexion, slightly tender, slightly enlarged, adnexa bilaterally with no pathological resistance, painless . Laboratory tests on admission: wbc 14.210/l, rbc 3.5010/l, hb 11.3 g / dl, hct 32.8%, plt 28610/l, normal general urine test . In the transvaginal ultrasound examination the following was stated: gestational sac in the uterine cavity of the diameter of 9 mm, with a yolk sac of 3.1 mm, no embryo visualized; left ovary 4730 mm; right ovary 3021 mm, translocated behind the uterus, over the superior pole a well - defined thick - walled vesicle visible, of the diameter of 20 mm, with visible peripheral vascularization of medium resistance flow character which can refer to the gestational sac implanted in the oviduct . Because of the suspicion of intra- and extrauterine pregnancy the patient was admitted to the gynecology ward . The following treatment was introduced: duphaston, kaprogest, no - spa . On the next day the patient in satisfactory general condition, cardiovascularly and respiratorily stable, arterial blood pressure 100/60 mm hg, pulse 80/min, slight vaginal bleeding sustained . Laboratory tests: wbc 13.910/l, rbc 3.5910/l, hb 11.7 g / dl, crp 46 mg / l, -hcg 23 173 miu / ml . Tvs examination was performed one more time: in the uterine cavity the gestation sac of the diameter of 11 mm visible, with yolk sac of the diameter of 3.5 mm, the embryonic structures were still not visualized; ovaries of normal size bilaterally, over the superior pole a well - defined thick - walled vesicle visible, of the diameter of 20 mm, with an increased vascularization; no pathological changes over left adnexa; trace amount of fluid in the pouch of douglas ultrasound image suggests the coexistence of inter- and extrauterine pregnancy on the right side, of the gestational age about 5/6 weeks (fig . On the 4 november 2007 control -hcg 27 393 miu / ml, in the us examination a gestational sac containing a single living embryo was stated in the uterine cavity, crl (crown - rump length) 4.2 mm, which referred to the 6 week of gestation, fhr(+) 110/min, with no trophoblast shearing off symptoms, in the area of the right adnexa of the uterus visible thick - walled vesicle of the diameter of 30 mm, with quite abundant peripheral vascularization; with the absence of free fluid collection in the pouch of douglas (figs . 2, 3). Because of the diagnosis of living intrauterine pregnancy and the suspicion of the coexistence of the right extrauterine pregnancy, the patient was qualified for surgical treatment . Intraoperatively the following was stated: body of the uterus enlarged, smooth, mobile, with the size referring to the 6 week of pregnancy; right oviduct livid, dilated to 23 cm, right ovary normal, left adnexa of normal size, with no pathological lesions; abdominal cavity organs macroscopically normal . Because of macroscopic symptoms of tubal pregnancy presence, the right oviduct was removed . Postoperative course not complicated: the patient in satisfactory general condition, cardiovascularly and respiratorily stable, normal body temperature, no vaginal bleeding . On the 5 day after surgery in tvs examination the following was stated: body of the uterus enlarged on the whole surface, of even outline, gestation sac visible in uterine cavity gs equals 25 mm, with visible embryo of crl 10 mm, which refers to 7 week of gestation, with regular heart rate of 140 bpm, trophoblast with no symptoms of shearing off . Ultrasound image of intrauterine and extrauterine pregnancy located in the right oviduct registered embryonic heart rate in the intrauterine pregnancy peripheral trophoblast vascularization in the extrauterine pregnancy basing on the studies of natural cycle stated that it can refer to 1/7963 of cases . Among the risk factors of intra- and extrauterine pregnancies one can list: chronic inflammation in the region of lesser pelvis, surgical procedures on adnexa of uterus, undergone extrauterine pregnancies, sexually transmitted diseases, the use of intrauterine device and assisted reproductive techniques (art). Walker at al . Proved that in patients treated because of infertility and who underwent in vitro fertilization the risk of heterotopic pregnancy increases 400-fold in comparison to natural conception . It is also thought that the incidence of this pathology after the use of art oscillates from 0.75% to 1.3% . The most frequent location of extrauterine pregnancy coexisting with intrauterine pregnancy are oviducts (93.9%), definitely more rarely the pregnancy is located in the ovary (6%). More frequent incidence of pregnancies in the left oviduct in comparison to the right oviduct has been observed (31.8% vs. 36.3%). In the described case the authors also report about incidences of single or multiple intrauterine pregnancy and extrauterine pregnancy localized in cervix, uterine corner or peritoneal cavity and also the coexistence of pathological intrauterine pregnancy, e.g. Blighted ovum and living extrauterine pregnancy . Heterotopic pregnancy diagnosis is one of the most difficult clinical problems . To the most frequent symptoms body of the uterus enlargement 42%, vaginal bleeding 32% . According to tal et al . The major symptoms are abdominal pain 83%, surgical abdomen symptoms and shock 13% and vaginal bleeding 50% of cases . In the presented case the majority of symptoms occurred the patient reported abdominal pain and vaginal bleeding . Because of the early period of pregnancy development no pathological resistance in gynecological examination was stated . Nevertheless, precise imaging of the adnexa of the uterus area by means of transvaginal ultrasound enabled to visualize a pathological structure which might have referred to a pregnancy implanted in the oviduct (thick - walled, peripherally vascularized fluid reservoir, characteristic for implanting trophoblast). This confirms the opinion that the basic diagnostic method in case of heterotopic pregnancy is transvaginal ultrasound examination, particularly recommended in patients after art between 4 and 6 week of pregnancy, however, some authors say that the sensitivity of this method is insufficient and equals about 56% . Report that heterotopic pregnancies in 70% of cases are diagnosed between 5th and 8th week of gestation, similarly as in the pregnancy described by us, in 20% between 9 and 10 week and in 10% in 11 week of gestation . It seems that the assessment of beta unit of chorionic gonadotropin in the diagnostics of such cases is little useful because the dynamics of concentration changes of this marker is not characteristic for this abnormality and additionally the presence of developing intrauterine pregnancy makes the result interpretation difficult . It should be hence thought that the most efficient diagnostic method, confirming final diagnosis and being at the same time a form of treatment is laparoscopy, more rarely laparotomy, performed in cases of intraperitoneal bleeding with shock symptoms . It should be also mentioned about the possibilities of conservative treatment in selected cases . Among these methods one can number inter alia fine needle aspiration of the embryo from the oviduct with simultaneous application of 50% glucose under the us control and in case of intramural pregnancy localized in the uterine corner local methotrexate application; in cervical pregnancy there are trials of placing hemostatic sutures or local hypertonic nacl solution . There are also reports about the use of prostaglandins . In these cases, however, because of their teratogenicity, this method is not widely accepted . It is estimated that intrauterine pregnancy after the abortion of extrauterine pregnancy develops normally in 6592% of cases . Reece et al . Submitted for analysis 37 patients with diagnosed heterotopic pregnancy after surgical treatment of extrauterine pregnancy 75.6% gave birth around their expected delivery date, 16.2% prematurely and 3% of pregnancies ended with a miscarriage . On the other hand, it should be remembered that the coexistence of extrauterine pregnancy with intrauterine pregnancy may be threatening not only for the developing fetus in the uterus but also for the mother because the mortality of women in such cases equals 1% . Concluding, we think that the visualization of normal pregnancy in the uterus in ultrasound examination does not release a doctor from a necessity of precise imaging of adnexa of the uterus . Thanks to this we can establish the diagnosis earlier and introduce adequate procedure, limiting the possibility of complication occurrence and assuring optimal conditions for the developing intrauterine pregnancy.
Retinitis pigmentosa (rp) was defined as a group of hereditary disorders that diffusely involve photoreceptor and pigment epithelial function characterized by progressive visual field loss and abnormal electroretinogram . Rp also has changes at vitreoretinal interface, such as vitreoretinal traction and preretinal membrane, which causes macular disorders such as cystoids macular edema and macular hole . We report a case of vitreoretinal traction syndrome associated with rp, which spontaneously resolved after posterior vitreous detachment (pvd). A 81-year - old woman presented with bilateral loss of peripheral vision and defective dark adaptation 15 years before . The best - corrected visual acuity was 20/28 and 20/28 in the right and left eyes, respectively . Slit - lamp examination showed bilateral retinal arteriolar narrowing and intraretinal pigment deposition (bone spicule pigmentation) in both eyes (figure 1a). The visual fields of the patient were markedly constricted to the central 10 in both eyes (figure 2). On june 2, 2006, retinal detachment was detected in the nasal periphery in the right eye (figures 1b and 1c). At that time, pvd was confirmed with weiss ring (figure 3). Fluorescein angiography showed a hyperfluorescence due to atrophy of retinal pigment epithelium but no active leakage in the detached area (figure 1c). The detached area was within the area where the visual field was lost, and we observed a clinical course of this eye without any treatment . Retinal detachment was kept localized and not extended . Five months later, pvd further progressed beyond the arcade area, accompanying retinal hemorrhage around the detached retina . In this case, an eye with rp was complicated with tractional retinal detachment, possibly associated with increased vitreoretinal traction secondary to the incidence of pvd . The retinal detachment was limited within the area where the visual field was lost and was not progressive . Eight months later, spontaneous resolution of tractional retinal detachment resulted from progression of pvd, which was suggested by transiently increased traction - related retinal hemorrhage . Eyes with rp may have abnormal liquefaction of vitreous and altered distribution of vitreoretinal adhesion . The incidence of pvd in the posterior pole might result in the focal remarkable traction in the peripheral retina and tractional retinal detachment . Eight months later, the retinal detachment was resolved because local vitreoretinal traction was weakened with extention of pvd beyond the arcade vessels . Rp has vitreomacular traction - related pathologic events involving vitreomacular traction syndrome, cystoids macular edema, and macular hole.13 such changes in this patient with rp might result in a tractional retinal detachment . Rani et al4 reported that a 50-year - old man underwent a tractional retinal detachment involving the posterior pole with a taut posterior hyaloids surface . In this study, vitrectomy was not performed because the patient opted for no surgical intervention in view of poor prognosis . On the other hand, it was reported that vitrectomy was effective for vitreous opacity,5 cystoid macular edema,6 exudative retinal detachment,7 and macular holes8 in rp . However, regarding the indication to perform a vitrectomy, the balance of the expected gain in visual function and usual risks of vitrectomy and rp - related risks, such as phototoxicity worsening of visual field loss, and cystoid macular edema . It might be a choice that a patient with tractional retinal detachment in rp is observed without surgical treatment, if the detached area is not progressive.
Pseudomonas aeruginosa is a gram - negative rod and belongs to the glucose non - fermentative bacteria family . It is an important opportunistic pathogen that causes infections in patients with weakened immune system and cystic fibrosis genetic defect, as well as patients at intensive care and burn units (1). These bacteria have a high resistance to a wide range of existing antimicrobials and antibiotics . Eradication of infections by p. aeruginosa is difficult due to their inherent resistance to a wide range of antibiotics, as well as their mobile genetic elements including resistance genes (2). Emergence of carbapenem - resistant strains has expanded amongst gram - negative bacteria in the recent years . The most important mechanisms of resistance to carbapenems are production of carbapenemase enzymes and secretory pumps, and lack of expression of external membrane proteins (porins) (3). Carbapenemases have the ability to hydrolyze penicillins, cephalosporins, monobactams and carbapenems (4). The presence of kpc in transferable plasmids and transposons can result in a rapid spread among bacteria including klebsiella pneumoniae, enterobacter species, acinetobacter baumannii and p. aeruginosa (5). The world s first report of kpc-2 presence in pseudomonas was reported by the international center of medical research and education in columbia, during year 2006 . Subsequently, a study from puerto rico reported on two types of kpc (kpc-2 and kpc-5) in p. aeruginosa (6). Rapid detection of strains producing carbanapemases, such as kpc, is crucial for preventing incorrect treatment, controlling hospital infections, and preventing the spread of these strains . Modified hodge test (mht) proposed by the clinical and laboratory standards institute (clsi), and boronic acid inhibitor - based assay are among the many phenotypic methods used in microbiology laboratories for identification of group a carbanapemases in the enterobacteriaceae family (7). In iran, no study has so far been carried out for evaluation of kpc frequency using phenotypic tests of mht and boronic acid inhibitor - based assay and for their comparison with the genotypic method of polymerase chain reaction (pcr) in p. aeruginosa . Therefore, the present study was performed to evaluate the frequency of kpc in p. aeruginosa, isolated from clinical samples of educational hospitals of arak university of medical sciences, using the mentioned phenotypic and genotypic methods . This project was approved by the arak university of medical sciences ethical committee (no . 92 - 152 - 14). This study was a descriptive cross - sectional study carried out from august 2012 to july 2013, in which 108 p. aeruginosa isolates were collected from urine, sputum, and ulcer samples of hospitalized patients at the educational hospitals of arak university of medical sciences, arak, iran . Pseudomonas aeruginosa was identified using standard biochemical methods, including gram staining, catalase test, oxidative - fermentation (of) test, triple sugar iron agar (merck, germany), growth at 42c, and production of blue - green pigments . Antibiotic susceptibility pattern of isolates was also determined using the disk diffusion method (kirby - bauer), according to the standards of clinical and laboratory standards institute (clsi) (8). All disks were made by the mast company (uk) and included the following, ceftazidime, ciprofloxacin, amikacin, gentamicin, imipenem and meropenem . First, a suspension of the standard strain of escherichia coli atcc 25922 was prepared at a concentration of 0.5 mcfarland and then diluted to 0.01 mcfarland with normal saline . The suspension was then lawn cultured on mueller hinton medium (merck, germany) using a swab . A 10-g meropenem disc (mast, uk) pseudomonas aeruginosa sample was cultured in a direct line from the disc edge towards the plate edge and the plates were incubated at 37c for 16 to 24 hours . Since kpc - producing p. aeroginosa inhibit e. coli on muller hinton medium and lead to unexplained results, e. coli standard strain and k. pneumoniae atcc 700603 were cultured on separate mueller hinton medium and pseudomonas was cultured on and the results of the two tests were finally compared (10). A disk containing imipenem (mast, uk) and another containing imipenem with 400 g of boronic acid (sigma - aldrich, germany) were placed on the agar . The diameter of the growth - inhibitory zone around the imipenem disk with boronic acid was compared with that around the corresponding imipenem disk without boronic acid . The test was considered positive for the detection of class a carbapenemase production when the diameter of the growth - inhibitory zone around the imipenem disk with boronic acid was 5 mm larger than that around the disk containing the imipenem substrate alone (11). The blakpc gene was detected by pcr using the following specific primers; forward: 5'cgtctagttctgctgtcttg3' and reveres: 5'cttgtcatccttgttaggcg3' (12). The dna amplification, programmed for the blakpc gene, consisted of an initial denaturation step (94c, three minutes), followed by 40 cycles of denaturation (94c, 30 seconds), annealing (58.2c, 60 seconds) and extension (72c, 30 seconds), and a single final extension (72c, five minutes). This study was a descriptive cross - sectional study carried out from august 2012 to july 2013, in which 108 p. aeruginosa isolates were collected from urine, sputum, and ulcer samples of hospitalized patients at the educational hospitals of arak university of medical sciences, arak, iran . Pseudomonas aeruginosa was identified using standard biochemical methods, including gram staining, catalase test, oxidative - fermentation (of) test, triple sugar iron agar (merck, germany), growth at 42c, and production of blue - green pigments . Antibiotic susceptibility pattern of isolates was also determined using the disk diffusion method (kirby - bauer), according to the standards of clinical and laboratory standards institute (clsi) (8). All disks were made by the mast company (uk) and included the following, ceftazidime, ciprofloxacin, amikacin, gentamicin, imipenem and meropenem . First, a suspension of the standard strain of escherichia coli atcc 25922 was prepared at a concentration of 0.5 mcfarland and then diluted to 0.01 mcfarland with normal saline . The suspension was then lawn cultured on mueller hinton medium (merck, germany) using a swab . A 10-g meropenem disc (mast, uk) pseudomonas aeruginosa sample was cultured in a direct line from the disc edge towards the plate edge and the plates were incubated at 37c for 16 to 24 hours . Since kpc - producing p. aeroginosa inhibit e. coli on muller hinton medium and lead to unexplained results, e. coli standard strain and k. pneumoniae atcc 700603 were cultured on separate mueller hinton medium and pseudomonas was cultured on and the results of the two tests were finally compared (10). A disk containing imipenem (mast, uk) and another containing imipenem with 400 g of boronic acid (sigma - aldrich, germany) were placed on the agar . The diameter of the growth - inhibitory zone around the imipenem disk with boronic acid was compared with that around the corresponding imipenem disk without boronic acid . The test was considered positive for the detection of class a carbapenemase production when the diameter of the growth - inhibitory zone around the imipenem disk with boronic acid was 5 mm larger than that around the disk containing the imipenem substrate alone (11). The blakpc gene was detected by pcr using the following specific primers; forward: 5'cgtctagttctgctgtcttg3' and reveres: 5'cttgtcatccttgttaggcg3' (12). The dna amplification, programmed for the blakpc gene, consisted of an initial denaturation step (94c, three minutes), followed by 40 cycles of denaturation (94c, 30 seconds), annealing (58.2c, 60 seconds) and extension (72c, 30 seconds), and a single final extension (72c, five minutes). Overall, 108 isolates of p. aeruginosa were collected from hospitalized patients clinical samples at three educational hospitals of arak university of medical sciences . The results of the antibiotic sensitivity pattern (number and percentage of resistant isolates) of p. aeruginosa isolates, obtained through the disk diffusion method, are presented in figure 1 . Gentamicin (gm), ceftazidim (caz), ciprofloxacin (cip), amikacin (ak), meropenem (mem), imipenem (imi). Assessment of carbapenemase production in p. aeruginosa through the mht method, using the standard strain of e. coli atcc 25922, resulted in only 27 examinable isolates; 81 isolates were unexplainable due to pseudomonas inhibition of e. coli growth in the culture medium (figure 2a). However, out of 108 isolates examined by the mht test, using the standard strain of k. pneumoniae atcc 700603, 38 isolates of p. aeruginosa produced carbapenemase and the results of this test were negative for 70 isolates (figure 2b). Using the combination - disk test with boronic acid, 26 isolates were identified as carbapenemase - producing strains, while 82 isolates were negative (figure 2c). Of the 108 isolates of p. aeruginosa studied by pcr, 13 isolates (12%) had the kpc carbapenemase encoding gene (blakpc) (figure 3). Molecular studies detected 50% blavim-1, 56.6% blavim-2, and 6.6% blaimp-1 while none of the strains had blaimp-2 and blaspm-1 genes . Lane m is the marker (dna ladder, 100bp); lanes 1, 2 and 4, are amplified products of kpc gene in p. aeruginosa, isolated from hospital samples . Lane 5, is the amplified product of the negative control k. pneumoniae lacking the kpc gene . Lane 3, the amplified product of the kpc gene in p. aeruginosa lacking the kpc gene . Utilization of reliable methods for identifying carbapenemase - producing strains and determining their antibiotic resistance pattern could have a very important role in treatment of infections caused by these strains . This could be an important step in the control of hospital infections, in order to prevent patients mortality and to reduce health care costs (3, 13). Since no study has so far been carried out for the evaluation of the frequency of p. aeruginosa - producing kpc carbapenemase in iran, in the present study, the presence of kpc carbapenemase was examined in p. aeruginosa isolated from clinical samples of patients hospitalized at hospitals of arak university of medical sciences, using the genotypic method of pcr . The efficiency of mht and boronic acid phenotypic methods for identification of kpc enzyme was compared with the pcr . Due to their wide range of activities, carbapenems are commonly used to treat infections caused by multidrug - resistant bacteria, particularly extended - spectrum beta - lactamases (esbls)-producing bacteria and ampc enzyme - producing strains (14). Spread of carbapenemase - producing bacteria throughout the world in the recent years has been considered as a major threat to public health . Among carbapenemases, kpc has a high frequency and has been commonly found in k. pneumoniae and enterobacter (15). The enzyme is encoded by a gene located on mobile elements such as plasmids; this results in kpc gene transfer among bacteria . Furthermore, the kpc enzyme hydrolyses beta - lactam drugs, including monobactams, carbapenems, and third - generation cephalosporins (16). The presence of this enzyme in p. aeruginosa was first reported in colombia, during year 2007 (17) and subsequently in other countries such as puerto rico (18), trinidad and tobago (19), the united states, and china (3, 6). Recent studies from iran have also indicated the prevalence of kpc - producing bacteria (20). The highest prevalence of kpc gene in iran, examined by pcr, was reported in k. pneumoniae by hashemizadeh et al . 13 isolates (12%) of p. aeruginosa were positive for kpc, using pcr . This could indicate horizontal transfer of kpc genes among bacteria isolated from nosocomial infections in iran . The prevalence of kpc in p. aeruginosa was 4.1% in puerto rico; this was lower than the present study (22). The pattern of antibiotic resistance in 13 kpc - producing isolates in the present study was such that they were all resistant to ceftazidime, gentamicin, amikacin, and ciprofloxacin . Phenotypic resistance caused by carbapenemase is affected by many factors such as strain, expression level, type, or enzyme variant, as well as the presence of other resistance mechanisms such as reduced permeability, secretory pumps, and other activities of beta - lactamases (4). In the present study, the disk diffusion method showed that of 13 kpc - producing isolates, six and five were resistant to imipenem and meropenem, respectively . The modified hodge test is a sensitive phenotypic method for detection of carbapenemases, however, it cannot identify the enzyme type . Instead of the standard strain of e. coli atcc 25922, pasteran et al . (10) used the standard strain of k. pneumoniae atcc 700603 (lacking carbapenemases and sensitive to carbapenem) for the mht . When the common indicator strain (e. coli atcc 25922) was used, p. aeruginosa inhibited the growth of e. coli standard strains; this resulted in an unexplainable test and decreasing of the test sensitivity and specificity . This problem was resolved through exchanging the indicator strain with the standard strain of k. pneumoniae atcc 700603 . Of the 13 kpc - positive isolates obtained using the mht method, 10 isolates were considered as kpc - producing strains . The results of the phenotypic method of boronic acid inhibitory effect on group a carbapenemases identified 11 isolates, out of 13 kpc - positive isolates . The important point in interpretation of the results of phenotypic methods applied in this represents the possible presence of other carbapenemase groups such as ges enzymes and various groups of metallo - beta - lactamase in the mentioned strains (given their resistance to imipenem and meropenem). As a result, unlike the study carried out by azimi et al . In iran (20), who only used the mht phenotypic method to assess the prevalence of kpc - producing strains, using only the mht method and its positivity in the examined isolates cannot be a reason for the presence kpc, and positive results can be caused by other carbapenemases, and in some cases, by ctx - m esbls along with a decrease in porins expression . Therefore, a definite confirmation of kpc - producing strains requires pcr followed by sequencing . The boronic acid method can detect kpc - producing strains, as well as ges amongst isolates . In isolates with ampc overexpression and change in porins, boronic acid method may lead to false - positive results (9, 23). Comparison of the two phenotypic methods used in this study showed that boronic acid is more sensitive than mht in identification of kpc - producing strains (84.6% vs. 77%). Given the significant prevalence of kpc - producing p. aeruginosa and their drug multi - resistance, proper measures seem necessary for controlling infections of these strains, such as their rapid and reliable detection and administration of appropriate antibiotics for treatment . In future studies, the origin of infection and genetic relationships between strains obtained from different hospitals can be evaluated through epidemiologic molecular approaches . A substantial amount of p. aeruginosa isolated from clinical samples of hospitals of arak (iran) produced kpc carbapenemase . Due to their low specificity, mht and boronic acid phenotypic methods cannot completely indicate kpc - producing p. aeruginosa . The sensitivity of boronic acid phenotypic method in detection of kpc was higher than mht (84.6% vs. 77%).
Despite the recent advancements in prevention and treatment of stroke, stroke remains the leading cause of disability and the fifth leading cause of death in the us . Especially in those older than 65 years, stroke is a leading cause of death and disability . In the future, due to rapid aging therefore, to aid in prevention, the identification of markers of stroke risk is important . Although stroke has been believed to be a multifactorial disorder with minimal classical patterns of inheritance, accumulating evidence has shown the importance of genetic factors in stroke . Especially, it has been reported that a number of inflammatory mechanisms play a fundamental part in stroke (2); thus, various inflammatory genes showing an association with stroke have received attention as candidate genes (34567891011). Also, genetic factors could have an effect on stroke onset, infarct size, and prognosis (12,13). Although several candidate genes have been studied as risk factors for stroke, there are few useful markers for the prevention, diagnosis, and treatment of stroke (14,15). Interleukin-6 (il-6) is a potent pleiotropic cytokine that regulates survival and differentiation of neuronal cells . The counterpart, interleukin-6 receptor (il-6r) complex consists of il-6r and the interleukin 6 signal transducer (il6st / gp130/il-6 beta), which is associated with many other cytokines . If il-6 binds to il-6r, this complex binds to gp130, leading to intracellular signaling cascades (16). Il-6 performs as the main stimulator of c - reactive protein (crp) production, the levels of which are known to be associated with metabolic syndromes such as obesity and diabetes, as well as with vascular events (17). As an extension of the study of il-6r, il-6, and crp in stroke,, there is no study about the associations between il-6r polymorphisms and ischemic stroke (is). The national institutes of health stroke scale (nihss) is a neurologic impairment assessment tool that provides an objective quantified measurement in stroke patients (18,19). Higher scores on nihss indicate greater stroke severity . In a previous il-6 polymorphism study, patients with severe disability (nihss 6) were associated with a specific genotype (20). Stroke rehabilitation outcomes are usually assessed using the modified barthel index (mbi), which is a validated tool scoring independent daily living (21). The aim of this study was to assess whether single nucleotide polymorphisms (snps) of the il-6r gene were associated with the development, neurologic status, and clinical features of ischemic stroke in the korean population . All participants with stroke were patients who visited the departments of rehabilitation medicine at kyung hee medical center and kyung hee university hospital at gangdong . Is patients were diagnosed based on magnetic resonance (mr) imaging, computed tomography (ct), or angiography . Exclusion criteria were ischemic heart disease or other causes of cerebrovascular events such as traumatic brain injury, transient ischemic attack, and vascular malformation, etc . Peripheral blood samples were collected from the subjects, and genomic dna extraction was performed using a qiaamp dna mini kit (qiagen, valencia, ca, usa). The genotypes of the two selected snps ware determined by direct sequencing (macrogen, seoul, korea). The following primers were used in the polymerase chain reaction (pcr) amplification: rs4845617 (forward 5-ctgttctccccgctcaggtgcg-3, reverse 5-agaggcggacaggctaatg-3) and rs2228144 (forward 5-gtagcctgggccacttcatca t-3, reverse 5-gacctctgaggcacaactcac-3). Pcr consisted of 40 cycles at 94c for 30 sec, 58c for 30 sec, 72c for 30 sec, and 1 cycle at 72c for 5 min . An abi prism 3730xl analyzer (pe applied biosystems, foster city, ca, usa) sequenced the pcr products, and seqmanii software (dnastar, madison, wi, usa) was used to analyze the sequencing data (22). To obtain odds ratios (ors), 95% confidence intervals (cis), and p values adjusted for age and sex as covariates, snpanalyzer pro (istech, goyang, korea), helixtree (golden helix, bozeman, mt, usa), and snpstats (http://bioinfo.iconcologia.net/index.php?module=snpstats) were used . The chi - square test was used to determine hardy - weinberg equilibrium (hwe). A multiple logistic regression analysis was adjusted for age and sex . In terms of increasing risk of disease, an increased specific allele frequency was noted in is patients compared with the allele frequency of controls . To analyze the association between a polymorphism and disease, a contingency table and chi - square test were applied using a prespecified genetic model . The codominant model was the most general model where the disease risk associated with ab individuals lies between that of aa and bb individuals . In dominant model, with the hypothesis that carrying allele b increased risk of disease (dominant model), the ab and bb genotypes are pooled giving a 2 * 2 table . Alternatively, under a recessive model for allele b, cells aa and ab would be pooled . Additive model is assumed that increased disease risk of for ab genotypes and 2 for bb genotypes (23). In this study, codominant model 1 compared major allele homozygotes with heterozygotes, and codominant model 2 compared major allele homozygotes with minor allele homozygotes . To determine the haplotypes between the two snps and the clinical features in patients with is, haploview version 4.2 (daly lab, cambridge, ma, usa) was used . The study was approved by the institutional review board of medical research institute, school of medicine, kyung hee university and center, and kyung hee university hospital at gangdong (irb no . The study was approved by the institutional review board of medical research institute, school of medicine, kyung hee university and center, and kyung hee university hospital at gangdong (irb no . There were 121 is patients (mean sd, 65.7 12.1 years) and 291 controls (mean sd, 63.0 9.3 years). There was a difference in mean age between is patients and control subjects, but it was not significant (p = 0.30). Is patients were classified into two subgroups according to nihss score (nihss 1, nihss score <6; and nihss 2, nihss score 6) and mbi score (mbi 1, mbi 60; and mbi 2, mbi score> 60). The numbers of is patients with nihss score <6 and 6 were 56 and 57, respectively . The numbers of is patients with mbi score 60 and> 60 were 71 and 25, respectively (data not shown). Nihss 1, nihss score <6; nihss 2, nihss score 6 . The genotype and allele frequencies of the two examined snps are shown in tables 2 and 3, respectively . Two snps (rs4845617, 5tur; rs2228144, ala31ala) of the il-6r gene were in hwe in the is and control groups, respectively (p> 0.05, data not shown). The genotype and allele frequencies of the two snps demonstrated no significant difference in is cases and controls (table 2). As shown in table 3, the snp rs4845617 was associated with the nihss score of is patients (p = 0.011, or = 0.24, 95% ci = 0.08 - 0.72 in codominant model 2, p = 0.006, or = 0.30, 95% ci = 0.12 - 0.74 in recessive model, and p = 0.008, or = 0.48, 95% ci = 0.28 - 0.84 in log - additive model). In snp rs4845617, the frequencies of genotype according to nihss score was significantly different in the codominant model 2, recessive model, and log - additive model, and the a allele frequency was significantly higher in the nihss 1 group of is patients . However, in snp rs2228144, the genotype and allele frequencies did not correlate with the nihss score of the is group (table 3). Furthermore, rs4845617 and rs2228144 had no correlation with mbi score in the is group (data not shown). Nihss 1, nihss score <6; nihss 2, nihss score 6 . We investigated the associations between haplotypes of control subjects and is patients and nihss score . The haplotype frequencies of the two snps were not significantly different between control subjects and is patients (table 4). However, as shown in tables 5 and 6, the ag and gg haplotypes differed between the nihss 1 and nihss 2 groups in is patients . The frequency of the ag haplotype was higher in the nihss 1 group, and that of the gg haplotype was higher in the nihss 2 group of is patients (p = 0.014, p = 0.0024, respectively). However, the haplotype frequencies found no significant difference by mbi scores (table 6). Nihss 1, nihss score <6; nihss 2, nihss score 6 . Ischemic stroke is known to be a heterogeneous multifactorial disease (24). Although conventional risk factors such as hypertension, diabetes, dyslipidemia and smoking account for a significant proportion of these stroke events, a considerable portion remains insufficiently explained by these factors (25,26). As risk factors for stroke, several genetic factors have been studied; however, there are few useful markers for prevention, diagnosis, and treatment of stroke (26). Therefore, increasing our understanding of risk factors including genetic components would allow us to predict the risk better, identification of novel stroke mechanisms, and new therapeutic approaches using genetic factors (27). Some of these snps include apolipoprotein e (3), 5-methyltetrahydrofolate - homocysteine methyltransferase (6), interleukin 4 (11), interleukin-1 receptor antagonist, tumor necrosis factor, interleukin 1 beta (8), neuropeptide y (5), peroxisome proliferator - activated receptor gamma (9), phosphodiesterase 4d camp - specific chemokine (c - c motif) ligand 5 (4), thromboxanea2 receptor, and thromboxane a synthase 1 (platelet) (10). Several snps have been identified in the il-6r gene, associated with carotid plaque (28), crp (17,29) and obesity or diabetes (30313233). However, there has been no study of polymorphisms of the il-6r gene in relation to stroke . Carotid plaque is assumed to be associated with increased stroke risk . In a genetic study in a dominican population, il-6r was suggested to be a related gene associated with carotid plaque (28). Il-6 has been shown to have a positive correlation with crp and to predict the risk of vascular events . The polymorphism of il-6r gene is linked with crp expression and plasma il-6 level (34). (35) demonstrated that the il-6r variants (rs6684439, rs4845622, rs8192284, rs4329505) are significantly associated with plasma crp level, independent of il-6 level . In addition, the il-6r variant interacts with crp in relation to diabetes risk . In another study, the il-6r gene (rs4845617) was suggested to play an important role in the pathogenesis of dyslipidemia and atherosclerosis (36). We identified snps of il-6r, in coding regions near the promoter region, that had greater than 0.1 heterozygosity and greater than 0.1 minor allele frequency . For rs4845617, heterozygosity is 0.471, and minor allele frequency is 0.3804; for rs2228144, heterozygosity is 0.208, and minor allele frequency is 0.1178 . This is the first report to identify an association between snps of the il-6r gene associated with risk of stroke and the clinical features of stroke . The two snps (rs4845617 and rs2228144) were not associated with development or daily activities of is . However, our results revealed that snp rs4845617 contributes to the neurologic status of is patients . The mechanisms remain of the effects of il-6r gene polymorphisms on stroke severity remain unclear . Compared with previous snps studies, the sample size in this study was relatively small . Therefore, other stroke risk factors analyses could be included while sample size became smaller after dividing groups with regard to hypertension, diabetes, dyslipidemia, and smoking history in this study . Further studies with larger sample size are necessary to elucidate this result . In summary, two snps of the il-6r gene (rs4845617, rs2228144) were analyzed in korean ischemic stroke patients . The frequencies of genotype and alleles of the two snps demonstrated no significant difference in is cases and controls . . However, in snp rs4845617, the frequencies of genotypes according to nihss score are statistically different, and the a allele frequency in the mild stroke patients is significantly higher than an allele frequency in the severe stroke patients . This indicates that snp rs4845617 is associated with the neurologic status evaluated by nihss in patients with is . In addition, the a allele of snp rs4845617 might have a protective effect against neurologic deficit in is patients.
Since laparoscopic surgery was introduced in 1987 by mouret and more frequently employed, it has rapidly evolved as a major innovation in the history of surgery, offering an important contribution to the reduction of all the typical complications related to open surgery . On the other hand, laparoscopic surgery can be associated with a specific type of incisional hernia through the trocar site causing complications such as small bowel obstruction . Trocar site hernia (tsh) is defined as an incisional hernia which occurs after minimally invasive surgery on the trocar incision site; some authors also define this condition as a port site hernia . In 2004 (i) early onset typedehiscence of anterior and posterior fascial plane and peritoneum characterized by early onset after surgery . Dehiscence of anterior and posterior fascial plane and peritoneum characterized by early onset after surgery . Hernias usually develop several months after surgery and they are not associated with small bowel obstruction . Hernias usually develop several months after surgery and they are not associated with small bowel obstruction . (iii) special typedehiscence of the whole abdominal wall . Intestine and/or omentum protrusion . We report the case of a 76-year - old woman who underwent a laparoscopic left hemicolectomy for a sigmoid tumour . The patient was discharged in good general conditions and with open alvus on the 7th postoperative day . Three days after discharge, the patient was affected by colicky abdominal pain mostly localized in the left upper quadrant, vomiting, and constipation which required a rehospitalization . On the clinical examination the abdomen was distended and tender particularly in the left upper quadrant; an oval mass (5 cm) was detected in the same abdominal quadrant near the 12 mm trocar site . The ultrasound scan showed a swelling constituted by entrapped intestinal loops, and the abdominal x - ray revealed multiple small bowel gas - fluid levels . Because of the clinical, us and radiological signs of obstruction, the patient underwent an emergency explorative laparotomy which showed a small bowel herniation through the trocar incision site in the left upper quadrant (figure 1); the intestinal loop appeared necrotic and had to be resected, and the hernia orifice was repaired . The clinical onset of a trocar site hernia is usually early as it often occurs within the 30th postoperative day, and it is due to the omentum or small bowel entrapment into the trocar wound . The intestinal occlusion clinical presentation is often insidious, with progression to an acute abdomen, and an early and emergency surgical approach is often required [35]. The first trocar site hernia case was described by fear in 1968 . In this report this was also the first case of the special type hernia described by tonouchi . So this first report tended to express a protrusion of the bowel and/or omentum as a hernia, " although in the described type no hernia sac was detected [13]. In 1974 schiff and naftolin reported two cases of small bowel herniation occurred between the 14th and 21st postoperative days that required laparotomy with small bowel resection . One of the first multicentric reports of operative laparoscopy revealed six incisional hernias out of 3560 cases (0.17%). Five of the six herniations were detected through a 12 mm port site, showing that the risk of herniation through a 12 mm trocar site was approximately 3-fold greater than that of a 10 mm trocar site . All the herniations were extraumbilical, and in three of the four cases of small bowel herniation, the fascia had been sutured . In this report kadar et al . Described cases of extraumbilical port site hernia, and for the first time two of the patients were treated laparoscopically . In 1994 an amount of 933 hernias was reported from a 4,385,000 estimated laparoscopic procedures (0,02%) by the american association of gynecologic laparoscopists . 725 (86.3%) of the 840 hernias in which the size of the original fascial defect was noted occurred in sites where 10 mm or larger diameter trocars had been placed . Only 10.9% (92/840) were related to the use of 810 mm trocars and only 2.7% (23/840) to minor diameter trocars . The hernias occurrence in this report is a function of the number of the performed laparoscopic procedures (p <.0001), and it is not related to the surgeon's experience (p = .41). These data are shared by the study reported by tonouchi; indeed, according to his work, 78.3% of hernias occurred on the 1012 mm trocar site, while 21.7% occurred on the site of a trocar whose diameter was 5 mm . In 1995, boike et al . Of the 21 herniations, 12 (57%) occurred on 12 mm port sites, 8 (38%) on 10 mm port sites, and one on 11 mm port site . Fascial screws were used to anchor ports in 11 (57%) patients with herniations . An attempt to close the fascia 16 herniations (76%) occurred on extraumbilical sites and 5 (23%) on the umbilical port site . The hernia contained small bowel in 18 cases (21%), cecum in 2 cases (0.9%), and ascending colon in 1 case (0.4%). The average interval to second operation was 8.5 days (range 2 to 42 days). In 3 patients (14%) the bowel herniation was repaired laparoscopically, while two patients (0,9%) required small bowel resection . From 1995 till 1996, on a total of 32,205 gynaecological laparoscopies, 130 major complications were registered by the national patient insurance association and 8 incisional hernias were reported (0.025%). The complications following operative laparoscopies included 48% urethral injuries, 19% bladder injuries, 13% intestinal injuries, 7% incisional hernias, 2% large - vessel injuries, and 11% different injuries . The size of the trocars ranged from 5 to 12 mm; small bowel resection was needed in three patients (38%). Boughey et al . In 2003 described four cases of richter's hernia after laparoscopy, two of which were repaired by open procedure and two by laparoscopy . The authors concluded that a laparoscopic hernia repair is an acceptable treatment at the time of diagnosis, especially in obese patients, as long as the incarcerated bowel is not severely compromised or ischemic . In 2006, the incidence of incisional hernia was estimated around 2%, exclusively in the periumbilical area . No incisional hernia in extra - umbilical areas was registered, despite the authors did not use to perform fascial suture on extraumbilical sites . This study underlined the fact that particular attention needs to be paid to periumbilical gap suture which is exposed to the trauma of trocar fixing, especially in obese and diabetic patients . In selected cases trocar site hernia is also one of the major complications after laparoscopic ventral hernia repair (lvhr). Its incidence was reported around 22% in a recent study published by bold et al . In 2007 . This report showed a higher incidence in the tsh group of female gender, patients treated with large meshes, and patients affected by diabetes; but the use of meshes larger than 10 15 cm for lvhr was the only tsh risk factor to reach statistical significance . The cause for this finding is probably due to the dilatation of the trocar orifice during the introduction of the mesh and also to a postoperative mesh retraction . Although trocar site hernias are well - known postoperative complications after laparoscopic surgery in adult patients, they have also been reported in preschool children . In 2008 paya et al . Conducted a retrospective reviewed of 293 laparoscopic procedures performed at a pediatric surgical tertiary care unit during a period of 4 years . 8 severe postoperative complications (2.7%) were described, and three of those were trocar site hernias (1.0%). All of them were omental hernias, and in all cases they were treated between the 3rd and 4th postoperative day . In all the patients, sharp - edged or pointedly round tips 2 to 5 mm sized trocars were used . Trocar site closure was performed using double - layer sutures for the first trocar, while the other trocar sites closure was performed carrying out one single suture including all layers . Before this work there was only one published series, for children and adolescents up to 19 years of age, reporting an incidence of trocar site hernia of 0.3% (2 out of 574 patients). Although tsh in adult patients is mostly limited to 10 mm trocars, in 1999 eltabbakh . Reported the case of a 54-year - old woman who presented small bowel obstruction and herniation through a 5-mm trocar site 1 week after a laparoscopically assisted vaginal hysterectomy and bilateral salpingo - oophorectomy . Since 1999 the purpose of several reports has been to focus on trocar - related problems with special respect to the tip design, concluding that port sites created by nonbladed trocars could not require fascial closure . Indeed, kolata demonstrated that the wounds made by nonbladed trocars were narrower than those created by cutting tip trocars in a pig experimental model . Leibl et al . Compared two groups of patients treated in a nonrandomized design with either sharp cutting single - use trocars or cone - shaped noncutting reusable trocars . This trial showed an incisional hernia in 1.83% of patients treated with a sharp trocar tip, a complication which could be significantly lowered down to 0.17%, by using a conic tip design . So they demonstrated a reasonable benefit for a conic tip design, which enables an atraumatic insertion through the abdominal wall . In 2000 liu and mcfadden reported 180 laparoscopic port sites performed with nonbladed trocars without fascial closure . Upon removal of large laparoscopic ports, the fascial defect was less than 6 to 8 mm, and the muscles of the abdominal wall covered the port site defect . The anterior fascial defect did not line up with the posterior fascial defect after removal of co2 insufflation . The conclusion of the study was that the use of nonbladed laparoscopic trocars appears to be a safe technique, allowing to visualize dissection through the abdominal wall layers and to create the smallest port dissection without cutting muscle fibers and with no bleeding risk . The possibility to disrupt the abdominal wall musculature allows the surgeon to avoid the closure of the small fascial defect . Johnson et al . Performed a retrospective review of 747 operative procedures using versastep trocar system, one of nonbladed laparoscopic trocars, in patients undergoing roux - en - y gastric bypass surgery . There were no hernias detected at any of the 1494 12-mm or 2241 5-mm versastep trocar sites, despite lack of suture closure . At the hasson port site old methods using classical instruments including reverdin and deschamps needles appeared to be cost effective and also useful as well as special wound devices designed for port site closure . Moreover, elashry et al . And nakada et al . Showed in two randomized control studies that the carter - thomason device and the exit puncture set both rated slightly higher than other devices; the carter - thomason device is also faster than all the tested techniques, results in lower port closure - related complications, and provides a leak - proof closure [2123]. Insertion of a surgicel plug into the muscular layer of trocar wounds has also been proposed by chiu et al . . Alternatively, tangential insertion of a trocar through the abdominal wall might be effective in reducing the size of fascial defects [25, 26]. Moreover, different data from the literature have demonstrated that radially expanding type trocars could be useful to avoid the necessity of closing the fascial defect . Trocar site hernia (tsh) is one of the potentially severe complications of operative laparoscopy with large - bore trocar ports . Tsh has been infrequently reported in the setting of two - trocar procedures but appears to be more common in operative procedures with multiple large bore ports, and it may occur at both umbilical and extraumbilical sites (table 3). The incidence of tsh is lower than incisional hernias after open surgery, even if the actual incidence could be probably higher . Indeed, our literature review points out at least 14 reports of tsh whose incidence is not reported (table 1). Moreover, tsh was not listed or reported as a complication of laparoscopic surgery in several recent surveys . In addition, some patients, loss from followup is also to be considered, other patients may remain asymptomatic, while in other cases herniation might not be evident because of obesity . Besides all these underestimated cases, the incidence of tsh resulting from our review ranges from 0.007% to 22% (table 1) with an average of 1.85% . The risk factors associated with the occurrence of tsh are related both to the patient's characteristics and the surgical technique . An important predisposing factor is obesity because of obese patients' thicker peritoneum, but advanced age, gender, nutritional status, diabetes, anaemia, steroid therapy, renal insufficiency, cancer, and wound infections also contribute to the occurrence of tsh . Different factors related to the surgical technique may also increase the risk of herniation by widening the fascial defect, such as the use of fascial screws " to secure the port within the abdominal wall; longer procedures that result in excessive manipulation of port sites may also widen the fascial defect and increase the risk of herniation; large ports; cutting trocars; undetected omentum or bowel entrapment into the intraperitoneal defect after trocar removal; not sutured larger fascial defects (table 2). Omental herniation, a type 3 complication according to the classification of tonouchi, may be an expected postoperative complication of laparoscopic surgery for young children . In adult surgery incisions 5 mm are sometimes not sutured at all, as in infants they are only sutured by one cutaneous stitch . According to most of the authors, despite the evidence that some types of trocars prevent or are better at avoiding trocar site herniation, closure of both the fascia and the peritoneum of the site should be, however, recommended if the incision is greater than 7 mm in adult patients and 5 mm in young children . Different authors believe that inserting the 10 mm lateral trocar in an oblique way or as a z - tract will reduce hernia formation by placing the external and internal fascias at different levels; instead, according to recent reports, tangential insertion of a trocar through the abdominal wall might be effective in reducing the size of fascial defects making it easier to close the fascia and peritoneum at the same time . Prevention of extraumbilical incisional hernias and dehiscences appears to be more effective when suture is performed under laparoscopic vision keeping the trocar inserted . Moreover, both the aponeurosis and the peritoneal membrane should be treated as carefully as possible, and different methods or devices should be employed to simplify and minimize the risk of hernia formation . A careful postoperative management is recommended especially for patients with risk factors such as obesity, extensive manipulation of the trocar, and longer procedures . Bowel occlusion clinical presentation is often insidious, as in the case of a partial richter's hernia . When in laparoscopic surgery a resolution of postoperative ileus after a period of 714 days of medical therapy and observation is not obtained, a differential diagnosis between postoperative ileus and pathologic postoperative occlusions (trocar site hernia, adhesions) is to be assessed . In these patients observation alone could be not enough appropriated to perform a well - timed diagnosis, making abdominal ct still play a key role for a right differential diagnosis.
Moderate to high intensity aerobic - type exercise produces oxygen free radicals that can cause damage to lipid membranes, proteins, deoxyribonucleic acid (dna) and other cellular components . The damage to lipid membranes, otherwise known as lipid peroxidation is defined as the oxidative deterioration of polyunsaturated fats in cellular lipid membranes caused by oxygen free radicals . The area of antioxidant supplementation and its ameliorating effects on exercise induced free radical damage (including lipid peroxidation) has attracted considerable interest in recent years . The theoretical benefits of using antioxidant vitamin supplements to quench oxygen free radicals appear large . The damage to lipids caused by the oxygen free radicals can result in many problems such as the inactivation of cell membrane enzymes, increased permeability of ions across membranes (decreased muscle cell functioning) and increased platelet aggregation in blood vessels . Other problems may include the progression of degenerative diseases (cardiovascular disease and cancer) and lessening of the effectiveness of the immune system . Two theories support the concept that resistance exercise could lead to an increase in the production of oxygen free radicals in active muscle sites . Intense muscle contractions can result in a temporary decrease in blood flow and oxygen availability and subsequent ischemia . The following reperfusion period (muscle relaxation) produces an abundant reintroduction of o2 and results in the formation of the o2 radical . Mechanical stress is another hypothesis used to explain an increase in free radicals . In particular, eccentric exercise causes high levels of force that has been shown to initiate muscle tissue damage . This initiates the inflammation process that eventually produces oxygen free radicals and lipid peroxidation . Antioxidant supplementation may provide protection against the negative health consequences of oxygen free radicals caused by aerobic and resistance exercise . Vitamin e is probably the most focused upon and important non - enzymatic antioxidant substance in the body . Unlike most nutrients, a specific role for vitamin e in a required metabolic function has not been found . The major function of vitamin e is to work as a chain - breaking antioxidant in a fat soluble environment thus preventing the propagation of free radical reactions . Vitamin e is a lipid radical scavenger and especially protects polyunsaturated fatty acids (pufa) within membrane phospholipids and in plasma lipoproteins . Lipid radicals react with vitamin e 1,000 times more rapidly than they do with pufa . Vitamin e provides an easily donated hydrogen to the lipid reaction and an antioxidant radical is created . Then, the new antioxidant radical combines with other antioxidant radicals and becomes harmless or combines with ascorbic acid and is converted back to tocopherol . Two studies involving vitamin e antioxidant supplementation and aerobic exercise have produced positive results, while six other studies [12,16 - 18,21,31] have produced' no effect' results . The results showed that vitamin e supplementation was ineffective in reducing resistance exercise induced lipid peroxidation . Opposing views have developed with regards to whether trained participants have increased protection against oxygen free radicals . Researchers have explored antioxidant vitamins and enzymes that are found in blood plasma, in local tissue and within erythrocytes . The primary objectives of the investigation were to determine: (1) whether a high intensity, whole body resistance exercise test (ret) caused lipid peroxidation measures to significantly increase, (2) the effects of a 2 week period of antioxidant vitamin supplementation (vitamin e) on the levels of lipid peroxidation measures caused by the ret, and (3) the impact that the training state (untrained vs trained) had on possible lipid peroxidation measures caused by the ret . Secondary purposes were to confirm whether a 2 week treatment period with vitamin e supplementation significantly increased blood plasma vitamin e levels and whether a 4 week washout period returned blood plasma vitamin e levels to baseline measures . The group descriptive measures (untrained vs trained) are noted in table 1, while the weights lifted (10 repetition maximum rm) for each exercise during the resistance exercise test (ret) are listed in table 2 . Group descriptive measures * body fat predicted from skinfolds using the durnin and womersley formula . Resistance exercise test weights all 27 participants were found to be in the normal range of plasma vitamin e levels (12 to 37 umol / l) before the study commenced . There were no significant differences between the untrained and trained groups with regards to the general descriptive measures taken except within the body fat percentage category and past resistance training experience category . The percentage of body fat was significantly higher in the untrained group (22.1% 5.9) in comparison to the trained group (16.2% 4.9) and as established by the enrolment criteria, the untrained group had greatly reduced experience in the weight room (0.1 year 0.1) in comparison to the trained group (5.2 years 2.6). There were significant differences found between the untrained and trained groups in weights lifted in all weight training exercises . The differences found between the untrained and trained groups in weights lifted was due to the substantial differences in past resistance training experience and lean body mass . The control variables that were used to ensure that the four groups (untrained placebo; untrained supplement; trained placebo; trained supplement) were consistent during the study included dietary vitamin e intake, dietary vitamin c intake, number of resistance training sessions, number of aerobic training sessions, and the rate of perceived exertion at the middle of the exercise test (rpe mid) and at the end of the exercise test (rpe end). A 2 group (trained vs untrained) 2 treatment (placebo vs supplement) factorial anova was performed on all 6 variable change scores (treatment period 1 to treatment period 2) separately and the results are presented in table 3 . All four groups had similar rpe mid and rpe end change score measures as indicated by the non significant status under the overall f statistic column . The two factorial anova tests indicated that the four groups had exercised at an intensity level that did not change from one period to the next . There was no significant difference between the untrained group and the trained group (t25 = -.04, p = .96) for rpe mid and as well there was also no significant difference between the untrained group and the trained group (t25 = .70, p = .48) for rpe end . This indicates that the two groups (trained vs untrained) were exercising at similar relative intensities . All four groups had similar change score values (treatment period 1 to treatment period 2) for the number of resistance workouts (f (3,23) = .14, p = .93) and aerobic workouts (f (3,23) = .38, p = .76). Therefore, there was no change in their workout patterns during the length of the study . The dietary vitamin c intake results showed no statistical differences (f (3,23) = .12, p = .95) between the four groups . There were no significant differences in the dietary vitamin e intake change scores between the four groups (f (3,23) = 1.2, p = .33). Overall, we see that there were no significant differences within the 4 groups in the 6 control variables selected . These 6 potential confounding variables were monitored to ensure that they did not compromise the results of the study . The 27 participants had a two week period of vitamin e supplementation (885 mg tocopherol / day su) and a two week period of placebo (soy bean oil capsule pl) separated by the 4 week washout . In studies with crossover designs (see figure 1), it is necessary to test for a carryover effect, i.e., to see if the supplemental vitamin e (or placebo) was transferred from the first treatment period to the second treatment period . An independent t - test was performed between the two groups (pl / su; su / pl) on plasma vitamin e change scores (pre to post treatment) (t22 = 0.49, p = .62). This test showed that there was no significant difference between the two groups and therefore the data from the two treatment periods was pooled . Experimental design . Legend: vit e = vitamin e; rpe = rate of perceived exertion; mda = malondialdehyde; hb = haemoglobin; hct = hematocrit; 2 week treat . = 2 weeks of treatment; = crossover of treatment; = time of measurement . The two dependent variables that were assessed included plasma vitamin e and malondialdehyde (mda). Malondialdehyde was assessed to determine if it significantly increased as a result of the ret . Secondly, mda values were also analyzed to see whether post exercise mda measures were influenced by the vitamin e supplementation or the state of training of the participant . A 2 treatment (supplement vs placebo) 2 group (untrained vs trained) factorial anova was performed on plasma vitamin e change scores (pre to post treatment) (f (3,42) = 16.94, p <.01). There was a significant difference found in the main effect for treatment (f (3,42) = 46.50, p <.01, as the two supplemented groups had large increases (almost double) in their plasma vitamin e levels, while the two placebo groups had very small plasma vitamin e changes . There was no significant difference found for the main effect for group (f (3,42) = 3.19, p = .08), plus no significant difference found for the treatment by group interaction (f (3,42) = 3.74, p = .06). Figure 2 shows the changes in plasma vitamin e as a result of the vitamin e and placebo treatments . Vitamin e and placebo supplementation a 2 group (trained vs untrained) 2 treatment (vitamin e vs placebo) 3 time (pre exercise vs immediate post exercise vs 6 hours post exercise) factorial anova with repeated measures on time was performed on mda values . There were no significant differences found in the main effect for group or main effect for treatment between the four groups (untrained / placebo; untrained / supplement; trained / placebo; trained / supplement) assessed . There was only one significant difference found and that was in the main effect for time (wilks' = .52, f (2,49) = 22.41, p <.01). Using the pairwise comparison post hoc test for the main effect for time, it was found that the 6 hour post exercise mda values were significantly higher in comparison to the pre exercise mda levels (t53 = - 4.15, p <.01). Immediate post exercise mda values were significantly lower than pre exercise mda levels (t53 = 2.52, p = .02) and the 6 hour post exercise mda values were significantly higher than the immediate post exercise mda values (t53 = - 6.56, p <.01). Figure 3 displays the mda measures from pre to immediate post exercise and 6 hours post exercise for the four groups . Vitamin e supplementation and the state of training in summary, there was no evidence that vitamin e supplementation was effective in reducing oxidative damage in comparison to the placebo group . As well, there was no difference between the trained and untrained groups with respect to their impact on lipid peroxidation . The group descriptive measures (untrained vs trained) are noted in table 1, while the weights lifted (10 repetition maximum rm) for each exercise during the resistance exercise test (ret) are listed in table 2 . Group descriptive measures * body fat predicted from skinfolds using the durnin and womersley formula . Resistance exercise test weights all 27 participants were found to be in the normal range of plasma vitamin e levels (12 to 37 umol / l) before the study commenced . There were no significant differences between the untrained and trained groups with regards to the general descriptive measures taken except within the body fat percentage category and past resistance training experience category . The percentage of body fat was significantly higher in the untrained group (22.1% 5.9) in comparison to the trained group (16.2% 4.9) and as established by the enrolment criteria, the untrained group had greatly reduced experience in the weight room (0.1 year 0.1) in comparison to the trained group (5.2 years 2.6). There were significant differences found between the untrained and trained groups in weights lifted in all weight training exercises . The differences found between the untrained and trained groups in weights lifted was due to the substantial differences in past resistance training experience and lean body mass . The control variables that were used to ensure that the four groups (untrained placebo; untrained supplement; trained placebo; trained supplement) were consistent during the study included dietary vitamin e intake, dietary vitamin c intake, number of resistance training sessions, number of aerobic training sessions, and the rate of perceived exertion at the middle of the exercise test (rpe mid) and at the end of the exercise test (rpe end). A 2 group (trained vs untrained) 2 treatment (placebo vs supplement) factorial anova was performed on all 6 variable change scores (treatment period 1 to treatment period 2) separately and the results are presented in table 3 . All four groups had similar rpe mid and rpe end change score measures as indicated by the non significant status under the overall f statistic column . The two factorial anova tests indicated that the four groups had exercised at an intensity level that did not change from one period to the next . There was no significant difference between the untrained group and the trained group (t25 = -.04, p = .96) for rpe mid and as well there was also no significant difference between the untrained group and the trained group (t25 = .70, p = .48) for rpe end . This indicates that the two groups (trained vs untrained) were exercising at similar relative intensities . All four groups had similar change score values (treatment period 1 to treatment period 2) for the number of resistance workouts (f (3,23) = .14, p = .93) and aerobic workouts (f (3,23) = .38, p = .76). Therefore, there was no change in their workout patterns during the length of the study . The dietary vitamin c intake results showed no statistical differences (f (3,23) = .12, p = .95) between the four groups . There were no significant differences in the dietary vitamin e intake change scores between the four groups (f (3,23) = 1.2, p = .33). Overall, we see that there were no significant differences within the 4 groups in the 6 control variables selected . These 6 potential confounding variables were monitored to ensure that they did not compromise the results of the study . The 27 participants had a two week period of vitamin e supplementation (885 mg tocopherol / day su) and a two week period of placebo (soy bean oil capsule pl) separated by the 4 week washout . In studies with crossover designs (see figure 1), it is necessary to test for a carryover effect, i.e., to see if the supplemental vitamin e (or placebo) was transferred from the first treatment period to the second treatment period . An independent t - test was performed between the two groups (pl / su; su / pl) on plasma vitamin e change scores (pre to post treatment) (t22 = 0.49, p = .62). This test showed that there was no significant difference between the two groups and therefore the data from the two treatment periods was pooled . Experimental design . Legend: vit e = vitamin e; rpe = rate of perceived exertion; mda = malondialdehyde; hb = haemoglobin; hct = hematocrit; 2 week treat . = 2 weeks of treatment; = crossover of treatment; = time of measurement . The two dependent variables that were assessed included plasma vitamin e and malondialdehyde (mda). Malondialdehyde was assessed to determine if it significantly increased as a result of the ret . Secondly, mda values were also analyzed to see whether post exercise mda measures were influenced by the vitamin e supplementation or the state of training of the participant . A 2 treatment (supplement vs placebo) 2 group (untrained vs trained) factorial anova was performed on plasma vitamin e change scores (pre to post treatment) (f (3,42) = 16.94, p <.01). There was a significant difference found in the main effect for treatment (f (3,42) = 46.50, p <.01, as the two supplemented groups had large increases (almost double) in their plasma vitamin e levels, while the two placebo groups had very small plasma vitamin e changes . There was no significant difference found for the main effect for group (f (3,42) = 3.19, p = .08), plus no significant difference found for the treatment by group interaction (f (3,42) = 3.74, p = .06). Figure 2 shows the changes in plasma vitamin e as a result of the vitamin e and placebo treatments . Vitamin e and placebo supplementation a 2 group (trained vs untrained) 2 treatment (vitamin e vs placebo) 3 time (pre exercise vs immediate post exercise vs 6 hours post exercise) factorial anova with repeated measures on time was performed on mda values . There were no significant differences found in the main effect for group or main effect for treatment between the four groups (untrained / placebo; untrained / supplement; trained / placebo; trained / supplement) assessed . There was only one significant difference found and that was in the main effect for time (wilks' = .52, f (2,49) = 22.41, p <.01). Using the pairwise comparison post hoc test for the main effect for time, it was found that the 6 hour post exercise mda values were significantly higher in comparison to the pre exercise mda levels (t53 = - 4.15, p <.01). Immediate post exercise mda values were significantly lower than pre exercise mda levels (t53 = 2.52, p = .02) and the 6 hour post exercise mda values were significantly higher than the immediate post exercise mda values (t53 = - 6.56, p <.01). Figure 3 displays the mda measures from pre to immediate post exercise and 6 hours post exercise for the four groups . Vitamin e supplementation and the state of training in summary, there was no evidence that vitamin e supplementation was effective in reducing oxidative damage in comparison to the placebo group . As well, there was no difference between the trained and untrained groups with respect to their impact on lipid peroxidation . Two results followed an expected pattern a high intensity resistance exercise bout resulted in significant increases in lipid peroxidation and vitamin e supplementation was able to significantly increase the levels of plasma vitamin e in participants . The end result of the study showed that the two weeks of vitamin e supplementation (885 mg / day tocopherol acetate) did not attenuate resistance exercise induced lipid peroxidation in both untrained or trained resistance participants . If the assumption is correct that acute measures of increased levels of lipid peroxidation contribute to long term negative health consequences, then the implications of this research would indicate that vitamin e antioxidant supplementation does not combat the negative health consequences . Also, the trained participant had no added protection against free radical damage if exposed to the same relative intensity of exercise . One of the purposes of this study was to explore the effects of a high intensity resistance exercise test on lipid peroxidation levels . State that peak changes in mda occur at 6 hours post exercise, while some studies have only examined immediate post exercise mda values . The current study found a significant decrease in mda immediate post exercise in both groups (supplemented and placebo); nevertheless, the key measurement to utilize is the measure occurring at the peak time of mda at 6 hours post exercise . The significant increase in mda (at 6 hours post exercise) agrees with the majority of research in the field of aerobic exercise and as well the mcbride et al . High intensity resistance exercise study . In the current study, it was found that plasma vitamin e levels significantly increased with the supplementation of 885 mg / day of vitamin e for 14 days . Nevertheless, vitamin e supplementation was not able to decrease the lipid peroxidation caused by intense resistance exercise . Other studies have also shown that vitamin e supplementation was not effective in reducing lipid peroxidation, although these studies used aerobic exercise as the mode of exercise . The reason for the' no effect' of vitamin e supplementation in the current resistance exercise study is not clear . This study controlled for many outside confounding variables that might have affected the results . Plus, the plasma vitamin e levels were significantly increased in the supplemented group due to the treatment . The results presented in this review are in conflict with the theoretical construct supporting vitamin e antioxidant supplementation outlined in the introduction . One potential reason explaining the ineffectiveness of vitamin e supplementation is that perhaps there were too many oxygen free radicals at the specific muscle tissue site (due to intense exercise) and the localized vitamin e was not sufficient enough to quench the overload . The rate of o2 flux into the working muscle may increase 100 fold during intense exercise . This can result in a 4 to 5 percent increase in the superoxide radical (o2 -). Perhaps, this is too much for the current levels of vitamin e in muscle tissue to handle . Further investigation is necessary at the muscle tissue site to provide more specific information with regards to the amount of vitamin e present and what quantity is being used locally to quench oxygen free radicals . The creation of higher levels of vitamin e in human plasma may be an ineffective method to combat exercise induced free radicals . This was the first study to explore the training state (untrained vs trained) in resistance participants to determine if the level of training had an impact on the amount of free radical damage . As expected, trained individuals could lift heavier weights, but as long as relative intensity was kept constant (i.e. Rpe), there was no difference between trained and untrained participants in terms of post exercise mda production . If one were to reconsider the mechanical stress and muscle damage theory outlined in the introduction, one might infer that the mda production was a function of muscle damage, not absolute muscle work . However, if the second hypothesis (ischemia - reperfusion theory) were reviewed, a more intense and larger muscle contraction from a trained participant would produce a greater, temporary decrease in blood flow and oxygen availability and subsequent ischemia . The following reperfusion would produce a larger reintroduction of o2 and result in a greater formation of the o2 radical . Subsequently a more developed antioxidant mechanism would be necessary to combat the larger amount of free radicals . In summary, this study showed that 1) a high intensity resistance exercise bout resulted in significant increases in lipid peroxidation, 2) two weeks of vitamin e supplementation (885 mg / day tocopherol acetate) offers no protection against resistance exercise induced lipid peroxidation and 3) training allows greater work output, but at the same relative intensity, trained and untrained participants can expect similar mda production . Recommendations for further research include the following: 1) further investigation is necessary at the muscle tissue site to provide more specific information with regards to the amount of vitamin e present and what quantity is being used locally to quench oxygen free radicals . 2) many of the endogenous antioxidant enzymes and vitamins should be monitored during research . This would provide a detailed picture of the changes that occur as a result of chronic training or an acute exercise bout . For example, lower amounts of exercise induced lipid peroxidation may be produced in the female body due to increased antioxidant properties as a result of elevated estrogens levels . 4) further investigations are required in the area of the trained versus untrained participant . There seems to be some support for long term training producing positive adaptations in the antioxidant composition in the human body . Twenty seven males and females between the ages of 19 and 30 years of age volunteered for this investigation . Fourteen participants (m = 7, f = 7) were placed in the untrained group and 13 participants (m = 8, f = 5) were enlisted in the trained group . The trained group consisted of individuals who had been doing resistance training for a minimum of 3 years to a maximum of 10 years and who were currently doing weight training regularly (3 to 5/ week). The untrained group was composed of individuals who had very little resistance training experience (under 6 months). The participants took part in a double blind, placebo controlled crossover experimental design study . Participants were randomly assigned to receive either the 885 mg tocopherol acetate / day or placebo during the first 2 week period . This was followed by a 4 week washout period and then a reversal of treatments during the last 2 week period (see figure 1 . In results section). At the end of each treatment period individual 3-day diet diaries were filled out and analyzed during treatment period #1 and treatment period #2 for all participants to quantify average vitamin e and vitamin c intakes for the 4 treatment groups (untrained / placebo; untrained / supplemented; trained / placebo; trained / supplemented). The participants were required to maintain their exercise habits they were accustomed to throughout the 8 week study . Daily logs were kept by each participant throughout the study that included a record of their exercise sessions, injuries or illnesses and major stress incidents . Participants were not allowed to exercise 24 hours prior to the ret and up to 6 hours post ret . The ret consisted of exercise performed in a circuit type fashion that consisted of 8 exercises . The exercises included the bench press, incline leg press, side lateral raises, leg curls, arm curls, leg extension, lat pull downs and abdominal curls . This means that one set was performed on each exercise, then the next exercise was performed until the circuit of 8 exercises was completed . A total of 3 circuits were performed with 2 minute rest periods between circuits and 1 minute and 30 seconds rest periods between each set . This ensured that each participant was lifting at a similar intensity in relation to their strength . Each individual's 10 rm for each exercise was predetermined 12 weeks prior to the commencement of the first treatment period . Also, a warm up circuit consisting of sets of 10 repetitions was performed at the beginning of the ret using 75% of the individual's 10 rm . Blood samples were obtained 5 minutes before the ret, immediately post exercise and 6 hours post exercise . The amount of blood withdrawn was small (20 ml) and it was obtained by a certified phlebotomist from an antecubital vein using vacutainers . The first blood sample was taken immediately before each ret to determine blood plasma vitamin e levels after treatment period #1 and treatment period #2 . They were taken before each ret, immediately after each ret and 6 hr post ret . The method of chirico was used to determine lipid peroxidation (levels of mda) using the modified tba test with bht added . Hematocrit (hct) and haemoglobin (hb) were also measured (pre and immediate post ret) and plasma volume shifts were determined using the equation suggested by van beaumont et al ., . The control variables that were used to ensure that the four groups (untrained placebo; untrained supplement; trained placebo; trained supplement) were consistent during the study included dietary vitamin e intake, dietary vitamin c intake, the number of resistance training sessions, the number of aerobic training sessions, rpe middle and rpe end . A 2 group 2 treatment factorial anova was performed separately on each of the control variable change scores (treatment period 1 to treatment period 2). The two dependent variables that were assessed included plasma vitamin e and malondialdehyde (mda). To determine the changes in plasma vitamin e as a result of the vitamin e and placebo treatments, a 2 treatment (supplement vs placebo) 2 group (untrained vs trained) factorial anova was performed on plasma vitamin e change scores (pre to post treatment). To evaluate the changes in mda, a 2 group (trained vs untrained) 2 treatment (vitamin e vs placebo) 3 time (pre exercise vs immediate post vs 6 hours post exercise) factorial anova with repeated measures on time was performed on mda values . Twenty seven males and females between the ages of 19 and 30 years of age volunteered for this investigation . Fourteen participants (m = 7, f = 7) were placed in the untrained group and 13 participants (m = 8, f = 5) were enlisted in the trained group . The trained group consisted of individuals who had been doing resistance training for a minimum of 3 years to a maximum of 10 years and who were currently doing weight training regularly (3 to 5/ week). The untrained group was composed of individuals who had very little resistance training experience (under 6 months). The participants took part in a double blind, placebo controlled crossover experimental design study . Participants were randomly assigned to receive either the 885 mg tocopherol acetate / day or placebo during the first 2 week period . This was followed by a 4 week washout period and then a reversal of treatments during the last 2 week period (see figure 1 . In results section). At the end of each treatment period individual 3-day diet diaries were filled out and analyzed during treatment period #1 and treatment period #2 for all participants to quantify average vitamin e and vitamin c intakes for the 4 treatment groups (untrained / placebo; untrained / supplemented; trained / placebo; trained / supplemented). The participants were required to maintain their exercise habits they were accustomed to throughout the 8 week study . Daily logs were kept by each participant throughout the study that included a record of their exercise sessions, injuries or illnesses and major stress incidents . Participants were not allowed to exercise 24 hours prior to the ret and up to 6 hours post ret . The ret consisted of exercise performed in a circuit type fashion that consisted of 8 exercises . The exercises included the bench press, incline leg press, side lateral raises, leg curls, arm curls, leg extension, lat pull downs and abdominal curls . This means that one set was performed on each exercise, then the next exercise was performed until the circuit of 8 exercises was completed . A total of 3 circuits were performed with 2 minute rest periods between circuits and 1 minute and 30 seconds rest periods between each set . This ensured that each participant was lifting at a similar intensity in relation to their strength . Each individual's 10 rm for each exercise was predetermined 12 weeks prior to the commencement of the first treatment period . Also, a warm up circuit consisting of sets of 10 repetitions was performed at the beginning of the ret using 75% of the individual's 10 rm . Blood samples were obtained 5 minutes before the ret, immediately post exercise and 6 hours post exercise . The amount of blood withdrawn was small (20 ml) and it was obtained by a certified phlebotomist from an antecubital vein using vacutainers . The first blood sample was taken immediately before each ret to determine blood plasma vitamin e levels after treatment period #1 and treatment period #2 . They were taken before each ret, immediately after each ret and 6 hr post ret . The method of chirico was used to determine lipid peroxidation (levels of mda) using the modified tba test with bht added . Hematocrit (hct) and haemoglobin (hb) were also measured (pre and immediate post ret) and plasma volume shifts were determined using the equation suggested by van beaumont et al ., . The control variables that were used to ensure that the four groups (untrained placebo; untrained supplement; trained placebo; trained supplement) were consistent during the study included dietary vitamin e intake, dietary vitamin c intake, the number of resistance training sessions, the number of aerobic training sessions, rpe middle and rpe end . A 2 group 2 treatment factorial anova was performed separately on each of the control variable change scores (treatment period 1 to treatment period 2). The two dependent variables that were assessed included plasma vitamin e and malondialdehyde (mda). To determine the changes in plasma vitamin e as a result of the vitamin e and placebo treatments, a 2 treatment (supplement vs placebo) 2 group (untrained vs trained) factorial anova was performed on plasma vitamin e change scores (pre to post treatment). To evaluate the changes in mda, a 2 group (trained vs untrained) 2 treatment (vitamin e vs placebo) 3 time (pre exercise vs immediate post vs 6 hours post exercise) factorial anova with repeated measures on time
Non - pulmonary causes should be considered especially if symptoms are persistent and refractory to typical treatment regimens . This article presents a case of asthma that was refractory to all treatments in the rural city of tamale, ghana . She typically experienced an increase in symptoms and refractoriness to treatment during the dusty season, when the harmattan, winds carrying sahara sands, envelops northern ghana . This year the patient's bronchospasm worsened during the harmattan but, unlike in prior years, was unresponsive to her routine medications plus prednisone . She had a blood pressure of 106/70, heart rate of 98, and respiratory rate of 22 . She received dialysis and 1 year later had no recurrence of cardiac tamponade but still required medication for asthma . This case is important in that it reminds clinicians that bronchospasm is not always of pulmonary origin and can be due to cardiac asthma . Additionally, it adds to a growing body of literature illustrating how bedside portable ultrasonography is a useful diagnostic tool, especially in areas without access to more expensive modalities such as x - rays . This case serves as a reminder that a normal blood pressure reading can occur with cardiac tamponade if the patient has baseline hypertension . It also highlights the importance of the systems aspect to medical care, noting the interrelation of physical and social environments . A 40-year - old ghanaian female farmer presented to her internist with an exacerbation of asthma . She has lived all of her life in tamale, ghana, and she and her physician were accustomed to asthmatics having increased symptoms at this time, during the dry season when the harmattan, dry desert winds carrying sand off of the sahara, blanket northern ghana . Her baseline medication was only an albuterol inhaler, which was used rarely on an as - needed basis . In prior years, she would increase her albuterol to two puffs four times a day, and that would typically control her bronchospasm . For the previous 5 weeks, her medications were albuterol inhaler two puffs four times a day, budesonide 400 g two puffs two times a day, montelukast 10 mg per day, and fluticasone 250 g / salmeterol 50 g one puff two times a day . Her respiratory symptoms did not abate, so she was put on two courses of prednisone 20 mg per day for 5 days, the last course ending 2 weeks previously, without relief . She presented to an outpatient medical clinic in tamale, a city with limited access to x - rays or blood tests . The patient complained of mild shortness of breath at rest but severe dyspnea on exertion for 1 month that had increased over the past 2 weeks despite the additional medications ordered by her internist . She denied experiencing orthopnea, chest pain, cough, fever, chills, abdominal pain, heartburn, dyspepsia, leg trauma, or swelling . She had a history of hypertension diagnosed many years ago but never took antihypertensive medication due to financial constraints . She also has had many episodes of malaria, with the last episode 5 months earlier, which was treated with artemether / lumefantrine . Her family history is significant for a mother who has had asthma since she was a teenager . The patient is poor, lives in tamale, has never had a chest x - ray, and has had no blood tests for 15 years . Controlling her asthma is crucial as she is a farmer who works in the field 7 days a week performing manual labor . The patient is a thin, muscular woman who appeared with mild dyspnea at rest . She was able to speak in full sentences without distress but had a mild increase in shortness of breath when asked to climb onto the exam table . She had a blood pressure of 106/70, heart rate of 98, respiratory rate of 22, and temperature of 37 c (98.6 f). Auscultation of the lungs was remarkable for bilateral wheezing in mid - late expiration in all lung fields with prolonged expiration and 1 + bibasilar inspiratory crackles . Cardiac exam revealed a regular rate and rhythm without murmurs, and heart sounds were not muffled . Neck veins were unable to be visualized . Abdominal exam revealed a scaphoid abdomen with normal bowel sounds, no masses or organomegaly, and no tenderness . She had 2 + carotid, dorsalis pedis, femoral, and radial pulses bilaterally . However, a physician from the united states was visiting and teaching ultrasonography to the ghanaian clinicians . He used a portable bedside ultrasound that had been previously donated to evaluate the patient . Subcostal and 4-chamber apical views revealed a swinging heart within a large pericardial effusion with diastolic collapse of the right ventricle . A diagnosis of pericardial tamponade was made, and an emergency pericardiocentesis was performed via a parasternal approach in the left third intercostal space . After 100 cc of straw - colored fluid were removed, the patient was significantly improved . A total of 750 cc was aspirated, and a repeat ultrasound now revealed a trivial effusion with normal ventricular function . Post - procedure, the patient had clear lungs, a blood pressure of 180/100, a heart rate of 72, and a respiratory rate of 12 . She was referred to accra, the capital of ghana, for blood tests that were performed 10 days later . She had a normal chest x - ray and after an extensive evaluation by a nephrology consultant was diagnosed with renal failure due to hypertensive nephropathy . She received dialysis and 1 year later had no recurrence of cardiac tamponade but still required albuterol inhaler as needed that was increased to every 6 hours during the harmattan to control her bronchospasm . There is increasing compression of all cardiac chambers as fluid fills the pericardial sac with equalization of intracardiac chamber pressures . Venous return to the heart diminishes as the low - pressure venous system cannot overcome the increase in intrapericardial pressure . Less blood enters the ventricles, and increasing intrapericardial pressure compresses the heart, forcing the intraventricular septum to bow into the left ventricle . This intraventricular dependence leads to decreased filling of the left ventricle and decreased ejection fraction . With acute decompensation, the pulmonary - capillary membrane may succumb to increased pressure, with shearing of the capillary and release of fluid, protein, and occasionally red blood cells into the alveoli . Pulmonary edema from left ventricular failure can cause bronchiolar compression and increased airway resistance with subsequent coughing or wheezing . Cardiac asthma is a clinical syndrome induced by acute passive congestion and edema of the lungs that occurs when the left side of the heart suffers from a sudden disproportion between workload and work capacity . Other potential etiologies for tamponade include infections, hypothyroidism, drugs, cancer, radiation, and collagen vascular disease . This woman had asthma for many years but now also had cardiac asthma from cardiac tamponade due to her previously undiagnosed renal failure . She had inspiratory crackles, which can be seen in congestive heart failure and are not typical for asthma . In fact, other physicians did not appreciate inspiratory crackles presumably for this reason . Although normotensive at presentation, this patient had a history of hypertension . In view of her possible relative hypotension and her findings of crackles, bronchospasm, and dyspnea, a bedside portable ultrasound was indicated, and it revealed the definitive diagnosis . Tamponade can cause hypotension due to decreased stroke volume, jugular - venous distension due to impaired venous return to the heart, and muffled heart tones due to fluid inside the pericardium . The patient did not have visibly distended neck veins, illustrating that these findings, known as beck's triad, are unreliable for the diagnosis of pericardial tamponade as it is seen only in a minority of patients . Although this patient presented with normal blood pressure, it increased substantially to the patient's baseline hypertensive state after pericardiocentesis . Her blood pressure at presentation, while seemingly normal, was actually significantly lower than her baseline . Dialysis treatments prevented recurrences of cardiac tamponade . In 2000, the american medical association passed resolution 108 and reaffirmed policy h-230.960, providing general acceptance of bedside ultrasound by non - radiology physicians and recognized that ultra - sound imaging is within the scope of practice of appropriately trained physicians and not a specialty specific privilege . This report also adds to the growing body of literature illustrating that bedside portable ultrasound is gaining utility as a useful diagnostic modality by non - radiologists in areas without access to radio - graphs . Compared to other modalities such as x - rays, it is less costly, requires less training, and uses few consumable items, making it ideal for use in areas with poor access to more advanced diagnostics . This case highlights the importance of the systems aspect of medical care, noting the interrelation of physical and social environments . The patient did have asthma that was worsened each year by environmental winds from the sahara . Yet pericardial tamponade, rather than an environmentally related exacerbation of asthma, proved to be the etiology of her dyspnea . Because she was indigent she lived in an area without significant diagnostic medical capabilities and therefore did not have access to blood tests to diagnosis her chronic renal disease . Yet a portable ultrasound was available in this clinic and was crucial in diagnosing pericardial tamponade . Fortunately, the patient was able to procure funds to be cared for at the only dialysis facility in ghana and was doing well without a recurrence of tamponade 1 year after pericardiocentesis . It illustrates that not all bronchospasm has a pulmonary etiology and that cardiac asthma should be considered, especially in cases of refractory bronchospasm . It also shows how diagnostic ultrasound can be used by nonradiologists in critically ill patients . Furthermore, this case is an example of how environmental changes, occupation, and finances all affect healthcare . The etiology of bronchospasm is not always of pulmonary origin, and non - cardiac etiologies such as pericardial tamponade should be pursued, particularly when wheezing is refractory to treatment . Bedside ultrasonography can be used as a diagnostic modality for cardiopulmonary disease, especially in areas without access to x - rays.
Metastases to the breast from extramammary malignancies are rare and account for 0.43% of all breast malignancies . Lymphoma, melanoma, sarcoma, lung carcinoma and ovarian tumor are common extramammary primary malignancies that metastasize to the breast [1 - 3]. Cases of metastasis from primary colorectal neoplasm to the breast is extremely rare . In searching medline and embase including non - english literature, and handsearching the references, we describe the features of metastatic breast cancer from adenocarcinoma of the colon in a 63-year - old woman . A 63-year - old woman was referred to a breast surgeon due to a mass with suspicious metastatic axillary lymph node discovered incidentally on positron emission tomography - computed tomography for follow - up study after colon cancer surgery without other metastatic lesion (fig . Four years ago, she underwent a subtotal colectomy for stage t3n1m0 sigmoid colon cancer with colonic obstruction and subsequent chemotherapy with 5-fluorouracil and leucovorine . Two years after the operation, a 2.8 cm sized solitary metastatic lung nodule on the right middle lobe was identified on chest computed tomography for follow - up study for which she underwent pulmonary wedge resection, followed by chemotherapy with oxaliplatin and 5-fluorouracil . Physical examination revealed a 2 cm sized firm nodule in the lower inner quadrant of the right breast without evidence of axillary or supraclavicular lymphadenopathy . The mass was not identified on mammography, but ultrasonography showed 1.1 cm sized mass in the lower inner quadrant of the right breast without enlarged lymph node in the ipsilateral axilla . Serum tumor markers were all in normal ranges (carcinoembryonic antigen 4.2 ng / ml, carbohydrate antigen 15 - 3 6.2 u / ml). Subsequent magnetic resonance imaging showed 1.8 cm sized ill - defined irregular shaped enhancing mass in the lower inner quadrant of the right breast and enlarged lymph node at the ipsilateral axilla compatible with a nodule suspicious for metastasis . Breast specific gamma imaging using tc - mibi showed a lesion with increased uptake in the lower inner portion of the right breast with no lesion uptake in the axilla . The tumor cells in the breast mass were cuboidal to columnar with eosinophilic cytoplasm and pseudostratification, compatible with the features of adenocarcinoma of colorectal origin (fig . Immunohistochemical study revealed the following results: tumor cells were strongly positive for cdx2, cytokeratin (ck)20 and negative for ck7, thyroid transcription factor-1, estrogen receptor, progesterone receptor, c - erbb2 (fig . 4). These findings are consistent with metastatic adenocarcinoma of the colon or rectum . Primary breast cancer is one of the most common malignancies and leading cause of death from malignant disease in women . A malignant mass in the breast can easily be misinterpreted as breast cancer and inappropriate surgical intervention could be carried out . Although there are few instances of breast metastasis from colorectal malignancy, correct diagnosis is crucial to avoid unnecessary surgical intervention . Generally, metastases to the breast from extramammary malignancies are characterized by rapidly growing, mobile masses that are easily palpable but do not cause overlying skin or nipple retraction, or bloody nipple discharge . Core biopsy allows histological assessment of the tissue, helping in identifying the origin of the carcinoma . On the histologic finding, the periductal and perilobular location of the tumor with the absence of in situ ductal carcinoma in the surrounding breast specimen favor a metastasis . Immunohistochemistry enables a more confident differentiation between a primary breast adenocarcinoma and a colorectal adenocarcinoma metastasis to the breast . For our patient, diagnosis was finally reached after immunohistochemistry finding . The majority of colorectal carcinomas are usually ck7-negative and ck20-positive, while the majority of primary breast carcinomas is ck7-positive and ck20-negative . And the positive immunostaining for cdx2 is a highly sensitive and specific marker of colorectal carcinoma . Our case showed these findings as well; tumor cells were positive for cdx2, ck20 and negative for ck7 . Recently, some authors have suggested that the expression of ck20 can be identified in primary breast cancer in contrast to the conventional immunohistochemistry results . So, clinicians and pathologists should examine multiple immunohistochemistry markers and combine them as an approach for final diagnosis . According to recent reports, the management of metastatic breast mass from colorectal adenocarcinoma should be diagnostic and palliative . Advocated that surgical excision should be avoided in the view of short life expectancy and risk of seeding to the skin . Suggested that excisional biopsy was usually appropriate and provided adequate local control . If the diagnosis for the breast mass is unclear, unnecessary intervention, for example mastectomy or lymph node dissection of axilla, can be performed . Therefore, when breast mass is identified incidentally on radiologic study during follow - up after operation for colorectal carcinoma, clinicians should keep the possibility of breast metastasis from colorectal adenocarcinoma in mind . Additionally, periodical examination of the breast after colorectal cancer surgery may be helpful to detect the metastasis early.
The etiology of psoriasis is unknown, but genetic, metabolic, and immunologic mechanisms have been proposed . It is known that psoriasis can occur due to abnormalities in essential fatty acid metabolism, lymphokine release, free radical generation, and lipid peroxidation . Alterations in plasma lipid and lipoprotein composition including a tendency toward an increase in total cholesterol (tc) and triglyceride (tg) and decrease in high - density lipoprotein cholesterol (hdl - c) levels suggest that psoriasis may associate with the disorders of lipid metabolism [2, 3]. Healthy skin secretes 85 mg of cholesterol within 24 hours whereas a psoriatic patient loses 12 grams of cholesterol with scales during that time . The morphology of psoriatic skin is characterized by epidermal thickness and parakeratosis, a pronounced dermal vascular plexus, and the presence inflammatory cells in the superficial dermis and epidermis . Increased polymorph nuclear leukocyte levels damage surrounding tissue by releasing reactive oxygen species produced via nadph oxidase / myeloperoxidase and proteolytic enzymes . Increased production of oxygen metabolites is a common feature of most human diseases including psoriasis and it usually triggers an upregulation of the antioxidant capacity, which is overwhelmed . When the oxidative stress develops, it leads to the oxidative damage of lipids and proteins [2, 4, 5]. Oxidation of the low - density lipoproteins (ldl) results in the production of modified ldl . One of the major and early lipid peroxidation products is oxidized low - density lipoprotein (ox - ldl). High titers of autoantibodies against ox - ldl have been reported in patients with psoriasis . The level of autoantibodies against ox - ldl has been suggested to reflect the in vivo oxidation of ldl [7, 8]. The presence of ox - ldl accumulation in psoriatic skin sample has not been shown before . The current study has been designed to evaluate the presence of ox - ldl accumulation in skin biopsy materials of psoriatic patients . This prospective study was performed in the psoriatic patients attending the dermatology outpatient clinic of zonguldak karaelmas university hospital . Eighty four psoriatic patients who were diagnosed clinically and histopathologically by the department of dermatology and a total of 40 age - and sex - matched healthy controls recruited from the general population as a control group were enrolled in the study . The patients with secondary hyperlipidemia such as chronic renal insufficiency, nephrotic syndrome, hypothyroidism, diabetes mellitus, obstructive liver disease, and the connective tissue disease were excluded . All patients and controls were included in the study after giving an informed consent . The height and weight of all subjects were recorded and their body mass indexes were calculated as weight (kg)/height (m). Blood samples were taken after a 12-hour overnight fast and sera were separated by low - speed centrifugation for 15 min . The levels of serum tc, hdl - c, ldl cholesterol (ldl - c), and tg were determined by enzymatic methods using a roche cobas integra 800 autoanalyzer . The skin punch biopsy specimens were collected from both lesional and nonlesional skin of 84 psoriatic patients . The presence of ox - ldl in biopsy materials of psoriatic individuals was evaluated using an immune - fluorescent staining method . The slides were prepared from biopsy sections, which were cut at 7-micron thickness . Slides were further divided into two pieces; one was used for the test and the other was used for negative control . Thirty l anti - oxidized ldl igg solution (mouse igg2 antibodies, antibodyshop, copenhagen, denmark) as primary antibody was added only on test slides, and the control slides were manipulated only with the same amount of phosphate buffered saline solution (pbs). After 30 minutes of incubation in a humid chamber at room temperature, both the control and test slides were washed with (pbs), and 30 l fitc (fluorescent isothiocyanate)-labeled goat anti - mouse igg (chemicon international, california, usa) was administered as a conjugate substance . For a further 30 minutes, the slides were kept and incubated at room temperature, and then washed with the standard pbs solution . After open - air drying, slides were examined under fluorescent microscopy at 100x magnification (leica dmrx, wetzlar, germany). Differences in continuous variables between the patient and the control groups were analyzed using the student t - test . Mann - whitney u test was used to compare nonparametric variables between two groups . All values were expressed as mean standard deviation (sd) unless otherwise stated . Table 1 illustrates the clinical and demographic characteristics of the study population . There was no statistically significant difference between psoriatic patients and the controls considering age, sex, weight, height, or bmi (p>.05). Tc, tg, and ldl - c levels were significantly higher, but hdl - c levels were lower in the psoriatic patients than in the control subjects . Hdl - c levels were significantly lower in the female psoriatic patients than in the female control subjects (p <.05). There was no statistically difference for tc, tg, and ldl - c levels between the psoriatic and the control subjects in the female group (table 3). Tc, tg, and ldl - c levels were significantly higher in the male psoriatic patients than in the male control subjects (p <.05). There was no statistically difference in hdl - c levels between the psoriatic and the control subjects in male group (table 4). We did not observe any positive immune - fluorescent staining in the nonlesional skin biopsy materials of the psoriatic patients . Significant positive immune - fluorescent staining was observed in the psoriatic skin biopsy materials . The dense cellular staining among the many studies on serum lipid values in psoriasis, conflicting results have been reported . In studies on serum tc levels in psoriatic patients, high [2, 9, 10], low [1, 11], and normal [12, 13] values have all been reported . In our study, we found significantly higher levels of tc values in the psoriatic patients (p <.05). As for serum ldl - c levels, high or normal [1, 10, 12] values have also been reported in psoriasis . We found that ldl - c values in the patients with psoriasis were significantly higher than the control group (p <.05). Normal [9, 10, 13] and low [1, 2] serum levels of hdl - c have been detected . In our study hdl - c levels in psoriatic patients were significantly lower than the control group (p <.01). The same controversy exists regarding serum tg levels, high [1, 2], low, and normal [9, 10, 12] values have also been reported in psoriasis . We found that tg values in the psoriatic patients were significantly higher than the control group (p <.001). The variety of data presented may be due to the fact that the patients included in statistical analyses suffer from different forms of psoriasis such as erythroderma and they undergo various treatments . Tc, tg, and ldl - c levels were significantly higher in the male psoriatic patients than in the male control subjects . There was no statistically difference in the female groups . Only for the females, hdl - c levels were lower in the psoriatic patients than in the control subjects . Considering the results of our research we would suggest analyzing the lipid profiles separately in males and females . Native ldl is only taken up modestly by macrophages, whereas modified ldl is rapidly taken up via scavenger receptors . The major modification of ldl particles in vivo is believed to be the oxidation of both its lipid and protein components . Oxidized or modified the oxidized ldl hypothesis is discovered by goldstein et al . And modified by steinberg et al . . The current oxidative modification or stress hypothesis of atherosclerosis predicts that ldl oxidation is an early, essential event in atherosclerosis and that ox - ldl does contribute to both initiation and progression of atherosclerosis . The oxidative modification hypothesis focuses on the concept that ldl in its native form is not atherogenic . The presence of ox - ldl in atherosclerotic lesions has been studied using antibodies that recognize specific epitopes on ox - ldl, which are not present in its native, nonoxidized, form . These antibodies avidly stain atherosclerotic lesions in humans with no demonstrable staining in normal arteries . A typical feature of atherosclerosis is the accumulation of oxidatively modified ldls within plaques . Also these lipoproteins are considered to contribute to the inflammatory state of atherosclerosis and to play a key role in its pathogenesis . The cellular uptake of ox - ldl leads to the generation of reactive oxygen species (ros). Ros are potentially very harmful substances, because they can react with proteins, dna, or lipids . In other words, the importance of this manuscript is to show the existence of ox - ldl in psoriatic skin . This study shows for the first time the accumulation of oxidized low - density lipoprotein in psoriatic skin lesions by direct immune - fluorescent method . Ox - ldl or anti - ox - ldl antibody levels can be measured in blood samples or body fluids by conventional biochemical and immunological methods . Especially, the level of anti - ox - ldl has been suggested to reflect the in vivo oxidation of ldl . The studies of vanizor kural and rem have demonstrate the existence of these antibodies in psoriasis . The level of anti - ox - ldl antibody was positively correlated with tc and negatively correlated with hdl - c in their studies . In our study, we detected accumulation of ox - ldl in psoriatic skin . This accumulation is markedly increased especially in upper epidermis . The upper - epidermal cells had dens cellular staining with anti - ox - ldl antibodies . We did not observe any positive immune - fluorescent staining in the nonlesional skin biopsy materials of the psoriatic patients . Have observed that tissue - cultered skin fibroblasts from psoriatic patients have reduced ldl receptor activity . Their study has no difference in ldl receptor activity between involved and uninvolved skin from our psoriasis patients . In our study, we only focused on the epidermal layer of involved and uninvolved skin from psoriatic patients . We detected accumulation of ox - ldl in the upper epidermis of the involved skin from the psoriatic patients . Ox - ldl can use native ldl receptor . However, it has a high - affinity advantage than its native form . In conclusion, ox - ldl is an important marker of oxidative stress and lipid peroxidation process . This capability may directly affect psoriatic epidermis and we believe that the accumulation of ox - ldl in the psoriatic skin may have an important role in pathogenesis of psoriasis.
Antidepressants represent the sixth leading substance category causing intoxication in the usa, with tricyclic antidepressants (tcas) being the most important category in that group . Tca intoxications led to 69 fatalities in 2012 . With 6305 exposures in 2012, amitriptyline was the single most important tca involved in intoxication . Similar findings are reported all over the world: amitriptyline is the second most responsible drug for death in antidepressant poisoning in the uk, where antidepressant self - poisoning is used in 20% of all poisoning suicides . Tcas were the most common suicide poison used in new zealand between 2001 and 2005 . In tehran, iran, amitriptyline is the most used tca in drug intoxication, where tcas are responsible for 16% of all admissions due to intoxication . In adult out - patients, amitriptyline is normally dosed between 75 and 150 mg / day, which provides therapeutic concentrations between 80 and 250 g / l . In cases of overdose, amitriptyline may cause an alteration of consciousness, hypernatraemia, convulsive seizure, arrhythmia and respiratory depression . First - line treatment focuses on general measures as well as correction of electrolyte disorders and arrhythmia . Extracorporeal means of toxin removal consist of charcoal haemoperfusion and plasma exchange, which decreased amitriptyline blood concentrations in a few cases . Due to its high plasma protein binding and volume of distribution (vod), amitriptyline the extracorporeal treatments in poisoning (extrip) workgroup therefore recommends not to use extracorporeal removal of tca, as this approach is not likely to offer a clinical benefit . We report two cases of amitriptyline poisoning in which we measured the amitriptyline elimination using a high cut - off (hco) dialyzer . Essential information on both patients as recommended by the extrip workgroup is summarized in table 1 . Table 1.relevant case report characteristics recommended by the extrip workgroup case 1case 2general information age (years)5453 weight (kg)5475 height (cm)168157 gender concurrent diseasesbreast cancer, chronic pain syndrome, depressionmgus, depression, chronic pain syndrome source providing the history of the poisoningparamedicsparamedics time from ingestion to hospital admission (h)7.58.5 known co - medicationlorazepampantoprazole, citalopram, mirtazapine other toxinstilidine, ethanolibuprofen, -blockers, alcohol activated charcoal givennoyes icu stay (days)35 discharge from hospital (days)320laboratory values albumin (g / l)34.842 creatinine at baseline (mol / l)/egfr ckd - epi36/115.3643/6 (akin iii) serum amitriptyline peak concentration (g / l)458412 serum nortipytilin peak concentrations (g / l)283259 serum tilidine / nortilidin peak concentrations (g / l)56/849na urine excretion (ml / days)3100anuria urine amitriptyline concentration (g / l)623na haematocrit (%) 4036.5ectr characteristics modality of ectrintermitted haemodialysisintermitted haemodialysis indication for ectrdetoxificationaki, rhabdomyolysis, detoxification ectr start after admission (h)2.51.5 dialyser (material / surface)hco dialyser (polysulfone, 1.8 m)high - flux dialyser (polysulfone, 1.3 m)hco dialyser (polysulfone, 1.8 m) dialysis time (min)295 (first treatment)220 (second treatment)320 (first treatment)775 (second treatment)/350 (hco) blood flow (ml / min)300 (first treatment)110 (second treatment)240 (high - flux)240 (high - flux) dialysate flow (ml / min)300 (first treatment)55 (second treatment)240 (high - flux)240 (high - flux) ultrafiltration rate (ml / h)5050 (first treatment)/50 (second treatment)/200 (hco) anticoagulationheparinheparin amitriptyline reduction ratio (%) 2728 (hco) ectr amitriptyline clearance (ml / min)587 (high - flux)33 (hco) total amount of amitriptyline in the collected dialysate (g)211920 (high - flux)na (hco)aki, acute kidney injury; akin, acute kidney injury network; ckd - epi, chronic kidney disease epidemiology collaboration; egfr, estimated glomerular filtration rate; hplc, high - performance liquid chromatography; ms / ms, tandem mass spectrometry.amitriptyline and nortriptyline were quantified (detection limit 5 g / l) by hplc followed by electrospray ionization and mass spectrometric detection and quantification of selected ion fragments (triple quadrupole ms / ms, api2000, pe sciex) after simple deproteinization with acetonitrile / methanol . G / l) by hplc - ms (waters micromass, quattro micro) after fluid extraction with cyclohexane.additional membrane characteristics are reported elsewhere .calculations of reduction ratios were executed according to equation (1):(1)rr=(cpostcpre)/cpre100 dialyser clearance was measured according to equation (2), using the patients hematocrit concentration (hct) at the time of clearance sampling:(2)kplasma = qb(1hct/100)((cartcven)/cart) relevant case report characteristics recommended by the extrip workgroup aki, acute kidney injury; akin, acute kidney injury network; ckd - epi, chronic kidney disease epidemiology collaboration; egfr, estimated glomerular filtration rate; hplc, high - performance liquid chromatography; ms / ms, tandem mass spectrometry . Amitriptyline and nortriptyline were quantified (detection limit 5 g / l) by hplc followed by electrospray ionization and mass spectrometric detection and quantification of selected ion fragments (triple quadrupole ms / ms, api2000, pe sciex) after simple deproteinization with acetonitrile / methanol . G / l) by hplc - ms (waters micromass, quattro micro) after fluid extraction with cyclohexane . Calculations of reduction ratios were executed according to equation (1):(1)rr=(cpostcpre)/cpre100 dialyser clearance was measured according to equation (2), using the patients hematocrit concentration (hct) at the time of clearance sampling:(2)kplasma = qb(1hct/100)((cartcven)/cart) a 54-year - old caucasian woman, who ingested an unknown amount of amitriptyline and tilidine in a suicide attempt, was admitted to our hospital deeply unconscious with a glasgow coma scale score of 5 . Electrocardiography showed a broad qrs complex (134 ms) and prolonged qtc (517 ms), representing increased risk for ventricular arrhythmias . Based on the clinical condition, we started a 5 h dialysis using an hco emic2 dialyser (polysulfone; 1.8 m) with a dialysate and blood flow of 300 ml / min to eliminate tilidine and other potentially ingested drugs . The treatment was well tolerated, and immediately afterwards a dialysis with low dialysate and blood flow was started with the aim of performing an extended dialysis . Due to clotting of the extracorporeal circuit, this dialysis prematurely ended after 220 min . Plasma concentrations of both substances were drawn at different time points (figure 1a). Plasma dialyser clearances for amitriptyline and tilidine were 58 and 67 ml / min, respectively, at the beginning and decreased towards the end of the first dialysis session (supplementary table s1). For comparison, dialyser clearances for creatinine and urea were 115 and 132 ml / min, respectively . Dialyser reduction ratios, dialyser clearance and total loss into the collected spent dialysate are listed in supplementary table s1 . Open triangles denote myoglobin values at the upper laboratory detection range . * amitriptyline concentration measured in different laboratories . Amitriptyline concentration measured in different laboratories . Into the sixth hour of treatment, the patient regained consciousness and was transferred to psychiatric care after 3 days in the intensive care unit (icu). A 53-year - old caucasian female who ingested 1750 mg of amitriptyline and 12 g of ibuprofen in a suicide attempt was admitted to our hospital . Serum creatinine was 634 mol / l, sodium 137 mmol / l and creatine kinase 27 308 u / l . Amitriptyline serum concentration was 412 g / l . The unconscious patient was transferred to our icu, intubated and mechanically ventilated . Gastroscopy revealed unabsorbed pills in the stomach, and activated charcoal was administered after they were removed . Haemodialysis was started 2 h after admission due to anuric acute kidney injury caused by rhabdomyolysis . Dialysis using an fx60s polysulfone dialyser (fresenius medical care; 1.3 m) was performed with a blood and dialysate flow of 240 ml / min . G / l at the start of the second dialysis treatment, amitriptyline concentrations did not show any remarkable decline in the following hours of treatment (figure 1b). To enhance extracorporeal removal, we employed the hco emic2 dialyser (fresenius medical care, polysulfone; 1.8 m) with a dialysate and blood flow of 240 ml / min, decreasing amitriptyline to 163 g / l . The increased removal was also confirmed by a plasma dialyser clearance of 33 ml / min for amitriptyline and 124 ml / min for myoglobin . Myoglobin serum concentrations decreased from> 60 000 g / l (upper detection limit) to 11 642 five days after admission, the patient was transferred to the nephrology ward, and renal replacement therapy was stopped after 14 days of intermittent haemodialysis . On renal biopsy, twenty days after initial admission, the patient was transferred to a psychiatric hospital . Of note, therapy with proton pump inhibitors, a therapy the patient had been prescribed for years, can cause both rhabdomyolysis and interstitial nephritis . A 54-year - old caucasian woman, who ingested an unknown amount of amitriptyline and tilidine in a suicide attempt, was admitted to our hospital deeply unconscious with a glasgow coma scale score of 5 . Electrocardiography showed a broad qrs complex (134 ms) and prolonged qtc (517 ms), representing increased risk for ventricular arrhythmias . Based on the clinical condition, we started a 5 h dialysis using an hco emic2 dialyser (polysulfone; 1.8 m) with a dialysate and blood flow of 300 ml / min to eliminate tilidine and other potentially ingested drugs . The treatment was well tolerated, and immediately afterwards a dialysis with low dialysate and blood flow was started with the aim of performing an extended dialysis . Due to clotting of the extracorporeal circuit, this dialysis prematurely ended after 220 min . Plasma concentrations of both substances were drawn at different time points (figure 1a). Plasma dialyser clearances for amitriptyline and tilidine were 58 and 67 ml / min, respectively, at the beginning and decreased towards the end of the first dialysis session (supplementary table s1). For comparison, dialyser clearances for creatinine and urea were 115 and 132 ml / min, respectively . Dialyser reduction ratios, dialyser clearance and total loss into the collected spent dialysate are listed in supplementary table s1 . Open triangles denote myoglobin values at the upper laboratory detection range . * amitriptyline concentration measured in different laboratories . * amitriptyline concentration measured in different laboratories . Into the sixth hour of treatment, the patient regained consciousness and was transferred to psychiatric care after 3 days in the intensive care unit (icu). A 53-year - old caucasian female who ingested 1750 mg of amitriptyline and 12 g of ibuprofen in a suicide attempt was admitted to our hospital . Serum creatinine was 634 mol / l, sodium 137 mmol / l and creatine kinase 27 308 u / l . Amitriptyline serum concentration was 412 gastroscopy revealed unabsorbed pills in the stomach, and activated charcoal was administered after they were removed . Haemodialysis was started 2 h after admission due to anuric acute kidney injury caused by rhabdomyolysis . Dialysis using an fx60s polysulfone dialyser (fresenius medical care; 1.3 m) was performed with a blood and dialysate flow of 240 ml / min . After a quick decrease of amitriptyline to 205 g / l at the start of the second dialysis treatment, amitriptyline concentrations did not show any remarkable decline in the following hours of treatment (figure 1b). To enhance extracorporeal removal, we employed the hco emic2 dialyser (fresenius medical care, polysulfone; 1.8 m) with a dialysate and blood flow of 240 ml / min, decreasing amitriptyline to 163 g / l . The increased removal was also confirmed by a plasma dialyser clearance of 33 ml / min for amitriptyline and 124 ml / min for myoglobin . Five days after admission, the patient was transferred to the nephrology ward, and renal replacement therapy was stopped after 14 days of intermittent haemodialysis . On renal biopsy, twenty days after initial admission, the patient was transferred to a psychiatric hospital . Of note, therapy with proton pump inhibitors, a therapy the patient had been prescribed for years, can cause both rhabdomyolysis and interstitial nephritis . Very recently, the extirp workgroup recommended not performing any extracorporeal treatments (ectrs) for intoxication with tcas . This recommendation is based on the fact that conventional haemodialysis is ineffective due to the high protein binding (> 90%) and large vod (1417 l / kg) and the lipophilic properties of tca . However, most of the haemodialysis data the workgroup based the recommendation on are from the 1960s and 1970s . Hence, data about the performance of modern membranes in tca intoxication are limited . The potential benefit of modern means of renal replacement therapy was suggested in a report on haemodiafiltration after acute amitriptyline intoxication in which the patient showed an improved vigilance during treatment . As no amitriptyline blood concentrations recently, extended dialysis using an hco dialyser has been introduced to remove large quantities of free light chains in patients with multiple myeloma . These dialysers are characterized by a larger pore size, which allows enhanced middle molecule removal without substantial elimination of albumin . Myoglobin, accumulated in rhabdomyolysis as in one of our cases, is also dialysed by highly permeable membranes . So far, there are only anecdotal reports on the use of hco dialysers for the removal of toxins . We could show that even with an increase of the amitriptyline dialyser clearance using hco instead of high - flux dialysis, the estimated total eliminated amount of amitriptyline by hco dialysis remains low (<0.1% of the ingested dose) and therefore may not exceed 3% of the ingested dose per hco dialysis session, which is considered to be the lower threshold for dialysability according to extrip criteria . An additional factor influencing amitryptilin concentrations is concomitantly ingested drugs, especially those that are metabolized mainly via cyp2d6 . Although these drugs, especially pantoprazole in our cases, might have an effect on metabolization notwithstanding, the inherent limitation of only two reported patients, is an important shortcoming of this article . In summary, even the elevated amitriptyline clearance by hco membranes in the context of extended dialysis is unlikely to confer a clinical benefit, supporting a recent recommendation of extrip to refrain from any ectr in intoxication with tcas . As a finding unrelated to the topic of extracorporeal toxin removal, we could show that hco extended dialysis is very effective in lowering elevated myoglobin in rhabdomyolysis.
Malnutrition is one of the most important causes for improper physical and mental development of children . One in every five children in the developing world is malnourished, and poor nutrition is associated with half of all child deaths worldwide . Malnutrition in children causes an increase in morbidity and mortality and has an adverse effect on intellectual ability . Globally, acute malnutrition causes more than 50% of childhood mortality in children under 5 years old, which implies that about 3.5 million children die of malnutrition each year . Weight - for - height (wfh) index (figure 1), height - for - age (hfa) index, weight - for - age (wfa) index (figure 2), body mass index, and skin fold thickness are to be used more frequently in the field . In april 2006, the who released new global growth charts for infants and children as old as 5 years to replace the existing cdc / who international growth charts, which were based on the 1977 nchs growth charts . The worldwide malnutrition estimation rates indicate that 35.8% of preschool children in developing countries are underweight, 42.7% are stunted, and 9.2% are wasted . The increasing prevalence of childhood obesity has become a growing matter of public health concern worldwide . Obesity has increased from 4.2%, in 1990, to 6.7%, in 2010, worldwide and is expected to reach 9.1%, in 2020 [9, 10]. In iran, like many of the other developing countries, the prevalence of obesity in children has been moving on . According to a survey in west azerbaijan, 8.7%, 7.5%, and 4.3% of the children aged less than five years suffered from stunting, wasting, and underweight, respectively . The present study aimed at assessing the prevalence of malnutrition (underweight, stunting, wasting, overweight, and obesity) in under - five - year - old children in salmas district . The current study is a cross - sectional study which was conducted for assessing the nutritional status of children under 5 years old in salmas district on the basis of national guide and has been performed from 16 until 30 october, 2011, with the cooperation of the office of community nutrition improvement and the united nations children's fund (unicef). Using cluster sampling, the statistical population included 059-month - old children residing in the cities and villages of salmas and by ena software sample size was calculated with 5% confidence interval; 902 children were determined . In this study, children being mentally and physically retarded and having problems in terms of anthropometry were removed from the study and replaced by other children . For medical ethics, the parental consent form must be completed to conduct completed design . In this study, first, the total number of households residing in rural and urban areas and the total number of children between 059 months in salmas city were cumulatively calculated . Then, in the ena software items, in the planning part, the desired items were entered into sample size calculation as follows: the number of children under 5 years old: 19824 people, estimate of the prevalence number of malnutrition: 8.7, widespread confidence interval: 2.3, design effect: 1.5.after entering the above information, 841 were determined as the sample size and, with 5% confidence interval for a sample sufficiency, the number of children was calculated as 885 children and, finally, in the study, 902 questionnaires were completed . Given that it was supposed to study 18 children in each cluster, 50 clusters were determined for this study . Then, the ratio of urban and rural populations in salmas was calculated in this region; the urban population was 49% and the rural population was 51% . Therefore, 26 rural clusters and 24 urban clusters were determined and in the next stage the names of all villages and urban blocks were separately entered into the part of selecting clusters in ena software according to the number of clusters . The required data were collected through measuring the height and weight and arm circumference of the children in the study, completing the questionnaire and interviews with mothers or caregivers of children . The scale used in this study was a single pan balance with the maximum capacity of 150 kg and accuracy of 100 gr . If possible, the child was directly weighed . If the baby was too small or cried so hard, first, the mother was weighed alone and then hugged the child . The scale automatically calculated the weight of the child by subtracting . Also, every day before starting work, to ensure the accuracy of the scale, the scale was tested using the control scale . The height of less - than - two - year children was measured in a supine and larger children were measured in standing position with an accuracy of one tenth of millimeter . The middle of the left arm circumference in children from 6 to 59 months was measured using a special band of measuring arm circumference based on the following steps and was recorded in millimeters . Chi - square test was to be used for relationship independent variables (sex and region) with malnutrition . The number of children under 5 years old: 19824 people, estimate of the prevalence number of malnutrition: 8.7, widespread confidence interval: 2.3, this study was done on 902 children under 5 years old including 49.6% being boys and 50.4% being girls . Most children were in the age group of 1829 months (24.7%) and the lowest number was in the age group of 5459 months (8.8%) (table 1). Totally, the prevalence of malnutrition based on underweight, stunting, and wasting was estimated to be 2.3%, 7.3%, and 1.4% among children, respectively . The results of the study showed that underweight in girls and rural areas was more common . Malnutrition under height for age in girls and boys in rural areas was more than that of the urban areas; also, we found that wasting index was not different in both sex and area . Current study showed that prevalence of overweight and obesity in girls and rural areas was less than in boys and urban areas but this difference was not significant (table 3). The relationship between gender and region with malnutrition showed that there was no statistical difference between sex and underweight, wasting, and stunting, but stunting was more common in rural areas and this different was significant (p <0.001) (table 4). The graph of the normal distribution of height for age in studied children in salmas shows that distribution of height for age was skewed to left comparing with who standard (figure 3). The aim of the current study was to assess the nutritional status of under - five - year - old children in urban and rural areas in salmas district . The prevalence of malnutrition based on underweight, stunting, and wasting was estimated to be 2.3%, 7.3%, and 1.4% among children, respectively, in salmas district . In a study in west azerbaijan province by farrokh - eslamlou, prevalence of underweight, stunting, and wasting was estimated to be 4.3%, 8.7%, and 7.5%, respectively . In another study, by veghari, malnutrition was observed in 3.20%, 4.93%, and 5.13% based on underweight, stunting, and wasting, respectively . In another study in khorasan province northeast of iran the rate of underweight, stunting, and wasting was reported to be 7.5%, 12.5%, and 4.4%, respectively . According to the unicef report, 11%, 15%, and 5% of under - five - year - old iranian children suffer from underweight, stunting, and wasting up, respectively . Results of current study showed that underweight in girls and rural areas was common more which is consistent with other studies [7, 13]. Malnutrition based on height for age in both girls and boys in rural areas was more than urban areas which is due to the poor economic status, cultural status, income level, food behavior, and less health care in rural areas that are known as the risk factor for malnutrition . Our findings show that there was no statistical difference between sex and underweight, wasting, and stunting, but we found statistically significant differences between stunting and region where stunting was more common in rural areas which is consistent with previous studies in iran and stunting is still highly prevalent in underdeveloped and developing countries . In current study, the prevalence of overweight and obesity is increasing worldwide and has become a public health challenge [10, 15]. The tracking of childhood overweight and associated health consequences into adulthood is of concern; several serious physical conditions are associated with overweight, especially obesity, among children including asthma, sleep problems, cardiovascular diseases, and type 2 diabetes . Prevalence of obesity and overweight in boys and urban areas was more than girls and rural areas but this difference was not significant . In this area, stunting, overweight, and obesity are the most important priorities that health officials must pay more attention to . Given the differences between various provinces and regions of the country which are a result of the differences between the levels of development in these areas, the necessity of designing and implementing targeted strategies it is worth noting that the present study has been conducted in a single period and in only one city of each province and using ena software; therefore, the judgment about the whole province requires general investigation in all cites of the province and the obtained results are solely applied to these three cities . This study, also, showed that the ena software has a special ability to determine the samples and clusters and is a simple, rapid, and accurate method, especially in epidemiological studies compared to other methods that were used in studies in our country which can be a convenient tool and its use is suggested for the same studies . Also, the quality control of the performed activities by the teams in the field is another distinctive feature of this software which is considered of high importance and emphasizes the use of this software.
Alzheimer's disease (ad) is a form of dementia affecting 26.6 million people worldwide as of 2006; a figure predicted to quadruple by 2050 . It manifests clinically with progressive cognitive impairment that can be divided into a predementia phase and mild, moderate, and severe dementia phases which are increasingly accompanied by noncognitive and neurological disturbances . There has been much work investigating the pathogenesis of ad which has resulted in several key findings allowing formation of several hypotheses . The most well - regarded theories as to the pathology underlying the degeneration of neurons in the brain are the formation of extracellular senile plaques (sps) via amyloid - beta (a) deposition and formation of intracellular neurofibrillary tangles (nfts) via hyperphosphorylation of tau protein . Indeed the presence of sps and nfts remain the mandatory pathological findings to make a definitive diagnosis, a stipulation that has not changed since they were first described in 1906 by alois alzheimer . The exact mechanisms as to how a deposition and nft formation cause neurotoxicity and neuronal loss remain unclear although several factors have been postulated . These include increased oxidative stress by production of reactive oxygen species by a [7, 8], increased oxidative stress mediated by metal ions within a, and interaction of a peptides with the n - methyl - d - aspartate (nmda) receptor resulting in neurotoxicity . In fact, to go back a step in the pathogenesis of ad, it is also not clear what causes the aggregation of a as amyloid plaques; however, there is much evidence that it involves the dyshomeostasis of metal ions . A is known to precipitate out in the presence of primarily zinc but also copper and iron ions due to a high - affinity metal - binding site, and occupation of this binding site has been shown to prevent the formation of a from app by inhibiting the initial cleavage of app by -secretase . The relevance to ad is clear in that pathology only seems to occur when a precipitates out and forms plaques . Many studies have demonstrated that a plaques contain high levels of zinc and copper [23, 24]. The potential significance of zinc in the aetiology of a formation and therefore ad is underscored by the fact that the a plaque load experienced by app transgenic mice is attenuated by crossing with mice that lack a zinc transporter and are thus unable to transport zinc into synaptic vesicles . In the same vein, it is also worth noting that a plaques are concentrated in the most zinc - rich area of the brain, the hippocampus, and levels of hippocampal zinc have been shown to be higher in ad brains than age - matched controls . Much of the insight we have gained with regards a and tau pathology has been obtained from specific genetic mutations that account for a subset of ad (approximately 1% of the disease as a whole) which is inherited in an autosomal dominant manner . There are three genes that have been identified that cause familial ad (fad). So far, twenty different mutations affecting the app gene causing fad have been defined . The two other locations of fad mutations are presenilin 1 (ps1) on chromosome 14 [32, 33] and presenilin 2 (ps2) on chromosome 1 [34, 35]. Although much progress has been made in our understanding of ad, this has not as yet been translated into either effective treatments or, crucially, an earlier or more accurate diagnosis . Currently, a firm diagnosis of ad requires histological analysis of central nervous system (cns) tissue to find the pathological changes described above and is thus a postmortem one . Making a clinical, premortem diagnosis relies on assessment of cognitive impairment and memory loss and has been reported to be inaccurate in 1015% of cases, presumably due in part to the similarity of symptoms to other diseases such as depression and other forms of dementia . In addition, a clinical diagnosis is less than ideal because, firstly, it is difficult in the early stages to distinguish ad from normal ageing effects and, secondly, the ability to detect cognitive impairment implies a significant amount of damage has occurred already, making possible treatments less likely to be effective . These problems have led to significant efforts in identifying biomarkers that could be used to diagnose and monitor ad . There has been some promise in using magnetic resonance imaging (mri) to determine differential patterns of brain atrophy as well as using positron emission tomography (pet) scanning to detect labelled a plaques . Other studies have shown that ad patients have higher levels of tau protein and lower levels of a42 in their cerebrospinal fluid (csf) [3841]. As worthy as these efforts are, they are not yet accurate enough to be useful for diagnosis with, for example, the use of mri to detect atrophy only able to differentiate from normal subjects in 85% of cases [37, 42, 43], which is not an improvement on clinical diagnosis . There is also the not inconsiderable cost of these techniques to consider, especially in the context of the prevalent nature of ad, as well as the difficulties of compliance in this group of patients . Although reluctant to quote a clich that has been adapted by the scientific community from an even more hackneyed phrase, it is true that the eye can be considered a window to the brain . The retina exists as an extension of the cns, and, thanks to its purpose of receiving light and translating into vision, it is optically transparent . Changes that occur in the retina can be visualised noninvasively and directly with increasingly sophisticated imaging techniques . As impressive as noninvasively detecting labelled a plaques with pet imaging is, it is a far cry from the ability to detect changes in single neurons as is now possible in the eye [4447]. Historically, the visual symptoms that have long been reported in ad patients (see later) have been attributed to neuronal damage to the visual pathways in the brain rather than the retina [48, 49]; however, there is increasing evidence that the specific pathological findings in the brain occur in the retina also, both in ad patients and transgenic ad animal models . Various different aspects of vision have been reported to be affected in ad since cogan's findings in 1985 . These include abnormalities in visual acuity, [50, 51], contrast sensitivity [52, 72], colour vision [54, 55], and motion perception [73, 74]. As would be expected, the majority of the changes that have been observed in ad eyes are in the retina . Cross - sectional imaging of the retina using optical coherence tomography (oct) has demonstrated in various studies that ad is associated with thinning of the peripapillary retinal nerve fibre layer (rnfl) [6264] with the loss occurring superiorly initially . These in vivo findings correspond with the predominantly inferior visual field loss experienced by ad patients and are corroborated by histopathological findings of reduced number of rgcs and axonal degeneration in postmortem ad retinas [7577]. In vivo imaging has also suggested a correlation of ad severity and reduced thickness of the rnfl (presumably due to loss of rgcs and axonal degeneration) at the macula as well as a decrease in rnfl thickness and neuroretinal rim of the optic nerve head . In vivo doppler imaging techniques have demonstrated a decrease in retinal blood flow analogous to cerebral blood abnormalities demonstrated in ad, although whether this is a primary phenomenon or simply a consequence of a thinned retina is hard to say . Changes in pattern electroretinograms (perg) and visual evoked potentials (veps) have been noted in ad patients [6668] with specific changes being correlated with rnfl thickness . App and a immunoreactivity has been detected in an age - dependent manner in the retinas of ad patients, and, even more excitingly (in terms of finding a retinal biomarker for ad), a plaques have been demonstrated as a postmortem finding in the retinas of ad patients . A comprehensive review has been published on this topic elsewhere . Ad patients have been noted to suffer from a particular type of cataract, namely, equatorial supranuclear, with a deposition localised to the opacities . Similar cataracts have been noted in down's syndrome subjects, further supporting deposition of a in the lens as the cause . This raises the intriguing possibility that one could detect a in the lens as a screening tool for ad although clearly this would require the changes in the lens preceding the symptoms of ad which has not as yet been proven . It would be interesting indeed if an ocular biomarker was found for ad that is not connected to the cns . A summary of these visual pathway signs and symptoms that have been described in ad patients is presented in table 2 . These findings make a compelling case to investigate ocular manifestations of ad further, and, for the remainder of this paper, we shall look at what has been discovered using animal models of ad . Fad accounts for less than 1% of ad cases [83, 84] and has been shown to be due to the three genes mentioned above (app, ps1, and ps2) inherited in an autosomal dominant manner . Their relatively small contribution to the ad burden as a whole is inversely proportional to the amount of information we have gleaned from them, both in terms of forming and confirming hypotheses about the pathogenesis, and providing animal models . The use of animal models in investigating any disease process is important as they provide a way of standardising the disease among subjects and can be experimented on in ways that are simply not possible in human subjects . Most of the animal models of ad are mice as, firstly, they are mammals and therefore have a similar cns structure to humans, and, secondly, it is relatively easy and inexpensive to produce transgenic strains expressing one or more of the elucidated genes . Currently, transgenic mice come in three varieties: single, double, or triple transgenic simply referring to the number of genes they express . The earliest mice models were single transgenic which increased a by increasing app via a mutant app gene . Early examples include the pdapp mice which express an fad mutation containing a valine residue substitution at position 717 using a platelet - derived growth factor- promoter and the tg2576 mice which express a different fad mutation characterised from a swedish family of fad sufferers (k670n / m671l) using a hamster prion promoter . Both these lines expressing different fad - associated mutations and various others that have been designed since [8789] have shown amyloid deposition and glial activation that increases with age [86, 90] and overall have been successful in mimicking these neuropathological aspects of ad as well as cognitive deficits . Although these different models do show significant similarities across different studies, there are differences such as timing of onset of the amyloid plaques which is presumably explained by the different host strains, different promoters, and different specific mutations of each model . App mutations account for only a small proportion of fad, and mice expressing fad mutations of ps1 and ps2 have also been created . Transgenic mice containing either fad ps1 or ps2 mutations show elevated levels of the relatively amyloidogenic a42; however, these lines do not go on to develop plaques [92, 93], a finding that can be explained by the fact that mice and rats lack two histidines that make up the a metal binding site [20, 94, 95] and highlight further the potential importance of zinc dyshomeostasis mentioned earlier . A natural follow on from this is to create double transgenic mice containing both app and ps1 or ps2 mutations . Various combinations have been created and investigated, and, in general, the addition of a ps1 or ps2 mutant gene to the app mutant gene accelerates the rate of amyloid deposition and plaque formation [9699]. A triple transgenic mouse model was created in 2003 containing app, ps1, as well as tau transgenes which successfully recapitulated the amyloidogenic as well as the nft features of ad with the mice developing amyloid plaques as well as nfts . More recently, rat models using the same principles have been established that show similar rates of amyloid deposition [101103] and have the theoretical advantage that behavioural studies will be more achievable than in mice . Other avenues explored in rodent models are over expressing endogenous app, knockout mice, mutations in beta, gamma, and alpha secretase, apoe, however, it is beyond the remit of this paper to describe all these in detail and the reader is directed toward a database of ad animal models kept by the alzheimer research forum at http://www.alzforum.org/res/com/tra and two comprehensive reviews on ad animal models from spires and hyman and from duyckaerts et al . Worth briefly mentioning are nonrodent models of ad which, while having the obvious disadvantage of being so phylogenetically distinct from humans, have the advantages that they are easier, cheaper, and quicker to perform experiments on . The drosophila fruit fly contains a homolog of app and presenilin as does the nematode ceanorhabditis elegans [107, 108]. Overexpression of these endogenous proteins as well as transgenic expression of human mutant app, ps, and tau genes in these species has certainly contributed to this field however not to the same extent as their rodent counterparts . The remainder of this paper will focus on what we have learnt specifically from the eyes of these animal models . Several studies using transgenic ad mouse models have demonstrated the presence of a in the retina . One study by liu and colleagues used the previously described single transgenic tg2576 mouse model which contains the app double swedish mutation and shows an age - dependent deposition of extracellular a and amyloid plaques in the cerebellum, hippocampus, and cortex as well as displaying cognitive deficits . In this study, they demonstrated extracellular a immunoreactivity and plaque like formation using four different monoclonal antibodies as well as congo red staining in tg2576 retinas . The a deposition occurred predominantly from the ganglion cell layer to the outer nuclear level with plaques even found in the photoreceptor layer and optic nerve head . Another study that utilised the tg2576 mouse model was less successful however in detecting a deposition . Here, a immunoreactivity was tested using the a monoclonal mouse antibody 1e8 and was only found in the retinal periphery with no plaque like structures detected . Of relevance is the fact that, in the same study, plaque - like structures were found in the cerebral cortex of the same animals using the same antibody . Also interesting to note is that the differences in the studies cannot be explained by a disparity in age of the animals as liu et al . Retinal a deposition has also been found in double and triple transgenic mouse models expressing app and ps mutations . One study used two different strains of app / ps mice . In the first strain which contained mutant human app and ps1 genes (tg2576 tg1), they found that extracellular a deposition, as determined by immunoreactivity to a monoclonal mouse a antibody, was present predominantly in the nerve fibre layer and ganglion cell layer in animals aged 27 months but not at the younger age of 7.8 months . In the second strain containing the same app mutant gene but with a different ps1 gene (appswe / ps1e9), there was a similar pattern of a immunoreactivity predominantly in the nerve fibre and ganglion cell layer although these animals were at an intermediate age of 10.5 months . This second strain (appswe / ps1e9) has been used in two subsequent studies facilitating a comparison of sorts . In one of these studies by perez and colleagues, a plaques, as determined by thioflavin - s and confirmed with immunostaining, were found from 12 months old but predominantly in the inner and outer plexiform layers with far fewer plaques present in the gcl, inl, and onl . Another study utilising the same mouse model is from dutescu and colleagues . In this study, moderate a deposition was detected in the gcl, ipl, inl and opl in 9-month - old mice . Overall these results seem rather inconclusive; however, the lack of a plaques found in ning and dutescu's work is potentially explained by the fact that they were looking at an earlier time point than the earliest point at which plaques were detected (12 months) in perez' study . One study has further characterised that the relatively amyloidogenic form of a, a42, is deposited in the gcl, inl, and onl of app single transgenic and app / ps1 double transgenic mice . Recent studies using a triple transgenic mouse model expressing app, ps1, and tau mutations have also demonstrated increased a deposition across the retina, particularly in the gcl and the inner segments of photoreceptor [47, 115]. A particularly exciting finding is that, in double transgenic mice (appswe / ps1e9), retinal a plaques can be stained with curcumin and imaged safely in vivo . In the same study, they demonstrated that the retinal plaques detected ex vivo occurred prior to plaques in the brain . This is hugely relevant as it suggests that retinal changes could potentially be used to make a diagnosis of ad, noninvasively, prior to even the current gold standard of postmortem histological analysis . A has also been detected in the retinal and choroidal vasculature of animal models in keeping with the corollary in the brain; cerebral amyloid angiopathy [110, 116, 117]. In 27-month - old double transgenic mice (tg2576 tg1), a immunoreactivity was detected in both retinal and choroidal microvasculature which was not present in younger (7.8 months) animals . At an intermediate age (10.5 months) a immunoreactivity was present in the choroidal vasculature only . It should be noted that the intermediate aged animals, although double transgenic for app and ps1 as with the 7.8- and 27-month old animals, contained different mutations . Another study using tg2576 single transgenic mice detected a deposition in retinal capillaries of 14-month - old mice . Interestingly, administration of amyloid peptide vaccinations increased this vascular deposition despite decreasing the extracellular plaques which mirrors what occurs in brains of mice models and supports the theory that immunotherapy solubilises a allowing it to drain via the vascular system . As one would expected app has been detected in the retina of the same animals that exhibit a deposition . In single transgenic tg2576 mice which overexpress app, liu et al . This was corroborated in a separate study using the same animals of a similar age . In double transgenic mice (tg2576 tg1), app was likewise detected in the gcl and inl of 27-month - old animals although was not present in younger, 7.8-month - old, mice . Unlike the tg2576 single transgenic mice, app was detected to a small degree in the rpe and photoreceptors . In the same study, a different double transgenic strain (appswe / ps1e9) exhibited app immunoreactivity only in the gcl at an intermediate age of 10.5 months . The same animal model in a different study showed moderate app staining in the ipl and opl in 9-month - old animals . App immunoreactivity has also been detected in the retina of a double transgenic mouse model containing the swedish app mutation and a ps1 knock in, although this study did not clarify in which layers this was confined to . The hyperphosphorylation of the microtubule - associated protein tau and subsequent deposition as neurofilbrillary tangles is associated with various neurodegenerative disorders (collectively called tauopathies) such as progressive supranuclear palsy, frontotemporal dementia, and parkinsonism linked to chromosome 17 and ad [120, 121]. Tau inclusions have been observed in the brains of ad transgenic mice [100, 122, 123] and appear to be a feature of the ad retina as well . In single transgenic tg2576 mice overexpressing app, hyperphosphorylated tau was detected using the at8 antibody adjacent to the a deposition from the gcl through to the onl . A different mouse model that expresses the human p301s tau transgene and develops tau inclusions throughout the central nervous system is used as a model for tauopathies rather than specifically ad . In this transgenic line, hyperphosphorylated tau was found in the rnfl which progressed to tau inclusions in the gcl with associated deleterious effects on axonal growth . Activated microglia and astrocytes are thought to initiate neuroinflammation in ad and have been shown to be upregulated in the brains of mouse models of ad [125, 126]. It is then relatively unsurprising that significant upregulation of inflammation has been detected in the retinas of ad mouse models . In tg2576 single transgenic mice, there was increased activation of astrocytes and microglia in all layers of the retina compared to wild - type controls as detected using cell - specific markers gfap for astrocytes and iba1 for microglia . Immunisation with amyloid peptide vaccinations in the same study led to increased neuroinflammation in the retina in accordance with similar findings in the brains of ad mouse models . In double transgenic mice (appswe / ps1e9), microglial activation was significantly higher than in age - matched controls as detected using a macrophage marker f4/80 . The same study used gfap to look for astrocytic activation and found that there was no measurable upregulation . In the same double transgenic model aged 10.5 months, another study found that monocyte chemotactic protein (mcp) 1, a relatively nonspecific marker of inflammation was increased in the gcl (the same area as a deposition was occurring) compared with wild - type controls although f4/80 immunoreactivity was not significantly different . A different double transgenic model (tg2576 tg1) in the same study found that, at a younger age, f4/80 and mcp-1 immunoreactivity was significantly less than at a higher age of 27 months leading them to conclude that this was due to progression of ad and that the mcp-1 but not f4/80 immunoreactivity in the intermediate aged mice represented a relatively early stage of inflammation prior to microglial activation . While this may well be true, the lack of a wild - type control at the young and old ages makes it hard to be sure that this is not merely an ageing effect independent of ad . Another finding that suggests an important role of neuroinflammation in the propagation of ad and indeed other neurodegenerative disorders is a consistent downregulation of complement factor h (cfh) in ad brain . Cfh is a cofactor that acts to suppress the alternative complement pathway; hence, low levels of cfh have a proinflammatory effect . One paper evaluated the presence of cfh and a40 and a42 peptides in the brains and retinas of several different transgenic ad mouse models (tg2576, psapp, 3 tg - ad, and 5 fad) and found that there was a consistent inverse correlation between levels of a and cfh in the retinas of these transgenics suggesting that an environment promoting complement activation is a feature of ad retinas . Interestingly, cfh has also been implicated in the pathogenesis of amd, another neurodegenerative disease affecting the retina suggesting, perhaps, a similar contribution of neuroinflammation to these diseases . Zinc has been shown to cause aggregation of cfh monomers which, combined with the high levels of cfh and zinc that are found in the sub - rpe deposits (drusen) that characterise this disease, suggest a critical role for zinc analogous to the one it is postulated to play in ad . Unfortunately, to the best of our knowledge, there is no research that has looked at levels of zinc in the retina of ad animal models . In common with other neurodegenerative diseases, cell death and loss of neurons is an end stage of ad . In double transgenic mice (tg2576 tg1), a significant increase in apoptosing cells in the gcl of 27-month - old animals compared with 7.8 month old animals was detected using terminal deoxynucleotidyl transferase mediated dutp nick end labeling assay (tunel). The same study also found an increase in tunel - positive cells in the gcl of a different double transgenic model (appswe / ps1e9) compared with age - matched controls . In single transgenic tg2576 mice, using retinal thickness as a measure of neuronal loss, a reduced thickness was detected compared with wild - type controls . In addition, administration of amyloid peptide vaccinations attenuated the reduction of retinal thickness in conjunction with a reduction of a deposition in these animals . Using tunel to look at nmda - induced apoptosis in app and ps1 single transgenic mice and app / ps1 double transgenic mice has yielded potential insight into how a may cause retinal degeneration . In this study, app and app / ps1 transgenic mice displayed fewer tunel - positive cells in the gcl following injection of nmda than wild - type controls suggesting that deposition of a may prevent activation of nmda - receptor pathways and mediate retinal dysfunction in ad in this way . In the same study, however, there was no detected difference in rgc number or inl thickness (obviously a relatively crude measure of neuronal loss) between the app overexpressing single transgenic mice, app / ps1 double transgenic, and ps1 knockin mice and their wild - type controls . This is clearly at odds with other studies and may represent a difference in the strains used as well as less sensitive methods of counting cells . A relatively recent development now allows direct visualisation of apoptosing ganglion cells in the retina . Using a fluorophore labelled annexin v protein as a marker of apoptosis and confocal laser scanning ophthalmoscopy to detect the fluorescence, it is possible to image single apoptosing ganglion cells in real time and in vivo [44, 46]. This technique has been refined and used to visualise apoptosing (labelled with annexin v) and necrosing (labelled with propidium iodide (pi)) cells in a triple transgenic mouse model of ad . In this study, the triple transgenic mice displayed increased rgc apoptosis and decreased rgc necrosis compared with wild - type controls . For obvious and very sensible reasons, the retina has been the target of most of the research looking at ad in the eye . It has though been established that the lenses of ad patients, as mentioned earlier, contain a aggregates that colocalise with a specific type (equatorial supranuclear) of cataract . This appears to be similarly manifested in ad mouse models with the epithelial cells of the corneas and lenses of single transgenic tg2576 mice and double transgenic app / ps1 mice, being immunopositive for app and a . The idea of using the retina as a means of diagnosing or measuring progression of ad or any other neurodegenerative disease is an inherently attractive one for the reasons outlined above, and the studies discussed here provide much to be optimistic about . Perhaps one of the main advantages of using the retina is the ability to noninvasively look directly at the nervous system . Much of the evidence discussed above shows that changes in the retina occur later than in the brain . The single transgenic tg2576 mouse model has been shown to develop a plaques in the brain at 9 months, while similar changes occur in the retina at 14 months [109, 111]. There is a similar pattern when looking at double transgenic mouse models with the tg2576 tg1 model showing increased levels of a40 and a42 in the brain by 3 - 4 months while not being raised in the retina of 7.8-month - old animals . However, a recent study looking at double transgenic mice has shown very clearly that a plaques appear earlier in the retina than in the brain by examining the same animals over time and, further, that they can be imaged noninvasively at this early stage . This finding raises the profile of the retina as a potential source of an earlier diagnosis in ad although it remains to be seen whether this finding is replicated in other studies and in human subjects . As discussed earlier, the role of zinc in the formation of a plaques appears to be significant and the fact that the retina is a particularly zinc - rich tissue bodes well for any plaque pathology being detectable relatively early in the disease . The rationale for investigating the retina is that, as an extension of the cns, it is reasonable to expect to find similar changes as occur in the brain . A side effect of this research, however, has been the finding that a deposition occurs in the lenses of ad subjects and has been found in lenses and corneas of single and double transgenic animal models . A deposition and hyperphosphorylated tau have also been detected in the lenses and corneas of triple transgenic mice raising the slightly unexpected but equally welcome possibility that an ocular biomarker for ad may exist that is not connected with the cns . Firstly, a plaques have only been detected in human ad subjects in one study, and it is this same study that provides the only evidence that retinal pathology precedes brain pathology; both findings that need to be corroborated . Secondly, there appears to be significant crossover of ad with other causes of neurodegeneration . Glaucoma, for example, is a neurodegenerative disease that results in loss of rgcs and manifests with rnfl thinning and visual field defects (i.e, . Similar findings as those described for ad patients), that have been reported as having a higher incidence in ad . It is possible that the changes thus far reported in the eyes of ad patients and animal models are not as specific for ad as we might hope . Thirdly, putting aside the question as to whether changes in the eye precede those of the brain, it is suggested that cognitive deficits of ad may come before detectable amyloid pathology in the brain meaning that a holy grail of detecting ad before its symptoms manifest (implying significant loss of neurons) by detecting amyloid plaques may not be possible . Nevertheless, as an absolute minimum, the ability to image the retina (and rest of the eye) noninvasively and relatively cheaply and quickly cannot but massively aid in assessing possible treatment effects of anti - ad, therapies as well as improve our knowledge of the underlying mechanisms of this and other forms of neurodegeneration . In common with ad there is much evidence linking zinc dyshomeostasis with the onset of amd, the leading cause of blindness in the developed world, with large amounts of zinc found in drusen . An apparent contradiction is that zinc supplements (presumably in their antioxidant role) have been shown to be beneficial in the nonneovascular type of amd (so called dry amd). This is putatively explained in a review by nan et al . By the fact that, as mentioned above, zinc causes aggregation of cfh . The high concentration of zinc found in drusen leads to a localised aggregation of cfh causing the sustained inflammatory response necessary for initiation of the disease . Later in the disease, the tissue surrounding the zinc - rich drusen is relatively zinc depleted and hence supplementation is beneficial . This is a typical example of the commonalities between different neurodegenerative diseases and highlights how research into one area is likely to benefit in others . Overall, the research looking at manifestations of ad in the eyes of animal models is notable by its paucity and it is difficult at this early stage to draw any firm conclusions other than that this is an extremely promising area of investigation and certainly warrants further research.
The accumulation of glycochenodeoxycholic (gcdc) acid in obstructive jaundice patients is cytotoxic, can harm hepatocytes, and impairs liver function [1, 2]. Gcdc acid is a primary biliary acid directly divided from cholesterol in hepatocytes and conjugated with amino acid glycyne or taurin and becomes a conjugate of glycine or taurin [3, 4]. Gcdc acid, as a dose dependent inductor of apoptosis in hepatocyte and kinase protein c, can be used as a parameter of pathological apoptosis of hepatocyte and impaired liver function . Several methods can be used to measure biliary acid level in the body fluid (serum or biliary fluid). Enzyme immunoassay method, which is mostly used to measure the total level of biliary acid, cannot be applied to measure primary, secondary, and tertiary biliary acid distinctively . Several animal studies have shown that high performance liquid chromatography (hplc) can measure gcdc acid serum faster and precisely . This study measures the gcdc acid serum in severe obstructive jaundice patients through biliary tract decompression models, using muraca and ghoos modified methods . This study was performed on obstructive jaundice patients, mostly due to periampullary tumor, with serum bilirubin above 10 mg / dl, who were admitted in the period from december 2007 to january 2009 . Patients with active hepatitis a, b, or c, liver malignancy, severe liver impairment with massive ascites, past experience of decompression procedure, and chronic liver failure were excluded . We used conventional open cholecystectomy as the bile decompression model to provide changes of gcdc acid level . Principle for quantifying conjugates of primary biliary acid (glycochenodeoxycholic, taurochenodeoxycholic, glycodeoxycholic, taurodeoxycholic acid), in the sample serum extracted by solid phase extraction (spe) using sepak c-18 column, with methanol solution after being mixed with the base naoh . The extract was concentrated using the n2 gas evaporation method, then set by high performance liquid chromatography using analytical column c18 with eluated mixture of methanol - phosphate buffer solution ph 4.5 (75: 25). The result of eluated separation is detected using ultra violet beam with the wave length of 205 nm . Gcdc acid level was set using the calibration curve, as a regression line between the chromatographed areas versus standard level of gcdc acid . High performance liquid chromatography tool is made using waters alliance 2695 separation module system, waters 2487 dual wave length, absorbance detector, with auto sampler, degasser and empower software . Separation of sample was done in an atlantis c18 5 m 3.9 150 mm analytical column, protected by sentry guard symmetry c18 5 m 3.9 20 mm guard column, using one set of vacuum filtration from millipore, spe extractor from jt baker, evaporization tool of n2 gas with water bath 40c . Test sample: spike sample is gcdc acid standard on model serum and serum sample from cholestasis patients . Chemical material test: sodium gcdc (sigma - aldrich pte.ltd, product no . G0759 1 g); glycodeoxycholic acid (sigma - aldrich pte.ltd, product no . 9910 1 g); methanol (e merck, hplc grade), acetone; kh2po4, and h3po4 (e merck); membrane filter (whatman, pore size 0.45 m); sepak spe column, c-18, (waters associate, cat . Wat 049010), and bond elute lrc - c18 (varian, spe column). (1)set the lod and loq of gcdc acid standard solution. (a)produce the primary standard solution (std.p) and working standard solution (std.w) glycochenodeoxycholic acid and glycodeoxycholic acid on methanol . (b)produce the primary standard solution (std.p) and the working standard solution (std.w) gcdc acid on the serum (spike sample-1). (b.1) make the std.p - gcdc acid solution on the serum, measure carefully 200 l of std.pthe gcdc acid solution on methanol, add the model serum up to 2 ml (level 200 g / ml). (b.2) make the std.w - gcdc acid solution on the serum, measure carefully 200 l of std.p - gcdc acid solution on the serum (1.3), then add the model serum up to level: 1; 5; 10; 25; 50; 100 g / ml . (c)extraction procedure with solid phase extraction (spe). (c.1) to 1.0 ml of serum (sample or model) add 0.5 ml of gcdc solution (standard) and 7.5 ml mixed solution of mobile phase solution0.2 m naoh (6: 8, v / v), then mix it until homogenous. (c.2) add the sample to the spe c-18 column that already activated with flowing methanol and water, respectively . Then rinse the sample with flowing 10.0 ml of water, 3.0 ml of acetone solution 10% on the water, and 10.0 ml of water, respectively . The solution speed is 10 ml / min. (c.3) the sample then extracted with 2.0 ml methanol . The eluat result then evaporized with n2 gas flow on 37c. (c.4) the residual then dissolved back to 0.5 ml mobile phase with vortex mixer for 30 seconds, then 10 l of that solution is injected to hplc . The chromatography system: the analytical column use the atlantis c18 5 m 3.9 150 mm, protected by sentry guard symmetry c18 5 m 3.9 20 mm guardcolumn . The mobile phase consisted of a mixed solution methanol a phosphate buffer solution contained 2.5 kh2po4 and 20 mm naoh with ph 4.5, regulated by h3po4 85% (75: 25). Flow speed: 1.0 ml / min, and detected by ultra violeton the wave length of 205 nm . Width area of the chromatogram is integrated electronically (empower software) (figure 2). (e)the lod estimation based on the issued level of s / n> 3, and the loq estimation based on the issued level of s / n> 10 . Calibration curve made of the spike samples (on serum) with range level: 0.5; 1.0; 5.0; 10.0; 25.0; 50.0; 100.0 g / ml . Set the linearity of calibration curve / regression line. (3)set the precision (coefficient of variation) and accuracy of the setting method . Produce the primary standard solution (std.p) and working standard solution (std.w) glycochenodeoxycholic acid and glycodeoxycholic acid on methanol . (b)produce the primary standard solution (std.p) and the working standard solution (std.w) gcdc acid on the serum (spike sample-1). (b.1) make the std.p - gcdc acid solution on the serum, measure carefully 200 l of std.pthe gcdc acid solution on methanol, add the model serum up to 2 ml (level 200 g / ml). (b.2) make the std.w - gcdc acid solution on the serum, measure carefully 200 l of std.p - gcdc acid solution on the serum (1.3), then add the model serum up to level: 1; 5; 10; 25; 50; 100 g / ml . (c)extraction procedure with solid phase extraction (spe). (c.1) to 1.0 ml of serum (sample or model) add 0.5 ml of gcdc solution (standard) and 7.5 ml mixed solution of mobile phase solution0.2 m naoh (6: 8, v / v), then mix it until homogenous. (c.2) add the sample to the spe c-18 column that already activated with flowing methanol and water, respectively . Then rinse the sample with flowing 10.0 ml of water, 3.0 ml of acetone solution 10% on the water, and 10.0 ml of water, respectively the solution speed is 10 ml / min. (c.3) the sample then extracted with 2.0 ml methanol . The eluat result then evaporized with n2 gas flow on 37c. (c.4) the residual then dissolved back to 0.5 ml mobile phase with vortex mixer for 30 seconds, then 10 l of that solution is injected to hplc . The chromatography system: the analytical column use the atlantis c18 5 m 3.9 150 mm, protected by sentry guard symmetry c18 5 m 3.9 20 mm guardcolumn . The mobile phase consisted of a mixed solution methanol a phosphate buffer solution contained 2.5 kh2po4 and 20 mm naoh with ph 4.5, regulated by h3po4 85% (75: 25). Flow speed: 1.0 ml / min, and detected by ultra violeton the wave length of 205 nm . Width area of the chromatogram is integrated electronically (empower software) (figure 2). (e)the lod estimation based on the issued level of s / n> 3, and the loq estimation based on the issued level of s / n> 10 . Produce the primary standard solution (std.p) and the working standard solution (std.w) gcdc acid on the serum (spike sample-1). (b.1) make the std.p - gcdc acid solution on the serum, measure carefully 200 l of std.pthe gcdc acid solution on methanol, add the model serum up to 2 ml (level 200 g / ml). (b.2) make the std.w - gcdc acid solution on the serum, measure carefully 200 l of std.p - gcdc acid solution on the serum (1.3), then add the model serum up to level: 1; 5; 10; 25; 50; 100 g / ml . Make the std.p - gcdc acid solution on the serum, measure carefully 200 l of std.pthe gcdc acid solution on methanol, add the model serum up to 2 ml (level 200 g / ml). Make the std.w - gcdc acid solution on the serum, measure carefully 200 l of std.p - gcdc acid solution on the serum (1.3), then add the model serum up to level: 1; 5; 10; 25; 50; 100 g / ml . (c.1) to 1.0 ml of serum (sample or model) add 0.5 ml of gcdc solution (standard) and 7.5 ml mixed solution of mobile phase solution0.2 m naoh (6: 8, v / v), then mix it until homogenous. (c.2) add the sample to the spe c-18 column that already activated with flowing methanol and water, respectively . Then rinse the sample with flowing 10.0 ml of water, 3.0 ml of acetone solution 10% on the water, and 10.0 ml of water, respectively the solution speed is 10 ml / min. (c.3) the sample then extracted with 2.0 ml methanol . The eluat result then evaporized with n2 gas flow on 37c. (c.4) the residual then dissolved back to 0.5 ml mobile phase with vortex mixer for 30 seconds, then 10 l of that solution is injected to hplc . To 1.0 ml of serum (sample or model) add 0.5 ml of gcdc solution (standard) and 7.5 ml mixed solution of mobile phase solution0.2 m naoh (6: 8, v / v), then mix it until homogenous . Add the sample to the spe c-18 column that already activated with flowing methanol and water, respectively . Then rinse the sample with flowing 10.0 ml of water, 3.0 ml of acetone solution 10% on the water, and 10.0 ml of water, respectively . The residual then dissolved back to 0.5 ml mobile phase with vortex mixer for 30 seconds, then 10 l of that solution is injected to hplc . Setting by the high performance liquid chromatography (hplc). The chromatography system: the analytical column use the atlantis c18 5 m 3.9 150 mm, protected by sentry guard symmetry c18 5 m 3.9 20 mm guardcolumn . The mobile phase consisted of a mixed solution methanol a phosphate buffer solution contained 2.5 kh2po4 and 20 mm naoh with ph 4.5, regulated by h3po4 85% (75: 25). Flow speed: 1.0 ml / min, and detected by ultra violeton the wave length of 205 nm . Width area of the chromatogram is integrated electronically (empower software) (figure 2). The lod estimation based on the issued level of s / n> 3, and the loq estimation based on the issued level of s / n> 10 . Calibration curve made of the spike samples (on serum) with range level: 0.5; 1.0; 5.0; 10.0; 25.0; 50.0; 100.0 g / ml . Set the linearity of calibration curve / regression line . Set the precision (coefficient of variation) and accuracy of the setting method . The extraction sample test 1.2 (serum) is suited with the extraction procedure used in the setting of the validation method (point a no . 2).the sample test level with hplc according to the procedure was set using the validation setting (point a no . 3).the calibration curve was set in each sample test setting . The extraction sample test 1.2 (serum) is suited with the extraction procedure used in the setting of the validation method (point a no . The sample test level with hplc according to the procedure was set using the validation setting (point a no . This study, which was performed on patients with characteristics mentioned in table 2, succeeded in quantifying the level of gcdc and glycodeoxycholic (gdc) acid in the serum of severe obstructive jaundice patients using the modified methods from muraca and ghoos . The chromatography method that is mostly used is high performance liquid chromatography (hplc) with ultra violet (uv) detector or spectromass . Because the gcdc acid is a very polar molecule, the extraction or isolation of this molecule needs to use solid - liquid extraction technique . The modification was also done on the chromatography system, which is an alternative to the degree of acidity on the mobile phase to 4.5 and using a more sensitive analytical homogenous column (c18). With these modifications, the gcdc acid and glycodeoxycholic acid separation resulted in a better resolution and a sharp chromatogram peak . This modification method can be used to quantify the gcdc acid and glycodeoxycholic acid serum (figure 1). The glycodeoxycholic acid is a secondary bile acid used as an internal standard because it can be detected and gives a better chromatogram peak . With the chromatography system, the pessimistic hypothesis that glycodeoxycholic acid on the sample can decrease the accuracy of level estimation can be solved by decreasing the extracted estimated sample without using the glycodeoxycholic acid as the internal standard . The precision and accuracy set on the level 1.0; 10.0; 50.0 g / ml for intraday validation gives score 3.39; 6.27; 3.05 and 3.61; 6.50; 3.23, and for interday validation gives score 4.74; 10.47; 11.36 and 6.94; 7.62; 10.48, that fulfill the validation requirement (table 1). The calibration curve on range level 0.5; 1.0; 5.0; 10.0; 25.0; 50.0; 100.0 g / ml gives score r = 0,9997 . The implementation of the modified method on in vivo samples (cholestasis patients) gives a better result which is the level can be quantified using the obtained calibration curve (table 2). This study quantifies the serial levels of gcdc acid serum in severe obstructive jaundice patients, which proves that there is an accumulation of glycochenodeoxycholate in the circulation of obstructive jaundice patients . Several studies reported that the accumulation of bile acid can harm the liver via apoptosis and necrosis and can cause kidney failure, diarrhea, sepsis, arrhythmia, epistaxis, andasthma - like disease [79]. Although bile acid can cause several diseases, its serum level is still unfrequently included in clinical practices or in hospitals as a liver function test or hepatocelular damage test . Accumulation of gcdc acid existed on each case of severe obstructive jaundice and was followed by pathological apoptosis of hepatocytes . The aim of this study was to measure the difference between level of glycochenodeoxycholate in the pre- and postdecompression process of the bile duct . The decompression process significantly decreased level of glycochenodeoxycholate as an apoptosis inductor of hepatocyte from 90.9 (sd 205.5) mol / l to 4.0 (sd 46.4) mol / l and then increased to 11.3 (sd 21.9) mol / l (p <0.05) (figure 3). Decreased accumulation of glycochenodeoxycholate in the postdecompression stage is due to the regurgitation stop and reuptake process of glycochenodeoxycholate by hepatocytes and then it is excreted to canaliculi . Increasing of hepatocyte apoptosis and accumulation of glycochenodeoxycholate in obstructive jaundice patients showed the role of glycochenodeoxycholate as an inductor of hepatocyte apoptosis via extrinsic apoptosis pathway, and this finding suits with the animal study result [5, 12]. However, in postdecompression stage there was a significant decrease in hepatocyte apoptosis and glycochenodeoxycholate level, so it can be concluded that a decrease on glycochenodeoxycholate level through bile duct decompression mechanism is an inhibitor of pathologic hepatocyte apoptosis . The differences from the previous study are the glycochenodeoxycholate level and hepatocyte apoptosis, which are not dose dependent in this study [2, 5]. Induction of apoptosis by glycochenodeoxycholate in the previous study was usually found in the hepatocyte culture, and on the other hand, this study showed that glycochenodeoxycholate was found on the liver tissue . The glycochenodeoxycholate level in this study is 30 times higher than normal level (according to douglas, the glycochenodeoxycholate level in nonjaundice patient is between 0.2 and 3.2 after decompression, the level of glycochenodeoxycholate on 12 cases was normal, mean while on the other 9 cases, the level decreased to 4 times lower than normal range . A few recent studies were looking for glycochenodeoxycholate antagonist such as fructose, calpain, pma, and brefeld in a as apoptosis inhibitors [2, 5, 11]. In this study, the antagonist form of glycochenodeoxycholate as inhibitor of pathologic hepatocyte apoptosis from this study we can summarize that the modified analysis method can be used to quantify level of gcdc acid on serum samples and furthermore the method can be used to support the gcdc acid pharmacokinetic study.
Injection drug use has long been regarded as a serious public health issue worldwide . According to a systematic review of the epidemiology of hepatitis b and hepatitis c, approximately 10 million intravenous drug users (idus) worldwide are carriers of anti - hepatitis c virus (hcv) antibodies, and 1.2 million idus carry hbsag antibodies . Additionally, approximately 19% of million people who inject drugs may be human immunodeficiency virus- (hiv-) positive . However, the proportion of cases related to drug use varies widely across countries depending on implementation of harm reduction policies, law enforcement practices and drug use practices, and their changes over time . In france, new diagnoses of hiv infection among drug users have dramatically decreased and, in recent years, have accounted for 2%-3% of total cases, which amounts to approximately 70 cases per year . In this population, prevalence decreased from 20% in the early 1990s to 10% in 2011 . These changes followed the introduction of free access to syringes in pharmacies (1987), the implementation of syringe exchange programmes, low - threshold services (1990), and opiate substitution treatments (1995). However, hcv infection prevalence has decreased more modestly, from 60% in the early 2000s to 44% in 2011 (8 - 9% among those under 30 years of age). Transmission of hiv and hcv remains a matter of concern with the use of a growing variety of drugs and injection practices and current evidence about sharing practices and hcv seroconversion, especially in the context of the growing nightlife culture among youths with very diverse social backgrounds [6, 7]. Similarly to other western european countries, france has a longstanding tradition of injection drug use, mainly heroin injection . In 2006, approximately 145,000 individuals in france were estimated to have used the intravenous route of administration at least once in their lifetime . After a period of injection drug use decline in france in the early 2000s, recent data suggest a levelling - off of injection practices since 2008, with the overall level remaining high [10, 11], especially among the youngest users . A recent european report shows an upward trend in the prevalence of high - risk drug users between 2006 and 2011 in france . Furthermore, ethnographic research has shown the emergence of new groups of idus and new patterns of substance abuse . Aside from underprivileged youths, new consumers belonging to diverse social backgrounds, such as users at raves / dance parties, use a wide spectrum of substances (hallucinogens, amphetamines, synthetic products, and cocaine and its derivatives), as observed by surveillance monitoring of emerging drug use trends [14, 15]. Heroin and other opiates, including prescription opioids (morphine - sulphate and buprenorphine), are used occasionally, sometimes with other substances, for their relaxing effects . Therefore, the current harm reduction strategies, developed at a time when heroin injection was predominant, especially among injectors of low socioeconomic backgrounds, may not be reaching these new initiates to injection; these users are at high risk of exposure to hcv / hiv, which is often acquired shortly after initiation into injection [1925]. The course of the first injection, including the circumstances and the people involved, has been shown to be particularly significant with respect to the future injection practices of new injectors . Thus, the majority are injected or helped by experienced injectors [18, 2733]. A recent modelling study carried out in scotland estimated that each injector initiates approximately 0.26 individuals into injection each year . Initiates are particularly vulnerable at the time of first injection because most are at the mercy of events . To date, most studies on initiation into injection drug use have been carried out among marginalised individuals who were mainly recruited through drug dependence clinics or injection drug user networks [18, 2631, 33, 3539]. In france, two epidemiological studies were carried out addressing the first injection in this population [30, 31]; however, none has focussed on recent initiations that took place in an era marked by changes in drug use patterns and drug - using environments . To document the profile of new initiates, the priminject study was carried out using the internet to reach current or former injectors and obtain descriptions of circumstances, behaviours, and potential exposure to blood - borne infections at the time of injection initiation . Launched within the context of changing trends in substance use, drug policy, and drug supply, priminject was the first study to describe new injectors and the circumstances surrounding their first injections over time . The aim of this exploratory analysis is to examine injection risk behaviours and correlates at the time of initiation into injection drug use among individuals who began injection in the post-2000 era in france . Priminject used the internet to reach young and diverse population, including individuals who had injected drugs only a few times and those who had engaged in long - term injection drug use . The electronic music scene was particularly targeted for these reasons [18, 41]. Indeed, the internet is one of the main communication channels for participants in the electronic music scene . It is also effective in reaching small and hidden populations [42, 43]. Promotional banners using visual codes associated with the party scene invited potential participants to share their experiences with drug injection . Priminject was also promoted in a wide range of harm reduction programmes and services in which the internet was made accessible to reach drug users using low - threshold services and self - help groups . The detailed methodology has been described elsewhere and in an online methodological appendix (see supplementary materials available online at http://dx.doi.org/10.1155/2015/507214). The questionnaire covered current social status (e.g., education and employment), history of legal and illegal substance use, and the detailed circumstances surrounding the first injection . To avoid missing data, the outcomes of interest were two injection risk behaviours: (1) receptive needle sharing, defined as injection with a syringe previously used by another person at first injection, and (2) receptive sharing of other injection equipment, defined as using a cooker or cotton filter previously used by another individual . One concerned participants' history of substance use before injection (use and age at first use of cannabis, ecstasy, cocaine, amphetamines, methamphetamine, ketamine, heroin, buprenorphine, methadone, other opiates, and/or hallucinogens), including heavy alcohol use (drunkenness). Early use for each substance was defined as use at 14 years of age or younger . Age at first injection was also assessed and dichotomized (<18 years old and 18 years old). The circumstances of first injection were documented, including age at that time, the type of substances used, year, and location (home or another private place, squat, street, outdoor location, or van / car), whether the injection took place during a party (whether in a public or private context and whether outdoors or indoors), whether the participant was alone, whether the participant injected him- or herself or was assisted, whether the first injection was planned, and whether the drug had been bought or given . The history of injection from initiation to the time of data collection was documented with two variables: the lifetime number of injections (only once, 210 times, 11 times, or more) and injection during the previous month (yes / no). Finally, the year of initiation was estimated by subtracting the age at the time of initiation from the age at the time of the interview . Subjects who injected earlier than 2000 were excluded from the present analysis to focus on the most recent injectors . Descriptive statistics were used to characterize the study sample included frequency distributions for categorical variables . To examine the association between the correlates and each outcome, all the variables with a p value <0.25 for one of the outcomes in univariate analyses, according to the wald test, were considered for inclusion in the multivariate models . Early use of substances was not included in the multivariate logistic regressions because it was highly correlated to age at first injection . Data collection was approved by the french individual data protection authority (cnil), and safeguards on confidentiality, anonymity of responses, and the nonregistration of ip addresses were clearly stated on the home page of the survey . Among the 1,884 individuals who visited the priminject url (http://www.shoot-premierefois.com/), 1,318 (70%) began to fill out the questionnaire . Among these individuals, 325 (25%) stopped completing the questionnaire before reaching the end of the section on first injection and were excluded from the analysis and 42 (3%) provided inconsistent answers . Most of these individuals discontinued completion or left the webpage at the very beginning of the questionnaire, in the general information section . The individuals who dropped out were younger than those who continued (mean age 27.6 versus 29.7, p <0.01) and were more often students . Among the 951 respondents, 455 had never injected (48%), 40 were living abroad (4%), and seven did not report the year of their first injection . In the present study, for internal consistency, only the responses of the 262 individuals who reported injecting drugs for the first time in or after 2000 were analysed (figure 1). More than one - third of these respondents (37%) learned about the study through the internet (through banners on the associations' websites) and 34% were invited to participate by outreach services (table 1). More than two - thirds of the respondents (65%) were male and the mean age was 25 years (sd = 6) (table 1). Only 29% of the respondents were employed, whereas 45% were unemployed and 26% were students . Regarding education, 51% had not completed high school and 26% had a college or university degree . Regarding drug use history, 64% reported early alcohol abuse and 60% early cannabis or other illegal substance use (39% only cannabis and 21% another drug). At the time of data collection, 12% reported having injected only once and 14% having injected only two to ten times in their lifetime . The majority of the sample (68%) had injected drugs at least once in the previous month . Twenty - six percent (26%) of the respondents had experienced their first injection before the age of 18 years . Most respondents reported having injected for the first time in a private place, for example, house, apartment, or hotel (69%), and 18% during a party, whatever the context and location (8% reported having injected during a party in a private place). Initiation was planned by 36% of the sample, and 26% were alone at the time . A significant proportion of the sample reported that they had injected themselves (47%). Heroin was the drug most commonly injected at first injection (58%), followed by other opiates (15%) and cocaine and crack or freebase (15%). Among the 262 respondents, 18 did not remember whether the syringe that they used the first time had already been used (table 2). Among the remaining 244 respondents, 8% (n = 20) reported that they had used a syringe already used by another person . The respondents who were female (crude odds ratio (cor) = 2.6, p = 0.040), under 18 years old at the time of initiation (cor = 4.5, p = 0.002), and injected by another individual (cor = 3.1, p = 0.036) were more likely to report needle sharing than other participants . The association between needle sharing and initiation during a party was only marginally significant (cor = 2.7, p = 0.062). Among the 230 subjects who recalled the use of a cooker or cotton filter, 17% (n = 40) reported receptive sharing of this equipment . Except for one individual, all of the individuals who used a shared needle also used a cooker or cotton previously used by another person . Correlates significantly associated with sharing equipment were gender (females: cor = 2.3, p = 0.020), first injection before the age of 18 (cor = 2.9, p = 0.004), first injection during a party (cor = 3.3, p = 0.004), not having planned to inject (cor = 2.4, p = 0.031), having been injected by another person (cor = 3.7, p = 0.001), and having been given the injected substance (cor = 2.8, p = 0.004). Injection before the age of 18 (adjusted odds ratio (aor) = 3.7, p = 0.015) and injection performed by another person (aor = 3.1, p = 0.049) were positively associated with receptive syringe sharing (table 2). In the multivariate analysis, receptive equipment sharing was positively associated with injection before 18 years of age (aor = 3.0, p = 0.011) and injection performed by another person (aor = 3.0, p = 0.010) (table 2). A borderline significant association was found with first injection during a party (aor = 2.6, p = 0.053). The final model showed that younger age and being injected by another idu were independently associated with increased risk in both syringe and other equipment at first injection . A nearly significant association was also found between injection at a party and equipment sharing . To date, most epidemiological studies on the circumstances of initiation into drug injection are mainly descriptive and have been carried out among idus whose injection dates to the period before 2000 [26, 27, 2931, 3539]. Priminject joins the few studies investigating the independent correlates of sharing behaviours at the time of first injection [28, 45]. This study is also the first to examine initiation into drug injection using an internet survey . Thus, a significant part of the sample was not recruited through treatment or harm reduction services, therefore allowing connection with young idus who were not necessarily street - entrenched or in need of services . Our findings are consistent with the literature showing that injection equipment (cooker / cotton filter) sharing is more prevalent than needle sharing [27, 29, 30, 38, 39, 46]. The rate of sharing injection equipment among injectors of our sample is consistent with recent results from the french ena - caarud study among new injectors . However, the definition of equipment is highly variable across studies and precludes valuable comparisons . Despite a decreasing trend in drug injection thanks to harm reduction policy, injection drug use has remained relatively common in france, as shown by recent studies [4, 10], suggesting a need to study in more depth routes to entry into injection . In our study, risky injection behaviours are strongly associated with being injected by a third person, as observed in previous studies [27, 29, 4749]. These practices might be linked to the important affective and emotional influences among couples as discussed elsewhere [32, 50, 51]. Because being injected by an experienced injector is very common (more than half of the first injections required such external help) and triples the likelihood of sharing needles and equipment, the influence of experienced users is key regarding the ability to demonstrate and practise safer use [34, 52, 53]. Interventions, such as the brief motivational intervention break the cycle, are designed to reduce, among people who inject drugs, injection initiation - related behaviours (e.g., speaking positively about injecting to noninjectors, injecting in front of noninjectors, and explaining or showing a noninjector how to inject) and initiation of noninjectors . The evaluation of the intervention reported that after the intervention, the participants were less likely to initiate drug users into injecting . This intervention has been recently evaluated with a peer - delivered design to increase awareness of the role of experienced users as peer educators . For example, the toronto intervention change the cycle (ctc) included attitudes not only towards responding to young users' demand for injection but also towards teaching safer injection practices . Pilot study results suggest that ctc holds promise as a preventive intervention and is currently under study in france . Our findings also support moving more broadly towards educational interventions on risks associated with drug injection, such as face - to - face educational sessions on safer injecting practices that have recently proved successful in france at reducing unsafe hiv - hcv transmission practices and injection - related complications . If the unplanned injection and having been given the injected substance appear to increase the risk of sharing equipment in the univariate analyses, this association did not hold after adjustment suggesting a confounding effect . In fact, an important result of our analysis also indicates that sharing equipment was more common when injection took place during parties . The party atmosphere appeared to favour the loss of control over the situation, the group effect, and difficulty in identifying clean equipment, especially among drug users without previous injection experience . A range of harm reduction programmes targeting the party scene have been launched, such as the nevershare syringe, with plungers in a range of colours to prevent accidental sharing . In france, more specific harm reduction programmes targeting the recreational use of drugs in the techno scene have also included injection and prevention of sharing in their portfolio (http://www.technoplus.org/). The priminject findings support the renewed development of programmes targeting youth involved in the party scene, where multiple illegal substances are widely available and there is a significant chance of moving to injection practices . Additionally, unlike previous results that indicated an association between cocaine injection and higher drug use practices [5962], the priminject results found that, at the first injection, the use of cocaine and other stimulants did not increase the sharing of either syringes or equipment . However, early initiation into injection (under the age of 18) was correlated with needle and equipment sharing at the time of first injection . Early injection was strongly correlated with early experience of illegal drug use (p <0.001): among the respondents who injected before the age of 18, 45% had used an illicit drug other than cannabis at the age of 14 or younger (versus 12% of the respondents who initiated injection at the age of 18 or older). Other individual factors were not documented to assess the various dimensions of vulnerability associated with the early onset of at - risk behaviours, such as poor family relationships, family history of alcohol and drug abuse, childhood trauma, and early school dropout [6366]. Initiation into drug use, including injection initiation in teenage years, puts young people at increased risk of drug - related harm and calls for an update of harm reduction services to address their specific needs . These results reinforce the need for early identification, referral, and intervention with young people at risk, such as the clinics for young drug users launched in france in 2004 . Within this framework, a comprehensive programme for preventing a large range of addictions (e.g., tobacco, alcohol, cannabis, and video games) includes information and communication campaign and outpatient clinics adapted to young drug users and their families . Early interventions, such as screening, brief intervention, and referral to treatment (sbirt), enable addressing high - risk drug users more effectively and help reduce harm associated with drug abuse, particularly among those who do not seek help . If this public health approach has proved successful among adults, it must be tailored to the changing and evolving needs of specific young target groups and new drug trends . For this purpose and because of challenges posed by changing consumption patterns among young people in the fight against infectious diseases, such as hiv and hcv, there is an urgent need to introduce new forms of intervention and services based on information and communication technologies and targeting very young drug users . While prior studies on the transition to injection were mostly based on samples recruited in dedicated drug services or using targeted sampling, street outreach, or chain referral methods among mostly marginalised users [2629, 31, 3539], priminject reached a diverse population with respect to social status, age, past and present drug use patterns, frequency of drug use, and current behaviour and carrier in injection . The study has been restricted to young people (mean age 25 years) who began injection in recent years (20002010) and captures a little known population that could not yet have had a long career in injection . The purpose of the study was to portray the entire spectrum of people who currently inject drugs, including those individuals with a very short history of drug injection, who represent a quarter of the sample, with 12% having injected only once and 14% two to ten times in their lifetime . These drug users are exposed to transmission of blood - borne infections, mainly hcv, in cases of unsafe practices . Recall bias cannot be excluded, especially among those from the most remote period of initiation . Desirability bias cannot be ruled out; however, compared with more conventional modes of data collection, the anonymity of the web administration could increase the level of reporting of sensitive information and its accuracy [71, 72]. Conversely, recent injectors are more likely to use the internet and to attend social events or services where the priminject information was promoted . This survey mode and its effort to reach electronic scene users may have biased the recruitment in favour of the least marginalised injectors . However, a sizeable proportion (approximately one - third) of the sample was recruited through outreach teams outside the internet channel . Furthermore, the factors associated with sharing outcomes were not significantly associated with how participants reached the priminject website, either through outreach programmes or while surfing the internet on their own . In such a hard - to - reach population, the priminject study does not claim to be statistically representative; rather, it covers a spectrum of users broader than that usually investigated . Given the consistency of the priminject findings with new drug use trends in france, as regards the age of new initiates to injection and persistence of sharing equipment practices, the priminject results might be considered to reflect current at - risk practices and their determinants that favour the ongoing transmission of hcv . The context of new patterns of drug use and emerging new consumer profiles among young people presents new challenges for harm reduction among young people . Initiation into drug use persists, and it carries potential risk for extremely diverse groups . This research identifies risk contexts during the first injection and encourages taking them into account in innovative (outreach, peer, and online) harm reduction programmes addressed both to people who inject occasionally during parties and festivals and to those who will move towards long - lasting drug use injection trajectories . In this context, the education of current injectors to protect both themselves and those they might initiate into injection is critically important . This diversification of harm reduction programmes in combination with efforts to improve access to highly effective hcv treatment could make further progress in reducing hcv prevalence and incidence.
A 41-year - old woman with a history of liver cirrhosis presented with recurrent portal hypertension and bleeding from esophageal varices . Three months prior to this admission, a tips was created with a 10 mm 7 cm wallgraft (boston scientific, natick, ma). However, the stent's anticoagulation was inadequate (international normalized ratio [inr]: 1.02 - 1.21) after placement . The initial attempts at recanalization of the completely occluded stent via the transjugular approach were unsuccessful . Therefore, a percutaneous transsplenic approach guided by ultrasound was used to gain entry to the splenic vein and portal vein for catheterization of the occluded stent . To perform the ultrasound guided puncture of the splenic vein through the spleen, we used a skater introducer set (angiotech, pbn medicals, denmark). A 22-guage chiba needle was introduced into the splenic vein, then a 0.018 inch guide wire was placed through the chiba needle into the splenic vein, and a 6-fr dilator system was placed over the wire . We then exchanged the 0.018 inch guide wire with a 0.035 inch guide wire, followed by a 5-fr introducer sheath and a 4-fr kmp catheter (cook medical inc ., however, residual thrombosis of the stent was noted in combination with occlusion of the hepatic vein (fig . So, we performed catheter - directed intrathrombus thrombolysis with urokinase (taiwan green cross co., taipei, taiwan). In brief, the distal end of a 4 fr rc1 catheter (cook medical inc ., bloomington, in) with home - made side holes (n = 10, made by needle - sticks into the distal 5-cm segment of the catheter) was wedged into the thrombosed tips stent . Then, catheter - directed intrathrombus thrombolysis with a solution of 48 vials of urokinase (60,000 u / vial) in 500 ml normal saline at a drip rate of 21 ml / hr (i.e., 2 vials / hr = 2,000 u recanalization was performed in the following day and a wallstent endoprosthesis (14 mm 9 cm, boston scientific, natick, ma) was placed, resulting in the successful opening of the shunt (fig . The catheters were removed and the transsplenic tract was embolized with 4 serial coils (mwce-35 - 8/4-tornado, cook medical inc ., she is doing well five months after discharge and an ultrasound study indicates that the stent remains patent . Transjugular intrahepatic portosystemic shunt is now considered the procedure of choice for accessing the portal system for management of refractory variceal bleeding . Certain complications, including a high reintervention rate due to occlusion of the stent, have raised concerns regarding its application (2, 3). Yet recent reports have suggested that using a covered prosthesis improves the tips patency to longer than two years (4, 5). Although a covered stent had been employed in the patient presented here, thrombosis occurred early (i.e., within 3 months). Transjugular intrahepatic portosystemic shunt failure requires recanalization of the stent or placement of serial or parallel stents (6, 7). Neointimal hyperplasia at the ends of the stent may completely occlude the outflow hepatic venous tract (1) and this can make reintervention difficult . As in this case, an alternative route is needed when attempts at recanalization via a conventional transjugular approach fail . The splenic vein drains directly to the portal vein, and its size and straight route make this approach an ideal option (5, 8). The transsplenic approach has been used for other indications, as reviewed by tuite et al . (8), but we are unaware of any other report of using the percutaneous transsplenic approach to recanalize an occluded tips stent . Additionally, we believe that the overnight infusion of a thrombolytic agent contributed to successful recanalization in our case (9). Concerns regarding post - procedural splenic bleeding and the reported difficulty some clinicians have experienced negotiating the pathway have limited the use of the transsplenic route . A cautious, image - guided approach reduces the risk of splenic hemorrhage (5, 8) and obliteration of the transsplenic tract with coils upon completion of the procedure also assists in preventing post - procedural bleeding (8). No significant splenic bleeding occurred in our patient, despite her liver impairment, during or following the intervention . Subtherapeutic anticoagulation (inr <2) probably contributed to the thrombosis and subsequent occlusion in this patient . There is no routine anticoagulation protocol to follow for tips patients . We prescribe anticoagulation for only the patients with tips dysfunction; however, there is no reference available for the effectiveness of this regime . As a general rule for preventing thromboembolism, chronic oral anticoagulant therapy with a vitamin k antagonist is administered and the dose is adjusted to achieve an inr of 2.0 to 3.0 (10). In summary, we have reported on a rare case of using the transsplenic approach for recanalization of a tips stent by thrombolysis . Transsplenic entry to the portal system is useful in recanalizing a stent that is difficult to reach through the usual transjugular route.
In the current issue of critical care, de prost and colleagues evaluated the impact of protective and injurious ventilation strategies on lung neutrophil distribution and activation in sheep 2 hours after endotoxin infusion . The protective ventilation strategy consisted of 8 ml / kg tidal volume and titration of positive end - expiratory pressure (peep) to achieve a plateau pressure of 30 cm h2o . Peep was not applied in the injurious ventilation protocol, and tidal volumes of 14 to 18 ml / kg were delivered . Positron emission tomography (pet) imaging and n-[nitrogen]-saline infusion were performed to evaluate regional lung perfusion and shunt fraction . Cellular metabolic activities were measured by using an f - fluorodeoxyglucose (f - fdg) infusion protocol, and lung leukocyte infiltration was determined by histological analysis . Their results show that protective ventilation was associated with better gas exchange and lower shunt fraction in dependent lung regions prior to endotoxin infusion . Endotoxin infusion worsened gas exchange in both groups, but less so in sheep receiving protective ventilation . Protective ventilation also attenuated f - fdg uptake and phosphorylation after endotoxin infusion, particularly in dependent areas of the lungs . The authors conclude that a protective ventilation strategy that optimizes alveolar recruitment and minimizes alveolar distension may mitigate neutrophil activation in the lung, particularly in dependent areas, during early experimental acute lung injury (ali). Use of the sheep model in this study had several advantages . With a size comparable to that of the human, the ovine model allowed an analysis of physiological endpoints that are clinically relevant and permitted the application of ventilation strategies that are similar to those used in clinical practice . The tidal volumes and peep applied in the protective strategy are similar to those advocated for use in the clinical setting . Alternatively, a study by takeuchi and colleagues described a method of pressure - volume curve analysis to identify the most appropriate peep during mechanical ventilation in an adult sheep model of ali, which may further optimize lung protection and would be interesting to apply in the model used by de prost and colleagues . The endotoxin infusion model has the advantage of being reproducible and easily titrated and is known to induce neutrophil accumulation in the lungs . However, the protocol appears to have induced minimal histological evidence of lung injury as indicated by lung injury scores of 0 to 1 (on a scale of 0 to 4) in both groups . Given the lack of demonstrable lung injury at the histological level, it is possible that differences in normal lung recruitment and hemodynamics contributed to the dissimilarities in gas exchange and shunt fraction observed between groups . However, changes in alveolar - capillary integrity that were not detectable by light microscopy may also be present early after endotoxin infusion and could have contributed to the observed gas exchange perturbations . Evidence indicates that dysregulated inflammation and the inappropriate accumulation and activation of leukocytes, especially neutrophils, contribute to the pathogenesis of ali . Furthermore, investigators have postulated that protective ventilation strategies decrease regional lung inflammation in subjects with ali . The assessment of cellular metabolic activity by using pet imaging and f - fdg infusion along with the evaluation of lung perfusion and ventilation, as performed by de prost and colleagues, is an informative, non - invasive approach that provides useful data regarding regional differences in cellular metabolic rate . The technique may have practical utility since studies have shown that evaluation of f - fdg uptake may be valuable in predicting respiratory failure and evaluating therapy in clinical and experimental models of ali [8 - 10]. The present study extends previous reports by documenting the impact of ventilation strategies on regional metabolic activity and neutrophil accumulation early during the course of ali . Although differences in cellular metabolic activity were observed between groups, neutrophil accumulation in the lungs was not different when sheep receiving protective or injurious ventilation were compared . The authors interpret that finding as possibly being indicative of increased neutrophil activation in sheep receiving injurious ventilation . That conclusion is based, in part, on previous studies that showed neutrophil activation to be the primary factor contributing to increased f - fdg uptake and phosphorylation during ali . However, as noted by the authors, it is unclear whether the alterations in f - fdg uptake and phosphorylation observed in their analysis are entirely specific for neutrophils . It is possible that the metabolic rates of other leukocyte and non - leukocyte cell populations were affected . Evidence indicates that alterations in macrophage, epithelial, and endothelial cell functions occur during ali . Further studies are needed to identify the cell populations that are affected and the functional importance of the observed alterations . Overall, the study by de prost and colleagues provides new insights into the impact of ventilation strategies on regional cellular metabolic activity during early ali . More investigation is needed to extrapolate their findings into the clinical setting and determine the functional importance of their findings . It is hoped that the group will perform follow - up studies to determine whether the observed changes in regional leukocyte activation are predictive of progressive respiratory failure and pulmonary injury as well as better define the specific cell populations involved . 18f - fdg: f - fluorodeoxyglucose; ali: acute lung injury; peep: positive end - expiratory pressure; pet: positron emission tomography.
In this issue of critical care, lesur and colleagues report the differential profile of stress response in septic and non - septic patients . Adrenocorticotropic hormone (acth) and acth / cortisol ratio were lower whereas baseline cortisol, procalcitonin (pct), and stromal cellderived factor-1-alpha (sdf-1) were higher in septic patients than in non - septic patients . Furthermore, a probability score incorporating acth, cortisol, and pct by multivariate logistic regression analysis predicted sepsis better than sepsis score or pct did . The response of hypothalamic - pituitary - adrenal (hpa) axis to the sustained stress of severe illness has been the focus of many studies in recent years . In healthy subjects, cortisol secretion by adrenal cortex is regulated by acth secretion by the pituitary, which in turn is regulated primarily by hypothalamic secretion of corticotropinreleasing hormone (crh), whereas cortisol inhibits both acth and crh production through a negative feedback [2 - 4]. However, hpa stress response during sepsis is much more complex and is poorly defined . Plasma cortisol levels may be low, normal, or high in sepsis but nonetheless inadequate to control the inflammatory response and meet the elevated metabolic demand . This effect is termed relative adrenal insufficiency (rai), also known as critical illness - related corticosteroid insufficiency (circi). Other factors are involved in the hpa stress response during sepsis . In rodent models, arginine vasopressin (avp) was shown to increase endogenous adrenal acth secretion . Apelin, a neuropeptide originating from paraventricular and supraopitc nuclei, acts on hpa axis regulation by releasing crh and acth and by reducing avp . Copeptin, a 39-amino acid glycopeptide, makes up the pre - pro - vasopressin molecule together with neurophysin ii and avp and serves as a surrogate marker to assess avp plasma concentrations in septic shock . In normal rats, the chemokine sdf-1 and its receptor colocalize with avp in magnocellular neurosecreatory neurons, resulting in an inhibition of avp - induced release . The dissociation of acth and cortisol levels in late phase (lasting many days to weeks), which is different from that of the acute phase (hours to a few days) of an illness, indicates that alternative pathways not mediated by acth are involved . Limited clinical studies prove that the dehydroepiandrosterone (dhea) level is very low in septic shock, whereas its sulphate and the cortisol / dhea ratio might be prognostic markers and signs of exhausted adrenal reserve in critical illness . Tissue resistance to corticosteroid action may also play an important role in sepsis and can be caused by either defects in the corticosteroid receptor or postreceptor alterations and may not be defined accurately based on plasma cortisol levels . Despite the uncertainty of the definition and diagnostic criteria, clinical studies show that patients with rai are at a significantly higher risk of hospital mortality and this has been the driver for corticosteroid replacement therapy in severe sepsis / septic shock [2 - 4]. This is not surprising upon review of the aforementioned complexity and unknowns of hpa stress response . Furthermore, it must be acknowledged that the decision to treat with stress - dose corticosteroids is based on clinical criteria rather than on the inconclusive results of adrenal function tests . The dissociation of acth and cortisol levels observed in the study is more compatible with neuroendocrine characteristics of prolonged critical illness, although the authors claimed to include patients within the first 24 hours of admission . The clinical significance of the predictive model is hindered by the unavailability of acth or cortisol measurements at the bedside and by the fact that the predictive value of sepsis score or pct has not been consistently validated in clinical trials . Despite all of these limitations, the study by lesur and colleagues undoubtedly expands our understanding of the complex neuroendocrine network regulating hpa stress response in human sepsis . We believe that further investigation into the mechanism is warranted before we plan a successful strategy for corticosteroid replacement in sepsis . Acth: adrenocorticotropic hormone; avp: arginine vasopressin; circi: critical illness - related corticosteroid insufficiency; crh: corticotropin - releasing hormone; dhea: dehydroepiandrosterone; hpa: hypothalamic - pituitaryadrenal; pct: procalcitonin; rai: relative adrenal insufficiency; sdf-1: stromal cell - derived factor-1-alpha.
Periodontal research has emerged and evidences are published referring to the connection between periodontal infection and systemic diseases . Maternal risk factors include age, height, weight, socio - economic status, ethnicity, smoking, alcohol, nutritional status, and stress . In addition, parity, birth interval, previous complications, pre- and ante - natal care, maternal hypertension, infections, and cervical incompetence may also be important . However, a significant proportion of low birth - weight is of unknown etiology . Among these birth weight is identified as one of the most important determinants to survive a newborn infant in all population groups . Even after taking increased care to avoid these known obstetric risk factors which were identified in approximately one fourth of preterm low birth cases, there still has been a relatively small decrease in the proportion of preterm low birth weight leading to a continued search for other causes and most of them are identified to be direct result of preterm labour or premature rupture of membranes, linking lower genital tract infection . Since the role of infection is receiving increasing attention, and the maternal infection on preterm delivery remained controversial, which may support an indirect effect as a consequence of the production of increased levels of inflammatory mediators shortening the gestational age . It is also plausible that micro - organisms may gain direct access to the amniotic fluid and fetus in several ways: ascending via the vagina through the cervix into the choriodecidual sac during pregnancy or via the endometrium, which may be chronically infected prior to pregnancy, or alternatively through a hemotogenous route . An association has been established between severe periodontitis, and a variety of systemic conditions . Among these are cardiovascular disease, including endocarditis and coronary heart disease, insulin dependent diabetes mellitus, and respiratory disease . The 1996 study by offenbacher and colleagues suggested that maternal periodontal disease could lead to a seven - fold increased risk of delivery of a plbw infant . Moreover, it has been observed in animal models that infection with gram - negative periodontitis - associated micro - organisms may adversely affect pregnancy outcomes . As pointed out by offenbacher et al, these findings have been shown potential significance to risk assessment of plbw, to oral health care during pregnancy . Since then numerous studies have been published establishing the link[1015] and some studies failed[1619] to establish association between maternal periodontitis and preterm low birth weight . Hence an attempt has been made to find the relationship between maternal periodontal disease and preterm low - birth weight infants in southern part of india . A sample of 134 systemically healthy women were examined and 104 were selected and divided into 52 cases and 52 controls depending on, mothers who had newborn's weight was less than 2500 g, women who had spontaneous pre - term labour, women with threatening pre - term labour and were treated, to maintain pregnancy as long as possible or preterm premature rupture (less than 37 weeks of gestation) of membranes . Exclusion criteria include the women with systemic medical problems, chronic infectious diseases, those who are receiving antibiotics at the time of the examination, and those who had taken dental treatment within 6 months . The nature of study was explained to subjects and consent was obtained for their participation prior to commencement of the study . Case defined as premature delivery (who 1950) occurring at less than 37 weeks of gestation, and is generally accompanied by low birth weight, i.e., a birth weight less than 2500 g. control defined as mothers with delivery occurring after 37 weeks without any previous complications, and newborn with birth weight of 2500 g. history of information about age, education status of parents, occupation, socio - economic status of the family, psychological stress levels of the pregnant women, number of previous pregnancies, previous preterm low birth weights, and miscarriages was noted . Recording of following clinical parameters were done using sillness and loe plaque index (pi), muhlemann and son sulcus bleeding index (sbi), probing pocket depth (ppd), and clinical attachment level (cal). Ppds and cal were measured to the nearest mm at 6 sites per tooth, i.e., around mesio - buccal, mid - buccal, disto - buccal, mesio - lingual, mid - lingual, and disto - lingual using william's periodontal probe . The probing depth was used for categorizing a mother with chronic periodontitis . According to gomes - filho, woman with probing depth 4 mm and cal 3 mm at the same site in at least four teeth weight of the newborn was analyzed using a manual machine (docbel, braun company pvt . Ltd .) By the gynecologist . The patient's hospital record was verified to confirm the data obtained for any variation . All the periodontal examinations were completed within 3 days post - partum as defined by offenbacher et al . The nature of study was explained to subjects and consent was obtained for their participation prior to commencement of the study . Case defined as premature delivery (who 1950) occurring at less than 37 weeks of gestation, and is generally accompanied by low birth weight, i.e., a birth weight less than 2500 g. control defined as mothers with delivery occurring after 37 weeks without any previous complications, and newborn with birth weight of 2500 g. history of information about age, education status of parents, occupation, socio - economic status of the family, psychological stress levels of the pregnant women, number of previous pregnancies, previous preterm low birth weights, and miscarriages was noted . Recording of following clinical parameters were done using sillness and loe plaque index (pi), muhlemann and son sulcus bleeding index (sbi), probing pocket depth (ppd), and clinical attachment level (cal). Ppds and cal were measured to the nearest mm at 6 sites per tooth, i.e., around mesio - buccal, mid - buccal, disto - buccal, mesio - lingual, mid - lingual, and disto - lingual using william's periodontal probe . The probing depth was used for categorizing a mother with chronic periodontitis . According to gomes - filho, woman with probing depth 4 mm and cal 3 mm at the same site in at least four teeth weight of the newborn was analyzed using a manual machine (docbel, braun company pvt . Ltd .) By the gynecologist . The patient's hospital record was verified to confirm the data obtained for any variation . All the periodontal examinations were completed within 3 days post - partum as defined by offenbacher et al . A statistical analysis was performed using spss system, containing descriptive statistics and univariate / multivariate logistic regression analyses . Categorical variables were compared by the chi - square test or fisher's exact test and continuous variables by the student's t test . Univariate and multivariate logistic regression analyses were constructed for preterm low birth weight, starting with all variables included in the univariate analyses . When comparison of means and standard deviations of different - variables in cases and controls were done, bleeding index, plaque index and birth weight, education status of the mother are highly significant at 1% level where as age does not show any significance as shown in table 1 . Comparision of different variables in case and control groups the comparison of mean values of different subjective variables in both groups graphically represented in figure 1 . Comparison of mean values of different subjective variables in case and control groups . When the percentage - with and without (ppd) 4 mm and cal 3 mm in at least 4 teeth was compared between cases (84.6%) and control (3.8%) groups, there was high significance observed at 1% level as shown in figure 2 . When the education status of the mothers was compared at different levels between cases and controls, high significance was observed at 1% level . Whereas the education status of the fathers was compared, there was no significance observed as represented in figure 3 and 4, respectively . Percentages of cases with and without ppd4 mm and cal3 mm in at least 4 teeth . Comparison of the education status of the mother at different levels in case and control groups . Comparison of education status of the father at different levels in case and control groups . When the socio - economic status of the families was compared at different levels between cases and controls, there was no observable significance and represented graphically in figure 5 . When the psychological stress level of the mothers was compared between cases (84.6%) and controls (38.5) high significance comparison of socio - economic status of the family at different levels in case and control groups . Significant associations were found between plbw and periodontal disease (p <0.001) when univariate logistic regression was done in pregnant women . Plaque index, bleeding index, psychological stress were the parameters significantly associated with plbw in the univariate analysis . Other non significant variables include age of the mother, father education status, socio economic status of the family and no . Of abortion as shown in the table 2 . Univariate logistic regression analysis (ppd) 4 mm and cal 3 in at least 4 teeth is the only variable which is significant at 1% level, when multiple logistic regression analysis was done, with a regression coefficient of 4.92 and odds ratio is 137.50 as shown in table 3 . Most of the confounding variables were found to be well known risk factors associated with plbw explaining pb and/or lbw showing highly significant relationship between periodontitis and plbw . However age of the mother did not show much of significance, this could be attributed to antenatal factors such as socioeconomic factors, infections and other complications . The plaque index showed highly significant differences (p<0.001 with an odds ratio 26.45) in both cases and controls . This could be because; during pregnancy the oral microflora uses the progesterone and estrogen hormones as vitamin k growth factors and they form the plaque on the gingival and tooth surfaces . In contrary studies conducted by radnai et al, showed insignificant plaque index values (p=0.198) in cases and controls . Significant differences were found in bleeding index (p <0.001 with an odds ratio 4.21) in both cases and controls . This is in agreement with zadeh - modarres et al, indicating that the control group had a better periodontal condition than the case group . The increased circulating levels of progesterone in turn cause dilation of gingival capillaries, permeability, and gingival exudates that may explain the redness and increased bleeding tendency during pregnancy . And our results established strong evidence that maternal periodontal disease is an independent risk factor for an adverse outcome of pregnancy (preterm low birth weight) showing significant differences (p<0.0001) in both cases and controls . This is in agreement with several studies conducted in different population groups by offenbacher et al, goepfort, marin et al, moliterno et al, siqueria et al, zadeh - modarreas, agueda et al and pitiphat et al . First, women with periodontal disease may experience more frequent and severe bacteremia than periodontally healthy women . As a result, the uterine cavity may become exposed to or colonized by periodontal bacteria or their byproducts (e.g., lipopolysaccharides). Once they reach the maternal - fetal unit, oral bacteria may elicit an inflammatory cascade that leads to preterm labour . Rather, cytokines generated within the diseased periodontal tissue may enter the systemic circulation and precipitate a similar cascade, again leading to spontaneous preterm labour and birth . In contrary, studies conducted by several authors[51619] did not provide connecting link between maternal periodontitis and preterm delivery . Highly significant (p<0.0001) association between probing pocket depth and preterm low birth weight was consistent when using at least one site with (ppd) 4 mm and cal 3 mm in at least 4 teeth . In controls, only 3.8% women showed (ppd) 4 mm and cal 3 mm when at least 4 teeth were considered indicating significant periodontal disease progression during pregnancy . A significant association between periodontal disease and adverse pregnancy outcome was observed in population groups with a incidence of preterm deliveries, from economically disadvantaged families shown by lopez et al, however, the present study, reports no relationship between socioeconomic status and adverse pregnancy outcomes . This is in accordance with, most studies conducted in european countries and canada . In the present study, periodontal status of the mother was found to be influenced greatly by educational status (p <0.05) of the pregnant women . This is in agreement with siqueria et al, toygar et al . On the contrary, an insignificant difference (p>0.05) this could be because educated mothers would take more preventive measures than less or uneducated mothers . On the other hand, periodontal status of the mother was not influenced by the father educational status (p>0.05). Similar results were obtained in a study conducted by radnai et al . According to our study mother's psychological stress levels and preterm low birth weight deliveries had significant (p<0.05) association . The systemically released hormone enters into saliva and would cause reduction of inflammatory cells inhibiting the immune response thereby causing the inflammation of the periodontium . Association between number of abortions and preterm low birth weight deliveries were found insignificant (p>0.05)., marin et al, found significant results between number of abortions and preterm low birth weight . The presences of specific genetic and environmental factors influence the pregnant women to induce abortion . An insignificant (p>0.05) association was observed between previous preterm low birth weight and preterm low birth weight deliveries in our study . On contrary, augeda et al, davenport et al, found significant results between previous preterm low birth weights and preterm low birth weight . This could be because the majority of the deliveries in our study are first deliveries . Association of number of previous deliveries and preterm low birth weight was insignificant (p>0.05) in our study . Since most of the pregnant women admitted for first delivery, they must have shown an insignificant association . On the basis of these findings, periodontal infections in pregnant women can be viewed as a potential obstetric risk factor . The fact being periodontal infections are both preventable and readily treated, this study findings provide opportunities for intervention strategies to reduce the incidence of preterm low birth weight . From the results obtained, the following conclusions were arrived at 1.periodontal disease in pregnant women is an important obstetric risk factor for preterm low birth weight.2.chronic periodontitis is associated with preterm low birth weight in pregnant women among this part of india.3.antenatal factors and periodontal status contribute for preterm low birth weight in pregnant women . Periodontal disease in pregnant women is an important obstetric risk factor for preterm low birth weight . Chronic periodontitis is associated with preterm low birth weight in pregnant women among this part of india.
Defects in many of the molecules that regulate the cell cycle have been implicated in cancer initiation and progression . These include p53, rb, p107 and prb2/p130, and cdk inhibitors (p15, p16, p18, p19, p21, p27), all of which act to prevent cell cycle progression until all repairs to damaged dna have been completed . In this section, we will review tumor suppressor genes that regulate cell cycle and apoptosis that have been found to be methylated in gastric cancers . Tumor suppressor genes which are most recently found to be methylated in gastric cancers regulate cell cycle progression and apoptosis . Kim et al . Reported that promoter methylation of early b - cell factor-3 (ebf3) was detected in 40.4% (42/104) of gastric cancer tissues but not in normal gastric tissues . The ebfs are a group of four highly conserved, dna - binding transcription factors with an atypical zinc - finger domain and a helix - loop - helix domain . Functional analysis demonstrates that ebf3 represses gastric cancer cell growth and migration but activates cell cycle arrest and apoptosis . Ebf3 up - regulates p21 and p27 in gastric cancer cells but represses cdk2, cyclin d1, cyclin d2, and rb as previously reported in different types of cancers, . Interestingly, in addition to their central roles in apoptosis regulation, the bcl-2 family of proteins influences the cell cycle, specifically the transition between quiescence and proliferation . Bcl2l10 methylation was detected in 44.5% of gastric cancers and 21.34% of normal gastric mucosae (p <0.05) by bisulphite sequencing . The pro - apoptotic effect of bcl2l10 and growth promotion by sirna targeting bcl2l10 in gastric cancer cells suggests that bcl2l10 may be a tumor suppressor by inducing apoptosis through mitochondrial pathways . The iroquois homeobox protein 1 (irx1) gene is located on chromosome 5p15.33, which is a cancer susceptibility locus . Irx1 transcription was suppressed by hypermethylation in gastric cancer, and restoring irx1 expression in sgc-7901 and nci - n87 gastric cancer cells inhibited tumor growth, invasion, and tumorigenesis in vitro and in vivo . Irx1 directly targets bradykinin receptor b2 (bdkrb2), an angiogenesis - related gene, as well as histone h2b type 2-e (hist2h2be) and fibroblast growth factor 70 (fgf7), cell proliferation and invasion related genes . Hypermethylation of irx1 was detected not only in primary gastric cancer tissues but also in the peripheral blood cells of gastric cancer patients, suggesting that irx1 could potentially serve as a biomarker for gastric cancer . The cklf - like marvel transmembrane domain - containing family (cmtm) is a novel family of proteins linking chemokines and the transmembrane-4 superfamily . Wang et al . Reported that cmtm3 is frequently methylated in many carcinoma cell lines and some primary tumors including gastric cancer, resulting in loss of its expression at both the mrna and protein levels . Ectopic restoration of cmtm3 expression in tumor cells leads to the suppression of cell growth and induction of apoptosis with caspase-3 activation, suggesting that cmtm3 may function as a tumor suppressor . Hypermethylation signals were also observed in some cultured and primary gastric cancers with little or no expression of transcription factor sox2, a sox transcription factor . Among the 52 patients with advanced gastric cancers who were tested, those having sox2 gene methylation in their cancer tissues had a significantly shorter survival than did those without the methylation (p = 0.006). Exogenous expression of sox2 inhibited cell growth through apoptosis and cell cycle arrest . Sox2-overexpressing cells exhibited characteristics of apoptosis, such as dna laddering and caspase-3 activation . Cell cycle arrest was associated with decreased levels of cyclin d1 and phosphorylated rb as well as an increased p27 level . Reported that zinc - finger transcription factor znf382 functions as a tumor suppressor in many types of carcinomas including gastric cancer . Ectopic expression of znf382 in tumor cells in which the gene was silenced significantly reduced clonogenicity and proliferation and induced apoptosis . Further found that znf382 inhibited nf-b and ap-1 signaling and down - regulated the expression of multiple oncogenes, including myc, mitf, hmga2, cdk6, stat3, stat5b, id1, and ikbke, most likely through heterochromatin silencing . A, pyrosequencing; b, q - msp; c, high - resolution melting (hrm) analysis; d, methylight; e, bisulfit sequencing . Methylation of the ubiquitin carboxyl - terminal hydrolase l1 (uchl1) was detected in primary digestive tumors, including 77% (53/69) of gastric carcinomas, but not in or occasionally in paired adjacent non - tumor tissues . Restoring uchl1 expression in cell lines where the gene had been silenced significantly inhibited their growth and colony formation ability by inhibiting cell proliferation, causing cell cycle arrest in g2/m phase, and inducing apoptosis through the intrinsic caspase - dependent pathway similarly, sdr - related gene product that binds to c - kinase (hsrbc), another novel methylated tumor suppressor gene in gastric cancer, increased the stability of p53 and expression of p53 target genes, such as p21, puma, and noxa . Hsrbc - mediated cell cycle arrest and apoptosis were abolished by blockade of p53 function . These results suggested that epigenetic inactivation of hsrbc contributes to the malignant progression of gastric tumors, in part, through attenuated p53 response to stress . Moreover, opioid binding protein / cell adhesion molecule - like gene (opcml) is also a stress- and p53-responsive gene, but this response is epigenetically impaired when the opcml promoter becomes methylated . Ecotopic expression of opcml led to significant inhibition of both anchorage - dependent and -independent growth of carcinoma cells in which the gene had been silenced . As reviewed above, many methylated tumor suppressor genes in gastric cancer contribute to the dysregulation of the important aspects of tumorigenesis: cell cycle and apoptosis . The understanding of these molecular mechanisms will provide accesses to novel molecular therapeutic strategies for inhibiting oncogenic activity of signaling pathways . Morbidity in most cancer patients is not due to primary cancer but to metastatic disease . The high death rate of gastric cancer strikingly correlates with the high metastatic capacity of most gastric cancers . Thus, understanding tumor progression to the metastatic state and changes in highly aggressive cells is important for the development of novel approaches to diagnose and treat aggressive malignancies . Detachment of cells with increased motility from a primary tumor is the first step of cancer invasion and metastasis . Gastric cancer cells with fibroblastoid morphological changes show increased motility and invasiveness due to decreased cell - cell adhesion, which is reminiscent of epithelial - mesenchymal transition (emt) during embryonic development . The dynamic regulation of cell - cell adhesion is crucial for developmental processes including tumorigenesis . With reduced cell - cell adhesiveness, cancer cells can disobey the social order and result in destruction of the histological structure . A common and early requirement for cell motility is actin polymerization, which drives the formation of cell protrusions that are used to adhere to the extracellular matrix, define the direction of migration and initiate cell crawling . Animal cells respond to signaling at the plasma membrane by remodeling their actin cytoskeleton . On the other hand, the movement of cells into a tightly woven extracellular matrix also require an active proteolytic system, which can cleave a path for cell migration . So the genes regulating the host cell cytoskeleton rearrangement and proteolytic activity also have important functions in cell morphogenesis and motility . Our group reported that epigenetic inactivation of phospholipase c delta 1 (plcd1) is common and tumor - specific in gastric cancer and that plcd1 acts as a functional tumor suppressor in gastric carcinogenesis . Located at the important tumor suppressor locus 3p22, plcd1 encodes an enzyme that regulates energy metabolism, calcium homeostasis, and intracellular movements . Ectopic expression of plcd1 in gastric tumor cells with silenced plcd1 dramatically inhibited clonogenicity and migration, possibly through down - regulation of mmp7 expression and hampered cyto - skeletal reorganization via phosphorylation and inactivation of cofilin . Deleted in liver cancer 1 (dlc1) is another tumor suppressor gene involved in the regulation of cytoskeletal organization and other functions and is frequently methylated in many cancers, including gastric cancer, . Recently, its new isoform, dlc1 isoform 4 (dlc1-i4), was also found to be silenced epigenetically, to have tumor inhibitory properties in multiple carcinomas, and to be regulated by p53 . . The down - regulation of e - cadherin may favor dissociation of cancer cells from one another, facilitating their invasion through the basal membrane . Although mutation and allelic loss have been confirmed as major mechanisms for e - cadherin (cdh1) gene inactivation in many malignancies, cdh1 promoter methylation could be frequently detected in gastric carcinoma . As a co - partner of e - cadherin, -catenin not only is critical for cell adhesion in the membrane and cytoplasm of cells, but also plays a role as a transcription activating protein in nuclei . Aberrant activation of the wnt/-catenin signaling pathway is frequently found in many cancers, including gastric cancer, . In addition to genetic deletions and point mutations, a number of negative regulators of wnt signaling, including secreted frizzled - related protein (sfrp), dickkopf homolog 2 (dkk2), dickkopf homolog 2 (dkk3) and wnt inhibitory factor 1 (wif1), were frequently methylated in gastric cancer. Recently, other genes involving wnt pathway were also reported as methylated tumor suppressor genes in gastric cancer . For example, sry - box containing gene 17 (sox17) was reported to be indispensable for embryonic development and a candidate tumor suppressor gene that antagonizes the canonical wnt/-catenin signaling pathway in colorectal cancer . Treatment with a demethylating agent induced sox17 expression in gastric cancer cells, thus indicating the down - regulation of sox17 by methylation . Transgenic expression of sox17 suppressed dysplastic tumor development in the stomach of k19-wnt1/c2me mice by suppressing wnt activity . These results suggested that sox17 protects benign tumors from malignant progression at an early stage of tumorigenesis, and down - regulation of sox17 contributes to malignant progression through promotion of wnt activity . The popeye domain - containing (popdc) genes bves, popdc2, and popdc3 encode proteins that regulate cell - cell adhesion and cell migration during development . Bves and popdc3 were reported to be hypermethylated in 69% and 64% of the gastric cancer tissues, respectively . Promoter hypermethylation is a causal event for long - term repression of bves and popdc3, whereas egf stimulation is an immediate repression mechanism for both genes in gastric cancer . Bves, popdc3, and e - cadherin mrnas were down - regulated and snail mrna expression was up - regulated in egf - induced emt in snu-216 cells . Interestingly, accumulating evidence suggests that a major subfamily within the cadherin superfamily, protocadherins, frequently act as tumor suppressor genes . Recent studies have shown that the main structural and functional properties of protocadherins are distinct from those of classical cadherins . They may not have the strong cell - cell adhesion activity but do have other functions, such as mediating specificity of cell - cell interactions and signal transduction . Yu et al . Reported that protocadherin 10 (pcdh10) was silenced or down - regulated in 94% (16 of 17) of gastric cancer cell lines . Furthermore, pcdh10 methylation was detected in 82% (85 of 104) of gastric tumors compared with 37% (38 of 104) of paired non - tumor tissues (p <0.001). Re - expression of pcdh10 reduced colony formation in vitro and tumor growth in vivo . It also inhibited cell proliferation, induced cell apoptosis, and repressed cell invasion, possibly through up - regulation of the pro - apoptosis genes fas, caspase 8, jun, and cdkn1a; the anti - proliferation gene fgfr; and the anti - invasion gene htatip2 . In cancer cells, glucose is often converted into lactic acid, which is known as the warburg effect . The reason that cancer cells have a higher rate of aerobic glycolysis, but not oxidative phosphorylation, remains largely unclear . Recently, fructose-1,6-bisphosphatase-1 (fbp1), which functions to antagonize glycolysis, was reported to be down - regulated through the nf-b pathway in ras - transformed nih3t3 cells . Fbp1 was hypermethylated in 57% (4/7) of gastric cancer cell lines and 33% (33/101) of gastric carcinomas . Restoration of fbp1 expression suppressed anchorage - independent growth, indicating the relevance of fbp1 down - regulation in carcinogenesis . Leucine - rich repeat - containing 3b (lrrc3b) is an evolutionary highly conserved leucine - rich repeat - containing protein, but its biological significance is unknown . Recently, lrrc3b was identified as a putative tumor suppressor gene and is reportedly silenced in gastric cancers by epigenetic mechanisms . Stable transfection of lrrc3b in gastric cancer cell line snu-601 inhibited anchorage - dependent and anchorage - independent colony formation . Moreover, lrrc3b expression suppressed tumorigenesis in nude mice . Microarray analysis of lrrc3b - expressing xenograft tumors showed induction of immune response - related genes and ifn signaling genes . Hematoxylin and eosin (h&e)-stained sections of lrrc3b - expressing xenograft tumors showed lymphocyte infiltration in the region . These results suggested that lrrc3b silencing in cancer may play an important role in tumor escape from immune surveillance . As reviewed above, aberrant dna methylation of promoter cpg islands is one of the major inactivating mechanisms of tumor suppressor genes and is deeply involved in gastric carcinogenesis . Moreover, in gastric cancer, dna methylation from the pre - malignant till the most aggressive stage of cancer can be defined . For instance, many genes such as thbd, lox, hrasls, flnc, and hand1 were found to be infrequently methylated in non - cancerous gastric mucosae, in addition to their frequent methylation in cancers . Similar findings were reported for cdh1, dapk, p14, thbs1, and timp-1 . The presence of trace amounts of methylation in non - cancerous gastric mucosae suggested that some gastric carcinogens could have induced the methylation . The most important gastric carcinogenic factor is helicobacter pylori (h. pylori) infection, which increases the risk of developing gastric cancers by 2.2- to 21.0-fold, . Recent studies to quantify dna methylation changes induced by the h. pylori infection in light of imflammatory reactions have been performed in both animal models and in the clinical setting . The findings suggest that h. pylori infection induces aberrant methylation in gastric mucosae and that levels of accumulated methylation are associated with gastric cancer risk . Notably, although h. pylori infection is important to trigger inflammation capable of inducing aberrant dna methylation, some inflammation processes appear to be critical in induction of aberrant dna methylation. Indeed, the inflammation induced by h. pylori infection, not h. pylori itself, was critically involved in methylation induction . H. pylori may induce methylation of promoters containing cpg islands by release of reactive oxygen species (ros) and nitric oxide (no) and by activation of dna methyltransferase, . More recently, sepulveda et al . Suggested that permanent dna methylation after h. pylori eradication may occur in stem cells, thus promoting tumorigenesis . Considering the significant involvement of aberrant dna methylation of cpg islands in human cancers, further identification of the inducing factors and mechanisms can be expected to provide novel targets for cancer prevention . In addition to regional hypermethylation, global hypomethylation is also purported to be a hallmark of cancer cells and is known to cause chromosomal instability as an early event during gastric carcinogenesis . However, yoshida et al . Reported that h. pylori infection potently induces alu and sata hypomethylation in gastric mucosae as an early event during gastric carcinogenesis, whereas global hypomethylation is present only in some individuals . Thus, the use of hypomethylation as a risk marker has not been considered realistic . Aberrant hypermethylation of promoter regions of specific genes is a key event in the formation and progression of cancer . An accumulating number of studies have reported that gene silencing by dna methylation may be established at an early stage in the multistep process of carcinogenesis . Methylations of specific genes or methylation patterns of groups of genes were found to be associated with chemotherapy response and prognosis . Thus, aberrant dna methylation can be applied to cancer diagnostics in three ways: as a marker to detect cancer cells or cancer - derived dna, as a marker to predict prognosis, and as a biomarker for the assessment of therapeutic response . Methylation analysis has an advantage in that it can be performed using chemically stable dna (compared to rna). Moreover, detecting gene methylation is easier than detecting gene mutation because the exact location of a mutation is usually unknown, making it difficult to specifically amplify dna molecules with an embedded mutation in excess of wild - type molecules . Detection of aberrant methylation can provide confirmation of the presence of intact cancer cells or cancer - derived dna in bodily fluids, such as blood, urine, sputum, saliva, and stools . Recently, the methylations of bnip3, chfr, cyp1b1, mint25, sfrp2, and rassf2 were analyzed in 107 specimens of peritoneal fluid by quantitative methylation - specific polymerase chain reaction (msp). The results showed that dna methylation in periotoneal fluid is a possible marker for detecting occult neoplastic cells on the peritoneum . Methylation analysis along with a cytological examination might, therefore, improve the positive detection of cancer cells in the peritoneal fluid of gastric cancer patients . The development of the bisulfate conversion technique that reproducibly changes unmethylated cytosines to uracil but leaves methylated cytosines unchanged rapidly increased progress in dna methylation detection . Bisulfite sequencing, msp, and combined bisulfite restriction analysis (cobra) were all developed on the basis of bisulfite conversion among these technologies, msp is a subjective, gel - based assay and cannot provide quantitative information . To date, several real - time msp methods, such as bisulfite treatment in combination with methylight, quantitative multiplex - msp(qm - msp),, or pyrosequencing, have been developed and used in dna methylation studies . For example, a recent study showed that one pyrosequencing analysis of global and site - specific dna methylation in peripheral blood samples from 105 gastric cancer patients provides quantitative dna methylation values that may serve as important prognostic indicators . However, prior to clinical application, these findings require validation in prospective clinical studies ., an increasing number of drugs targeting dna methylation have been improved to increase efficacy and to decrease toxicity . 5-azacyti - dine, the most successful epigenetic drug to date, is currently recommended as the first - line treatment of high - risk myelodysplastic syndromes (mds). New methods for gene - specific epigenetic modification are being developed and tested in solid tumors . Gastric cancer is a biologically heterogeneous disease with various molecular tumor subsets that likely respond distinctly to therapy . Methylation of genes involved in dna repair and maintaining genome integrity (e.g. Mgmt, hmlh1, wrn, and fancf), as well as genes involved in cell cycle checkpoints (e.g. Chfr, 14 - 3 - 3, cdk10, and p73) all reportedly influence sensitivity to chemotherapeutic drugs, suggesting that dna methylation could serve as a molecular marker for predicting tumor responsiveness to chemotherapy . An investigation of dna methylation using specialized high - throughput platforms can potentially be applied to further stratify patients to individualized therapies . Methylated tumor suppressor genes are being intensively investigated in gastric cancer, but the underlying functions and mechanisms need to be carefully examined . Future investigations of the connections between h. pylori infection, gastric cancer, and epigenetic changes will greatly expand our understanding . We believe that information obtained from studying dna methylation will have an impact on cancer prevention, diagnostics, and treatment, and will contribute to cancer elimination . However, proper selection of methylation markers is crucial for sensitive and specific detection, and further technological advances are necessary in the future.
A 65-year - old man without any symptoms was referred for an operation on the aortic root and ascending aortic aneurysm . He had undergone a total correction of tetralogy of fallot (tof) and aortic valve replacement with mechanical valvular prosthesis 22 years earlier (in 1987, at the age of forty - three). In august 2009, a huge aneurysmal dilatation (9 cm) of aortic root and proximal ascending aorta, severe tricuspid regurgitation, and good left ventricular ejection fraction were found on echocardiography . Computed tomography showed a huge saccular aneurysm of the aortic root and proximal ascending thoracic aorta (fig . 1). The patient underwent a bentall procedure involving a composite conduit with a mechanical valvular prosthesis . The operation also included pulmonary valve replacement using a bioprosthesis, tricuspid annuloplasty, subaortic pannus resection, maze procedure, and coronary artery bypass surgery (saphenous vein to proximal right coronary artery). Because the right coronary artery orifice was deviated to the left side and was close to the aortic annulus, coronary artery bypass surgery was chosen despite availability of the button technique . After the operation, there was the microscopic finding of cystic medial degeneration in the ascending aortic wall (fig . He was discharged on his 37th postoperative day . At follow - up, he remains well 17 months after this latest procedure . In 1997, dodds and colleagues described the first series report about progressive aortic regurgitation and aortic root dilatation after complete, uncomplicated repair of tof . A long - standing volume overload of the aortic root may cause aortic root dilatation in adults with a repaired tof . The right to left shunt through the ventricular septal defect in unrepaired tof increases the volume overload effect on the aortic root . Another causative mechanism for progressive aortic root dilatation intrinsic histological changes were found in tof patients; including medionecrosis, fibrosis, cystic medial necrosis, elastic fragmentation and elastic lamellae disruption . Our patient had initial reparative surgery at the age of forty - three in 1987 . The phrase of the enlarged aorta was described in the record of the first operation ., we did not know why correction was not performed in the initial operation . In 2002, an operation for ascending aortic aneurysm was recommended, but he refused any surgery at that time . The pathologic conditions of aortic root and ascending aorta in repaired tof are no longer a benign problem . In recent reports, these are the first reports of aortic dissection in tetralogy of fallot . After an initial curative operation for tof, meticulous monitoring of aortic root and ascending
The spinocerebellar ataxias (scas) are a group of genetically heterogeneous neurodegenerative disorders characterized by cerebellar, pyramidal, extrapyramidal, cognitive, and peripheral nerve dysfunction in variable combination . Dystonia can be encountered in a small subset of patients with sca, but task - specific dystonia (writer's cramp) is extremely rare and has been reported only in association with stray cases of sca types 6, 7, and 14 worldwide . We report a rare case of genetically confirmed sca type 1 (sca1) with a prominent and disabling writer's cramp . A 48-year - old, nonalcoholic, male police officer, presented to us with 2 years history of very slowly progressive dysarthria and a mild gait imbalance noticed only during running and marching . For the past 4 months, he also complained of an abnormal posturing and stiffness of his right hand while writing . There was no abnormal posturing of the hand, or any other part of the body while carrying out any other activities of daily living . There was no history of any motor or sensory deficit or incoordination of the upper limbs . His history was insignificant and there was no history of a similar illness in his siblings or other family members . On examination, his higher mental functions were preserved and cranial nerves were intact . On motor examination, there was no nystagmus, but a slight slowing of the horizontal and vertical saccades was observed . There was no incoordination in the upper limbs, but the heel - shin test was slightly impaired . A task - specific dystonia in the form of a writer's cramp with lifting of the right index finger off the pen and curling of the thumb and the last two digits was documented while writing . There was no evidence of dystonia at rest or extrapyramidal manifestations such as bradykinesia, rigidity, or tremor in any other part of the body . In view of the history of a very mild, slowly progressive, cerebellar ataxia of long duration, slow saccades, hyperreflexia and a prominent writer's cramp, a possibility of inherited sca with task - specific dystonia was kept . His routine investigations including hemogram, blood sugar, liver, renal, thyroid function tests, and serum vitamin b12 levels were all normal . He tested negative for antibodies to hiv, hepatitis c virus, and hepatitis b surface antigen . Magnetic resonance imaging brain revealed significant cerebellar hemispheric and vermian atrophy [figure 1]. His writer's cramp responded well to botulinum toxin injection with a significant improvement in his handwriting [figure 2]. T1 axial and t2 coronal magnetic resonance imaging brain images showing cerebellar hemispheric and vermian atrophy handwriting specimen before (a) and after (b) botulinum toxin injection dominantly inherited scas are a heterogeneous group (40 and counting) of neurodegenerative disorders identified by specific mutations . They predominantly affect the cerebellum and its connections and are characterized by prominent limb ataxia with impaired balance, gait, speech, and eye movements . Movement disorders in the form of myoclonus, chorea, parkinsonism, tremors, and dystonia have also been described . Dystonia is commonly seen only in sca types 17, 3, and 2 . However, there are case reports of both focal and generalized dystonia in sca types 1, 6, 7, 8, 12, 14, 20, and 36 as well . Sca1 is associated with abnormal cytosine - adenine - guanine repeats on the ataxin 1 gene on chromosome 6 and can be accompanied by cognitive dysfunction, parkinsonism, and dystonia in addition to ataxia . However, extrapyramidal features are more common in sca types 2 and 3 than sca1 . Studied extrapyramidal manifestations in 85 patients of sca types 1, 2, and 3 . Overall dystonia was encountered in 13 of the 85 (15.2%) cases only and was more common in sca2 (17.9%, n = 5/28) and sca3 (17.6%, n = 3/17) than sca1 (12.5%, n = 5/40). In a study by lee et al ., extrapyramidal symptoms were found in 53% sca3 (n = 29) and 12% sca2 patients (n = 17). None of the 6 cases with sca1 had any evidence of extrapyramidal dysfunction in their cohort . Found dystonia in only 9.1% (n = 33) of cases of sca1 as compared to 44.4% (n = 9) cases of sca2 . In contrast to the usual pattern of focal or generalized dystonia reported in sca1, our case presented with a prominent task - specific dystonia in the form of a writer's cramp and added to the clinical spectrum of this subtype . A review of the literature reveals that even in the sca subtypes manifesting with dystonia, task - specific dystonia such as writer's cramp is extremely rare . There are only stray case reports of writer's cramp in sca types 6, 7, and 14 from all over the world [table 1] and no reported case of this association in sca1, as observed in our case . Summary of reported cases of task specific dystonia in spinocerebellar ataxias pathways implicated in the manifestation of dystonia include the cerebello - thalamocortical and basal ganglia - thalamocortical circuits . In a pathoanatomical study of patients with sca1, rb et al . Found neuronal loss and degeneration in these pathways besides the primary motor cortex and cerebellum . It was also seen that the extent of the involvement of these structures correlated well with predominant clinical symptoms that were seen in an individual case . Drr et al . Have observed that the basal ganglia, especially the internal pallidum and the subthalamic nucleus show severe degeneration in sca3 but are relatively spared in sca1 which may account for the more frequent dystonia in sca3 . In sca patients with writer's cramp, the dystonia can precede, accompany or follow the onset of cerebellar ataxia . In our patient, writer's cramp manifested almost 1 years after the onset of the gait ataxia but subsequently became the most prominent and disabling complaint . To the best of our knowledge, this is probably the first case report of sca1 with a task - specific dystonia or writer's cramp . Our case highlights the ever - expanding phenotypic heterogeneity of the sca's in general and sca1 in particular.
Where applicable, please follow the ontology for biomedical investigations: http://obi-ontology.org/page/main_pageimage 1organism / cell line / tissuenih3t3 mouse fibroblasts and transformed nih3t3-k - rassexnasequencer or array typemouse genechip mogene-1_0 -st - v1 arrays (affymetrix)data formatraw data: cel files, normalized data: soft, miniml, txtexperimental factorsimmortalized nih3t3 mouse fibroblasts vs. transformed nih3t3-k - ras mouse fibroblasts cultured at 1 mm glucose and daily treated with 10 m forskolinexperimental featurestranscriptome profiling of genes modulated by pka in immortalized and transformed mouse fibroblasts . Cells were cultured in medium with 1 mm glucose and then treated with fsk . The samples for the microarray analysis were collected at 72 h of culture in low glucose after daily treatments with fsk.consentdata are publicly available the immortalized nih3t3 and the transformed nih3t3-k - ras cell lines were routinely maintained in dmem medium (life technologies) with 10% new born calf serum (life technologies), 25 mm glucose and other supplements as described previously, . All cells were cultured at 37 c in 5% co2 . To perform the array experiments after 16 h, the cells were washed twice with phosphate - buffered saline and incubated in medium (time 0) supplemented with 1 mm glucose instead of 25 mm (fig . Hence pka activation, the cells were daily treated with 10 m forskolin (fsk) (sigma - aldrich) starting from 24 h after medium replacement . Fsk - treated and untreated (dmso) cells were then collected for array analyses at 72 h of culture in low glucose medium, which corresponds to 48 h of fsk - treatment (fig . The basal and the fsk - induced camp levels as well as the pka activation in both cell lines are described in, . Cells were lysed in trizol (invitrogen, carlsbad, ca) and total rna was further purified with the rneasy kit (qiagen, hilden, germany) following manufacturer instructions . Rna quality and integrity was determined by an agilent 2100 bioanalyzer (agilent technologies, santa clara, ca) on rna nano chips . Single strand biotinylated cdna was generated as follows: 100 ng of total rna were subjected to 2 cycles of cdna synthesis with the ambion wt expression kit (life technologies). The first cycle - first strand synthesis is performed using an engineered set of random primers that exclude rrna - matching sequences and include the t7 promoter sequences . After second - strand synthesis, the resulting cdna is in vitro transcribed with the t7 rna polymerase to generate a crna . This crna is subjected to a second cycle - first strand synthesis in the presence of dutp in a fixed ratio relative to dttp . Single strand cdna is then purified and fragmented with a mixture of uracil dna glycosylase and apurinic / apirimidinic endonuclease 1 (affymetrix) in correspondence of incorporated dutps . Dna fragments are then terminally labeled by terminal deoxynucleotidyl transferase (affymetrix) with biotin . The biotinylated dna was hybridized to the mouse genechip mogene-1_0 -st - v1 arrays (affymetrix), containing almost 23000 genes selected from mus musculus genome databases refseq, ensembl and genbank . Chips were washed and scanned on the affymetrix complete genechip instrument system, generating digitized image data (dat) files . Data where then normalized using a global normalization approach with the affymetrix gene expression console software, generating the .cel files microarray analysis was performed on biological triplicate samples . Labeling of cdna and hybridization to mouse mogene-1_0 -st - v1 arrays were performed at the irgs, biogem, ariano irpino (av), italy . The samples included (see table 1): 1) gsm1666885, immortalized nih3t3 mouse fibroblasts replicate 1, 2) gsm1666886, immortalized nih3t3 mouse fibroblasts replicate 2, 3) gsm1666887, immortalized nih3t3 mouse fibroblasts replicate 3, 4) gsm1666888, nih3t3-k - ras transformed mouse fibroblasts replicate 1, 5) gsm1666889, nih3t3-k - ras transformed mouse fibroblasts replicate 2, 6) gsm1666890, nih3t3-k - ras transformed mouse fibroblasts replicate 3, 7) gsm1666891, immortalized nih3t3 mouse fibroblasts treated with fsk replicate 1, and 8) gsm1666892, immortalized nih3t3 mouse fibroblasts treated with fsk replicate 2, 9) gsm1666893, immortalized nih3t3 mouse fibroblasts treated with fsk replicate 3, 10) gsm1666894, nih3t3-k - ras transformed mouse fibroblasts treated with fsk replicate 1, 11) gsm1666895, nih3t3-k - ras transformed mouse fibroblasts treated with fsk replicate 2, 12) gsm1666896, nih3t3-k - ras transformed mouse fibroblasts treated with fsk replicate 3 . All samples were normalized through the robust multi - array average (rma) method with background correction and quantile normalization at core genes level as implemented by the r / bioconductor package differential expression analysis was performed using a linear model approach with least - square fitting and false discovery rate correction as provided by the r / bioconductor package two differential expression tests (contrasts) were performed: untreated normal cells vs. fsk - treated normal cells - denoted as nf / n - and untreated transformed cells vs. fsk - treated transformed cells - denoted as tf / t . Only the probe of each gene having the minimum average p - value in the two contrasts has been kept . There were 496 genes (probes) with absolute log fold - change at least 1 for contrast nf / n and 208 genes for contrast tf / t . To gain a better understanding of the biological implications of these expression profiles, we performed a comprehensive gene set analysis of the differential expression results using the implementation provided by the r / bioconductor package the analysis used as gene sets the 202 kegg pathways classified as metabolic or signaling as downloaded on jan . The pathways contain 6885 unique genes of which 6010 are included in the analysis dataset (approx . Piano provides the implementation of several gene set analysis tests and of a consensus methodology to summarize the results obtained with the different tests . This approach should be less sensitive to possible hidden biases of the single tests and allows, for example, the integration of sources of gene expression data with other types of high throughput data like proteomic data obtained by 2-dige . The following tests have been performed: a)meanb)medianc)sumd)maxmeane)gene set enrichment analysis (gsea)f)parametric analysis of gene set enrichment (page)g)reporter featuresh)wilcoxon rank - sum testi)tail strength . Gene set enrichment analysis (gsea) parametric analysis of gene set enrichment (page) wilcoxon rank - sum test tests (a)(f) used t - values computed in the differential expression analysis while tests (g)(i) used the corresponding p - values (and log fold changes, for devising the directionality). Tests (f), (g), (h) computed gene set statistics significance via the theoretical null distribution, while the remaining ones via gene (re)sampling . Each test may return distinct p - values for each gene set (i.e., pathway) in the following directionality classes: distinct - directional (up or down), indicated as dist(up) and dist(down), which tests if the expression of the gene set as a whole is regulated in a distinct direction (either up or down). By definition, a gene set cannot be significant in both classes as regulations in opposite directions will cancel out the effect.mixed-directional (up or down), indicated as mix(up) and mix(down), which tests if a significant subset of its genes are coordinately up- or down - regulated . A gene set can be significant in both classes.non-directional, indicated as nondir, which tests if the expression of the gene set as a whole is significantly perturbed, discarding any information about directionality . Distinct - directional (up or down), indicated as dist(up) and dist(down), which tests if the expression of the gene set as a whole is regulated in a distinct direction (either up or down). By definition, a gene set cannot be significant in both classes as regulations in opposite directions will cancel out the effect . Mixed - directional (up or down), indicated as mix(up) and mix(down), which tests if a significant subset of its genes are coordinately up- or down - regulated . Non - directional, indicated as nondir, which tests if the expression of the gene set as a whole is significantly perturbed, discarding any information about directionality . A total of 35 p - value vectors over the 45 possible combinations for each contrast have been obtained since not all tests returned results for all the directionality classes . The combined analysis of the p - values obtained by each gene set in the various directionality classes provides a clear picture of the (possible) regulation of that gene set . Consistency of the results has been empirically verified by computing the pairwise correlation between the p - value vectors . 2 depicts the correlation matrices of the p - value vectors of contrast nf / n on the left and of contrast directionality classes of the p - value vectors are indicated by the annotation bars on the top and on the left of the two plots, while letters refer to the different gene set analysis tests as per the previous list . According to the plots, p - value vectors of the same directionality class (obtained with different tests) have strong correlation (see, for example, the class dist(dn)), p - value vectors of similar classes have a non - negligible correlation (see, for example, mix(dn) and dist(dn)) and p - value vectors of opposite classes are inversely correlated (see, for example, dist(dn) and dist(up)). Further confirmation is provided by the dendograms depicted on the sides, showing that tests of the same directionality class cluster together . The only exception is test (i) tail strength for the distinct down - directional class on both contrasts . Despite that, the p - values of the gene sets on these classes still appear to be in accordance (albeit less correlated) with the rest of the results and represent only a small perturbation that the final consensus analysis should easily accommodate . Principal component analysis (pca) of the same set of vectors provides a second empirical support to the consistency of the results computed by the different tests . 3 depicts each p - value vector (represented as the corresponding letter, see the list above) for contrast nf / n (left) and contrast tf / t (right) in the space of its first three principal components (x- and y - axes and size). Ideally, each directionality class (represented by colors) should cluster together in the resulting space . The most evident outliers are those computed by test (i) for the distinct down - directional class, that are placed near the vectors of the mixed down - directional class . Piano computes the overall consensus rank by first ranking each gene set in each directionality class for each method according to the predicted p - value . These ranks are then aggregated according to the borda rule (a single - winner election method). 4 depicts the aggregated ranks obtained by the gene sets that ranked in the first 5 positions in at least one directionality class . Directionality classes are represented as columns while numbers and colors represent the position of each gene set (row) in the aggregated rank of that column for both contrast nf / n (left block) and contrast tf / t (right block). In general, a pathway can be considered significantly regulated in a particular directionality class if it ranks in the first positions (albeit a general cut - off does not exist). As expected, pathways ranking high (i.e., small numbers) in a directionality class (see, for example, ribosome biogenesis in eukaryotes) are ranked low (large numbers) in the opposite directionality class . Such a representation provides a clear and concise comparison of the regulation of pathways in the two contrasts, highlighting common regulation of pathways in normal and transformed cells, like ribosome biogenesis in eukaryotes, down - regulated in both nf / n and tf / t, and specific pathway regulations, different for the two cell lines, like the up - regulation of pathway steroid biosynthesis detected in tf / t but not in nf / n . The immortalized nih3t3 and the transformed nih3t3-k - ras cell lines were routinely maintained in dmem medium (life technologies) with 10% new born calf serum (life technologies), 25 mm glucose and other supplements as described previously, . All cells were cultured at 37 c in 5% co2 . To perform the array experiments after 16 h, the cells were washed twice with phosphate - buffered saline and incubated in medium (time 0) supplemented with 1 mm glucose instead of 25 mm (fig . Hence pka activation, the cells were daily treated with 10 m forskolin (fsk) (sigma - aldrich) starting from 24 h after medium replacement . Fsk - treated and untreated (dmso) cells were then collected for array analyses at 72 h of culture in low glucose medium, which corresponds to 48 h of fsk - treatment (fig . The basal and the fsk - induced camp levels as well as the pka activation in both cell lines are described in, . Cells were lysed in trizol (invitrogen, carlsbad, ca) and total rna was further purified with the rneasy kit (qiagen, hilden, germany) following manufacturer instructions . Rna quality and integrity was determined by an agilent 2100 bioanalyzer (agilent technologies, santa clara, ca) on rna nano chips . Single strand biotinylated cdna was generated as follows: 100 ng of total rna were subjected to 2 cycles of cdna synthesis with the ambion wt expression kit (life technologies). The first cycle - first strand synthesis is performed using an engineered set of random primers that exclude rrna - matching sequences and include the t7 promoter sequences . After second - strand synthesis, the resulting cdna is in vitro transcribed with the t7 rna polymerase to generate a crna . This crna is subjected to a second cycle - first strand synthesis in the presence of dutp in a fixed ratio relative to dttp . Single strand cdna is then purified and fragmented with a mixture of uracil dna glycosylase and apurinic / apirimidinic endonuclease 1 (affymetrix) in correspondence of incorporated dutps . Dna fragments are then terminally labeled by terminal deoxynucleotidyl transferase (affymetrix) with biotin . The biotinylated dna was hybridized to the mouse genechip mogene-1_0 -st - v1 arrays (affymetrix), containing almost 23000 genes selected from mus musculus genome databases refseq, ensembl and genbank . Chips were washed and scanned on the affymetrix complete genechip instrument system, generating digitized image data (dat) files . Data where then normalized using a global normalization approach with the affymetrix gene expression console software, generating the .cel files labeling of cdna and hybridization to mouse mogene-1_0 -st - v1 arrays were performed at the irgs, biogem, ariano irpino (av), italy . The samples included (see table 1): 1) gsm1666885, immortalized nih3t3 mouse fibroblasts replicate 1, 2) gsm1666886, immortalized nih3t3 mouse fibroblasts replicate 2, 3) gsm1666887, immortalized nih3t3 mouse fibroblasts replicate 3, 4) gsm1666888, nih3t3-k - ras transformed mouse fibroblasts replicate 1, 5) gsm1666889, nih3t3-k - ras transformed mouse fibroblasts replicate 2, 6) gsm1666890, nih3t3-k - ras transformed mouse fibroblasts replicate 3, 7) gsm1666891, immortalized nih3t3 mouse fibroblasts treated with fsk replicate 1, and 8) gsm1666892, immortalized nih3t3 mouse fibroblasts treated with fsk replicate 2, 9) gsm1666893, immortalized nih3t3 mouse fibroblasts treated with fsk replicate 3, 10) gsm1666894, nih3t3-k - ras transformed mouse fibroblasts treated with fsk replicate 1, 11) gsm1666895, nih3t3-k - ras transformed mouse fibroblasts treated with fsk replicate 2, 12) gsm1666896, nih3t3-k - ras transformed mouse fibroblasts treated with fsk replicate 3 . All samples were normalized through the robust multi - array average (rma) method with background correction and quantile normalization at core genes level as implemented by the r / bioconductor package differential expression analysis was performed using a linear model approach with least - square fitting and false discovery rate correction as provided by the r / bioconductor package two differential expression tests (contrasts) were performed: untreated normal cells vs. fsk - treated normal cells - denoted as nf / n - and untreated transformed cells vs. fsk - treated transformed cells - denoted as tf / t . Only the probe of each gene having the minimum average p - value in the two contrasts has been kept . There were 496 genes (probes) with absolute log fold - change at least 1 for contrast nf / n and 208 genes for contrast tf / t . To gain a better understanding of the biological implications of these expression profiles, we performed a comprehensive gene set analysis of the differential expression results using the implementation provided by the r / bioconductor package the analysis used as gene sets the 202 kegg pathways classified as metabolic or signaling as downloaded on jan . The pathways contain 6885 unique genes of which 6010 are included in the analysis dataset (approx . Package piano provides the implementation of several gene set analysis tests and of a consensus methodology to summarize the results obtained with the different tests . This approach should be less sensitive to possible hidden biases of the single tests and allows, for example, the integration of sources of gene expression data with other types of high throughput data like proteomic data obtained by 2-dige . The following tests have been performed: a)meanb)medianc)sumd)maxmeane)gene set enrichment analysis (gsea)f)parametric analysis of gene set enrichment (page)g)reporter featuresh)wilcoxon rank - sum testi)tail strength . Gene set enrichment analysis (gsea) parametric analysis of gene set enrichment (page) wilcoxon rank - sum test tests (a)(f) used t - values computed in the differential expression analysis while tests (g)(i) used the corresponding p - values (and log fold changes, for devising the directionality). Tests (f), (g), (h) computed gene set statistics significance via the theoretical null distribution, while the remaining ones via gene (re)sampling . Each test may return distinct p - values for each gene set (i.e., pathway) in the following directionality classes: distinct - directional (up or down), indicated as dist(up) and dist(down), which tests if the expression of the gene set as a whole is regulated in a distinct direction (either up or down). By definition, a gene set cannot be significant in both classes as regulations in opposite directions will cancel out the effect.mixed-directional (up or down), indicated as mix(up) and mix(down), which tests if a significant subset of its genes are coordinately up- or down - regulated . A gene set can be significant in both classes.non-directional, indicated as nondir, which tests if the expression of the gene set as a whole is significantly perturbed, discarding any information about directionality . Distinct - directional (up or down), indicated as dist(up) and dist(down), which tests if the expression of the gene set as a whole is regulated in a distinct direction (either up or down). By definition, a gene set cannot be significant in both classes as regulations in opposite directions will cancel out the effect . Mixed - directional (up or down), indicated as mix(up) and mix(down), which tests if a significant subset of its genes are coordinately up- or down - regulated . Non - directional, indicated as nondir, which tests if the expression of the gene set as a whole is significantly perturbed, discarding any information about directionality . A total of 35 p - value vectors over the 45 possible combinations for each contrast have been obtained since not all tests returned results for all the directionality classes . The combined analysis of the p - values obtained by each gene set in the various directionality classes provides a clear picture of the (possible) regulation of that gene set . Consistency of the results has been empirically verified by computing the pairwise correlation between the p - value vectors . 2 depicts the correlation matrices of the p - value vectors of contrast nf / n on the left and of contrast tf / t on the right . Directionality classes of the p - value vectors are indicated by the annotation bars on the top and on the left of the two plots, while letters refer to the different gene set analysis tests as per the previous list . According to the plots, p - value vectors of the same directionality class (obtained with different tests) have strong correlation (see, for example, the class dist(dn)), p - value vectors of similar classes have a non - negligible correlation (see, for example, mix(dn) and dist(dn)) and p - value vectors of opposite classes are inversely correlated (see, for example, dist(dn) and dist(up)). Further confirmation is provided by the dendograms depicted on the sides, showing that tests of the same directionality class cluster together . The only exception is test (i) tail strength for the distinct down - directional class on both contrasts . Despite that, the p - values of the gene sets on these classes still appear to be in accordance (albeit less correlated) with the rest of the results and represent only a small perturbation that the final consensus analysis should easily accommodate . Principal component analysis (pca) of the same set of vectors provides a second empirical support to the consistency of the results computed by the different tests . 3 depicts each p - value vector (represented as the corresponding letter, see the list above) for contrast nf / n (left) and contrast tf / t (right) in the space of its first three principal components (x- and y - axes and size). Ideally, each directionality class (represented by colors) should cluster together in the resulting space . The most evident outliers are those computed by test (i) for the distinct down - directional class, that are placed near the vectors of the mixed down - directional class . This confirms the observation made before for fig . 2 and, again, this should not represent an issue for the consensus analysis . Piano computes the overall consensus rank by first ranking each gene set in each directionality class for each method according to the predicted p - value . These ranks are then aggregated according to the borda rule (a single - winner election method). 4 depicts the aggregated ranks obtained by the gene sets that ranked in the first 5 positions in at least one directionality class . Directionality classes are represented as columns while numbers and colors represent the position of each gene set (row) in the aggregated rank of that column for both contrast nf / n (left block) and contrast tf / t (right block). In general, a pathway can be considered significantly regulated in a particular directionality class if it ranks in the first positions (albeit a general cut - off does not exist). As expected, pathways ranking high (i.e., small numbers) in a directionality class (see, for example, ribosome biogenesis in eukaryotes) are ranked low (large numbers) in the opposite directionality class . Such a representation provides a clear and concise comparison of the regulation of pathways in the two contrasts, highlighting common regulation of pathways in normal and transformed cells, like ribosome biogenesis in eukaryotes, down - regulated in both nf / n and tf / t, and specific pathway regulations, different for the two cell lines, like the up - regulation of pathway steroid biosynthesis detected in tf / t but not in nf / n . The microarray data and the piano computational approach here presented, have allowed to the identification of significant pro - survival processes, otherwise hidden, regulated by pka in glucose deprivation . A part from our approach, these data could be further used to uncover other mechanisms of cancer resistance mediated by pka, whose role in cancer progression has assumed great relevance in recent years,,.
The bacterial agents of infectious keratitis that have been studied in considerable detail are three of the most common causes of such infections, namely, staphylococcus aureus, streptococcus pneumoniae, and pseudomonas aeruginosa . The mechanisms underlying the tissue damage occurring during these infections have been studied in animal models . These infections are initiated by injection of bacteria into the corneal stroma, usually of new zealand rabbits, or by the application of a topical drop of bacteria to a scarified cornea, usually of a mouse . Important to this research is the relative virulence of three forms of a bacterial strain, namely, the unaltered parent strain, its mutant deficient in a single specific gene coding for a secreted protein, and that same mutant strain following insertion of a functional copy of the mutated gene, a rescued strain . If the parent and rescue strains have statistically equivalent virulence and the mutant has significantly less virulence, then the mutated gene is recognized as a key virulence factor for the cornea . An additional method for establishing a specific gene as a virulence factor is to demonstrate that insertion of this specific gene into a nonpathogenic strain can significantly increase the virulence . These types of genetic analysis of virulence have defined multiple virulence factors for each of the three organisms commonly causing keratitis . The importance of secreted proteins to keratitis can be illustrated by the study of certain nonpathogenic strains of bacteria . One observation that is not generally recognized, but is very important to consider, is that bacteria can be injected into a rabbit cornea and there grow from a small inoculum to millions of bacteria without causing any harm to the eye [4, 5]. For instance, pseudomonas putida has been shown to grow well without mediating inflammation or corneal damage . This organism has lps and other surface molecules, but it does not secrete proteins with corneal toxicity . This harmless infection is unlike that seen in an infection with the same p. putida strain after it has been modified by the insertion of a plasmid bearing a single p. aeruginosa gene coding for a secreted protease known to be a corneal virulence factor . In fact, the secretion of any one of the three known p. aeruginosa proteases can result in a virulent infection . The value of knowing the mechanisms of bacterial corneal virulence relates to the need to limit such mechanisms before the tissue damage deprives the eye of vision . Application of an antibiotic to an infected eye can eliminate the infecting bacteria, but the damaging bacterial proteins already secreted can continue to mediate harmful inflammation and act directly to damage the cornea . The inclusion of a steroid during antibiotic therapy helps control the inflammatory process, but the actions of the secreted proteins are not affected by such therapy [7, 8]. Knowledge of the key mediators of tissue damage must be known to allow subsequent development of adjunct therapies to limit the action of these bacterial proteins . The prospect of using the immune system to inhibit these secreted bacterial proteins has a merit, but the bacterial enzymes found to be active in damaging corneal tissue may be poor immunogens or the antibody produced may not be effective in impeding the enzymatic activity . Thus, the mechanisms of keratitis have partially evaded the benefit of our current therapies . Also problematic is the emergence of bacteria with greater resistance to those antibiotics that were highly successful for many previous years; delays in obtaining an effective therapy provides time for the bacterial population to expand and to continue secreting the damaging proteins . Pseudomonas corneal infections typically are associated with the use of contact lenses; that is, this is a man - made disease which was rarely a problem during the centuries prior to the contact lens use [1012]. The organism, seen as a single gram - negative rod, is found in the environment, especially in moist places, so it is often available to contaminate the contact lens cases . Its adherence to plastic, coupled with its resistance to disinfectants, favors its introduction into the eye . These organisms can react with a corneal defect in the epithelium and they can pass through the epithelial barrier to the corneal stroma . Once these organisms reach the corneal stroma, the infections can rapidly progress toward melting of the cornea, an event attributed to the bacterial proteases, the activation of matrix metalloproteinases, and a damaging immune response that delivers among other things both reactive oxygen intermediates and host proteases . P. aeruginosa is capable of secreting at least seven different proteases; these are elastase a (las a), elastase b (las b), modified elastase, alkaline protease (ap), protease iv, pseudomonas aeruginosa small protease (pasp), and the large exoprotease (lep a). Las a, las b, modified elastase, and ap are metalloproteinases and may be produced by only some strains . These metalloproteases, especially las b and ap, have been well studied in terms of their potential contribution to keratitis . These enzymes, especially las b, upon injection into the corneal stroma can mediate considerable corneal damage [18, 19]. However, mutation of any one of these genes does not result in significantly reduced virulence of the organism [2022]. Also, data exist showing that a strain with the potential to produce las b fails to produce the enzyme during keratitis . P. putida, when supplied with a plasmid - borne gene for las b, secretes las b and demonstrates significant virulence in the infected rabbit cornea . Lep a is a large protease that has been postulated to be a serine protease [16, 24]. The enzyme has been shown to be a virulence factor in a nonocular model of infection, but to date there are no published studies of its role in an ocular infection . An important study on lep a showed that this enzyme can cleave a host transmembrane protein, designated the protease - activated receptor, which, when cleaved, can induce the production of cytokines . This study helps explain the inflammation that results when the bacteria producing proteases interact with corneal cells . This finding may also clarify the failure of p. putida to cause inflammatory changes as it grows in the cornea whereas the same stain engineered to produce a p. aeruginosa protease causes significant inflammation . In contrast to the findings with the metalloproteases, the serine protease piv is produced by essentially all strains able to cause keratitis [25, 26]. Mutation of the piv gene has been shown to reduce the corneal virulence and the corneal virulence was restored following the insertion into the mutant strain of a plasmid coding for functional piv . When a piv - coding plasmid was inserted into p. putida, the organism acquired a significant amount of corneal virulence . Piv is able to cleave many proteins; in fact, few proteins with lysine escape cleavage by this protease [27, 28]. . Cleaved by piv are a variety of host defense proteins including immunoglobulins, complement components, antimicrobial peptides, and surfactants [2729]. This protease contributes to virulence yet it is inefficient in cleaving collagens, the chief structural component of the corneal stroma . Piv has a molecular weight of 27,384 daltons and it can aggregate following exposure to sds to enzymatically active masses of> 200,000 daltons [27, 28]. Extensive immunizations with recombinant piv were needed to produce even a relatively small amount of antibody to recombinant piv or native piv . The antibodies that were produced failed to inhibit the piv catalytic activity or to provide protection from corneal damage due to the injection of active enzyme . The enzyme activity is susceptible to tlck, a serine protease inhibitor, but unfortunately tlck is highly toxic for eyes . The development of a nontoxic inhibitor could be very useful as an adjunct therapy for treating these infections . The pasp protease has recently been analyzed relative to its role in keratitis and its properties as an enzyme [15, 30, 31]. The pasp gene is found in all strains tested and western blots of culture supernatants indicate that it is commonly expressed and secreted by both clinical isolates and established lab strains . A mutant lacking the pasp gene was engineered and found to have significantly less virulence than its parent or its rescued strain . The reduced virulence of the pasp - deficient mutant was demonstrated in both the rabbit intrastromal injection model and the mouse scratch model of keratitis . Injection of purified pasp into the rabbit cornea results in the destruction of the epithelium and the formation of erosions that can reach into the stroma . Pasp, like piv, is not neutralized by antibody to the recombinant pasp protein and the antibody does not protect the cornea from the injected enzyme or active infection . The native pasp protein as found in culture supernatants has a molecular weight of 18,500 daltons [15, 30]. Studies of the purified enzyme or its recombinant protein showed that, unlike piv, pasp does not efficiently cleave many host proteins [15, 30]. However, pasp is able to cleave collagens and this trait further distinguishes pasp from piv . Cleavage of collagen by pasp suggests that this enzyme could be important in the destruction of the cornea . Pasp will cleave peptides with lysine or arginine and it can convert poly - l - arginine or poly - l - lysine to small peptides and free amino acids . Pasp appears to be a serine protease that is susceptible to serine protease inhibitors (e.g., tlck) and partially inhibited, in a non - dose - dependent fashion, by high concentrations of edta (> 100 mm). Enzymatic activity may require the formation of a homodimer in order to create the triad of three amino acids that form the active catalytic site . The possibility exists that piv provides the bacteria with a defense against multiple host defense molecules whereas pasp is active in cleaving the collagen - based structure of the cornea . Once a sizeable population of p. aeruginosa is established in a tissue site, a great deal of host response and tissue damage occurs before the infection is cleared . Recent attention has been given to s. pneumoniae (pneumococcus) as a major cause of conjunctivitis outbreaks; however, this organism is also a common cause of infectious keratitis . Some epidemiologic studies identify the pneumococcus as the top cause of bacterial keratitis [3239]. Most other reports show this bacterium and other streptococcus species to be the causative agents most commonly encountered after p. aeruginosa and/or s. aureus [4049]. Pneumococcal keratitis is not typically contact lens associated like p. aeruginosa, but predisposing conditions such as ocular trauma or surgery are factors in this disease [32, 33, 36, 39, 41, 48, 5054]. The outer capsule of s. pneumoniae, while not protein but rather polysaccharide in composition, is likely the single most studied virulence factor of this bacterium . Pneumococcus normally resides in the human nasopharynx, and studies that date back to early bacterial virulence and transformation experiments such as those of griffith and avery et al . Determined that the polysaccharide capsule (i.e., the characteristic that provides a smooth colony appearance) is the component necessary for s. pneumoniae to establish virulence and survive the host immune system . The central dogma of pneumococcal virulence in infections such as pneumonia, otitis media, meningitis, and septicemia is that noncapsular bacteria are avirulent . This long held rule was proven to be untrue for keratitis, as noncapsular strains were shown to cause as severe keratitis as their capsular counterparts in intrastromal infection models [57, 58]. Other than the capsule, the pneumococcus possesses a variety of proteins that have been characterized as virulence factors in nonocular models of disease . One such protein is pneumolysin, which is a toxin belonging to the family of bacterial cholesterol - dependent cytolysins . Pneumolysin is a 53 kda protein that does not possess any known secretion signal sequence . This cytolysin was long thought to be an intracellular protein released from the bacteria upon cell lysis [5961] and more recently reported to be cell wall associated . The mode of action of pneumolysin is the binding of monomers to cholesterol in host cell membranes, oligomerization at the membrane into 3050 mers, and pore formation resulting in host cell lysis [6365]. Lower concentrations of pneumolysin have been reported to stimulate leukocyte migration and activate complement, thus stimulating the host inflammatory response and causing immunomediated damage to host tissues . Johnson and allen first identified pneumolysin as responsible for ocular tissue damage during pneumococcal keratitis and characterized the biochemical features in vitro and the role in corneal virulence in vivo [68, 69]. Pneumolysin was verified to play a major role in keratitis as evidenced by reduced corneal virulence of a pneumolysin - deficient strain of s. pneumoniae compared to its parent strain in a rabbit intrastromal infection model . Mutation of the complement activation domain of pneumolysin also resulted in decreased corneal virulence, particularly inflammation . Added to these findings was that induction of leukopenia in rabbits resulted in significantly decreased severity of corneal damage following challenge with purified pneumolysin, indicating that pneumolysin was at least partly responsible for triggering the inflammatory response and causing immunomediated damage . Moreover, these and more recent studies have shown that pneumococcal keratitis continues to worsen in animal models when the bacteria have either reached a very low number or have been completely cleared [58, 71, 73, 74], underscoring the fact that corneal damage occurs despite eradication of the bacteria by antibiotics . Efforts to find feasible pneumolysin inhibitors for the cornea have led to the use of soluble cholesterol as a topical therapy . Cholesterol was long known to be effective in inhibiting the hemolytic activity of pneumolysin in vitro, so this concept was employed in vivo . Topical cholesterol was shown to significantly reduce corneal inflammation in pneumococcal keratitis, purportedly by acting as a competitor for host cholesterol and neutralizing pneumolysin [76, 77]. Another attempt at targeting pneumolysin was the use of active and passive immunization in an animal model of keratitis [73, 78]. Proteins other than pneumolysin have been shown to be important for virulence in nonocular pneumococcal diseases but have not been associated with keratitis to date . Choline - binding proteins such as pneumococcal surface proteins a and c (pspa and pspc) are anchored by their bonds to choline in the cell wall . Other proteins are those containing lpxtg motifs that are recognized by bacterial sortase enzymes and are placed on the cell surface . One pneumococcal lpxtg protein of interest is neuraminidase a (nana), which cleaves n - acetylneuraminic acid from host cell components and is suggested to be important for the binding of pneumococci to conjunctival epithelial cells by degrading host cell mucin . A variety of surface - associated proteins that do not fall into the categories of choline - binding proteins or lpxtg proteins have also been identified as involved in adherence, immune evasion, immune activation, and enzymatic reactions in nonocular models . Finally, at least four zinc metalloproteinases, including an iga protease, have been identified with conflicting reports of their cellular locations . One of these proteases, zmpc, has recently been shown to induce ectodomain shedding of a membrane - associated mucin from cultured conjunctival and corneal epithelial cells . Much remains unknown, however, as to the factors other than pneumolysin that contribute to pneumococcal keratitis . S. aureus is the most common cause of bacterial keratitis and an important cause of other ocular infections [8287]. This gram - positive coccus is found in human carriers who retain the organism in their anterior nares, throat, and perianal body sites . Specific strains of bacteria found in the flora around the eye provide the source of organisms that infect the eye . Humans are one reservoir for this organism, and multiple animals, especially pigs, have had an important role in the epidemiology of s. aureus . Keratitis occurs in individuals whose eyes are compromised by any of multiple changes including ocular surgery, contact lens use, trauma, viral infection, or other illnesses [9193]. S. aureus is well known for its ability to evolve mechanisms of antibiotic resistance, making these infections among the most difficult to treat, and antibiotic resistance has increased since 2000 [9497]. Although the antibiotic resistance of s. aureus is well known, what is less well recognized is that the gene transfer mechanisms that created the highly resistant strains can also transfer virulence traits [98100]. Bacteriophage provides horizontal transfer of individual genes as well as clusters of virulence traits in a genetic unit designated as a pathogenicity island . Individual strains can develop a set of genes that allow their emergence as a cause of life - threatening infections . S. aureus has been shown to bind to human corneal cells in culture, a reaction mediated by the fibronectin - binding protein on the bacterial surface . Binding to the cornea can also be mediated by a collagen - binding adhesin on the s. aureus surface . Despite this binding ability and the availability of organisms from the flora surrounding the eye, keratitis infrequently develops . Possibly the greatest barrier protecting the eye is the bactericidal enzyme phospholipase a2, a component of the tear film [103, 104]. Once inflammation occurs in the anterior portion of the eye, the amount of phospholipase a2 increases, thus enhancing protection against bacteria . The topical application of s. aureus to a scarified rabbit cornea typically fails to cause an infection and results in the rapid loss of the bacteria . An active infection of the rabbit cornea has been achieved by treating a bacterial inoculum on a contact lens with spermidine and applying spermidine to the eye both before and after applying the contaminated lens to the corneal surface . Spermidine is able to bind to the bacterial surface and prevent bacterial killing by phospholipase a2 . There is, however, one unique strain of s. aureus that can infect the scarified cornea without any other treatments; this strain is susceptible to the bactericidal action of tears but has demonstrated an enhanced invasion of human corneal epithelial cells in vitro [unpublished finding]. These data suggest that keratitis is dependent on bacterial binding and rapid penetration of the corneal epithelium . The events occurring once bacteria reach the corneal stroma have been studied in some detail . The virulence of a prototype s. aureus strain (8325 - 4) following its injection into the rabbit cornea was significantly reduced by a mutation of the gene coding for alpha - toxin, a lytic cytotoxin produced by nearly all s. aureus strains . The alpha - toxin rescue strain had corneal virulence equivalent to that of the parent strain . Nanogram quantities of purified alpha - toxin were shown to cause extensive sloughing of the corneal epithelium, corneal edema, and severe iritis . The importance of this toxin was found also in the infection of the mouse cornea [108, 109]. Alpha - toxin is now recognized as the critical virulence factor in s. aureus pneumonia in humans . Research on the alpha - toxin's mechanism of action indicates that the toxin enters the cytoplasmic membrane and moves laterally until seven subunits unite into a circular arrangement forming a pore in the cytoplasmic membrane . The individual toxin molecules are thought to interact with caveolin-1 in the membrane to form a pore [111113]. Inhibitors of the alpha - toxin - mediated lysis of erythrocytes have been developed by inserting lipid molecules into a cyclodextrin ring [114, 115]. One such inhibitor containing cholesterol has been shown to reduce the virulence of infections of the rabbit cornea . As was described above, the cyclodextrin - based inhibitor active against alpha - toxin is also active against pneumolysin . Alpha - toxin is not the only virulence factor contributing to the tissue damage during s. aureus keratitis; important also is gamma - toxin, a two - component toxin produced by nearly all s. aureus strains [116, 117]. Deletion of the gamma - toxin genes from a prototype strain, strain newman, resulted in a significant loss in corneal virulence and restoration of these genes enhanced the virulence back to that produced by the parent strain . A mutation in gamma - toxin or inhibition of this toxin has also been shown to reduce the virulence of endophthalmitis caused by s. aureus [119, 120]. Gamma - toxin is composed of an f component and an s component that are each nontoxic when tested alone [121, 122]. The s component is thought to bind to the target cell and only then will the f component bind . The combination of f and s can move laterally in the cell membrane and multiple f - s pairs can combine into a ring that penetrates the membrane causing cell lysis [122124]. A cyclodextrin - based inhibitor for the gamma - toxin has very recently been identified as an inhibitor of the gamma - toxin - mediated lysis of erythrocytes, but it has not been tested yet in infected corneas . Gamma - toxin is only one of several two - component toxins produced by s. aureus and each has its own f and s components . Gamma - toxin is composed of two proteins, either hlga and hlgb or hlgc and hlgb; likewise the panton - valentine leucocidin (pvl), a well - recognized toxin, is composed of its two proteins, lukf - pv and luks - pv . Lesser known proteins involved in toxic activity include three s - type proteins lukm, luks - r, and luk e and two f - type proteins lukf - r and luk d [122124]. There is about 6070% sequence homology among the various f components and a fairly similar degree of homology among the multiple s components . The two - component toxin systems of s. aureus are complicated by the fact that the f component of one toxin can bind to the s component of another toxin . Therefore, multiple unique toxins can be formed by one component from each of two different toxins (e.g., the f of one toxin with the s of another toxin). Each combination of an f and an s component can have its own specific toxicity . How these toxins relate to corneal damage is yet to be resolved, but because these toxins are homologous with gamma - toxin, it is likely that at least one such toxin has corneal toxicity . Another molecule with proven ability to serve as a corneal virulence factor is the setnm-1 gene . This gene is a part of a cluster of genes for super - antigen - like proteins involved in virulence for infections in nonocular sites . These genes are found in a pathogenicity island on the chromosome of many s. aureus isolates and they are thought to have been derived from a phage genome . The genes in this island, other than setnm-1, are known to inhibit host immune mediators such as complement or iga . Only setnm-1 has been shown to mediate corneal damage; that is, a mutant deficient in this gene has significantly reduced corneal virulence as compared to its parent and rescued strains . It is not yet clear how setnm-1 functions as a virulence factor, but one possibility is that it has protease activity . Injection of the protein produced by the setnm-1 gene can cause extensive corneal damage, an event not expected for a super - antigen - like protein . The fundamental treatment of bacterial keratitis is based on the action of bactericidal antibiotic therapy to eliminate the bacteria that secrete the toxic proteins . A key issue in treatment is that the cornea has rapidly replicating bacteria prior to the onset of severe symptoms, and later, when symptoms are present, bacteria with a much reduced rate of bacterial replication predominate . Key drugs, such as fluoroquinolones, are far more effective on replicating than nonreplicating bacteria, so the treatment of the cornea needs to be prompt, aggressive, and prolonged . Global regulation of gene expression in bacteria limits the production of important toxins and enzymes until the bacteria are no longer rapidly replicating . Once replication slows or stops, the toxins are secreted; thus, nonreplicating bacteria are hard to kill and they are efficient toxin producers . The points to be stressed are that prompt bactericidal therapy is a must and that the toxins once produced cannot now be eliminated without a loss of healthy tissue.
Glaucoma and ocular hypertension are progressive, vision - threatening conditions associated with increased intraocular pressure (iop). Quigley and broman have reported that, by 2020, more than 28 million people in asia and nearly 60 million people worldwide will be diagnosed with open - angle glaucoma.1 in japan, glaucoma is the leading cause of visual impairment.2 reducing iop is currently the only established treatment for slowing or preventing progression of open - angle glaucoma and ocular hypertension,3 which, if untreated can lead to visual field defects and blindness.4 multiple classes of iop - lowering agents have been developed for therapeutic use, including carbonic anhydrase inhibitors and beta - adrenergic receptor antagonists (blockers).3 systemic administration of carbonic anhydrase inhibitors and blockers, among other agents, can produce adverse effects, including malaise, fatigue, and sleep disturbances;5,6 as a result, ophthalmic instillation has been pursued as a route of administration for treatment of glaucoma and ocular hypertension . Many patients require multiple ocular hypotensive agents to achieve sufficient iop reduction.7 topical treatment with the nonselective blocker timolol 0.5% (tim) and an adjunctive agent to lower iop has become increasingly common.3,8 concomitant therapy with topical brinzolamide 1% (brinz), a carbonic anhydrase inhibitor, and tim has been demonstrated to significantly decrease iop in patients with glaucoma or ocular hypertension.911 both brinz and tim, individually and in combination, are generally well tolerated.1014 concomitant administration of multiple topical agents has been associated with drug washout, increased complexity of administration, and decreased treatment compliance; these factors can decrease delivery of effective doses of ocular hypotensives.1517 fixed - combination pharmacotherapies of iop - lowering agents eliminate risk of washout and simplify drug administration.16,17 the safety and efficacy of fixed - combination brinzolamide 1%/timolol 0.5% (brinz / tim - fc) have been established in adult patients with glaucoma or ocular hypertension; because brinz / tim - fc has been marketed in the european union, earlier studies included mostly white or black patients and relatively few asian patients.1822 in a double - masked, parallel - group study, brinz / tim - fc achieved significantly superior iop reduction compared with brinz or tim monotherapy.22 furthermore, patients transitioned to brinz / tim - fc (usually because of insufficient iop reduction with or intolerance to their previous treatment) achieved significant iop reductions from baseline after 46 weeks of therapy, and nearly 90% of patients judged the tolerability of brinz / tim - fc positively.19 the objective of this randomized, double - masked, multicenter, parallel - group, controlled study was to evaluate the safety and efficacy of brinz / tim - fc compared with concomitant therapy of unfixed brinz and tim (brinz + tim) in japanese patients with open - angle glaucoma or ocular hypertension . The main hypothesis tested was that the iop - lowering efficacy of brinz / tim - fc is similar to that of brinz + tim . This was a phase iii, randomized, double - masked, multicenter, parallel - group, positive - controlled study (figure 1) conducted at 34 sites in japan . At the screening visit (week 4), patients gave their written informed consent to participate in the study and were evaluated for inclusion and exclusion criteria and use of prohibited or restricted concomitant drugs . Use of other iop - lowering agents was suspended for the duration of the study . Patients were instructed to administer tim twice daily at 9 am (30 minutes) and 9 pm (30 minutes) until the baseline visit (observation phase). At the baseline visit (week 0), conducted 287 days after screening, eligibility was confirmed based on inclusion and exclusion criteria and compliance with tim therapy during the observation phase . Patients were randomized to brinz / tim - fc or brinz + tim treatment groups and instructed to instill the appropriate active agent(s) or placebo (ie, brinz / tim - fc and matched placebo or brinz and tim) twice daily, at 9 am (30 minutes) and 9 pm (30 minutes), for 8 weeks (treatment phase). Efficacy and safety endpoints were assessed at 9 am (before instillation of ophthalmic solutions) and 11 am (2 hours post instillation) at baseline, week 4, and week 8 . A total of 24 sites also performed efficacy and safety assessments at 4 pm (7 hours post instillation). The institutional review board of each participating institution reviewed and approved the study protocol, and the study was conducted according to the declaration of helsinki . Study participants were japanese patients aged $20 years with a diagnosis of open - angle glaucoma (primary open - angle glaucoma, exfoliation glaucoma, pigmentary glaucoma) or ocular hypertension for whom tim monotherapy provided insufficient iop reduction . Patients were eligible for participation if iop in at least one eye was in the range of 1836 mmhg at both 9 am and 11 am at the baseline visit (week 0), with neither eye> 36 mmhg . Key exclusion criteria included a history of chronic or recurrent severe ocular inflammatory disease, ocular trauma or intraocular surgery within 6 months or laser eye surgery within 3 months of screening, ocular infection or endophthalmitis, retinal disease, hypersensitivity to study drugs, or use of confounding ophthalmic or systemic drugs (unless on a stable dosage regimen with no new administration from screening to the end of the treatment phase). Additionally, patients with maximum corrected visual acuity 0.2 (decimal acuity) or an anterior chamber angle grade <2 in either eye were excluded . During the observation phase (week 4 to week 0), all patients instilled one drop of tim aqueous ophthalmic solution in each eye twice daily . Throughout the treatment phase (week 0 to week 8), patients instilled either a placebo (an aqueous ophthalmic solution containing no active ingredient) followed by brinz / tim - fc ophthalmic suspension (azarga; alcon laboratories, inc, fort worth, tx, usa) or tim followed by brinz ophthalmic suspension (alcon laboratories, inc), with concomitant instillations 5 minutes apart twice daily . At the screening visit, patients were provided with a journal and requested to record the conditions of investigational drug instillation and any changes in concomitant drugs . The primary efficacy endpoint was mean iop change from baseline at 11 am (2 hours post instillation) at the week 8 visit . Similarity of the iop - lowering efficacy of brinz / tim - fc versus brinz + tim was evaluated (margin of noninferiority, + 1.1 mmhg). Iop was measured by goldmann applanation tonometry at screening and at 9 am, 11 am, and 4 pm at baseline, week 4, and week 8 . Adverse events were assessed at the baseline, week 4, and week 8 visits . Solicited and unsolicited adverse events were recorded at each visit and coded using the medical dictionary for regulatory activities japanese translation, version 14.1 . The following safety parameters were assessed at screening, baseline, week 4, and week 8: best corrected visual acuity (decimal acuity scale), slit lamp examination (cornea, eyelid / conjunctiva, iris / anterior chamber, lens), blood pressure, and pulse rate . Funduscopy (vitreous, retina / macula / choroid, optic nerve, optic nerve cup - to - disc ratio), gonioscopy (anterior chamber angle grade), static perimetry (visual field stage, defined using greve s modification of the aulhorn classification23), and laboratory tests (hematology, serum chemistry, and qualitative urinalysis) were performed at screening and week 8 . Mean changes in iop from baseline for each group and the difference between groups were estimated with 95% confidence intervals (cis) by a repeated - measures analysis of covariance model with baseline iop values used as the covariate . Significance of the primary endpoint, ie, iop reduction from baseline at the 11 am week 8 assessment, was determined by paired t - tests . Descriptive statistics were obtained for mean standard deviation iop and iop change from baseline throughout the study . Noninferiority of brinz / tim - fc versus brinz + tim was considered to be proven if the upper limit of the one - sided 97.5% ci of the difference between treatment groups in mean iop change from baseline at 11 am at week 8 was <1.1 mmhg . Post hoc analyses of treatment group differences in incidence of adverse events were performed using fisher s exact tests . Group sizes and statistical power were determined before initiation of the study . Assuming a standard deviation of 3.0 mmhg for the iop change from baseline, sample sizes of 135 patients per group were determined to be sufficient to detect a difference in iop $1.1 mmhg within the coverage probability of the 97.5% upper ci with 85% power . Efficacy was analyzed in the per - protocol population (defined as all patients who received study medication in the treatment phase, had post - administration tests and observation data, and satisfied the protocol criteria) and the intent - to - treat population (defined as all patients who received study medication in the treatment phase and who had post - administration tests and observation data). Safety variables were analyzed in the safety population (defined as all patients who received study medication). This was a phase iii, randomized, double - masked, multicenter, parallel - group, positive - controlled study (figure 1) conducted at 34 sites in japan . At the screening visit (week 4), patients gave their written informed consent to participate in the study and were evaluated for inclusion and exclusion criteria and use of prohibited or restricted concomitant drugs . Use of other iop - lowering agents was suspended for the duration of the study . Patients were instructed to administer tim twice daily at 9 am (30 minutes) and 9 pm (30 minutes) until the baseline visit (observation phase). At the baseline visit (week 0), conducted 287 days after screening, eligibility was confirmed based on inclusion and exclusion criteria and compliance with tim therapy during the observation phase . Patients were randomized to brinz / tim - fc or brinz + tim treatment groups and instructed to instill the appropriate active agent(s) or placebo (ie, brinz / tim - fc and matched placebo or brinz and tim) twice daily, at 9 am (30 minutes) and 9 pm (30 minutes), for 8 weeks (treatment phase). Efficacy and safety endpoints were assessed at 9 am (before instillation of ophthalmic solutions) and 11 am (2 hours post instillation) at baseline, week 4, and week 8 . A total of 24 sites also performed efficacy and safety assessments at 4 pm (7 hours post instillation). The institutional review board of each participating institution reviewed and approved the study protocol, and the study was conducted according to the declaration of helsinki . Study participants were japanese patients aged $20 years with a diagnosis of open - angle glaucoma (primary open - angle glaucoma, exfoliation glaucoma, pigmentary glaucoma) or ocular hypertension for whom tim monotherapy provided insufficient iop reduction . Patients were eligible for participation if iop in at least one eye was in the range of 1836 mmhg at both 9 am and 11 am at the baseline visit (week 0), with neither eye> 36 mmhg . Key exclusion criteria included a history of chronic or recurrent severe ocular inflammatory disease, ocular trauma or intraocular surgery within 6 months or laser eye surgery within 3 months of screening, ocular infection or endophthalmitis, retinal disease, hypersensitivity to study drugs, or use of confounding ophthalmic or systemic drugs (unless on a stable dosage regimen with no new administration from screening to the end of the treatment phase). Additionally, patients with maximum corrected visual acuity 0.2 (decimal acuity) or an anterior chamber angle grade <2 in either eye were excluded . During the observation phase (week 4 to week 0), all patients instilled one drop of tim aqueous ophthalmic solution in each eye twice daily . Throughout the treatment phase (week 0 to week 8), patients instilled either a placebo (an aqueous ophthalmic solution containing no active ingredient) followed by brinz / tim - fc ophthalmic suspension (azarga; alcon laboratories, inc, fort worth, tx, usa) or tim followed by brinz ophthalmic suspension (alcon laboratories, inc), with concomitant instillations 5 minutes apart twice daily . At the screening visit, patients were provided with a journal and requested to record the conditions of investigational drug instillation and any changes in concomitant drugs . The primary efficacy endpoint was mean iop change from baseline at 11 am (2 hours post instillation) at the week 8 visit . Similarity of the iop - lowering efficacy of brinz / tim - fc versus brinz + tim was evaluated (margin of noninferiority, + 1.1 mmhg). Iop was measured by goldmann applanation tonometry at screening and at 9 am, 11 am, and 4 pm at baseline, week 4, and week 8 . Adverse events were assessed at the baseline, week 4, and week 8 visits . Solicited and unsolicited adverse events were recorded at each visit and coded using the medical dictionary for regulatory activities japanese translation, version 14.1 . The following safety parameters were assessed at screening, baseline, week 4, and week 8: best corrected visual acuity (decimal acuity scale), slit lamp examination (cornea, eyelid / conjunctiva, iris / anterior chamber, lens), blood pressure, and pulse rate . Funduscopy (vitreous, retina / macula / choroid, optic nerve, optic nerve cup - to - disc ratio), gonioscopy (anterior chamber angle grade), static perimetry (visual field stage, defined using greve s modification of the aulhorn classification23), and laboratory tests (hematology, serum chemistry, and qualitative urinalysis) were performed at screening and week 8 . Mean changes in iop from baseline for each group and the difference between groups were estimated with 95% confidence intervals (cis) by a repeated - measures analysis of covariance model with baseline iop values used as the covariate . Significance of the primary endpoint, ie, iop reduction from baseline at the 11 am week 8 assessment, was determined by paired t - tests . Descriptive statistics were obtained for mean standard deviation iop and iop change from baseline throughout the study . Noninferiority of brinz / tim - fc versus brinz + tim was considered to be proven if the upper limit of the one - sided 97.5% ci of the difference between treatment groups in mean iop change from baseline at 11 am at week 8 was <1.1 mmhg . Post hoc analyses of treatment group differences in incidence of adverse events were performed using fisher s exact tests . Group sizes and statistical power were determined before initiation of the study . Assuming a standard deviation of 3.0 mmhg for the iop change from baseline, sample sizes of 135 patients per group were determined to be sufficient to detect a difference in iop $1.1 mmhg within the coverage probability of the 97.5% upper ci with 85% power . Efficacy was analyzed in the per - protocol population (defined as all patients who received study medication in the treatment phase, had post - administration tests and observation data, and satisfied the protocol criteria) and the intent - to - treat population (defined as all patients who received study medication in the treatment phase and who had post - administration tests and observation data). Safety variables were analyzed in the safety population (defined as all patients who received study medication). A total of 366 patients were enrolled in the observation phase . Of these, 319 continued into the treatment phase (brinz / tim - fc, n=158; brinz + tim, n=161; mean age 6412 years) and were included in the intent - to - treat data set (ie, all patients administered an investigational drug for whom post - administration tests and observation data existed). A total of 309 completed the study and were included in the per - protocol population . Forty - seven patients discontinued the study during the observation phase; the most frequent reasons for discontinuation from the observation phase were selection criteria (n=25), meeting exclusion criteria (n=1 0), and adverse events (n=8). Baseline demographic and diagnosis information for the per - protocol population are presented in table 1 . The majority of patients (56%) were diagnosed with primary open - angle glaucoma, followed by ocular hypertension (41%). Efficacy for the per - protocol and intent - to - treat populations was similar throughout the study; therefore, the efficacy data presented here are only from the per - protocol data set . Mean baseline iop values were similar between the brinz / tim - fc and brinz + tim treatment groups at 9 am (21.2 mmhg and 21.0 mmhg, respectively), 11 am (20.8 mmhg and 20.8 mmhg), and 4 pm (19.8 mmhg and 20.3 mmhg). Mean iop reductions from baseline with brinz / tim - fc and brinz + tim ranged from 2.5 mmhg to 3.4 mmhg and from 2.7 mmhg to 3.3 mmhg, respectively, and were similar in the brinz / tim - fc and brinz + tim groups at all time points (figure 3). Treatment comparisons of iop values for patients who had assessments at two time points (ie, 9 am and 11 am) and those who had assessments at three time points (ie, 9 am, 11 am, and 4 pm) are presented in tables 2 and 3, respectively . Reductions in iop from baseline at the 11 am week 8 assessment (the primary efficacy endpoint) were significant in both the brinz / tim - fc and brinz + tim treatment groups (least squares mean iop reduction: brinz / tim - fc, 3.4 mmhg, n=150; brinz + tim, 3.3 mmhg, n=149; both p<0.0001). The difference in least squares mean iop reduction from baseline between treatments (brinz / tim - fc minus brinz + tim) ranged from 0.0 mmhg to 0.3 mmhg, and the upper limit of the 97.5% one - sided ci of the difference between groups at 11 am in week 8 was 0.4 mmhg, which was within the margin of noninferiority of <1.1 mmhg . During the treatment phase, descriptive statistics for mean iop values were similar for brinz / tim - fc and brinz + tim (range 17.118.3 mmhg and 17.518.2 mmhg, respectively; figure 4). No differing trends in iop - lowering efficacy of brinz / tim - fc or brinz + tim were found in patients diagnosed with primary open - angle glaucoma versus ocular hypertension . Mean iop at baseline was similar between patient subgroups (primary open - angle glaucoma, 20.521.0 mmhg; ocular hypertension, 20.421.3 mmhg). Mean iop reductions from baseline with brinz / tim - fc were 2.9 mmhg to 3.6 mmhg and 2.0 mmhg to 3.0 mmhg in patients with primary open - angle glaucoma and ocular hypertension, respectively; iop reductions with brinz + tim were 2.7 mmhg to 3.7 mmhg and 2.3 mmhg to 2.8 mmhg . In total, 318 patients received an investigational drug during the treatment phase (safety population; brinz / tim - fc, n=157; brinz + tim, n=161). One or more adverse events were observed in 21% (n=68/318) of patients (brinz / tim - fc, n=29/157 [18%]; brinz + tim, n=39/161 [24%]; p=0.22; table 4). Most adverse events were mild or moderate; one serious adverse event, ie, coronary spastic angina, for which a causal relationship with treatment could not be ruled out, occurred in a patient in the brinz + tim group . A post hoc analysis showed that significantly fewer treatment - related adverse events occurred in brinz / tim - fc - treated patients (3%) compared with brinz + tim - treated patients (12%; p=0.0029; table 4). The most frequently reported treatment - related adverse events were blurred vision and eye irritation (table 4). The most common treatment - emergent adverse event (observed in 2% of patients) with brinz / tim - fc was nasopharyngitis (n=6/157 [4%]); with brinz + tim, the most common treatment - emergent adverse events were blurred vision (n=5/161 [3%]), eye irritation (n=4/161 [2%]), and allergic conjunctivitis (n=4/161 [2%]). Additional visual and ophthalmic safety parameters, including best corrected visual acuity, visual field, optic nerve cup - to - disc ratio, angle grade, and intraocular and external features assessed by slit - lamp and funduscopy were largely unchanged from baseline to week 8 . Deterioration in visual field score from baseline was observed in 3% (n=5/156) of patients who received brinz / tim - fc and 7% (n=11/161) of patients who received brinz + tim . There were no substantial variations in hematology, serum chemistry, or urinalysis parameters in either treatment group over time . A total of 366 patients were enrolled in the observation phase . Of these, 319 continued into the treatment phase (brinz / tim - fc, n=158; brinz + tim, n=161; mean age 6412 years) and were included in the intent - to - treat data set (ie, all patients administered an investigational drug for whom post - administration tests and observation data existed). A total of 309 completed the study and were included in the per - protocol population . Forty - seven patients discontinued the study during the observation phase; the most frequent reasons for discontinuation from the observation phase were selection criteria (n=25), meeting exclusion criteria (n=1 0), and adverse events (n=8). Baseline demographic and diagnosis information for the per - protocol population are presented in table 1 . The majority of patients (56%) were diagnosed with primary open - angle glaucoma, followed by ocular hypertension (41%). Efficacy for the per - protocol and intent - to - treat populations was similar throughout the study; therefore, the efficacy data presented here are only from the per - protocol data set . Mean baseline iop values were similar between the brinz / tim - fc and brinz + tim treatment groups at 9 am (21.2 mmhg and 21.0 mmhg, respectively), 11 am (20.8 mmhg and 20.8 mmhg), and 4 pm (19.8 mmhg and 20.3 mmhg). Mean iop reductions from baseline with brinz / tim - fc and brinz + tim ranged from 2.5 mmhg to 3.4 mmhg and from 2.7 mmhg to 3.3 mmhg, respectively, and were similar in the brinz / tim - fc and brinz + tim groups at all time points (figure 3). Treatment comparisons of iop values for patients who had assessments at two time points (ie, 9 am and 11 am) and those who had assessments at three time points (ie, 9 am, 11 am, and 4 pm) are presented in tables 2 and 3, respectively . Reductions in iop from baseline at the 11 am week 8 assessment (the primary efficacy endpoint) were significant in both the brinz / tim - fc and brinz + tim treatment groups (least squares mean iop reduction: brinz / tim - fc, 3.4 mmhg, n=150; brinz + tim, 3.3 mmhg, n=149; both p<0.0001). The difference in least squares mean iop reduction from baseline between treatments (brinz / tim - fc minus brinz + tim) ranged from 0.0 mmhg to 0.3 mmhg, and the upper limit of the 97.5% one - sided ci of the difference between groups at 11 am in week 8 was 0.4 mmhg, which was within the margin of noninferiority of <1.1 mmhg . During the treatment phase, descriptive statistics for mean iop values were similar for brinz / tim - fc and brinz + tim (range 17.118.3 mmhg and 17.518.2 mmhg, respectively; figure 4). No differing trends in iop - lowering efficacy of brinz / tim - fc or brinz + tim were found in patients diagnosed with primary open - angle glaucoma versus ocular hypertension . Mean iop at baseline was similar between patient subgroups (primary open - angle glaucoma, 20.521.0 mmhg; ocular hypertension, 20.421.3 mmhg). Mean iop reductions from baseline with brinz / tim - fc were 2.9 mmhg to 3.6 mmhg and 2.0 mmhg to 3.0 mmhg in patients with primary open - angle glaucoma and ocular hypertension, respectively; iop reductions with brinz + tim were 2.7 mmhg to 3.7 mmhg and 2.3 mmhg to 2.8 mmhg . In total, 318 patients received an investigational drug during the treatment phase (safety population; brinz / tim - fc, n=157; brinz + tim, n=161). One or more adverse events were observed in 21% (n=68/318) of patients (brinz / tim - fc, n=29/157 [18%]; brinz + tim, n=39/161 [24%]; p=0.22; table 4). Most adverse events were mild or moderate; one serious adverse event, ie, coronary spastic angina, for which a causal relationship with treatment could not be ruled out, occurred in a patient in the brinz + tim group . A post hoc analysis showed that significantly fewer treatment - related adverse events occurred in brinz / tim - fc - treated patients (3%) compared with brinz + tim - treated patients (12%; p=0.0029; table 4). The most frequently reported treatment - related adverse events were blurred vision and eye irritation (table 4). The most common treatment - emergent adverse event (observed in 2% of patients) with brinz / tim - fc was nasopharyngitis (n=6/157 [4%]); with brinz + tim, the most common treatment - emergent adverse events were blurred vision (n=5/161 [3%]), eye irritation (n=4/161 [2%]), and allergic conjunctivitis (n=4/161 [2%]). Additional visual and ophthalmic safety parameters, including best corrected visual acuity, visual field, optic nerve cup - to - disc ratio, angle grade, and intraocular and external features assessed by slit - lamp and funduscopy were largely unchanged from baseline to week 8 . Deterioration in visual field score from baseline was observed in 3% (n=5/156) of patients who received brinz / tim - fc and 7% (n=11/161) of patients who received brinz + tim . There were no substantial variations in hematology, serum chemistry, or urinalysis parameters in either treatment group over time . The primary treatment approach for glaucoma and ocular hypertension is to reduce iop and prevent disease progression.3,7 clinical studies have demonstrated that multiple hypotensive agents are often required to achieve sufficient iop reduction.7,24 increasing use of multiple anti - glaucoma medications over time was previously observed in japanese patients.25 fixed - combination pharmacotherapies of multiple ocular hypotensive agents, including brinz / tim - fc, were shown to reduce iop in patients with glaucoma and ocular hypertension, with greater efficacy than their component monotherapies.22,2628 furthermore, compared with unfixed combination therapies (ie, multiple medication bottles), fixed - combination therapies can decrease cumulative patient exposure to preservatives, reduce risk of drug washout, and simplify drug administration.1517,29 the goal of the current study was to evaluate the safety and efficacy of brinz / tim - fc compared with unfixed concomitant brinz + tim in japanese patients with open - angle glaucoma (primary open - angle, exfoliation, pigmentary) or ocular hypertension . Both brinz / tim - fc and brinz + tim produced significant iop reductions from baseline over 8 weeks of treatment; iop reductions with brinz / tim - fc were numerically equal to or greater than those with brinz + tim at all time points . The iop - lowering efficacy of brinz / tim - fc and brinz + tim was similar in patients diagnosed with primary open - angle glaucoma versus ocular hypertension . Adverse events occurring with brinz / tim - fc and brinz + tim were mostly of mild or moderate severity, and post hoc analysis suggested that fewer treatment - related adverse events occurred with brinz / tim - fc compared with brinz + tim . No substantial or clinically relevant aggravations of visual and ophthalmic safety parameters of disease progression were observed with either treatment . The safety and efficacy of brinz / tim - fc and brinz + tim in this study were consistent with those reported in previous studies of these agents as combination therapy and monotherapy in other patient populations.10,11,18,19,21,22,30,31 similar to the current study, which demonstrated comparable efficacy of brinz / tim - fc and unfixed concomitant brinz + tim, other clinical assessments of fixed - combination therapies have demonstrated that fixed - combination pharmacotherapies containing tim and dorzolamide, a carbonic anhydrase inhibitor, or latanoprost, a prostaglandin analog, have efficacy similar to that of concomitant treatment with their active components.3235 fixed - combination dorzolamide 1%/tim is approved for use in japan; there are currently no comparative data for brinz / tim - fc versus the fixed combination of dorzolamide 1%/tim . However, in a previous multinational noninferiority study conducted in europe, brinz / tim - fc produced iop reductions similar to those achieved with fixed - combination dorzolamide 2%/tim.20 further, studies conducted in the us and south america indicate that among patients with a treatment preference, brinz / tim - fc was favored by patients over fixed - combination dorzolamide 2%/tim.21,31 this result may be attributable to the increased severity and duration of ocular discomfort with dorzolamide 2%/tim compared with brinz / tim - fc.18,21,31,36 patients in the current study reported a low incidence of dysgeusia, a result that may be related to adequate informed consent (including explanation of adverse events) before study participation . Based on the similar iop - lowering efficacy of brinz / tim - fc and brinz + tim, brinz / tim - fc is expected to provide a benefit to patients with glaucoma as a substitute for unfixed concomitant brinz + tim in terms of both treatment convenience and compliance . A potential limitation of the current study is that the study population did not include any patients with normal - tension or closed - angle glaucoma; both of these conditions are common in people of japanese descent.1,37 additionally, future studies of patients with pigmentary or exfoliation open - angle glaucoma are needed; because of the small numbers of patients with these glaucoma etiologies in the current study, conclusions regarding the safety and efficacy of brinz / tim - fc in these patients should be made with caution . Treatment with twice - daily brinz / tim - fc significantly reduced iop throughout this 8-week study in japanese patients with open - angle glaucoma or ocular hypertension . Iop - lowering efficacy was similar with brinz / tim - fc and brinz + tim . Further, the safety profiles of brinz / tim - fc and brinz + tim were similar, and both therapies were well tolerated.
Renal dysfunction is a strong risk factor for cardiovascular disease in the general population,1) and it is associated with an increased risk of death and cardiovascular events in patients with a broad range of cardiovascular diseases, including heart failure,2) stable coronary artery disease undergoing percutaneous coronary intervention (pci)3)4) and acute coronary syndromes.5)6) in the setting of acute myocardial infarction (ami), mortality risk is increased in patients with renal dysfunction (rd) of any degree of severity.7 - 9) primary pci is the best reperfusion strategy for ami patients and its mortality benefit has been shown in randomized trials.10 - 12) however, most of these trials frequently excluded patients with rd, and few studies examining the outcomes of ami patients with rd undergoing primary pci have been reported . To date, several studies evaluating the in - hospital prognostic significance of rd in patients undergoing primary pci for ami have reported that rd is an independent predictor of in - hospital mortality,13 - 15) even in the case of a successful pci.13)14) however, one of these studies13) used serum creatinine level to determine rd despite the fact that serum creatinine level can be unreliable as an estimate of renal function (rf), while the other studies14)15) included a small number of patients and divided patients according to their rf into merely 2 groups which is insufficient for rd risk stratification . The aim of the present study was to investigate the impact of admission estimated glomerular filtration rate (gfr) on in - hospital outcomes in patients with st - segment elevation myocardial infarction (stemi) undergoing primary pci using data from the korea acute myocardial infarction registry (kamir). Kamir is a korean prospective multicenter online registry designed to reflect " real - world " practice trends for patients presenting with ami in the recent reperfusion era; the registry has been supported by the korean circulation society since november 2005 . Online registry of ami cases (www.kamir.or.kr) has been performed at 41 universities or community hospitals that are high - volume centers with facilities for primary pci and onsite cardiac surgery . Data were collected at each site by a trained study coordinator using a standardized case report form, and registered and submitted from individual institutions via password - protected internet - based electronic case report forms . The study protocol was approved by the ethics committee at each participating institution . From january 2006 to december 2007,, 864 patients were excluded from this study because they had received fibrinolytic therapy and 2,407 patients were excluded because they did not undergo pci as the primary treatment strategy; an additional 82 patients were excluded due to missing data needed to calculate estimated gfr . 1). Data on clinical, angiographic and in - hospital outcomes were collected . The mean age of the study patients was 62.212.8 years, and 3,355 (73.8%) patients were males . The mean estimated gfr was 78.3 ml / min/1.73 m. the angiographic success rate was 91.8%, and the overall in - hospital mortality rate was 5.3% . Stemi was defined by the presence of new st - segment elevation of at least 1 mm (0.1 mv) in 2 contiguous leads or new left bundle - branch block on the index or subsequent electrocardiogram with at least 1 positive cardiac biochemical marker of necrosis . Primary pci was defined as percutaneous coronary revascularization within 24 hours of symptom onset without antecedent treatment with a fibrinolytic agent as the initial therapy . Successful pci was defined as thrombolysis in myocardial infarction 3 flow with residual stenosis 50% in the infarct - related artery . Major bleeding was defined as intracranial bleeding, bleeding associated with the need for blood transfusion, or any other clinically relevant bleeding as judged by the investigator . Rf was defined by estimated gfr, which was calculated by the modification of diet in renal disease equation (mdrd)16) from the serum creatinine level measured on admission . Normal rf, moderate and severe rd were defined as estimated gfr 60 ml / min/1.73 m, between 30 to 59 ml / min/1.73 m and <30 ml / min/1.73 m, respectively . All analyses were performed using statistical package for the social sciences (spss) software version 17.0 (spss inc, chicago, il, usa). Data are presented as meanstandard deviation or median with interquartiles for continuous variables, and as frequency for categorical variables . Comparisons between continuous variables were done using one - way analysis of variance or the kruskal - wallis test, while the pearson's chi - square test was used for categorical variables . Kamir is a korean prospective multicenter online registry designed to reflect " real - world " practice trends for patients presenting with ami in the recent reperfusion era; the registry has been supported by the korean circulation society since november 2005 . Online registry of ami cases (www.kamir.or.kr) has been performed at 41 universities or community hospitals that are high - volume centers with facilities for primary pci and onsite cardiac surgery . Data were collected at each site by a trained study coordinator using a standardized case report form, and registered and submitted from individual institutions via password - protected internet - based electronic case report forms . From january 2006 to december 2007, a total of 7,895 stemi patients were registered in kamir . Of these, 864 patients were excluded from this study because they had received fibrinolytic therapy and 2,407 patients were excluded because they did not undergo pci as the primary treatment strategy; an additional 82 patients were excluded due to missing data needed to calculate estimated gfr . 1). Data on clinical, angiographic and in - hospital outcomes were collected . The mean age of the study patients was 62.212.8 years, and 3,355 (73.8%) patients were males . The mean estimated gfr was 78.3 ml / min/1.73 m. the angiographic success rate was 91.8%, and the overall in - hospital mortality rate was 5.3% . Stemi was defined by the presence of new st - segment elevation of at least 1 mm (0.1 mv) in 2 contiguous leads or new left bundle - branch block on the index or subsequent electrocardiogram with at least 1 positive cardiac biochemical marker of necrosis . Primary pci was defined as percutaneous coronary revascularization within 24 hours of symptom onset without antecedent treatment with a fibrinolytic agent as the initial therapy . Successful pci was defined as thrombolysis in myocardial infarction 3 flow with residual stenosis 50% in the infarct - related artery . Major bleeding was defined as intracranial bleeding, bleeding associated with the need for blood transfusion, or any other clinically relevant bleeding as judged by the investigator . Rf was defined by estimated gfr, which was calculated by the modification of diet in renal disease equation (mdrd)16) from the serum creatinine level measured on admission . Normal rf, moderate and severe rd were defined as estimated gfr 60 ml / min/1.73 m, between 30 to 59 ml / min/1.73 m and <30 ml / min/1.73 m, respectively . All analyses were performed using statistical package for the social sciences (spss) software version 17.0 (spss inc, chicago, il, usa). Data are presented as meanstandard deviation or median with interquartiles for continuous variables, and as frequency for categorical variables . Comparisons between continuous variables were done using one - way analysis of variance or the kruskal - wallis test, while the pearson's chi - square test was used for categorical variables . Patients with rd were older, were more often females and had lower bmi values . Also, they were more likely to have lower systolic blood pressure, increased heart rate and higher killip class at presentation . Pre - hospital delay time was similar in the rd group and the normal rf group, but door - to - balloon time was longer in the rd group as compared to the normal rf group . On medical history, with respect to laboratory findings, high sensitivity c - reactive protein and b - type natriuretic peptide levels were higher in the rd group, but peak creatine kinase - mb level and left ventricular ejection fraction were lower in the rd group as compared to the normal rf group . Use of both heparin and gp iib / iiia inhibitor was lower in the rd group as compared to the normal rf group (table 1). Patients with rd were more likely to have multivessel disease and left main coronary artery stenosis . The location of infarct - related artery was significantly different in the three groups, according to their rf . While involvement of the left anterior descending coronary artery was less frequent, involvement of the right coronary artery was more frequent in the severe rd group . Also, rate of successful pci decreased significantly as rf declined; however, rate of stent insertion remained similar in all the three groups (table 2). In - hospital complications, including arrhythmia, cardiogenic shock, ischemic events, acute renal failure and major bleeding, developed more frequently in patients with rd (table 3). In - hospital mortality rates increased significantly as estimated gfr decreased (p<0.001), and approximately one - fourth of the patients (25.6%) in the severe rd group died (fig . 2). Although the main cause of in - hospital mortality was pump failure (p<0.001), frequencies of the causes of mortality were not significantly different between the three groups (p=0.165) (table 4). On multivariate logistic regression analysis, age, diabetes, killip class 3, successful pci and left ventricular ejection fraction were identified as independent predictors of in - hospital mortality . In addition, decreased estimated gfr was also identified as a powerful independent predictor of in - hospital mortality . When compared with the normal rf group, adjusted or was 2.67 {95% confidence interval (ci): 1.44 to 4.93; p=0.002} in the moderate rd group and 4.09 (95% ci: 1.48 to 11.28; p=0.006) in the severe rd group (table 5). Patients with rd were older, were more often females and had lower bmi values . Also, they were more likely to have lower systolic blood pressure, increased heart rate and higher killip class at presentation . Pre - hospital delay time was similar in the rd group and the normal rf group, but door - to - balloon time was longer in the rd group as compared to the normal rf group . On medical history, with respect to laboratory findings, high sensitivity c - reactive protein and b - type natriuretic peptide levels were higher in the rd group, but peak creatine kinase - mb level and left ventricular ejection fraction were lower in the rd group as compared to the normal rf group . Use of both heparin and gp iib / iiia inhibitor was lower in the rd group as compared to the normal rf group (table 1). Patients with rd were more likely to have multivessel disease and left main coronary artery stenosis . The location of infarct - related artery was significantly different in the three groups, according to their rf . While involvement of the left anterior descending coronary artery was less frequent, involvement of the right coronary artery was more frequent in the severe rd group . Also, rate of successful pci decreased significantly as rf declined; however, rate of stent insertion remained similar in all the three groups (table 2). In - hospital complications, including arrhythmia, cardiogenic shock, ischemic events, acute renal failure and major bleeding, developed more frequently in patients with rd (table 3). In - hospital mortality rates increased significantly as estimated gfr decreased (p<0.001), and approximately one - fourth of the patients (25.6%) in the severe rd group died (fig . 2). Although the main cause of in - hospital mortality was pump failure (p<0.001), frequencies of the causes of mortality were not significantly different between the three groups (p=0.165) (table 4). On multivariate logistic regression analysis, age, diabetes, killip class 3, successful pci and left ventricular ejection fraction were identified as independent predictors of in - hospital mortality . In addition, decreased estimated gfr was also identified as a powerful independent predictor of in - hospital mortality . When compared with the normal rf group, adjusted or was 2.67 {95% confidence interval (ci): 1.44 to 4.93; p=0.002} in the moderate rd group and 4.09 (95% ci: 1.48 to 11.28; p=0.006) in the severe rd group (table 5). The main finding of the present study is that rd defined by estimated gfr at admission is an independent predictor of in - hospital mortality in patients with stemi undergoing primary pci; this increased mortality risk was observed not only in the patients with severe rd but also in the patients with moderate rd . In the present study, rd was defined by estimated gfr calculated using the mdrd equation, which is currently recommended in clinical practice,17) and patients were divided into three groups . Although rd, as defined by either serum creatinine level or estimated gfr, has been associated with increased mortality in patients with ami,13 - 15)18)19)21) serum creatinine level is insensitive for an early detection of rd and could underestimate the incidence of moderate or severe rd concealed behind the near - normal creatinine levels,9)22)23) thereby underscoring the risk of rd in ami patients . Furthermore, a graded risk of rd clearly exists, rf should be classified into at least 3 groups using estimated gfr for appropriate rd risk stratification in clinical practice . Our study on the basis of estimated gfr, showed that patients with moderate rd had a six - fold higher in - hospital mortality rate, while patients with severe rd had a eleven - fold higher in - hospital mortality rate as compared to the patients with normal rf . In our study, patients with rd were older, and were more often women . Although rf decreases with age and women tend to be older than men at the time of ami presentation,24) it may also be an inherent influence of the variables used in the mdrd equation . In addition to older age and female gender, rd was more frequently associated with hypertension, diabetes, higher killip class, multivessel disease and low left ventricular ejection fraction . These findings which have been described by other authors13)19)21) predispose to worse clinical outcomes after ami . However, after adjustment for baseline differences, increased in - hospital mortality persisted in the patients with rd, suggesting that an increased mortality in patients with rd was not fully explained by these associated conditions, and that rd is a strong independent predictor of in - hospital mortality . The rate of in - hospital complications was higher in the patients with rd as compared to the patients with normal rf . Cardiogenic shock, the most common cause of death in this study regardless of rf, developed with a three - fold higher frequency . It may be possible that the high incidence of unsuccessful pci, recurrent ischemia or re - infarction and bleeding may potentiate the already existing weakened ischemic resistance reflected by high prevalence of diabetes and multivessel disease in the rd group . After ami, acute renal failure more commonly developed among those patients with low left ventricular ejection fraction, higher killip class, anterior wall infarction, a hematocrit <30%, congestive heart failure, cardiogenic shock or stroke during admission.25) the rd group in our study shared many of these features, and although this study did not assess contrast - induced nephropathy (cin) it may also contribute to it . Usually, the clinical benefit of primary pci is accompanied by an increased risk of bleeding in ami patients with rd, and a previous study has reported that rd is independently associated with bleeding after primary pci.19) as expected, despite the less frequent use of heparin and glycoprotein iib / iiia inhibitors in the rd group as compared to the normal rf group, which have a proven efficacy in the setting of ami, major bleeding increased significantly in the rd group as compared to the normal rf group . Despite the fact that primary pci is the most effective ami treatment in terms of improvement in survival, this mortality benefit is attenuated in some patient subgroups, including the elderly, women, patients with renal insufficiency, heart failure, diabetes, anaemia, acute hyperglycemia, cardiogenic shock, and those developing cin.15) because the patients with rd frequently have more than one of these conditions, they might be at a very high risk of mortality after ami . A recent study by medi et al.26) which investigated the benefit of reperfusion strategies in stemi patients in the presence of rd, reported that mortality rates remain high; they also found that primary pci was associated with a lower adjusted in - hospital mortality than fibrinolytic therapy in the patients with normal rf and moderate rd . However, in the patients with severe rd, primary pci was not associated with reduced mortality . In conclusion, we have limited knowledge on the optimal reperfusion strategy for the severe rd group . To improve the survival in ami patients with rd undergoing primary pci, more aggressive treatment and meticulous care are needed . Firstly, the success of primary pci has special importance because a successful pci is an independent predictor of in - hospital mortality as shown in our study and rd was shown to be associated with the risk of unsuccessful pci results . Secondly, medications such as aspirin, beta - blockers, and ace inhibitors should be administered early after ami, so that the patients with rd could gain a similar mortality benefit as their normal rf counterparts.27)28) thirdly, reducing bleeding complications29) by using the radial artery approach and direct thrombin inhibitor during pci is needed.30) fourthly, an effort should be made to prevent cin, including adequate hydration, reducing contrast use, use of low - osmolarity contrast and administration of n - acetylcysteine.19)20) because kamir is a large multicenter population - based prospectively - designed study including unselected patients with ami, it provides comprehensive information on treatments and outcomes among patients with ami and rd in the contemporary pci era . Because this study included stemi patients only, the median pre - hospital delay time in the rd group was relatively short as compared to that in the previous studies13)19); this feature could minimize the hemodynamic compromising effect of ami on baseline serum creatinine level . Similar to a previous study, because the patients with rd underwent pci less often as compared to those with normal rf, there might be a selection bias and unidentified confounders, which might limit the generalizability of the data . Secondly, we did not collect information on medications relevant for prognostication, and therefore analyses in this study was not controlled for the impact of these drugs . Thirdly, there are inherent limitations of the estimated gfr calculation.17) decreased estimated gfr on admission is a strong risk factor for increased in - hospital complications and mortality in stemi patients undergoing primary pci . These risks increased in a stepwise fashion according to the degree of decreased estimated gfr . Clinicians should be alert to the increased mortality in patients with rd and make all the attempts to reduce complications of primary pci and stress intensive medical management of these high - risk patients . Similar to a previous study, because the patients with rd underwent pci less often as compared to those with normal rf, there might be a selection bias and unidentified confounders, which might limit the generalizability of the data . Secondly, we did not collect information on medications relevant for prognostication, and therefore analyses in this study was not controlled for the impact of these drugs . Decreased estimated gfr on admission is a strong risk factor for increased in - hospital complications and mortality in stemi patients undergoing primary pci . These risks increased in a stepwise fashion according to the degree of decreased estimated gfr . Clinicians should be alert to the increased mortality in patients with rd and make all the attempts to reduce complications of primary pci and stress intensive medical management of these high - risk patients.
Zika and chikungunya viruses are both transmitted by aedes aegypti mosquitoes and are associated with an abrupt onset of fever, arthralgia, myalgia and rash . In brazil, acute exanthematous outbreaks related to zika (zikv) and chikungunya viruses (chikv) have been reported in many regions and sometimes as co - infections,,, . Acute chikungunya infection generally leads to prominent joint symptoms with moderate to severe arthralgia and arthritis that may persist for months and even years . Rarely, encephalitis and other neurological involvements may also complicate chkv infection such as recently reported a neonatal encephalitis in brazil with similar lesions on brain scan as those previously described in the la runion islands,, . In all these situations, a rapid diagnosis is of importance for epidemiological purposes and clinical management . In zikv infections, the molecular diagnosis in serum is generally possible until the first six days of symptoms onset and, later on, urine or saliva is used, . Zika detection in urine may help in ascertaining the diagnosis after the initial period of viremia in areas with co - circulation of zikv and dengue virus (denv), where serologic cross - reactions may occur, but evidence for that associated with chikv infection has not been shown . An expanded window for diagnosis in chikv is also needed since igm seropositivity may persist for months after the initial acute infection . Many other viruses have been detected in semen, such as ebola, hiv, hbv, hpv, hsv-1, hsv-2, marburg, but there has been no published data so far on the presence of chikv in semen,,,, . We report the presence of chikv rna for a prolonged period of time in the urine and semen of an adult with a dual infection with dengue virus type 3 for a prolonged period of time . A 25-year - old man from salvador, brazil presented with a 6 days of high fever, arthralgia, myalgia, headache and photophobia . He also reported a burning sensation on his eyes and a non - pruritic rash in the trunk and upper limbs on the first 3 days, and complained of pain involving the ankles, knees, shoulders, wrists, lower back, and neck . Of note, he also reported a transient burning sensation in the urethra and genital region that started 3 days before the onset of symptoms and resolved spontaneously . On examination the patient was febrile with a temperature of 38.3c, had a maculopapular erythematous diffuse rash, joint enlargement with mild inflammatory signs affecting the wrists, the metacarpophalangeal and metatarsophalangeal joints as well as the ankles . The patient was not able to raise his arms on command because of shoulder pain and was eating with difficulty because of pain involving his temporomandibular joint . Blood samples were drawn for viral workup, semen was also requested due to the complaint of dysuria, and the possibility for zika diagnosis since the patient could not provide a urine sample at that time . Blood, urine and semen were collected again after 30 days of symptoms onset and were further processed . Serum and semen samples were submitted to viral rna extraction using a maxwell total viral nucleic acid 16 purication kit (promega, usa) regarding that the semen sample, the incubation time of the lysis step was extended to 30 min . Urine sample was submitted to viral rna extraction using qiamp viral rna purification (qiagen, usa). Subsequent to viral rna extraction, all samples were submitted to rt pcr technique (accessquick system, promega, usa) to screen for chikv, zikv and denv using conventional techniques,, . Serum and semen specimens were positive for chikv rna in the first collected samples; semen and urine specimens were positive for chikv rna after 30 days of symptoms onset, with negative results in serum . Denv-3 rna was positive in serum specimen when first collected 6 days after the initiation of symptoms and was not tested thereafter . Table 1 presents the clinical findings and molecular results during the time frame of infection . The patient made use of prednisone starting on the 2nd day of symptoms onset with 40 mg qd for 10 days, tapering to 20 mg qd for the next 10 days, and 10 mg qd for the last 8 days, with an uneventful course and no clinical findings after 30 days . Ebola rna (ebo - rna) can be detected in up to 290 days after clinical manifestations and ebola infectious particles in up to 70 days . Transmission of ebola virus (ebov) from a male survivor to a female has been documented 179 days after illness in liberia . In another study, persistence of ebo - rna could be found in semen specimens at least 9 months after the onset of symptoms with important consequences related to sexual transmission . Many papers have reinforced the sexual transmission of zikv since foy et al . Have suggested its relationship,,, . This report, besides describing a patient with classical signs of zikv, drew attention to symptoms of prostatitis with hematospermia . Our patient reported a burning sensation in the urethra and the genital region and may also have had a transient prostatic involvement with detection of chikv rna in semen . Zika rna has been detected in semen for up to 6 months after the onset of symptoms and is involved in male - to - female as well as in female - to - male transmission, . Studying human papilloma virus (hpv) have found a high prevalence of this virus in semen 27.2% of healthy adults in amsterdam and using fluorescence in situ hybridization (fish) for hpv - dna and immunocytochemistry for the hpv - l1 and hpv - e4 proteins, the authors detected hpv - dna, hpv - e4 and hpv - l1 in exfoliated keratinocytes present in some hpv16-positive semen samples, indicating the presence of hpv viral particles . Even though alphavirus envelope glycoproteins function as the attachment point to cells, no human cell surface receptor has been implicated in cell entry so far . Primary peripheral blood cells such as cd4 + t lymphocytes, primary cd14 + monocytes and dendritic cells were reported to be refractory to chikv binding and infection . Macrophages, on the other hand, are highly sensitive to chikv and showed cytopathic effect following chikv infection, . Mononuclear cell infiltration and viral replication in the muscles (particularly skeletal muscle progenitor cells, not muscle fibers) and joints are associated with myalgia and arthralgia and synovial macrophages have been shown to contain viral rna months after infection . It may be postulated that an inflammatory infiltration with macrophages in the genital tract may be the source of the chikv, leading to mild symptoms and an unknown persistence time in semen . The detection of chikv in semen has many important implications, including the possibility of sexual transmission . Even though we did not perform cytopathic assays for chikv, this finding must be further investigated . We did not find any other study showing evidence of chikv in semen and, specially, for such a long period since the onset of symptoms . Another unique finding in our study was the detection of chikv in urine after 30 days of the initial symptoms contrasting with recent findings in literature showing no detection of chikv in urine after the first week of symptoms onset . This could provide an expanded window for the diagnosis of a recent infection with chikv . The use of prednisolone may have contributed to the prolonged viral shedding and another factor that may, in part, have added to that was the possible interaction between chikungunya and dengue type 3 . With the ongoing circulation of denv, chikv and zikv in brazil, such a finding of dual infections will be increasingly seen and reported, as we recently published for chikv and zikv . In india, an estimate of co - infection with chikv and denv using serological markers estimated point prevalences on the range of 5.79.5% . In 1964 myers and carey reported that seven patients out of 332 patients (2.1%) from south india had a simultaneous increase in antibody to both chikv and denv virus and that these patients had also an unremarkable clinical course and an expected development of antibodies to both agents, indicating that the host response was not altered by the dual infection . During an outbreak of both chikv and denv-1 in toamasina, madagascar, in 2006, 10 out of 55 patients sampled (18.2%) were shown to be co - infected with both virus with no complications recorded . However, chahar et al . Reported that during the 2006 dengue outbreak in delhi six patients were co - infected with chikv and denv (with denv-3 in 5 out of 6), 2 of these patients had dengue hemorrhagic fever with central nervous system (cns) involvement and one patient died . More recently, villamil - gomez et al . Reported a 49-year - old male from colombia with a febrile illness, bilateral conjunctivitis and a pruritic rash that was diagnosed with zikv, chikv and denv and had an uneventful course . The true extent of chikv - denv co - infection has been hampered by current diagnosis largely based on clinical grounds with unavailability of molecular methods in many parts of the world, . This work was supported by the ministry of education coordenao de aperfeioamento de pessoal de nvel superior (capes) zika fastrack number 88887116628/2016 . Written informed consent was obtained from the patient for publication of this case report and accompanying images . A copy of the written consent is available for review by the editor - in - chief of this journal on request.
Nephron - sparing treatments have been considered as the best therapeutic strategy for localized renal cell carcinoma (rcc), and these procedures have gained popularity . The application of renal ablative treatments, including radiofrequency ablation and cryoablation, has been increasing . These approaches preserve renal function, shorten the duration of hospital stay, and result in early convalescence . However, these treatments have limitations such as the lack of pathologic tumor assessment and uncertain long - term oncologic outcomes . Although its oncological outcomes are equivalent to those of radical nephrectomy for localized rcc, partial nephrectomy has advantages over radical nephrectomy [3 - 5]. Patients undergoing radical nephrectomy have a significantly higher chance of developing chronic renal insufficiency than do those undergoing partial nephrectomy . The incidence of renal insufficiency over time is significantly greater in patients undergoing radical nephrectomy . Herein, we present our early experiences of robotic partial nephrectomy (rpn) procedures performed at our institution and compare the operative outcomes of rpn with those of lpn . Between february 2009 and june 2010, 13 patients underwent transperitoneal rpn (group 1) and 14 patients underwent transperitoneal lpn (group 2) by a single surgeon . The patients were diagnosed with rcc or angiomyolipoma (aml) indistinguishable from rcc in radiologic studies . The operative methods were chosen after obtaining informed consent and agreement for the charges for the operations from the patients . Rpn was performed with the da vinci s system (intuitive surgical, sunnyvale, ca, usa). In case of a centrally located tumor, a ureteral stent the patients were placed in a 70-degree lateral position under 14 mmhg of co2 gas insufflation . Usually, 3 robotic ports and 1 assistant port were used . In cases of a tumor in the upper pole of the right kidney, an additional robotic trocar (the third robotic arm) 1). In addition, a 30-degree, 10 mm robotic camera was used . The patient cart with robotic arms approached the patient posteriorly . The renal vein was not clamped . Before tumor excision, 12.5 g of mannitol was administered intravenously . After removal of the tumor, a frozen biopsy of the tumor bed was performed . The renal parenchyma with capsule was sutured with vicryl 2 - 0 attached to hem - o - lok clips (weck closure systems, research triangle park, nc, usa). The continuous suture was initiated from outside the renal parenchyma and continued to compress the renal parenchyma . Hem - o - lok clips were placed after each throw of the running suture . Finally, absorbable clips (lapra - ty, ethicon inc ., somerville, nj, usa) were applied instead of tying knots (fig . 2). After confirmation of hemostasis, a fibrin sealant (tisseel, baxter ag, vienna, austria) and a cellulose mesh (surgicel, ethicon inc ., the patients' records were reviewed retrospectively . To compare the operative results of the 2 groups, the mann - whitney u test and fisher's exact test were used ., chicago, il, usa), with p - values<0.05 considered to indicate statistical significance . The characteristics of the patients who underwent rpn (group 1) or lpn (group 2) are presented in table 1 . Four cases (30.8%) in group 1 had a history of abdominal operations, including inguinal herniorrhaphy, laparoscopic hemicolectomy, appendectomy, and laparoscopic renal cyst excision . Five cases (35.7%) in group 2 had a history of abdominal operations, including transvaginal hysterectomy, transabdominal hysterectomy, laparoscopic partial nephrectomy, and laparoscopic cholecystectomy . The mean operative time was 153.222.3 minutes and 117.532.0 minutes in groups 1 and 2, respectively (p=0.003). The mean robotic console time of group 1 was 101.221.5 minutes, and the mean laparoscopic time of group 2 was 86.832.3 minutes (p=0.139). The definition of the laparoscopic time was from insertion of the laparoscopic instruments to removal of the instruments . Although the operative time of rpn was longer than that of laparoscopy, the differences in robotic console time and laparoscopic time were not significant . The mean warm ischemic time was 35.38.5 minutes and 36.46.8 minutes in 9 patients of group 1 and 10 patients of group 2, respectively (p=0.823). The mean estimated blood loss in groups 1 and 2 was 283.6113.5 ml and 264.1163.7 ml, respectively (p=0.382). Transfusion was performed in 2 patients (15.4%) in group 1 (p=0.222). Postoperative pain control was achieved by patient - control analgesia with morphine (40 mg) and ketorolac (150 mg) for 2 days . Additionally, pethidine hcl was administered at mean dosages of 3.38.8 mg and 3.512.0 in groups 1 and 2, respectively (p=0.299). The mean times to postoperative initiation of ambulation were 1.20.4 days and 1.20.4 days (p=0.920), and the times to initiation of oral intake were 1.20.4 days and 1.10.3 days (p=0.504) in groups 1 and 2, respectively . The mean length of hospital stay in groups 1 and 2 was 6.21.8 days and 5.30.6 days, respectively (p=0.290) (table 2). The mean tumor size was 2.71.2 cm and 2.01.2 cm in groups 1 and 2 (p=0.035). Pathologic results showed 11 cases of rcc and 2 cases of aml in group 1, and 9 cases of rcc, cases of aml, and 1 case of oncocytoma in group 2 (p=0.785). Open partial nephrectomy (opn) is one of the standard modalities of nephron - sparing surgery . Long - term follow - up results of opn for localized rcc have shown acceptable cancer control effects [6 - 8]. However, the postoperative recovery period of opn is similar to that of open radical nephrectomy because of the morbidity due to the large flank incision . The number of lpns has steadily increased since its introduction by winfield et al in 1993 . The indications are expanded to more challenging cases, however, including central and hilar tumors, endophytic tumors, tumors greater than 4 cm, tumors in solitary kidneys, and tumors in patients with compromised renal function . Concerning oncological outcomes, the 5-year cancer - specific survival rate for t1 rcc was more than 90% in a multicenter study . Lpn has surgical and functional outcomes similar to those of opn in addition to comparable oncological outcomes . Gill et al presented a comparative study of lpn and opn, in which lpn had shorter operating time, less estimated blood loss, shorter hospital stay, and longer warm ischemic time . Marszalek et al demonstrated that lpn had shorter warm ischemic time, hospital stay, and operating time in 200 patients undergoing either lpn or opn . . However, lpn still has a steep learning curve to overcome the technical challenges of complete tumor excision with hemostasis and renal reconstruction in a limited renal ischemic time . It can offer a magnified, three - dimensional view and fully - articulating wristed instruments and enables surgeons to perform difficult operations . Aron et al presented no proven advantages of rpn over lpn in 12 matched - pair patients . However, due to advances in the surgical technique, favorable operative results and intermediate - term outcomes have been demonstrated in recent reports . The positive surgical margin rate ranged from 0% to 2.3% [17 - 23]. Rpn has advantages in the treatment of complex tumors such as endophytic, hilar, and multiple tumors . Rogers et al reported the feasibility of rpn for hilar tumors in 11 patients in a multi - institutional analysis . Even though the feasibility and safety of rpn has been proven, it does have drawbacks, including the lack of haptic feedback, dependency on an assistant, and high operating costs . Long - term functional and oncological outcomes are needed to make rpn a standard treatment for small renal tumors . Our initial experience with rpn showed acceptable operative outcomes comparable with those of previous reports [15 - 23] one of the reasons was that the patients required a longer stay under the korean health care system . Although the operative time of rpn was longer than that of lpn, there was no significant difference in robotic console time and laparoscopic time . It might take some time to connect the robotic surgical system to the patient in the rpn group . The reasons for the long ischemic time might be the insertion time of suture materials and inexperienced assistants . If we had found a remnant cancer, we would have performed a radical nephrectomy . They had intraperitoneal adhesions from previous abdominal operations, which led to incomplete arterial dissections and clampings and bleeding . We did not find advantages in the operative results of rpn, which will require further accumulation of experience and technical developments . We used a sliding - clip renorrhaphy for calyceal reconstruction and parenchymal compression . When placing the hem - o - lok clips, it is necessary to pull the suture taut and then push the clip snug against the renal parenchyma . After completion of the suture and confirmation of hemostasis, a fibrin sealant and cellulose mesh were applied to the suture site . Finally, a third layer suture of the fascial covering was performed . This technique has certain advantages, including effective hemostasis, decreased dependence on assistance, and decreased operation and warm ischemic time . Furthermore, long - term follow - up is needed to identify oncologic and functional outcomes of rpn . Our experiences showed that rpn was technically feasible, and its operative outcomes were comparable to those of lpn . Although the operative time of rpn was longer than that of lpn, there was no significant difference in operative outcomes, including robotic console time and laparoscopic time . To identify advantages of rpn, we must accumulate more experience and make further technical developments . Further studies with long - term follow - up of rpn are also needed to make rpn a standard treatment for localized rcc.
Radon gas can be absorbed into the bloodstream following inhalation, and it will then be distributed to the systemic tissues . This results in a dose of radiation to the tissues, although the effective dose from radon gas inhalation is generally about 20 times less than that resulting from radon progeny inhalation [1, 2]. The biokinetics of inhaled radon has been studied both numerically [38] and experimentally [9, 10]. Different biokinetic models for radon have been developed with regard to the systemic compartments and relevant parameters such as a tissue / blood partition coefficient . The latest model, which was developed as a generic biokinetic model framework for inhaled (and ingested) noble gases, was reported by leggett et al . . The predictions generated when this model was applied to radon were shown to be consistent with measured data from earlier human studies . The majority of radon biokinetic models assume that inhalation is the only route of exposure to radon, and that no entry occurs through the skin . Only the model calculation by peterman and perkins explained that gas exchange of xenon through skin is much lower (about 0.6%) than that occurring by inhalation, suggesting the assumption that uptake through the skin could be ignored was valid . In response to this report, the question arose as to whether this observation was still true for a person taking a bath in a radon hot spring, as the radon concentration in thermal water is much higher than that in air (maybe by at least three orders of magnitude). In such a situation, it is possible that skin exposure may be a significant contributor to the radiation dose . The water that gives rise to natural spas rises through major faults or large fissures in the earth, and may come from deep underground zones to reach the surface at moderate temperatures . This underground water may contain high concentrations of radon as a result of passing through cracks or pores that are surrounded by materials containing high levels of radium, such as rocks and radium deposits . It has been reported that water with a radon concentration between hundreds and thousands of becquerels per liter may be used for therapeutic purposes . Depending on the ratio of the radon concentration in thermal water to that present in the surrounding air, the amount of radon absorbed via the skin would be expected to be less significant than, similar to or more significant than the dose obtained by inhalation . However, the dermal absorption rate of radon from water and its subsequent systemic modeling have not been elucidated in detail . The aim of the present study was to evaluate quantitatively the skin absorption of radon that takes place during taking a bath using published data from human subjects . The most recent biokinetic model for radon was first modified to account for skin absorption as an intake route . Values of the unknown parameter, i.e. The skin permeability coefficient, were estimated from human data; the variability and validity of the estimated values are then discussed . Lastly, radiation doses due to the intake of radon or its progeny via inhalation or skin absorption are simply assessed for a possible exposure scenario in a radon hot spring to better understand the impact of each exposure route . Here it should be noted that in this paper, the terms radon and radon progeny are clearly differentiated, and the units bq l and bq m are used for water and air, respectively, according to the convention . This model was developed by incorporating skin compartments into the model previously published by leggett et al . . In their original model, the only routes of radon intake that were considered were inhalation and ingestion, because the purpose of their study was to develop a generic model from the viewpoint of radiation protection from inert gas exposure by inhalation and ingestion . Our fundamental mathematical descriptions for the kinetics of radon in tissues, and the values of the introduced parameters (e.g. The transfer coefficient between compartments and tissue mass) are derived from those reported in the paper of leggett et al . And icrp publ . 89 [3, 12]. Based on the rationale behind this biokinetic modeling, the rate of change in the radon activity in a tissue (compartment), qi (bq), is expressed as: (1)dqidt = fi(cacv)qi fig . Rt - air, respiratory air; breast - g, glandular tissue of breast; breast - a, adipose tissue of breast; hatm, human alimentary tract model . Rt - air, respiratory air; breast - g, glandular tissue of breast; breast - a, adipose tissue of breast; hatm, human alimentary tract model . Where fi (m s) is the blood flow rate, ca (bq m) is the radon concentration in non - pulmonary arterial blood, cv (bq m) is the radon concentration in non - pulmonary venous blood and (s) is the decay constant of radon . This equation can be rewritten as: (2)dqidt = fivaqafipiviqiqi where va (m) is the volume of the non - pulmonary arterial blood, qa (bq) is the activity of radon in the non - pulmonary arterial blood, pi () is the tissue / blood partition coefficient of radon and vi (m) is the volume of the tissue . The terms fi / va and fi/(pivi) are called the transfer coefficients from arterial blood to tissue, and from tissue to venous blood, respectively . Equations (1) and (2) are also applicable to the compartment unexposed skin (head), since the head does not touch the thermal water . On the other hand, for the compartment exposed skin (other), a new term describing the exchange of radon via skin must be added to eq . (1): (3)dqesdt = fes(cacv)+kaes(cwcesps / w)qes where the subscript es stands for the exposed skin, k (m s) is the permeability coefficient of radon in skin, a (m) is the surface area, cw (bq m) is the radon concentration in water and ps / w () is the skin / water partition coefficient of radon . This kind of treatment has been widely employed as a first approach in previous studies of the dermal uptake of substances (e.g.). In a manner similar to the rearrangement of eq . (2), eq . (3) can be rewritten as: (4)dqesdt = fesvaqafespsvesqes+kaescwkaesps / wvesqesqes, where ps () is the skin / blood partition coefficient of radon . Parameters related to the two skin compartments (i.e. Blood flow rate, tissue volume and the skin / blood partition coefficient) were determined as follows . The blood flow rate was assumed to be simply proportional to the surface area . According to icrp publ . 89, the total surface areas of the human body are 1.90 m for adult males and 1.66 m for adult females, and the skin on the head accounts for 7.5% of the total area of the body for both sexes . In addition, regional blood flow rates in adults are given as 5.0% of the cardiac output for both sexes . Consequently, the blood flow rates were estimated to be 0.4% (= 5.0% 0.075) of the cardiac output for the skin on the head, and 4.6% (= 5.0% (1 0.075)) for the remaining skin . For the estimation of the volumes of the two skin compartments, epidermal and dermal masses of 0.005 and 0.22 g cm, respectively, were used . The volumes (or masses) of skin on the head and the remaining parts of the body were subsequently calculated to be 0.292 l (321 g) and 2.71 l (2979 g), respectively, for adult males; and 0.255 l (280 g) and 1.84 l (2020 g), respectively, for adult females . A tissue / blood partition coefficient of 0.4 was assigned to both skin compartments, as this value was applied to the compartment to evaluate values of k and their range, our model calculation was fitted to human data from three previous studies [1416]. The experimental conditions and results are briefly summarized in table 1 . During each experiment, the subject's body (except the head) exhaled air samples were taken from the subjects during and/or after bathing, and their radon concentrations were measured . The study of nagy used radon - free air, meaning that subjects were only exposed to radon through their skin . Furuno were similar, although the radon concentrations in both water and air were different by an order of magnitude [15, 16]. Table 1.summary of human volunteer experiments and values of kaes estimated by the present modelreferenceexperimental condition kaes (m s)number of subjectsradon concentration (bq m) water temperature (c)bath time (min)breath sampling for radon measurementwaterairnagy 17 (male 8; female 9)average: 73 10 range: (6586) 10<1.93160once immediately after bathing.5th percentile mode gm (median) am 95th percentile5.4 10 9.5 10 3.7 10 7.3 10 2.7 10tempfer et al . 1 (female)950 1030003720eleven times during and after bathing.best estimate7.4 10furuno 1 (unknown)58 102743660five times during bathing.best estimate6.9 10since it was impossible to identify which data corresponded to male or female subjects, the analyses were performed individually assuming that the subjects were all male or female . The sex - averaged kaes is represented here; in fact, the values were almost the same between the assumed male and female groups.radon-free air was used for breathing . Summary of human volunteer experiments and values of kaes estimated by the present model since it was impossible to identify which data corresponded to male or female subjects, the analyses were performed individually assuming that the subjects were all male or female . The sex - averaged kaes is represented here; in fact, the values were almost the same between the assumed male and female groups . For the evaluation of k, we relied heavily on empirical data reported in the study of nagy, which included a large ensemble of volunteers (table 1). The radon concentration in the exhaled air samples from the original data were normalized to a radon concentration of 100 bq l in thermal water (fig . 2). It is apparent that the data are comparable to a log - normal distribution with a geometric mean (gm) of 303 bq m and a geometric standard deviation (gsd) of 3.2 . The distributions of k and kaes were evaluated, and the results are shown in table 2 and fig . 3, respectively . It is worth noting that the cohort of volunteers participating in nagy's study was composed of different sexes and ages, and individuals could not be uniquely identified in the corresponding plots in fig ., we therefore assumed that all experimental data were obtained either from male or female adults . As shown in table 2, the values of k between the 5th and 95th percentiles ranged over two orders of magnitude, while different skin surface areas resulted in small differences in k between males and females . In fact, the values of kaes were almost the same for both sexes, leading to overlapping of the two curves shown in fig . Table 2.skin permeability estimated by fitting the present model calculation to the experimental data provided by nagy skin permeability k (m s)malefemalek5th mode5.4 106.2 10kgm geometric mean (median)2.1 102.4 10kam arithmetic mean4.1 104.8 10k95th 95th percentile1.5 101.8 10note: since it was impossible to identify which data corresponded to male or female subjects, the analyses were individually done assuming that the subjects were all male or female . 2.distributions of radon concentrations in exhaled air (bq m) immediately after a 60-min bathing session in thermal water . The closed circles are experimental data reported by nagy, which were normalized to a radon concentration of 100 bq l in thermal water . Gm stands for geometric mean, gsd for geometric standard deviation and am for arithmetic mean . Gm stands for geometric mean, gsd for geometric standard deviation and am for arithmetic mean . Skin permeability estimated by fitting the present model calculation to the experimental data provided by nagy note: since it was impossible to identify which data corresponded to male or female subjects, the analyses were individually done assuming that the subjects were all male or female . Distributions of radon concentrations in exhaled air (bq m) immediately after a 60-min bathing session in thermal water . The closed circles are experimental data reported by nagy, which were normalized to a radon concentration of 100 bq l in thermal water . Gm stands for geometric mean, gsd for geometric standard deviation and am for arithmetic mean . Gm stands for geometric mean, gsd for geometric standard deviation and am for arithmetic mean . In the studies of tempfer furuno, the time dependence of radon concentration in exhaled air during (and after) bathing was investigated [15, 16]. In fig . 4, measured data are compared to least - squares - fitted data, and the best estimated k values (kbest) were obtained . Both values of kbestaes (7.4 10 and 6.9 10 m s) were found to fall between k5th (5.4 10 m s) and k95th (2.7 10 m s), which were determined from the empirical data of nagy . The curve total was then separated according to the contribution of each exposure route into the parts via inhalation and via skin. Fig . 4.comparisons between the model calculations and human studies of radon concentrations in exhaled air during and after bathing in thermal water . Experimental data: (a) tempfer et al . And (b) furuno [15, 16]. The solid curves were obtained by the use of the best estimated k values (kbest), which were determined by fitting the experimental data . Taking into account the contribution of each exposure route, the curves (total) were then separated into inhalation and skin uptake . Comparisons between the model calculations and human studies of radon concentrations in exhaled air during and after bathing in thermal water . Experimental data: (a) tempfer et al . And the solid curves were obtained by the use of the best estimated k values (kbest), which were determined by fitting the experimental data . Taking into account the contribution of each exposure route, the curves (total) were then separated into inhalation and skin uptake . Two scenarios were tested to illustrate the influences of both the permeability coefficient k and the different exposure routes on the radon concentration in exhaled air during and after bathing . In the first, it was assumed that the bathing time was 20 min and the radon concentrations were 100 bq l in the thermal water and 0 bq m in the surrounding air (i.e. Only skin exposure was considered). Secondly, a scenario of only inhalation exposure with a concentration of 1000 bq m in air was considered . As shown in fig . 5, the rates of increase and decrease in radon concentration during and after exposure are different between the two exposure routes 5.model predictions of radon concentrations in exhaled air during and after bathing in thermal water, for several values of k. first, only skin exposure was assumed, with the following conditions: bathing time 20 min and radon concentration 100 bq l in water . For comparison, only inhalation exposure was assumed with a bathing time of 20 min and a radon concentration of 1000 bq m. model predictions of radon concentrations in exhaled air during and after bathing in thermal water, for several values of k. first, only skin exposure was assumed, with the following conditions: bathing time 20 min and radon concentration 100 bq l in water . For comparison, only inhalation exposure was assumed with a bathing time of 20 min and a radon concentration of 1000 bq m. from table 1, it can be concluded that the values of kaes (i.e. K) estimated from the three human studies were reasonably consistent . In addition, the time trends indicated in fig . 4 these facts suggest that the present biokinetic model is accurate and represents a useful tool to predict the rate of radon intake through skin from thermal water, and its subsequent behavior in the body . According to kety and krogh [17, 18], the increase in the diffusion coefficient of an inert gas is approximately 1% c in the temperature range between 0 and 36c . The range of the results obtained for kaes allowed us to conclude that the degree of radon absorption through the skin is more strongly influenced by individual variability than the water temperature . Thus, the values of kaes obtained here could also be applicable to the entry of radon through skin from the air . However, it is also clear from fig . 4 that the calculated data (solid lines) change more abruptly with time than the empirical data (closed plots); for example, a relatively large difference can be found just after starting the test . The fast increase or decrease in radon concentration observed immediately after starting or finishing the bath, respectively, is mainly due to the assumption made in the model that the concentration of exhaled radon that originated from inhalation could rapidly reach equilibrium with that in the environment . Figure 5 is helpful to better understand this issue . In the case of the compartment rt - air (see fig . 1), our modeling and relevant parameters were in accordance with those reported by leggett et al . . We must emphasize that their original modeling concept (or assumption) was appropriate in terms of continuous inhalation and dose assessment in the area of radiation protection . A half - time of 23 s, corresponding to a transfer coefficient of 2600 d, was assumed for environment rt - air and rt - air environment, which was based on measured half - times (e.g.). This short half - time was estimated from data observed during the rapid phase of noble gas exhalation by human subjects, which occurs immediately after a period of continuous inhalation (8.5 h). The model of leggett et al . Did not pay particular attention to brief inhalation periods, such as those that would occur during bathing (at the longest 60 min), and this may account for the differences observed between the prediction and measurement in fig . 4 . In fact, another measurement by furuno demonstrated that, in the case of exposure resulting solely from inhalation, it took a few tens of minutes to reach an equilibrium between the radon concentrations in exhaled air and those in the environment . In addition, it should be noted that it has not been empirically validated that our model with a single skin compartment correctly represents the radon transport and storage properties of the actual skin layers (stratum corneum, viable epidermis and dermis). This validation is important if the model is to realistically reproduce the behavior of radon in skin . For the assessment of radiation dose, however, validation may not necessarily be required because overestimation or underestimation of the predicted radon concentrations in skin is expected to be counterbalanced when the periods during and after bathing are considered together . The present work is not the first attempt that has been made to incorporate the skin absorption of radon into a biokinetic model . The first model was reported by peterman and perkins, and described the uptake of radon from air into skin . Hofmann and winkler - heil have recently reported that this model was capable of making reasonable predictions . The modeling by peterman and perkins assumed that radon diffusing through surface skin layers was dissolved in subcutaneous fat (i.e. There was no absorption above the subcutaneous fat), and that radon absorption into the bloodstream occurred from this area . Interestingly, they did not rely on experimental data from radon exposure tests with subjects to derive a parameter associated with that process; this parameter was determined using four pieces of information the diffusion coefficient of radon in tissue, the thickness of the surface skin layers, the skin surface area and the volume of subcutaneous fat . In contrast, in a manner similar to that used for many common substances, our skin modeling was based on dermal absorption, and it is difficult to theoretically acquire a value for the permeability coefficient k. our rationale for modeling the intake of radon via skin is different from that of peterman and perkins, although it is evident that both models can reproduce the observed data to some degree . As it was not possible to directly compare the estimated skin parameters of both models, we made an attempt to compare them from the standpoint of the contribution of the skin to the total uptake of radon . Peterman and perkins noted that the contribution of skin to xenon absorption was about 0.6% when compared with the respiratory route; radon may also have a similar value . Our model calculation quantified corresponding values for radon of 0.1% for k5th, 0.2% for kmode, 0.7% for kgm, 1.1% for kam and 2.5% for k95th . In our calculation (eqs (3) and (4)), cw and ps / w were replaced by radon concentration in air (cair) and ps / a (the skin / air partition coefficient of radon), respectively, because in this case, the surrounding medium was air only . It is obvious that our values are in the same range as those given by peterman and perkins, regardless of the difference between the models . At the moment, it cannot be concluded which concept is better used when considering the intake of radon via skin, and this should be studied further . Based on the calculation of radon distribution in the body, doses to tissues were evaluated for a scenario in which radon exposure occurred during a 20-min bathing session with radon concentrations of 100 bq l in thermal water and 1000 bq m in air, followed by a resting period in which radon concentrations of 0 bq m were assumed in both mediums . The activities of radon in the body were followed until they became negligibly small . In the dosimetry, it was assumed for simplicity that equilibrium between radon and its progeny (po, pb, bi and po) was established anytime and anywhere . Only energy deposition from alpha particles was considered because the energies of beta particles and gamma rays emitted by radon progeny are significantly lower . Table 3 shows a comparison of equivalent and effective doses, calculated using various values of k. the doses for red marrow and breast, which have higher tissue / blood partition coefficients, are reasonably higher . It is also obvious that the skin dose increases with increasing k, as expected . In the case of the scenario studied, the effective dose from radon progeny inhalation exposure, which was calculated with the dose conversion factor suggested by the united nations scientific committee on the effects of atomic radiation (unscear), is still more important than the dose resulting from radon exposure, even for k95th . The effective dose from radon exposure accounts for, at most, 8% of the total dose from all exposures . It is worth noting that, if the radon concentration in water is 10 times higher (i.e. 1000 bq l), the dose contribution from the radon exposure can reach approximately 40% in the case of k95th . This high concentration level has occasionally been observed in real hot springs [11, 20]. Table 3.calculated doses for radon exposure following a 20-min bath in radon - rich thermal water (1000 bq m in air and 100 bq l in water) and subsequent resting (0 bq m in both water and air)tissueradon exposure (summed dose from inhalation and skin absorption exposures) radon progeny inhalation exposuremale female kzero (= 0)k5thkmodekgmkamk95thkzero (= 0)k5thkmodekgmkamk95thequivalent dose (nsv)kidneys212223283464212223283464-liver212223283464212223283464-bone surface333448222336-red marrow145151156189231432145152157190232439-breast45484959731364648496073138-skin11385818735211491140622023801251-other121313161936121313161937-effective dose (nsv)323435445510832343644561101200this means only inhalation of radon (i.e. Without accounting for its exchange through skin).the dose from radon progeny inhalation was calculated using a dose conversion factor of 9 nsv (bq h m) and an equilibrium factor of 0.4 . Calculated doses for radon exposure following a 20-min bath in radon - rich thermal water (1000 bq m in air and 100 bq l in water) and subsequent resting (0 bq m in both water and air) this means only inhalation of radon (i.e. Without accounting for its exchange through skin). The dose from radon progeny inhalation was calculated using a dose conversion factor of 9 nsv (bq h m) and an equilibrium factor of 0.4 . A trial assessment of doses from radon in a natural environment (not a bathing situation) the application of our estimated k to the air - to - skin exchange of radon may be valid as discussed above . The effective doses from both inhalation and skin absorption exposures are estimated to be 9798 psv (bq h m) for both sexes for kzero (i.e. Exposure only by inhalation) and any k value given in table 2 . This result leads to the conclusion that skin uptake is negligible compared with the inhalation of radon, even when the inhalation of radon progeny is not considered . In this study, a biokinetic model of radon is introduced in which the exchange of radon between skin and the environment was incorporated into the latest sophisticated model . The skin permeability, k, which is necessarily implemented in the presented model, was determined, and found to have a log - normal distribution among individuals . The estimated values of k were validated for the skin - to - water exchange of radon, and based on their temperature - dependent behavior, were inferred also to be applicable to skin - to - air exchange . The changes in radon concentration in exhaled air during and after bathing, as an index of its dynamics after intake into the body, were compared . In general, there was an agreement between the model predictions and real - world observations . The need to consider the dose contribution of radon absorbed via the skin was also discussed by comparison with the contribution made by radon and its progeny following inhalation . It was shown that this depends on the ratio of the radon concentration in thermal water to that present in air . For typical indoor and outdoor exposures, the intake of not only radon progeny, but also radon, through the skin is negligible in comparison with the intake via inhalation . In situations involving immersion in radon - rich thermal water, however, it might be better to consider the impact of skin absorption; our calculation demonstrated that skin absorption might reach a few tens of a percent of the total dose when the radon concentration is 1000 bq m in air and 1000 bq l in water . This result provides a new insight into the existing approach for radon exposure assessment, although the relevance of these findings may be limited to this kind of special case . Funding to pay the open access publication charges for this article was provided by japan atomic energy agency.
The patients in the african - heritage (n = 9) and caucasian - heritage (n = 11) groups had similar distributions of sex, age, and duration of diabetes (male 75 vs. 70%, p = 0.89; mean sd age 53.3 7.2 vs. 55.2 4.6 years, p = 0.50; and duration 10.3 10.7 vs. 6.8 6.4 years, p = 0.37, respectively). Systolic blood pressure and diastolic blood pressure were 124.4 vs. 122.1 mmhg (p = 0.75) and 77.0 vs. 76.1 mmhg (p = 0.81), respectively . The patients were nave to antihypertensive therapy, and equal numbers in each group received metformin (n = 6) and insulin (n = 2). A1c and urinary albumin were measured by high - pressure liquid chromatography (ha 8 - 121; biomen, berkshire, u.k .) And immunoturbidimetry, respectively . Microalbuminuria was excluded on the basis of three consecutive albumin - to - creatinine ratios <3 mg / mmol in sterile, early - morning urine samples and a urinary albumin excretion rate <30 mg / day . Renal plasma flow (rpf) was measured by the constant infusion method (6,7). A bolus dose of 8 mg / kg paraminohippurate (merck, sharp & dohme, hoddesdon, u.k .) Was given with a 20 mg / min infusion . After a 90-min equilibration period, the concentration of the infusate was multiplied by the infusion flow rate and divided by the mean of duplicate plasma samples at this and subsequent time points . Plasma paraminohippurate was assayed after deproteinizing the samples with 6% trichloroacetic acid for 10 min at 70c and sequentially adding sodium nitrite, ammonium sulfamate, and n-1-naphthylethylenediamine using a cobas mira (roche, lewes, u.k . ). After initial equilibration, an amino acid mixture (vamin; pharamcia & upjohn, milton keynes, u.k .) Was infused (0.043 ml kg min). Rpf was assessed 80 min later, and then l - nmma (clinalfa, laufelfingen, switzerland) was begun at the nonpressor dose of 20 g kg min . Both infusions were continued for a further 20 min, after which a final rpf measurement was made . During the studies, blood pressure was monitored automatically (dinamap; critikon, basingstoke, u.k . ), and whole blood was sampled from a venflon in a hand vein to measure glucose by the oxidase method (one touch; lifescan, high wycombe, u.k .) Every 10 min . Mean arterial pressure (map) was calculated as the diastolic blood pressure plus one - third of the pulse pressure . Renal blood flow (rbf) was calculated by dividing the rpf by 1 hematocrit and renal vascular resistance (rvr) by dividing map by rbf . The study was approved by the ethics committee of the whittington hospital national health service trust . Analyses between or within the groups were performed using spss for windows (version 10; spss, chicago, il). Continuous variables were compared with parametric or nonparametric tests and associations tested with spearman's rank correlation test or pearson's x test according to their distribution . Categorical variables were compared using a test with continuity correction or fisher's exact test . Clearance and rpf measurements were corrected for a body surface area of 1.73 m. data are expressed as means sd unless otherwise stated . Analyses between or within the groups were performed using spss for windows (version 10; spss, chicago, il). Continuous variables were compared with parametric or nonparametric tests and associations tested with spearman's rank correlation test or pearson's x test according to their distribution . Categorical variables were compared using a test with continuity correction or fisher's exact test . Clearance and rpf measurements were corrected for a body surface area of 1.73 m. data are expressed as means sd unless otherwise stated . Comparative baseline measurements of rpf and systolic and diastolic blood pressures were similar between the african - heritage and caucasian - heritage groups (rpf 533.7 174.7 vs. 565.3 260.8 ml / min per 1.73 m, p = 0.78; systolic 124.9 23.7 vs. 121.6 12.3 mmhg, p = 0.29; and diastolic 77.1 9.5 vs. 76.3 5.7 mmhg, p = 0.81, respectively). There were no differences in creatinine clearance or median urinary albumin excretion rate (93.7 19.9 vs. 98.9 19.5 ml / min per 1.73 m, p = 0.57, and 12.6 [4.125.0] vs. 14.0 [interquartile range 8.524.1] mg / day, p = 0.79). Averaged blood glucose was similar (6.7 0.9 vs. 7.4 0.9 mmol / l; p = 0.14). A1c was lower in the african - heritage than in the caucasian - heritage group (6.8 0.69 vs. 8.0 0.94%; p = 0.005). The l - nmma infusion was associated with significant changes in systolic blood pressure in the african - heritage group (fig . Relative to the baseline and post amino acid measurements, there was a mean rise of 10.0 mmhg (95% ci 2.317.9; p = 0.017) and 7.3 mmhg (1.013.7; p = 0.03), respectively, in the african - heritage group and 4.3 mmhg (1.8 to 10.4; p = 0.23) and 2.4 mmhg (3.5 to 8.3; p = 0.38) in the caucasian - heritage group . Final blood pressure was higher in the african - heritage group (137.5 9.0 vs. 123.4 14.2 mmhg; p <0.05) and was associated with a fall in rbf (46.0 ml / min per 1.73 m; p <0.05) and a rise in rvr (from 0.12 0.06 to 0.14 0.04 mmhg ml / min per 1.73 m; p = 0.036). The changes in rvr correlated with map (r = 0.77; p = 0.004). In this study, patients without hypertension or renal disease of african heritage had an increased sensitivity to the renal vasoconstrictive effect of no synthase (nos) inhibition . These data suggest that a reduction in no bioavailability may adversely affect autoregulatory processes that could potentially increase vulnerability to renal damage (8). We used the amino acid infusion to optimize renal blood flow and suppress tubuloglomerular feedback as a contributor to vasoconstriction . Therefore, the reduction in renal blood flow that we observed was probably due to an effect of nos inhibition on the renovascular smooth muscle . Early in the course of diabetes, no production is necessary to forestall a rise in blood pressure . Hypertension is associated with the generation of no - quenching free radicals and is a prerequisite for the development of renal disease (1012). Furthermore, the renal expression of nos in patients with diabetes is related to the degree of vasculopathy (13). It could therefore be considered that upregulation of no production in patients of african heritage is related to a mechanism that opposes an enhanced vasoconstrictor tendency . Although consistent with experimental studies, these outcomes require caution before being generalized . Confirmatory studies in patients with and without diabetes with greater power and the evaluation of the role of vasoconstrictive cytokines, angiotensin
One of the consequences of the negative effects of the metabolic syndrome is a change in the structure and function of the left ventricle . It is well - known how certain risk factors like hypertension, diabetes or obesity affect the structural and functional changes of the left ventricle . A small number of studies have focused on examining the impact of the metabolic syndrome . However, there have been extremely few studies of the influence of the increasing number of metabolic syndrome risk factors on the structure and function of the left ventricle (diastolic, systolic and global). Furthermore, azevedo et al did not assess left ventricular global function, they did not use precise tissue doppler indexes for the estimation of left ventricular diastolic function, and they did not identify ms criteria independently associated with the parameters of structure and function of the left ventricle . The aim of this study was to determine whether the increased number of metabolic syndrome (ms) risk factors caused deterioration of the structure and function of the left ventricle in subjects with metabolic syndrome . This cross - sectional study included 280 consecutive subjects with some cardiovascular risk factors who were sent from the primary care clinic to the echo laboratory at the clinic for cardiology, the clinical centre of serbia, from 1 january 2006 to 31 december 2008 . The study group was divided into 2 groups: the first group involved 204 subjects (108 women and 96 men) with ms, while the control group included 76 subjects (41 women and 35 men) with no ms risk factors . Patients with clinical or laboratory signs of heart failure, coronary artery disease, previous cerebrovascular insult, valvular heart disease, secondary hypertension or other chronic diseases such as cirrhosis of the liver, kidney failure, or endocrinological diseases (except diabetes mellitus type 2) were excluded from the study . Ms was defined by the presence of 3 or more of the american national cholesterol education program s adult treatment panel iii (ncep - atp - iii) criteria from 2001: abdominal obesity (waist circumference 102 cm in men and 88 cm in women), increased fasting triglycerides (1.7mmol / l), decreased hdl cholesterol (<1.0mmol / l in men and <1.3mmol / l in women), high blood pressure (130/85 mmhg or antihypertensive therapy), and increased level of fasting glucose (6.1mmol / l). Considering the number of risk factors and in order to examine the impact of the increasing number of factors on the structural and functional changes of the left ventricle, the ms group was divided into 3 subgroups; subjects with 3, 4 and 5 risk factors . The anthropometric measurements (height, weight, waist circumference) were taken from all subjects included in the study in order to calculate body surface (bsa) and body mass index (bmi). Regarding laboratory analyses, we used the level of fasting glucose, hemoglobin a1c, total cholesterol, low and high - density lipoprotein cholesterol (hdl, ldl), triglycerides and uric acid . Arterial blood pressure values were obtained by measuring the average value of 2 consecutive measurements in the sitting position with 5 minutes between measurements in the morning hours, obtained by conventional sphygmomanometer . The diagnosis of diabetes was based on the criteria of the world health organization published in 2006, and arterial hypertension was diagnosed according to recommendations of the european association for hypertension in 2007 . The protocol was approved by the research ethics committee of the faculty of medicine, university of belgrade . Echocardiographic examination was performed on the acuson sequoia 256 ultrasound system by using a 2-to-4 mhz transducer . The values of all echocardiographic parameters were obtained as the average value of 5 consecutive cardiac cycles . The left ventricle end - systolic (lvesd) and end - diastolic diameters (lvedd), the left ventricle free wall (pwt), septum thickness (ivs) and the left atrium (la) diameter were determined according to the recommendations of the american society of echocardiography . End - systolic and end - diastolic volumes and parameters of systolic function (ejection fraction ef, and fractional shortening the left ventricular mass (lvmass) was calculated by using the penn formula: lv mass=1.04[(lvedd+pwtd+ivs) (lvedd)]13.6 g . The left ventricular mass index (lvmass / the left ventricular hypertrophy was defined as lvmass / ht 51 g / m for men and 49.5g / m for women . The analysis of transmitral inflow velocities was obtained by pulsed - wave doppler in the apical 4-chamber view with the sample volume placed at the mitral valve leaflet tips . Measurements included transmitral early diastolic (e - wave) and atrial (a - wave) velocities which were used to calculate e / a ratio and e - wave deceleration time (dt). Tissue doppler imaging was used to obtain the left ventricle myocardial velocities in the apical 4-chamber view with a 2-mm sample volume placed at the septal and lateral segments of mitral annulus during early diastole (eseptal and elateral) and systole (sseptal and slateral). The e / eseptal and e / elateral ratios were determined using previously estimated values of e and eseptal and elateral flow velocities during early diastole obtained by pulsed doppler and tissue doppler . E / eaverage was determined in the same way (eaverage was calculated as average of eseptal i elateral). The presence of the left ventricular diastolic dysfunction was based on the recommendations of the european and the american society of echocardiography using e / a ratio, deceleration time (dt), isovolumic relaxation time (ivrt), elateral, eseptal, and e / eaverage ratio . Systolic function was assessed by ejection fraction, shortening fraction, as well as the parameters obtained by using tissue doppler (sseptal and slateral). The parameters necessary for calculation of tei index were obtained by tissue doppler in the apical 4-chamber view . The isovolumetric contraction time (ivct) and isovolumetric relaxation time (ivrt) were measured from the end of the mitral annular velocity pattern to the onset of the s - wave and from the end of the s - wave to the onset of the mitral annular velocity pattern, respectively . The ejection time (et) continuous variables were presented as mean standard deviation (sd) and the analysis of equal variance (anova) was used to detect differences between groups as they showed normal distribution . The odds ratios and 95% confidence interval (ci) were calculated by using univariate logistic regression . We calculated p value for the trend of lv hypertrophy and lv diastolic dysfunction prevalence . Stepwise multiple variable regression analysis determined which ms criteria were independently associated with parameters of left ventricular structure and function (rwt, e / a ratio, dt, e / eseptal, and e / elateral). To determine the difference between groups we used bonferroni post - hoc analysis . Echocardiographic examination was performed on the acuson sequoia 256 ultrasound system by using a 2-to-4 mhz transducer . The values of all echocardiographic parameters were obtained as the average value of 5 consecutive cardiac cycles . The left ventricle end - systolic (lvesd) and end - diastolic diameters (lvedd), the left ventricle free wall (pwt), septum thickness (ivs) and the left atrium (la) diameter were determined according to the recommendations of the american society of echocardiography . End - systolic and end - diastolic volumes and parameters of systolic function (ejection fraction ef, and fractional shortening the left ventricular mass (lvmass) was calculated by using the penn formula: lv mass=1.04[(lvedd+pwtd+ivs) (lvedd)]13.6 g . The left ventricular mass index (lvmass / the left ventricular hypertrophy was defined as lvmass / ht 51 g / m for men and 49.5g / m for women . The analysis of transmitral inflow velocities was obtained by pulsed - wave doppler in the apical 4-chamber view with the sample volume placed at the mitral valve leaflet tips . Measurements included transmitral early diastolic (e - wave) and atrial (a - wave) velocities which were used to calculate e / a ratio and e - wave deceleration time (dt). Tissue doppler imaging was used to obtain the left ventricle myocardial velocities in the apical 4-chamber view with a 2-mm sample volume placed at the septal and lateral segments of mitral annulus during early diastole (eseptal and elateral) and systole (sseptal and slateral). The e / eseptal and e / elateral ratios were determined using previously estimated values of e and eseptal and elateral flow velocities during early diastole obtained by pulsed doppler and tissue doppler . E / eaverage was determined in the same way (eaverage was calculated as average of eseptal i elateral). The presence of the left ventricular diastolic dysfunction was based on the recommendations of the european and the american society of echocardiography using e / a ratio, deceleration time (dt), isovolumic relaxation time (ivrt), elateral, eseptal, and e / eaverage ratio . Systolic function was assessed by ejection fraction, shortening fraction, as well as the parameters obtained by using tissue doppler (sseptal and slateral). The parameters necessary for calculation of tei index were obtained by tissue doppler in the apical 4-chamber view . A 2-mm sample volume was placed in the lateral corner of the mitral annulus . The isovolumetric contraction time (ivct) and isovolumetric relaxation time (ivrt) were measured from the end of the mitral annular velocity pattern to the onset of the s - wave and from the end of the s - wave to the onset of the mitral annular velocity pattern, respectively . The ejection time (et) continuous variables were presented as mean standard deviation (sd) and the analysis of equal variance (anova) was used to detect differences between groups as they showed normal distribution . The odds ratios and 95% confidence interval (ci) were calculated by using univariate logistic regression . We calculated p value for the trend of lv hypertrophy and lv diastolic dysfunction prevalence . Stepwise multiple variable regression analysis determined which ms criteria were independently associated with parameters of left ventricular structure and function (rwt, e / a ratio, dt, e / eseptal, and e / elateral). To determine the difference between groups we used bonferroni post - hoc analysis . There was no statistically important difference in mean age between the subjects with ms and controls (538 vs. 527 years, p>0.05). Among subjects with ms, 91 of them (44.6%) had 3 risk factors, 65 of them (32%) had 4 factors, and the remaining 48 patients (23.4%) had all 5 risk factors . Among the patients with metabolic syndrome, the most common risk factors were high blood pressure (76%) and abdominal obesity (75%), followed by elevated levels of triglycerides (56%), glucose (55%) and hdl (52%) if the subgroups with 3 and 4 risk factors are considered separately, distribution of risk factors is different . In this case, in the subgroup with 3 criteria the most common factor was abdominal obesity (85%), elevated blood pressure was in second place (75%), elevated glucose level was third (42%), low hdl with 41% was fourth, and higher level of triglycerides had the lowest prevalence (30%). In the subgroup with 4 ms components, elevated blood pressure was in first place (78%), elevated triglycerides in second place (60%), abdominal obesity was in third place (43%), elevated glucose level was right behind (40%), and low hdl had the lowest frequency (32%). Hypertension was the most prevalent in the subgroup with all 5 factors, while it was equally distributed in subgroups with 3 and 4 factors . On the other hand, diabetes was equally present in subgroups which had 4 and 5 criteria, and was significantly less in the subgroup with 3 risk factors (table 1). Values of all the parameters of ms were significantly higher in all ms subgroups compared to controls (table 1). No statistically significant difference was shown in almost all parameters of the metabolic syndrome, except for hdl level, which decreases with the increasing number of factors . There were no differences in the lv diameters, ef and fs between the observed subgroups, nor when compared to the controls (table 2). The la diameter in subjects with 3 ms risk factors was significantly smaller compared to subjects with 4 or 5 factors . The rwt exhibited stepwise increases from the group with 3 factors to the group with all 5 risk factors, while lvmass index did not differ significantly in subjects with 4 or 5 risk factors, but it was still significantly increased when compared to the group with 3 criteria (table 2). The parameters of systolic function obtained by tissue doppler (sseptal and slateral) were similar in the 3 subgroups . On the other hand, parameters of left ventricular diastolic function e / a, dt, eseptal, elateral, e / eseptal, e / elateral, and e / eaverage progressively deteriorated with an increasing number of risk factors (table 2). The parameters required for calculation of tei index also changed with the increased number of risk factors . Thus, ivrt and ivct exhibited stepwise prolongation with the increased number of criteria, while there was no significant difference in et between the observed subgroups, except among the subgroups with 3 and 5 risk factors (table 2). These findings showed that there was a progressive impairment in lv global function, estimated with tei index, as the number of ms criteria increased . Compared with the control group, all 3 subgroups with ms had a significantly higher prevalence of lv hypertrophy (table 3). Subjects with 3 criteria had a 4-fold higher prevalence compared to the control group (or 4.14, 95% ci: 1.3312.88, p=0.01), subjects with 4 factors had 4.5-fold greater prevalence (or 4.5, 95% ci: 1.3914.59, p=0.009), while subjects with all 5 criteria of the metabolic syndrome had an almost 10-fold greater prevalence of lv hypertrophy (or 9.87, 95% ci: 3.0731.73, p<0.001). Among the patients with ms we noticed that subjects with all 5 risk factors had a higher incidence of lv hypertrophy in relation to the remaining 2 groups (table 3) however, subjects with 3 or 4 risk factors have a similar risk of left ventricular hypertrophy, while subjects with 5 risk factors were 2.5 times more likely to have lv hypertrophy than subjects with 3 risk factors (or 2.39, 95% ci: 1.085.27, p=0.038). Patients with 5 components have a similar risk of left ventricular hypertrophy as subjects with 4 risk factors . In relation to the control group, all 3 subgroups of ms had a significantly higher risk of left ventricular diastolic dysfunction (table 3). Subjects with 3 factors of metabolic syndrome had a 3 times greater risk than the control group (or 3.14, 95% ci: 1.267.84, p=0.013), those with 4 factors had almost 3.5 times higher risk (or 3.49, 95% ci: 1.359.07, p=0.012), and subjects with all the criteria had almost 8.34 times greater risk of lv diastolic dysfunction (or 8.34, 95% ci: 3.1921.84, p<0.001). Risk of lv diastolic dysfunction progressively increased from the group with 3 to the group with 5 criteria (table 3). Subjects with 5 factors of metabolic syndrome had 2.7 times higher prevalence than persons with 3 criteria (or 4.65, 95%ci: 1.265.58, p=0.013), and 2.4 times higher prevalence of lv diastolic dysfunction than those with 4 risk factors (or 2.39, 95%ci: 1.085.28, p=0.045). The multivariate linear regression analyses found that systolic and diastolic blood pressure and waist circumference were independently associated with relative wall thickness and dt, respectively (table 4). The same analysis revealed that systolic and diastolic blood pressure, glucose level and waist circumference were also independently associated with e / a ratio (table 4). The multiple regression models of e / eseptal, e / elateral, and e / eaverage revealed systolic blood pressure, triglycerides level and waist circumference as independent predictors (table 5). A small number of clinical studies have explored the impact of different numbers of metabolic syndrome risk factors on the structure and function of the left ventricle . This is the first study that compares the effects of the increasing number of ms components on systolic, diastolic, and global left ventricular function by using tissue doppler imaging . In our study, values of all the parameters of ms were significantly higher in persons with ms compared to controls, but there were no significant differences among the 3 ms subgroups . Individual factors of ms in this investigation were not equally distributed in the ms group and its subgroups . The analysis of echocardiographic parameters of the left ventricle structure showed that there were no differences in the left ventricular diameters between the control group and the 3 subgroups with ms, which corresponds to the findings of other authors . However, there are studies that have shown that left ventricular diameters increased proportionally with the number of ms criteria . Results of the present study revealed that parameters that indicate left ventricular hypertrophy (the left ventricle relative wall thickness, the left ventricular mass indexed to height) progressively increased as the number of ms risk factors increased . The multivariate analyses of our results showed that systolic and diastolic blood pressure and waist circumference were independently associated with relative wall thickness . Other authors also found a correlation between these parameters and left ventricular hypertrophy in ms . Additionally, rurik et al . Found that stability in body weight is a preventive factor of some components of ms, mainly diabetes, which is very important for this population of patients . The prevalence of left ventricular hypertrophy significantly increased with the increasing number of risk factors; hypertrophy was present in 19% of the subjects with 3 factors, 20% of those with 4 factors and even 35% of subjects with all 5 risk factors . This high percentage of subjects with left ventricular hypertrophy can be explained by the large proportion of patients with arterial hypertension, as well as a reasonably high percentage of patients with diabetes . The left atrium diameter also increased from the group with 3 criteria to the group with all 5 criteria of ms, which corresponds to findings from the literature . The traditional parameters of systolic left ventricular function (ejection fraction and fractional shortening) were not different among the observed groups . The parameters obtained by using tissue doppler (sseptal and slateral) also confirmed that there were no significant differences between the groups, which matches the results of fuentes et al . . Parameters of left ventricular diastolic function evidently deteriorated with the increasing number of ms factors . The e / a ratio was progressively reduced from the control group to the subjects with all 5 risk factors due to the increasing of the late diastolic transmitral velocity (a wave), which is probably the consequence of an increase in left ventricle rigidity . The multivariate analysis revealed that systolic and diastolic blood pressure, glucose level and waist circumference were independently associated with e / a ratio . Showed that systolic and diastolic blood pressure and hdl are independent predictors of e / a ratio, while masugata et al . Found that systolic blood pressure and triglycerides were independently associated with e / a ratio . The deceleration time was significantly prolonged with the growing number of risk factors, whereas flow velocities across the septal and lateral segments of the mitral annulus during early diastole measured by tissue doppler (eseptal, elateral) were significantly and gradually reduced, which resulted in higher e / eseptal, e / elateral and e / eaverage ratios . Our study showed that deceleration time was independently associated with systolic and diastolic blood pressure and waist circumference, whereas systolic blood pressure, triglycerides level and waist circumference were independently associated with e / eseptal and e / elateral, respectively . The progressive deterioration of parameters of the left ventricular diastolic function with the increasing number of ms criteria confirmed additive and synergistic effects of ms risk factors on the left ventricle . Fuentes et al . Obtained similar results, noting that they determined eseptal and eglobal (average of 4 mitral annular sites). The same authors also found that diastolic blood pressure, triglycerides and waist circumference were independently associated with eglobal, whereas mahmud et al . The possible reason for the difference between these studies may lie in the fact that the authors used different echocardiographic parameters and, more importantly, different echocardiographic methods for estimation of systolic and particularly diastolic function of the left ventricle . In the beginning it was enough to use pulsed doppler for determination of transmitral e / a ratio, dt, ivrt and estimation of left ventricular diastolic function . The advent of tissue doppler imaging gave us new opportunities for more accurate estimation of left ventricular systolic and diastolic function which we and other authors in recently published studies used (sseptal, slateral, eseptal, elateral). . Found that the prevalence of the left ventricle diastolic dysfunction increases from 20% to 36% starting from the group without risk factors to subjects with 4 or 5 risk factors, while fuentes et al . Revealed that the prevalence of diastolic dysfunction was 79% in the control group, 1718% in the group with pre - metabolic syndrome (1 or 2 criteria), and 2935% in the group with metabolic syndrome . In our research, left ventricle diastolic dysfunction was observed in 9% of the controls, 24% in the group with 3 factors, 26% in the group with 4 risk factors and 46% in the group with all 5 risk factors . The slightly higher percentage of left ventricular diastolic dysfunction in this study could be explained by the higher proportion of hypertensive patients and significantly higher values of systolic and diastolic blood pressure compared to the aforementioned studies . The parameters needed for its calculation were significantly different among the observed groups, so the isovolumetric contraction and isovolumetric relaxation time progressively extended, while the ejection time was quite constant, which resulted in a significant increase in tei index; in other words, stepwise and progressive worsening of global left ventricular function in subjects with ms . After determining the effects of ms on global left ventricular function, other authors did not compare mutual subgroups with the different number of ms factors, and found that global left ventricular function was significantly affected in patients with ms . The lack of subjects with 1 or 2 risk factors could contribute to the findings of metabolic syndrome and its influence on functional and structural damage of the left ventricle certainly is a limitation of the study . On the other hand, the best insight into the effect of metabolic syndrome on left ventricular function and structure is sought through the comparison between subjects with no ms criteria and subjects with 3, 4 or 5 criteria . Patients included in the study were recruited from primary care; however, referral bias still exists because those patients had some cardiovascular risk factor that could contribute to the impairment of lv structure and function, which also represents a limitation to this study . A small number of clinical trials have studied this issue, but even in these studies tissue doppler imaging was not used, which could partly reduce the comparison of obtained results . A small number of clinical studies have explored the impact of different numbers of metabolic syndrome risk factors on the structure and function of the left ventricle . This is the first study that compares the effects of the increasing number of ms components on systolic, diastolic, and global left ventricular function by using tissue doppler imaging . In our study, values of all the parameters of ms were significantly higher in persons with ms compared to controls, but there were no significant differences among the 3 ms subgroups . Individual factors of ms in this investigation were not equally distributed in the ms group and its subgroups . The analysis of echocardiographic parameters of the left ventricle structure showed that there were no differences in the left ventricular diameters between the control group and the 3 subgroups with ms, which corresponds to the findings of other authors . However, there are studies that have shown that left ventricular diameters increased proportionally with the number of ms criteria . Results of the present study revealed that parameters that indicate left ventricular hypertrophy (the left ventricle relative wall thickness, the left ventricular mass indexed to height) progressively increased as the number of ms risk factors increased . The multivariate analyses of our results showed that systolic and diastolic blood pressure and waist circumference were independently associated with relative wall thickness . Other authors also found a correlation between these parameters and left ventricular hypertrophy in ms . Additionally, rurik et al . Found that stability in body weight is a preventive factor of some components of ms, mainly diabetes, which is very important for this population of patients . The prevalence of left ventricular hypertrophy significantly increased with the increasing number of risk factors; hypertrophy was present in 19% of the subjects with 3 factors, 20% of those with 4 factors and even 35% of subjects with all 5 risk factors . This high percentage of subjects with left ventricular hypertrophy can be explained by the large proportion of patients with arterial hypertension, as well as a reasonably high percentage of patients with diabetes . The left atrium diameter also increased from the group with 3 criteria to the group with all 5 criteria of ms, which corresponds to findings from the literature . The traditional parameters of systolic left ventricular function (ejection fraction and fractional shortening) were not different among the observed groups . The parameters obtained by using tissue doppler (sseptal and slateral) also confirmed that there were no significant differences between the groups, which matches the results of fuentes et al . . Parameters of left ventricular diastolic function evidently deteriorated with the increasing number of ms factors . The e / a ratio was progressively reduced from the control group to the subjects with all 5 risk factors due to the increasing of the late diastolic transmitral velocity (a wave), which is probably the consequence of an increase in left ventricle rigidity . The multivariate analysis revealed that systolic and diastolic blood pressure, glucose level and waist circumference were independently associated with e / a ratio . Fuentes et al . Showed that systolic and diastolic blood pressure and hdl are independent predictors of e / a ratio, while masugata et al . Found that systolic blood pressure and triglycerides the deceleration time was significantly prolonged with the growing number of risk factors, whereas flow velocities across the septal and lateral segments of the mitral annulus during early diastole measured by tissue doppler (eseptal, elateral) were significantly and gradually reduced, which resulted in higher e / eseptal, e / elateral and e / eaverage ratios . Our study showed that deceleration time was independently associated with systolic and diastolic blood pressure and waist circumference, whereas systolic blood pressure, triglycerides level and waist circumference were independently associated with e / eseptal and e / elateral, respectively . The progressive deterioration of parameters of the left ventricular diastolic function with the increasing number of ms criteria confirmed additive and synergistic effects of ms risk factors on the left ventricle . Obtained similar results, noting that they determined eseptal and eglobal (average of 4 mitral annular sites). The same authors also found that diastolic blood pressure, triglycerides and waist circumference were independently associated with eglobal, whereas mahmud et al . Found that systolic blood pressure correlated with e / eseptal the possible reason for the difference between these studies may lie in the fact that the authors used different echocardiographic parameters and, more importantly, different echocardiographic methods for estimation of systolic and particularly diastolic function of the left ventricle . In the beginning it was enough to use pulsed doppler for determination of transmitral e / a ratio, dt, ivrt and estimation of left ventricular diastolic function . The advent of tissue doppler imaging gave us new opportunities for more accurate estimation of left ventricular systolic and diastolic function which we and other authors in recently published studies used (sseptal, slateral, eseptal, elateral). Azavedo et al . Found that the prevalence of the left ventricle diastolic dysfunction increases from 20% to 36% starting from the group without risk factors to subjects with 4 or 5 risk factors, while fuentes et al . Revealed that the prevalence of diastolic dysfunction was 79% in the control group, 1718% in the group with pre - metabolic syndrome (1 or 2 criteria), and 2935% in the group with metabolic syndrome . In our research, left ventricle diastolic dysfunction was observed in 9% of the controls, 24% in the group with 3 factors, 26% in the group with 4 risk factors and 46% in the group with all 5 risk factors . The slightly higher percentage of left ventricular diastolic dysfunction in this study could be explained by the higher proportion of hypertensive patients and significantly higher values of systolic and diastolic blood pressure compared to the aforementioned studies . The parameters needed for its calculation were significantly different among the observed groups, so the isovolumetric contraction and isovolumetric relaxation time progressively extended, while the ejection time was quite constant, which resulted in a significant increase in tei index; in other words, stepwise and progressive worsening of global left ventricular function in subjects with ms . After determining the effects of ms on global left ventricular function, other authors did not compare mutual subgroups with the different number of ms factors, and found that global left ventricular function was significantly affected in patients with ms . The lack of subjects with 1 or 2 risk factors could contribute to the findings of metabolic syndrome and its influence on functional and structural damage of the left ventricle certainly is a limitation of the study . On the other hand, the best insight into the effect of metabolic syndrome on left ventricular function and structure is sought through the comparison between subjects with no ms criteria and subjects with 3, 4 or 5 criteria . Patients included in the study were recruited from primary care; however, referral bias still exists because those patients had some cardiovascular risk factor that could contribute to the impairment of lv structure and function, which also represents a limitation to this study . A small number of clinical trials have studied this issue, but even in these studies tissue doppler imaging was not used, which could partly reduce the comparison of obtained results . This research has shown that the structure of the left ventricle is significantly impaired in patients with ms, but that the left ventricular systolic function is completely preserved in patients with ms . Thus it can be concluded that the impaired global left ventricular function is actually the result of impairment of diastolic function . The degree of structural and functional damage increased with the number of risk factors for metabolic syndrome . Further studies recruiting subjects with 1 or 2 ms criteria are necessary for complementing the influence of ms on the left ventricular structure and function.
Most patients with small cell lung cancer (sclc) relapse within a year of initial therapy, and many are candidates for second - line treatment . Although many patients are in excellent physical condition at the time of relapse, few drugs or drug combinations are capable of achieving tumor regression in this setting . Patients with sensitive relapse may respond to a number of agents including topotecan, irinotecan, vinorelbine, paclitaxel, and gemcitabine [1 - 4]. Topotecan is the best - documented second - line therapy for previouslytreated sclc, although treatment outcomes have been disappointing . Topotecan produces an 18% response in patients with sensitive relapse, and in refractory patients, the response is less than 10% . A topotecan / cisplatin doublet showed a higher response rate in patients with sensitive relapse although median survival times were similar to those obtained with topotecan alone . For some patients with sensitive relapse, re - induction with the same regimen or topotecan might be considered, but for patients with refractory relapse, no regimen is a standard option . Thus, patients with good performance status are candidates for clinical trials for further treatment . As a single agent, paclitaxel produces a response rate of 27% in sclc patients with sensitive relapse and a response rate of 20% in those with refractory relapse . Gemcitabine has a response rate of 16% in sclc patients with sensitive relapse and a response rate of 6%-13% in those with resistant relapse . Because of their single - agent activity, different mechanism of action, non - overlapping toxicities, in vitro synergy, and beneficial pharmacologic interaction, the use of a combination of paclitaxel and gemcitabine is an attractive option . Paclitaxel significantly decreases the systemic clearance and volume of distribution of gemcitabine, and significantly increased steady - state concentrations of gemcitabine . Interpatient and intrapatient variability in gemcitabine pharmacokinetics was not observed when gemcitabine was administered in combination with paclitaxel in non - small cell lung cancer (nsclc) patients . Some phase ii trials of first - line gemcitabine plus paclitaxel in nsclc patients showed encouraging response rates of 41%-53% [12 - 14]. These combination chemotherapies, in which paclitaxel was administered every 3 weeks, were associated with substantial toxicity, and grade 3 - 4 neutropenia developed in 70%-80% of patients . Weekly paclitaxel treatment has an efficacy comparable to that of the every-3-weekly paclitaxel but with less myelosuppression and neurotoxicity . Based on these studies, we selected a combination of weekly paclitaxel (80 mg / m) and gemcitabine (1,000 mg / m) and conducted a phase ii study to evaluate the efficacy and safety of this combination in patients with sclc who have relapsed or failed to respond to first - line platinum - based therapy . Eligibility in the study required histologically- or cytologically - confirmed sclc that progressed during or after first - line chemotherapy or chemoradiotherapy . Patients needed to have measurable disease according to the response evaluation criteria in solid tumors (recist). Additional criteria were as follows: patients must (1) be at least 18 years old; (2) have an eastern cooperative oncology group performance status (ecog ps) of 0 to 2; (3) have not had prior radiotherapy on measurable lesions (but previous surgery and/or chest radiotherapy for the primary lesion was allowed); (4) have had a minimum of 28 days since any prior chemotherapy or radiation before study entry; and (5) have adequate bone marrow, hepatic, and renal functions, defined as a white blood cell count 3,500/mm, absolute neutrophil count (anc) 1,500/mm, platelets 100,000/mm, alanine aminotransferase or aspartate aminotransferase 2.5 times the upper normal limit, serum bilirubin <1.5 times the upper normal limit, and serum creatinine 1.5 mg / dl . Patients were excluded if there was severe comorbidity such as a myocardial infarction within the preceding six months, symptomatic heart disease (including unstable angina, congestive heart failure, or uncontrolled arrhythmia), or serious concomitant infection, including post obstructive pneumonia . The presence of central nervous system (cns) metastases, however, was not an exclusion criterion, provided that cns symptoms were absent or sufficiently minor to be well - controlled with corticosteroids . Written informed consent approved by the institutional review board of the national cancer center was obtained from all patients prior to entering the study . This study was registered with clinicaltrials.gov (identifier: nct00453 167). A complete history and physical examination, including documentation of concomitant medications and performance status, standard laboratory studies, and an electrocardiogram, was performed within 14 days prior to study entry . Chest x - ray, computed tomography scans of the chest including the upper abdomen, magnetic resonance imaging of the brain, and a radionuclide bone scan were performed within 4 weeks prior to study entry . Complete blood cell counts and chemistry were performed on days 1 and 8 of each cycle . Paclitaxel (padexol, seoul, korea) and gemcitabine (geroam, seoul, korea) were administered to patients . Treatment consisted of 80 mg / m paclitaxel and 1,000 mg / m gemcitabine by intravenous infusion on days 1 and 8 every 3 weeks until disease progression . Paclitaxel was given first as a 60-minute intravenous infusion, immediately followed by a 30-minute gemcitabine intravenously . Premedication consisted of dexamethasone (10 - 20 mg intravenously), pheniramine maleate (45.5 mg intravenously), and famotidine (20 mg intravenously) before paclitaxel infusion . During the course of chemotherapy, paclitaxel doses were decreased by 15 mg / m for grade 4 hematologic toxicities or grade 3 or 4 non - hematologic toxicities . Gemcitabine doses were decreased by 20% for grade 4 hematologic toxicities or grade 3 or 4 non - hematologic toxicities . The primary objective of this study was to estimate the overall response rate of paclitaxel and gemcitabine as second - line chemotherapy in patients with metastatic or recurrent sclc . The secondary objectives were to estimate the time to progression (ttp) and overall survival (os). With 80% power and a 5% one - sided type i error, 18 patients were needed in the first stage, and 33 patients were needed in total . At the first stage, if there were five or fewer responses out of the initial 18 patients, the study would conclude that the anticipated response rate is less than 20% and would terminate . Otherwise, accrual would continue to a full sample of 33 assessable patients . At the second stage, at least 11 objective responses among 33 patients were required for this regimen to be regarded as worthy of further investigation . The response rate of the treatment was calculated as the ratio of the number of complete and partial responders to the total number of evaluable patients . A 95% confidence interval for the response rate the toxicity profile was estimated as the ratio of the number of occurrence to the total number of evaluable patients . The os was defined as the period of time from the first day of treatment to death from any cause . Patients still alive were censored at the last day on which they were known to be alive . The ttp was defined from the first day of treatment to the date that disease progression was assessed . The duration of response for all responders was defined as the period of time from the date of the first response, i.e., either partial response or complete response (whichever occurred first), to the date of disease progression . Eligibility in the study required histologically- or cytologically - confirmed sclc that progressed during or after first - line chemotherapy or chemoradiotherapy . Patients needed to have measurable disease according to the response evaluation criteria in solid tumors (recist). Additional criteria were as follows: patients must (1) be at least 18 years old; (2) have an eastern cooperative oncology group performance status (ecog ps) of 0 to 2; (3) have not had prior radiotherapy on measurable lesions (but previous surgery and/or chest radiotherapy for the primary lesion was allowed); (4) have had a minimum of 28 days since any prior chemotherapy or radiation before study entry; and (5) have adequate bone marrow, hepatic, and renal functions, defined as a white blood cell count 3,500/mm, absolute neutrophil count (anc) 1,500/mm, platelets 100,000/mm, alanine aminotransferase or aspartate aminotransferase 2.5 times the upper normal limit, serum bilirubin <1.5 times the upper normal limit, and serum creatinine 1.5 mg / dl . Patients were excluded if there was severe comorbidity such as a myocardial infarction within the preceding six months, symptomatic heart disease (including unstable angina, congestive heart failure, or uncontrolled arrhythmia), or serious concomitant infection, including post obstructive pneumonia . The presence of central nervous system (cns) metastases, however, was not an exclusion criterion, provided that cns symptoms were absent or sufficiently minor to be well - controlled with corticosteroids . Written informed consent approved by the institutional review board of the national cancer center was obtained from all patients prior to entering the study . A complete history and physical examination, including documentation of concomitant medications and performance status, standard laboratory studies, and an electrocardiogram, was performed within 14 days prior to study entry . Chest x - ray, computed tomography scans of the chest including the upper abdomen, magnetic resonance imaging of the brain, and a radionuclide bone scan were performed within 4 weeks prior to study entry . Complete blood cell counts and chemistry were performed on days 1 and 8 of each cycle . Paclitaxel (padexol, seoul, korea) and gemcitabine (geroam, seoul, korea) were administered to patients . Treatment consisted of 80 mg / m paclitaxel and 1,000 mg / m gemcitabine by intravenous infusion on days 1 and 8 every 3 weeks until disease progression . Paclitaxel was given first as a 60-minute intravenous infusion, immediately followed by a 30-minute gemcitabine intravenously . Premedication consisted of dexamethasone (10 - 20 mg intravenously), pheniramine maleate (45.5 mg intravenously), and famotidine (20 mg intravenously) before paclitaxel infusion . Granisetron (3 mg) was given intravenously before paclitaxel infusion . During the course of chemotherapy, paclitaxel doses were decreased by 15 mg / m for grade 4 hematologic toxicities or grade 3 or 4 non - hematologic toxicities . Gemcitabine doses were decreased by 20% for grade 4 hematologic toxicities or grade 3 or 4 non - hematologic toxicities . The primary objective of this study was to estimate the overall response rate of paclitaxel and gemcitabine as second - line chemotherapy in patients with metastatic or recurrent sclc . The secondary objectives were to estimate the time to progression (ttp) and overall survival (os). With 80% power and a 5% one - sided type i error, 18 patients were needed in the first stage, and 33 patients were needed in total . At the first stage, if there were five or fewer responses out of the initial 18 patients, the study would conclude that the anticipated response rate is less than 20% and would terminate . Otherwise, accrual would continue to a full sample of 33 assessable patients . At the second stage, at least 11 objective responses among 33 patients were required for this regimen to be regarded as worthy of further investigation . The response rate of the treatment was calculated as the ratio of the number of complete and partial responders to the total number of evaluable patients . A 95% confidence interval for the response rate the toxicity profile was estimated as the ratio of the number of occurrence to the total number of evaluable patients . The os was defined as the period of time from the first day of treatment to death from any cause . Patients still alive were censored at the last day on which they were known to be alive . The ttp was defined from the first day of treatment to the date that disease progression was assessed . The duration of response for all responders was defined as the period of time from the date of the first response, i.e., either partial response or complete response (whichever occurred first), to the date of disease progression . Thirty patients (91%) were men, and 32 patients (97%) had an ecog ps of 0 or 1 . Thirty patients (91%) received irinotecan - platinum and three patients received etoposide - platinum . As a prior therapy, 23 patients received chemotherapy alone, and 10 patients received chemoradiation . Among the chemotherapy - only group, all 23 patients received irinotecan - platinum chemotherapy . Among the 10 patients treated with chemoradiation, seven patients received irinotecan - platinum, and three patients received etoposide - platinum . Sensitive relapse was defined as a chemotherapy - free interval of 3 months or greater, and refractory relapse was defined as no response to initial therapy or progression within 3 months after initial therapy . The median number of cycles administered was three (range, 1 to 12 cycles), and 10 patients completed six cycles of chemotherapy . Over 133 cycles, delayed chemotherapy administration occurred in 44 cycles (33%), and dose reduction occurred in 22 cycles (16%). The most common cause for the delay in chemotherapy administration was either holiday (23 cycles) or neutropenia (19 cycles). Twenty - two cycles required dose reduction, mainly because of neutropenia (18 cycles), thrombocytopenia (3 cycles), and pneumonia (1 cycle). The overall response rate was 29.4% in sensitive relapse and 31.3% in refractory relapse (table 2). The median ttp was 12.0 weeks (95% confidence interval [ci], 7.57 to 16.44), the median os was 31.0 weeks (95% ci, 23.44 to 38.56), and the 1-year os rate was 30.3% (95% ci, 14.6 to 46.0) (fig . 1). No pretreatment characteristic, including sex (male vs. female), ecog ps (0 vs. 1 - 2), stage at diagnosis (limited vs. extensive), smoking history (never vs. ever), prior treatment (chemotherapy only, concurrent chemoradiotherapy vs. chemotherapy followed by radiotherapy), best response of any prior treatment (pr vs. non - pr), treatment - free interval (<3 months vs. 3 - 6 months vs. 6 months), was predictive of tumor response (table 3). The salvage treatments included cyclophosphamideadriamycin - vincristine (6 patients), adriamycin - ifosfamide - vincristine (5 patients), etoposide - cisplatin (3 patients), irinotecan - cisplatin (2 patients), oral etoposide (2 patients), adriamycin - ifosfamide (1 patient), and pemetrexed (1 patient). All patients (n=33) who received at least one cycle of therapy were assessable for toxicity . Toxicity was reported as the maximum toxicity experienced during entire study treatment, rather than just during the first cycle . Hematologic and non - hematologic toxicities observed over the entire course of the study are summarized in table 4 . G4 neutropenia was observed in 18.2% of patients and g3 thrombocytopenia was observed in 24.2% of patients . Another patient died of pneumonia during the third cycle, but g1 neutropenia was present (anc, 1,219/l). G3 another patient developed g3 neuropathy after the first cycle, but recovered completely in 3 months . Thirty patients (91%) were men, and 32 patients (97%) had an ecog ps of 0 or 1 . Thirty patients (91%) received irinotecan - platinum and three patients received etoposide - platinum . As a prior therapy, 23 patients received chemotherapy alone, and 10 patients received chemoradiation . Among the chemotherapy - only group, all 23 patients received irinotecan - platinum chemotherapy . Among the 10 patients treated with chemoradiation, seven patients received irinotecan - platinum, and three patients received etoposide - platinum . Sensitive relapse was defined as a chemotherapy - free interval of 3 months or greater, and refractory relapse was defined as no response to initial therapy or progression within 3 months after initial therapy . The median number of cycles administered was three (range, 1 to 12 cycles), and 10 patients completed six cycles of chemotherapy . Over 133 cycles, delayed chemotherapy administration occurred in 44 cycles (33%), and dose reduction occurred in 22 cycles (16%). The most common cause for the delay in chemotherapy administration was either holiday (23 cycles) or neutropenia (19 cycles). Twenty - two cycles required dose reduction, mainly because of neutropenia (18 cycles), thrombocytopenia (3 cycles), and pneumonia (1 cycle). The overall response rate was 29.4% in sensitive relapse and 31.3% in refractory relapse (table 2). The median ttp was 12.0 weeks (95% confidence interval [ci], 7.57 to 16.44), the median os was 31.0 weeks (95% ci, 23.44 to 38.56), and the 1-year os rate was 30.3% (95% ci, 14.6 to 46.0) (fig . 1). No pretreatment characteristic, including sex (male vs. female), ecog ps (0 vs. 1 - 2), stage at diagnosis (limited vs. extensive), smoking history (never vs. ever), prior treatment (chemotherapy only, concurrent chemoradiotherapy vs. chemotherapy followed by radiotherapy), best response of any prior treatment (pr vs. non - pr), treatment - free interval (<3 months vs. 3 - 6 months vs. 6 months), was predictive of tumor response (table 3). The salvage treatments included cyclophosphamideadriamycin - vincristine (6 patients), adriamycin - ifosfamide - vincristine (5 patients), etoposide - cisplatin (3 patients), irinotecan - cisplatin (2 patients), oral etoposide (2 patients), adriamycin - ifosfamide (1 patient), and pemetrexed (1 patient). All patients (n=33) who received at least one cycle of therapy were assessable for toxicity . Toxicity was reported as the maximum toxicity experienced during entire study treatment, rather than just during the first cycle . Hematologic and non - hematologic toxicities observed over the entire course of the study are summarized in table 4 . G4 neutropenia was observed in 18.2% of patients and g3 thrombocytopenia was observed in 24.2% of patients another patient died of pneumonia during the third cycle, but g1 neutropenia was present (anc, 1,219/l). G3 another patient developed g3 neuropathy after the first cycle, but recovered completely in 3 months . This study was a single - arm phase ii study to evaluate the efficacy of paclitaxel plus gemcitabine in patients with sclc that progressed or failed to respond to platinum - based chemotherapy . Historically, the median os is only 14 weeks if no active therapy is given other than best supportive care (bsc) after first - line chemotherapy . Second - line chemotherapy increased os and resulted in better symptom control compared with bsc . The strongest predictor of outcome for patients with relapsed sclc is the duration of remission . Patients with sensitive disease respond to the same initial therapy in approximately 50% of cases . The median os from the start of a second - line therapy is approximately 6 months . In patients with refractory disease, response rates to second - line therapy are less than 10%, and the median os from the start of a second - line therapy is 4 months . Response rates to combination chemotherapy are higher than those to a single agent; however, the reported response rates are variable, reflecting the population heterogeneity . Our study began in 2005, and a similar study's report was published in 2006 . They showed that weekly paclitaxel and gemcitabine treatment were moderately active in sclc patients pretreated with platinum and etoposide . Paclitaxel (80 mg / m) was given on days 1, 8, and 15, and gemcitabine (1,000 mg / m) was given on days 1 and 8 every 3 weeks . Of these patients, 32% had refractory disease, and the objective response rate was 26%, including 20% in patients with refractory sclc and 28.6% in patients with sensitive sclc . The response rate was only slightly higher in patients with sensitive relapse than in those with refractory relapse, indicating that the regimen may be more useful in the former group . Predictive of response to second - line chemotherapy were the interval between the completion of induction and relapse, the extent of tumor regression achieved with the induction regimen, and the composition of the induction program . Platinum plus irinotecan has been the standard first - line chemotherapy for sclc at the national cancer center in korea since 2002, when the japanese cooperative oncology group showed that irinotecan plus cisplatin was superior to etoposide plus cisplatin in terms of response rate, progression - free survival (pfs), and os . In this study, 30 patients (91%) received irinotecan plus platinum and three patients received etoposide plus platinum . Sixteen patients (49%) had refractory relapse . Given the refractory nature of the disease, the overall response rate of 30.3% in the current study is remarkable, although we set our initial target response rate to be 40% . Our study design required at least 11 objective responses among 33 patients for this regimen to be regarded as worthy of further investigation; 10 patients achieved pr . We observed similar response rates in both groups (29.4% in sensitive relapse and 31.3% in refractory relapse). Also, high activity in patients with refractory disease may reflect a lack of adverse effects of prior treatment with irinotecan / platinum on the antitumor activity of paclitaxel / gemcitabine, which suggests a lack of cross - resistance between paclitaxel / gemcitabine and irinotecan / platinum . A recent randomized phase 3 trial of amrubicin versus topotecan as second - line treatment reported a median os of 7.5 months with amrubicin versus 7.8 months with topotecan; in refractory patients, median os was 6.2 and 5.7 months, respectively . In this study, although amrubicin did not improve survival when compared with topotecan in the second - line treatment of patients with sclc, os did not differ significantly between treatment groups and improvement in os was noted in patients with refractory disease treated with amrubicin . Although direct comparison of phase 2 data with phase 3 data is not reasonable, the weekly paclitaxel / gemcitabine regimen in the current study showed efficacy comparable to amrubicin and topotecan . Because second - line chemotherapy in sclc patients is only palliative, we have to consider quality of life, toxicity, and cost . In the second - line setting, all patients had already received platinum doublets, and thus, we had to consider cumulative toxic effects . A randomized phase iii trial comparing oral topotecan (2.3 mg / m / day for 5 days every 21 days) to intravenous topotecan (1.5 mg / m / day for 5 days every 21 days), found reasonable response rates (18.3% vs. 21.9%) however, g4 neutropenia was common (47% vs. 64.2%), and diarrhea of all grades was observed (35.9% vs. 19.9%). A study of second - line weekly paclitaxel and gemcitabine showed g3 - 4 asthenia in 13% of patients . The average relative dose intensity was 72% for paclitaxel and 83% for gemcitabine . In the current study, the dose intensity was 86.4% for paclitaxel and 85.4% for gemcitabine, and treatment - related toxicity was observed considerably less often (18.2% g4 neutropenia and 24.2% g3 thrombocytopenia). Aside from myelosuppression, g3 non - hematologic toxicities were rare, and most of them were manageable with good compliance . In conclusion, second - line paclitaxel and gemcitabine were well - tolerated with a 30.3% response rate in sclc patients previously treated with platinum - based chemotherapy . Our study suggests that paclitaxel and gemcitabine can be good options for second - line therapy in platinum - resistant sclc patients.
In the previous issue of critical care, chou and colleagues report that early initiation of renal replacement therapy (rrt), as defined by rifle criteria, was not associated with reduction in hospital mortality in patients with acute kidney injury (aki) and sepsis . The timing of initiation of rrt has been a controversial issue for many years in both patients suffering from chronic kidney disease and those suffering from acute kidney disease . A recently published systematic review and meta - analysis on this topic concluded that earlier initiation of rrt in critically ill aki patients may have a beneficial impact on survival but that, in the absence of new evidence from suitably designed randomized trials, a definitive treatment recommendation cannot be made . The idea that' earlier' initiation of treatment should be beneficial stems from our belief that sometimes complex interventions may change the course of a disease . In the case of aki and sepsis, it has been hypothesized that early dialysis in sepsis can reduce circulating levels of inflammatory substances and may therefore beneficially impact on the pathophysiological mechanisms of the disease . Unfortunately, the validity of this premise has never been proven, and existing evidence points rather in the opposite direction . Both literature data and the currently published study once more confirm that patients with sepsis die with aki rather than of aki: no single indicator of renal function or kidney injury was predictive of mortality in the multivariate model as it was applied by chou and colleagues . In the patient group with septic aki, dialysis should not be seen as a curative intervention, but rather as supportive therapy, preventing the patient from dieing from hyperkalaemia or fluid overload during the period the kidneys are temporarily failing . As a consequence, early dialysis, in the semantic meaning of' intervention before support is needed', exposes patients to side effects of the treatment without really helping them . Problematic for correct interpretation of the data in nearly all studies, including the one by chou and colleagues, is the fact that virtually all are retrospective . This complicates the interpretation at various levels . As strict clinical rules on the timing of initiation of dialysis were present in these icus during the collection of these data, all patients in fact started at the same' time point' in their disease, that is, when they fulfilled one of the preset criteria . As such, the categorization' early versus late' loses the semantic significance of a' time - related event', and in fact no conclusions on timing can be made . Conclusions on the impact of' early versus late initiation of dialysis' would only be justified when, at the moment patients fulfilled the criteria for dialysis, one group started rrt immediately while for the other group dialysis was delayed for one or more days . In the only available randomized controlled trials in this field, early versus late was defined by the urinary output versus biochemical values or by magnitude of urinary output . One important aspect of the current paper by chou and colleagues is that the rifle criteria have no value in determining the need for dialysis, as equal numbers of patients within the different rifle categories were apparently started on dialysis . Indeed, if rifle were a good predictor of need for dialysis, one would expect that there was a preponderance of rifle class' i' or' f' in the cohort of dialyzed patients, quod non . Unfortunately, the study does not provide data on the distribution of the different rifle categories in the non - dialyzed patients, but we would not be surprised that these rifle categories were exactly comparable to those in the dialyzed cohort . Rifle is a scoring system developed to grade prognosis of acute renal injury, and although it performs quite well at the cohort level, its applicability to individual patient outcome is rather poor . This is even more true in the current study, as the most powerful component of the rifle criteria, urine output, was not taken into account . As a consequence, the correct conclusion of the current data should thus be that serum creatinine is not a good parameter to use for determining when to start dialysis in aki patients, just as has been found in patients with chronic kidney disease . The omission of urine output as a parameter is critical, especially as fluid overload (central venous pressure> 12 mmhg) was a criterion to start dialysis . The combination of evaluation of fluid status and urine output, and especially the evolution over time of these two parameters, is probably one of the major decisive criteria to start dialysis at present . When the patient is euvolemic, or even volume overloaded, and still remains oliguric despite maximal support, one should not await further organ damage, and dialysis should be initiated . In addition, as only patients who did actually start dialysis were included, it is difficult to guess what happened to patients with classes rifle 0 or i who did not start dialysis . It is likely that these patients had a better survival than those who did start dialysis, and then, the conclusion of the study would be that early initiation of dialysis based on rifle criteria is detrimental . Such a conclusion is different from the statement that early initiation of dialysis based on rifle criteria in patients with sepsis does not reduce mortality . In conclusion, maybe we cannot answer this question now because it may be the wrong question: as dialysis is supportive and not curative, patients either need dialysis, in which case it should not be delayed, or they do not need dialysis, in which case it can only harm . Once we have agreed on those, the timely initiation of dialysis in those who are predicted to inevitably progress to one of those conditions seems the most appropriate strategy . In contrast, with current practice, it seems unlikely that serum creatinine or another serum / urine - based biomarker will be one of those criteria.
Periprosthetic supracondylar femoral fractures following total knee arthroplasty (tka) are infrequent, but is a devastating complication . The purpose of this study was to evaluate the incidence and outcomes of periprosthetic supracondylar femoral fractures following tka using nonoperative as well as open reduction and internal fixation (orif) techniques . Between january 2004 and december 2010, we followed 3,920 operated patients of total knee arthroplasty (tka) and identified 23 patients with periprosthetic supracondylar fractures . Details regarding pre fracture status, treatment offered and the present status were also recorded and analyzed . There were 17 women and 6 men and the average age was 68.26 years (range 52 - 83 years). Of the 23 patients, 20 patients were treated by operative method, whereas only three patients with relatively undisplaced fractures were treated nonoperatively . As per radiological assessment, two of three conservatively treated cases had malunion, whereas among 20 cases treated operatively, 16 had primary union with one malunion . Two patients had union after bone grafting, whereas two had nonunion . The average reduction in the knee score after fracture was 20.53% . Desirable results for periprosthetic fractures can be obtained if proper and timely intervention is done, taking into account the other comorbid conditions . However, short duration of followup and small number of patients were major limiting factors in this study . Periprosthetic supracondylar femur fractures following total knee arthroplasty (tka) are infrequent, but devastating, complications . Although the prevalence is low at present, ranging from 0.3 to 2.5%, as the number of tkas performed increases, so will the number of periprosthetic fractures . Risk factors associated with the development of periprosthetic fractures include osteopenia, osteoporosis and certain disease processes such as rheumatoid arthritis, seizure disorders, parkinson's disease and myasthenia gravis . The use of corticosteroids, old age and female sex have been implicated . Processes related to the implant and surgical technique such as anterior femoral notching, malalignment, loosening of the implant and osteolysis play an additional role in the development of periprosthetic fractures . Treatment options range from nonoperative methods including casting, traction and bracing to surgical treatment with open reduction and internal fixation (orif), intramedullary fixation and even revision arthroplasty . The decision whether to proceed with nonoperative or operative treatment has been subject of great controversy . Rates of nonunion for supracondylar fractures proximal to total knee prostheses are higher than for supracondylar fractures without the knee implant . Stems, rods, screws and cement may block the medullary canal, preventing intramedullary fixation of fractures . Stems and rods also block screw fixation through the medullary canal to hold plates on the bone . It has been shown that patients sustaining a periprosthetic distal femur fracture have increased morbidity and mortality rates compared to distal femoral fractures without a prosthesis . If all treatment types are pooled together, the rate of nonunion is 9%, loss of fixation 4%, rate of infection is 3% and the rate of revision surgery is 13% . The purpose of this study was to assess the outcome after periprosthetic supracondylar femur fractures following tka . Between january 2004 and december 2010, we followed 3,920 operated patients of tka and identified 23 patients operated for tka with a periprosthetic supracondylar fracture [table 1]. Details regarding the prefracture status and treatment offered were obtained from the medical record department of the hospital . Predisposing factors such as female gender, osteopenia, inflammatory arthritis, increasing age, use of corticosteroids, presence of notching, manipulation for tka, major trauma and bone osteolysis were assessed . Prefracture status was difficult to assess exactly as all the patients reported to us post fracture . However, from the history it was clear that they had good range of motion (more than 90) and had no stiffness . The inclusion criterion was any patient operated for primary tka surgery having periprosthetic supracondylar femur fracture and the exclusion criteria were any patients with periprosthetic tibial or patellar fractures, patients with revision tka and having periprosthetic supracondylar femur fracture, or patients operated by some other surgeon presenting to this institute with periprosthetic supracondylar femur fracture . We classified the patients having supracondylar fractures according to the rorabeck's scheme of classification . Type i involves a nondisplaced fracture in association with a stable prosthesis, type ii is a stable prosthesis with a displaced fracture and type iii involves any fracture in the presence of a loose prosthesis . Twenty of the 23 patients were treated by plating [figure 1]; we used a distal femoral locking plate (dflp), condylar buttress plate (cbp), or a low contact dynamic compression plate (lcdcp) depending on the fracture . X - ray of knee joint (anteroposterior and lateral views) showing (a) peri prosthetic supracondylar femur fracture on rt . (c) final followup showing union all patients were followed up first at the time of suture removal and then every six weeks for three visits and then six monthly for functional and radiological assessment . Depending upon the postoperative fracture reduction quality and the stability of the fixation, physiotherapy was started in the immediate postoperative period . Initially, guarded knee mobilization (with hinged ak brace) was started and gradually independent knee mobilization was introduced . Subsequently, range of motion and strengthening exercises were introduced and once the signs of clinical and radiological union appeared (decreased pain, increased confidence of the patient, increased range of motion and slow disappearance of the fracture line on x - rays), gradual weight bearing was started . Three of the 23 cases were treated with traction and slab initially, followed by an above - knee cast [figure 2]. All the patients were evaluated at the end of one week for condition of the plaster as well as for radiological alignment . Patients were followed up initially at the end of the first week and then every month for condition of the plaster . X - ray of knee joint (anteroposterior and lateral views) showing (a) periprosthetic supracondylar femur fracture on right side (r 1 type). (b) union at final followup x - ray (treated conservatively with ak cast) once the signs of satisfactory radiological union appeared, the cast was removed and physiotherapy started in form of static quadriceps exercises, stretching exercises, knee mobilization and range of motion exercises . Partial weight bearing was allowed for a period of 4 - 6 weeks and then full weight bearing was started . The total incidence of the periprosthetic fracture in the operated cases of tka in our study was 0.58% (23 cases out of 3,920 consecutive primary tkas). The mean postoperative followup was 26 months (range 5 - 48 months). There were 17 females and 6 males . The average age in the series was 68.3 years (range 52 - 83 years). Average age was 67.5 years in males (range 52 - 83 years) and 68.52 years in females (range 59 - 78 years). The interval between tka and periprosthetic fracture averaged 14.38 months (range 0.1 - 71 months). Of the 23 cases, 11 cases of periprosthetic fractures occurred due to low - velocity trauma; the remaining 12 cases were due to high - velocity motor vehicular accidents (mvas). Osteoporosis was associated with six cases and these fractures were a consequence of a low - velocity injury . Twenty patients had (n = 20) had class ii fracture (displaced fracture with intact bone - prosthesis interface); three patients (with low - velocity trauma) had class i fracture (undisplaced fracture). We used distal femoral locking plate (dflp) in 16 cases, condylar buttress plate (cbp) in three cases and an low contact dynamic compression plate (lcdcp) in one case . The average duration of hospitalization was 11.08 days; 7.67 days for conservatively managed patients and 11.8 days for operatively managed patients [table 2]. Management, duration of hospitalization, complications, knee scores and outcomes three patients had postsurgical infection . Serial blood counts, erythrocyte sedimentation rate (esr) and c - reactive protein titers were done and the patients were considered to be free of infection after the titers remained normal for six weeks after stopping the antibiotics . We could achieve union in the form of malunion in one patient, whereas the other two ultimately progressed to radiological nonunion and refused to have any further surgical intervention . The average duration for clinical union as assessed by the ability of the patient to bear full weight without any walking aid was five months, whereas the average duration of radiological union was seven months . Of the three patients who had malunion, two were from the conservatively managed group . The average knee society score on final followup was 80 in the conservatively managed patients and 87.0 in the operated patients . Seventeen of the 23 patients were ambulatory at the latest followup, whereas two were non ambulatory (functional category 4). Residual alignment at last followup for operated cases was 3.77 of valgus and that for conservatively treated cases was 8.67 of valgus [table 2]. The literature remains fairly divided on the best treatment method of periprosthetic supracondylar femur fractures since hirsch et al . Nonoperative conservative management, using casting, traction and immobilization, can be complicated by delayed union, muscular atrophy, loss of function, venous thromboembolism and physical deconditioning . These include the fracture pattern, degree of displacement and the type of prosthesis used . The functional status of the prosthesis, including loosening, wear and instability, as well as the quality of the surrounding bone, must also be taken into account . Good outcomes were defined previously as healed fractures without joint pain and a 90 arc of motion . Furthermore, it has also been suggested that shortening of the affected limb up to 2 cm and 5 of valgus / varus deformity is acceptable in these cases . Operative management of fracture is undertaken with the goal of achieving fracture stability and union, while allowing early mobilization of the patient . Methods of surgical fixation include standard orif techniques using cbps, condylar screws, or blade plates, retrograde intramedullary rods and supracondylar nails . Osteoporosis is a significant risk factor for postoperative periprosthetic fractures . In our study, it was associated with six cases and the majority of fractures associated with osteoporosis occurred following a low - velocity trauma . Paraschou et al . In their study showed that osteoporosis was associated with six patients out of a total of 15; all fractures were due to low - velocity trauma and the results were similar to those of our study . It has been shown that 3 mm anterior femoral notching resulted in torsional load to failure by 55 n - m . The risk of fracture was initially thought to be due to a decrease in bending and torsional strength associated with notching . These results, however, were based on mathematical and biomechanical studies, but in clinical practice, little evidence is available to support this theory . Ritter et al ., in their retrospective analysis, demonstrated no difference in knees with or without notching . Their observations were attributed to osseous remodeling and stress redistribution . In our study, notching was seen in 14 patients; 10 cases had grade i notching, whereas four cases had a grade ii notching . Of the 14 cases, seven cases had a fracture within six months of tka, whereas others had a fracture after six months . They showed that nonoperative treatment of fractures above well - fixed components can, however, be as successful as surgical intervention and remains a viable first line approach . Although two of them were malunited, all the three fractures united at final followup and none of them needed re intervention or had any other complication . Of the 20 operated patients, 16 underwent dflp, whereas three patients had cbp and one patient was managed with lcdcp . Thirteen of them showed acceptable radiological union within three months; one patient had malunion, whereas one had nonunion which later united following bone grafting . The average duration of hospitalization in our study was 11.08 days, 7.67 days in conservatively managed patients and 11.8 days in operated cases . Six of the 20 operated cases required some form of re intervention after primary management of periprosthetic fracture which increased the duration of hospitalization ranging from 5 to 15 days with an average increase of six days as compared to the average duration without any re intervention . The average reduction in the knee score after periprosthetic fracture is 20.53%, which shows that the periprosthetic fracture ultimately hampers the functional outcome of a tka . As per functional assessment based on the knee score at the final followup, 25% achieved category f1 (> 75), 55% achieved category f2 (50 - 75), 8% f3 (25 - 50) and 12% fell in f4 (<25). Reported three patients with fracture nonunion with varus misalignment at the end of nine months after operative management of periprosthetic fracture . Thus, bone grafting may be a handy tool for treating delayed union / nonunion whenever necessary . Matthew et al . Compared the less invasive stabilization system (liss) and retrograde intramedullary nailing in periprosthetic fractures after tka . These results suggested that the retrograde - inserted nail may provide greater stability for the management of periprosthetic supracondylar femur fractures . Intramedullary nailing is now becoming a method of choice for the treatment of fractures at a relatively proximal level due to good results and relatively fewer complications . Studied pericemented nailing using an intramedullary nail augmented with polymethyl methacrylate (pmma) cement in five patients . They showed that nailed cementoplasty is proposed as a salvage procedure in octogenarians unfit for lengthy interventions . Beris et al . Reported three cases of periprosthetic fractures after tka treated with ilizarov external fixator followed up for three years . Uncomplicated healing of fracture with excellent alignment of lower extremity was achieved in 12 weeks after surgery . The ultimate goal of management in periprosthetic fractures is to restore anatomical alignment and achieve stable fixation and early mobilization . If the prosthesis or implant is loose, or bone quality is poor, then the implant should be revised . If the prosthesis or implant is stable and bone quality is adequate for fixation, then the implant should be retained while the fracture is fixed following standard principles . However, a short duration of followup and small number of patients are major limiting factors of this study . To conclude, we found that the total incidence of periprosthetic fractures in operated tka was 0.58% (23 of 3,920); 87% patients (20 of 23) fell in the r2 category of rorabeck's classification . Desirable results for periprosthetic fracture can be obtained if proper and timely intervention is done, taking into consideration other comorbid conditions.
Modeling the electrostatic potential and energies in systems comprised of biological macromolecules is an essential step for each study aimed at understanding the macromolecules function, stability, and interactions . However, this is not a trivial task, especially for huge systems made of large biomolecules and their assemblages and for modeling phenomena occurring in microseconds and longer timeframes . Continuum electrostatics offers an advantage over explicit methods in such cases since (a) the atomic details of the water phase are reduced and (b) continuum electrostatics intrinsically provides equilibrium solutions . Typically, the macromolecule is considered to be a low dielectric medium while the water phase is modeled as a homogeneous medium with a dielectric constant of 80 . While there is a consensus in the community that a dielectric constant of about 80 is appropriate for describing dielectric properties of bulk water in modeling equilibrated systems, the optimal value of the protein (macromolecular) dielectric constant is still an ongoing debate in the literature . This inconsistency is indicated by the use of numerous optimal dielectric constant values in various studies . Investigations modeling the macromolecule as a rigid object or using snap - shots obtained from molecular dynamics (md) simulations to deliver the energies via molecular mechanics poisson boltzmann (mmpb) or generalized born (mmgb) methods typically use a low dielectric constant of = 1 or = 2 (to account for electronic polarizability), although larger values were reported as well . In works devoted to modeling protein stability, numerous dielectric constant values were used, from as low as = 1 or 2 to as high as = 40, including multidielectric regions . Similarly, in the field of modeling macromolecular interactions, researchers were using various values for the protein internal dielectric constant . Perhaps the most widespread of the optimal values for the dielectric constant is seen in the continuum methods for pka calculations . The most commonly used dielectric constant value is = 4, which is believed to account for electronic polarization and small backbone fluctuations . However, larger values, such as = 8, = 10, = 11, and = 20, were also reported . Other examples can be listed as well, but it is clear that there is no universal value of the dielectric constant that is appropriate for all models and methods . Perhaps the largest body of work on the dielectric constant of proteins is due to warshel and co - workers . It was demonstrated that the dielectric constants in semimacroscopic models depend on the definition and the specific treatment . Using various models and the discriminative benchmark, warshel and co - workers demonstrated that the protein dielectric constant is not a universal constant but simply a parameter that also depends on the model being used . In terms of structural reorganization occurring during the process being modeled, they pointed out that semimicroscopic models which do not model the structural relaxations are forced to use a large value for the dielectric constant . In addition, including the reorganization of ionized residues and plausible water penetration would require applying an even higher dielectric constant in the modeling algorithm . Altogether, the works of warshel and many other researchers point out that the specific treatment of the conformational reorganization (both of the solute and the surrounding water phase) in the continuum electrostatics is the major determinant for the optimal value of the internal dielectric constant . Modeling reactions involving large conformational changes which are not explicitly treated in the computational protocol requires the usage of large values for the dielectric constant, while other reactions that do not induce conformational changes can be successfully modeled with low dielectric constant even when a rigid structure is used . The goal is to develop an automatic procedure which can assign an appropriate dielectric constant value by utilizing the 3d structure of the macromolecule alone . As mentioned above, the continuum electrostatics approach is an alternative to the explicit models, and it is expected to perform the best if it can capture as many details as possible from the explicit model . Explicit models treat the system as a multitude of atoms, some of which are connected via chemical bonds, other interacting via van der waals (vdw) and electrostatic nonbonded interactions (figure 1a). Replacing the atomic details of the explicit models with a continuum should address three important questions: (a) how to treat the water molecules within the immediate water shell surrounding the protein, (b) how to model the cavities inside the protein, and (c) how to model the inhomogeneous protein matrix (figure 1b). Many investigations demonstrated the importance of water molecules in the first layer of water shell and that their properties differ from those of bulk water . The main reason is that a significant fraction of these water molecules may be involved in direct interactions with protein atoms, and thus their ability to move and reorient can be severely restricted in comparison with those of the bulk water . In addition, the surface exposed amino acid side chains are quite flexible, and if these alternative conformations are ensemble averaged, the resulting shell surrounding the protein will be a mixture of protein side chains and water molecules . Obviously the dielectric properties of this shell cannot be modeled with the bulk dielectric constant of 80 . In addition, the dielectric constant should depend on the topology of the protein surface, such that the immediate water shell around convex surfaces should be assigned a lower dielectric constant (water and side chain reorganization is more restricted) than that of the concave protein surfaces . Because of this, it is also important to be able to determine the artificial boundary between the protein and water, which results in generating the so - called molecular surface . The treatment of cavities or channels inside the biomolecules is another crucial problem for continuum electrostatics methods . The water molecules in small cavities are very few, typically their mobility is highly restricted and should be modeled with a dielectric constant lower than that of bulk water . In contrast, in large cavities, the waters may form clusters and act collectively . In addition, some cavities may be filled with water molecules with short or long residential times; thus cavities or channels containing water molecules with low occupancy should be treated as regions with a low dielectric constant and vice versa . Perhaps the most crucial issue for continuum electrostatics is the treatment of the protein matrix . Atoms in biomolecules have different charges and flexibilities depending on the packing and their mutual interactions . Because of that, macromolecules dielectric properties are not homogeneous, resulting in a position - dependent dielectric constant (figure 1b). Different flexibilities are accounted when comparing the binding site involved in lock - and - key versus induced - fit binding as well as those in allosteric regulations . The proteins involved in electron and proton transfer are shown to be inhomogeneous in their dielectric response to the charge translocation as well . In general, the hydrophobic core is much better packed and contains significantly fewer charged atoms than the molecular surface and therefore has a much lower capacity to respond to the local electrostatic field, and thus, from a continuum electrostatics point of view, should be modeled as a low dielectric medium as indicated in ref (35). These observations prompted the development of approaches to assign a specific local dielectric constant to each amino acid type or even to each amino acid . Some of these approaches include the intrinsic polarizabilities of amino acids delivered from the results of md simulations, using residue - specific dielectric constants for pka calculations and optimizing the amino - acid - specific dielectric constant to predict the folding free energy changes due to mutations . All of these approaches treat the protein matrix as a kind of mosaic structure made of small blocks with different dielectric properties . Bypassing the question about the applicability of a macroscopic definition of the dielectric constant for such small structural segments, the main problem with such approaches (including our previous work) is the nonrealistic nature of the dielectric boundary between the segments with different dielectric constants . The smooth dielectric function should reflect the physical nature of the macromolecule, and the most straightforward approach is to be delivered from atomic densities of the corresponding atoms . Space occupied by loosely packed and charged atoms is expected to have the potential to reorganize and to respond to the local electrostatics field and thus should be modeled with a high dielectric constant . Such regions correspond to a protein surface which is loosely packed and rich in charged and polar residues . In contrast, space regions made of tightly packed uncharged atoms, as in the hydrophobic core, have little ability to respond to the local electrostatic field and should be modeled with a low dielectric constant . All of these features can be captured with the so termed gaussian method of representing atomic densities and then using it to deliver a smooth dielectric function . It should be clarified that we emphasize using such an approach to deliver a smooth dielectric function for the entire space but not to model the water molecule boundary or derive the surface of molecules . In this work, we report a gaussian - based approach to deliver a smooth dielectric function for the entire space domain (the macromolecule(s) and the water phase). To assess the effects of this development on various biophysical quantities which can be computationally modeled, the method was implemented in the delphi program, and several tests were carried out . The correctness of the approach in reflecting the expected physical properties of macromolecules is demonstrated on a large set of protein structures by showing that the generated smooth dielectric function results in values of about 67 in the protein interior and values of 2030 at the protein water interface, which is consistent with previous md - based work . In addition, it is shown that the space occupied by charged and polar groups is assigned larger dielectric values as compared to the space occupied by hydrophobic amino acids . Furthermore, in a benchmarking test of a large set of experimentally determined pka s in staphylococcal nuclease (snase), the gaussian - based smooth dielectric function (with low reference dielectric constant value of 4) delivers much better results (rmsd = 1.77) as compared with the homogeneous dielectric method (rmsd = 2.43), despite the fact that the homogeneous dielectric method optimal results were obtained at a higher dielectric constant value of 10 . The results of homogeneous and gaussian - based smooth dielectric methods for each individual titratable group are shown in supporting information (table s1). Given a molecule in the water phase, we applied the gaussian equation and implemented three steps as follows to calculate the dielectric distribution of a protein from its density distribution as originally described by nicholls et al . Given a macromolecule with n atoms, the density of an atom i is represented by a gaussian distribution (figure 2a, b):1where i(r) is the density at position r, ri is the distance between the center of the atom i and position r, ri is the vdw radius of atom i, and is the relative variance . Upper panels: cartoon presentation in the 2d grid plane, where intensity of the colors reflects the value of either the density or . Lower panels: profiles of the density and resulting . After the density of each atom within the macromolecule is generated, the density in the overlapping areas occupied by multiple atoms is calculated by2where the mol(r) denotes the density at position r coming from multiple atoms, and i(r) is the density of a single atom i, which is obtained from eq 1 . This function guarantees that the density at the overlapping region is higher than the density generated by any involved single atom, but the density mol (r) always stays between 0 and 1 (figure 2c, d). Finally, the smooth dielectric function is delivered from the density distribution using the linear function:3where on the left denotes the dielectric distribution function, in denotes the reference dielectric value when the density is 1, out denotes the reference dielectric value for the water phase, and is the density obtained from eq 2 (figure 2e, f). The above formalism, provided that standard force field atomic vdw radii are used, has only one adjustable parameter, the variance in the gaussian distribution . The functional forms of eqs 13 can also be considered as adjustable since atomic density in principle can be modeled with almost any symmetrical smooth function (different from gaussian), and the corresponding molecular density and dielectric function can be delivered by other means different from eqs 2 and 3 . However, it seems to us that the most important parameter is still the variance in the gaussian distribution, since its variation will essentially mimic the usage of different functions in eq 1 . In the current work, the functional forms of eqs 2 and 3 are kept as originally suggested in ref (40), but alternatives will be explored later . Thus, in order to proceed further with the analysis, the value of the normalized variance in eq 1 must be selected . In this work, we chose to select it based on a benchmarking test of pka values, because dielectric relaxation is the most profoundly associated with ionization / deionization phenomena (see discussion for more details). In order to assess the impact of the smooth dielectric function on the accuracy of pka calculations and to deliver the optimal value of the normalized variance, we utilized the experimental data obtained in garcia - moreno s lab (http://pkacoop.org/wordpress/?p=28) and used in the pka cooperative (http://pkacoop.org/wordpress/). The reason for selecting this data set is not only because it is a representative set for the pka cooperative but also because it involves pka s both surface - exposed and buried amino acids . This data set is comprised of 89 pka s for staphylococcal nuclease (snase). In 19 of the cases, the pka calculations were based on the structure of wild type (pdb i d: 1stn) snase and its hyperstable variant (pdb i d: 3bdc), which is called +phs . In 20 of the cases, pka calculations were based on the x - ray structures of snase with mutations, and in 50 of the cases, the pka calculations were based on the in silico generated mutant from the wild type snase (pdb i d: 3bdc; list of the amino acids, structure used, and experimental pka s are available from the pka cooperative web page, http://pkacoop.org/wordpress/). Since the predictions of the pka s in our list do not require modeling multiple titration sites, but the prediction of a single pka per structure, the following surface - free approach (sfa) was developed and applied . Note that because energies are delivered as grid energies of the corresponding finite - difference algorithm, there is no need to define a molecular surface . This provides a significant advantage over previous works, since defining the molecular surface would add additional uncertainty in the protocol . In addition, the sfa reflects best the motivation and the development of the smooth dielectric function: no need to draw a sharp border between the protein and the water phase . For each pka calculation, four structures were generated (figure 3): (1) the deprotonated state of the concerned residue in the protein, (2) the protonated state of the concerned residue in the protein, (3) the deprotonated state of the concerned residue in water, and (4) the protonated state of the concerned residue in water . The structures of the protein and the residue for which pka is calculated were kept identical in the four states in order to cancel the artificial the extra proton of protonated asp / glu was not modeled, but its charge was distributed evenly over the carbonyl oxygens (the argument being to avoid artificial grid energy). Similarly, the missing proton of deprotonated lys / arg was not removed from the side - chains, but the charge was distributed over all polar hydrogens to result in zero net charge for deprotonated lys / arg . Pka of a residue calculated via four step procedures representing four states: (a) the deprotonated state of the residue in the protein, (b) the protonated state of the residue in the protein, (c) the deprotonated state of the residue in water, and (d) the protonated state of the residue in water . For each state, the grid energy was calculated, keeping the grid and position of the protein and the residue of interest identical among the runs, and the following energies were obtained: (1) g (depro, protein), the protein electrostatic grid energy with the deprotonated residue; (2) g (proto, protein), the protein electrostatic grid energy with the protonated residue; (3) g (depro, water), the electrostatic grid energy of the deprotonated residue in the water phase; and (4) g (proto, water), the electrostatic grid energy of the protonated residue in the water phase . Then, the value of the pka shift was calculated as4 the parameters used in delphi were scale = 2 points /, perfil = 70, and out = 80.0 . The convergence criterion was 0.0001 [kt / e], and the linear poisson boltzmann equation was solved . The internal reference dielectric constant and the normalized variance were considered to be adjustable parameters . The charges and radii were taken from the amber force field . In order to ensure the statistical significance of the analysis and to assess the general trend of the smooth dielectric function, a large set of diverse proteins was taken from the pdb bank (http://www.rcsb.org/pdb/home/home.do), and several filtering steps were performed . First, only structures determined by x - ray experiments with a resolution less than 1.5 were selected . Finally, the structures with cofactors which are not made of regular residues were also deleted from the data set . The final data set was made of 91 proteins: 1arb, 1bgf, 1bkr, 1byi, 1c8c, 1es9, 1ew4, 1ezg, 1g8a, 1gpp, 1gqi, 1h1n, 1hzt, 1i1j, 1i2 t, 1idp, 1ijy, 1jl1, 1k0 m, 1kmt, 1kng, 1l3k, 1lkk, 1llf, 1lu4, 1lzl, 1m1f, 1mf7, 1mn8, 1my7, 1n62, 1ng6, 1nkd, 1nko, 1o7i, 1o7j, 1o82, 1o9i, 1oai, 1oi7, 1r29, 1r7j, 1sg4, 1sjy, 1smo, 1t3y, 1tqg, 1tvn, 1ucs, 1ukf, 1ulr, 1usm, 1utg, 1uxz, 1uz3, 1v05, 1vh5, 1w5r, 1w7c, 1x6z, 1xod, 1xsz, 1z21, 1zzk, 2a26, 2a6z, 2b0a, 2car, 2e3h, 2end, 2fcj, 2fhz, 2fq3, 2gec, 2gom, 2h3l, 2hox, 2hqx, 2ivy, 2j5y, 2j6b, 2ohw, 2p5k, 2pmr, 2pth, 2ve8, 2vn6, 3bbb, 3bzp, 3cjs, 3ct6 . The data set was used to analyze the following plausible relations and distributions: (1) the average dielectric constant () and radius of gyration of the protein and (2) the average and residue type distribution . (1) average dielectric constant distribution: for each protein in the data set, the center of the mass and gyration radius were calculated . Then, the protein interior was mapped into different shells with a different radius from the center of the protein . For each shell, the average value obtained from all grid - midpoints inside this shell was calculated . Thus, an -radius map was generated for each of the proteins (figure 4a). (2) -residue type distribution: the average dielectric constant per residue was calculated using only the side chain atoms (backbone was not included). Then, a sphere of radius 5 was drown around each side - chain atom, and the dielectric constants of all midgrid points within the sphere were summed and averaged . Further, these average dielectric constants were summed over all atoms of the side - chain and averaged again to obtain the average dielectric constant per side chain . Finally, the average dielectric constant for each type of residue was obtained from all residues with the 91 protein set . Average dielectric constant against the radius of gyration (rg) of a protein . (a) schematic of calculating the average value of a shell with radius r and thickness d; the thickness of the shell is set as 0.1 rg of a protein . (b) average -radius distribution of 91 proteins in the data set . Left upper corner shows the structure of elongated protein (1uz3.pdb) for which the spherical shape is not a good approximation, and on the right lower corner is shown a protein (1brk.pdb) which is almost spherical in shape . The test on small molecule free energies of transfer from a vacuum to water was done on a data set of 504 neutral organic small molecules taken from david mobley s group . The solvation energies of all of these molecules have been experimentally determined, with the range from 11.95 to 3.16 kcal / mol . Solvation energy gsol has two components, polar and nonpolar:5where gpolar indicates the polar (electrostatic) term and gnonpolar denotes the nonpolar term . The polar component of solvation energy was calculated as the grid energy difference of the system in water and in a vacuum:6 the above grid energies were calculated keeping the corresponding small molecule at the same grid position to cancel the grid artifacts . Specific considerations were made for the calculations in a vacuum since one has to define the molecular surface in this case (the border between molecule and vacuum). Note that in our approach the dielectric function is continuous and runs throughout the entire space and is designed to describe dielectric properties of the molecule in water . Here, we assume that the properties of molecules are unchanged as they are moved from water to a vacuum . Thus, following the strategy implemented in zap, the molecular surface of molecules is defined by applying a specific cutoff for the dielectric constant, cutoff . The cutoff was varied in the protocol to obtain the best fit against experimental data . The nonpolar term of solvation energy gnonpolar is calculated via the accessible surface area method:7where and b are constants and sa denotes the solvent accessible surface area, which is calculated using naccess2.1.1 (http://www.bioinf.manchester.ac.uk/naccess/). The force field used in the calculations was am1-bcc, which is part of general amber force field (gaff). In order to optimize the parameters, reference in was varied from 0.1 to 4.0, the value of normalized variance i was varied from 0.80 to 1.40, and the value of epsilon cutoff bnd was varied from 4.0 to 60.0 . For each combination of the i and bnd values, the least - squares method was used to obtain the optimized and b constants . The best parameters are shown in the results section (note that because of the different nature of the process, these values are not expected to be the same as those obtained in pka calculations . In this section, the results of parametrizing and using the smooth gaussian - based dielectric function are presented . It should be restated that this development is aimed to better capture the effects seen in explicit electrostatic calculations within the framework of continuum electrostatics for proteins . The proteins are the primary target because of their intrinsic conformational flexibility, the presence of small or large cavities inside, and an irregularly shaped protein water interface . However, introducing a smooth gaussian - based dielectric function should not deteriorate the performance of continuum electrostatics even in the cases involving modeling molecules rigid by nature with no cavities inside, such as small molecules and drugs . Thus, the features of the smooth gaussian - based dielectric function are manifested modeling several classes of problems: (a) pka s of various titratable groups with the pka cooperative initiative, (b) conceptual considerations and linkage to the physical properties of proteins and amino acids, (c) the role of electrostatic potential on the electron transfer in the reaction center protein, (d) free energy of transfer of small molecules, and (e) reducing grid dependency in energy calculations . Analysis of the results at the last two pka cooperative meetings showed that groups using rigid structures for pka calculations obtain the best results with respect to the experimental data if a large value is assigned for the protein dielectric constant . The works of groups utilizing md techniques to predict pka s indicated that almost in each case the ionization induces small or large conformational change in the proteins . Because of these observations, the pka cooperative data set was chosen for testing the gaussian - based smooth dielectric function . Thus, the pka values of 89 residues in staphylococcal nuclease protein (snase) were calculated using the sfa method described in the methods section, and predictions were compared between homogeneous dielectric and gaussian - based methods . In both cases, the value of the internal dielectric constant was independently varied to obtain the smallest rmsd with respect to experimental data . In order to determine the best protein value for the pka calculation in a homogeneous protein dielectric, the protein value was varied from 1.0 to 20.0 with an increment of 1.0 . For each protein value, the pka values were calculated for all 89 cases and then compared to the experimental results . It was found that the best protein value for homogeneous dielectric pka calculations is 10.0, which resulted in a rmsd between calculated and experimental pka values of 2.43 pk (figure 5). Using a gaussian - based method on the same data set, two parameters need to be determined, the values of the reference dielectric value in and the normalized variance . Here, we varied the reference in from 1.0 to 10.0 with an increment of 1.0 and from 0.80 to 1.20 with an increment of 0.01 . For each combination of these two parameters, the calculated pka values for all 89 cases were compared with the experimental values . From this test, the best parameters for pka calculations obtained are in= 4.0 and = 0.93, resulting in rmsd = 1.77 (figure 5). Results of pka calculations of 89 residues in staphylococcal nuclease protein (snase), calculated using the homogeneous method and gaussian method in delphi . The fact that the gaussian - based method achieves a much smaller rmsd than the homogeneous protein dielectric method is very encouraging . In addition, the best results using the gaussian - based method were obtained at a low reference dielectric constant of 4, while the best dielectric constant using the homogeneous method was 10 . This indicates that the gaussian - based method mimics the effects of the conformational changes occurring in the titration better than the homogeneous high dielectric does by distributing dielectric values within the protein structure . The first task is to check if the generated smooth gaussian - based dielectric function addresses the questions mentioned in the introduction about modeling the protein water interface, cavities inside the protein, and the protein matrix . For the testing, the optimal values for the reference internal dielectric constant and normalized variance obtained in the pka section were used . The reaction center protein (pdb i d: 1aij) was taken as a test case (although the test was done on many other proteins as well). Figure 6 shows the results of (a) a slice of dielectric distribution and the entire protein structure and (b) a slice of dielectric distribution with atoms close to this slice . Several differences from the traditional homogeneous dielectric distribution method can be seen, the smooth gaussian - based method results in three improvements: (1) the dielectric distribution near the protein water boundary region no longer contains a discrete dielectric jump . Instead, it now smoothly increases from a low dielectric value inside the protein to water = 80 in bulk water . (2) the small cavities inside the protein are assigned proper dielectric values . For small cavities, which may contain only a limited number of water molecules, which are not free to move and reorient, the dielectric value for such cavities is neither water nor protein . Instead, the gaussian - based method assigns dielectric values between water and protein depending on the cavity size and shape . (3) the dielectric distribution inside the entire protein is not simply a constant value (protein). The regions with tightly packed atoms are assigned lower dielectric values, while the regions with loosely packed atoms get higher dielectric values . This distribution reflects the physical nature of the dielectric response: the regions filled with loosely packed atoms should be treated as polarizable media, since the atoms in those areas can move to respond to the local electrostatic field . In contrast, tightly packed atoms in the hydrophobic core do not carry much charge and cannot respond to the local field and therefore should be considered as regions with low polarizability . (b) a slice of dielectric distribution with atoms close to the slice surface . It is expected that the average dielectric constant in the core of the protein is lower than that on the surface, as indicated in a previous md study . Here, the same question is addressed on a set of 91 diverse proteins (see the methods section). Each black line in figure 4b denotes the dielectric distribution of a particular protein . It can be seen that the distributions of the dielectric constant of all the proteins in the data set have the same tendency: the dielectric value in the core is close to protein . As the shell moves toward the surface of the protein, the dielectric value grows . When the radius of the shell is about two gyration radii, the average dielectric value of the shell region reaches water . However, despite the overall similarity, different proteins have different dielectric distributions . When the radius of the shell is equal to the gyration radius, the maximum and minimum average dielectric values of the shell are 64.7 for protein pdb i d 1uz3 and 8.4 for the protein pdb i d 1bkr . The reason for this difference is a different shape of these two proteins (see figure 4b). The protein 1uz3 is a very elongated, nonspherically shaped protein, and the average dielectric value is large at the shell with a radius equal to the gyration radius because it includes water as well . If the protein has a spherical - like shape, the average dielectric value of the shell with a radius equal to the gyration radius is smaller, as for the protein 1uz3 . The red line in figure 4b indicates the average behavior of the dielectric distribution of all 91 proteins . This general tendency reveals that the inner parts of the proteins have lower average dielectric values and the outer parts have higher values . Another analysis was carried out to show the distribution of dielectric values per residue type . For each residue, the average dielectric value of all side chains was calculated as described in the methods section . The calculations were performed on all 91 proteins in the data set, and then the results were averaged per amino acid type (figure 7). Figure 7 shows the average dielectric constant value for each type of residue, and it can be seen that the range is from 11.0 to 25.6 . Charged amino acids (lys, arg, glu, and asp) are associated with the highest average dielectric values . They have the propensity to be located on the surface of the protein and to be loosely packed, leaving room for structural rearrangement . The observation that the gaussian - based dielectric function has the largest value assigned for the space occupied by such residues correctly reflects the physics of dielectric relaxation and supports the usefulness of the developed procedure . Thus assigning high dielectric values for charged residues is physically sound, which has been shown to improve the accuracy of pka s and the electrostatic potential calculation . The space occupied by hydrophobic residues is assigned relatively low average dielectric value (figure 7). Hydrophobic residues are more likely to be found in the core of the protein, typically tightly packed and not able to adopt alternative conformations . In addition, their side chains are made of atoms carrying little charge . Because of that, their ability to alter the local electrostatic field is very limited . The fact that the gaussian - based method automatically assigns a low dielectric constant for the hydrophobic residues is very encouraging and demonstrates that the method captures the correct physics . In the middle their average dielectric values (figure 7) are higher than that of hydrophobic residues but lower than that of charged residues . Thus, the model reflects the correct physics for these amino acids as well . The analysis is focused on investigating the role of the electrostatic potential on the electron transfer from quinone a (qa) to quinone b (qb) in the reaction center protein . Previous works demonstrated that this process is slow and involves conformational changes in the protein . Since the goal of the gaussian - based smooth dielectric method is to mimic the effects of conformational changes via properly assigned dielectric constant, this particular reaction is a perfect test for the method . To illustrate the advantages of the gaussian - based smooth dielectric method over the standard homogeneous dielectric approach, the electrostatic potential distribution in the reaction center protein (pdb i d: 1aij) was calculated using both the regular homogeneous method and the gaussian - based method implemented in delphi . The electron transfer is from qa to qb, the electrostatic potential is expected to be less negative (more positive) at the electron acceptor site (qb) as compared with the electron donor site (qa). Previous work and figure 8 demonstrate that the potential delivered with a homogeneous protein dielectric constant opposes the electron transfer; i.e., the potential at qb is more negative than at qa site . In our previous investigation, this problem was solved by utilizing the results of ref (20), showing that the vicinity of the qb site is more flexible than that of the qa site, which made us assign a high dielectric constant of 20 for the residues with a qb pocket while modeling the rest of the protein with a dielectric constant of 4 . Such an approach requires both prior knowledge about the flexibility of different protein regions and manual assignment of an appropriate dielectric constant . In contrast, the gaussian - based smooth dielectric method automatically assigns adequate dielectric constants based on the 3d structure of the protein and, as seen in figure 8, greatly reduces the potential barrier for the electron transfer . Compared to the potential in figure 8a, the potential at the qa site in figure 8b is less positive and the qb site is less negative . Potentials of qa and qb in figure 8b are at a similar level, which agrees with the experimental observation of the electron transfer process . Electrostatic potential in the reaction center protein (pdb i d: 1aij), calculated by (a) the homogeneous method in delphi and (b) the gaussian - based method in delphi . Previous work on the same data set of 504 small molecules utilized md simulations with the explicit solvent model and reported rmsd of 1.24 kcal / mol . Here, we use the same data set of small molecules to test the performance of both the homogeneous and gaussian - based dielectric . It should be clarified that small molecules are much less flexible than proteins and do not have internal cavities . Because of that, they are not expected to be very polarizable and the gaussian - based method is not expected to offer any advantage over the homogeneous dielectric . However, if the development is correct, it is anticipated that the results obtained with the gaussian - based and homogeneous dielectrics should be quite similar . Keeping in mind that small molecules are less polarizable than proteins, it is expected that different (as compared with those in proteins) reference values for the internal dielectric constant and variance will deliver the best rmsd . Here, we optimized the reference internal dielectric constant, the variance of the gaussian function, the cutoff for the molecule water interface, and the coefficients of the nonpolar component of the solvation energy (calculated with the solvent assessable surface area, sasa). The best results are achieved when the parameters are set as follows: the reference in = 1.0, reference variance i = 1.0, cutoff for the molecular boundary is at bnd = 16 . For the nonpolar term calculation, = 0.0028 kcal/(mol) and b = 0.0948 kcal / mol . The corresponding rmsd is 1.59 kcal / mol, which is close to the results obtained with explicit water simulations . The results of the calculations are shown in figure 9 against the experimentally measured transfer energies . For homogeneous dielectric calculations, the best rmsd = 1.45 kcal / mol (figure 9), when the parameters are set as follows: in = 1.0, = 0.0094 kcal/(mol), and b = 1.1579 kcal / mol . Solvation energies of small molecules calculated by gaussian - based dielectric methods . Calculating electrostatic energies by using finite difference methods if the concerned biomolecule is shifted to a new position, the newly obtained solvation energy might be different from those obtained at the original position . Since the gaussian - based method uses smoothed dielectric distribution rather than two - dielectric constants with a sharp jump at the protein water boundary, it is expected that the energies calculated by the smoothed method should be less grid - sensitive than traditional methods . Figure 10 shows the grid sensitivity of the electrostatic solvation energy of a small molecule calculated with both a gaussian - based smooth dielectric and with a homogeneous dielectric . The first test involved translation such that the small molecule is moved along the x direction in steps of 0.005 and the energy calculated for each position (figure 10a). The molecule was rotated in steps of 10, and for each rotation the energy was calculated (figure 10b). Figure 10 shows that energies calculated with the gaussian - based smooth dielectric function are much less sensitive to the grid details, which is another significant advantage of the proposed approach . Grid sensitivity of the gaussian method and homodeneous dielectric delphi . (b) a triethylamine molecule is rotated in 360. (c) energy sensitivity of shift . Since the nature and the optimal value of the dielectric constant of proteins (and macromolecules in general) was and is the subject of many investigations and scientific publications, it is worth summarizing the outcome of this work with regard to frequently carried research tasks and scenarios . One of the most common tasks in computational research is to calculate the electrostatic component of the solvation energy of a protein or a small molecule . As mentioned in the introduction, such calculations were reported in the literature utilizing various values for the internal dielectric constant . Which dielectric value is the best? Reiterating once more the lessons outlined by warshel and co - workers, we would like to clarify the difference between calculations involving small molecules and those involving proteins . It is useful to envision the case of a molecule for which atomic details are revealed with absolute precision (including hydrogens). Further idealizing the model considering that the thermal motions are not present, the electrostatic interactions among the atoms of the molecule should be calculated with a dielectric constant of 1 (or 2 to account for electronic polarizability). This idealized case represents, to a great extent, the real case scenario of modeling the solvation energy of rigid molecules and, in general, modeling processes which do not induce conformational (and ionization) changes . The above discussion does not represent the best test case of our approach, since the dielectric response is expected to be manifested the best upon introducing / removal of a charge . The natural process in proteins involving charge creation / removal is ionization / deionization of titratable groups upon ph changes or other factors . Because of that, in our opinion, the most appropriate phenomenon to illustrate the advantages of the smooth dielectric function is the pka s modeling . Calculating the pka shift requires one to find the energy difference (most electrostatic component of the energy) between the corresponding protein with ionized and neutral groups of interest . However, typically only the structure of the protein with the group being ionized or neutral is available . Depending on various structural factors, the ionization / deionization of the group could induce small or large conformational changes, which are not taken into account in the protocols using rigid structures . To account for these structural changes, which in turn will affect the electrostatic interactions, we would like to point out that despite the use of a unified reference internal dielectric constant (= 4) for our protein modeling, the corresponding smooth dielectric function is unique for each protein . This is because it results from structural characteristics such as packing, the presence of internal cavities, and their shapes . Because of that, it is expected that the proposed approach and delivered parameters can be used without adjustment in future studies involving different sets of proteins . The analysis of the smooth dielectric function done on a large and diverse set of proteins proved that the approach is physically sound . Indeed, without explicit considerations about physical properties of the amino acid (charged, polar versus hydrophobic), the results on the average dielectric constant value over amino acid types showed that the highest dielectric values were automatically assigned to the space occupied by charged groups, and the lowest dielectric values were attributed to the hydrophobic core . This is obviously related to the packing and the fact that charged and polar residues prefer to be at the protein surface, while hydrophobic groups are typically buried . However, engineered proteins may not follow such a trend and may have a titratable group buried in the packed hydrophobic core, as with many of the cases in the pka cooperative data set . A buried titratable group, charged or not, represents a highly polar structural element, for which the contribution to the protein s polarizability will depend on the ability to change conformation or ionization states and may not be captured by our model . To address the possibility that the local dielectric constant associated with the space taken by titratable groups (especially in case of non - naturally occurring groups) may have to be not only a function of atomic packing but to be further increased, we repeated the pka calculations with a modified gaussian - based approach: the radii of titratable atoms of asp, glu, arg, and lys were artificially lowered by a factor of 2, which resulted in reduced packing and a higher local dielectric constant . The best rmsd (rmsd = 1.75 pk) was found to be almost the same as it was with the original gaussian - based method (rmsd = 1.77 pk). This observation indicates that the current model captures most of the effects relevant to the dielectric response upon ionization, while it does not rule out further improvement by specific treatment of the ionizable groups.
Mr spectroscopic imaging (mrsi) is a powerful imaging technique that provides spatially resolved metabolic information . It has been used together with anatomical and functional imaging to improve diagnostic specificity in multiple diseases, and it shows promise for improving treatment planning and the ability to monitor therapeutic response [111]. Despite great interest in this technology from the research and clinical communities, the adoption of advanced mrsi methods has been relatively slow, with a relatively limited number of studies having applied such techniques in clinical trials of new therapies . A major limitation in integrating mrsi into these studies has been the lack of commercially available methods for visualization and interpretation of the data . For conventional 3d imaging, the use of the dicom standard has resulted in a great deal of interoperability between software packages, imaging archives, and data . However, despite the existence of a dicom standard for encoding mrsi data, current datasets are still created with vendor - specific proprietary formats . This results in a low degree of interoperability between imaging devices, picture archiving and communication systems (pacs), and software packages for analyzing the data . This situation is particularly problematic for multicenter collaborations, which require complicated workflows and file format conversions to evaluate data from multiple vendors . As a result, information about variations in metabolic parameters is typically delivered to pacs in the form of static dicom secondary capture images, which hinders its integration with other types of multimodal imaging data . This hinders the development and validation of postprocessing methodologies as well as the integration of mrsi data into routine radiological workflows . The open - source software package known as sivic (spectroscopic imaging, visualization, and computing) [14, 15] was developed at ucsf to address the limitations of existing strategies for analyzing mrsi data . In the following, there is firstly an overview of mrsi data, followed by a description of the sivic software package . Two workflows that have been implemented at ucsf in order to streamline the routine use of mrsi in research and clinical studies are presented as examples of the applications of sivic . This is followed by a description of an approach for generalizing mrsi data analysis pipelines . Working with mrsi data has unique requirements compared with anatomical and functional images . In a volumetric sense, mrsi data is at least 4-dimensions, comprising 3 spatial and at least one spectral dimension . Reconstruction, postprocessing, and quantification of such data require specialized algorithms for generating and evaluating spectral data . Once reconstructed, the mrsi data are typically visualized by displaying a frequency spectrum at each spatial location (figure 1(a)). Dynamic mrsi requires analysis of mrsi data at multiple time points and is conveniently represented as frequency specific plots reflecting the dynamic behavior of individual metabolites (figure 1(b)). This means that specialized tools are required to represent the data and correlate it with other types of images . This introduces a major obstacle in managing the data and developing software that will work with data acquired on scanners from multiple vendors . In contrast, anatomical images are typically encoded as standard dicom mr image storage sop instances . This enables existing dicom infrastructures to be used for data transmission between devices, storage of images in pacs, and visualization with standardized image viewing applications . Mrsi data, on the other hand, require special workflow protocols that are separate from the standard workflows . Raw mrsi data is typically manually copied from the scanner's hard drive following an exam, processed offline, and rendered by an analyst, and the resulting screen captures are transmitted to pacs as dicom secondary capture image storage sop instances for radiologists to view in the reading room . Since the mrsi data are delivered to pacs separately from the rest of the exam, it may be necessary to notify the radiologist by e - mail, complicating their ability to read exams efficiently . Not only does this require extra workstations, storage, and personnel, but it results in inefficient delivery of results that are required for patient care . From a research perspective, the use of vendor - specific mrsi data formats hinders the development and validation of spectroscopic and metabolic imaging methods as there are limited software packages capable of reading, reconstructing, processing, displaying, and exporting data that are encoded in all of the most common data formats . This poses an obstacle to comparing data from multiple scanners and complicates the comparison of reconstruction, processing, and quantification algorithms using data from different scanner vendors . Though not widely implemented, the dicom standard does define an information object definition (iod) for encoding mrsi data, which could greatly simplify the use of mrsi if more widely adopted . Jmrui is a closed - source package that supports reading, analysis, and visualization of mrsi data from multiple vendors as well as dicom mri and mrs data . The midas package is an open - source project that supports ge, philips, and siemens data and is distributed with an mrsi acquisition sequence implemented for each of these vendor platforms that midas is capable of reconstructing and processing . Tarquin is an open - source package for spectral quantification that understands multiple vendor formats as well as the dicom mr spectroscopy standard . Though these software packages provide needed functionality for the analysis of mrsi data, none of them provide a complete scanner - to - pacs workflow . The following sections describe the open - source software framework and application suite that were developed at ucsf to implement the dicom mr spectroscopy (mrs) standard and to address mrsi analysis and workflow needs . Sivic is an extensible, open - source, freely available, and cross - platform software suite designed to support all aspects of mrsi data analysis and visualization . It comprises a set of c++ libraries that support the various stages of analysis including data io (input - output), algorithm pipelines, and visualization (figure 2). Many of the svk c++ classes extend base classes from the visualization toolkit (vtk) for 3d visualization or dcmtk, which provides low - level dicom support . Vtk is widely used in other medical imaging software enabling svk classes to be compatible with those packages . This compatibility is important for the development of sivic plug - ins to applications such as 3d slicer . The svk io layer is a key component of sivic, enabling it to work with data from multiple formats and export data to the dicom standard . The classes in the svk libraries can be used to construct flexible mrsi applications that work with data from multiple vendor sources . In addition to providing these building blocks, the project provides a suite of applications that are built from the libraries . This supports reading mri and mrsi data, mrsi reconstruction, processing algorithms such as apodization, zero filling, and phasing, visualization of mrsi data and acquisition constructs such as the voxel grid, volume localization, and sat band placement and also supports exporting data to supported formats . The sivic gui is also provided in the form of a plug - in for the osirix [15, 22, 23] open - source pacs and medical imaging package . This enables it to be used for visualization of mrsi data together with the storage management functionality provided by osirix pacs . Sivic also provides command line tools for converting between different file formats and for applying reconstruction, postprocessing, and quantification algorithms . Source - code and binary releases for osx, windows, and linux are freely available from sourceforge: http://sourceforge.net / projects / sivic/. The software is released under a bsd license, which enables it to be freely used in open- or closed - source, free, or commercial applications . Current workflows for the delivery of quantitative mrsi data from the scanner to the reading room are inflexible and inefficient processes . Because standard reading workstations are incapable of rendering the high - dimensional mrsi data, they are typically rendered in the form of dicom secondary capture image storage sop instance reports and displayed as screen capture images . These images are limiting because they are static objects and cannot be further manipulated or analyzed . Even for product sequences that are reconstructed and analyzed on the scanner using vendor provided software, it is often desirable to create custom - tailored reports that focus on study - specific content and to generate reports from novel sequences or from analyses not supported by the vendor's native software . Providing customized dicom secondary capture reports typically requires taking the data offline and using custom software algorithms . An added complication of such offline analysis is that non - dicom mrsi data must be retrieved from the scanner using a separate workflow, for example, via sftp, and must be stored separately from the dicom exam . This results in a decoupling of the actual mrsi data from the rest of the exam and requires significant effort to maintain a searchable record for future retrieval . In the following, on - scanner and off - scanner a common enabling feature is the use of sivic to convert vendor - specific mrsi data to standard dicom sop classes that can be transferred from the scanner to pacs, managed with the rest of the exam data, and retrieved for review or additional analysis (figure 4) using existing dicom infrastructure or easily accessible open - source tools . This section describes a workflow for reconstructing and analyzing mrsi data directly on a scanner (figure 5). Raw data are acquired and written to the scanner's file system in a vendor - specific file format . . Once started, sivic loads the raw mrsi data and can optionally load 3d dicom mr image storage reference images (figure 6). Raw data from a phantom acquisition are shown in the right panel . The yellow box represents the press volume localization, and sat bands are shown in purple . Once loaded into the gui, the mrsi data may be preprocessed with apodization filters, zero - filled, reconstructed, and phased . The resulting spectra may then be quantified to obtain maps that represent the spatial distribution of various metabolites (figure 7). For computationally demanding reconstructions, data are securely staged on a computational cluster for batch processing using sivic's command line tools, and the results are returned to the scanner in near real time where they can be loaded for review in the sivic gui . At this stage, if the data have been suitably prepared for radiological interpretation, a dicom secondary capture report may be generated for review in the reading room . The quantified metabolite maps may be exported as dicom mr image storage, or enhanced mr image storage sop instances, and the reconstructed mrsi data may be exported as a dicom mr spectroscopy sop instance . The complete exam, now in dicom format, can then be transferred to an offline pacs system . Once in pacs, a radiologist may review the dicom secondary capture report together with other anatomical or functional images . From a research workstation, the original raw or reconstructed data may be retrieved for additional processing and analysis . Figure 8 shows an entire imaging exam including mri, sc, mrsi, and raw data in osirix and dcm4chee pacs . The entire exam including mrsi data and derived 3d metabolite maps is now archived in pacs, which is a major benefit for data management . A key point here is that the derived metabolite maps are 3d dicom images which can be treated on an equal footing with other 3d imaging data to correlate mrsi with other data in a multimodal analysis (figure 9). Specialized software such as sivic is still required for visualization of dicom mrsi data, however, in principle any software package that implements the dicom mr spectroscopy standard will be capable of interpreting it . The sivic plug - in for osirix permits the mrsi data to be visualized from within osirix pacs . Several other freely available software packages such as tarquin [18, 30] and jmrui [16, 31] also support the reading of dicom mrs data and provide capabilities that are complimentary to sivic . A workflow for reconstructing and analyzing mrsi data using an external workstation and transferring the resulting images is shown in figure 10 . In this scenario, raw data are encapsulated in raw data storage sop instances using the svk_create_dcmraw utility on the scanner and transferred to an offline pacs . The resulting dicom raw data storage instances, together with the other dicom data from the exam, are retrieved to a workstation where sivic tools process and reconstruct the data as described above . The dicom sc report is sent back to pacs where it can be retrieved for review in the reading room . Mrsi data from patients with brain tumors are routinely acquired on ge mri scanners at ucsf using product as well as novel acquisition methods developed in our research groups [32, 33]. These are converted to dicom raw data storage sop instances using svk_create_dcmraw and pushed, together with other dicom data, to a research dcm4chee pacs . Details of the spectroscopic data processing pipeline are beyond the scope of this paper and are described here only at a high level . Mrsi data is unencapsulated from the dicom raw data storage object, and the file integrity is confirmed by the sha1 digest . The unencapsulated raw data are converted to dicom mr spectroscopy storage instances with the command line svk_gepfile_reader utility . Apodization and zero filling as well as spatial and spectral fourier transforms are performed within sivic . In addition to these methods, sivic supports zero and first - order phase correction, hsvd baseline removal, sum - of - squares coil combination, and peak height and integrated area metabolite quantification . Registration, segmentation, and other standard image processing algorithms are already implemented in other packages and are not reimplemented within sivic . Metabolite maps are exported from sivic as standard 3d images and can be processed using any number of available tools . The final processed mrsi data and mri data are loaded into the sivic gui in order to create a dicom secondary capture report for radiological review as shown in figure 11 . The format of the report and its contents have been based on recommendations from neuroradiologists at ucsf who are involved in the treatment of patients with brain cancers . Over the past year approximately 400 brain mrsi reports have been sent to the ucsf clinical pacs for review using this method . A limitation of such workflows is that not all pacs implementations currently support the storage of raw data storage sop class or the mr spectroscopy storage sop class, however many do, such as dcm4chee, osirix, carestream, philips, and agfa . Furthermore, reading workstations are still not capable of directly rendering mrsi data, which necessitates the use of dicom secondary capture image reports . However, the ability to couple the raw and processed mrsi data with the dicom record is a major benefit, making the data accessible to applications that implement the dicom mrs standard . Another major goal of sivic is to provide a flexible, vendor neutral mrsi analysis package that facilitates the validation of metabolic imaging methods and the dissemination of novel mrsi methods broadly within the community . The approach taken to achieve this is to separate vendor- and acquisition - specific details from generalized downstream reconstruction and analysis algorithms . All pipelines are thus divided into a data - reading component that is vendor and sequence specific, followed by a vendor and sequence neutral component representing the downstream processing pipeline as shown in figure 12 . Variability in data loading reflects differences in (i) data formats and (ii) acquisition methods . These differences are handled modularly within sivic's svkimagereader2 class hierarchy in the following way . The process is split into two parts, reading the raw data file and interpreting its contents using a data mapping class . Sivic implements readers for multiple vendor formats, and their responsibility is to parse a vendor's file format, but without making any interpretation of the content . Once the raw data has been parsed the data mapper is used to interpret the vendor- and acquisition - specific details such that the output of the svkimagereader2 (e.g., svkmrsimagedata) consists of data sampled on a regularly spaced grid suitable for the fourier transform reconstruction and acquisition - neutral processing . Because the output of the readers has been standardized in this way, the sivic algorithms can be tested using data from multiple sources . The vendor - specific readers only need to be implemented once per vendor data format . Mappers are more complex, yet the underlying algorithms utilized by the mappers to accomplish data reordering or resampling exist as separate svk algorithm classes that may be reused to accomplish the same task in similar data acquired on different vendor's scanners . For example, linear phase correction algorithms, required to correct for time delays in epsi frequency sampling, may be used to make this correction on epsi data from any vendor . This modularity is of great value and enables svk readers to be adapted for use with data from different vendors . At ucsf, this has enabled sivic software initially developed to read epsi data acquired on a varian animal scanner to be adapted easily for use on data acquired from a clinical ge scanner as studies transitioned from animal validation to human trials . The sivic software framework and application suite presented here comprise a widely accessible software package designed to facilitate the routine incorporation of mrsi data into imaging studies . This is accomplished by providing tools for converting mrsi data from nonstandard vendor - specific formats to the standard dicom mr spectroscopy sop class . The use of this standard enables existing dicom infrastructures to manage mrsi data together with other components of the exam, rather than requiring separate storage, transmission, and searching infrastructures . Two mrsi workflows that have been implemented at ucsf to analyze and deliver quantitative mrsi data from scanner to the clinical pacs and reading room in over 400 brain tumor exams were described . These workflows store ge raw data as dicom raw data storage sop instances, reconstructed mrsi data as dicom mr spectroscopy storage sop instances, metabolic image maps as dicom enhanced mr image storage sop instances and reports as dicom secondary capture image storage sop instances . The encoding of derived 3d metabolite maps as dicom mr image storage sop instances enables them to be used by standard dicom image analysis software, thus providing a straightforward mechanism to integrate metabolic data with other anatomical and functional imaging data as part of a multimodal analysis . The use of the dicom mr spectroscopy sop class to encode mrsi data increases data accessibility to any application that implements the dicom mrs standard . As has been demonstrated here, this allows mrsi data to be managed by conventional pacs solutions and enables mrsi analysis software to be used for evaluation of data from multiple sources . Sivic extends the interoperability to data originally encoded in vendor - specific formats and thus enables a common set of software algorithms and visualization tools to be used with data from multiple sources . Tools developed on one scanner platform can thus be relatively easily ported to other scanner platforms . This facilitates the transition of methods from animal models to human models and streamlines the use of mrsi analysis in multicenter trials . Other dynamic imaging modalities can also benefit from the type of high dimensional visualization tools used here for display of mrsi data . For example, mr perfusion studies track the time evolution of contrast in a 3d volume, and sivic has been adapted to display such data sets both as 3d arrays of time curves as well as 3d maps representing derived perfusion parameters . The distribution of sivic as a free open - source software package that runs on all major operating system has been shown to foster interinstitutional mrsi research studies as research mrsi acquisition sequences can be distributed together with the software required for reconstruction and visualization of data acquired with novel mrsi methods . These collaborations provide important feedback for the project that acts to stabilize the distributions and improve functionality.
When they look at the smartphone screen in this posture for a long time, they experience shoulder and neck pain, and occasionally complain of headaches1 . When continuous loads are applied in a static posture with the head kept lowered, musculoskeletal diseases may develop2 . This may lead to myofascial pain syndrome by causing stress and excessive tension in the muscles around the neck and shoulders3 . Myofascial pain syndrome may develop along with tissue damage, or abnormal conditions may occur as a result of abrupt stress or excessive tension on the muscles4 . Jobs that require sitting at a desk for long hours, such as computer and office work, negatively influence the neck and shoulder muscles5 . In addition, changes in the strength of the deep cervical flexors, endurance, and the location of the lower jaw have been shown in individuals with neck pain, compared with individuals without neck pain6 . Kieine and schumman studied the activity of the upper trapezius associated with changes in shoulder postures, and tepper studied the effects of computer work on the activity of the upper trapezius7, 8 . These studies found that incorrect postures cause excessive tension in the upper trapezius and the surrounding muscles . Such excessive tension is known to cause pain by developing abnormal forces in the skeletal system9, 10 . The measurement of cervical - bent postures of women using computers showed increases in the head tilting of women complaining of pain11 . A large proportion of the existing studies have focused on the visual display terminal (vdt) that is commonly seen with office computers . In addition, some studies have examined the fatigue and activity of cervical muscles under the postures adopted while using a microscope in the workplace as well as the activity of cervical muscles while individuals were watching a digital multimedia broadcasting (dmb) phone12,13,14 . Smartphones and tablets have recently drawn a great amount of attention and have become almost daily necessities; however, these devices and other similar new devices may cause cervical deformities when used for extended hours . Therefore, multiple studies on changes in the activity and fatigue of cervical erectors in the postures of smartphone users should be conducted in various environments to prevent skeletal diseases . Therefore, this study was conducted to investigate the changes in the activity and fatigue of the splenius capitis and upper trapezius agonistic muscles, the muscles that support the head, under the three postures adopted most frequently while using a smartphone . In this study, the three common postures while using a smartphone were considered as independent variables, and the corresponding muscle activity and fatigue as dependent variables . The experiment was based on a within - group design in which tests were performed on a single group under three different conditions . The subjects were 15 college students in their 20s who were given complete explanations about the experiment in advance . The subjects were required to be healthy individuals with no history of spinal damage or undergoing any surgery, and no hand or wrist injuries or other surgeries during the preceding six months . All participants were instructed about potential risks and experimental design, and were provided with an informed consent form to sign prior to participation, with the knowledge that they could withdraw at any time . General characteristics of the subjects are shown in table 1table 1.general characteristics of the subjectsmeanectage (yrs)23.6 2.4height (cm)174.7 7.6weight (kg)69.2 11.9gender (men / women)8/7 . The muscles targeted for measuring muscle activity were the splenius capitis and upper trapezius, which are the agonistic muscles for cervical extension and are known to cause neck pain11, 15 . The researcher identified the location of these muscles by activating the areas around the subjects relevant muscles, and then attached electrodes, as shown in table 2table 2.locations for attachment of electrodesmusclelocationsplenius capitismidpoint between the spinous process of c7 and the peak of the shoulder bladeupper trapeziusthe point 2 cm away from the lateral side of t4, by referring to previous studies15 . The electrodes were attached after sterilization with alcohol would be adequate, and the electrodes were attached after sterilization with alcohol using cotton balls . The markers of a three - dimensional motion analyzer were attached to objectively determine the maximum cervical bending posture, middle cervical bending posture, and neutral posture . The markers were attached to the center of the forehead, the seventh cervical vertebra (c7), and the seventh thoracic vertebra (t7). A chair of the same height as that in a subway train was prepared, and each subject was instructed to sit in the chair with his or her hips touching the back of the chair and the pelvis fixed . In the maximum bending posture, the subject was instructed to place a smartphone as high as the subject s elbow and grab it with both hands 5 cm away from the trunk (fig . Maximum bending posture in the middle bending posture, the subject s her upper arms were close to the trunk and the neck was bent slightly in a comfortable manner (fig . 2fig . The edge of the upper part of the smartphone s screen and the subject s eye level were kept horizontal (fig . The average degree of neck - bending during each of the three postures was obtained by measuring and averaging the degrees of the three motion markers for each posture during preliminary tests on five subjects . The average degree of neck - bending was 100 for the maximum bending posture, 122 for the middle bending posture, and 131 for the neutral posture . A height - adjustable table was prepared to support the subjects arms during the postures to avoid fatigue in the arms16 . Surface electromyography (semg) was used to measure the 15 subjects while they remained in the three postures, and measurements were performed randomly to reduce errors caused by measuring in the sequence of the postures . While each subject was adopting each posture for five minutes, he or she was instructed to continuously type the sentences the blue house is not seen from the outside . And after five minutes, the subject s muscle activity and fatigue were measured . After being measured under one condition, each subject was provided with a 24-hour break to recover from fatigue, and then was tested under the next condition17 . In this study, a chair having the same height as that of a seat in a subway train and a height - adjustable vibrating table was used . The smartphone used during the experiment was one that is commonly used by koreans, and a three - dimensional motion analyzer (smart e, italy) was employed to measure the degree of bending during each posture . A wireless electrode emg system (free emg, bte, italy) was used as an emg device to identify the muscle activity and fatigue of the splenius capitis and upper trapezius . Emg data from the maximum cervical bending postures, middle cervical bending postures, and neutral postures were applied into root mean square (rms) for five minutes, and mean values were also calculated for one min and were normalized by% rvc18 . Middle bending posture the study data were analyzed statistically, using spss version 18.0 for windows . The kolmogorov - smirnov test was used to confirm that the characteristics of the data used in this study represented normal distribution . An analysis of variance (anova) test was conducted to compare the activity and fatigue of the cervical erector during the three different postures while using the smartphone . Scheffe s test was employed as a post - hoc test on the statistically significant differences between the muscle groups, and the statistical significance level for all data was set at =0.05 . In terms of the differences in the muscle activity for each posture, the four muscles measured (right splenius capitis, right upper trapezius, left splenius capitis, left upper trapezius) did not show any statistically significant differences (table 3table 3.comparison of the muscle activity under the posturesmuscleposturemeanstandard deviationright splenius capitisneutral posture14.27.4middle bending posture13.48.2maximum bending posture 18.825.9right upper trapeziusneutral posture8.95.8middle bending posture5.53.9maximum bending posture 7.15.7left splenius capitisneutral posture14.29.9middle bending posture13.111.0maximum bending posture 13.711.0left upper trapeziusneutral posture7.74.4middle bending posture5.63.9maximum bending posture7.91.2). The comparison of muscle fatigue among the postures showed statistically significant differences for the right splenius capitis, left splenius capitis, and left upper trapezius (table 4table 4.comparison of the muscle activity under the posturesmuscleposturemeanstandard deviationright splenius capitisneutral posture0.20.0middle bending posture0.20.0maximum bending posture0.20.0right upper trapeziusneutral posture0.20.0middle bending posture0.20.0maximum bending posture0.20.0left splenius capitisneutral posture0.20.0middle bending posture0.20.0maximum bending posture0.20.0left upper trapeziusneutral posture0.20.0middle bending posture0.20.0maximum bending posture0.20.0values are shown as mean sd, * p<0.05 . Significant difference in three postures . : significantly different compared with middle bending posture . : significantly different compared with maximum bending posture . ). Values are shown as mean sd, * p<0.05 . Significant difference in three postures . The purpose of this study was to examine changes in muscle activity and fatigue under different postures while using a smartphone, because of their rapidly increasing use . In particular, polakowska reported that cervical degenerative changes appear due to working postures, types of motions during work, and amplitude of vibration; paccinni et al . Reported that improper postures are associated with abnormal cervical curvatures19, 20 . Therefore, one aim of this study was to provide basic data on correct postures while using a smartphone to prevent neck pain and deformation that can occur due to their extended use in undesirable postures . In terms of changes in muscle fatigue associated with postural changes during smartphone use, this study showed that the maximum bending posture resulted in significantly higher levels of muscle fatigue in the right splenius capitis, left splenius capitis, and left upper trapezius, compared with middle bending posture . There were no significant differences in muscle activity in the right splenius capitis, left splenius capitis, and left upper trapezius among the three postures . However, there was no change in muscle activity because of the experimenter s tension by the awareness of experiments was not controlled and the realization of real long - time smart phone use was limited by measuring emg signal for short smart phone using time of five minutes21,22,23.this result is consistent with that of jung s study, in which during the head - neck bending exercise of the cervical lordosis group, kyphosis group, and hyperlordosis group, a comparative analysis was performed on the activity of the deep flexor and the sternocleidomastoid using pressure and ultrasonic images, and a higher level of pressure led to a corresponding increase in the activity of the deep cervical flexor24 ., these results may be because muscles exercise their forces in the opposite direction to fight opposite movements25 . However, the results of this study differ from those of some previous studies . For example, thuresson compared muscle activity during the cervical neutral posture and cervical 20 forward bending posture on the axis of c7t1, and found a higher level of muscle activity during the 20 forward bending . In addition, yoo compared muscle activity during the neutral posture and bending posture, and reported a statistically significant higher level of muscle activity during the bending posture17, 26 . According to the results of villanueva s study, in which the trunk s movements affected the activity of the muscles that surround it, continuous use of smartphone in the present study may have caused contractions of muscles in the hands, wrists, and arms . Thus, muscle activation in the cervical erector was not only confined to the cervical area but also spread into the hands, wrists, and arms, thereby resulting in no statistically significant changes in muscle activity27 . In this study, the muscle fatigue under the maximum bending posture and neutral posture showed similar levels of increases, although this result was not statistically significant . Some studies have reported that a smaller degree of joint flexion led to a statistically significant higher level of muscle fatigue, which may also support the present study result28, 29 . In addition, a smaller degree of cervical flexion increases the level of head - lowering, and the head is then influenced by gravity to a larger extent30 . Here, a larger load is applied to the cervical erector to support the relevant position, which may cause increased levels of fatigue . First, the subjects were measured while they were using a smartphone for a short time of five minutes; therefore, the study did not fully reproduce the situation of individuals using their smartphones in the subway, which is typically for longer periods . In addition, the subjects were 15 college students in their 20s, and thus, the results derived cannot be generalized for various age groups . Moreover, it was difficult to control the subjects daily activities during the 24-hour break provided after each measurement . Consequently, a follow - up study should fully reproduce the conditions in which individuals use their smartphones on public transportation, and test subjects from various age groups for longer durations of smartphone use.
In central europe patients with muscle - invasive bladder cancer (mibc) have relatively poor prognosis . This includes also patients initially undergoing radical surgical treatment . In order to find underlying reasons, we have previously estimated the timing of radical cystectomy in a multicentre study involving 575 polish patients . However, one of the most important limitations of the abovementioned study was the inclusion criterion of being cystectomised instead of being diagnosed with mibc . Consequently, the data on final treatment in the whole population of mibc patients are still limited . Within this short communication the aim of this study was to describe patterns of care in polish patients with newly diagnosed mibc . This is a multicentre retrospective cohort study involving 296 consecutive patients with primary mibc diagnosed in the years 20122013 in 13 polish urological centres . In all patients the diagnosis was made based on histological examination of surgical specimens from transurethral resection of the bladder tumour . The mean age of the cohort was 72.1 years and male - to - female ratio was 3.2: 1 (225 vs. 71). Differences between cystectomised and non - cystectomised patients were evaluated with u mann - whitney test and test for quantitative and qualitative variables, respectively . Comparison of patients depending on qualification for radical cystectomy table presents absolute, median, or percentage values . Haemoglobin; rc radical cystectomy data on nicotine use was available only in 220 patients (77.2% of cohort) among 121/285 (42.5%) patients disqualified from rc, 32/121 (26.4%) patients were qualified for a second step of transurethral resection of the bladder tumour (turbt) intentionally followed by systemic chemotherapy, four (3.3%) patients after complete turbt were qualified for adjuvant intravesical chemotherapy only, while the remaining 85 (70.2%) patients were qualified for palliative treatment in the form of chemotherapy and/or radiotherapy and/or best supportive care . Despite poor outcomes of treatment of patients with mibc in central europe, data on patterns of surgical and medical management, as well as its quality, are still unavailable . We performed a retrospective study aimed at the description of further treatment in patients diagnosed with primary mibc . The most important finding of our analysis is the high percentage of patients qualified for radical treatment . A clinically important fact is that that these numbers would probably be higher if we excluded from the analysis patients with metastatic disease, who are not candidates for rc by definition . Available data on patterns of care in mibc patients published in the last 10 years present significantly lower rates of curative treatment, covering 2152.5% of patients [47]. However, the studies cited above included more patients and/or were based on cancer or national registries . Some portion of patients included in these analyses was treated with radiotherapy alone, which nowadays is not regarded as a radical approach . We have also found that patients disqualified from curative treatment were older, had lower bmi values, lower haemoglobin concentration, and declared lower rate of nicotine abuse and shorter time interval between first symptom to diagnosis . While age alone should not influence clinical decisions, it is suggested that older mibc patients are less frequently qualified for radical surgery, and it is well established that the morbidity related to rc is increased within this group [912]. Low haemoglobin concentration, as well as malnutrition is associated with shorter survival after rc [9, 13, 14]. Moreover, abnormal bmi value increases the risk of surgical complications [12, 15, 16]. Our findings on nicotine use and time from first symptom to diagnosis are both surprising and unexplainable . Considering the pathogenesis and clinical course of the disease, one can suspect that these results are fortuitous . Finally, they are of no practical significance . The study's strengths are its multi - institutional character, involvement of both academic and non - academic urological departments, and enrolment of a representative cohort of patients . The most important limitation of the study is the lack of data on lymph node and distant metastases . As available clinical staging is limited to regional status, among patients disqualified from surgery there are both patients unfit for surgery and patients with initially metastatic disease . Their differentiation in the present study was not performed . Because the majority of polish patients with primary mibc receive curative treatment, the stage of the disease alone seems not to be the leading cause of poor survival . However, the appropriateness of qualification for rc and treatment quality needs to be assessed for a final conclusion on the factors influencing outcomes of treatment in poland . The results presented within this paper come from post hoc analysis of data collected during a multicentre study aimed at oncological characterisation of a large cohort of polish patients with primary urothelial carcinoma of the bladder . The study was produced under the auspices of the residents section of the polish urological association . All the investigators, but two (m.s . And p.r . ), were urologists in training.
Bariatric surgery has become an effective treatment for obesity, also reducing the onset of type 2 diabetes mellitus (t2 dm) as well as inducing remission and reducing cardiovascular mortality and mortality in general [3, 4]. Obesity is a chronic condition characterized by elevated inflammatory markers [57] and is associated with nonalcoholic fatty liver disease (nafld) [8, 9]. Serum gamma - glutamyltransferase (ggt) and alanine aminotransferase (alt) are markers of nafld and of liver fat content [10, 11]. Increased platelet counts have been observed in conditions with chronic inflammation as well as in obesity, probably due to secondary thrombocytosis [1214]. In more advanced stages of nafld, with portal hypertension and splenomegaly, there is a linear association between decreased platelet counts and increased fibrosis in the histopathology of liver biopsies, which may indicate that platelet counts might be an important biomarker of the degree of fibrosis in nafld patients . Platelet count is a simple, easy to perform, cost - effective, and accurate surrogate marker for predicting fibrosis severity in nafld patients . Bariatric surgery improves steatosis and fibrosis in patients with morbid obesity nafld, and adjustable gastric banding in a previous study has been related to a nonsignificant trend of lowered platelet counts . Regarding rygbp, one study reports a significant reduction in platelet counts 1 year after surgery . Data after longer periods of followup, after rygbp as well as bpd - ds surgeries, are lacking . The aim of this study was to assess changes, if any, in morbidly obese patients treated with bpd - ds and rygbp, from baseline, that is, before surgery, to followups 1 year and 3 years after surgery, with regard to platelet counts and serum concentrations of ggt and alt . Ten morbidly obese patients who had undergone bpd - ds surgery (five men and five women), all caucasians, free from established diabetes, were recruited from the outpatient clinic of obesity care, uppsala university hospital, uppsala, sweden . Data from the bpd - ds group were compared to that of a morbidly obese group (n = 21; three men and eighteen women), all free from established diabetes and had undergone rygbp . Patients were investigated preoperatively (baseline) and then 1 year (1st followup) and 3 years (2nd followup) after bpd - ds and rygbp, respectively . Roux - en - y gastric bypass is a procedure that combines restriction and malabsorption . It is considered by many to be the gold standard because of its high level of effectiveness and its durability . More extreme malabsorption accompanies biliopancreatic diversion procedures, commonly performed with a duodenal switch in which a short, distal and common channel length of small intestine severely limits caloric absorption, which induces a greater weight loss than rygbp does . A very high bmi indicated that bpd - ds procedure was performed instead of rygbp at our clinic [19, 20]. All participants underwent physical examination and blood tests for platelet count, ggt, and alt preoperatively (baseline) and at the 1st and 2nd followups . Blood samples were collected from each patient (following an overnight fast) and were analyzed using routine tests at the department of clinical chemistry at uppsala university hospital [19, 20]. Weight (kg) and height (m) were measured on standardized calibrated scales, and bmi (kg / m) was calculated . Tests were two tailed, and a p value <0.05 was considered significant . Patient clinical characteristics at baseline, that is, before rygbp and bpd - ds surgeries, are shown in table 1 . There were no statistically significant intergroup differences in platelet counts or plasma concentrations of ggt and alt . Mean weight and bmi were, as expected, higher in the bpd - ds group, selecting the patients for this procedure, and age was lower . Bmi decreased by 43% in the bpd - ds group from 53.5 kg / m at baseline to 30.7 kg / m at 1st followup (p <0.001) and was unchanged between the 1st and 2nd followups (30.2 kg / m, p <0.001), as shown in figure 1(a). In the rygbp group, bmi was reduced by 30% from 42.3 kg / m at baseline to 29.7 kg / m at the 1st followup (p <0.001) but was 32.1 kg / m at the 2nd followup (p <0.001), implying a 6% gain (gain over the baseline bmi) between the 1st and 2nd followups (p <0.001). Platelet counts were reduced by 22% in the bpd - ds group from 308 10/l at baseline to 240 10/l at the 1st followup (p <0.001) and were unchanged at the 2nd followup (244 10/l, p <0.001), as shown in figure 1(b). In the rygbp group, platelet counts were reduced by 10% from 297 10/l at baseline to 266 10/l at the 1st followup (p = 0.012) but were 292 10/l at the 2nd followup (p = 0.687), implying a 9% increase between the 1st and 2nd followups (p = 0.024). Katal / l at the 1st followup (p = 0.01) and was 0.32 katal / l at the 2nd followup (p <0.001), but this further decrease was not significant (p = 0.867), as shown in figure 1(c). In the rygbp group, ggt katal / l at the 1st followup (p <0.001), with no further alteration at the 2nd followup (0.31 katal / l, p <0.001). Katal / l at the 1st followup (p = 0.004) and was unchanged at the 2nd followup (0.41 katal / l, p = 0.004). In the rygbp group, katal / l at the 2nd followup (p <0.001), implying a further decrease by 16% between the 1st and 2nd followups (p = 0.02). The main findings in this study were that liver enzymes, ggt and alt, markedly decreased over time after both rygbp and bpd - ds surgeries, but platelet counts only decreased significantly after bpd - ds . The alteration in platelet counts showed a somewhat different pattern after rygbp, with a reduction at the 1st followup but no significant change at the 2nd followup . It might be speculated that the sustained reduction in platelet counts may indicate a long - term improvement in the inflammation of the liver and a more pronounced decrease of liver - fat - content - related inflammation in obese patients treated by bpd - ds compared to rygbp . Platelets vary daily and are depending on a variety of issues such as ethnicity, age, and gender . Buckley et al . Have showed in their analysis of serial platelet counts from 3,789 subjects that the repeatability of the platelet count is very high . Obesity is an inflammatory condition [23, 24] and a major risk factor for the development of nafld and liver disease . In obese patients, ultrasonographic examinations as well as liver biopsies have revealed that nafld is very common . As it is difficult to perform biopsies in all nafld patients, it has been reported that a lowered ggt may best predict improvements in inflammation and fibrosis in the hepatocytes in nafld, which are two major prognostic features in this condition, whereas changes in aminotransferase concentrations did not predict change in steatosis . Furthermore, increased numbers of platelets are observed in conditions with low - grade inflammation, such as obesity, although the platelet counts are within normal ranges . Overweight, obese, and morbidly obese females have significantly elevated platelet counts compared with normal - weight females and male subgroups . The gender difference in platelets might be due to the higher body fat mass in females . Higher platelet counts are associated with more adverse clinical outcomes in patients with myocardial infarction and stroke . Obesity is also associated with platelet dysfunction, increased adhesiveness, and activation [2628]. In more severe states of nafld with fibrosis, a consumption of thrombocytes are observed . In a recent study, yoneda et al . Used liver biopsies to evaluate the clinical usefulness of measuring platelet counts for predicting the severity of liver fibrosis in 1,048 patients with nafld . Our data show a sustained reduction in platelet counts over time after bpd - ds, probably induced by a more pronounced weight loss than after rygbp and possibly a more pronounced decrease of liver inflammation . One year after rygbp, a significant reduction in platelet counts was observed, which is in accordance with 1 year data from dallal et al ., but the reduction was not sustained at the 2nd followup, 3 years after surgery . There are several limitations in the present study such as the small number of patients and the lack of a morbidly obese control group followedup over 3 years . However, such patients can be logistically difficult to follow for long term followups . The bpd - ds group was significantly younger than the rygbp group, but no differences were observed between the two groups at baseline in platelet counts, ggt or alt . Body fat content and liver fat content, measured by imaging techniques such as dual energy x - ray absorptiometry or ultrasonography, would have been warranted to investigate if and how different fat distribution might influence the variables analyzed in this study . In conclusion, morbidly obese patients treated with rygbp and bpd - ds show a marked and sustained decrease in ggt and alt . A significant reduction in platelets, a marker for inflammation and fibrosis in nafld, was observed in both groups after 1 year but only in bpd - ds over time, which may indicate improvements in general inflammatory status and particularly steatohepatitis.
Myocardial bridging is defined as an epicardial coronary artery that goes intramurally through the myocardium beneath the muscle bridge . While generally benign, myocardial bridges can cause ischemia, ventricular tachyarrhythmias, atrioventricular block, and sudden cardiac death.1)2) for symptomatic patients, various therapeutic approaches have been attempted, but the optimal treatment of myocardial bridging still remains controversial.3)4) coronary stenting has been another therapeutic option with medical and surgical treatment, but the high risk of perforation and high rate of in - stent restenosis have limited its use.5 - 10) recently, we experienced a patient with a perforated coronary artery after implantation of a drug - eluting stent (des) that was successfully rescued by deployment of covered stent in symptomatic myocardial bridging . A 46 year - old woman who had no coronary risk factors, presented with exertional chest pain for several weeks . The chest pain was typical for angina pectoris and depressed st segments were noted at the exercise test . Echocardiography revealed normal left ventricular (lv) systolic function {ejection fraction (ef)=72%} without any regional wall motion abnormality . We performed coronary angiography which showed significant stenosis (up to 80%) aggravated by severe myocardial bridging at the mid - portion of the left anterior descending (lad) artery (fig . So we decided to do a percutaneous coronary intervention (pci) at the lad lesion . Through a 7 fr judkins guiding catheter, predilatation was performed with a maverick balloon catheter (2.515 mm, boston scientific, natick, ma, usa) at 10 atmospheres for 20 seconds . We deployed a taxus stent (3.516 mm, boston scientific, natick, ma, usa) according to the size of the predilated balloon catheter . But the middle segment of the lesion was not compliant, so the stent was not fully expanded with nominal pressure ., the coronary artery was perforated and some extravasation of contrast media was observed in the pericardium (fig . But, the patient's vital signs were stable (blood pressure 115/70 mmhg) with only a mild increase in heart rate . However, because the perforated site was entrapped intramurally through the myocardium in the interventricular groove, there was no evidence of accumulated blood at the dependent position of the pericardium on fluoroscopy or echocardiography . So we decided to observe the patient with close monitoring of symptoms and vital signs . But echocardiography showed no evidence of pericardial effusion . On an intravascular ultrasound (ivus) study, a large perforated site and a perivascular hematoma were observed in the mid - portion of the deployed stent (fig . 1c). Based on the ivus findings, a jo covered stent (319 mm, jomed international ab, helsingborg, sweden) was deployed at the perforation site . Four months after the procedure, ct angiography showed no evidence of residual hematoma or pseudoaneurysm (fig . 2a and b). Follow - up coronary angiography performed at 8 months after the procedure showed good distal flow with minimal stenosis at the proximal edge of the stent (fig . 2c). Although coronary stenting is an effective interventional approach to improve symptoms in selected patients with myocardial bridging, it is associated with a high risk of coronary perforation.5 - 7) the reason for this phenomenon is not clear . Autopsy findings showed that tunneled segments in myocardial bridging tend to be deficient in vascular smooth muscle density, which may be more prone to vascular disruption during high inflation pressures during pci.11)12) another study revealed that the vessel area in the myocardial bridge segment was significantly smaller than that in the adjacent reference segments proximal and distal to the myocardial bridge throughout the cardiac cycle.13) this finding might explain the higher rate of coronary perforation associated with coronary stent implantation for myocardial bridges . The histological and anatomical differences in tunneled coronary arteries may require an adjustment in stent diameter and inflation pressures to help reduce the risk of coronary perforation . In our case, we selected an oversized stent, resulting in coronary perforation . Pre - interventional ivus may be helpful in selection of an appropriate size of stent and, in particular, in cases that require high inflation pressures for optimal stent implantation . Although coronary perforation is an uncommon complication following pci, it usually causes a catastrophic result including cardiac tamponade, emergency coronary artery bypass surgery, or pseudoaneurysm formation, with the potential for late coronary rupture and death.14)15) but, in myocardial bridging as observed in our patient, because the perforation site and extravasated blood are mainly confined in the interventricular groove, perforation itself usually does not cause hemodynamic instability . We were able to evaluate the lesion using ivus to decide on implantation of a covered stent after perforation . Coronary stenting in myocardial bridging has been associated with a high restenosis rate.9) possible factors for this include shear stress from persistent external compression from myocardial bridges, causing neointimal proliferation, and long stent and recoil phenomena when inadequate pressures are used for stent deployment . A des was chosen as a feasible alternative to surgery because it had the ability to reduce restenosis . In our case, we performed pci with a des, which also showed good distal flow with minimal restenosis at the proximal edge of the stent at follow - up angiography . Our case showed that, even though coronary perforation had occurred in myocardial bridging, the perforation site was confined in the interventricular groove . Therefore, it could be managed more easily than conventional coronary perforation.
Musculoskeletal disorders are one of the most common causes of occupational injuries and disability in industrialized nations and developing countries (1 - 3). A variety of risk factors are involved in the occurrence of the damage that can be divided by physical factors such as poor posture, ergonomics, lifting, and carrying heavy loads and working with repetitive movements (4), psychological, organizational, and individual factors (5). These disorders mainly occur in the upper extremities such as hands, wrists, arms, shoulders, neck, and waist (6). These disorders occur due to repetitive movements that led to the injury of nerves, tendons, joints, cartilage or disks between the vertebrae (7). Factors that cause these disorders are awkward posture, repetitive movements, and excessive force . The signs of musculoskeletal symptoms are muscle pain, discomfort, numbness down, burning, tenderness, swelling, limited range of motion, and loss of power . A long repetitive movement of the body (8) causes these pains . According to the previous studies, there is a significant relationship between musculoskeletal disorders and repetitive motion . Several professionals such as surgeons and personnel of the operating rooms are at risk of these symptoms . The surgeons perform the surgery in a standing position, and the hands are generally in motion in surgery . Sometimes a fixed posture continues for hours and the pressure exerted by the musculoskeletal organs is too high (11). Over time, the continuous exposure to biomechanical and psychosocial stressors may intensify the musculoskeletal injuries in the workplace . Because surgery is often subtle, sensitive, and time - consuming, ergonomics aims at helping the surgeons to work without feeling any pain, or stress, and with less error (12). Nowadays, various surgical procedures are done such as open surgery, laparoscopy, and microsurgery (13). The body posture of the surgeons during open surgeries is described as a head - bent and back - bent posture . Surgeons maintain this posture for long periods; and as a result, they experience physical discomfort during and after the surgery (13). During laparoscopic procedures, the body movement of the surgeon is very limited, resulting in a more static upright body posture compared to open surgery (13). Due to the position and depth of the incision during open surgery, surgeons have a fixed work posture, tending to work with arms abducted and unsupported (14). For instance, repetitive motion of the wrist in laparoscopic surgery, and neck static posture in microsurgery could cause musculoskeletal disorders (14,15). In addition to improper posture due to ergonomics, repetitive movements of the hands and wrists, neck and shoulders, and excessive force can ultimately cause or exacerbate these effects (16). According to healthcare professionals, multiple ergonomic risk factors in the operating rooms can lead to or aggravate musculoskeletal symptoms . Moreover, no comprehensive study has been conducted to evaluate and compare the ergonomic risk factors in these 3 types of surgeries . This study aimed at evaluating the role of various ergonomic risk factors in the frequency or resonance frequency of musculoskeletal symptoms in surgeons who perform surgery (open surgery, laparoscopy, and microsurgery) in a hospital of iran university of medical sciences . Eighty - one male surgeons who consistently worked at milad hospital in tehran participated in this study . Each of these surgeons exclusively conducted one of the 3 types of open surgery, laparoscopy, and microsurgery . After interviewing the surgery team, to determine the prevalence of musculoskeletal symptoms, the nordic questionnaire (a questionnaire made by kurinka et al . At the institute of occupational health in 1987) was used (17). In this study demographic information such as age, height, weight, work experience, and number of hours per day were added to the questionnaire . To estimate and evaluate the ergonomic risk factors in each of these three types of surgery wera method was used . The wera covers an extensive range of physical risk factors including posture, repetition, forceful, vibration, contact stress, and task duration, and it assesses the five main body regions (shoulder, wrists, back, neck and legs) (18). Eighty - one surgeons who performed the 3 following types of surgeries participated in this study: open surgery (n=26), laparoscopy (n=28), and microsurgery (n=27). Each of the surgery types was observed using the wera tool . During the surgery, observation of the workplace was carried out by recording the surgeries using a video camera . The three types of surgery were observed and videotaped to collect data for the wera assessment . The angle of the body segments relative to the vertical position was estimated (shoulders, wrists, back, neck and legs) using the video tapes (18). The participants were middle aged and experienced (5.4 years of work experience). Table 2 demonstrates the prevalence of musculoskeletal disorders that the surgeons experienced during the past 12 months . The prevalence of symptoms in the neck, back, shoulder, and arm was high; and a high percentage of the participants involved in all the 3 types of surgeries (open surgery, laparoscopy, and microsurgery). No significant difference was found in the prevalence of musculoskeletal symptoms in the body of the surgeons performing these 3 types of surgeries . * friedman two - way analysis of the variance test table 3 displays the evaluations of the wera scores . The average of wera final score is 40.11, representing an upward risk for musculoskeletal disorder in 3 types of surgeries . In this study, the wera score of laparoscopic surgery had a significant relationship with back problems (r=0.61, p=0.02), wrist (r=0.53, p=0.03), and neck (r=0.49, p=0.02). Musculoskeletal disorder had a significant relationship with the wera score (r=0.48, p=0.02) in open surgery, and (r=0.46, p=0.04) microsurgery . The aim of this study was to evaluate the relation of musculoskeletal disorders and ergonomic risk factors based on wera method in 3 types of surgery among the surgeons who were working in tehran's hospitals . In this study, it was found that specified ergonomic risk factors, based on evaluating by wera, has a high impact on the prevalence of musculoskeletal symptoms . On the other hand, the type of surgery was the main cause of musculoskeletal disorders among surgeons who participated in this study . In a study on the prevalence of musculoskeletal symptoms in surgeons, it was found that the highest prevalence was in the lower back, neck, and hands due to poor postures of the surgeons during surgery (19). In another study, the most important cause of arthritis pain and disability was found to be long - term operating mode or standing back for long hours (11). Therefore, the results of this study are consistent with those of the previous studies on the prevalence of musculoskeletal symptoms in surgeons . Musculoskeletal disorder is more common in laparoscopic surgery and open surgery due to incorrect posture, such as the need to bend neck and back (20). On the other hand, the prevalence of musculoskeletal symptoms in wrist of the surgeons had a direct relationship with instruments in this study, which is consistent with the results of previous studies (21). Improper use of hand tools in the surgery caused musculoskeletal symptoms and back pain, especially in awkward postures (22). In a study conducted on surgeons, the most complaints of the surgeons were related to limbs shoulder, wrist, and waist (23). In another study, the highest prevalence was in the back, neck, and wrists, causing adverse deviation of the wrist posture from the normal posture (24). Among the most important tools used in laparoscopic surgery is grasper / loop, which causes poor posture of the body . In addition, looking into a monitor for a long time increases the risk of musculoskeletal symptoms in laparoscopic surgeries in the cervical region (25). Moreover, working with the surgical microscope for a long - time, improper postures, and improper seating increase the prevalence of musculoskeletal symptoms in the back and neck muscle areas while performing microsurgery (26). The results of this study revealed that the prevalence of musculoskeletal symptoms was high among the surgeons . Therefore, it is necessary to take action to solve this problem by using appropriate ergonomic tools, management solutions, and suitable design of surgical instruments . A standing - sitting ergonomic chair could be used to prevent back pain in open surgery . Moreover, using a suitable chair can prevent improper postures . To prevent wrist musculoskeletal symptoms, surgical tools with ergonomic design and soft rubber handle depending on the type of surgery training, using appropriate seats and ergonomic instruments are the best solution to reduce musculoskeletal symptoms in the surgeons . The results of this study revealed that the prevalence of musculoskeletal symptoms was high in 3 types of open surgery, laparoscopy, and microsurgery among the surgeons . In addition, it was found that these symptoms were more prevalent in the neck, waist, and hands . Depending on the type of surgery, teaching appropriate methods, using equipment properly, and using proper ergonomic seats are the best strategy to reduce musculoskeletal symptoms in surgeons.
Hypophosphatemic rickets (hr) is a metabolic bone disorders manifested by musculoskeletal disorders specially in the lower extremities, growth retardation and dental problems[1, 2]. This disorder affects all ages and both sexes and is characterized by a low concentration of serum phosphate, elevated alkaline phosphatase, normal or decreased serum calcium and inappropriate levels of 1,25-dihydroxy - vitamin d [1,25 (oh)2 vit d][1, 3]. Musculoskeletal disorders are due to mineralization impairment of the bone matrix and teeth with different etiologies . X - linked hypophosphatemic rickets (xlhr) is the most common form of the genetic disorders causing rickets due to hypophosphatemia . This disorder results from mutation in the phex gene and the product of this gene has a role in phosphatonin inactivation . Hr is more common in females with positive family history observed in 35.3% patients, nevertheless, it seems this disorder is more frequently and more severe among males in xlh form . Common features are a short stature, backache, body deformities, joint pain, and fractures . Dental abnormalities include dental taurodontism with increasing mean crown - body to root ratio, ectopic permanent canines, dental abcesses[2, 5] and enamel hypoplasia . Treatment of rickets with vitamin d (vit d) and phosphate supplements has been shown to prevent and cure the dental anomalies in some but not all patients . From 1970, dental problems were reported in 23 - 67% xlhr patients[3, 6, 7], but these problems have not been described well in previous studies . This study was a cross sectional investigation that was conducted in a referral pediatrics endocrinology clinic in iran during 3 years (2008 - 2010). The diagnosis of hypophosphatemic rickets was made on the basis of clinical and radiological findings of rickets in a patient with low level of serum phosphate, normal or low level of serum calcium (<8.2 mg / dl) and normal levels of 25(oh)2-vit d (<15 pg / ml), and normal or mildly elevated pth with high level of serum alkaline phosphatase (> 55 pg / ml). Patients who did not have a clear diagnosis or refused to participate in the study were excluded . After taking a dental history, all subjects had a dental examination (including dental caries, enamel hypoplasia, taurodontism, dental abscesses and gingivitis); opg was performed if necessary . Clinical examination was performed to look for dental deformities by a trained dentist for all patients . Information about dental problem including: dental abscess, enamel hypoplasia, dental caries, gingivitis, taurodontism, and delay in the primary or permanent dentition was obtained . For permanent teeth, decay, missing, or filled teeth (dmft) index and for primary teeth, decay or filled teeth (dft) delay in eruption of teeth was based on times of eruption of the primary and permanent teeth from logan and kronfeld . Taurodontism was suggested if there was any change in tooth shape and was confirmed by orthopantomography (opg). In this study we enrolled 19 patients with hypophosphatemic rickets . Mean age of these patients was 104.23 years (range 3 - 17). Eleven (57.9%) patients were female and 8 patients (42.1%) male (female to male ratio: 2/1.3). Fifteen (79%) patients had regular follow - up after diagnosis of background disease and 17 (89.5%) patients had at least one dental problem . The most common dental problems were dental caries and delay in eruption of the dentition in 9 (47.7%) patients . Enamel hypoplasia was found in 8 (42.1%) patients and 3 (15.8%) patients had taurodontism and all last group were male . Both dental abscesses and gingivitis were found in 2 (10.5%) patients . Six (54.5%) female and 3 (37.5%) male patients had dental caries . The prevalence of dental caries was significantly more frequent in case group (p=0.04) that was 10.5% in healthy control matched group . This study showed that hr has a variable age of presentation and it was more common in females[2, 3]. Dental caries was the most common finding in this study (47.7%) that was similar to chaussain - miller's study . Dental caries is one of the most common factors for pulp infection, so oral hygiene has an important role for caries prevention . Dental abscesses were found in 10.5% of the patients compared to 25 - 65% in other studies[4, 6, 12]. In patients with hr the dentition is highly susceptible to dental caries and bacteria can invade easily from the oral cavity to the dental pulp by means of structural defects in the enamel . Difference of prevalence of dental abscess may be due to early diagnostic and treatment of these patients, although shroff et al believe that prophylactic pulpotomy therapy may have been no benefit in preserving the primary dentition in xlhr patients . In our study, enamel hyperplasia has been reported in 16.6% patients with permanent teeth by bender and naidorf, however they said the incidence of this disorder is 36.8% (14/38) in cases reported in the literature, this is similar to our study . Although this phenomena is expectable in hr patients, no significant differences was reported in dental age compared with the respective chronological age in a study . Genetic mechanisms have a main role causing defective dentition and dentine mineralization . In this study taurodontism had a significantly increased tendency in male xlhr subjects . Similar findings were reported by seow et al . In a controlled, longitudinal study, they showed taurodontism had a significantly higher tendency in male xlhr patients . Patients respond well to a combination of oral phosphate and 1,25(oh)2-vitd (calcitriol)[4, 6]. The beneficial dental effect of phosphate supplements after birth and the possible influence of maternal phosphate homeostasis suggest that most abnormal dental features are linked to hypophosphatemia and deficient renal production of 1,25(oh)2-d . Some effects of 1,25(oh)2-d on dentin may be indirect, through an increased intestinal absorption of calcium and phosphorus . 1,25(oh)2-d may also exert some direct effect on dental cells, as odontoblasts and ameloblasts express the vitamin d receptor and respond in vitro to this vitamin . It seems, the best results were achieved when medication started during early childhood[4, 18]. Dental care of these patients should consist of periodic examination, topical fluoride application, pit and fissure sealants and maintenance of good oral hygiene . Dental caries as common as delay in dentition were the most prevalent problems in xlhr patients that could be reduced by proper dental care and good oral hygiene . So the dentist as well as pediatrician should be made aware of the features of disorder and early intervention.
The number of people surviving into old age is increasing, and it is a global phenomenon affecting developing and developed countries . Disability is defined as a restriction in the ability to perform normal activities of daily living, and it helps to quantify the impact of disease or injury . Disability is particularly a useful concept in assessing the health of elderly people, because they have several diseases occurring simultaneously with varied severity and impacts on their daily lives . Gill and colleagues have reported the powerful effects of disability on individual well - being, the need for informal help and health care, as well as long - term care needs and costs . On the basis of this, the epidemiology of elderly disability cannot be overemphasized . The process of disability represents a distinct phase in the life of many elderly persons . Functional limitation is associated with loss of independence and with increased need for both formal and informal care [4, 5]. The prevalence of physical disability in elderly persons with functional limitation are, therefore, important for policy development on care of the elderly be it formal or informal care . Contrary to the developed nations, most developing nations, specifically those in sub - sahara africa, lack reliable data to formulate policy on aging even though the populations of their elderly persons (aged 60 years and above) are increasing even more than developed nations . The pattern and profile of disability that is obtained among the elderly in developed countries differs from those in developing nations . For example, life expectancy in nigeria is currently about 48 years for elderly men and 50 years for elderly women . In the developed countries, the available data suggest that life expectancy at birth was around 35 to 40 years in the mid-1700s, rose to about 45 to 50 by the mid-1800s, so that by the middle of the twentieth century, it was approximately 66 to 67 years probably because of that rapid improvements that began at the end of the nineteenth century . Physical disability and functional limitation are common among older people, leading to adverse consequences such as dependency and institutionalization . Older people's ability to function independently is important, as physical disability and functional limitation have profound public health implications with increased utilization of health care and a need for supportive services and long - term care . Due to economic hardship and extreme limitation of well - paid job opportunities in rural areas, most children and caregivers of the elderly have migrated to towns and cities for greener pasture thus abandoning the elderly with their disabilities . This underscores the need to study the prevalence of physical disability and functional limitation especially in a nigerian rural underserved population of older adults . Several studies on physical disability and functional limitation have been reported in developed countries . However, data are very scanty for developing countries especially in rural nigeria . Apart from demographic factors like female gender and increasing age [12, 13], social variables like smoking and alcohol consumption, low - income earning, low education, and urban dwelling have been associated with increased risk of disability among elderly persons [12, 14]. In many respects, these correlates of disability the objective of this study is, therefore, to determine the prevalence and factors associated with physical disability and functional limitation among elderly nigerian . The study subjects were elderly rural dwellers aged 60 years and above from abadam, guzamala, and mobbar local government areas (lgas) in borno state, north - eastern nigeria; and the study was conducted between march and august 2010 . Elderly people who were non - nigerians and those who were temporary residents (lived in the community less than 24 months) were excluded from the study . The study population was identified from 2006 community census list which was obtained from the lga population census unit . Homes of the participants and primary health centers in each selected local government areas served as the venues of interview and clinical assessments, respectively . In order to reduce or avoid missed opportunity, period of interview was in the morning and evening, while the clinical assessment was between 8 am to 4 pm daily in the health centers . The interview and clinical assessment were conducted by seven community health officers and three nurses mostly kanuri indigenes that were very fluent in kanuri and hausa languages and were trained as research assistants in all aspects of the study such as questionnaire administration and clinical assessment . The questionnaire was pretested in another kanuri community to avoid ambiguity and easy administration during the survey . Information on the following relevant health - related variables was obtained: presence of chronic conditions, depressive symptomatology, height and weight measurement, cognitive function, and presenting visual acuity . Questions about the presence of chronic diseases include have you ever been managed as a patient for diseases like hypertension, heart attack, diabetes, epilepsy, stroke, arthritis, pneumonia, and asthma? Chronic conditions were coded a, b, and c. hypertension and heart attack belongs to code a, diabetes belongs to code b, while arthritis, pneumonia, and asthma were coded c . Depressive symptomatology was assessed using the short version of the geriatric depression scale 15 item (gds). Body mass index (bmi) was calculated as weight in kilogram divided by square of height in meter expressed as kg / m in the result and table . Ecaq has been shown to be a valid tool for assessment of cognitive impairment among older people living in developing countries . A score of 0 to 4 indicates probable cognitive impairment, 5 to 6 borderline, and 7 and above as normal . Visual acuity was assessed at designated primary health care centers using a standard metric snellen chart of alphabets e type at 6 meters . Participants' self reporting or presenting visual acuity (pva) was ascertained with wearing of habitual optical corrective glasses (spectacles). The world health organization defines mild or moderate visual impairment as pva of less than 6/18 but equal to or better than 3/60 . Face - to - face interview was used to collect data on sociodemographic variables like gender, age, education level, marital status, social support, monthly income, ownership of motor vehicle, ownership of modern house, living arrangement, and ethnicity . This is a population - based cross sectional study and multistage sampling technique was used . The three lgas were purposively chosen but randomly selected using simple random sampling technique from the available rural lgas and subjects were allocated to each lga proportionately according to population of the elderly in the lgas . Cluster sampling technique was used in the final selection of all participants (total sampling) in each lga that met the inclusion criteria . Two physical function measures were used in the assessment: performance - based functional limitation and self reported physical disability . The tinetti performance oriented mobility assessment tool (tpomat) was used and is a measure of functional limitation that assesses older people's gait and balance abilities [19, 20]. In conducting the balance assessment, participants' balance abilities were assessed by performing maneuvers such as sitting in chair, rising from chair, immediate standing balance (first three to five seconds after standing), further standing balance, balance with eyes closed, turning balance, ability to withstand displacement when slightly pushed from the sternum, neck turning, one leg standing balance, back extension, reaching up, bending down, and finally sitting down . For gait assessment, participants were asked to stand with the examiner in an obstacle - free walkway . Participants used their usual walking aid and were asked to walk down the walkway at their usual pace . Participants' gaits were observed for initiation of gait, step height, step length, step symmetry, step continuity, path deviation, trunk stability, walk stance, and turning while walking . For maneuvers such as path deviation, trunk stability, and walk stance, the examiner walked behind the participants and for others next to the participants . Participants were then asked to walk back at a more rapid than usual but safe pace using usual walking aids . Level of performance of each activity was rated 0 - 1, where a score of 0 meant inability to perform the activity and a score of 1 meant ability to perform the activity . The maximum score for the gait component was 12 points and for the balance component it was 16 points . Participants with scores of less than 12 (for gait) or less than 16 (for balance) were defined as having performance - based functional limitation . In order to test for physical disability, barthel index is an assessment of patients' level of independence in activities of daily living (adl). The ten adl items assessed were feeding, bathing, dressing, grooming, toileting, bladder control, bowel control, transferring from bed to chair, walking, and stair climbing . For this study, the operational definition of physical disability is needing help in one or more of these adl activities . In order to compare this study with others, physical disability was also determined using the six katz index of independence in adl items related to self care (feeding, dressing, bathing, toileting, transferring, and walking) [22, 23] and five items related to self - care (feeding, dressing, bathing, toileting, and transferring). Following collection, collation, and editing, data were entered into a computerized data base . Clustering of data and sampling probability weights were taken into consideration during the analysis . In order to allow comparison with prevalence of adl disability reported in other studies, we estimated the prevalence of ten, six, and five items adl dependence . In this study, the prevalence for disability was also aged standardized population using the indirect standardization method for proper comparison with studies elsewhere . Indirect standardization method was also used for comparing prevalence of physical disability and functional limitation across the three ethnic groups (kanuris, fulanis, and hausa), and in this study, kanuris group was used as the standard population . As a result of the high prevalence of physical disability and functional limitation, prevalence ratio (pr) all analyses were carried out using spss log binomial regression and poisson regression with strong and reliable variance . Two sets of univariate analyses were performed using chi - square tests: firstly, analysis was done to identify associations between the ten items physical disability and health related and sociodemographic variables; secondly, similar analysis was done with functional limitation . Then, multivariate poisson regression with robust variance was performed to test which of the health - related variables and sociodemographic variables were independently associated with physical disability and functional limitation . Variables with clinical and statistical significance (p value of <.05 in the univariate analysis) were regarded as being significant . Participants with cognitive impairment identified through scores of less than five based on the elderly cognitive assessment questionnaire (ecaq), were removed from the analysis (n = 43). Individual medical conditions (such as stroke, diabetes, arthritis, etc .) Were used as explanatory variables in the analysis to find out their association with disability as well as functional limitation . Due to very high illiteracy level in the study areas, informed (verbal) consent was obtained from all participants . Of the 1905 questionnaires distributed to elderly people who satisfied the inclusion criteria, 1824 respondents completed the questionnaire and were also available for physical examination, giving a response rate of 95.7% . Reasons for nonresponse include lack of interest (25%), competing issues (60%), sickness (5%), and traveling (10%). The age of respondents ranged from 60 to 87 yrs (with mean age of 69 7 years sd). Of the elderly men, 31.2% were within 6064 yrs age group, 28.6% were 6569 years, 23.7% were 7074 yrs, and 34.6% were within 6064 yrs age group, 26.1% were 6569 years, 21.1% were 7074 yrs, and 18.2% were 70 years and above . There were more elderly women [977 (53.3%)] than elderly men [847 (46.7%)]. Illiteracy level was 85% and of those that were literate, 87% had primary education and 11% had secondary education and 3% had tertiary education . Of all the elderly women, only 4.6% had secondary education, 15.3% had primary education and 80.1% had no formal education . Kanuri (84.%) constitutes the major ethnic group, while fulani and hausa represent 8.8% and 7.2%, respectively . Marital status of elderly men showed 86.3% married, 10.8% widowed, 1.8% divorced, and 1.1% single . Of the elderly women, 45.7% were married, 38.5% were widowed, 11.1% were divorced, and 4.7% were single . More than four - fifth (88.4%) of the respondents live with other family members, while 11.6% lived alone . In both sexes, more than two - thirds had normal cognitive function, 92.1% in elderly men and 81.2% in elderly women . Elderly women (12.6%) are two times borderline cognitive impaired compared with elderly men (6.1%). Also, elderly women (5.4%) are about three times probably cognitive impaired compared with elderly men (1.8%). More elderly women (24%) had more than one chronic disease than elderly men (15.5%). Elderly women (25.1%) are slightly more depressed than elderly men (22.7%). Elderly women (16.4%) are also more overweight than elderly men (12.5%). More than three - quarters (78.5%) earned less than one hundred american dollars per month and less than 5% of the participants earned more than three hundred american dollars per month (table 1). More than one - quarter (28.3%) of the respondents signified interest for assistance in at least one of the 10 adls in the barthel index . The prevalence of disability based on at least one item of the six adl scale was 15.7% and prevalence of disability based on at least one item in the five adl scale was 12.1% . The overall prevalence of disability (10 items adl, 6 items adl, and 5 items adl) and functional limitation increased with advancing age . The prevalence of needing help in at least one of the ten adls of the barthel index increased from 11.7 in those aged 6064 years, to 98.9% of those aged 75 years and older (table 2). The prevalence of functional limitation rose from 12.4% in those aged 60 to 64 years to 98.3% in the 75 years and above age group (table 2). In all the participants, the prevalence of both self - reported physical disability and objective measurement of functional limitation was higher in elderly women than in elderly men (table 2). Among the three ethnic groups, kanuris had the highest prevalence of physical disability (10 items adl, 6 items adl, and 5 items adl) compared to the fulanis and hausa (figure 1). However, the prevalence of functional limitation was almost similar across all ethnic groups . The correlations between performance - based functional limitation and self - reported physical disability among the different ethnic groups showed thus that the correlation coefficient for kanuris, hausas, and fulanis were 0.52, 0.48, and 0.23, respectively . Elderly persons with levels of mid - arm circumference indicative of severe malnutrition had an increased risk of physical disability and functional limitation (table 3). Among the four groups of monthly level of income, respondents that earned less than 100 us$/month had the highest prevalence of physical disability (10 items adl, 6 items adl, and 5 items adl). The prevalence of functional limitation rose from 0.6% in those that earned more than 300 us$/month to 33.2% in those that earned less 100 us$/month . With increase in age, elderly women with low education self - reported one or more chronic diseases than their elderly men counterparts . This study also showed that having depressive symptomatology and presence of visual impairment (mild - to - moderate blindness) were found to be more associated with physical disability . Furthermore, being at risk of isolation was associated with functional limitation (table 4). In table 4, all explanatory variables except ethnicity used in the univariate analysis were significantly associated with functional limitation . The multivariate associations between physical disability and functional limitation, and sociodemographic and health - related variables are shown in table 5 . Table 5 shows a significant independent associations between physical disability and advanced age, (75 years: prevalence ratio (pr) 22.2; 95% ci 14.536.8), presence of diabetes (pr 6.1; 95% ci 4.37.1), and visual impairment (blindness: pr 6.6; 95% ci 3.611.9). The independent variables found to be associated with functional limitation include advanced age, (75 years: pr 10.5; 95% ci 5.416.4), female gender (pr 9.3; 95% ci 3.718.3), presence of arthritis (pr 5.2; 95% ci 3.56.8), and having depressive symptomatology (pr 6.4; 95% ci 4.79.2). In contrast to physical disability, functional limitation represents an outcome that is free from external factors or environmental influences . This adds clarity to the understanding of the dynamics of the pathway from disease to disability . The study population was randomly selected from geographically defined rural communities, and a high response rate was recorded . The prevalence rates of physical disability for all the three adl scales and functional limitations were less than one - third and increased with age . The increase was observed to be higher in elderly women than elderly men and among kanuris than among fulanis and hausas . Advance in age, presence of diabetes, stroke, depressive symptomatology, and visual impairment were independent variables found to be more associated with physical disability . Furthermore, advance in age, female gender, arthritis, and depressive symptomatology were also significantly associated with functional limitation . As previously stated, studies on physical disability among elderly people in nigeria is very scarce; therefore, comparison of findings in this study with studies elsewhere is limited by definition criteria, differences in the way disability was measured, and sample characteristics . Studies in which the scope of definition of disability was not wide; for example, in which disability is based on any level of difficulty in the performance of daily tasks, the prevalence of disability is expected to be high and probably higher than that from this study . In addition, studies that exclude institutionalized elderly persons, the range of disability will also be different . Institutional care of the elderly is very rare in nigeria, and this study includes the entire range of functional limitations obtainable in rural population and thus excludes elderly in institutional care . Despite the scenario explained above, the rates of disability and functional limitation are comparable to levels reported among elderly persons in malaysia . Using the 10 items barthel index, this study revealed that more than one fifth (28.3%) of the elderly aged 60 years and above were dependent in at least one adl . This finding is similar to that reported by previous studies [27, 28]. However, a study in singapore found much lower disability prevalence than this study . Comparison with studies in other countries is difficult due to use of different adl measurements; however, narrowing adl disability to receiving help for at least one of five adl items (eating, bathing, dressing, transferring, and toileting) or six adl items (walking, eating, bathing, dressing, transferring, and toileting) allows reasonable comparison across some studies . Elderly women in this study have more functional disability than elderly men . Also, increase in age was found to be associated with increasing rates of disability . All these variables are often associated with the occurrence of disability as reported in the literature . According to the six - item adl index, the prevalence of physical disability for people aged 65 in this study was 21.4% (table 2), which is moderately higher than the united states' national long term care survey, which is 13% (7.9% when age - standardized to the nigerian population sample). However, the prevalence of six - item adl disability among people age 60 years and above in the caribbean, and among people age 75 years and above in latin america and the caribbean, appears to be similar to the prevalence rates in this study . Using the five - item adl index, for people aged 65 years and above this appears to be much higher when compared to the findings from developed countries, for example 6% in canada (3.2% when age standardized), 10% in france (5.5% when age standardized), 14% in italy (7.3% when age standardized), and 11% in sweden (5.5% when age standardized). Disability prevalence rates in this study appear comparable to rates in other developing countries; for example, among people aged 65 and older, the prevalence of 5 items adl disability in malaysia was 16% (14.8% when age standardized) and 10% in srilanka, (14.4% when age standardized). This is almost similar to 12% in india (9.3% when age standardized) and 11% in malaysia (10.5% when age standardized). However, the prevalence rate in this study is higher than 8% from shanghai, china . Differences in criterion definition and sample profile may account for disparity between this finding and that of china . The following may be other possible reasons why nigerian's disability prevalence rate is different from those reported from the developed countries: sample for this study was drawn from rural community, high illiteracy level (85%), the low educational levels in elderly cohorts (90.4% had no formal education or low education level), a figure higher than the developed country, and the prevailing sociodemographic differences between nigeria and the wealthy industrialized nations . Since disability in adl is one of the main reasons for institutionalization in the developed nations, this may be another reason why prevalence of physical disability in elderly people in developed countries is lower compared with this finding . The african tradition, particularly nigerian tradition, dictates that elderly people should be taken care of by their family members . The institutional care of the elderly is very rare in nigeria, thus majority of the elderly people in nigeria live with their spouse or other family members . Self - report or performance - based measures are useful in assessing functional limitation . However, performance based measurements offers more information, because they help to identify important physical parameters involved in performing daily activity tasks . Comparison of prevalence of functional limitation across studies is difficult due to differences in concept and measurement of functional limitation used . Using the tinetti performance - oriented mobility assessment tool, the overall prevalence of functional limitation among nigerian aged 75 years and above was 51.5% (table 2). This is very close to a previous study that reported 48% but much higher compared with that reported among the italian aged 75 years and above which was 21% . This study shows a higher prevalence of physical disability and functional limitation among elderly women than elderly men in all age groups and the higher the age the wider the gender difference . Previous studies [39, 40] have also reported higher levels of physical disability and functional limitation in elderly women than elderly men . Cumulative effect of pregnancy and childbearing, poor / lack of education, and poor health care may be responsible for higher physical disability and functional limitation seen in elderly women . Poor or lack of education may be associated with low income and poverty, poor standard of living, unhealthy lifestyle behavior, malnutrition, and less frequent use of health and medical care services . This study showed that more elderly women (80.1%) than elderly men (41.6) had no formal education; this is in conformity with the literature that low socioeconomic status is associated with physical disability . Chronic disease like obesity was found to be commoner in elderly women than elderly men; this finding is similar to malaysia study . In addition, underweight is higher in elderly men than elderly women, this is also similar to malaysia study . Sedentary life style among elderly women and carbohydrate as the main food consumption could be the reason for overweight commoner in elderly women than elderly men . In this study, the bmi values (20 to 24.9) associated with optimum physical function coincide with values associated with lowest risk of morbidity similar to previous studies in chinese populations relating bmi to health outcomes [42, 43] and mobility decline . This observation is not unexpected, given the close inverse relationship between walking speed and health - related outcomes in well - functioning older people [45, 46]. The findings from this study emphasize yet another adverse effect of obesity in the elderly apart from increased risk of various diseases that of functional limitation . For example, more than one - quarter (28.3%) of the respondents signified interest for assistance in at least one of the 10 adls in the barthel index (table 2). The request for help for some of the activities of daily living suggests that muscle function may be adversely affected and may partly account for functional limitations . The association between grip strength and appendicular muscle mass emphasizes this point . In obese elderly people, an exercise component must be included in the treatment regimens to maintain or increase lean muscle mass and bone mineral density . Such regimens have been shown to result in a reduction in fat mass without changes in fat - free mass, increase physical performance, and improve quality of life . Concerning the effect of ethnicity on prevalence of physical disability, this study showed that hausas had the highest prevalence of self - reported physical disability followed by fulanis and kanuris . The observed differences among the ethnic groups may be attributed to different types of occupations as similarly expressed in a previous study . In other words, this study revealed that hausas and fulanis are more commonly involved in very stressful and laborious manual occupations . Specifically, the hausas and fulanis are usually engaged in farming, tree felling, and truck pushing, while the fulanis are usually engaged in nomadic activities . This study showed a significant association between functional limitations and advanced age, female gender, stroke, arthritis, and depressive symptomatology, and it is similar to findings from a previous study . Living alone, poor social support, being overweight or underweight, presence of diabetes mellitus, stroke, and visual impairment were not associated with functional limitation . This finding is also similar to previous findings for advanced age, female gender, presence of arthritis and depressive symptomatology [49, 50] being associated with functional limitation . This study is limited by involving only elderly people in rural community, excluding elders from institutions as well drawing of inferences between health - related variables and physical disability or functional limitation . Other limitations include study design (cross - sectional design), which does not allow determination of direction of causality despite the presence of associations . In addition, the study design does not also include information on duration of disability thus making it difficult to confirm that some of the disabilities were or were not transient in nature . This study, however, has a number of strengths; this is one of the very few studies to assess the prevalence and correlates of performance - based functional limitation among elderly nigerians . Validated measures of disability that conform with theories of aging were used, for example, in the nagi model of disablement; functional limitation takes priority before (precedes) disability . Relationship between malnutrition and disability has also been reported by a previous study in rural malawi, where chilima and ismail observed a relationship between undernutrition and handgrip strength, psychomotor speed and coordination, and mobility and ability to carry out activities of daily living independently . Disability in old age is an important indicator of any community population health, as elderly people usually have more than one illness, and the functional impacts of combined conditions provide a better measure of health than do diagnostic categories . In addition, in developing countries, access to physicians this study has shown that the overall pattern of disability in nigeria has the relationships similar with studies elsewhere . Of particular note is that physical disability and functional limitation is common in nigerian elderly . Though the prevalent rates of physical disability and functional limitation is higher than that obtainable in developed countries but similar and comparable to partner developing countries . More importantly, elderly women, especially those with advanced age, chronic diseases, depressive symptomatology, and visual impairments showed greater risk of disability and functional limitation compared with elderly men . This finding is indispensable when considering those to focus for appropriate prevention and intervention strategies like physical exercise, health education, and home visits of high - risk individuals in community - dwelling nigerians.
The accelerometer is a useful measurement tool for monitoring physical activity, especially the upper extremity activities of patients with stroke1 . Unlike previous assessment tools for upper - limb function after stroke, accelerometers can also assess level of performance of activities of daily living, as well as capacity (the ability to perform some action)2 . Thus, accelerometers allow objective measurement of upper - limb activity during daily living as well as in clinical practice3 . A previous study found that accelerometry of daily arm activity was significantly related to the mal - aou scale, an upper - limb assessment tool which takes the form of a semistructured interview4 . An accelerometer was also used in a study assessing the reliability of log-14 for upper limb measurement5 . However, subjects in these studies wore the accelerometer for more than one day, making it difficult to evaluate upper - limb movement of specific activities . The action research arm test (arat) is a tool that assesses the abilities of grasp, grip, pinch and performance of gross movements after stroke6 . It is a highly reliable and validated measurement tool for the evaluation of upper limb motor impairment7 . The arat is used to measure specific upper limb movements including fine and gross movements8, and a comparison between the accelerometer and arat would determine whether the accelerometer is a useful tool for monitoring specific upper limb activities . Accordingly, the purpose of this study was to investigate the sensitivity of an accelerometer in measuring upper extremity activities . Fifteen subjects were recruited from rehabilitation hospitals in won - ju, korea for this study . The inclusion criteria were: a diagnosis of stroke with hemiparesis, no severe deficits in cognitive function (mini mental state examination (mmse) score> 22) and the absence of orthopedic upper limb limitations . We obtained written informed consent using the form approved by the yonsei university wonju institutional review board from all research subjects before beginning the study . The accelerometer used in this study was a fitmeter developed by fit dot life corporation of korea in 2010 . The fitmeter is small (35 mm 35 mm 13 mm) and light (13.7 g); thus, it is easy and convenient to attach to a specific body part . The frequency of measurement and sensitivity of the fitmeter are from 1/32 to 30 seconds and 2 to 8 g, respectively9 . For this study, the fitmeter was set at 1/32 seconds and 2 g to measure slower activities and fine motor movements . The arat assesses motor function of the upper limbs after stroke, as well as the amount of movement possible in stroke recovery stages . The arat uses a wooden box and different sizes of blocks and other objects . The arat consists of 19 test items including those that involve grasp (6), grip (4), pinch (6) and gross movement (3) actions . The highest possible arat score is 57, based on a four - point scale that rates the quality of movement over 60 seconds as follows: 0 = no movement, 1 = partial movement, 2 = movement performed slower than normal (560 seconds), 3 = movement performed normally (in less than 5 seconds). The test takes 515 minutes to complete, depending on the subject s symptoms10 . The inter - rater and test - retest reliabilities for stroke patients were 0.99 and 0.98, respectively indicating high reliabilities11 . Subjects wore accelerometers embedded within wrist bands on both wrists and performed the arat items . Subjects were required to place both arms on the desk before and after performing the arat in order to clarify the start and end point of the test . The mann - whitney test was used to compare median differences in arat and acceleration scores between the affected and non - affected sides . Spearman s rank correlation coefficient was calculated to test the significance of relationships between acceleration and arat variables . Table 1table 1.subject characteristics at baseline (n=15)characteristicgender, m / f (total)9/6, 15age (yrs)67.3 9.9affected side, l / r, (total)7/8, 15time since stroke onset (y)3.1 2.3values expressed as mean sd or n. shows the demographic characteristics of the study subjects . The study included nine males and six females with a mean age of 67.3 9.9 years . There was a significant difference in the median score between the affected and non - affected sides both the arat and accelerometer results . The arat scores were higher on the non - affected side (p<0.05), while upper limb activity was higher on the affected side (p<0.05) (table 2table 2.median differences in arat and acceleration scores between the affected and non - affected sidesaffected sidenon - affected sidearat42.8 (11.1)57 (0)accelerometer74488.3 (51778.1)35963.1 (11240.5)values are mean (sd), p<0.05). The correlation coefficient between arat and accelerometer results indicates that the results were not significantly correlated (table 3table 3.correlation between arat and the accelerometerarat (affected side)accelerometer (affected side)0.24accelerometer (non - affected side)0.91). Values expressed as mean sd or n. values are mean (sd), p<0.05 previous accelerometer studies primarily measured physical activity over several days12 . In contrast, this study was performed in a clinical setting and measured and compared upper extremity movements of specific activities performed using the paretic and non - paretic hands . The accelerometer results indicated there is a significant difference between the affected and unaffected upper extremities, and this was confirmed by the arat . This outcome was not consistent with previous studies comparing accelerometer recordings and the results of the motor activity log and the actual amount of use test1 . First, because we did not consider the timing of arat activities, there are data errors associated with the amount of upper limb movement as measured by the accelerometer . In addition, differences in quantitative and qualitative data of the accelerometer and arat affected the correlation coefficients . However, the results of this study indicate that the accelerometer is a sensitive tool for measuring upper limb activity . Future studies should use an accelerometer to measure specific activities in a clinical setting.
Maxillary sinus pneumatization can pose a surgical hazard in terms of oro - antral communications following extraction and endodontic surgery of the antral related teeth . It also increases the risk of introducing foreign bodies, root tips, or teeth displacement into the sinus cavity, and it is well known to influence orthodontic teeth movement [57]. If the communication remains open or if the infection persists, chronic inflammation of the sinus membrane may result with subsequent permanent epithelization of the oro - antral fistula a situation that further increases the risk of sinusitis . Lastly and needless to say that implant - supported rehabilitation of posterior maxilla is jeopardized by the natural tendency of the maxillary sinus to pneumatize bone during life and the inherent bone remodeling, which pursue teeth loss causing rapid alveolar bone resorption . Implant insertion within inadequate bone quantity carry risk of oro - antral communication and in such circumstance, maxillary sinus floor elevation is predictable and the possibility of using graft material is not even far . Both procedures require extra preoperative planning [812]. The sound knowledge and preoperative vision of this region will assist the surgeon to be more confident and be familiar with the common anatomic variants and to avoid such serious complications . Periapical, panoramic, and conventional ct have been recommended for the preoperative planning . In many clinical situations, the use of three - dimensional imaging proved to be beneficial as compared to two - dimensional imaging and overcomes its limitations . Ct scan was developed to overcome the lack of cross - sectional information, superimposition, distortion, and magnification noted in the conventional radiography [6,1618]. Exploring the normal radiographic anatomy of the maxillofacial region has reached areas that were hidden in the past . This is true concerning the maxillary sinus pneumatization especially with the increased reliability of 3d imaging . Three - dimensional ct technologies have greatly improved the ability to explore the interior of the cranium and to estimate the volumes of different anatomical compartments such as the maxillary sinus and the nasal cavity . It also facilitated the correlation between these anatomical compartments and the different ethnic groups relative to climate variations . However, the large dose of ionizing radiation delivered by medical ct is crucial and debatable [1921]. Outstandingly, the cbct technology has achieved considerable reduction of absorbed radiation doses compared to medical ct imaging and a bit similar to dental panoramic radiography [2224]. Standard dental protocol scans using traditional ct delivers 1.512.3 times greater radiation than comparable medium field of view dental cbct scans . Till that moment, the image quality of cbct was adjudged to be equivalent to that of traditional ct for visualizing the maxillofacial structures . Moreover, beam - hardening artifacts due to dental - filling materials and implants are far weaker at cbct than ct [2528]. Considering the anatomical variability related to the maxillary sinus, its intimate relation to the maxillary posterior teeth, and because of all the implications that pneumatization may possess, three - dimensional assessment of maxillary sinus pneumatization is of most usefulness . This is especially the case whenever surgical endodontic apicectomy, periodontal flaps, surgical extraction, implant installation, orthognathic surgeries, or surgical intervention for space occupying lesions involving the maxillary sinus and/or the maxilla are intended . Therefore, the aim of this study was to analyze the maxillary sinus dimensions both linearly and volumetrically to assess the maxillary sinus pneumatization . The present study was performed as a retrospective analysis of data stored in a private radiology center . Out of respect for doctor patient confidentiality, all personal information concerning the patients as well as the diagnostic cause of the inclusion criteria of patients to the study were based solely on the radiologists interpretation about lack of mucosal thickening in either maxillary sinuses as well as any bone deformities . Both sinuses in 15 patients scans were measured giving rise to data from 30 sinuses . Images were acquired using the i - cat imaging system (next generation, imaging sciences international, hatfield, usa). The patients were exposed in the sitting position and immobilized using a head band to adjust the head against the head rest and chin cup . The mid - sagittal plane was aligned to be perpendicular to the horizontal plane using vertical and horizontal alignment beams as recommended by the manufacturer . The i - cat is equipped with an amorphous silicon flat panel, and a single 360 degrees scan collects the projection data for reconstruction . The x - ray field size applied was 16 cm diameter 13 cm height, and scanning time was 8.9 s (fast enough to avoid patient movement, image blurring, and haziness). Operating parameters were 120 kvp and 5 ma with slice thickness of 0.3 mm (the standard resolution for scanning at i - cat machine). The i - cat s vision software (imaging sciences international) was used which allows the recording of linear measurements of images . The measurements were performed by observer (n a .- w . ), who has a 15 years experience in oral and maxillofacial radiology . This study was approved by the research ethics committee, faculty of oral and dental medicine, cairo university . The linear measurements were performed according to a protocol that was tested elsewhere for inter- and intraobserver agreement and showed statistically non - significant differences between the observers . Since there were no radiopaque markers used in this study, the selection of the cuts for measuring sinus dimensions was based on the presence of certain anatomical landmarks . According to the anatomical fact that the maxillary sinus is pyramidal in shape with an almost square base oriented medially, the measurements of the sinus dimensions were conducted as follows:1.linear measurements of the maxillary sinus length (craniocaudal extension; cc): on the i - cat vision software, mpr was chosen for interfacing; adjusting the orientation axis for the axial cut parallel to the occlusal plane at the alveolar crest level; adjusting the orientation axis of the sagittal cut to be midway between buccal and palatal cortices; adjusting the coronal cut at area of intended measurement by rotation of the axial image till the orientation axis for the coronal cut becomes perpendicular on buccal cortex . This was repeated at interdental areas between upper first and second premolars, upper second premolar and upper first molar, upper first and second molars, upper second and third molars; giving rise to 4 craniocaudal measurements: cc 1st and 2nd premolars, cc 2nd premolar and 1st molar, cc 1st and 2nd molars and cc 2nd and 3rd molars, respectively, for each side (fig . The coronal cut oriented exactly interdental was used (its axis of orientation in the axial cut was positioned interdentally). The measurements were taken from the lowest point of the cortical boundary of orbital floor to the lowest border of the cortical boundary of the sinus floor . To standardize the measurements, they were conducted along the orientation axis apparent on the cut to take the advantage of being automatically adjusted by the software used.2.linear measurements of the maxillary sinus width (antroposterior dimension; ap) and height (mediolateral dimension; ml) were performed on two levels; along nasal floor and along root of zygoma giving rise to 4 measurements: ap ns, ap zg, ml ns, and ml zg, respectively, on each side . To standardize the axial cut used for measurements, its orientation axis in the coronal cut was adjusted to be exactly passing bilaterally along the inferior cortical boundary of the nasal cavity and root of zygoma, respectively . The measurements were repeated till the maximum antroposterior and mediolateral dimensions were obtained (figs . 2 and 3). Linear measurements of the maxillary sinus length (craniocaudal extension; cc): on the i - cat vision software, mpr was chosen for interfacing; adjusting the orientation axis for the axial cut parallel to the occlusal plane at the alveolar crest level; adjusting the orientation axis of the sagittal cut to be midway between buccal and palatal cortices; adjusting the coronal cut at area of intended measurement by rotation of the axial image till the orientation axis for the coronal cut becomes perpendicular on buccal cortex . This was repeated at interdental areas between upper first and second premolars, upper second premolar and upper first molar, upper first and second molars, upper second and third molars; giving rise to 4 craniocaudal measurements: cc 1st and 2nd premolars, cc 2nd premolar and 1st molar, cc 1st and 2nd molars and cc 2nd and 3rd molars, respectively, for each side (fig . The coronal cut oriented exactly interdental was used (its axis of orientation in the axial cut was positioned interdentally). The measurements were taken from the lowest point of the cortical boundary of orbital floor to the lowest border of the cortical boundary of the sinus floor . To standardize the measurements, they were conducted along the orientation axis apparent on the cut to take the advantage of being automatically adjusted by the software used . Linear measurements of the maxillary sinus width (antroposterior dimension; ap) and height (mediolateral dimension; ml) were performed on two levels; along nasal floor and along root of zygoma giving rise to 4 measurements: ap ns, ap zg, ml ns, and ml zg, respectively, on each side . To standardize the axial cut used for measurements, its orientation axis in the coronal cut was adjusted to be exactly passing bilaterally along the inferior cortical boundary of the nasal cavity and root of zygoma, respectively . The measurements were repeated till the maximum antroposterior and mediolateral dimensions were obtained (figs . 2 and 3). The selected sites for linear measurements were 16 in number giving rise to a total of 240 readings . Ten sinuses for five patients (out of the original fifteen) were then selected for further volumetric analysis of the maxillary sinus . Right and left volumetric measurements were taken for the five patients.1-volume determination via segmentation technique using simplant software (simplant, materialise dental nv, leuven, belgium).2-volume determination via geometric calculation method according to the geometrical equation: volume of pyramid = base surface area 1/3 height . Volume determination via segmentation technique using simplant software (simplant, materialise dental nv, leuven, belgium). Volume determination via geometric calculation method according to the geometrical equation: volume of pyramid = base surface area 1/3 height . Volume of maxillary sinus (pyramid) = antroposterior (width) craniocaudal(length) mediolateral(height)/3 . In order to obtain the width, length, and height of the sinus, the coronal and axial cuts were sequentially reviewed to get maximum height of the sinus [mediolateral dimension] and the sagittal cuts were sequentially reviewed to get the maximum sinus base width [antroposterior dimension] and length [craniocaudal dimension] (fig . The amount of the maxillary sinus pneumatization was calculated relative to the highest level of the sinus floor expected at the distal side of the 1st premolar (where the sinus floor is supposed to start) by subtracting this value from the other measured craniocaudal values; e.g., sinus pneumatization between the 2nd and 3rd molars = craniocaudal dimension between the 2nd and 3rd molars craniocaudal dimension between the 1st and 2nd premolars . In cases where the sinus was absent at the area between 1st and 2nd premolars, the craniocaudal dimension between the 2nd premolar and 1st molar was used in the subtraction equation . Descriptive statistics were used for all the measurements . The average, standard deviation, coefficient of variation, and 95% confidence interval values for the craniocaudal, mediolateral, and antroposterior dimensions were calculated for the right and left sides of each patient separately . The pearson s correlation coefficient was used to evaluate the correlation between right and left 2d linear measurements for sinus symmetry as well as the correlation between 3d simplant and geometrically derived volumetric measurements . Student s paired t - test was also performed for the linear measurements (sample size = 15). The linear measurements were performed according to a protocol that was tested elsewhere for inter- and intraobserver agreement and showed statistically non - significant differences between the observers . Since there were no radiopaque markers used in this study, the selection of the cuts for measuring sinus dimensions was based on the presence of certain anatomical landmarks . According to the anatomical fact that the maxillary sinus is pyramidal in shape with an almost square base oriented medially, the measurements of the sinus dimensions were conducted as follows:1.linear measurements of the maxillary sinus length (craniocaudal extension; cc): on the i - cat vision software, mpr was chosen for interfacing; adjusting the orientation axis for the axial cut parallel to the occlusal plane at the alveolar crest level; adjusting the orientation axis of the sagittal cut to be midway between buccal and palatal cortices; adjusting the coronal cut at area of intended measurement by rotation of the axial image till the orientation axis for the coronal cut becomes perpendicular on buccal cortex . This was repeated at interdental areas between upper first and second premolars, upper second premolar and upper first molar, upper first and second molars, upper second and third molars; giving rise to 4 craniocaudal measurements: cc 1st and 2nd premolars, cc 2nd premolar and 1st molar, cc 1st and 2nd molars and cc 2nd and 3rd molars, respectively, for each side (fig . The coronal cut oriented exactly interdental was used (its axis of orientation in the axial cut was positioned interdentally). The measurements were taken from the lowest point of the cortical boundary of orbital floor to the lowest border of the cortical boundary of the sinus floor . To standardize the measurements, they were conducted along the orientation axis apparent on the cut to take the advantage of being automatically adjusted by the software used.2.linear measurements of the maxillary sinus width (antroposterior dimension; ap) and height (mediolateral dimension; ml) were performed on two levels; along nasal floor and along root of zygoma giving rise to 4 measurements: ap ns, ap zg, ml ns, and ml zg, respectively, on each side . To standardize the axial cut used for measurements, its orientation axis in the coronal cut was adjusted to be exactly passing bilaterally along the inferior cortical boundary of the nasal cavity and root of zygoma, respectively . The measurements were repeated till the maximum antroposterior and mediolateral dimensions were obtained (figs . 2 and 3). Linear measurements of the maxillary sinus length (craniocaudal extension; cc): on the i - cat vision software, mpr was chosen for interfacing; adjusting the orientation axis for the axial cut parallel to the occlusal plane at the alveolar crest level; adjusting the orientation axis of the sagittal cut to be midway between buccal and palatal cortices; adjusting the coronal cut at area of intended measurement by rotation of the axial image till the orientation axis for the coronal cut becomes perpendicular on buccal cortex . This was repeated at interdental areas between upper first and second premolars, upper second premolar and upper first molar, upper first and second molars, upper second and third molars; giving rise to 4 craniocaudal measurements: cc 1st and 2nd premolars, cc 2nd premolar and 1st molar, cc 1st and 2nd molars and cc 2nd and 3rd molars, respectively, for each side (fig . The coronal cut oriented exactly interdental was used (its axis of orientation in the axial cut was positioned interdentally). The measurements were taken from the lowest point of the cortical boundary of orbital floor to the lowest border of the cortical boundary of the sinus floor . To standardize the measurements, they were conducted along the orientation axis apparent on the cut to take the advantage of being automatically adjusted by the software used . Linear measurements of the maxillary sinus width (antroposterior dimension; ap) and height (mediolateral dimension; ml) were performed on two levels; along nasal floor and along root of zygoma giving rise to 4 measurements: ap ns, ap zg, ml ns, and ml zg, respectively, on each side . To standardize the axial cut used for measurements, its orientation axis in the coronal cut was adjusted to be exactly passing bilaterally along the inferior cortical boundary of the nasal cavity and root of zygoma, respectively . The measurements were repeated till the maximum antroposterior and mediolateral dimensions were obtained (figs . 2 and 3). The selected sites for linear measurements were 16 in number giving rise to a total of 240 readings . Ten sinuses for five patients (out of the original fifteen) were then selected for further volumetric analysis of the maxillary sinus . Right and left volumetric measurements were taken for the five patients.1-volume determination via segmentation technique using simplant software (simplant, materialise dental nv, leuven, belgium).2-volume determination via geometric calculation method according to the geometrical equation: volume of pyramid = base surface area 1/3 height . Volume determination via segmentation technique using simplant software (simplant, materialise dental nv, leuven, belgium). Volume determination via geometric calculation method according to the geometrical equation: volume of pyramid = base surface area 1/3 height . Volume of maxillary sinus (pyramid) = antroposterior (width) craniocaudal(length) mediolateral(height)/3 . In order to obtain the width, length, and height of the sinus, the coronal and axial cuts were sequentially reviewed to get maximum height of the sinus [mediolateral dimension] and the sagittal cuts were sequentially reviewed to get the maximum sinus base width [antroposterior dimension] and length [craniocaudal dimension] (fig . The amount of the maxillary sinus pneumatization was calculated relative to the highest level of the sinus floor expected at the distal side of the 1st premolar (where the sinus floor is supposed to start) by subtracting this value from the other measured craniocaudal values; e.g., sinus pneumatization between the 2nd and 3rd molars = craniocaudal dimension between the 2nd and 3rd molars craniocaudal dimension between the 1st and 2nd premolars . In cases where the sinus was absent at the area between 1st and 2nd premolars, the craniocaudal dimension between the 2nd premolar and 1st molar was used in the subtraction equation . Descriptive statistics were used for all the measurements . The average, standard deviation, coefficient of variation, and 95% confidence interval values for the craniocaudal, mediolateral, and antroposterior dimensions were calculated for the right and left sides of each patient separately . The pearson s correlation coefficient was used to evaluate the correlation between right and left 2d linear measurements for sinus symmetry as well as the correlation between 3d simplant and geometrically derived volumetric measurements . Student s paired t - test was also performed for the linear measurements (sample size = 15). The maximum craniocaudal extension of the maxillary sinus was located around the 2nd molar in 28 sinuses out of 30 (93%). Maximum craniocaudal extension of the maxillary sinus was located distal to the 2nd molar in 15 sinuses out of 30 (50%) followed by the mesial side of the 2nd molar (11 sinuses out of 30 = 36%). In only two sinuses, the craniocaudal extension of the maxillary sinus was equal on both sides around the 2nd molar . The maximum craniocaudal extension of the maxillary sinus was seen around the 1st molar in one sinus only and it was equal on both the distal and the mesial sides . In another sinus, the maximum craniocaudal extension of the maxillary sinus was seen between the 2nd premolar and 1st molar . Almost in all cases, 4 sinuses (bilateral in 2 patients) began more distally at the area of the 2nd premolar and one sinus did not reach beyond the level of 2nd molar . The largest average for craniocaudal dimensions was mesial to the 2nd molar (35.54 3.96 mm) (table 1). The maximum mediolateral extension of the maxillary sinus was located at the level of root of zygomatic complex in 90% of sinuses (27 sinuses out of 30). The maxillary sinus was located at a higher level than the nasal floor in 3 sinuses (10% of sinuses), 2 of these sinuses were in the same patient . The maximum antroposterior extension of the maxillary sinus was seen at the level of the root of zygomatic complex in 90% of sinus (27 sinuses out of 30). In 3 sinuses, the maximum antroposterior extension was seen at the level of the nasal floor, 2 of them were in the same patient . The sinus was bilaterally absent at the level of nasal floor in the same case that did not pneumatize distal to the 2nd molar and was absent in the right side of another case . The largest average for mediolateral and antroposterior dimensions was at the zygomatic complex level with amounts of 20.43 2.62 mm and 31.54 3.2 mm, respectively (table 2). The amount of sinus pneumatization was calculated relative to the craniocaudal extension of the sinus between the 1st and 2nd premolars . In the two cases where the sinus anatomically started at the 2nd premolar level, the amount of pneumatization was calculated relative to the craniocaudal extension at the 2nd premolar . Thus, in these two cases, no value was recorded for sinus pneumatization between 2nd premolar and 1st molar . In a single case, the extension of the sinus did not reach the 3rd molar so no value was recorded for this site . Negative pneumatization values denote higher sinus floor level at these sites (lesser craniocaudal dimension) compared to the sinus floor level at the site of the 1st premolar . The largest average sinus pneumatization was mesial to the 2nd molar (14.04 3.5 mm), while the average pneumatization around the 1st molar was 9.21 3.3 mm and 13.76 3.84 mm for the left side and 9.1 2.77 mm and 14.04 3.5 mm for the right side relative to the 1st premolar (table 3). There was a high correlation between the linear measurements of the right and left sides, where the antroposterior extension of the sinus at level of the nasal floor had the largest correlation (r = 0.89). The calculated p - values were all statistically non - significant denoting lack of difference between the two sides . There was also a high correlation between the simplant and geometric derived maxillary sinus volumes for both right and left sides (r = 0.98 and 0.96, respectively) (table 4). The anatomical pneumatization and relations of the maxillary sinus through the alveolar bone are complex, due to the variable extensions of the sinus . The relations between the teeth and the sinus floor are critical elements for diagnosis, dental treatments, and any surgical intervention of dento - antral complex . Several studies have investigated the maxillary sinus volume, dimensions, and the relative positions of the maxillary sinus to teeth . There is a wide range of maxillary sinus dimensions in different studies that may reflect the influential effects like human and race variability and triggering of pneumatization . The selected sites for linear measurements were 16 in number giving rise to a total of 240 readings . Increasing the number of readings allowed having average values that were comparable to other studies results . The maxillary sinus is anatomically pyramidal in shape with its apex located at the zygoma . Accordingly, the linear measurements performed in this study were conducted so that the mediolateral extension represented the height of the maxillary sinus geometrically from its base till its apex, while the antroposterior and the craniocaudal extensions represented the length and the width of the sinus base . In this study, it was found that the largest average craniocaudal, mediolateral, and antroposterior extensions of the maxillary sinus using cbct were 35.54 3.96, 20.43 2.62, and 31.54 3.2 mm, respectively . A comparable average dimension of the sinus was that of tiwana et al . . They stated that 33 mm high, 23 mm wide, and 34 mm in an anterior posterior length are the average dimension of the maxillary sinus . Moreover, the analysis of maxillary sinus by the application of high - resolution ct in shahbazian et al . Study revealed that the antroposterior and mediolateral dimensions of maxillary sinus were in the range of 38 mm (sd 5.2) and 23.5 mm (sd 5.1), respectively . Yet, their study did not mention information about the craniocaudal extension of the sinus . The maxillary sinus in the adult consists of a pyramid shaped cavity with its base at the lateral nasal wall and its apex extending into the zygomatic process of the maxilla . The results obtained in this study revealed that the height of this pyramid (mediolateral) is the smallest dimension, while the antroposterior and craniocaudal dimensions of its base are nearly equal . The results obtained in the current study furthermore assure that the maximum craniocaudal extension of the maxillary sinus was located around the 2nd molar (28 cases out of 30 = 93%). This result strongly matches that of nimigean et al ., who found that the lowest point of the sinus floor was related to the 2nd molar in 93.9% of cases . On the contrary, koppe et al . Found in 50% of the examined skulls that the apices of the upper first and second molars gave rise to prominences on maxillary sinus floor and ariji et al . Showed that the roots of the maxillary first molar were close to the sinus floor in 60% of the studied specimens . The frequency of greatest craniocaudal extension of the maxillary sinus relative to posterior maxillary teeth surfaces was 50% for the distal surface of the 2nd molar, 36% for the mesial side of the 2nd molar, and 3.3% for the mesial side of the 1st molar . A similar relation between the sinus and the teeth with different frequency was that of killey and kay . Their frequency of close proximity between the roots of the posterior maxillary teeth and the sinus floor was 45.5% for the 2nd molars, 30.4% for the 1st molars, and 19.7% for the 2nd premolars . . Also found that the distance between sinus floor and root tip was longest for the 1st premolar root tip and shortest for the 2nd molar buccodistal root tip for both right and left sides . Moreover, nimigean et al . Concluded that the danger of antral penetration is greater at the level of the buccal roots of the 1st and 2nd molars followed by the 2nd premolar . They also considered these sinusal roots and inferred that variations of the sinus floor s depth can depend on sinuses dimensions, their size, and pneumatization . Variations of the pneumatization of the maxillary alveolar process could take place due to the craniofacial morphological modifications through evolution that is influenced by dentition, chewing force, breathing movements and craniofacial growth factors that also control the pneumatization of the maxillary alveolar processes . This study showed that the largest average sinus pneumatization was mesial to the 2nd molar (14.04 3.5 mm), while the average pneumatization around the 1st molar was 9.21 3.3 and 13.76 3.84 mm for the left side and 9.1 2.77 and 14.04 3.5 mm for the right side relative to the sinus pneumatization between 1st and 2nd premolars . Unlike most of the studies that estimate sinus pneumatization of alveolar bone relative to the horizontal level of the nasal floor, the present study calculated the sinus pneumatization relative to the highest level of the sinus floor proposed to be located between the 1st and 2nd premolar, where the sinus floor starts to assume a more horizontal level . Although the current study did not calculate the amount of bone remaining between sinus floor and root apices, yet it is obvious that the maximum amount of sinus pneumatization around the 2nd molar obtained in our study goes in agreement with the least amount of bone remaining above the 2nd molar in different studies . The inverse relation between sinus pneumatization and remaining alveolar bone is well known and is further strengthened by nimigean et al . . Their study inferred that the antral floor depends upon the dental scaffold that constitutes the main factor during development and will transform in relation with the normal / pathological status of the dento - periodontal apparatus, for which they concluded that the available bone is lost from the inferior expansion of the sinus after teeth loss . In a striking observation, the average linear craniocaudal, antroposterior, and mediolateral measurements were almost bilaterally matching in all cases . The student s paired t - test also revealed that there was a non - significant statistical difference between the right and left sides . Study revealed symmetric morphology of maxillary sinus in 83% of patients, while the remaining patients (17%) showed a predominant asymmetric morphology . Radiologically compared the depth of the sinus floor and did not observe statistical differences between the right and the left sides . In this study, the 3d volumetric measurements of the maxillary sinus obtained for only five patients using the simplant software highly correlated with the mathematically obtained volumes by the geometric calculation (0.98 for the right and 0.96 for left side). Thus, for 3d volumetric measurements of maxillary sinus, the need for simplant software should be questioned regarding the cost effectiveness . Although different software s for volumetric analysis seem attractive, illustrative and more diagnostic, yet the geometric method offered a much cheaper, easier, and less sophisticated substitute . The relations of the sinus floor can be accurately assessed on the different orthogonal images obtained through 3d cbct scan . The geometric method for volumetric analysis offered a much cheaper, easier, and less sophisticated substitute; therefore, with the availability of software, 3d volumetric measurements are more facilitated . Cbct showed a great potential for proper preoperative planning and is an indispensable alternative for ct when 3d imaging is mandatory for all dental practitioners . The decision about the imaging technique that is most appropriate for each clinical situation should be based upon the radiation dose, the cost, and the reliability of each technique.
Sexually transmitted chlamydia trachomatis infection is of widespread public health concern because of its prevalence and potentially devastating reproductive consequences, including pelvic inflammatory disease (pid), infertility, and ectopic pregnancy [13]. The negatively charge elementary bodies (eb), infectious particles of c. trachomatis, invade the mucosal surface of the female genital tract and persist in them for a long time . Abundant in vitro data suggests that the inflammatory response to chlamydiae is initiated and sustained by actively infected host cells including epithelial cells and resident macrophages . C. trachomatis has the ability to infect both epithelial cells and resident macrophages . These infected host cells act as first responders to initiate and propagate immune responses, which later participate in initiation of adaptive immune responses . Activation of adaptive immune responses consequently leads to accumulation of effector t and b cells at the site of chlamydia infection and plays critical roles in controlling the infection [5, 6]. However, c. trachomatis uses various strategies to escape the host immune response and persist for a prolonged period of time, subsequently leading to the many disease manifestations associated with the infection . This is a common scenario for most intracellular organisms such as mycobacteria, where cells produce excessive inflammatory mediators to contribute to disease manifestation by damaging neighboring cells . For example, results from studies using the murine model of c. trachomatis revealed that tubal dilation frequently occurred as an end result for a primary infection, suggesting that the inflammatory process resulting from a single c. trachomatis infection is sufficient to result in long - term tissue damage . Like other infectious microorganisms, inflammatory mediators have been documented to be hallmarks of c. trachomatis infection and its pathogenesis [46]. Because of the inherent difficulties in acquiring human tissue samples for study, researchers have taken advantage of multiple animal models of chlamydia infection to examine the nature and timing of the inflammatory response . We have shown by in vitro experiments that primary chlamydia infection of human epithelial cells and mouse macrophages occurs within 2 days of infection and is characterized by significant production of il-6, tnf, and il-8 . It is well documented that inflammatory cytokines and chemokines play critical role for the recruitment and chemoattractant of neutrophils and other leukocytes . Neutrophils have the capability to destroy accessible ebs, and when recruited in high numbers, they release matrix metalloprotease (mmps) molecules and neutrophil elastase, which have been shown to contribute to tissue damage [10, 11]. To control inflammation triggered by infectious organisms, alternative strategies that could balance the levels of inflammatory mediators released during infection are of intense interest . Recently active compounds with the capacity to modulate host inflammatory responses have received considerable attention as they may be potential new therapeutic agents for the treatment of inflammatory diseases [1215]. Naringenin is a naturally occurring polyphenolic compound containing two benzene rings linked together with a heterocyclic pyrone ring . Naringenin is a normal constituent of the human diet in grapefruit and tomatoes and is known to exhibit a variety of biological activities, such as enzyme inhibitors, antioxidants, anticancer, and as an anti - inflammatory agent [1721]. Since its discovery, naringenin's wide ranges of pharmacological properties have attracted the attentions of many researchers because of its anti - inflammatory properties . Its anti - inflammatory property is actively studied in macrophages and ex vivo human whole - blood models [2224]. In this study, we investigated the anti - inflammatory capacity of naringenin to regulate cytokines and chemokines produced by mouse j774 macrophages infected with live c. trachomatis (mopn nigg ii). We used multiplex elisa to determine a broad range of inflammatory cytokines and chemokines produced during the interaction of c. trachomatis and macrophages . We then assessed the ability of naringenin to regulate the production level of these mediators . Next, we determined the potential mechanism(s) by which naringenin may modulate inflammatory mediators by investigating its effect on tlr2, tlr4, and cd86 receptors, as well as the p38 mapk pathway . The findings from our study are discussed here in the context of naringenin as a potential new immunomodulator of c. trachomatis induced inflammation . Mouse j774 macrophages were obtained from the american type culture collection (atcc, manassas, va, usa) and cultured as already described . C. trachomatis mopn nigg ii was purchased from atcc (atcc vr-123) and propagated as previously described . To establish infection, macrophages (10 cells / well) were seeded in 24-well plates for 24 h after which they were infected with live c. trachomatis infectious particles (10) in 500 l of growth media / well . The cells were then incubated at 37c under 5% co2 and culture supernatants were collected at 48 h after infection . The optimum bacterium dose and duration of infection were determined as reported . As a positive control, macrophages (10 cells / well) were stimulated with e. coli lps (1 g / ml) and culture supernatants were collected at 48 h after stimulation . Collected supernatants were centrifuged at 450 g for 10 min at 4c and stored at 80c until used . The stock solution of naringenin (sigma, st . Louis, mo, usa) was prepared by dissolving 40 mg of naringenin in 1 ml dimethyl sulfoxide (dmso). After 2-day infection of macrophages with c. trachomatis, the media were replaced with fresh media containing various concentrations (0.01, 0.1, 1, and 10 g / ml) of naringenin . Cell - free supernatants were collected after an additional 48 h incubation following centrifugation at 450 g for 10 min at 4c and stored at 80c until used . Milliplex mouse 32-plex cytokine and chemokines detection reagent (catalogue number mpxmcyto-70 k - pmx32) was purchased from millipore (emd millipore corporation, billerica, ma, usa) and the assay was performed as described . Cytotoxicity of naringenin to mouse j774 macrophages was measured using the 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (mtt) dye reduction assay and the celltiter 96 cell proliferation assay kit (promega, madison, wi, usa). Cells were seeded in a 96-well plate at a density of 10 cells / well in 50 l media and incubated overnight at 37c under 5% co2 . Naringenin was added to cells in concentrations ranging from 0.1 to 100 g / ml and after 48 h supernatants were removed, cells were washed twice with sterile pbs, followed by addition of 15 l of mtt dye solution to each well, and cells were further incubated for 3 h at 37c under 5% co2 . To stop the reaction, 100 l of solubilization solution / stop mixture was added to each well and plates incubated for 30 min at room temperature (rt). Absorbance at 570 nm was measured using a tecan sunrise plate reader (tecan us inc . The percentage of cell viability was obtained using the optical density readings of naringenin treated cells compared to those of normal cells (control), where% viability = [a]test/[a]control 100, where [a]test is the absorbance of the test sample and [a]control is the absorbance of control sample . Mouse j774 macrophages (10 cells / ml) were left uninfected or infected with c. trachomatis and after 48 h infection the media were removed and replenished with fresh media containing 1 g / ml of naringenin . Following incubation for an additional 48 h, cells were scraped from wells, washed, and then blocked with fc blocking antibody (bd bioscience) in facs (fluorescence - activated cell sorting) buffer (pbs containing 0.1% nan3 and 1% fetal bovine serum) for 15 min at 4c . Cells were next washed two times followed by staining with fluorochrome - conjugated antibodies (50 l in facs buffer) against mouse tlr2 (pe), tlr4 (fitc), cd80 (pe - cy7), and cd86 (apc) (ebiosciences). Cells were incubated with fluorochrome antibodies for 30 min at 4c, washed 2 times, and then fixed using 2% paraformaldehyde solution . Data were acquired on a bd facscanto ii flow cytometer (bd bioscience) with at least 10 events for each sample . Tlr2, tlr4, cd80, and cd86 positive cells and their mean fluorescence intensity (mfi) were analyzed using flowjo software (treestar inc ., mouse j774 macrophages (3 10 cells / well) were infected with live c. trachomatis (3 10 ifu / well) in 6-well plates for 48 h followed by replacement of fresh media containing 1 g / ml of naringenin . Rna was extracted from the cell pellets using qiagen rneasy kit (qiagen inc ., valencia, ca, usa), which included a dnase - i digestion step . Qrt - pcr was employed to quantify mrna gene transcripts of cd86 and tlr2 using taqman rna - to - ct 1-step kit in combination with taqman gene expression assays (applied biosystems by life technologies, foster city, ca, usa) as reported . Amplification of gene transcripts was performed according to the manufacturer's protocol using abi viia 7 real - time pcr (applied biosystem by life technologies) and standard amplification conditions . The relative changes in gene expression were calculated using the following equation: 2 where all values were normalized with respect to the housekeeping gene gapdh mrna levels . Amplification using 50 ng rna was performed in a total volume of 20 l . Each real - time pcr assay was performed in triplicates and the results are expressed as the mean sd . To determine if the p38 mapk pathway is employed by c. trachomatis to trigger production of cytokines and chemokines by mouse j774 macrophages, we next blocked p38 mapk signaling with its specific inhibitor, sb203350 (emd millipore corporation, billerica, ma, usa). Mouse j774 macrophages (10 cells / well) were preincubated with 20 m of sb203350 for 24 h, infected with c. trachomatis (10 ifu / well), and incubated for an additional 72 h. cell - free supernatants were collected by centrifugation and the production levels of randomly selected cytokines (il-6, tnf, il-12p70, and il-1) and chemokines (ccl5 and cxcl10) were determined using single elisas as described previously . The 20 m concentration and 24 h inhibition time point used for sb203350 were optimal conditions predetermined in our laboratory . Mouse j774 macrophages (3 10 cells / well) were seeded in 6-well plates and infected with live c. trachomatis (3 10 ifu / well) for 15, 30, and 60 min . Cells were lysed at different time points using 1x ripa buffer (sigma) supplemented with phosphatase inhibitors (sigma). Immediately cells were transferred to microcentrifuge tubes, sonicated for 15 sec to shear dna and reduce sample viscosity followed by centrifugation at 450 g for 10 min at 4c . The concentrations of proteins were determined by the bicinchoninic acid assay (bca) (thermo scientific, rockford, il, usa). Proteins were separated by sds - page, transferred to nitrocellulose membranes, and blocked with blocking buffer (tris - buffered saline (tbs)) containing 0.1% tween-20 and 5% w / v nonfat milk . After blocking for 1 h, the membrane was washed 3 times for 5 min each with wash buffer (tbs, 0.1% tween-20) and incubated overnight with gentle agitation at 4c with phospho - p38 or total p38 primary antibodies (cell signaling technology inc . Beverly, ma, usa) each at a dilution of 1: 1000 (diluted in primary antibody dilution buffer (1x tbs, 0.1% tween-20, 5% bovine serum album (bsa), and dh2o). Following overnight incubation, the membrane was washed 3 times and incubated with hrp - conjugated secondary antibody (cell signaling) at 1: 2000 (diluted in blocking buffer) with gentile agitation for 1 h at rt . After 3 washes, protein bands were visualized using lumiglo substrate (cell signaling) on scientific imaging film (kodak inc ., the sizes of total p38 and phospho - p38 were determined from the biotinylated protein ladder . Biotinylated secondary antibody (1: 1000 diluted in blocking buffer) was used to detect the protein markers . For some experiments, macrophages were infected with c. trachomatis in the presence and absence of naringenin at 1 g / ml to determine if naringenin may exert its anti - inflammatory activity by blocking the p38 mapk pathway . Protein lysates were collected and used in western blotting to detect the phosphorylation of p38 mapk as described in the preceding paragraph . The two - tailed unpaired student's t - test was used to compare the data . Like other infection agents, c. trachomatis induces the secretion of various inflammatory mediators upon its infection of macrophages . In the present study, we employed multiplex elisa to identify and quantify cytokines and chemokines in supernatants from macrophages infected with live c. trachomatis . Infected macrophages produced significant (p <0.001) levels of cytokines (il-6, tnf, il-10, il-12p70, il-1, il-1, and gm - csf) and chemokines (ccl4, cxcl10, cxcl5, ccl5, and cxcl1) (figures 1(a) and 1(b)). However, the production levels of these mediators were reduced in a dose - dependent manner in the presence of added naringenin (figures 1(a) and 1(b)). Supernatants of c. trachomatis infected macrophages that contained 10 g / ml of added naringenin showed a significant reduction in the levels of cytokines and chemokines (p <0.001) (figures 1(a) and 1(b)). The inhibitory activity of naringenin was significantly (p <0.01) observed with as little as 1 g / ml (figure 1(a)), suggesting the potency of naringenin even at low concentrations . Naringenin similarly reduced the production levels of cytokines and chemokines in a dose - dependent manner (p <0.001) when lps was used as the stimulant, especially at 10 g / ml (figures 1(a) and 1(b)). Overall, our results indicate that naringenin has an anti - inflammatory effect against c. trachomatis induced inflammatory mediators by macrophages . To ensure that the inhibitory effect of naringenin is not attributed to cell death, cytotoxicity studies were performed employing the mtt assay and j774 macrophages exposed to various concentrations of naringenin (0.01 to 100 g / ml). With the exception of the 100 g / ml naringenin concentration, all other tested concentrations exhibited between 85% and 100% cell viability, suggesting that naringenin is effectively nontoxic to macrophages at these concentrations (figure 2(a)). 96-well plate with cell death occurring in the presence of 100 g / ml of naringenin (yellow color) versus viable cells at other naringenin concentrations (dark purple color). Overall, these results demonstrate that naringenin's anti - inflammatory effect on inflammatory mediators produced by c. trachomatis infected macrophages is not attributed to cell death but rather to alternative mechanisms . Receptors on host cell surfaces such as tlrs recognize extracellular stimuli for subsequent intracellular signaling processes . Multiple studies have shown that tlr2 and tlr4 play pivotal roles in the recognition of c. trachomatis [2629]. To begin to understand the mechanism(s) by which naringenin modulates inflammatory mediators, we first focused on whether or not naringenin will affect the putative tlr2 and tlr4 receptors expressed on c. trachomatis infected mouse j774 macrophages . As compared to unstimulated cells, c. trachomatis infected cells expressed more tlr2 and tlr4 receptors, which were markedly downregulated in the presence of added naringenin, especially for tlr2 (figures 3(a) and 3(c)). In addition, the mfi for tlr2 and tlr4 on c. trachomatis infected cells was significantly increased (p <0.05) as shown by ratios of 22 and 16, respectively, in comparison to those of j774 and naringenin only uninfected cells (figure 3(e)). When naringenin was added to c. trachomatis infected macrophages, the mfi of tlr2 and tlr4 reduced significantly (p <0.05) as compared with that of c. trachomatis infected macrophages (figure 3(e)), suggesting the ability of naringenin to down - regulate the expression of these receptors . Our result provides evidence that naringenin diminishes the recognition of c. trachomatis by its putative tlr2 and tlr4 receptors to possibly exert its anti - inflammatory downstream effects during reinfection of cells by c. trachomatis . For t cells to be fully activated, antigen presenting cells must express costimulatory molecules such as cd80 and cd86 . Therefore, down - regulating the expression of either cd80 or cd86 or both may negatively impact the activation of t cells . Here we tested if naringenin may impact t - cell activation by down - regulating cd80 and cd86 expression levels on c. trachomatis infected macrophages . Our flow cytometric results show that naringenin at 1 g / ml downregulates the expression of cd86 induced by c. trachomatis infected macrophages but not that of cd80 as compared to macrophages exposed only to c. trachomatis (figures 3(b) and 3(d)). Moreover, naringenin significantly reduced (p <0.05) the mfi of cd86 on c. trachomatis infected cells from 18 to 9 (figure 3(e)). On the other hand, naringenin did not reduce the mfi of cd80 on infected cells (figure 3(e)), indicating its selective modulation of costimulatory molecules on c. trachomatis infected cells . This finding further suggests that naringenin anti - inflammatory effect is not only limited to innate immune responses but also to adaptive immune responses since the expression of either cd80 or cd86 or both plays critical roles for activation of t cells during adaptive immune responses . As a further validation of our flow cytometric results, we next determine the effect of naringenin on the mrna gene transcript expression levels of tlr2 and cd86 in c. trachomatis infected j774 macrophages . C. trachomatis enhanced the gene transcripts expression levels of tlr2 and cd86, which were both significantly (p <0.05) downregulated (up to a 2-fold decrease) in the presence of naringenin (at 1 g / ml) (figure 4). Combining these findings suggests that naringenin downregulates tlr2 and cd86 expression at both the protein and mrna gene transcripts levels, thus underscoring its role in regulating c. trachomatis inflammation in macrophages . Among the many mapk pathways multiple studies have suggested that p38 is a key mapk pathway that is activated by intracellular pathogen to induce inflammatory mediators [3133]. To investigate if the p38 pathway is exploited by c. trachomatis for production of its concomitantly elicited inflammatory mediators, we treated j774 macrophages with a p38 specific inhibitor followed by quantification of randomly selected cytokines and chemokines in collected supernatants . With the exception of il-1, our result shows that the levels of il-6, il-12p70, tnf, ccl5, and cxcl10 were significantly reduced (p <0.05) when macrophages were treated with the p38 inhibitor (figure 5), suggesting that this pathway is used by c. trachomatis for their production by macrophages . Given that p38 mapk mediates, in part, the production of inflammatory mediators by c. trachomatis infected macrophages, we investigated if this pathway may be used by naringenin to exert its anti - inflammatory effect in macrophages . Therefore, we first determined that indeed c. trachomatis could induce the phosphorylation of p38 mapk in j774 macrophages for the production of its inflammatory mediators . Our time - kinetics experiment shows that c. trachomatis infected macrophages expressed the highest p38 phosphorylation at 60 min (figure 6(a)). However, in the presence of naringenin, the phosphorylation of p38 reduced as indicated by the reduced band intensity (figure 6(b)). Similarly, lps induced the phosphorylation of p38 at 60 min of stimulation, but naringenin reduced its ability to induce phosphorylation of p38 (figure 6(c)). Overall, our results show increased phosphorylation of p38 map kinase in c. trachomatis infected macrophages, which was downregulated by naringenin, suggesting a potential downstream mechanism for naringenin to regulate inflammatory mediators . Inflammatory responses to c. trachomatis are initiated and sustained by actively infected host cells including epithelial cells and resident macrophages . The influx of inflammatory cells in pathogen - induced diseases can be either beneficial or detrimental to the host . Therefore, immunointervention strategies that can reduce the influx of inflammatory cells in a beneficial fashion could potentially impact the pathogenesis of diseases . Along with other controlling strategies, our laboratory is also interested in evaluating anti - inflammatory molecules to control c. trachomatis inflammation . Previously we have shown that the anti - inflammatory cytokines, il-10, downregulate essential inflammatory mediators produced by epithelial cells infected with live c. trachomatis . In the present paper we explored the natural flavonoid, naringenin, as a potential anti - inflammatory agent to regulate inflammatory mediators produced by c. trachomatis infected macrophages . Among the numerous structural diversities, we selected naringenin based on its abundance in nature and potential application in medicine . The following observations were made here: (1) by multiplex elisa a spectra of cytokines and chemokines, which may perpetuate an early c. trachomatis inflammation, were revealed, (2) naringenin downregulated cytokines and chemokines as produced by c. trachomatis infected macrophages, (3) naringenin downregulated tlr2 and tlr4 and also the cd86 costimulatory molecule on infected macrophages, and (4) naringenin inhibited the ability of c. trachomatis to phosphorylate p38 mapk for production of its inflammatory mediators by macrophages . Activation of immune cells, especially macrophages with microbial stimuli, influences the nature and progression of disease . In this study, analysis from c. trachomatis infected macrophages revealed increased levels of gm - csf, il-1, il-1, il-6, tnf, il-12p70, and il-10 after a 2-day infection, with tnf, il-6, and il-1 being more robustly produced (figure 1(a)). Indeed this observation is of no surprise since cytokines are secreted at different magnitudes during the infection process . It is well reported that all secreted cytokines have their own specific role during the infection process [1, 48]. One plausible explanation for lower levels of il-12p70, il-10, il-1, and gm - csf may be attributed to differences in the time kinetics for their optimum secretion during the infection process . Interestingly, this finding is in agreement with previous studies where lower levels of il-10 were detected during borrelia infection of human monocytes and c. trachomatis infection of human epithelial cells and macrophages . The heightened secretion of tnf, il-6, and il-1 by c. trachomatis infected macrophages may have some relevancy to the initiation of a chlamydia inflammation . It has been demonstrated that il-6, tnf, and il-1 have crucial roles in increasing the intracellular adhesion molecule (icam). Infection of nonimmune host epithelial cells and resident tissue innate immune cells with chlamydia results in an increase in adhesion molecules, whereby these molecules promote binding of small proteins such as chemokines on cell surfaces . Chemokines play critical role attracting leukocytes to the site of infection, where the leukocytes presence can be seen either as beneficial or detrimental to the host . The main leukocytes that are recruited and attracted by chemokines during an early inflammatory process are macrophages and neutrophils [16]. Our result shows that c. trachomatis infected macrophages produced greater quantities of ccl4, cxcl10, ccl5, cxcl1, and cxcl5 (figure 1(b)). The production levels of most chemokines are typically influenced by the type of cytokines present in the inflammatory milieu . The different profiles of chemokines produced by infected macrophages in this study correlated with the high levels of il-6, tnf, and il-1. High levels of il-6, tnf, and il-1 apparently cause chemokines to stick to endothelial cell surfaces for efficient attraction mainly due to an increase in icam . Overall, our results clearly demonstrate that the spectra of cytokines and chemokines produced by c. trachomatis infected macrophages may have significant roles in initiating its inflammatory process and thus pathogenesis of disease . Naringenin has a broad - spectrum medicinal application against bacteria, parasitic, and viral infections . 's study showed an antifilarial activity of naringenin against the filarial parasite, brugia malayi . Naringenin was also shown to exhibit antimicrobial activity against pathogenic bacteria like listeria monocytogenes, escherichia . Similarly, an antiviral activity of naringenin was shown against herpes simplex virus type-1 (hsv), polivirus, parainfluenza virus type-3, and respiratory syncytial virus (rsv). Du and colleagues demonstrated that naringenin regulates immune system function in a lung cancer infection model, where it reduced il-4 but increased il-2 and ifn- levels . In a different study, shi et al . Also showed that naringenin displayed an inhibitory role in allergen - induced airway inflammation by reducing il-4, il-13, ccl5, and ccl11 . For the first time, in the present study we have shown that naringenin has an anti - inflammatory effect in an in vitro c. trachomatis infection model . Naringenin reduced in a dose - dependent manner the level of major inflammatory mediators secreted by c. trachomatis infected macrophages, which was not attributed to cell death . These studies suggest that naringenin has a broader immune - regulatory property in different disease models, especially inflammatory diseases . In this study, we have clearly demonstrated that naringenin altered the levels of numerous cytokines and chemokines in c. trachomatis infected macrophages by its alteration of multiple inflammatory pathways . Induction of inflammatory pathway initially starts when invasive pathogens are recognized by cell surface receptor molecules such as tlrs in the host, followed by activation of various signaling pathways . It is well documented that c. trachomatis is recognized by tlrs specifically tlr2 and tlr4 on macrophages to induce secretion of inflammatory mediators, which can be either beneficial or detrimental to the host [29, 39]. Here in the present study we show enhanced expression of both tlr2 and tlr4 on c. trachomatis infected macrophages and whose expression levels were reduced by naringenin (figures 3 and 4). Our study suggests the capacity of naringenin to inhibit the interaction of c. trachomatis with its upstream putative receptors to potentially mediate its anti - inflammatory effect in macrophages . Tlr - stimulated macrophages induce effectors of the adaptive immune system such as cd40, cd80, and cd86 to drive t - cell activation and proliferation . The cd28-mediated costimulatory signal can result in an enhanced t - cell proliferation and cytokine production which contributes to the development of various inflammatory diseases [4042]. Our flow cytometry result demonstrates that c. trachomatis induced the expression of cd80 and cd86, however, with only cd86 expression being modulated by naringenin (figures 3 and 4). Although we have not shown it in this study, but inhibiting cd80 and cd86 expression has a possibility to impair the activation of t cells and eventually blocking effectors of the adaptive immune system . Lim and coworkers documented significant reduction in the levels of il-2 and ifn- when both cd80 and cd86 costimulatory molecules were inhibited confirming the key role played by costimulatory molecules in functional t - cell activation . Weakened t - cell activation is directly associated with less interaction between antigen presenting (apc) cells and t cells . Thus, our data provides mechanical insights of c. trachomatis engulfment by macrophages as indicative by heightened expression of cd80 and cd86, which eventually contributes to the activation of adaptive immune responses . Down - regulation of only cd86 expression in the presence of naringenin provides evidence for its broader capability in modulating inflammatory response during c. trachomatis infection . However, the perplexing question remains as to why naringenin inhibited cd86 but not cd80 expression even though both are costimulatory molecules highly needed for t - cell activation and also by which cell - to - cell binding forces depend on their recognition . It has been reported that treatment with cd80/86 blocking antibodies reduced the interaction force of cell: cell conjugates [43, 44]. Both cd80 and cd86 can bind to the t - cell stimulatory receptor cd28 and to the inhibitory receptor ctla4 . Cd86 appeared to strengthen apc: t - cell interactions more markedly than cd80 since higher force reduction was observed after blocking cd86 alone than that achieved by disrupting cd80 alone [44, 45]. Therefore, the ability of cd86 and not cd80 to induce stronger apc: t - cell interaction indicates its crucial ability in initiating immune responses . Upon microbial recognition by tlrs, mapk signaling pathways of the many mapk pathways, p38 is considered to be an important pathway to induce inflammatory mediators during c. trachomatis infection . Our inhibition study supports this idea, where in the presence of a p38 inhibitor the levels of il-12p70, il-6, tnf, ccl5, and cxcl10 (figure 5) were significantly reduced suggesting that this pathway is employed by c. trachomatis to induce these respective inflammatory mediators . Furthermore, phosphorylation of p38 by c. trachomatis in macrophages in this study (figure 6) underscores that it triggers this pathway for producing its concomitant inflammatory mediators . Of outmost significance, naringenin inhibited the ability of c. trachomatis to phosphorylate p38 in macrophages, suggesting possibly its attenuation of concomitantly produced cytokines and chemokines . Other investigators have reported that naringenin's inhibitory role in allergen airway infection is associated with its down - regulating the activation of the nf-b pathway via mapk pathway . In another study, it was also shown that naringenin manifested its anti - inflammatory functions in vitro by inhibiting nfb in macrophages [47, 48]. Shi et al . Also reported that naringenin can suppress mucous production by inhibiting nfb activity in a murine model of asthma . Overall, our findings coupled with the above mentioned reports provide evidence that inflammatory signaling pathways including mapk, especially p38 and nfb, are potential targets for naringenin anti - inflammatory effects . C. trachomatis has a prolonged and unique developmental life cycle which takes 2472 h for completion after entry into target cells . This process involves lysis and reinfection of cells by the released ebs after binding to their cognate cell surface receptors . Reinfection reportedly is one of the major characteristics of c. trachomatis persistent infection [4, 31] contributing to the pathogenesis of disease . The ability of naringenin to reduce cell surface receptor expression and associated inflammatory signaling pathways 48 h after infection of cells with c. trachomatis is a testament of naringenin regulation of inflammatory mediators during the reinfection process . Even though we focused on selected cell surface receptors and signaling pathways in this study, we cannot dismiss the involvement of other receptors like the nucleotide binding site / leucine - rich repeat (nbs / lrr) protein, nod2 that is recognized by c. trachomatis (and our unpublished observation) or the nfb signaling pathway that reportedly mediates naringenin anti - inflammatory actions . Admittedly, the precise mechanisms by which naringenin downregulates surface receptors and signaling pathways were not investigated here . Nevertheless, we cannot rule out the possibility that naringenin regulatory activity may be the direct consequences of its reducing the c. trachomatis infectious load in macrophages, ultimately resulting in less induction of inflammatory mediators . Whether or not naringenin has anti - bactericidal activity against c. trachomatis in macrophages is the topic of our ongoing investigations . In summary, most intracellular microorganisms including c. trachomatis prefer not to be targeted by regimens that impair their perpetuation in cells by inducing unwanted immune responses to amplify the disease progression . Therefore, in such scenarios, immunointervention approaches that focus on reducing any unwanted host immune response is attractive and can be viewed as alternative means to prevent or control severe inflammatory responses . Our findings presented here are the first, to our knowledge, to demonstrate that naringenin is an immunomodulator of inflammatory responses triggered by c. trachomatis in macrophages . Reduction of these inflammatory mediators by naringenin is mediated upstream by modulating tlr2, tlr4, and cd86 macrophage surface receptors and downstream via the p38 mapk signaling pathway . More studies are warranted to further explore the in vivo relevancy of naringenin in controlling severe inflammatory responses that are induced not only by c. trachomatis but also by other similar pathogenic microorganisms.
The incidence of lung cancer is constantly increasing, and this is a phenomenology that has raised concerns since decades, mostly important, because the disease has changed its manifesting modalities, and even the histological profile has undergone modifications [13]. On the other hand, if previously the age - specific parameter regarded mainly older patients, actually the trend of having more and more younger patients with lung cancer and with females suffering increasingly from the latter, is unrelenting . Tobacco smoking habits have been accused to play a direct role in the fact that females are manifesting increasingly a higher incidence of lung cancer, although conclusions hardly converge [57]. Albeit that numerous professional settings have been related to higher incidence of lung cancer, tobacco smoking still remains the mostly discussed factor . It seems nevertheless that several years of exposure to active or passive smoking are necessary before modifications of the bronchial mucosa can be detected . Furthermore, correlating the manifestation of the adenocarcinoma of the lung with tobacco smoking has been continuously an issue of controversy, although recent and more large studies have still found a relation, but rather a smaller one, when compared with other histological types of lung cancer [8, 9]. In the present study, the authors have tried to describe the behaviour of a sample group of 54 albanian females suffering from lung cancer and recruited for a diagnostic and therapeutic followup at the university hospital of pulmonary diseases (uhpd) in tirana, during the period from january to june 2011 . Several factors are discussed, such as the age of the patients, smoking habits, karnofsky score, histological type, and treatment modalities . Aiming to profile the actual trend of lung cancer in albanian women other studies have been sketched on the same issue but focusing on other parameters, such as pain and other oncologic variables . Also, models of studying smoking behaviour in this setting and group of patients have been proposed, mainly in regard to disease perception and behavioural changes related to the latter . In a retrospective study, we have evaluated the behaviour of female patients diagnosed and treated for lung cancer . All patients were admitted in a university facility (uhpd) of tirana, and cases were grossly divided in primary and secondary lung cancer . The female patients diagnosed with lung cancer during the period january june 2011 and treated with the previously mentioned facility were all recruited consequentially to the present study, with a sample group having a total of 54 cases . The majority of the cases were diagnosed through thoracic computerized tomography (ct), namely, 28 from the total of 54 females that formed the present sample of study . Karnofsky performance status (kps) was used as a standard score of measuring the ability of cancer patients to perform ordinary tasks of the everyday life activities . Kps is a scale ranging from 0 to 100, with a higher score meaning the patient to be more able to carry out everyday activities; such a scale has been proposed more than sixty years from now and yet has never lost its validity and utility . The stadification of the lung cancer has been done according to the system tnm (tumor, node, and metastasis) of the year 2009, seventh update . Self - reporting of the number cigarettes per day was used as a measure to consider the presence of smoking as a risk factor . For the purpose of the study, female patients were divided in smokers and nonsmokers, with the latter group never smoking or smoking occasionally (less than two cigarettes per day in an irregular basis); strong smokers (consuming 1 pack per year, equivalent of smoking twenty cigarettes daily for at least one year) formed a minority of the sample (see results later). 30 of them suffered from primary lung cancer (57%), and the rest of 24 female patients manifested a secondary lung cancer (43%). Although the majority of cases were above 51 years of age (28/54, i.e., more than half of the total), worth mentioning is the fact that we had 17 cancer patients (31%) aging from 31 to 40 years old . From the sample group we had 6 patients self - referring as smokers; heavy smokers that exceeded their smoke consumption by more than twenty cigarettes per day were a minority (two from six smokers). Surprisingly, 48 female patients diagnosed with lung cancer self - referred as being nonsmokers; thus we had a large majority (89%) of nonsmoking patients, forming part of a group diagnosed and treated for lung cancer . Regarding the distribution of histological types of the primary lung cancer, we had a majority of adenocarcinomas (20 from a total of 30 cases with primary lung cancer); the overall histological data are included in the table 2 . From the other subgroup with secondary lung cancer (24 cases in total) we had one case of metastasizing melanoma, one tumor of the thoracic wall extending per contiguity, one metastasizing cerebral tumour, one ovary - originated, and another one from colorectal origin; two cases had originated from trachea and another two from mediastinal structures . Breast metastasis and mesotheliomas formed the majority of the secondary lung cancer cases, respectively, with six and nine cases (see figure 1 for the histological distribution of secondary lung cancer diagnosed in the sample group). In the following table (table 3) we summarize the distribution of cases regarding the tnm staging, performance status (kps), and the main modality of treatment the patients received . From the data we gathered, we had the majority of cases presenting to a medical facility already in their fourth stage (tnm), although their performance status was generally good, which might comply with the surreptitious character of lung cancer, especially in nonsmoking women . The main modality of treatment offered was chemotherapy (45 out of a total of 54 patients); eight patients were operated and eventually half of them received thereafter chemotherapeutic treatment as well . We had no data regarding one case, which was treated in another facility, after the diagnosis was made . This is a descriptive and retrospective study, performed in a university facility, which is the only tertiary hospital dedicated to pulmonology in albania . The data of the present study have a limited validity, since the number of patients (54 in total) and the time length of their recruitment (six months) are both parameters of a controversial significance, from the epidemiological point of view . In order to avoid confusions regarding the role of risk factors, we dichotomized the sample group merely in smokers and nonsmokers, without entering in details regarding the severity of tobacco smoking as a phenomenon . Such a severity must, for sure, play an important role in the genesis of the lung cancer; therefore it cannot be underemphasized . In fact, the definition of nonsmokers, light smokers, and heavy smokers are another subject of controversy; nonprofessional sources consider a light smoker as a person smoking less than five cigarettes per day, in confront to a heavy there are authors that have made much more meticulous separations of smokers in subgroups, such as nonsmokers, heavy smokers, 3-month quitters, 6-month quitters, 12-month quitters, and long - term quitters . Heavy smoker index has been proposed and applied in different studies . Obviously, the scope of our study was more limited, and we merely divided patients into smokers and nonsmokers . From the data we gathered and the results presented herein, it is an impressive finding of a majority of nonsmokers suffering from lung cancer (48 out of 54 patients in the present sample, i.e., 89%). The question of secondary, second hand, or passive smoking will come out surely under these circumstances, and several sources have detailed the issue [18, 19]. In an obvious desperate attempt to control smoking in public environments, albanian government passed an ad hoc bill, on november 2006, which forecasted severe fines applied to smokers; such fines in fact were never collected . The law was stigmatized as the forgotten law from the media; but it is not excluded that other legislative or judicial acts might follow in the next future, since the era of litigation aiming to restrict tobacco exposure is surely arrived . Hereby passive smokers and claims of liabilities related to health damages provoked to them are continuously upheld, especially in particular settings such as working places and so forth . Such a good performance should have played some role in delaying the diagnosis, for we had on the other side, a very important number of cases staging at the fourth stage (tnm), with exactly 66% of the patients at the most advanced stage in the moment of diagnosis . Regarding the kps we grouped the scores under the denominations of low when such a score was 1040; medium when the score was 5070 and high for the scores 80100, such a grouping of scores has been applied from other sources as well [23, 24]. The present study, while confirming the general medical concern regarding a possible increasing trend of lung cancer among albanian women, raises two important issues . First, the fact that second - hand smoking role has to be scrutinized seriously and measured to be applied, when dealing with a majority of female lung cancer patients that self - referred as nonsmokers . Second, the fact that a large number of newly diagnosed lung cancer patients were already in advanced tnm stages albeit the performance status (kps) was generally high requires a thorough revision of preventive medical policies and diagnostic procedures at the primary level of medical care that are obviously lacking the ability to early diagnose a potentially lethal disease . Since the initial clinical signs of this malignant disease are far from being specific or pathognomonic, guidelines for early referral and investigation are proposed and applied, with meaningful results . This study tries to clarify some of the factors that have concerned albanian clinicians recently regarding the trend of lung cancer among females . Albeit the sample is relatively small and the time length of the study is short, it is worth mentioning that parallel studies are difficult to find; paucity of sources has made comparative international conclusions, with albania mentioned, rarely, if ever.
We observe evidence for reconnection in the cusp plasma at saturnwe present evidence that the reconnection process can be pulsed at saturnsaturn's cusp shows similar characteristics to the terrestrial cusp we observe evidence for reconnection in the cusp plasma at saturn we present evidence that the reconnection process can be pulsed at saturn saturn's cusp shows similar characteristics to the terrestrial cusp the magnetospheric cusp is a permanent funnel - shaped region which is present in any magnetosphere [e.g., russell, 2000]. Solar wind plasma can flow into the cusp via diffusive processes since the magnetic field strength is weak, or through the process of reconnection . Reconnection between interplanetary magnetic field (imf) and closed magnetospheric field lines results in solar wind (sw) plasma flowing into the magnetosphere along the open field lines, through the cusp [smith and lockwood, 1996]. Mcandrews et al . Presented magnetopause crossings which suggested the presence of reconnection signatures . Auroral evidence of consecutive reconnection events at saturn's magnetopause were reported by radioti et al . . On the other hand, masters et al . Showed that dayside reconnection may not be as common at saturn as at earth due to the typically high magnetosheath beta; moreover, the consequences of reconnection apparently differ, with no evidence of flux transfer events [lai et al ., 2012] or low - latitude boundary layer response to the imf seen at saturn [masters et al ., 2011]. The cusp is important as it can provide remote evidence for dayside reconnection and magnetically maps to a large area of the magnetopause, providing more information to the ongoing debate of the nature of reconnection at saturn . At earth, the ionospheric cusp footprint is usually observed near 1200 local time (lt). Cowley et al . Showed that due to saturn's fast rotation, a newly open flux tube can have a significant azimuthal motion, and therefore, the cusp may be observed after 1200 lt . The first evidence of saturn's auroral cusp footprint came from observations made by the hubble space telescope [grard et al ., it was observed as a spot at 1200 lt and was inferred to be due to reconnection occurring in the lobes . In this paper we report on in situ observations and analysis of the cusp for the first time . The associated characteristics of the cusp are earth - like with similar dispersions observed . From the analysis the field - aligned distance from the cusp to the site of reconnection the cusp was observed on the 21 january 2009 when cassini was at 11351205 lt, at a radial distance of 15 rs from saturn, a magnetic latitude of 45, and an l shell of 31 rs . In figure 1 we present in situ and remote - sensing observations obtained during and just prior to the cusp crossing . From 0700 to 0800 caps (cassini plasma spectrometer) data show high - energy, tenuous electrons and in figure 1b very low ion fluxes, observations which are typical of the high - latitude magnetosphere . In figure 1c, lemms (low - energy magnetospheric measurement system) data show increases in flux of high - energy electrons when the spacecraft is in the magnetosphere . Observations from the 21 january 2009 . In the top panel are three polar projections of saturn's northern aurora, obtained with the fuv channel of ultraviolet imaging spectrograph (uvis), taken at 1801, 1848, and 2012 ut . The grid shows latitudes at intervals of 10 and meridians of 30. noon is to the bottom and dawn to the left . The times at which the images are taken in comparison to the in situ observations are indicated by black arrows (i iii). Below the auroral observations: (a) omnidirectional electrons from the electron spectrometer (els)-caps, (b) ions from the ion mass spectrometer (ims)-caps presented in counts / accumulation, (c) high - energy electron data from lemms, (d) the three krtp components of the magnetic field, and (e) radio and plasma wave science (rpws) electric field spectrogram . The polar cap is labeled as pc . From just before 0900 until 1100 ut, caps observed intermittent magnetospheric high - energy tenuous plasma, and more dense cool plasma . At the same time, figure 1d shows that mag (dual technique magnetometer) observed rotations in the b component of the magnetic field, which are indicative of field - aligned currents (facs) [e.g., bunce et al ., it has been shown that facs coincide with observations of whistler mode radio emission . During this event, the facs derived from b are found to be consistent with past observations, and whistler mode emission was observed (figure 1e) by rpws (radio and plasma wave science) instrument . When the els (electron spectrometer) observed colder electrons, ims (ion mass spectrometer) observed significant increases in ion fluxes . From 1100 to almost 1900 ut, cassini observed the cusp, which is marked by the dashed vertical lines . Els observed steadier fluxes of cold dense electrons, similar to magnetosheath plasma . At 1500 the observed electrons had a slightly higher energy (an increase of 100 ev) and there was an increase in flux from 1600 ut for 2 h. from 1100 ut onward, ims observed ions which had a stepped energy - time dispersion structure (underlined in figure 1). This step structure in the ions and the changes in the electron parameters suggests that cassini was traversing different reconnected magnetic flux tubes in the cusp attributed to bursts or pulses of reconnection occurring at different areas along the magnetopause [lockwood and smith, 1994; lockwood et al ., ut, cassini entered the polar cap (pc), which are also open field lines, where electron and ion fluxes were at or below the noise level, and auroral hiss appears in the rpws data (indicative of open field lines in the polar cap which are devoid of detectable plasma). Also presented are three images of the aurora taken after and at the end of the in situ observations presented . They show the existence of bifurcations of the main auroral emission (marked with white arrows). Our identification of the region from 1100 to almost 1900 as cusp is supported by two strong pieces of evidence from caps observations: (1) as described in greater detail in the supporting information, composition measurements indicate that the ions are of solar wind origin (h and m / q=2 ions were in the ratio 25100 [see supporting information for more details], with no appreciable w,); and (2) the electron energy spectra are much more characteristic of typical magnetosheath measurements than of magnetospheric electron spectra . Figure 2 shows a comparison of the average energy distribution of the electrons from 1100 to 1900 ut to those of the magnetosphere and the most recent magnetosheath observation . The electrons up to 10 ev are due to spacecraft charging . From 10 ev, the cusp electrons are more similar in energy distribution to the magnetosheath than to the magnetosphere, showing that the plasma is therefore more likely of sw origin and not magnetosphere . Average electron energy distributions of the cusp at 11101820 ut (blue), magnetosphere 02000700 ut (red) and magnetosheath (green) taken from the most recent observation on 12 november 2008 14001900 ut . In addition, we show angular distribution plots (see figure 3) of the ions at selected energies and times (note that the viewing perspective in figure 3a is reversed compared to the others; see the description in the caption). The angular distributions (in figure 3a) of the ions in the magnetosphere (06250700 ut) show they are coming primarily along the field line (black dot) from the direction of the subsolar point . However, the ions in the cusp in figures 3b 3d are not field aligned . The ions in the cusp are arriving from the direction of the equatorial plane between 1245 and 1715 ut, with the ions strongly convecting from the direction of the equatorial plane at 15251715 ut, which is consistent with reconnection occurring at low latitudes, followed by subsequent poleward convection through the cusp . In none of the distributions in figure 3 is there evidence for a peak near the corotation direction (triangle), which is in or near the field of view for all except the 12401244 interval . Angular distributions of ions at an average energy near the peak count rate at four different times: (a) 06250700, (b) 12401244, (c) 15251529, and (d) 17121718 ut on 21 january 2009 . In figure 3a the center of the plot corresponds to the look direction directly away from saturn, while the entire outer circle corresponds to the look direction toward saturn . The dashed circle midway between the center and the outer edge corresponds to the look direction 90 away from saturn, with the northward - viewing direction at an azimuth (labels around the outer circle) of 0. the look direction to see corotation lies on the dotted circle at an azimuth of 270, as indicated by the triangle . For figures 3b 3d, the viewing perspective is reversed, with the look direction to saturn now in the center of the plot . The other directions remain as described for figure 3a . In particular, the corotation look direction is still marked by a triangle and flows from north of the spacecraft would be seen in the upper half of the plots . The solid black dots show the orientation of the magnetic field (both the parallel and antiparallel directions). The ions during this period also display energy - latitude and energy - pitch angle dispersions (discussed below) which are typical characteristics of the terrestrial cusp [e.g., hill and reiff, 1977]. The upstream sw conditions are characterized from the saturn kilometric radiation (skr) observations made by rpws, and model data from enlil which is a 3-d magnetohydrodynamic model of the heliosphere [odstrcil, 2003] (see supporting information). The increase of skr intensity and subsequent extension toward low frequencies has been shown to often derive from interplanetary shocks [desch and rucker, 1983, 1985; badman et al ., 2008], but also more recently from internal processes as well [lamy et al ., 2013]. The comparison of rpws observations with enlil simulations over an extended period of time shows intensified emission (observed by rpws) close to the predicted arrival (from enlil) of sw dynamic pressure enhancements (e.g., around the time of our cusp observations on day of year (doy) 1920 and other time periods on doy 2930 and 3940), as well as at times seemingly unrelated to solar wind parameters . The first of the enlil - predicted solar wind pressure enhancement events matches the interval investigated in this paper within the uncertainty of enlil propagation . The arrival time uncertainty of the model at 5.4 au can be at least 4 days and maybe larger at 9 au [jian et al . This supports the possibility that the magnetosphere was in a compressed state during the interval examined here, which would provide more favorable conditions for dayside reconnection [e.g., jackman et al ., 2004; masters et al . The cusp was observed on the 21 january 2009 when cassini was at 11351205 lt, at a radial distance of 15 rs from saturn, a magnetic latitude of 45, and an l shell of 31 rs . In figure 1 we present in situ and remote - sensing observations obtained during and just prior to the cusp crossing . From 0700 to 0800 caps (cassini plasma spectrometer) data show high - energy, tenuous electrons and in figure 1b very low ion fluxes, observations which are typical of the high - latitude magnetosphere . In figure 1c, lemms (low - energy magnetospheric measurement system) data show increases in flux of high - energy electrons when the spacecraft is in the magnetosphere . Observations from the 21 january 2009 . In the top panel are three polar projections of saturn's northern aurora, obtained with the fuv channel of ultraviolet imaging spectrograph (uvis), taken at 1801, 1848, and 2012 ut . The grid shows latitudes at intervals of 10 and meridians of 30. noon is to the bottom and dawn to the left . The times at which the images are taken in comparison to the in situ observations are indicated by black arrows (i iii). Below the auroral observations: (a) omnidirectional electrons from the electron spectrometer (els)-caps, (b) ions from the ion mass spectrometer (ims)-caps presented in counts / accumulation, (c) high - energy electron data from lemms, (d) the three krtp components of the magnetic field, and (e) radio and plasma wave science (rpws) electric field spectrogram . The polar cap is labeled as pc . From just before 0900 until 1100 ut, caps observed intermittent magnetospheric high - energy tenuous plasma, and more dense cool plasma . At the same time, figure 1d shows that mag (dual technique magnetometer) observed rotations in the b component of the magnetic field, which are indicative of field - aligned currents (facs) [e.g., bunce et al ., it has been shown that facs coincide with observations of whistler mode radio emission . During this event, the facs derived from b are found to be consistent with past observations, and whistler mode emission was observed (figure 1e) by rpws (radio and plasma wave science) instrument . When the els (electron spectrometer) observed colder electrons, ims (ion mass spectrometer) observed significant increases in ion fluxes . From 1100 to almost 1900 ut, cassini observed the cusp, which is marked by the dashed vertical lines . Els observed steadier fluxes of cold dense electrons, similar to magnetosheath plasma . At 1500 the observed electrons had a slightly higher energy (an increase of 100 ev) and there was an increase in flux from 1600 ut for 2 h. from 1100 ut onward, ims observed ions which had a stepped energy - time dispersion structure (underlined in figure 1). This step structure in the ions and the changes in the electron parameters suggests that cassini was traversing different reconnected magnetic flux tubes in the cusp attributed to bursts or pulses of reconnection occurring at different areas along the magnetopause [lockwood and smith, 1994; lockwood et al ., ut, cassini entered the polar cap (pc), which are also open field lines, where electron and ion fluxes were at or below the noise level, and auroral hiss appears in the rpws data (indicative of open field lines in the polar cap which are devoid of detectable plasma). Also presented are three images of the aurora taken after and at the end of the in situ observations presented . They show the existence of bifurcations of the main auroral emission (marked with white arrows). Our identification of the region from 1100 to almost 1900 as cusp is supported by two strong pieces of evidence from caps observations: (1) as described in greater detail in the supporting information, composition measurements indicate that the ions are of solar wind origin (h and m / q=2 ions were in the ratio 25100 [see supporting information for more details], with no appreciable w,); and (2) the electron energy spectra are much more characteristic of typical magnetosheath measurements than of magnetospheric electron spectra . Figure 2 shows a comparison of the average energy distribution of the electrons from 1100 to 1900 ut to those of the magnetosphere and the most recent magnetosheath observation . The electrons up to 10 ev are due to spacecraft charging . From 10 ev, the cusp electrons are more similar in energy distribution to the magnetosheath than to the magnetosphere, showing that the plasma is therefore more likely of sw origin and not magnetosphere . Average electron energy distributions of the cusp at 11101820 ut (blue), magnetosphere 02000700 ut (red) and magnetosheath (green) taken from the most recent observation on 12 november 2008 14001900 ut . In addition, we show angular distribution plots (see figure 3) of the ions at selected energies and times (note that the viewing perspective in figure 3a is reversed compared to the others; see the description in the caption). The angular distributions (in figure 3a) of the ions in the magnetosphere (06250700 ut) show they are coming primarily along the field line (black dot) from the direction of the subsolar point . However, the ions in the cusp in figures 3b 3d are not field aligned . The ions in the cusp are arriving from the direction of the equatorial plane between 1245 and 1715 ut, with the ions strongly convecting from the direction of the equatorial plane at 15251715 ut, which is consistent with reconnection occurring at low latitudes, followed by subsequent poleward convection through the cusp . In none of the distributions in figure 3 is there evidence for a peak near the corotation direction (triangle), which is in or near the field of view for all except the 12401244 interval . Angular distributions of ions at an average energy near the peak count rate at four different times: (a) 06250700, (b) 12401244, (c) 15251529, and (d) 17121718 ut on 21 january 2009 . In figure 3a the center of the plot corresponds to the look direction directly away from saturn, while the entire outer circle corresponds to the look direction toward saturn . The dashed circle midway between the center and the outer edge corresponds to the look direction 90 away from saturn, with the northward - viewing direction at an azimuth (labels around the outer circle) of 0. the look direction to see corotation lies on the dotted circle at an azimuth of 270, as indicated by the triangle . For figures 3b 3d, the viewing perspective is reversed, with the look direction to saturn now in the center of the plot . The other directions remain as described for figure 3a . In particular, the corotation look direction is still marked by a triangle and flows from north of the spacecraft would be seen in the upper half of the plots . The solid black dots show the orientation of the magnetic field (both the parallel and antiparallel directions). The ions during this period also display energy - latitude and energy - pitch angle dispersions (discussed below) which are typical characteristics of the terrestrial cusp [e.g., hill and reiff, 1977]. The upstream sw conditions are characterized from the saturn kilometric radiation (skr) observations made by rpws, and model data from enlil which is a 3-d magnetohydrodynamic model of the heliosphere [odstrcil, 2003] (see supporting information). The increase of skr intensity and subsequent extension toward low frequencies has been shown to often derive from interplanetary shocks [desch and rucker, 1983, 1985; badman et al ., 2008], but also more recently from internal processes as well [lamy et al ., 2013]. The comparison of rpws observations with enlil simulations over an extended period of time shows intensified emission (observed by rpws) close to the predicted arrival (from enlil) of sw dynamic pressure enhancements (e.g., around the time of our cusp observations on day of year (doy) 1920 and other time periods on doy 2930 and 3940), as well as at times seemingly unrelated to solar wind parameters . The first of the enlil - predicted solar wind pressure enhancement events matches the interval investigated in this paper within the uncertainty of enlil propagation . The arrival time uncertainty of the model at 5.4 au can be at least 4 days and maybe larger at 9 au [jian et al ., this supports the possibility that the magnetosphere was in a compressed state during the interval examined here, which would provide more favorable conditions for dayside reconnection [e.g., jackman et al ., burch et al . Showed that ions in the cusp display an energy - pitch angle dispersion, whereby the gradient of the dispersion is dependent on the distance to the reconnection site . Following burch et al ., model dispersions can be calculated using a magnetic field model [khurana et al ., 2006] and compared to observed dispersions to calculate the distance to the reconnection site (see figure 4). The data were divided into five intervals due to the presence of the five clear energy - latitude dispersions . Table 1 shows results of this analysis, where we find the reconnection site distance ranged from 27 to 51 rs . Method, which estimates the distance (d) to the reconnection site to be 39 23 rs . Unlike table 1, the field - aligned distances from cassini to the site of reconnection calculated from ion pitch angle - energy dispersionsa the mean distances are shown with their propagated standard errors, as well as the standard deviation from the mean . Just after the time interval during which cassini was traversing saturn's magnetospheric cusp, the uvis observations show bifurcations (marked with white arrows in figure 1) which have been suggested to occur due to the opening of closed magnetospheric field lines at the magnetopause [radioti et al ., 2013]. Previous studies [radioti et al ., 2011] have shown that during the presence of bifurcations, the main auroral emission expands with time to lower latitudes, which is indicative of opening of flux . The expansion of the main emission is equal to the area occupied by the bifurcations, suggesting that the bifurcations represent the amount of newly open flux and thus are signatures of magnetopause reconnection . Suggested that the consecutive brightenings of the auroral bifurcations are due to multiple reconnection along the same magnetic flux tube . We are unable to infer whether this is happening; however, we conclude that both the in situ data and the uvis observations imply reconnection occurring on this day . The overall plasma observations show that cassini passed from the magnetosphere through field - aligned currents (observed in the b component of the magnetic field) and then the spacecraft entered open field lines where it observed cusp plasma . These two facs might represent layers that moved toward and away from the spacecraft without completely passing over it, meaning we observed the fac magnetic signature of the fac without fully traversing it . This study focuses on the cusp observations, and therefore, we do not explore the facs further . While in the cusp, ims observed ion energy - latitude dispersions: the effect of magnetopause reconnection, poleward convection of open field lines, and possible azimuthal dispersion . The angular distributions of the ions show that they are coming from below the spacecraft, which is consistent with convection of a newly opened magnetospheric field line . Step - like energy - latitude dispersions in the ion observations suggest that reconnection is pulsed at the magnetopause, and not steady . Also observed are ion pitch angle - energy dispersions, which have been used to calculate the variable field - aligned distance to the reconnection site (table 1). The results indicate that reconnection is occurring along the magnetopause, and is probably not occurring in a steady manner . The characteristics of the cusp at saturn are very similar to the terrestrial cusp, with the presence of two types of dispersions: energy - latitude and energy - pitch angle . Multiple ion energy - latitude dispersions are likely due to temporal variations, as studied previously at earth . As we do see changes in the electron flux and energy at the edges of the dispersions, this is not a spatial feature . The duration of the cusp crossing was large in comparison to earth (hours as opposed to minutes at earth) [e.g., pitout et al ., 2009]. This study thus confirms that although dayside magnetopause reconnection at saturn is often suppressed [masters et al . Comparison with enlil predictions of the solar wind environment suggest that saturn's magnetosphere may have been in a compressed state during this cusp crossing, a condition that is known to be more conducive to magnetopause reconnection . A future statistical study of the cusp will help describe the debated nature and overall rate of reconnection at saturn . In order to describe saturn's rotational effect on the cusp, further investigations are necessary, as well as a detailed model of the saturnian cusp.
The deleterious impact of hydrosalpinx on fertility is best exemplified by studies showing a 50% reduction in ivf pregnancy rates in their presence (1). Chlamydia infection and pelvic inflammatory disease are associated with an increased risk of both tubal infertility and ectopic pregnancy, with the association proportionate to the number of infections(2). Various theories have been proposed to explain the observation of lower ivf pregnancy rates in the setting of hydrosalpinx, to include mechanical effects, embryo and gametotoxicity, decreased expression of key implantation molecules, and/or a direct effect on the endometrium leading to intrauterine fluid formation(3). Drainage of hydrosalpingeal fluid into the endometrial cavity may exert a mechanical effect by washing the transferred embryo from the cavity . Cultured epithelial cells isolated from hydrosalpinx affected tubes produce a fluid which is hostile to both spermatozoa and early mouse embryo development(4). Multiple studies have demonstrated deficiency in endometrial markers of embryo receptivity in the presence of hydrosalpinx . Il-2, t lymphocytes, cd3 +, cd8 +, cd4 +, alpha v beta 3 integrin, lif, mmps and hoxa10 have all been shown to be decreased in the endometrium from women with versus without hydrosalpinx(5 - 8) though molecular inflammatory changes in the setting of hydrosalpinx are documented, a hysteroscopic endometrial phenotype in the presence of hydrosalpinx has not been well characterized . Eighteen months prior to presentation, she was diagnosed with a chlamydial infection by cervical culture and treated with a single dose azithromycin . A negative chlamydia culture was confirmed four months prior to presentation . As part of her initial infertility evaluation at our center, a hysterosalpingogram (hsg) was performed in a window of doxycycline prophylaxis which demonstrated bilateral hydrosalpinges, with the right tubal diameter measuring greater than the left and bilateral tubal occlusion (figure 1). Hysterosalpingogram demonstrating bilateral distal tubal occlusion with hydrosalpinges staged combined endoscopy was performed in the operating room . Hysteroscopy revealed endometrial inflammation as evidenced by diffuse hyperemia and mucosal oedema (figure 2a). Laparoscopic findings were significant for a right sided hydrosalpinx measuring over 2 centimeters in diameter and dense adhesions of the bowel to the left hydrosalpinx and ovary . She underwent right salpingectomy and left tubal occlusion at the visible isthmic region via clip placement . She experienced an unremarkable postoperative course and was scheduled for in vitro fertilization (ivf) treatment . Hysteroscopic appearance of endometrial cavity immediately pre - salpingectomy (a) and six months after interruption of communication with hydrosalpinges (b). For each series, images from left to right depict right cornual, fundal and left cornual regions, respectively . Six months later, the patient underwent hysteroscopic endometrial cavity evaluation in preparation for ivf . At hysteroscopy, the patient subsequently underwent ivf with transfer of a single blastocyst culminating in the delivery of a healthy infant at term . Given the importance of tubal patency in non - ivf treatment and the detrimental impact of tubal pathology such as hydrosalpinx, oviductal evaluation represents an important part of the initial female infertility work up . Given the trend among women to present for infertility care later in the reproductive lifespan, patients undergoing ivf may not have had prior tubal evaluation via either of the standard modalities . Transvaginal ultrasound in the detection of hydrosalpinx has been reported, albeit with user - dependent sensitivity . The present case suggests that an inflamed endometrial appearance may be a hysteroscopic sign of a communicating hydrosalpinx requiring dedicated tubal study prior to initiating fertility treatment as depicted in figure 2, the endometrial surface appears erythematous with friable and tortuous vascularity in the setting of a hydrosalpinx, and normal appearing after surgical interruption of hydrosalpingeal drainage . Subsequent ivf treatment and transfer of a single blastocyst resulted in an intrauterine pregnancy, with subsequent term delivery, indicative of functional embryo receptivity on a molecular level, although no molecular evidence is available for confirmation . In view of these findings, we propose an inflamed appearance at hysteroscopy for endometrial cavity screening should prompt a dedicated study to rule out hydrosalpinx prior to proceeding with ivf treatment . To date, such a hysteroscopic endometrial phenotype in the presence of hydrosalpinx has not been described.
High - risk vascular surgery patients, including those with thrombotic disorders, present safety and technical challenges for anesthetic management . Given the poor tolerance of these patients to hemodynamic perturbations, the safest methods should be considered for surgical anesthesia.1 the factor v leiden (fvl) mutation, a single point mutation that confers factor v resistance to protein c degradation, is the most common genetic cause of thrombophilia.2 in this case report, we discuss the successful use of infraclavicular brachial plexus, thoracic paravertebral, and unilateral subarachnoid blocks for a patient with fvl mutation and left axillary artery occlusion . A 58-year - old, 76 kg, 162 cm tall, american society of anesthesiologists (asa) physical status ii woman was scheduled for axillo - brachial bypass to treat left axillary artery occlusion (subclavian steal syndrome). The surgeon planned to harvest the patient s left distal saphenous vein for axillo - brachial bypass . The patient had a history of hypertension, chronic obstructive pulmonary disease (copd) (fev1/fvc [forced expiratory volume in 1 second / forced vital capacity] ratio: 50% by spirometry) and fvl mutation . Her medications included valsartan 160 mg plus hydrochlorothiazide 25 mg daily, aspirin 300 mg daily, formoterol 12 g plus budesonide 400 g inhaled twice daily, tiotropium bromide 18 g inhaled daily, and theophylline 200 mg twice daily . Pre - operative platelet count, bleeding time, prothrombin time, activated partial thromboplastin time (aptt), and international normalized ratio (inr) were normal . Low molecular weight heparin (lmwh) 40 mg was administered subcutaneously 12 hours before the procedure, and her daily copd medications (formoterol / budesonide inhaler, tiotropium inhaler, and theophylline) were given on the morning of the procedure . After applying electrocardiography, noninvasive arterial blood pressure, and pulse oximetry monitors, the patient was placed in the sitting position and oxygen was applied via face mask at a rate of 2 l per minute . She was given midazolam 1 mg and fentanyl 25 g for sedation, and 500 ml of crystalloid solution intravenously . The thoracic paravertebral block (tpvb) was performed according to the method of eason and wyatt.3 palpation was used to localize the seventh cervical vertebra (c7) and first thoracic vertebra (t1) at the tip of the scapula . Spinous processes of t1 through t5 were outlined, and a point was marked 2.5 cm left lateral to each of the spinous processes (figure 1). Skin and subcutaneous tissue were anesthetized along the vertical line with 4 ml lidocaine 1% . A 22-gauge spinal needle was inserted 2.5 cm lateral to the spinous process of t1, in the direction of t1 . The transverse process was found with the tip of the needle, and then the needle was withdrawn to the skin and redirected caudally to slide under the transverse process . The needle was advanced to the paravertebral space, as identified by loss of resistance to air . After the paravertebral space was identified and aspiration did not produce blood, air, or cerebrospinal fluid, 5 ml of levobupivacaine was injected, and the needle was removed . The patient was placed supine and observed for signs of intravascular or epidural injection and respiratory difficulty . Sensation was assessed by using ice - cold and pin - prick tests, repeated at 5-minute intervals . We used comlekci et al s technique for infraclavicular block, in which the highest point of the shoulder is taken as a reference point.4 the infraclavicular region was prepared with povidone - iodine . Using a 22-gauge, 100 mm insulated needle and a nerve stimulator (stimuplexb, braun ag, melsungen, germany), we assessed hand responses for n. medianus and n. musculocutaneous at 0.4 ma . A total of 200 mg lidocaine 2% (10 ml) and 150 mg levobupivacain 0.5% (30 ml) was injected slowly with aspirations after every 5 ml (figure 2). Repeated sensory blockade assessments were performed at frequent intervals . Ten minutes after completing the tpvb, unilateral spinal block was performed in the leftdown lateral decubitis position . A 25-gauge quincke needle was used to introduce 5 mg of hyperbaric bupivacaine 0.5% for induction at the l3l4 interspace . The left distal saphenous vein was prepared in 15 minutes and the area closed primarily . The patient recovered from brachial and thoracic paravertebral block in 4 hours and spinal block in 2 hours . The pain - free period after the procedure was 7 hours at the axillary artery site and 4 hours at the saphenous vein harvest site . Oral medications were started on the second postoperative day, and the patient was discharged on postoperative day 7 without complications . Inherited resistance to activated protein c through fvl mutation leads to a thrombophilic state.5 fvl mutation is the most common inherited risk factor for venous thromboembolism, with heterozygous carriers having a 410-fold increased risk of deep vein thrombosis (dvt) and homozygous patients having up to a 100-fold increase in dvt risk.6 while planning the patient s anesthesia management, we searched for methods associated with quick recovery, less postoperative pain, less postoperative nausea and vomiting, reduced postoperative analgesic requirements, reduced association with thromboembolic events, and shorter hospital stays . Because of the patient s advanced obstructive lung disease, we chose regional anesthesia . This approach was also chosen in this patient with an fvl mutation because regional anesthesia is associated with a lower risk of thrombosis compared to general anesthesia.7 although we chose an infraclavicular block for arm anesthesia, we performed sensorial blockade of the axillary region using a tpvb at the t1, t2, and t3 levels.8 tpvb can be performed with the patient sitting, lying on the side, or prone . We chose the sitting position because it provides easy identification of landmarks.9 we believed that unilateral low - dose spinal anesthesia would be sufficient for saphenous vein harvest . Hyperbaric bupivacaine at 4 mg and 6 mg doses have been compared and found to be equivalent for unilateral, segmental spinal anesthesia for outpatient knee arthroscopy . The 4 mg dose appears superior to the 6 mg dose because it produces faster spinal anesthesia induction and the patient achieves discharge criteria significantly earlier.10 we used 5 mg of hyperbaric bupivacaine, which proved adequate during saphenous vein harvest . For most patients, lmwh thromboprophylaxis should be discontinued 1012 hours prior to surgery and coagulation status (aptt) should be assessed prior to neuraxial blockade.11 although our patient was prone to thrombosis because of her fvl mutation, we discontinued lmwh, as per general recommendations, 12 hours prior to the procedure . Performing a combination of regional techniques on one patient is time consuming, may create intraoperative patient discomfort, and may be associated with higher failure rates . These factors may also contribute to an increased risk of technique - specific complications and local anesthetic toxicity.12 however, these regional techniques may be suitable alternatives for patients with thrombophilias, because they may be performed with minimal postoperative pain and early recovery without thromboembolic complications.
The online version of this article (doi:10.1007/s00894 - 015 - 2643-z) contains supplementary material, which is available to authorized users . Leflunomide 1 (scheme 1) is a disease - modifying antirheumatic drug (dmard) with antiinflammatory and immunosuppressive activity used for the treatment of psoriatic and rheumatoid arthritis since 1998 (usa) and 1999 (eu) [13]. Leflunomide undergoes rapid metabolization to teriflunomide 2 (scheme 1), a metabolite that is responsible for the biological activity of leflunomide . Teriflunomide 2 is a noncompetitive inhibitor of dihydroorotate dehydrogenase (dhodh), an enzyme involved in the conversion of dihydroorotate (dho) to orotate by utilizing a flavin mononucleotide (fmn) cofactor in the redox reaction present in the pyrimidine de novo biosynthesis pathway . Moreover, teriflunomide 2 suppresses t - cell proliferation by blocking the synthesis of immunosuppressive cytokines . Teriflunomide itself is used in the management of relapsing multiple sclerosis as an oral drug [5, 6]. Due to its interaction with the immune system, leflunomide 1 has also been investigated for anticancer activity . It was shown that leflunomide might be a potential new candidate for targeted therapy in multiple myeloma and, more recently, in neuroblastoma . The pharmacological profile of leflunomide 1 seems to be an inspirational factor that stimulates many scientific groups around the world for searching of new synthetic methods of this drug as well as its analogues [913].scheme 1mechanism of leflunomide 1 metabolization mechanism of leflunomide 1 metabolization albeit the detailed mechanism of leflunomide 1 metabolization is not known, the experimental studies indicated that the presence of unsubstituted c-3 position in the isoxazole ring is crucial for the ring opening . Most probably the ring cleavage occurs through a two - electron reduction to an imine intermediate . The latter compound can exist in two geometric forms, i.e., z and e isomers, that can equilibriate through a keto form (scheme 1). The z isomer is energetically favored due to the presence of an internal hydrogen bond between the keto and hydroxyl group . The existence of this bond is also helpful in the penetration of teriflunomide through cell membranes but it is believed that such bond interferes with the interaction of teriflunomide with the target enzyme dhodh . The interaction of teriflunomide 2 with dhodh has been a subject of several investigations, both from the experimental and theoretical point of view . Human dhodh complex and found that teriflunomide 2 interacts with amino acids tyr356 and arg136 in the enzyme domain . The carbonyl oxygen is hydrogen bonded through a water molecule to arg136, whereas the enolic hydroxyl is directly linked to tyr356 . In a more recent mostly docking studies, [15, 16] concluded that in the 2hsdhodh complex, three hydrogen bonds could be observed . Apart from the above direct bonding to tyr365, there are two water - mediated hydrogen contacts to arg265 and gln47 . From a comprehensive theoretical analysis of compounds 1 and 2 as well as several teriflunomide analogues, panek et al . Inferred that the primary acceptors of the external interactions are the amide and nitrile groups . The interactions between drug molecules and their environment can be investigated with a variety of analytical methods including nmr, ir, raman, mass, and scanning tunneling spectroscopy (sts). Computational chemistry is an invaluable complement to nuclear magnetic resonance spectroscopy as it allows for rapid visualization of the solvation phenomena . We successfully applied the methodology that involve computations and nmr for the estimation of interaction sites of an indazole magnesium complex . Moreover, the h nmr technique, compared to other methods, is fast and cheap, and enables to follow changes in chemical shifts with no need for a time - consuming alternative approach . Herein it must be added that the use of n or o nmr techniques would result in serious errors and could not be such informative as there are only two nitrogen and oxygen atoms in the structure of 1 and 2 . Moreover, very low natural abundance and a relatively large quadrupole moment renders o nmr method difficult for routine nmr measurements . This substantiates once more the assumption that the use of proton nmr spectroscopy is the most appropriate for the studies described in the present paper . However, the investigations and understanding of the relationship between molecular structure and nmr parameters can sometimes be quite difficult, and therefore are often supported by theoretical calculations [17, 18]. Applications of in silico techniques are very wide, e.g., the dft calculations at the b3lyp/6 - 31 g level of theory were recently used to study leflunomide adsorption to nanotubes . The approach that involves computations and h nmr spectroscopy for the estimation of interaction sites of analyte able to affect the environment seems to be a right choice . On this account we decided to extend the goal of our study to investigate the nmr spectrum of the pro - drug 1, especially the influence of solvent molecules on amide moiety within cell . Then, we focused our attention on the interactions of active metabolite, teriflunomide 2, with selected amino acids in the enzymatic binding site of dhodh . To validate conclusions, we carried out an oniom analysis to confirm the results of the dft investigation, especially that, to the authors knowledge, there have been no prior studies of teriflunomide and dhodh using the oniom technique . Continuing our investigations on the interactions of biologically important azahetarenes with environment, we focused on leflunomide and its active metabolite, teriflunomide . The present study deals, inter alia, with simulation of the h nmr spectrum of 1 . Particular attention was given to the amide bond and isoxazole ring in the first solvation sphere . Furthermore, we estimated the interaction energy of teriflunomide 2 with tyrosine and, through a water molecule, with arginine, both in the enzymatic binding site . To achieve the above aims the conformers were obtained by rotating the bonds c9-n1, n1-c2, and c2-c11 (leflunomide 1) or c12-n2, n2-c5, and c5-c3 (teriflunomide 2) in dihedral angle increments of 20. the conformers were further optimized in a solvation model conductor - like polarizable continuum model (cpcm) with water as a solvent at the a) dft / b3lyp/6 - 31g(d, p) and b) dft / b3lyp/6 - 311+g(d, p) level of theory [2325]. Herein we have to add that the structural analysis of compounds 1 and 2 was carried out previously, but the authors examined only geometric arrangements of these compounds and their electronic properties . In this study our attention was focused only on the h nmr spectra of leflunomide 1 and the interactions of teriflunomide 2 as a ligand with selected amino acids in the enzymatic binding site . The theoretical h nmr spectrum was generated for all rotamers using the gauge - including atomic orbital (giao) method, implemented in gaussian g09 d.01 . To show the results more clearly, only four rotamers of the lowest energy were considered, optimized at the b3lyp/6 - 31g(d, p) (conformers i iv, tables s1, supplementary material) and b3lyp/6 - 311+g(d, p) (conformers v viii, table s2, respectively, supplementary material) level of theory (cpcm solvation model and water as solvent). The calculated values (table s1 and s2) show a strong correlation with the nmr experimental data for compound 1 . Only the amide proton has a high relative error of the chemical shift, equal to 29% at the b3lyp/6 - 31g(d, p)/cpcm level of theory and to 28% at the b3lyp/6 - 311+g(d, p)/cpcm level of theory . These errors may be due to the steric effects connected with the proximity of rotating methylisoxazole and phenyl groups, proton mobility and its ability to interact with the solvent . The use of more complex basis sets or diffuse functions during optimization does not increase the correlation between the calculated and experimental values of chemical shifts . Taking into consideration the accuracy of calculations as well as time and cost required to complete them, the use of dft / b3lyp/6 - 31g(d, p)/giao in the nmr analysis of rotamers of 1 seems to be a reasonable and justified choice . It is worth mentioning that more time - consuming basis (b3lyp/6 - 311++g(3df,2pd)/cpcm) applied for this type of calculations did not result in a significant improvement of accuracy (table s4, supplementary material). The influence of solvent on the relative error of the chemical shift of the amide proton is supported by a simulation of the nhh2o interactions (conformer ix, fig . 1, table s3 in the supplementary material; cpcm solvation model and water as solvent). In this case the presence of water molecules causes a change of the n - h bond length before and after optimization at the b3lyp/6 - 31g(d, p)/cpcm level of theory by approximately 0.01 . It results in a considerable decrease of the chemical shift relative error of the amide proton to approximately 5% and in the formation of an n - ho strong hydrogen contact (rn - h = 1.025, dh - o = 1.891, = 170.4). It is noteworthy that leflunomide 1h2o adduct has a relatively high interaction energy, equal to -10.30 kcal mol (including basis set superposition error, bsse) [27, 28].fig . 1interaction of 1 with water molecules and formation of nhh2o hydrogen bond (conformer ix) interaction of 1 with water molecules and formation of nhh2o hydrogen bond (conformer ix) the mobility of the amide proton of leflunomide 1 could also be caused by keto - enol tautomerism and the formation of a n = c - oh bond . To check whether this is the case, the energy of the enol form of 1 was estimated and optimized at the b3lyp/6 - 31g(d, p) level of theory (cpcm solvation model and water as solvent) for two isomers with the hydroxyl hydrogen anti or syn to the c = n bond (fig . The energy difference between the enol forms (a) and (b) of 1 is approximately 3.28 kcal mol . The more stable conformer is the one with the anti hydroxyl proton (fig . Undoubtedly, this energy difference is partly due to a forced rotation of the phenyl ring of the second enol form (fig . The energy difference between the amide form of 1 and its stable tautomer (fig . The influence of the trifluoromethyl group attached at the phenyl ring of 1 on tautomerism is negligible . This is because the energy difference between the enol form analogues lacking the cf3 group is approximately 3.74 kcal mol . On the other hand, the difference between the enol and amide analogues of 1 without the cf3 group is approximately 18.8 kcal mol . These results indicate that the secondary amide bond of leflunomide 1 is by far a more stable one, despite its susceptibility to a polar solvent that can impact its subtle electron structure.fig . 2tautomers of 1 with different positions (a and b) of hydroxyl groups tautomers of 1 with different positions (a and b) of hydroxyl groups after investigating the properties of protons of leflunomide 1, we examined their influence on the binding between teriflunomide 2 and amino acids in the dhodh cavity as hydrogen atoms are commonly involved in intramolecular interactions . Docking studies showed that teriflunomide 2 interacts with tyrosine tyr356 and, through a water molecule, with arginine arg136 in the binding site of dhodh [16, 29]. Tyrosine adduct at the b3lyp/6 - 31g(d, p)/cpcm (water as solvent) level of theory, we found that both molecules can interact through several hydrogen contacts . As we have mentioned in the introductory section, previous studies on the structure of teriflunomide 2 suggested that compound 2 and some of its analogues existed mainly in a z configuration stabilized by a strong intramolecular hydrogen bond (scheme 1) [3032]. Other reports, both experimental and theoretical, pointed out that the active form of teriflunomide was the z configuration lacking the internal hydrogen contact [14, 17]. However, there are no reports that deal with the possibility of the e isomer formation and its interaction with dhodh . As we have indicated above, the exact physiological mechanism of the isoxazole ring opening in leflunomide is not known in detail and it is possible that this ring cleavage may provide both z and e isomers . Besides, these isomers can be in equilibrium via the keto form (scheme 1). Thus, we investigated these interactions by optimization of adducts between teriflunomide 2 and tyrosine, and both e and z configurations were taken into consideration even though e and z isomers have almost identical internal energy (-641,439.70 kcal mol). In the first adduct, s1 in the supplementary material; optimization using cpcm solvation model and water as solvent). These contacts involve the nitrile and hydroxyl groups of teriflunomide 2, and hydroxyl group of tyrosine; the latter group acts as a donor and acceptor . The interaction between the tyrosine hydroxyl group and the amide proton of 2 (adduct xi, fig . S2 in the supplementary material; optimization using cpcm solvation model and water as solvent) results in the formation of a n - ho type of hydrogen contact (r = 1.018, d = 2.038, = 173.2). S3, supplementary material; optimization using cpcm solvation model and water as solvent) between tyrosine and teriflunomide 2, a hydrogen bond is formed between the teriflunomide carbonyl oxygen and tyrosine phenolic hydroxyl . The interaction energy is a little higher (5.84 kcal mol) than that for the previous adduct . The above results show that the highest interaction energy involves the hydroxyl groups of teriflunomide 2 and tyrosine (x). This is probably due to the relatively largest partial positive charge on the hydrogen atom of the teriflunomide hydroxyl group that lies in the proximity of the electron withdrawing nitrile and amide functionalities . The interaction between the nitrile group and tyrosine hydroxyl is of minor importance because this type of hydrogen bonding is usually classified as a weak to medium strong interaction (the sp hybridization of nitrogen atom). Moreover, the calculated angle (ca 135) differs significantly from the typical angle for h - bonded nitriles that is usually close to linearity . Nevertheless, the cnho hydrogen bond can still improve stability of the teriflunomide tyrosine adduct . The assumption concerning the contribution of the cnho hydrogen contact to the overall strength of the adduct is supported by the results obtained for the interaction between tyrosine amino and teriflunomide 2 nitrile groups (adduct xiii, fig . S4 in the supplementary material; optimization using cpcm solvation model and water as solvent). Here, the interaction energy is only 2.41 kcal mol, so it is the lowest value from the interactions discussed above . We also investigated the interactions of the tyrosine hydroxyl group with the hydroxyl and amide functionalities of teriflunomide 2 in a z configuration, as well as on the interaction of the tyrosine amine group with the nitrile function of (z)-teriflunomide (adducts xivxvi, figs . 3 and 4, fig . S7 in the supplementary material, table 1; optimization using cpcm solvation model and water as solvent).fig . 3structure of the (z)-teriflunomide 2tyrosine adduct xiv; interaction between teriflunomide carbonyl group and tyrosine hydroxyl groupfig . 4structure of the (z)-teriflunomide 2tyrosine adduct xv; interaction between teriflunomide amino group and tyrosine hydroxyl grouptable 1comparison of interaction energies for adducts involving (z) and (e)-teriflunomide 2; b3lyp/6 - 31g(d, p) level of theoryteriflunomide 2 e isomer z isomergroup involved in interactionadductinteraction energy [kcal mol]adductinteraction energy conformer 2 with internal h - bond [kcal mol]interaction energy conformer 2 without internal h - bond [kcal mol] oh x 10.94 xiv 4.907.28 nh xi 3.53 xv 7.1419.95 co xii 5.84 xvi 3.557.67 cn xiii 2.41 xvii 2.10 structure of the (z)-teriflunomide 2tyrosine adduct xiv; interaction between teriflunomide carbonyl group and tyrosine hydroxyl group structure of the (z)-teriflunomide 2tyrosine adduct xv; interaction between teriflunomide amino group and tyrosine hydroxyl group comparison of interaction energies for adducts involving (z) and (e)-teriflunomide 2; b3lyp/6 - 31g(d, p) level of theory the optimization of the adduct in which the (z)-teriflunomide interacts with tyrosine hydroxyl results in a contact shift toward the teriflunomide carbonyl group (adduct xiv, fig . 3). The interaction energy between the contacting molecules is 4.90 kcal mol . On the other hand, the rotation of the teriflunomide hydroxyl group by 180, which breaks the intramolecular hydrogen bond, increases the interaction energy to 7.28 kcal mol (table 1). This evidently shows that if the intramolecular hydrogen contact existed it would weaken the intermolecular hydrogen bond between hydroxyl functionalities of teriflunomide and tyrosine . The adduct xv is formed when the tyrosine hydroxyl group interacts with the amide nitrogen of (z)-teriflunomide (the intramolecular hydrogen bond parameters: o - ho = c (r = 1.019, d = 1.537, = 151.6); its energy is equal to 7.14 kcal mol (fig . 4). The interacting molecules are linked through two hydrogen bonds, i.e., a hydrogen hotyrnhteriflunomide contact (r = 2.027, d = 2.304, = 162.4) and a weaker one between the tyrosine hydroxyl group and nitrile electrons (r = 0.976, d = 1.981, = 116.4). The optimization of the adduct led to lengthening of the tyrosine oh bond of 0.008 and an insignificant lengthening of the teriflunomide nh bond (0.002). Reshaping of the teriflunomide hydroxyl configuration resulted in cleavage of the intramolecular oho = c bond and formation of a complex with the interaction energy of 19.95 kcal mol (table 1; optimization using cpcm solvation model and water as solvent). The teriflunomide nh bond is lengthened by 0.006 and linked with the tyrosine carboxyl group . The calculated interaction energy between the tyrosine hydroxyl and (z)-teriflunomide carbonyl is 3.55 kcal mol (adduct xvi, fig . The interacting molecules are connected through a hotyrocteriflunomide hydrogen bond and the calculated change in the oh bond is quite small (0.003). On the other hand, the interaction energy between the same functionalities but with the (e)-teriflunomide contribution (without the internal hydrogen bond) is 7.67 kcal mol (table 1). The tyrosine oh bond is lengthened by a similar value as for the z isomer (0.002). A visible structural difference between the z and e isomers of teriflunomide is the spatial arrangement of the p - trifluoromethylphenyl ring . This ring is coplanar with the amide bond in the isomer z but it is twisted from coplanarity in the isomer e. this deviation might also influence to some extent the strength of the intermolecular hydrogen bonding between teriflunomide and tyrosine . Next, we compared the interactions between the amino group of tyrosine and nitrile of z (adduct xvii, fig . S8 given in the supplementary material) or e teriflunomide (adduct xiii, fig . S4 in the supplementary material; optimization using cpcm solvation model and water as solvent). The interaction energies for both isomers is similar and equals to 2.41 and 2.10 kcal mol . Thus, the presence of the intramolecular c = oho hydrogen bond does not significantly affect the strength of the weakest interaction discussed here . Previous studies showed that teriflunomide 2 also interacts with arginine through a water molecule in the active site of dhodh [3032]. To examine whether this is a significant feature, we optimized the adducts of compound 2 with water, in which a single molecule of water interacted separately with the oh, nh, and co groups of 2 . The respective bsse corrected interaction energy values were 14.24, 5.80, and 4.18 kcal mol (table 2).table 2calculated interaction energy (kcal mol) of (z)- or (e)-teriflunomide (2) with arginine via water molecule conformers xviiixxiii; eh2o interaction energy of 2 with water; e interaction energy of 2water arginine adduct; b3lyp/6 - 31g(d, p) level of theoryteriflunomide 2 e isomer z isomer e isomer z isomercomplex2water2water argininegroup of 2 e h2o [kcal mol] e h2o [kcal mol]conformer e [kcal mol]conformer z [kcal mol] oh 14.2411.50 xviii 23.95 xxi 76.70 nh 5.806.50 xix 11.20 xxii 8.82 co 4.181.89 xx 3.26 xxiii 11.59 calculated interaction energy (kcal mol) of (z)- or (e)-teriflunomide (2) with arginine via water molecule conformers xviiixxiii; eh2o interaction energy of 2 with water; e interaction energy of 2water arginine adduct; b3lyp/6 - 31g(d, p) level of theory moreover, we analyzed the adducts of teriflunomide 2 (e configuration) and arginine with water participation and with particular attention to the amino acid carboxylic group (optimization using cpcm solvation model and water as solvent). The interaction energies of the adducts xviiixx are 23.95, 11.20, and 3.26 kcal mol, respectively (fig . 5, fig . The higher value for the adduct xviii is probably due not only to the three hydrogen bonds, i.e., teriflunomide hydroxylwaterarginine hydroxyl (r = 0.998, d = 1.685, = 175.2) and two teriflunomide conh guanidine contacts (d1 = 1.015, r1 = 2.067, = 149.8, as well as r2 = 1.012, d2 = 2.203, = 141.3), but also to a quasi - ionic interaction between a protonated guanidine fragment of the amino acid and the polarized amide carbonyl . The structure of the adduct is in agreement with the docking studies [16, 29].fig . 5structure of the (e)-teriflunomide 2water arginine adduct xviii; interaction of arginine carboxyl group with teriflunomide hydroxyl group via water molecule structure of the (e)-teriflunomide 2water arginine adduct xviii; interaction of arginine carboxyl group with teriflunomide hydroxyl group via water molecule the adduct teriflunomide 2waterarginine xix (fig . S10 in the supplementary material) is stabilized by two interactions: a. a strong hydrogen bond between the amide nh and arginine carboxylic group with participation of water; b. a weak contact between the nitrile group and carboxylic hydroxyl . S11, supplementary material) with the lowest interaction energy is, in turn, stabilized by hydrogen bonding that involves the carboxylic group (arginine) and amide carbonyl group (2) through a water molecule . The arginine carboxylic group is linked to water through both carbonyl and hydroxyl elements of this functionality . The interaction associated with the carboxylic hydroxyl seems to be a weaker one because of a comparatively longer distance d (1.933). The energy relative to the oh, nh, and co groups of (z)-teriflunomide interacting with water is 11.50, 6.50, and 1.89 kcal mol, respectively (table 2). Similarly to the interaction of (e)-teriflunomide with water, the weakest affinity to water can be observed for the nh group of (z)-teriflunomide . Somewhat different conclusions can be drawn from the analysis of the adducts (z)-teriflunomidewaterarginine xxixxiii (fig . S13 and s14 in the supplementary material, table 2; optimization using cpcm solvation model and water as solvent). The individual interaction energies of arginine with the oh, nh, or co groups of (z)-teriflunomide with the contribution of water are as follows: 76.70, 8.82, or 11.59 kcal mol . On the other hand, the values for the same interactions for teriflunomide with a 180 rotated hydroxyl group are 52.84, 9.81, and 13.01 kcal mol, respectively.fig . 6structure of the (z)-teriflunomide 2 water arginine adduct xxi; interaction of arginine carboxyl group with teriflunomide hydroxyl group via water molecule structure of the (z)-teriflunomide 2 water arginine adduct xxi; interaction of arginine carboxyl group with teriflunomide hydroxyl group via water molecule analogously to (e)-teriflunomide, the (z) configuration of this metabolite generates a similar set of hydrogen bonds (xxi). A hydrogen contact is present between the hydroxyl group of arginine and water (d = 2.024, r = 0.972, = 177.6). The adduct is also stabilized by a bifurcated contact between the guanidine residue and teriflunomide carbonyl (r1 = 1.029, d1 = 1.797, = 162.9 oraz r2 = 1.015, d2 = 2.266, = 141.3). The almost twice lower interaction energy for the adduct (z)-teriflunomidearginine in comparison with the adduct that involves the e isomer is probably due to a lower electron density of the carbonyl oxygen and lower accessibility of the hydroxyl hydrogen, both engaged in the intramolecular hydrogen bond . Analyzing the data depicted in table 2, we can conclude that the contribution of water to the overall interaction energy of the (z)-teriflunomidewaterarginine complex is higher than the analogous contribution to the adduct involving e isomer . Our results clearly indicate that the hydroxyl, nitrile, and amide groups contribute to the interactions of teriflunomide 2 with arginine through water and are in agreement with the previous reports [16, 29]. In order to prove a crucial role of the amide functionality in the stability of teriflunomideamino acid adduct within the receptor cavity we carried out the quantum mechanics / molecular mechanics (qm: mm) calculations using the oniom method implemented in the gaussian software . The human dihydroorotate dehydrogenase (dhodh) in complex with a leflunomide derivative inhibitor 4 taken from the protein data bank base (3gou.pdb) was chosen as the biological target [16, 36]. An initial target for further optimization was prepared by removing the internal ligand from the 3gou.pdb file ((2z)-n-(3-chloro-2'-methoxybiphenyl-4-yl)-2-cyano-3-hydroxybut-2-enamide, an analogue of teriflunomide), but keeping the internal coordinates unchanged . Then the internal ligands were replaced by the optimized structure of 2 and additionally the residues were saturated with hydrogen atoms . In this manner we prepared two input models . For the low layer we chose the uff force field (mm calculations), and for the high layer the semi - empiric pm6 method (qm calculations). The main difference between these oniom models is that in the first one all atoms are optimized, whereas in the second one only the linking atoms as well as the qm layer undergo optimization . The qm layer consisted of the ligand and all residues containing atoms connected with the ligand (closer than 4). In the supplementary material the results of our calculations are depicted in fig . 7 and table 3 . The results of our calculations prove the importance of the amide bond for the stability of the 2amino acid adduct within dhodh cavity and are in good agreement with the experimental data involving the original receptor . This suggests that the binding mode of 2 and an analogue of teriflunomide (3gou protein with internal ligand) are similar . Furthermore, it seems that the e isomer of teriflunomide might provide a stronger teriflunomideamino acid type of interaction.fig . 7structure of the teriflunomide 2dhodh complex (enhanced) optimized using oniom method; blue optimized model, orange original structure of dhodh complex (3gou.pdb file)table 3calculated distances () between optimized teriflunomide (2) and corresponding amino acid within dhodh cavity; 3gou original receptor dhodh taken from the pdb data base (non optimized), fmn flavin mononucleotide (cofactor), model 1 first calculated (oniom pm6:uff) model (rms = 1.763), model 2 second calculated (oniom pm6:uff) model (rms = 0.187), tyr tyr356 2.7102.5462.570 cn h - n (arg136) 3.4993.1063.076 ch 3 ch 3(fmn) 4.0373.4204.112 ch 3 ch 3(val134) 4.0063.6154.037 cn o pro52 4.1004.8534.128 ch phenyl ch 3(leu46) 3.8473.4013.589 f 3 c c ring(pro364) 4.0584.7164.476 c = o amide (h 2 n)2 c arg136 4.3082.8622.823 structure of the teriflunomide 2dhodh complex (enhanced) optimized using oniom method; blue optimized model, orange original structure of dhodh complex (3gou.pdb file) calculated distances () between optimized teriflunomide (2) and corresponding amino acid within dhodh cavity; 3gou original receptor dhodh taken from the pdb data base (non optimized), fmn flavin mononucleotide (cofactor), model 1 first calculated (oniom pm6:uff) model (rms = 1.763), model 2 second calculated (oniom pm6:uff) model (rms = 0.187), tyr tyrosine, arg the nmr estimation proved that the amide bond of leflunomide might be involved in the hydrogen bond forming . Our investigations have shown that the use of more complex basis sets or diffuse functions during optimization does not increase the correlation between the calculated and experimental values of chemical shifts . Taking into consideration the accuracy of calculations as well as time and cost required to complete them, the use of giao method in the nmr analysis of rotamers of leflunomide seems to be the appropriate choice . The results of theoretical studies have also shown that the interactions of teriflunomide with tyrosine and arginine involve principally the amide fragment of teriflunomide . Our calculations confirm that the presence of the internal hydrogen bond between (z)-teriflunomide carbonyl oxygen and enolic hydroxyl decreases the interaction strength between teriflunomide and tyrosine or arginine . Moreover, even the e isomer of teriflunomide, if ever formed under physiological conditions, would usually provide a stronger interaction teriflunomideamino acid than the z isomer with the internal hydrogen bond . Density functional calculations were executed and the geometries of compounds were optimized at the dft level of theory using the gaussian 09 d.01 program, b3lyp functional, 6 - 31g(d, p) and 6 - 311+g(d, p) basis set, and conductor - like polarizable continuum model (cpcm, water as a solvent) [2325]. The vibrational frequencies and thermodynamic properties were calculated by applying the ideal gas, rigid rotor, and harmonic oscillator approximations, energy minimum was confirmed by the frequency calculation for all conformers, no negative frequencies were detected in generated vibrational spectrum of analyzed conformers . The conformers were obtained by rotating the bonds c9-n1, n1-c2, and c2-c11 (leflunomide 1) or c12-n2, n2-c5, and c5-c3 (teriflunomide 2) in dihedral angle increments of 20, a total of 52 conformers were obtained . Nmr shielding for proton (h) was calculated for tms at b3lyp/6 - 31g(d, p) level of theory (cpcm solvation model and water as solvent). The compound of interest (1) and reference compound (tms) were calculated using the same method, and the reference compound was used to obtain the chemical shifts of 1 according to the following equation: i = ref i, where i was chemical shift of i - nuclei of 1, ref and i were the calculated isotropic magnetic shielding tensor for the tms and 1, respectively [18, 40]. The calculated chemical shifts for the homotopic protons of methyl groups a or b (scheme 1) were averaged . Interaction energy was calculated using counterpoise method based on the basis set superposition error (bsse) at b3lyp/6 - 31g(d, p) level of theory [27, 28]. All oniom (pm6:uff) calculations were carried out as implemented in the gaussian 09 d.01 program . The human dihydroorotate dehydrogenase in complex with a leflunomide derivative inhibitor 4, acquired from the protein data bank base (3gou.pdb), was selected as the biological target [16, 36]. An initial target for further optimization was prepared by removing the internal ligand from the 3gou.pdb file (an analogue of teriflunomide), but keeping the internal coordinates unchanged . Then the internal ligands were replaced by the optimized structure of 2 and additionally the residues were saturated with hydrogen atoms . The calculations were carried out using resources provided by poznan supercomputing and networking center (reef cluster), as well as wrocaw center for networking and supercomputing (supernova cluster).
We compared the lumbar repositioning error (re) according to different lumbar angles in a flexion pattern (fp) subgroup of patients with non - specific chronic low back pain (nsclbp). Approximately 85% of this population was classified as having nsclbp, with no radiological change between the 12th rib and the inferior gluteal fold1 . The management approach has been the use of subgroups classified on the basis of pain - provoking postures and movements in nsclbp2 . Repositioning error (re) is defined as proprioceptive impairment, known to result in poor spinal stability3 . Impaired proprioception in positions such as sitting and standing can be related to lbp . In particular, it is associated with flexion direction in the subgroup with pain provoked by lumbar flexion4 . However, few studies have examined re in subjects with flexion - related lbp during the performance of different lumbar flexion angles, as in extension on sitting and standing upright postures . Thus, the purpose of this study was to compare changes in lumbar re at different angles while standing and re - standing and sitting and re - sitting in a subgroup of fp subjects with nsclbp . S system5, 6 and was defined as subjects with pain provoked by postures and movement - related flexion of the lumbar spine . In the fp subgroup, symptoms were relieved by movement associated with extension, lordosis of lumbar segments, and the loss of a neutral spine posture due to a flexed spine5, 6 . The subjects were aged 44.78.2 years (mean sd) with a height of 165.45.1 cm, a body weight of 62.37.2 kg, a korean oswestry disability index (odi) of 30.04.0%, and a visual analog scale (vas) score of 5.51.2 . Ethical approval was obtained from the inje university faculty of health science human ethics committee . We used a dual inclinometer (acumar, lafayette instrument co., lafayette, usa) to measure the lumbar re at the main and companion parts (l1 and sacrum). Intra - test reliability of the dual inclinometer was 0.90, and the inter - test reliability was 0.85 . The subjects were required to stand upright for 5 s and to hold lumbar flexion angles of 30 and 15 and a lumbar extension angle of 15 for 5 s, followed by return to the starting position . The re of the lumbar spine was defined as the difference in the mean sagittal angles between neutral sitting and re - sitting phases and between the standing and re - standing phases of the task . The spss software (ver . 12.0; spss, chicago, il, usa) was used for all analyses, and the level of statistical significance was set at 0.05 . One - way repeated - measures analysis of variance and the least significant difference (lsd) test as a post hoc pair - wise comparison were used to determine significant re differences among the six tasks . The lumbar re increased significantly with flexion at 30 during sitting . Upon sitting upright, the lumbar re between sitting and re - sitting was significantly greater with a flexion of 30 (5.13.7) than 15 (2.03.7) or with an extension of 15 (1.51.9) (p <0.05). In addition, re while sitting with a flexion of 30 was significantly greater than that between the standing and re - standing positions during flexions of 30 (1.91.5) and 15 (0.70.6) and an extension of 15 (0.80.6) (p <0.05). Upon standing upright, the lumbar re between the standing and re - standing positions during a flexion of 30 was significantly greater than during a flexion of 15 or extension of 15 (p <0.05). In our study, lumbar spine re increased in a specific direction while in the sitting position in the fp subgroup . In accordance with previous research5, 6, the fp subgroup in this study had a deficit in flexed - toward status while sitting, but this was not apparent while standing . However, while the previous study used lumbar full flexion in the standing position, our study used a flexion angle of 30. the neutral re from 30 of flexion was greater than those from 15 of flexion or 15 of extension while standing, and less than that from 30 of flexion while sitting . The standing position would have added proprioceptive input from other distant receptors, while the adoption of a seated position would minimize other proprioceptive inputs by immobilizing the lower legs and the pelvis7, 8 . Furthermore, this may be due to characteristics of the fp group, where pain is provoked during sitting, whereas the pain tended to be relieved upon standing2 . The results of this study revealed the highest displacement changes between sitting and re - sitting on flexion of 30 of the lumbar spine from the upright sitting posture . When spinal structures, such as passive ligaments or active muscles are stretched or flexed during sitting, reflexive muscle activity may be reduced, passive structures may be lengthened, and their tension may be reduced due to unsuitable stretching stimulation from the central nervous system9 . Dolan and green10 reported significantly increased lumbar re following 5 min in a slouched posture, but not following a 3-s duration . Our study showed increased re immediately while sitting at a flexion angle of 30. we suggest that a higher lumbar flexion angle may have a negative impact on lumbar positioning sense while in the sitting posture than in the standing posture in fp subjects with nslbp . We also suggest that the measurement method for lumbar res would be more effective while sitting using a flexion angle of 30 in fp subjects.
Energy drinks (ed) have increased in popularity among adolescents and young adults, because of the possible ergogenic effects [14] and the improvement of cognitive performance due to some ingredients found in these beverages [5, 6], in particular caffeine, taurine, glucuronolactone, and glucose . So far, little evidence exists regarding acute effects of the ed on cardiac function . The most important cardiovascular effects of caffeine in acute settings are the increase of blood pressure and circulating concentration of norepinephrine, the increase of arterial stiffness, and the impairment of endothelium - dependent vasodilation . Taurine (aminoethane sulfonic acid) is a ubiquitous compound found in very high concentrations in heart and muscle . It has been demonstrated that it has a role in the control mechanism of myocardial contractility and studies in animal models have shown that the lack of taurine induces the onset of dilated cardiomyopathy; the beneficial effect of taurine on heart failure was also reported . Moreover, it has been demonstrated that the use of both taurine and caffeine is able to determine a reduction of the effects of caffeine, especially concerning heart rate modifications . Regarding the cardiac effects, an echocardiographic study, concerning the influence of a drink containing taurine and caffeine, performed on healthy subjects, has demonstrated an improvement of left ventricular contractility about forty minutes after taking it . The aim of this study was to investigate whether taking a taurine and caffeine containing energy drink determines acute changes in myocardial function assessed by conventional echo - doppler analysis and by speckle tracking echocardiography (ste), a new technique for assessing myocardial function . The study group included 35 healthy young volunteers (mean age 25 2 years, 16 men). All subjects had unremarkable history and normal findings at physical examination, electrocardiogram, and echocardiography . Eight subjects were usual consumers of energy drinks (no more than a can a week). All participants were asked to abstain from smoking, coffee, and other food or beverages containing caffeine for at least 12 hours before the examinations . Baseline clinical, blood pressure, ecg, and echocardiographic measurements were made after 5 minutes of supine rest in a quiet and comfortable environment . After baseline examination, all subjects drank 168 ml / m (bsa, gehan & george) of an energy drink containing caffeine (0.03%), taurine (0.4%), glucuronolactone (0.24%), glucose, and other ingredients, in maximum 5 minutes, and they underwent again echocardiography, electrocardiography, and blood pressure measurements 1 hour after drinking . Each participant was also studied in a control experiment by an equal volume of fruit juice one day after energy drink consumption . The analysis of files recorded was performed offline by a single, experienced, and independent echocardiographer, who did not know if the images refer to those obtained at baseline, after energy drink, or fruit juice consumption, using a commercially available, semiautomated, 2-dimensional strain software (echopac, ge, milwaukee, wi, usa). The study protocol was in accordance with the helsinki declaration and the ethical standards of our institution, and all participants gave informed consent for participation in the study . Echocardiographic studies were performed using a high - quality ultrasound machine (vivid 7; ge, milwaukee, wi) with the subjects in the left lateral recumbent position . All measurements were made in accordance with current recommendations of american society of echocardiography (ase). Left ventricle (lv) systolic function was analyzed by calculating left ventricle ejection fraction (lvef), measured using simpson's method, and by obtaining left ventricle longitudinal function parameters, as mitral annular systolic plane systolic excursion (mapse) with m - mode and mean peak systolic annular velocity with pulsed tissue - doppler (mitral s) by averaging values measured at septal and lateral mitral annulus . Left ventricle diastolic function was assessed by the ratio between peak early (e) and late diastolic (a) lv filling velocities with trans - mitral pulsed doppler and by mean e and a mitral velocity with pulsed tissue doppler . Right ventricle (rv) systolic function was assessed by calculating tricuspid annular plane systolic excursion (tapse) and mean peak systolic annular velocity by pulsed tissue doppler on tricuspid annulus (tricuspid s). The speckle - tracking analysis was performed in accordance with the indications of the ase / eae consensus document of mor - avi et al . . Apical 4-chamber, 2-chamber, apical long - axis view, basal, and apical short axis view images were obtained using conventional 2-dimensional grayscale echocardiography, during breath hold and with a stable ecg trace . Three consecutive heart cycles were recorded and averaged . The frame rate was set between 60 and 80 frames per second . From apical views, we calculated left ventricular longitudinal strain (gls), free wall and global right ventricular longitudinal strain (rvls), left atrial (la), and right atrial (ra) longitudinal strain [18, 19]. For the twisting analysis, after manual demarcation of lv endocardium by a point - and - click approach, at the basal and apical short - axis views, the global basal and apical rotations were estimated as the average angular displacement of 6 myocardial segments during systole . Lv twisting curve was automatically generated as the net difference between mean apical and basal rotation [20, 21]. Changes in the variables observed after ed and fruit juice consumption were compared using the student's t - test for paired data . Analyses were performed using the spss (statistical package for the social sciences, chicago, il) software release 11.5 . Figure 1 shows the mean relative increases of parameters studied at baseline, after energy drink, and in the control challenges . Significant variations occurred on lv myocardial deformation parameters after taking the energy drink (figure 2). Mean relative increases of mapse, gls, and twisting by ste were 11%, 10%, and 22% (figure 1). All these variables had a very significant increase in respect to baseline with a p value of <0.001, 0.004, and <0.0001, respectively (table 2). Lvef showed an enhanced global lv systolic function with an increase of 5% (p = 0.01) from baseline . The parameters of rv deformation underwent significant changes: tapse, global rvls, and free wall rvls had a mean relative increase of 15% (p <0.0001), 8% (p = 0.001), and 5% (p = 0.01), respectively (table 2, figure 3). La and ra deformation assessed by global peak of atrial longitudinal strain (pals) did not undergo significant variations in respect to baseline . Blood pressure and electrocardiographic parameters were showen to be roughly the same between groups, and a mild increase of 6% in diastolic blood pressure after ed consumption was not significant (p = 0.07). There were no significant changes in the parameters measured at baseline and after taking the juice, as shown in table 3 . In addition to standard echo - doppler analysis, speckle tracking echocardiography (ste) was used in our study to assess cardiac deformation in three spatial directions: longitudinal, radial, and circumferential . Ste is a new technique for assessing myocardial function in physiological and pathological settings, and its feasibility and accuracy were tested in comparison with tagged magnetic resonance imaging, the gold standard to study myocardial deformation . It has been proved that ste is able to detect initial ventricular dysfunction in hypertension, diabetes, valvular heart disease, and heart failure, with high sensitivity in analyzing minimal change in myocardial deformation [11, 16]. In our study population of 35 young healthy subjects, taking an ed containing sugar, caffeine (0.03%), and taurine (0.4%) showed a significant change of myocardial function of both lv and rv one hour after drinking it, suggesting a possible positive effect on cardiac inotropism . In fact, the study of lv performance showed an increase of longitudinal function, with an increase of mapse and gls, and a remarkable enhancement of lv twisting (figure 2). These modifications can probably explain the concomitant increase of lv global function represented by lvef . Likewise, the study of rv performance showed an improvement of longitudinal function with a significant increase of tapse, and global and free rvls in respect to baseline (figure 3). Mitral and tricuspid plane excursion underwent a major change in respect to lv and rv longitudinal strain despite the higher sensitivity of the latter, but m - mode analysis only evaluates the displacement of the basal portion of the ventricles, unlike ste analysis that indicates the average of the displacements of all ventricular segments . Such modifications on cardiac mechanics are probably due to the inotropic effect of some substances contained in the ed . In particular, taurine seems to have a similar digital effect by means of the control of myocardial contractility, modulating sarcoplasmic reticular ca2 + release, and stimulating the pumping rate of ca2 + activate atpase pumps, preventing intracellular ca2 + overload . In fact, it has been reported that taurine may reduce left ventricular end - diastolic pressure in patients with heart failure . Furthermore, in japan, taurine has been used clinically and has been claimed to be beneficial to patients that are unresponsive or resistant to digitalis or diuretics . Also, the effect of caffeine could be involved in producing an increase in the myocardial contraction, but previous studies have ruled out a positive inotropic effect of caffeine on myocardial cells [24, 25]. An inotropic effect due to some substances of this ed can also explain the increase of lv twist after taking the drink . In fact, the effect of contractility on torsion has been well demonstrated; positive inotropic interventions, such as dobutamine infusion and paired pacing, greatly increase torsion [2628], especially through augmentation of left ventricular apical endocardial rotation . In normal subjects, lv twist represents a mechanism for generating stored energy during systole, which is released during early diastole to produce ventricular recoil, upward annular motion, and suction, confirming the close relation of systolic function to early diastole . In normal hearts, all of these aspects of ventricular function increase on exercise to aid fast ejection and, more important, enable rapid filling of the ventricle during a shortened diastole period while maintaining a low filling pressure . The lv twisting motion is a consequence of myocardial fiber orientation, which changes from an approximately longitudinal but slightly oblique orientation in the subendocardium to a circumferential orientation in the mid - wall and to an oblique orientation in the subepicardium [32, 33]. Thus, the subendocardial and subepicardial fibers represent two oppositely directed spirals and in normal heart because of larger radii, the torque of subepicardial fibers dominates over subendocardial fibers and accounts for the normal counterclockwise rotation of the lv apex . Previous studies have found that in the setting of lv diastolic dysfunction, torsion is increased in patients with mild diastolic dysfunction but reduced in those with more severe degrees of diastolic dysfunction; these changes may be explained by the fact that in the early stage, the subendocardial longitudinal fibers are primarily affected so that unopposed epicardial torque will increase apical twist, whereas later more widespread fibrosis or damage will affect global function and lead to reduced twist . Moreover, tan et al . Showed that in patients affected by heart failure with preserved ejection fraction, in contrast with normal subjects, these abnormalities of lv function became more apparent on exercise, demonstrating a reduction of myocardial systolic strain, longitudinal function, and finally twisting motion . Since this study was performed on young healthy individuals at rest, future studies need to focus on whether such benefits persist after long term consumption of energy drinks and what the effects are of consuming these drinks during physical activity; it will also be important to determine which of the effects are induced in patients with cardiac disease to further our understanding of the potential benefits or risks of energy drink consumption . We evaluated young healthy subjects, so these results cannot be generalized for other populations . The number of subjects of our sample was limited, although it has allowed us to reach interesting conclusions . Moreover, we have investigated the acute changes on myocardial performance only one hour after energy drink consumption . Based on the pharmacokinetics of certain substances of this drink (such as caffeine and taurine), it should be interesting to evaluate the cardiovascular effect at different times from the consumption of these beverages . Lastly, we have used a pear juice as a control, but the same volume of this beverage does not correspond to the same amount of sugar dissolved in the energy drink.
Endoscopists are already successful at treating obese patients, who are more at risk of gastrointestinal (gi) diseases such as cancer than the general population, and assessing their gi condition before bariatric surgery . They are also increasingly efficient when helping with postoperative complications such as leaks, stenosis, or weight regain after various bariatric procedures . Moreover, it seems today that they may claim a role in primary treatments of obesity, while purely endoscopic methods are available and upgraded on a regular basis . As recently stated by the american society for gastrointestinal endoscopy (asge), endoscopic bariatric therapies offer a viable, safe alternative for patients who have been unsuccessful at weight loss with diet and exercise . They may also be appropriate for patients who are not suitable for, or are unwilling to undergo, a more invasive surgical procedure . If bariatric endoscopy may be viewed as a competitor to bariatric surgery, current trends suggest the development of combined strategies as well as mutual assistance when it comes to procedures that require both endoscopic and surgical skills . Although expanding, the array of bariatric techniques does not meet the current needs of morbidly obese patients (class ii to iii obesity). Resources for spreading this type of surgery are lacking, while more basic and general procedures are not even available throughout the world . Besides, they are often disregarded by a majority of patients because they are deemed excessive . Somehow, futile quarrels and surgical discrepancies are abundant, for example: should we do a hiatal hernia repair in the mean time as a sleeve gastrectomy? Should we only do the regular roux - en - y gastric bypass or can we afford the omega - loop bypass? In the meantime, and paradoxically, bariatric surgery claims to expand its boundaries, for instance taking on class i obesity (international federation for the surgery of obesity and metabolic disorders [ifso] statement, 2014). Several issues have been raised: should minimally invasive procedures take over? When and how should this happen? Typical surgical concepts as well as new ones are valuable assets because they make it possible to establish benchmarks and fruitful combinations . One may cite new concepts like digestive neuro - stimulation (theoretically adaptable endoscopically), new operations (e.g., laparoscopic greater curve plication, a debatable procedure, but with highly relevant endoscopic applications; sleeve gastrectomy associated with ileal transposition). New technical approaches are on the spot as well (e.g., single incision laparoscopic surgery, robotic adjunction). Three - dimensional and/or enhanced imagery last but not least, research is being carried out regarding operations in - between surgery and endoscopy, typically the natural orifice transluminal surgery procedures, e.g., gastro - jejunal anastomosis through stents or magnets . On the other hand, other fields will contribute to any bariatric procedure, such as patient monitoring (smartsensing) results from the rapidly progressing field of internet on things business . Although in its infancy, the possibility to continuously monitor several health parameters could find potential applications in obese patients, before or after any kind of weight - loss procedure . Coaching tools are not to be ignored in a time when the importance of physical activity is stressed more often (e.g., vibrating platforms). So far, no drug has challenged the results of surgery, but some are currently being tested and even drugs that have been discarded have been proven useful in combination with bariatric techniques . Moreover, fundamental research has benefited from surgery and could contribute to weight - loss by itself; for instance, microbiota transplantation or brown tissue manipulation . None of them has yet fulfilled the requirements of a typical bariatric treatment, with sustained weight - loss and regression of comorbidities in the long run . Understandably, they may act as a bridge to more complex surgical procedures and/or attract patients who are not eligible for surgery . Countless procedures have been initiated, but so far very few have met efficacy criteria with published results . (1) intra - gastric balloons: the initial prototypes were not satisfactory, but since the early nineties one may consider that these devices are reliable . They are usually implanted for 6 months . Only the orbera balloon (apollo endosurgery inc ., austin, tx, usa) has been thoroughly reviewed, and was recently analyzed by the asge, with a systematic review and meta - analysis using diagnostic and therapeutic thresholds established in 2012 as a part of its preservation and incorporation of valuable endoscopic innovations initiative . Based on a meta - analysis of 17 studies including 1,638 patients, the% excess weight loss (ewl) at 12 months was 25.44% (95% confident interval [ci], 21.47 to 29.4), with three randomized control trials (rcts; difference in% ewl of 26.9% in favor of balloon over control). While mostly deemed a safe procedure, one must not forget the adverse events that may occur with a balloon (fig . This can be achieved through refilling the balloon, for instance with the spatz balloon (spatz fgia inc ., jericho, ny, usa), or designing a double - balloon volume (duo - shape balloon; reshape, san clemente, ca, usa). Perhaps the most interesting devices will be the ones that can be swallowed without endoscopy and anesthesia (obalon; obalon therapeutics, carlsbad, ca, usa), and even possibly self - excreted (allurion - elipse, unpublished data; allurion technologies, el segunto, ca, usa). (2) gastric partitioning achieved by endoscopic means is a new concept that might be the most promising . Theoretically a fully stapled pouch such as achieved by surgical means can be transposed through endoscopy . This has even been performed with a device that no longer exists (toga; satiety inc, palo alto, ca, usa). For the time being, the most promising technique seems to be gastric plication, with two competing devices: usgi - pose (usgi inc ., san clemente, ca, usa) and apollo - overstitch (apollo endosurgery inc . ). The first one ensures a partial plication with separated transmural stitches and anchors placed along the upper part and the antrum (fig . The second uses several full - thickness stitches in a triangular pattern, cinched together and repeated along the fundus six to eight times (fig . Both have been initially tested as re - do procedures for weight - regain after gastro - jejunal bypass, reducing the size of a gastric pouch, and/or gastro - jejunal anastomosis . While the first entails deep and reliable plications, the second ensures a more global shrinking of the lumen with few gaps, and thus may be compared to a bariatric surgical plication (fig . The most recent and significant experiences with primary cases have been reported by espinos et al . Lopez - nava et al . Reported 50 patients, 13 with a follow - up of more than 1 year . (3) the metabolic field: these techniques aim at mimicking the metabolic effect of the surgical gastric bypass on type 2 diabetes, which relies mostly on duodenal exclusion from food passage . Duodeno - jejunal bypass - sleeve (djbs), also called endo - barrier (fig . 5), has been the most studied of the new devices for the past few years, and has also elicited a comprehensive report from the asge . It consists of a 60 cm jejunal tube that is anchored to the proximal duodenum and retrieved 12 months later . Three studies including 105 patients have shown a% ewl of 35.3% at 12 months, and four rcts showed a difference in% ewl of 9.4% in favor of djbs . (4) other devices can be mentioned but have not yet generated enough data: the endo - aspire consists of an endoscopically - placed gastrostomy tube and siphon assembly . The food is conveniently stored and then flushed . Patients aspirate gastric contents 20 minutes after meal consumption, removing about 30% of ingested calories . Trans - pyloric materials are also being experimented with, as well as various intra - luminal restrictive devices . Typical surgical concepts as well as new ones are valuable assets because they make it possible to establish benchmarks and fruitful combinations . One may cite new concepts like digestive neuro - stimulation (theoretically adaptable endoscopically), new operations (e.g., laparoscopic greater curve plication, a debatable procedure, but with highly relevant endoscopic applications; sleeve gastrectomy associated with ileal transposition). New technical approaches are on the spot as well (e.g., single incision laparoscopic surgery, robotic adjunction). Three - dimensional and/or enhanced imagery last but not least, research is being carried out regarding operations in - between surgery and endoscopy, typically the natural orifice transluminal surgery procedures, e.g., gastro - jejunal anastomosis through stents or magnets . On the other hand, other fields will contribute to any bariatric procedure, such as patient monitoring (smartsensing) results from the rapidly progressing field of internet on things business . Although in its infancy, the possibility to continuously monitor several health parameters could find potential applications in obese patients, before or after any kind of weight - loss procedure . Coaching tools are not to be ignored in a time when the importance of physical activity is stressed more often (e.g., vibrating platforms). So far, no drug has challenged the results of surgery, but some are currently being tested and even drugs that have been discarded have been proven useful in combination with bariatric techniques . Moreover, fundamental research has benefited from surgery and could contribute to weight - loss by itself; for instance, microbiota transplantation or brown tissue manipulation . None of them has yet fulfilled the requirements of a typical bariatric treatment, with sustained weight - loss and regression of comorbidities in the long run . Understandably, they may act as a bridge to more complex surgical procedures and/or attract patients who are not eligible for surgery . Countless procedures have been initiated, but so far very few have met efficacy criteria with published results . (1) intra - gastric balloons: the initial prototypes were not satisfactory, but since the early nineties one may consider that these devices are reliable ., austin, tx, usa) has been thoroughly reviewed, and was recently analyzed by the asge, with a systematic review and meta - analysis using diagnostic and therapeutic thresholds established in 2012 as a part of its preservation and incorporation of valuable endoscopic innovations initiative . Based on a meta - analysis of 17 studies including 1,638 patients, the% excess weight loss (ewl) at 12 months was 25.44% (95% confident interval [ci], 21.47 to 29.4), with three randomized control trials (rcts; difference in% ewl of 26.9% in favor of balloon over control). While mostly deemed a safe procedure, one must not forget the adverse events that may occur with a balloon (fig . This can be achieved through refilling the balloon, for instance with the spatz balloon (spatz fgia inc ., jericho, ny, usa), or designing a double - balloon volume (duo - shape balloon; reshape, san clemente, ca, usa). Perhaps the most interesting devices will be the ones that can be swallowed without endoscopy and anesthesia (obalon; obalon therapeutics, carlsbad, ca, usa), and even possibly self - excreted (allurion - elipse, unpublished data; allurion technologies, el segunto, ca, usa). (2) gastric partitioning achieved by endoscopic means is a new concept that might be the most promising . Theoretically a fully stapled pouch such as achieved by surgical means can be transposed through endoscopy . This has even been performed with a device that no longer exists (toga; satiety inc, palo alto, ca, usa). For the time being, the most promising technique seems to be gastric plication, with two competing devices: usgi - pose (usgi inc ., san clemente, ca, usa) and apollo - overstitch (apollo endosurgery inc . ). The first one ensures a partial plication with separated transmural stitches and anchors placed along the upper part and the antrum (fig . The second uses several full - thickness stitches in a triangular pattern, cinched together and repeated along the fundus six to eight times (fig . Both have been initially tested as re - do procedures for weight - regain after gastro - jejunal bypass, reducing the size of a gastric pouch, and/or gastro - jejunal anastomosis . While the first entails deep and reliable plications, the second ensures a more global shrinking of the lumen with few gaps, and thus may be compared to a bariatric surgical plication (fig . The most recent and significant experiences with primary cases have been reported by espinos et al . Reported 50 patients, 13 with a follow - up of more than 1 year . (3) the metabolic field: these techniques aim at mimicking the metabolic effect of the surgical gastric bypass on type 2 diabetes, which relies mostly on duodenal exclusion from food passage . Duodeno - jejunal bypass - sleeve (djbs), also called endo - barrier (fig . 5), has been the most studied of the new devices for the past few years, and has also elicited a comprehensive report from the asge . It consists of a 60 cm jejunal tube that is anchored to the proximal duodenum and retrieved 12 months later . Three studies including 105 patients have shown a% ewl of 35.3% at 12 months, and four rcts showed a difference in% ewl of 9.4% in favor of djbs . (4) other devices can be mentioned but have not yet generated enough data: the endo - aspire consists of an endoscopically - placed gastrostomy tube and siphon assembly . The food is conveniently stored and then flushed . Patients aspirate gastric contents 20 minutes after meal consumption, removing about 30% of ingested calories . Trans - pyloric materials are also being experimented with, as well as various intra - luminal restrictive devices . Companies and physicians alike have to overcome numerous barriers, which are present throughout the development process . Regarding endoscopic devices, these barriers are particularly important . Many events are in a position to kill an innovative device: if the market has not been clearly identified, or is too small, sales will not meet the expectations; likewise if the device is too complex, or too expensive for its application . Many interesting devices can be stalled if investors do not want to finance inevitable delays or if regulatory bodies request additional trials . The adoption of a new device can take longer than anticipated, and training for experienced physicians might be complicated . Last but not least, any startup can be purchased by a major company in order to eliminate competition . For instance, hormonal studies are already available, which suggest more or less strong metabolic effects that could match those of surgery . Have shown that after 24 weeks of implantation of the endo - barrier, patients had lost 12.71.3 kg (p<0.01), while hemoglobin a1c had improved from 8.4%0.2% to 7.0%0.2% (p<0.01). Both fasting glucose levels and the postprandial glucose response were decreased at 1 week after implantation and remained decreased at 24 weeks . In parallel, the glucagon, glucagon - like peptide 1, and glucose - dependent insulinotropic hormone responses decreased and insulin levels did not change significantly . Mathus - vliegen and de groot have studied the effects of a balloon in 42 patients . In group 1, basal cholecystokinin (cck) levels decreased but meal - stimulated responses remained unchanged after 13 weeks of sham treatment . In group 2, basal and meal - stimulated cck levels decreased after 13 weeks of balloon treatment . At the end of the second 13-week period, when group 1 had their first balloon treatment, they duplicated the initial 13-week results of group 2, whereas group 2 continued their balloon treatment and reduced meal - stimulated cck release . Both groups showed reduced meal - stimulated pancreatic polypeptide (pp) secretions at t1 and t2 compared to t0 . (3) one may consider techniques that are ready but require additional studies, e.g., endo - barrier, endoplication, and endo - aspire . On the other hand, some are not yet available (or not anymore) but they could become a priority provided research is carried out, e.g., endo - rings (teris device; barosense, menlo park, ca, usa), endo - stapling (ace method; boston scientific corporation, natick, ma, us), transpyloric shuttle (baronova, goleta, ca, usa), the satisphere method, and duodenal resurfacing (fractyl, unpublished data; fractyl, waltham, ma, usa). (4) facing the criticism of those in favor of surgery for everyone is not the least important issue! The current and most common position from the bariatric surgical community states that the efficacy, durability, and long - term clinical utility of endoscopic procedures remain to be established . Although essentially true, this statement overlooks the fact that a majority of obese patients eligible for surgery reject these procedures and/or do not have access to them . Companies and physicians alike have to overcome numerous barriers, which are present throughout the development process . Regarding endoscopic devices, these barriers are particularly important . Many events are in a position to kill an innovative device: if the market has not been clearly identified, or is too small, sales will not meet the expectations; likewise if the device is too complex, or too expensive for its application . Many interesting devices can be stalled if investors do not want to finance inevitable delays or if regulatory bodies request additional trials . The adoption of a new device can take longer than anticipated, and training for experienced physicians might be complicated . Last but not least, any startup can be purchased by a major company in order to eliminate competition . For instance, hormonal studies are already available, which suggest more or less strong metabolic effects that could match those of surgery . Have shown that after 24 weeks of implantation of the endo - barrier, patients had lost 12.71.3 kg (p<0.01), while hemoglobin a1c had improved from 8.4%0.2% to 7.0%0.2% (p<0.01). Both fasting glucose levels and the postprandial glucose response were decreased at 1 week after implantation and remained decreased at 24 weeks . In parallel, the glucagon, glucagon - like peptide 1, and glucose - dependent insulinotropic hormone responses decreased and insulin levels did not change significantly . Mathus - vliegen and de groot have studied the effects of a balloon in 42 patients . In group 1, basal cholecystokinin (cck) levels decreased but meal - stimulated responses remained unchanged after 13 weeks of sham treatment . In group 2, basal and meal - stimulated cck levels decreased after 13 weeks of balloon treatment . At the end of the second 13-week period, when group 1 had their first balloon treatment, they duplicated the initial 13-week results of group 2, whereas group 2 continued their balloon treatment and reduced meal - stimulated cck release . Both groups showed reduced meal - stimulated pancreatic polypeptide (pp) secretions at t1 and t2 compared to t0 . (3) one may consider techniques that are ready but require additional studies, e.g., endo - barrier, endoplication, and endo - aspire . On the other hand, some are not yet available (or not anymore) but they could become a priority provided research is carried out, e.g., endo - rings (teris device; barosense, menlo park, ca, usa), endo - stapling (ace method; boston scientific corporation, natick, ma, us), transpyloric shuttle (baronova, goleta, ca, usa), the satisphere method, and duodenal resurfacing (fractyl, unpublished data; fractyl, waltham, ma, usa). (4) facing the criticism of those in favor of surgery for everyone is not the least important issue! The current and most common position from the bariatric surgical community states that the efficacy, durability, and long - term clinical utility of endoscopic procedures remain to be established . Although essentially true, this statement overlooks the fact that a majority of obese patients eligible for surgery reject these procedures and/or do not have access to them . A breakthrough from the basic research field is highly anticipated, and could come from any biological / drug research . The implementation of stepwise strategies, making use of new and old techniques, some endoscopic, some surgical, represents what is actually done for the time being . Conceptual similarities are useful when figuring out such strategies . Likewise, adjacent technologies (e.g., smartsensing for monitoring, or the development of robotic platforms useful for endoscopy and surgery alike) could be proven instrumental . Could be enough in the near future, i.e., the success of a single endoscopic device among those that are currently being tested . This could come from one of the available tools . Among the devices presented above or under development, we feel entitled to select three that are particularly promising: (1) the new balloons, e.g., swallowable ones; (2) the endoscopic plication; and (3) the metabolic asset sleeve endobarrier . (1) the ethical frame should be kept in mind all along . According to the american society for metabolic and bariatric surgery, the implementation of such new devices should be limited to clinical trials and peer - reviewed protocols . (2) for the time being, most of the current techniques that fit into this description have rather short - term effects, which are strongly influenced by external factors in a much more important way than regular bariatric surgeries . Atypical weight - loss trajectories may be observed more often in minimally invasive methods that achieve less important weight - loss . Short - term effects may be described under the term micro - trajectories: 3- to 6-month periods are commonly analyzed in this field versus 1 year - period in typical surgical procedures . The existence of an on - off pattern (the device being active or not for a variable duration) makes it more complex to analyze weight - loss curves . Such an effect can be observed in typical surgical procedures as well (e.g., gastric banding, gastric neuro - stimulation). Paradoxically, weight - loss may be de - connected to the on - off pattern in some cases; for instance, some patients continue losing weight when a balloon has been removed . Can we define the causes of atypical trajectories (possibly control effects, center effects, or behavioral effects)? Caution is in order when evaluating the benefits of a given technique and its safety profile, and when designing the methods for rcts of obesity treatment . Most minimally invasive or endoscopic techniques for obesity treatment are not ready for prime time and require more observational or randomized studies, at least concerning primary procedures . However, they are already being successful as re - do procedures in cases of surgical failure . A time - frame for step - strategies can be defined, allowing better long - term results and a favorable risk / benefit ratio . One must advise caution and warn that re - do after endoscopic techniques might be more difficult than anticipated . Keeping in mind a bariatric schedule and the necessity of experimenting with combinations, we assume that one success among some of the current devices that are being developed and tried could change our expectations, and attract investors.
Guidelines such as the 2011 st gallen international consensus statement, the 2010 european society for medical oncology (esmo), and american society of clinical oncology (asco) guidelines, and the 2011 national comprehensive cancer network (nccn) guidelines include recommendations that, following surgery for early hormone receptor - positive (hr) breast cancer, postmenopausal women receive adjuvant aromatase inhibitor (ai) treatment either as initial therapy or following 23 years of tamoxifen in order to reduce the risk of recurrence.14 the use of ais as initial therapy, after 23 years of tamoxifen or after 5 years of tamoxifen, has been shown to be more effective than 5 years of adjuvant tamoxifen alone, resulting in an improvement in disease - free survival (dfs) and a reduction in breast cancer events.3,5 the asco recommendations take into account the fact that locoregional, distant recurrent, and contralateral breast cancer have clinical consequences for breast cancer patients.3 the course of the disease is characterized by peaks in recurrence at 2 years and at 3.5 to 4 years following surgery for breast cancer; the majority of these recurrences are distant recurrences.6 in the breast international group (big) 198 trial, for example, upfront letrozole demonstrated a significant 19% improvement in dfs (351 events with letrozole vs 428 events with tamoxifen; p = 0.003), and a significant 27% reduction in the risk of distant recurrence early on at 25.8 months of follow - up (184 events with letrozole vs 249 with tamoxifen; p = 0.001).7 the early reduction in the risk of distant metastases with letrozole seemed to have had long - term clinical implications on patient outcomes . At 76 months median follow - up in big 198, there was a significant 12% improvement in dfs (509 events vs 565 events; p = 0.03) and also a nonsignificant 13% improvement in overall survival (p = 0.08) with initial adjuvant letrozole compared with tamoxifen.8 recently published data from the big 198 trial at 8 years follow - up demonstrated a significant advantage in overall survival with letrozole monotherapy over tamoxifen monotherapy.9 although the recommended duration of adjuvant ai therapy currently is 5 years according to the esmo guidelines,2 the nccn guidelines note that the optimal duration of ai therapy is not known,4 and trials are currently investigating durations of up to 10 years.1012 it is important to communicate with patients about how to prevent and manage the adverse events associated with ais, which resemble the symptoms of menopause and include bone density loss, increased fractures, arthralgia, and other musculoskeletal symptoms,3,13 and to reinforce the importance of staying on therapy to derive clinical benefits . Her body mass index (bmi) was 24.5 kg / m (height = 169 cm; weight = 70 kg). She had a history of mild irritable bowel syndrome (ibs) triggered by certain foods and by stress . She had been taking calcium (1000 mg) and vitamin d (400 international units) as directed by her family physician, since the onset of menopause . In 2007, a mass in her right breast was discovered by routine mammography . In 2007, the patient had a right inferior quadrantectomy with sentinel lymph node (sln) biopsy for breast cancer, and a 1-cm tumor and two slns were resected . Pathology revealed that the tumor had tubular histology and was her2 negative, and estrogen and progesterone receptor (er and pgr) positive; both slns were negative for metastases . In july through september 2007, the patient underwent radiation therapy to the right breast . Scintigraphy for bone metastases, x - ray for lung and liver metastases, and ultrasound for liver metastasis were all performed, and each was negative . Her medical oncologist recommended 5 years of adjuvant endocrine therapy with an ai, and in july 2007, the patient initiated treatment with anastrozole 1 mg / day . A postoperative bone mineral density test showed borderline osteopenia (t - scores: lumbar spine 1.5; left femoral 0.9; right femoral 1.3), and the patient continued previous calcium and vitamin d supplementation . The patient was seen in the clinic for follow - up every 3 months for the next 24 months . At the first visit, she had complaints of joint pain and stiffness, particularly in her wrists and knees, but she reported no effect on her normal activities . She did not want to take any medication for the stiffness, and she reported taking anastrozole 1 mg / day regularly . Paracetamol 1000 mg was prescribed on an as - needed basis with a follow - up phone call planned after 2 weeks . At the follow - up phone call, the patient reported no relief with paracetamol, but she did not want to take additional medications . Nonsteroidal anti - inflammatory drugs (nsaids) were suggested, but the patient had experienced problems in the past with this type of medication aggravating her intestinal symptoms . The problem of joint pain associated with ais was reviewed with the patient, and nonpharmacological treatments such as stretching exercises, massage, and warm showers were suggested . The patient was still being seen every 3 months, and an evaluation was planned at 6 months . At her 6-month visit, the patient reported being tired and achy, and she questioned how long ai therapy needed to continue . She reported taking anastrozole 1 mg / day regularly and paracetamol occasionally (1000 mg, 23 times per day), but was not doing any specific exercises, yoga, or physical therapy . The patient was prescribed a topical nsaid: diclofenac gel 1%, applied 23 times per day to affected areas . This led to some reduction in pain, and stiffness subsided, but the patient did not persist in using the topical formula as it was not effective in managing her pain . At her 9-month visit, she tried hot water baths at a nearby thermal spa, but did not persist with this intervention . The patient admitted that she had not been taking anastrozole 1 mg / day regularly for the past month due to adverse event experiences . At this point, the option of a treatment change was discussed; it was decided that she would try a different ai to see if it might be tolerated better, and letrozole 2.5 mg / day was then prescribed . The patient was to begin therapy 2 weeks after the visit, and have a clinic appointment after another 2 weeks . The patient noticed an improvement in her joint symptoms after stopping anastrozole treatment . At the 2-week visit, she reported taking letrozole daily and was not experiencing joint stiffness . She received phone follow - ups at 2-week intervals, and at her clinic visit in july 2008, was no longer suffering from joint pain or stiffness . The patient is now 3 years past her initial breast cancer surgery and has been taking letrozole 2.5 mg / day for more than 2 years . In clinical trials in postmenopausal women with hr breast cancer, both nonsteroidal (anastrozole and letrozole) and steroidal (exemestane) ais have been associated with an increased incidence of arthralgia compared with tamoxifen or placebo . In the anastrozole (arimidex; astrazeneca, wilmington, de), tamoxifen, alone or in combination (atac) trial of 5 years of initial adjuvant anastrozole compared with tamoxifen, the incidence of arthralgia at 68 months follow - up was significantly higher with anastrozole than with tamoxifen (35.6% vs 29.4%; p <0.0001).14 it was noted that adverse events such as arthralgia were only recorded during the 5 years of active treatment and within the first 2 weeks after stopping treatment.15 consequently, at 100 months of follow - up in atac, there was little difference in the incidence of arthralgia compared with previous reports,15 and the incidence of arthralgia was not reported at 120 months of follow - up.16 in the big 198 trial, at 71 months of median follow - up, arthralgia was more common in women taking letrozole - containing regimens (letrozole monotherapy for 5 years, or the sequence of 2 years of letrozole or tamoxifen followed by 3 years of the other agent) than in women receiving tamoxifen monotherapy for 5 years (31.9%34.7% vs 30.1%; p = 0.05).8 in the tamoxifen exemestane adjuvant multinational (team) trial, at 2.75 years median follow - up, the incidence of arthralgia was 17.9% with initial adjuvant exemestane and 9.2% with initial adjuvant tamoxifen (p 0.001);17 at 5.1 years of median follow - up, the incidence of joint disorders was 36% with exemestane and 31% with sequential tamoxifen followed by exemestane (p <0.0001).18 similar results were seen in the intergroup exemestane study (ies) trial, in which patients were randomized after completing 23 years of tamoxifen.19 at 55.7 months of median follow - up, significantly more patients who switched to exemestane reported arthralgia compared with patients who continued on tamoxifen for the rest of the 5-year treatment period (18.6% vs 11.8%; p <0.0001).19 in an analysis at 91 months of median follow - up, including patients both on and post - treatment, the incidence of musculoskeletal pain was significantly higher with exemestane than with tamoxifen (37.6% vs 29.9%; p <0.001).20 in the ma.17 trial of extended adjuvant letrozole compared with placebo in patients who had completed 5 years of tamoxifen treatment, there was significantly more arthralgia at 30 months of median follow - up with letrozole than with placebo (25% vs 21%; p <0.001).21 suboptimal adherence to adjuvant medication regimen in postmenopausal women with hr breast cancer may lead to inappropriate therapeutic efficacy of prescribed medication (tamoxifen or an ai), and may also increase the risk of cancer recurrence and reduce disease survival rates . Recently published reviews indicate that nonadherence with tamoxifen and ai therapy is common, and adherence reported in clinical trials may differ significantly from that observed outside of the clinical trial setting.22,23 studies of patients taking adjuvant endocrine therapy for hr breast cancer have shown nonadherence rates of 20%50% at follow - up times ranging from 14.5 years following the start of endocrine therapy.2427 joint symptoms are frequently cited as reasons for discontinuing treatment.2729 in a retrospective study of 600 postmenopausal, hr, early breast cancer patients receiving adjuvant ai therapy in a clinical practice setting (median follow - up 19.7 months), arthralgia and myalgia led to discontinuation of the ai in 45.5% and 17.8% of the 101 patients who discontinued due to toxicity, respectively.28 in another study, 20% of 56 breast cancer patients receiving ai therapy in a clinical practice setting discontinued due to new or worsening arthralgia or bone pain.29 communicating with patients about ais and presenting management strategies can help patients remain on treatment . 27 the previously mentioned study of 56 patients in a clinical practice setting showed that discontinuation due to arthralgia or bone pain occurred within the first 3 months of treatment, leading the authors to recommend monthly visits during the first 3 months of therapy in order to address any issues and ensure that patients continue taking ais.29 however, monthly visits are generally not an option for patients in europe and north america, and were not an option for the patient in our case . It is also important to communicate with patients about the benefits associated with ais and the risks of not taking their prescribed treatment.27 the use of adjuvant ais has been associated with significant improvements in dfs in postmenopausal women with hr breast cancer (table 1). A study using automated pharmacy records in a large integrated health system showed an increased risk of mortality at 10 years in women with stage i iii hr breast cancer who discontinued or were nonadherent to endocrine therapy; survival was significantly higher in patients who adhered to therapy compared with patients who were nonadherent (81.7% vs 77.8%; p <0.01).24 a study of breast cancer patients in a community setting showed that 1589 (35%) of the 4526 patients receiving endocrine therapy had adherence rates that have been associated with an increased risk of mortality (adherence rates <80%).30 nurses can play a vital role in discussing adverse events with patients at each visit and also discerning whether they are taking their medications as prescribed . It has been suggested that follow - up phone calls between visits may also be helpful in addressing any adverse events that may arise.27 other techniques to improve adherence include the use of aids such as calendars or pillboxes.27 enlisting support from the patient s family and friends is another important component to facilitating patient adherence.27 recommendations for the management of joint symptoms include pharmacological and nonpharmacological interventions, and also switching to a different ai . Breast cancer patients taking ais have used nsaids such as ibuprofen as well as paracetamol for the relief of joint symptoms.29 the patient in our case was prescribed paracetamol, which provided little relief . However, it should be kept in mind that proton - pump inhibitors may be helpful in alleviating any gastrointestinal symptoms associated with nsaids.31 use of a topical nsaid was associated with some relief of the patient s pain, but not stiffness, and she did not continue using it . As an alternative to painkillers, a number of different nutritional supplements are being investigated for the treatment of arthralgia associated with the use of ais . A phase ii clinical study evaluating glucosamine plus chondroitin (estimated enrollment = 53) for the relief of joint pain and stiffness in postmenopausal breast cancer patients taking ais is currently recruiting participants.32 in a report from this study that included 21 evaluable patients at 24 weeks, 80% of patients had experienced improvements in joint symptoms in their hands, knees, or both areas.33 supplementation with vitamin d to achieve a target concentration of 40 ng / ml 25-hydroxyvitamin d has also been associated with a decreased risk of new and worsening arthralgia in a prospective cohort study of postmenopausal breast cancer patients initiating ai therapy.34 additional studies (one recently completed phase i / ii study and two phase ii studies currently in progress) have been investigating the use of vitamin d for arthralgia in postmenopausal women with breast cancer who are taking ais.3537 nonpharmacological treatments for arthralgia associated with ais include lifestyle changes such as exercise and weight loss; these may be more appropriate for patients with mild symptoms.31 interestingly, compared with postmenopausal breast cancer patients with bmi <25 kg / m, the prevalence of joint pain appears to be reduced in postmenopausal breast cancer patients who are overweight (bmi 2530 kg / m) but not in those who are obese (bmi> 30 kg / m).38 this observation may be attributed to increased adipose tissue in overweight women, resulting in increased levels of estrogen and other sex hormones, since joint problems in women taking ais or in normal menopause appear to be related to a reduction in estrogen levels.38 however, obesity is associated with an increased risk of osteoarthritis; this may negate the protection from arthralgia afforded by the increased levels of estrogen.38 warm showers, physical therapy, massage, and acupuncture may also provide relief of arthralgia symptoms.39,40 in a randomized, blinded, sham - controlled study in 51 postmenopausal patients with early breast cancer and self - reported musculoskeletal pain while taking ais, acupuncture was effective in reducing joint pain and stiffness and improving functional ability and physical wellbeing.40 several of these interventions were presented to our patient, but she was not amenable to physical therapy or exercises, and did not persist in going to a thermal spa for the temporary relief she received from hot water baths . Switching from one nonsteroidal ai to another is another strategy that may allow patients experiencing arthralgia on one ai to continue adjuvant ai therapy . This is the treatment strategy that ultimately allowed our patient to find relief for her symptoms and to continue the benefits of adjuvant ai therapy . In the anastrozole versus letrozole: investigation into quality of life and tolerability (aliquot) study of adjuvant ais in postmenopausal women with hr breast cancer, the incidence of joint pain was similar with letrozole and with anastrozole (40%49% vs 52%).41 however, approximately half of the patients in aliquot with joint symptoms on letrozole did not report joint symptoms on anastrozole, and vice versa (table 2).42 in the articular tolerance of letrozole (atoll) study and a study by yardley et al, a majority of postmenopausal women with hr breast cancer who discontinued anastrozole due to musculoskeletal symptoms were able to continue therapy with letrozole for at least 6 months: 71.5% in atoll and 87.4% in yardley et al (table 2).43,44 in clinical trials in postmenopausal women with hr breast cancer, both nonsteroidal (anastrozole and letrozole) and steroidal (exemestane) ais have been associated with an increased incidence of arthralgia compared with tamoxifen or placebo . In the anastrozole (arimidex; astrazeneca, wilmington, de), tamoxifen, alone or in combination (atac) trial of 5 years of initial adjuvant anastrozole compared with tamoxifen, the incidence of arthralgia at 68 months follow - up was significantly higher with anastrozole than with tamoxifen (35.6% vs 29.4%; p <0.0001).14 it was noted that adverse events such as arthralgia were only recorded during the 5 years of active treatment and within the first 2 weeks after stopping treatment.15 consequently, at 100 months of follow - up in atac, there was little difference in the incidence of arthralgia compared with previous reports,15 and the incidence of arthralgia was not reported at 120 months of follow - up.16 in the big 198 trial, at 71 months of median follow - up, arthralgia was more common in women taking letrozole - containing regimens (letrozole monotherapy for 5 years, or the sequence of 2 years of letrozole or tamoxifen followed by 3 years of the other agent) than in women receiving tamoxifen monotherapy for 5 years (31.9%34.7% vs 30.1%; p = 0.05).8 in the tamoxifen exemestane adjuvant multinational (team) trial, at 2.75 years median follow - up, the incidence of arthralgia was 17.9% with initial adjuvant exemestane and 9.2% with initial adjuvant tamoxifen (p 0.001);17 at 5.1 years of median follow - up, the incidence of joint disorders was 36% with exemestane and 31% with sequential tamoxifen followed by exemestane (p <0.0001).18 similar results were seen in the intergroup exemestane study (ies) trial, in which patients were randomized after completing 23 years of tamoxifen.19 at 55.7 months of median follow - up, significantly more patients who switched to exemestane reported arthralgia compared with patients who continued on tamoxifen for the rest of the 5-year treatment period (18.6% vs 11.8%; p <0.0001).19 in an analysis at 91 months of median follow - up, including patients both on and post - treatment, the incidence of musculoskeletal pain was significantly higher with exemestane than with tamoxifen (37.6% vs 29.9%; p <0.001).20 in the ma.17 trial of extended adjuvant letrozole compared with placebo in patients who had completed 5 years of tamoxifen treatment, there was significantly more arthralgia at 30 months of median follow - up with letrozole than with placebo (25% vs 21%; p <0.001).21 suboptimal adherence to adjuvant medication regimen in postmenopausal women with hr breast cancer may lead to inappropriate therapeutic efficacy of prescribed medication (tamoxifen or an ai), and may also increase the risk of cancer recurrence and reduce disease survival rates . Recently published reviews indicate that nonadherence with tamoxifen and ai therapy is common, and adherence reported in clinical trials may differ significantly from that observed outside of the clinical trial setting.22,23 studies of patients taking adjuvant endocrine therapy for hr breast cancer have shown nonadherence rates of 20%50% at follow - up times ranging from 14.5 years following the start of endocrine therapy.2427 joint symptoms are frequently cited as reasons for discontinuing treatment.2729 in a retrospective study of 600 postmenopausal, hr, early breast cancer patients receiving adjuvant ai therapy in a clinical practice setting (median follow - up 19.7 months), arthralgia and myalgia led to discontinuation of the ai in 45.5% and 17.8% of the 101 patients who discontinued due to toxicity, respectively.28 in another study, 20% of 56 breast cancer patients receiving ai therapy in a clinical practice setting discontinued due to new or worsening arthralgia or bone pain.29 communicating with patients about ais and presenting management strategies can help patients remain on treatment . 27 the previously mentioned study of 56 patients in a clinical practice setting showed that discontinuation due to arthralgia or bone pain occurred within the first 3 months of treatment, leading the authors to recommend monthly visits during the first 3 months of therapy in order to address any issues and ensure that patients continue taking ais.29 however, monthly visits are generally not an option for patients in europe and north america, and were not an option for the patient in our case . It is also important to communicate with patients about the benefits associated with ais and the risks of not taking their prescribed treatment.27 the use of adjuvant ais has been associated with significant improvements in dfs in postmenopausal women with hr breast cancer (table 1). A study using automated pharmacy records in a large integrated health system showed an increased risk of mortality at 10 years in women with stage i iii hr breast cancer who discontinued or were nonadherent to endocrine therapy; survival was significantly higher in patients who adhered to therapy compared with patients who were nonadherent (81.7% vs 77.8%; p <0.01).24 a study of breast cancer patients in a community setting showed that 1589 (35%) of the 4526 patients receiving endocrine therapy had adherence rates that have been associated with an increased risk of mortality (adherence rates <80%).30 nurses can play a vital role in discussing adverse events with patients at each visit and also discerning whether they are taking their medications as prescribed . It has been suggested that follow - up phone calls between visits may also be helpful in addressing any adverse events that may arise.27 other techniques to improve adherence include the use of aids such as calendars or pillboxes.27 enlisting support from the patient s family and friends is another important component to facilitating patient adherence.27 recommendations for the management of joint symptoms include pharmacological and nonpharmacological interventions, and also switching to a different ai . Breast cancer patients taking ais have used nsaids such as ibuprofen as well as paracetamol for the relief of joint symptoms.29 the patient in our case was prescribed paracetamol, which provided little relief . However, it should be kept in mind that proton - pump inhibitors may be helpful in alleviating any gastrointestinal symptoms associated with nsaids.31 use of a topical nsaid was associated with some relief of the patient s pain, but not stiffness, and she did not continue using it . As an alternative to painkillers, a number of different nutritional supplements are being investigated for the treatment of arthralgia associated with the use of ais . A phase ii clinical study evaluating glucosamine plus chondroitin (estimated enrollment = 53) for the relief of joint pain and stiffness in postmenopausal breast cancer patients taking ais is currently recruiting participants.32 in a report from this study that included 21 evaluable patients at 24 weeks, 80% of patients had experienced improvements in joint symptoms in their hands, knees, or both areas.33 supplementation with vitamin d to achieve a target concentration of 40 ng / ml 25-hydroxyvitamin d has also been associated with a decreased risk of new and worsening arthralgia in a prospective cohort study of postmenopausal breast cancer patients initiating ai therapy.34 additional studies (one recently completed phase i / ii study and two phase ii studies currently in progress) have been investigating the use of vitamin d for arthralgia in postmenopausal women with breast cancer who are taking ais.3537 nonpharmacological treatments for arthralgia associated with ais include lifestyle changes such as exercise and weight loss; these may be more appropriate for patients with mild symptoms.31 interestingly, compared with postmenopausal breast cancer patients with bmi <25 kg / m, the prevalence of joint pain appears to be reduced in postmenopausal breast cancer patients who are overweight (bmi 2530 kg / m) but not in those who are obese (bmi> 30 kg / m).38 this observation may be attributed to increased adipose tissue in overweight women, resulting in increased levels of estrogen and other sex hormones, since joint problems in women taking ais or in normal menopause appear to be related to a reduction in estrogen levels.38 however, obesity is associated with an increased risk of osteoarthritis; this may negate the protection from arthralgia afforded by the increased levels of estrogen.38 warm showers, physical therapy, massage, and acupuncture may also provide relief of arthralgia symptoms.39,40 in a randomized, blinded, sham - controlled study in 51 postmenopausal patients with early breast cancer and self - reported musculoskeletal pain while taking ais, acupuncture was effective in reducing joint pain and stiffness and improving functional ability and physical wellbeing.40 several of these interventions were presented to our patient, but she was not amenable to physical therapy or exercises, and did not persist in going to a thermal spa for the temporary relief she received from hot water baths . Switching from one nonsteroidal ai to another is another strategy that may allow patients experiencing arthralgia on one ai to continue adjuvant ai therapy . This is the treatment strategy that ultimately allowed our patient to find relief for her symptoms and to continue the benefits of adjuvant ai therapy . In the anastrozole versus letrozole: investigation into quality of life and tolerability (aliquot) study of adjuvant ais in postmenopausal women with hr breast cancer, the incidence of joint pain was similar with letrozole and with anastrozole (40%49% vs 52%).41 however, approximately half of the patients in aliquot with joint symptoms on letrozole did not report joint symptoms on anastrozole, and vice versa (table 2).42 in the articular tolerance of letrozole (atoll) study and a study by yardley et al, a majority of postmenopausal women with hr breast cancer who discontinued anastrozole due to musculoskeletal symptoms were able to continue therapy with letrozole for at least 6 months: 71.5% in atoll and 87.4% in yardley et al (table 2).43,44 approaches to alleviate musculoskeletal symptoms in postmenopausal breast cancer patients taking ais include pharmacological interventions (such as nsaids or vitamin d supplementation), nonpharmacological interventions (such as homeopathy or lifestyle changes including exercise and weight loss), and switching between nonsteroidal ais . While offering greater clinical efficacy than tamoxifen, switching from one ai to another can provide relief of joint pain and stiffness for some postmenopausal women taking adjuvant ais for hr breast cancer . It is important to address the adverse events associated with ais and also to provide strategies for managing them so that in order to derive the most clinical benefit, patients remain adherent to therapy.
Of all the mental disorders, those that fall under the umbrella of psychotic disorders are certainly the most disabling and most difficult to manage . Severe psychiatric deficits, including hallucinations, delusions, cognitive difficulties, and poor social and occupational functioning, plus a debilitating course of lifelong cognitive impairments are characteristic of patients diagnosed with schizophrenia, severe bipolar disorder, and chronic clinical depression . These disorders are also characterized by significantly decreased life expectancy with the chief factors of this excess risk of death arising from cigarette smoking, obesity, metabolic disorders associated with diabetes, hypertension, and stroke [2, 3]. A recent survey of over 1000 subjects with psychotic disorders conducted in australia noted that over 75% of all patients were overweight or obese, 20% suffered from diabetes and hypertension, and over 50% of patients met criteria for metabolic syndrome, defined by a combination of central obesity plus 2 or more of the following risk factors: elevated hdl c levels, increased blood pressure, increased blood glucose levels . Other recent studies done in south america and in asia have reported that prior to treatment, young patients may already be at a metabolic disadvantage, with already higher than average rates of obesity (21%), hypertension (29%), and smoking (26%) and significantly increased rates of diabetes (8% vs 1% in age - matched controls) [5, 6]. These physical health deficits are considerably exacerbated by the antipsychotic and antidepressant medications required to treat their mental illnesses . For many patients, reduction of dosing and/or tapering off psychotropic medications is not clinically recommended, given the seriousness of these mental disorders and the high risk of relapse and significant self - harm and harm to others . The long - term overall result is an approximate 20-year reduction of lifespan from early death from cardiovascular and metabolic disease . Alternate non - pharmacologic approaches and interventions for concurrent metabolic disorders in severe mental illness are required to modify the cardiometabolic sequelae of treatment to alleviate the burden of mortality in this population . In the previous decade, increased rates of abdominal obesity, dyslipidemia, hyperglycemia, and hypertension have been observed in patients with psychotic disorders, all of which are key risk factors for cardiometabolic disorders, such as diabetes and cardiovascular disease [8, 9]. Patients presenting with severe psychosis and schizophrenia spectrum disorders are widely prescribed antipsychotic medications to manage the symptoms of illness . There are an estimated 235,000 people with schizophrenia in canada, with an economic impact at over $6.85 billion annually . The use of antipsychotic drugs has increased dramatically in the past decade, with the introduction of newer compounds with different side - effect profiles, additional approved indications as well as greater off - label use . For example, members of our group have previously reported that antipsychotics were being used off - label for a wide range of disorders, including bipolar, depression, anxiety, and personality disorders in a large canadian cohort . We and others have reported that antipsychotics are also being prescribed increasingly to nontraditional populations such as children and adolescents . The first generation antipsychotics (fgas), or typical, antipsychotic drugs were developed in the 1950s, and revolutionized psychiatry . However, many patients remained resistant or refractory to their clinical effects, and extended use commonly resulted in severe neurological motor side - effects, and subsequently fell out of favor [12, 13]. The second generation antipsychotics (sgas) (also known as the atypicals), developed in the 1990 and 2000s, represent compounds with greater efficacy for refractory psychosis . While the sgas display much lower propensity to induce motor side - effects, recent research has indicated that these drugs are commonly associated with different but equally severe side - effects . All antipsychotic medications are associated with higher rates of sedation, sexual dysfunction, postural hypotension, cardiac arrhythmia, and sudden cardiac death [13, 14]. Preclinical animal studies have clearly shown that exposure to sgas have direct adverse effects on the cardiovascular system . At this time there is overwhelming evidence indicating that use of the sgas can result in severe metabolic disturbances that requires much better clinical management than currently provided in order to prevent unnecessary mortality [8, 16]. These effects are so severe that the american diabetes association, the american psychiatric association, the american association of clinical endocrinologists and the north american association for the study of obesity co - sponsored a joint consensus statement, providing guidelines for assessment of metabolic risk for all patients being treated with atypical antipsychotics . Weight gain is the most common adverse effect among the sgas and some of the fga . In a review of the literature, allison et al . Noted the following mean increases in weight at 10 weeks of treatment with the sgas: clozapine 4.45 kg, olanzapine 4.15 kg, chlorpromazine 2.58 kg, risperidone 2.10 kg, haloperidol (a fga) 1.08 kg, and ziprasidone 0.04 kg . In another systematic review, increases in weight of 10% or more associated with clozapine, olanzapine, and risperidone were: 6% at 8 weeks, 15% at 10 weeks, and 27% 60% at 312 months . Our own observations in a cohort of drug - nave first episode patients showed an average weight gain of 1.8 kg in just 4 weeks of low dose risperidone or quetiapine exposure (unpublished data). Alarmingly, among patients with metabolic syndrome, the relative risk for type ii diabetes and coronary heart disease (chd) is 1.55 times that of the general population . Results from the clinical antipsychotic trial of intervention effectiveness (catie) study (a large multi - center trial sponsored by nimh) controlled for factors including age, race and gender and observed that 42.7% of patients treated with atypicals had metabolic dysregulation . When controlling for body mass index (bmi), catie men were 85% more likely, and catie women 137% more, to have metabolic syndrome than their control counterparts . The greater risk for metabolic dysregulation associated with sgas may be independent of effects on body weight [27, 28]. It is therefore very likely that the sgas exert effects on glucose tolerance and insulin sensitivity that are independent of (and not secondary to) weight gain . Further evidence in support of this hypothesis comes from reports that have detailed new - onset diabetes in the absence of obesity or substantial weight gain in atypical drug - treated patients . Additionally, acute effects of sgas in normal subjects included glucose intolerance in the absence of major weight gain . Over 25% of the diabetic keto - acidosis and 15% of new - onset hyperglycemia cases were in atypical - treated patients who did not experience weight gain or who had lost weight . Despite incontrovertible evidence of increased cardiometabolic risk in individuals with mental illness taking antipsychotic medication, unfortunately, patients with schizophrenia are often at risk of receiving less optimal treatment for cardiovascular disease compared with other populations . A recent review by mitchell and colleagues found that across 39 internationally published studies, rates of routine baseline metabolic screening was generally low, and above 50% only for blood pressure and triglycerides (59.9%). Cholesterol was measured in 41.5%, glucose in 44.3%, and weight in 47.9% of patients . Lipids and glycosylated haemoglobin (hba1c) were monitored in less than 25% . These data indicated that in routine clinical practice, metabolic monitoring is remarkably low in people prescribed antipsychotic medications, despite the introduction of new monitoring guidelines for this population . The following measurements were recommended in the development of new guidelines (in order of frequency): fasting glucose, body mass index, fasting triglycerides, fasting cholesterol, waist, high - density lipoprotein / low - density lipoprotein, blood pressure, and symptoms of diabetes . In an ongoing study that we are conducting in a cohort of treatment - resistant chronic psychosis patients, we have observed that an additional measure of arterial stiffness based on aortic pulse wave velocity offers a sensitive and effective tool for evaluating cardiovascular disease risk in this population, and may be a more rapid way of accurately assessing cardiovascular disease risk (phillips et al . Submitted). In terms of additional interventions, most clinical guidelines recommended providing advice on physical activity, diet, psycho - education of the patient (and family), treatment of lipid abnormalities, treatment of diabetes, referral for advice and treatment, and smoking cessation advice . While commendable, the provision of advice alone does not ensure that patients most in need of intervention actually receive any appropriate intervention . Moreover, due to the physical and psychological limitations of this population, physical activity, or exercise interventions, which are likely to confer considerable health benefits with respect to moderating the metabolic side - effects of medications, requires both a tailored exercise prescription and ongoing clinical monitoring . Exercise barriers for those with severe mental disorders generally include lack of motivation, poor concentration, sedative effects of medications, insufficient financial resources, and lack of access to appropriate exercise programs . It has been suggested that the beneficial effects of exercise may be greatly under - appreciated and that the positive effects of controlled exercise include not only improved metabolic responses, but may also confer neuro - protection, increased quality of life, and reduction in the severity of psychopathological symptoms . With respect to the adverse metabolic effects of antipsychotic treatment, physical exercise can prevent or lessen cardiovascular disease risk factors including elevated blood pressure, insulin resistance, glucose intolerance, elevated blood triglycerides, low high - density lipoprotein cholesterol levels, and obesity, all of which are high in prevalence in psychosis patients . It is apparent that severe mental illnesses are diseases of the brain, resulting in adverse clinical sequelae, such as psychosis and cognitive dysfunction . Exercise may provide direct benefit for these aspects of the illness as well . In this regard, a recent review has highlighted the value of regular exercise programs in schizophrenia patients with respect to ameliorating the severity of psychosis [38]. Clearly, for those with severe mental illness, appropriate exercise offers both physical and psychiatric benefits, and is thought to exert a salutary effect on interacting networks mediating metabolism, immuno - inflammatory function, and cellular respiration for both body and brain . The therapeutic benefits of regular exercise in those with major depression is well known, and is also believed to alleviate symptom severity in schizophrenia patients . Currently, there is a paucity of research testing its effects on people seeking help for mental health issues . It is likely that expecting people to exercise at levels recommended by standard population guidelines may be unrealistic given their struggle with mental health issues, or that self - directed exercise is possible . In an ongoing investigation our group is studying the effects of a 12-week regular exercise intervention on physical and mental health in chronic treatment - resistant psychosis patients . Full cardiovascular fitness evaluations have so far been conducted in a cohort of 17 chronic psychosis patients (mean age 31.9 yrs) treated with high dose sgas (invited poster symposium - international congress of schizophrenia research 2013, orlando, florida) [43]. Individualized exercise programs were tailored to patients based on their baseline cardiorespiratory fitness and motor abilities . For this study, fitness progress was closely monitored on a weekly basis over the 12-week course of intervention . Full cardiorespiratory fitness was re - assessed at 6 weeks and 12 weeks . It is well known that low cardiovascular or cardiorespiratory fitness, as assessed by v02 max, is a key factor for coronary heart disease . The mean cardiovascular capacity (v02 max - ml / kg / min) in this cohort at baseline was 19.8 ml / kg / min, far below the expected healthy norms for this age cohort, and was congruent with patients suffering from mild to moderate heart failure . The observation of lower than predicted v02 max capacity has been observed in less severely ill schizophrenia patients as well [46, 47]. Despite the presence of sgas, we, and others have measured improvements in v02 max and blood pressure after just 6 to 12 weeks of regular exercise at moderate exertion levels (55% 70% of maximum heart rate) [43, 46]. Our own data have shown that after only 12 weeks of regular exercise, patients were able to reduce their average body mass index (bmi) from a mean baseline bmi of 29.9 to a mean bmi of 27.1 12 weeks later [43]. For this cohort of severely ill patients, improvements in anxiety, depression, and psychotic symptom severity were also observed after completion of 12 weeks of regular exercise [43]. These preliminary observations strongly suggest that even for the most symptomatically severe and treatment refractory patients, adjunct regular exercise offers significant benefits with respect to lessening metabolic effects of antipsychotic treatment . Moreover, the improvements in mood deficits and cognitive deficits conferred by regular exercise can be attained without further burden of anxiolytics, antidepressants, or mood stabilizers . Given the positive effects of controlled exercise to improve metabolic responses, provide neuro - protection, increase quality of life, and reduce psychopathological symptoms, an individualized exercise prescription in the context of a monitored exercise program is an optimal and cost - effective method to manage the cardio - metabolic side effects of medication and should be widely available to those with severe mental illness . Of all the mental disorders, those that fall under the umbrella of psychotic disorders are certainly the most disabling and most difficult to manage . Severe psychiatric deficits, including hallucinations, delusions, cognitive difficulties, and poor social and occupational functioning, plus a debilitating course of lifelong cognitive impairments are characteristic of patients diagnosed with schizophrenia, severe bipolar disorder, and chronic clinical depression . These disorders are also characterized by significantly decreased life expectancy with the chief factors of this excess risk of death arising from cigarette smoking, obesity, metabolic disorders associated with diabetes, hypertension, and stroke [2, 3]. A recent survey of over 1000 subjects with psychotic disorders conducted in australia noted that over 75% of all patients were overweight or obese, 20% suffered from diabetes and hypertension, and over 50% of patients met criteria for metabolic syndrome, defined by a combination of central obesity plus 2 or more of the following risk factors: elevated hdl c levels, increased blood pressure, increased blood glucose levels . Other recent studies done in south america and in asia have reported that prior to treatment, young patients may already be at a metabolic disadvantage, with already higher than average rates of obesity (21%), hypertension (29%), and smoking (26%) and significantly increased rates of diabetes (8% vs 1% in age - matched controls) [5, 6]. These physical health deficits are considerably exacerbated by the antipsychotic and antidepressant medications required to treat their mental illnesses . For many patients, reduction of dosing and/or tapering off psychotropic medications is not clinically recommended, given the seriousness of these mental disorders and the high risk of relapse and significant self - harm and harm to others . The long - term overall result is an approximate 20-year reduction of lifespan from early death from cardiovascular and metabolic disease . Alternate non - pharmacologic approaches and interventions for concurrent metabolic disorders in severe mental illness are required to modify the cardiometabolic sequelae of treatment to alleviate the burden of mortality in this population . In the previous decade, increased rates of abdominal obesity, dyslipidemia, hyperglycemia, and hypertension have been observed in patients with psychotic disorders, all of which are key risk factors for cardiometabolic disorders, such as diabetes and cardiovascular disease [8, 9]. Patients presenting with severe psychosis and schizophrenia spectrum disorders are widely prescribed antipsychotic medications to manage the symptoms of illness . There are an estimated 235,000 people with schizophrenia in canada, with an economic impact at over $6.85 billion annually . The use of antipsychotic drugs has increased dramatically in the past decade, with the introduction of newer compounds with different side - effect profiles, additional approved indications as well as greater off - label use . For example, members of our group have previously reported that antipsychotics were being used off - label for a wide range of disorders, including bipolar, depression, anxiety, and personality disorders in a large canadian cohort . We and others have reported that antipsychotics are also being prescribed increasingly to nontraditional populations such as children and adolescents . The first generation antipsychotics (fgas), or typical, antipsychotic drugs were developed in the 1950s, and revolutionized psychiatry . However, many patients remained resistant or refractory to their clinical effects, and extended use commonly resulted in severe neurological motor side - effects, and subsequently fell out of favor [12, 13]. The second generation antipsychotics (sgas) (also known as the atypicals), developed in the 1990 and 2000s, represent compounds with greater efficacy for refractory psychosis . While the sgas display much lower propensity to induce motor side - effects, recent research has indicated that these drugs are commonly associated with different but equally severe side - effects . All antipsychotic medications are associated with higher rates of sedation, sexual dysfunction, postural hypotension, cardiac arrhythmia, and sudden cardiac death [13, 14]. Preclinical animal studies have clearly shown that exposure to sgas have direct adverse effects on the cardiovascular system . At this time there is overwhelming evidence indicating that use of the sgas can result in severe metabolic disturbances that requires much better clinical management than currently provided in order to prevent unnecessary mortality [8, 16]. These effects are so severe that the american diabetes association, the american psychiatric association, the american association of clinical endocrinologists and the north american association for the study of obesity co - sponsored a joint consensus statement, providing guidelines for assessment of metabolic risk for all patients being treated with atypical antipsychotics . Weight gain is the most common adverse effect among the sgas and some of the fga . In a review of the literature, allison et al . Noted the following mean increases in weight at 10 weeks of treatment with the sgas: clozapine 4.45 kg, olanzapine 4.15 kg, chlorpromazine 2.58 kg, risperidone 2.10 kg, haloperidol (a fga) 1.08 kg, and ziprasidone 0.04 kg . In another systematic review, increases in weight of 10% or more associated with clozapine, olanzapine, and risperidone were: 6% at 8 weeks, 15% at 10 weeks, and 27% 60% at 312 months . Our own observations in a cohort of drug - nave first episode patients showed an average weight gain of 1.8 kg in just 4 weeks of low dose risperidone or quetiapine exposure (unpublished data). Alarmingly, among patients with metabolic syndrome, the relative risk for type ii diabetes and coronary heart disease (chd) is 1.55 times that of the general population . Results from the clinical antipsychotic trial of intervention effectiveness (catie) study (a large multi - center trial sponsored by nimh) controlled for factors including age, race and gender and observed that 42.7% of patients treated with atypicals had metabolic dysregulation . When controlling for body mass index (bmi), catie men were 85% more likely, and catie women 137% more, to have metabolic syndrome than their control counterparts . The greater risk for metabolic dysregulation associated with sgas may be independent of effects on body weight [27, 28]. It is therefore very likely that the sgas exert effects on glucose tolerance and insulin sensitivity that are independent of (and not secondary to) weight gain . Further evidence in support of this hypothesis comes from reports that have detailed new - onset diabetes in the absence of obesity or substantial weight gain in atypical drug - treated patients . Additionally, acute effects of sgas in normal subjects included glucose intolerance in the absence of major weight gain . Over 25% of the diabetic keto - acidosis and 15% of new - onset hyperglycemia cases were in atypical - treated patients who did not experience weight gain or who had lost weight . Despite incontrovertible evidence of increased cardiometabolic risk in individuals with mental illness taking antipsychotic medication, metabolic screening practices are often incomplete or inconsistent . Unfortunately, patients with schizophrenia are often at risk of receiving less optimal treatment for cardiovascular disease compared with other populations . A recent review by mitchell and colleagues found that across 39 internationally published studies, rates of routine baseline metabolic screening was generally low, and above 50% only for blood pressure and triglycerides (59.9%). Cholesterol was measured in 41.5%, glucose in 44.3%, and weight in 47.9% of patients . Lipids and glycosylated haemoglobin (hba1c) were monitored in less than 25% . These data indicated that in routine clinical practice, metabolic monitoring is remarkably low in people prescribed antipsychotic medications, despite the introduction of new monitoring guidelines for this population . The following measurements were recommended in the development of new guidelines (in order of frequency): fasting glucose, body mass index, fasting triglycerides, fasting cholesterol, waist, high - density lipoprotein / low - density lipoprotein, blood pressure, and symptoms of diabetes . In an ongoing study that we are conducting in a cohort of treatment - resistant chronic psychosis patients, we have observed that an additional measure of arterial stiffness based on aortic pulse wave velocity offers a sensitive and effective tool for evaluating cardiovascular disease risk in this population, and may be a more rapid way of accurately assessing cardiovascular disease risk (phillips et al . Submitted). In terms of additional interventions, most clinical guidelines recommended providing advice on physical activity, diet, psycho - education of the patient (and family), treatment of lipid abnormalities, treatment of diabetes, referral for advice and treatment, and smoking cessation advice . While commendable, the provision of advice alone does not ensure that patients most in need of intervention actually receive any appropriate intervention . Moreover, due to the physical and psychological limitations of this population, physical activity, or exercise interventions, which are likely to confer considerable health benefits with respect to moderating the metabolic side - effects of medications, requires both a tailored exercise prescription and ongoing clinical monitoring . Exercise barriers for those with severe mental disorders generally include lack of motivation, poor concentration, sedative effects of medications, insufficient financial resources, and lack of access to appropriate exercise programs . It has been suggested that the beneficial effects of exercise may be greatly under - appreciated and that the positive effects of controlled exercise include not only improved metabolic responses, but may also confer neuro - protection, increased quality of life, and reduction in the severity of psychopathological symptoms . With respect to the adverse metabolic effects of antipsychotic treatment, physical exercise can prevent or lessen cardiovascular disease risk factors including elevated blood pressure, insulin resistance, glucose intolerance, elevated blood triglycerides, low high - density lipoprotein cholesterol levels, and obesity, all of which are high in prevalence in psychosis patients . It is apparent that severe mental illnesses are diseases of the brain, resulting in adverse clinical sequelae, such as psychosis and cognitive dysfunction . Exercise may provide direct benefit for these aspects of the illness as well . In this regard, a recent review has highlighted the value of regular exercise programs in schizophrenia patients with respect to ameliorating the severity of psychosis [38]. Clearly, for those with severe mental illness, appropriate exercise offers both physical and psychiatric benefits, and is thought to exert a salutary effect on interacting networks mediating metabolism, immuno - inflammatory function, and cellular respiration for both body and brain . The therapeutic benefits of regular exercise in those with major depression is well known, and is also believed to alleviate symptom severity in schizophrenia patients . Currently, there is a paucity of research testing its effects on people seeking help for mental health issues . It is likely that expecting people to exercise at levels recommended by standard population guidelines may be unrealistic given their struggle with mental health issues, or that self - directed exercise is possible . In an ongoing investigation our group is studying the effects of a 12-week regular exercise intervention on physical and mental health in chronic treatment - resistant psychosis patients . Full cardiovascular fitness evaluations have so far been conducted in a cohort of 17 chronic psychosis patients (mean age 31.9 yrs) treated with high dose sgas (invited poster symposium - international congress of schizophrenia research 2013, orlando, florida) [43]. Individualized exercise programs were tailored to patients based on their baseline cardiorespiratory fitness and motor abilities . For this study, fitness progress was closely monitored on a weekly basis over the 12-week course of intervention . Full cardiorespiratory fitness was re - assessed at 6 weeks and 12 weeks . It is well known that low cardiovascular or cardiorespiratory fitness, as assessed by v02 max, is a key factor for coronary heart disease . The mean cardiovascular capacity (v02 max - ml / kg / min) in this cohort at baseline was 19.8 ml / kg / min, far below the expected healthy norms for this age cohort, and was congruent with patients suffering from mild to moderate heart failure . The observation of lower than predicted v02 max capacity has been observed in less severely ill schizophrenia patients as well [46, 47]. Despite the presence of sgas, we, and others have measured improvements in v02 max and blood pressure after just 6 to 12 weeks of regular exercise at moderate exertion levels (55% 70% of maximum heart rate) [43, 46]. Our own data have shown that after only 12 weeks of regular exercise, patients were able to reduce their average body mass index (bmi) from a mean baseline bmi of 29.9 to a mean bmi of 27.1 12 weeks later [43]. For this cohort of severely ill patients, improvements in anxiety, depression, and psychotic symptom severity were also observed after completion of 12 weeks of regular exercise [43]. These preliminary observations strongly suggest that even for the most symptomatically severe and treatment refractory patients, adjunct regular exercise offers significant benefits with respect to lessening metabolic effects of antipsychotic treatment . Moreover, the improvements in mood deficits and cognitive deficits conferred by regular exercise can be attained without further burden of anxiolytics, antidepressants, or mood stabilizers . Given the positive effects of controlled exercise to improve metabolic responses, provide neuro - protection, increase quality of life, and reduce psychopathological symptoms, an individualized exercise prescription in the context of a monitored exercise program is an optimal and cost - effective method to manage the cardio - metabolic side effects of medication and should be widely available to those with severe mental illness.
Age is the most important risk factor for ad, with the prevalence rising substantially between the ages of 65 and 85 years.1 the incidence of the disease doubles every five years after 65 years of age, with diagnosis of 1275 new cases per year per 100,000 persons older than 65 years, so that ad affects 30%50% of all people by the age of 85 years.2 data on centenarians show that ad is not necessarily the outcome of aging, but the odds of receiving a diagnosis of ad after 85 years exceed one in three.3,4 despite its remarkable prevalence among the elderly, ad has been regarded as a specific disease, distinct from normal aging . This view is supported in large part by clinical and pathologic similarities to early - onset, dominantly inherited familial ad, where genetic mutations related to amyloids have been identified . There is much evidence that early onset (sporadic) ad (load) overlaps with normal aging in many clinical and pathologic respects.5 interestingly, early onset ad accounts only for 5% of total ad cases . The majority of ad patients (90%95%) are load, and it usually develops after 65 years of age.6 while early onset ad is almost certainly genetically based, there are no specific gene mutations that are associated with inheritance of the disease in load . The expression of the apolipoprotein e (apoe) 4 allele is one of the risk factors identified for load.7 in the central nervous system, apoe is synthesized by astrocytes, microglia, and, to a lesser extent, by neurons . The role of apoe in load pathogenesis is not fully elucidated, but it has been suggested that apoe is important in trafficking of amyloid (a) peptide.8 in addition, apolipoprotein j (clusterin), an amyloid -peptide chaperone, tomm40, a transporter of proteins across the mitochondrial membrane, and sortillin - related receptor, which functions to partition amyloid precursor protein away from -secretase and -secretase, are recently discovered proteins encoded by the risk genes for load.3 in addition to nonmodifiable genetic risk factors, potentially modifiable factors, such as hypertension, diabetes mellitus, hyperlipidemia, hyperhomocysteinemia, coronary and peripheral artery diseases, alcohol, smoking, obesity, levels of physical or mental activity, levels of education, and environmental exposures have been investigated to identify risk factors for load.9,10 furthermore, it has been reported that risk index methods including these risk factors provide a practical, flexible, and objective framework for identifying the optimal combination of measures for identification of high - risk individuals for prevention and early intervention efforts.10 despite the personal and societal burden of load, our understanding of the genetic predisposition to load and the contribution of other risk factors remains limited . More importantly, there are few data to explain the overall risks and benefits of prevention strategies or their impact on risk modification.9 ad is characterized by extensive atrophy of the brain caused by a series neuropathologic changes, including neuronal loss, formation of amyloid plaques, appearance of neurofibrillary tangles, and synaptic loss.11,12 amyloid plaques and neurofibrillary tangles result from an aberration in deposition of the a peptide and the hyperphosphorylated tau protein, respectively, and these depositions lead to neuronal loss and neurotoxicity in the brain affected by ad.13 however, these changes in the brain are not found throughout the brain and preferentially affect specific brain areas in a manner that is essentially consistent from patient to patient.14 data obtained by electron microscopy and immunocytochemical and biochemical analysis on synaptic marker proteins in ad biopsies and autopsies indicate that synaptic loss in the hippocampus and neocortex is an early event and the major structural correlate of cognitive dysfunction . From all cortical areas analyzed, the hippocampus appears to be the most severely affected by the loss of synaptic proteins, while the occipital cortex is affected least.15 in addition, it was reported that synaptic loss is currently the best neurobiologic correlate of cognitive deficits in ad . Furthermore, synaptic function is impaired in living neurons, as demonstrated by decrements in transcripts related to synaptic vesicle trafficking.16 although new imaging techniques and powerful animal models have helped understanding the time course and the mechanisms of the lesions, the relationship between a accumulation and tau pathology is still badly understood and the mechanism of load continues to be debated . Accumulation of a peptides may be the key event in the pathogenesis of ad . The exact mechanism by which a peptide deposition induces neurotoxicity is unclear, but it appears that oxidative stress plays an important role . Stress is extensive in ad, and a peptides stimulate oxidative stress by both direct and indirect mechanisms . A peptides by themselves may act as enzymes and can bind to mitochondrial proteins, resulting in the generation of free radicals.17,18 furthermore, a peptides generate oxidative stress via neuroinflammation . Considerable evidence has supported the hypothesis that neuroinflammation is associated with ad pathology.18 in addition, in ad, vascular injury and parenchymal inflammation perpetuate the cycle of protein aggregation and oxidation in the brain, and diffuse pathologic changes include cerebral amyloid angiopathy, affecting more than 90% of patients with ad, capillary abnormalities, disruption of the blood brain barrier, and large - vessel channels.3,19 it has also been reported that clearance of a along diseased perivascular channels and through the blood brain barrier is impeded in ad atheroma,20 and that deregulation of a transport across the capillary blood brain barrier is caused by the imbalanced expression of low - density lipoprotein receptor - related proteins and receptors for advanced glycation end products.19,21 furthermore, insulin resistance and hyperinsulinemia are implicated in a number of pathophysiologic processes related to ad.22,23 it has been demonstrated that reduced brain insulin signaling is associated with increased tau phosphorylation and a levels in a streptozotocin - induced model of diabetes mellitus,24,25 and also that insulin promotes the release of intracellular a in neuronal cultures and accelerates a trafficking to the plasma membrane . Similarly, intravenous insulin infusion also raises plasma a42 levels in patients with ad but not in normal adults, an effect that is exaggerated in patients with ad and a higher body mass index . In addition, impaired insulin or insulin - like growth factor-1 signaling can result in hyperphosphorylation of tau, which can cause cell death mediated by apoptosis, mitochondrial dysfunction, or necrosis, and promote oxidative stress, which contributes to the neurodegeneration cascade, and leads to dementia - associated behavioral and cognitive deficits . For this reason, it seems that insulin resistance causes tau phosphorylation, neurofibrillary tangle formation, and increased beta amyloid aggregation in load.22,2325 therefore, we think that the insulin resistance should be taken into account, both in explaining the pathophysiologic mechanisms and the managing of the load . In short, the current pathophysiologic approach to load is based on a number of common mechanisms of neurodegeneration, including accumulation of abnormal proteins, mitochondrial dysfunction, and oxidative stress, impaired insulin signaling, calcium homeostasis dysregulation, early synaptic disconnection, and late apoptotic cell death . Aging itself is associated with mild cognitive deterioration, probably due to subtle multifactorial changes resulting in a global decrease of functional brain reserve.3,22,26 ad can affect different people in different ways, but the most common symptom pattern begins with gradually worsening difficulty remembering new information . In the early stages, the most commonly recognized symptom is inability to acquire new memories, such as difficulty in recalling recently observed facts.27 cognitive profiles of normal aging emphasize a decline in skills, including learning efficiency, working memory, and psychomotor speed . Although memory impairment is the earliest cognitive change in ad, distinguishing early disease from normal aging can be difficult, and making a decision as to whether a memory complaint is associated with the normal aging process or is a precursor sign for dementia, is difficult for the doctor.2830 therefore, the earliest observable symptoms are often mistakenly thought to be age - related concerns, or manifestations of stress.31 when ad is suspected, the diagnosis is usually confirmed by behavioral assessment and cognitive tests, often followed by a brain scan if possible.31 as the damage spreads, individuals also experience confusion, disorganized thinking, impaired judgment, trouble expressing themselves, and disorientation . The following are warning signs of alzheimer s disease: memory loss that disrupts daily lifechallenges in planning or solving problemsdifficulty completing familiar tasks at home, at work, or at leisureconfusion in time or placetrouble understanding visual images and spatial relationshipsnew problems with words in speaking or writingmisplacing things and losing the ability to retrace stepsdecreased or poor judgmentwithdrawal from work or social activitieschanges in mood and personality.27 memory loss that disrupts daily life challenges in planning or solving problems difficulty completing familiar tasks at home, at work, or at leisure confusion in time or place trouble understanding visual images and spatial relationships new problems with words in speaking or writing misplacing things and losing the ability to retrace steps decreased or poor judgment withdrawal from work or social activities changes in mood and personality.27 as the disease advances, symptoms include confusion, irritability, and aggression, mood swings, language breakdown, long - term memory loss, and the general withdrawal of the sufferer as their senses decline.31 as the disease progresses, cognitive impairment becomes profound and daily functioning skills decline . Although typically thought of as indicative of late - stage disease, behavioral symptoms can appear early in the course of the disease, well before clinical diagnosis . As the disease advances, symptoms such as anxiety, irritability, and agitation become more pronounced.32 behavioral symptoms are also a major source of stress for the caregiver . Behavioral disturbances have been shown to be a strong predictor of caregiver burden8 and are associated with increased financial hardship for the caregiver.33 physical functions are gradually lost, ultimately leading to death . Ad develops for an indeterminate period of time before becoming fully apparent, and it can progress undiagnosed for years . The mean life expectancy following diagnosis is approximately 7 years.34 fewer than 3% of individuals live more than 14 years after diagnosis.35 there is an increasing interest in the identification of patients in the earliest stage of ad, prior to clinical manifestation of dementia, in order to provide effective early intervention that aims at delaying significant impairment . A definitive diagnosis of ad requires a detailed post - mortem microscopic examination of the brain . But nowadays, ad can be diagnosed with more than 95% accuracy in living patients by using a combination of tools . These include taking a careful history from patients and their families, and assessing cognitive function by neuropsychologic tests . Other causes of dementia must be ruled out, such as low thyroid function, vitamin deficiencies, infections, cancer, and depression . It is also crucial to differentiate ad from other neurodegenerative dementias.36 the national institute of neurological and communicative disorders and stroke and the alzheimer s disease and related disorders association (nincds - adrda) and the diagnostic and statistical manual of mental disorders, fourth edition, text revision (dsm - iv - tr) criteria for ad are the prevailing diagnostic standards in research . However, they have now fallen behind the unprecedented growth of scientific knowledge . Moreover, nincds - adrda was reported in 1984 and the subsequent dsm - iv - tr in 2000 . For this reason, to improve the specificity for diagnosis of ad, the criteria were revised by dubois to offer a new diagnostic approach including genetic testing, molecular imaging, and body fluid biomarkers.37 furthermore, draft reports presented at the international conference on alzheimer s disease in 2010 will form the basis of new diagnostic criteria for mild cognitive impairment and ad . There was no effective therapy for ad before the approval of the cholinesterase inhibitors and memantine . These agents are associated with detectable symptomatic improvement, and have a modest effect on the progression of ad from mild cognitive impairment to disabling dementia and death.38 medicines currently prescribed for ad fall into three groups, ie, inhibitors of acetylcholinesterase (according to the cholinergic hypothesis of ad, memory impairments result from death of cholinergic neurons in the basal fore - brain), an antagonist of a receptor for the neurotransmitter glutamate, and drugs from the psychiatric toolbox to control depression and behavioral abnormalities.36 the clinical development of new agents for symptomatic and disease - modifying treatment of ad has resulted in both promise and disappointment . Despite the fact that no new compound for the treatment of ad has been introduced since the approval of memantine in 2002, the variety of drug targets and mechanisms of action, and the total number of compounds under investigation make it highly likely that important new pharmacotherapeutic options will become available for the treatment of ad over the next decade . Moreover, research into the underlying etiology and pathophysiology of ad is likely to facilitate identification of additional targets for future drug development.38 in addition, stem cell therapy for ad might be used to replace destroyed neurons, but ad poses particular challenges in this regard because it affects diverse types of neurons in different brain regions.36 however, our experience has demonstrated that mesenchymal stem cell therapy might provide neuronal replacement and improved cognitive function in streptozotocin - induced neurodegeneration in rats, but adjunctive therapies with mesenchymal stem cells in this type of neurodegeneration need to be tried.39 however, the development of bone marrow mesenchymal stem cell therapy for the replacement of cells and tissues lost due to neurodegeneration in ad is still in the early stages, and further studies will be needed before it can be tested in humans . Nonetheless, nowadays, there is no definitive evidence to support any particular measure being effective in prevention of ad . Global studies of measures to prevent or delay the onset of ad have often produced inconsistent results . However, epidemiologic studies have proposed relationships between certain modifiable factors, such as diet, cardiovascular risk, pharmaceutical products, or intellectual activities, among others, and a population s likelihood of developing ad . Only further research, including clinical trials, will reveal whether these factors can help to prevent ad.40 in addition, at the international conference on alzheimer s disease in 2010, it was also reported that moderate to heavy physical activity is associated with a reduced risk of dementia, with up to two decades of follow - up.41 in summary, ad is increasingly being diagnosed as one of the most important medical problems in the elderly, and the management of elderly patients with ad is complex . A comprehensive approach is required that focuses on both the patient and caregiver . Despite all developments, our treatment options for prevention and treatment of the cognitive, behavioral, and psychologic symptoms of ad are still lacking . Therefore, it is important for clinicians to recognize early signs and symptoms of ad and to determine potentially modifiable risk factors.
The microvillar photoreceptors of invertebrates respond to light stimulation with a graded depolarization, called the receptor potential . Microvillar photoreceptors utilize the phosphoinositide cascade to couple photon absorption by rhodopsin to the activation of the ion channels in the plasma membrane that give rise to the receptor potential (for reviews see fein and cavar, 2000; hardie and raghu, 2001). The phosphoinositide cascade utilizes phospholipase c to generate two intracellular messengers via the hydrolysis of phosphatidylinositol-4,5-bisphosphate (pip2), * soluble inositol 1,4,5-trisphosphate (ip3), and membrane - bound diacylglycerol (dag). For limulus ventral photoreceptors the dag branch of the phosphoinositide cascade does not appear to be involved in the activation of the ion channels that give rise to the receptor potential (dabdoub and payne, 1999; fein and cavar, 2000). Rather, the evidence indicates that calcium release from intracellular stores, mediated by ip3, plays an important role in the generation of the receptor potential ., 1984; fein et al ., 1984) or calcium (payne et al ., 1986a) into the r - lobe of limulus ventral photoreceptors activates an ionic conductance with a reversal potential similar to that of the light - induced conductance . Moreover, injection of ip3 into the r - lobe releases calcium from intracellular stores (brown and rubin, 1984; payne and fein, 1987) and previous injection of calcium buffers effectively block excitation produced by a subsequent injection of ip3 (payne et al . If ip3-mediated calcium release is solely required for generating the entire light response of limulus ventral photoreceptors, it must then be true that ip3-mediated calcium release is both necessary and sufficient for generating the light response . Previous studies aimed at testing whether ip3-induced calcium release is necessary for generating the entire light response of limulus ventral photoreceptors have yielded conflicting results that make one suspicious of the conclusions based on these studies (frank and fein, 1991; faddis and brown, 1993). These studies used the aminoglycoside antibiotic neomycin, which is thought to act by binding to pip2, thereby preventing the production of ip3 and also heparin an inhibitor of ip3-induced calcium release, which appears to function by binding to the ip3-r (frank and fein, 1991; faddis and brown, 1993). The findings in these studies led to a similar suggestion, that ip3-induced calcium release only mediates a portion of the light response in limulus ventral photoreceptors or, stated differently, that visual excitation can occur in the absence of ip3-induced calcium release (frank and fein, 1991; faddis and brown, 1993). Although these studies used the same agents, a number of the experimental findings were significantly different and the reasons for these differences have never been determined; consequently, the conclusions based on these findings are suspect . The purpose of the present study was to reexamine the question of whether ip3-induced calcium release is necessary for generating the entire light response of limulus ventral photoreceptors using an inhibitor that was unavailable at the time when these earlier studies (frank and fein, 1991; faddis and brown, 1993) were undertaken . The experimental evidence as to whether ip3-induced calcium release is sufficient for generating the light response is considered in discussion . The membrane - permeable ip3-r antagonist 2apb (maruyama et al ., 1997) has proven to be an effective inhibitor of ip3-mediated calcium release in intact cells of vertebrates and invertebrates (maruyama et al ., 1997; ma et al ., 2000 2apb was not found to alter either agonist - mediated ip3 production or ip3 binding to its receptor (maruyama et al ., 1997; moreover, 2apb was found to rapidly penetrate xenopus oocytes to inhibit ip3-mediated calcium mobilization and recovery was rapid and essentially complete when 2apb was washed out (chorna - ornan et al ., 2001). When limulus ventral photoreceptors were exposed to 2apb (wang it was found that the light - activated current was inhibited in a concentration - dependent manner . Moreover, 100 m 2apb reversibly inhibited both light- and ip3-induced calcium release as well as the current activated by pressure injection of calcium into the r - lobe . Thus, 2apb has the advantage, in limulus ventral photoreceptors, of inhibiting both ip3-induced calcium release and the current activated by the released calcium . For these reasons 2apb was chosen to reexamine the question of whether ip3-induced calcium release is necessary for generating the entire light response of limulus ventral photoreceptors . Methods for removing and preparing the ventral nerves containing the photoreceptors of limulus have been described previously (fein and devoe, 1973). Briefly, ventral nerves were dissected out, desheathed, treated with 1% pronase, and pinned to sylgard in the bottom of a plexiglass chamber containing artificial sea water (asw) (in mm, 435 nacl, 10 kcl, 10 cacl2, 25 mgso4, 20 mgcl2, 10 hepes, ph 7.0). The chamber had a volume of 1.0 ml and asw superfused through the chamber at a rate of 3 ml / min . Calcium - free asw, that is egta - asw, was made by replacing the cacl2 with 1 mm egta (sigma - aldrich). An axoclamp-2a current and voltage clamp amplifier (axon instruments, inc .) Was used for intracellular recording of membrane potential or for recording membrane current when performing a two electrode voltage clamp . Cells were stimulated with white light from a 45-w tungsten - halogen bulb focused on the preparation (fein and charlton, 1975). The intensity of the unattenuated beam was 3.5 mw / cm, and stimulus intensities are given as log10 i / i0, where i0 is the unattenuated light intensity . Cells were illuminated throughout the experiments with infrared light from a substage illuminator, allowing for visualization of the photoreceptors (and substances injected into them) with an infrared - sensitive video camera (corson and fein, 1983). Cells were impaled with either one or two single barreled microelectrodes, which were formed on a p-97, flaming / brown micropipette puller (sutter instrument co.). Pressure pulses of 2040 psi having duration of 100200 ms were typically used to inject substances into cells from such electrodes . Previous work has shown that ventral photoreceptors are segmented into two lobes: an a - lobe and an r - lobe (calman and chamberlain, 1982; stern and lisman, 1982). The concentration of substances injected into cells is given as the concentration in the injection electrode . Because the cells are compartmentalized and because there is no information about how rapidly substances are metabolized by the cell actual intracellular concentrations of injected substances are not given (frank and fein, 1991). Pclamp 8 was used to record experimental data by computer (axon instruments, inc . ). Data from pclamp was output to origin 7.0 (microcal software) and coreldraw 11 (corel corp .) For final preparation of figures . 2apb (calbiochem) was stored as a 20 mg / ml stock solution in dmso, which was diluted in either asw or calcium - free asw immediately before use . Cells were exposed to varying concentrations of 2apb for 10 min, the exposure time used in a previous study that examined the effects of 2apb on limulus ventral photoreceptors (wang et al ., 2002). This ensured that the results reported here could be directly compared with these previous findings . Cyclopiazonic acid (calbiochem) was stored as a 10 mm stock solution, which was diluted in calcium - free asw immediately before use . The effects of 100 m 2apb on the initial transient and the steady - state components of the response to a 6-s step of light are shown in fig . If ip3-mediated calcium release is necessary for generating the entire light response then one would expect 2apb to block both the transient and steady - state components of the response at all light intensities . The light responses, measured under voltage clamp, at two different light intensities differing by a thousand fold in light intensity (log10i / i0 = 5.0 and log10i / i0 = 2.0) are shown in fig . 1, a and c, shows the initial components of the response on an expanded time scale and low gain because the initial light - induced currents turn on and off rapidly and are one to two orders of magnitude greater than the steady - state currents at these light intensities . Fig . 1, b and d, shows the steady - state components of the light responses at these intensities on a much slower time scale and much higher gain . It took 40 min for the cell in fig . 1 to recover from exposure to 100 m 2apb . It can also be seen that 2apb slows the rising phase of the light response . Light - induced currents measured under voltage clamp before, in the presence of 100 m 2apb, and 40 min after recovery from exposure to 2apb . In b and d the initial component of the responses go off scale except for the response at log10i / i0 = 5.0 in the presence of 2apb . The responses are presented in this way in b and d so that the effect of 2apb on the steady - state components of the responses can be visualized . The bar above the records in b and d shows the time of occurrence of the 6-s light stimulus . The first 0.5 s of the responses during the light stimulus in b and d are shown on an expanded time scale and at much lower gain in a and c, respectively . The responses are shown this way in a and c so that the effect of 2apb on the initial transient components of the responses can be visualized . For this particular cell the light responses after washout of 2apb exceeded those before exposure to 2apb; this was not a consistent finding . Typically, when recording from cells the light sensitivity will often decrease as time progresses; however, sometimes, as in this cell, the sensitivity to light will improve a small amount over time . Also note that after the initial peak current there is a small overshoot before the current reaches a plateau (fig . 1 are from an experiment that examined the effects of 2apb on the light response over a much wider range of light intensities, the results of which are summarized in the graph of fig . The experiment was performed on a total of 14 cells, 8 of which did not exhibit any recovery of sensitivity after exposure to 2apb . Moreover, these eight cells exhibited the greatest degree of desensitization in the presence of 2apb . Experience over many years has shown that cells impaled with two microelectrodes and stimulated with the high intensity lights used in these experiments don't survive very well for the times (4060 min) required for these experiments . Therefore these eight cells were classified as damaged and the data obtained from them was excluded from further analysis . The remaining six cells all exhibited approximately the same degree of desensitization in the presence of 2apb (see fig . 2) and all exhibited significant recovery of sensitivity after exposure to 2apb, with two of the six exhibiting complete recovery of sensitivity . The absolute values of both the peak inward current and steady - state inward current, for these six cells, are plotted as a function of the intensity of a 6-s step of light in fig . 2 were obtained by stimulating the photoreceptor once a minute with steps of light of increasing intensity . The graphs in fig . 2 demonstrate that 100 m 2apb reversibly inhibits both the initial transient and steady - state components of the light response at all intensities, except perhaps at the highest intensities (see also fig . Intensity response function for the absolute value of the initial transient (, control;, 100 m 2apb) and steady - state (, control;, 100 m 2apb) components of the light response measured under voltage clamp . The data were obtained before and in the presence of 100 m 2apb for each of six cells . Data obtained 40 min after returning to asw after exposure to 2apb is also included for the two cells that completely recovered from exposure to 2apb . Each intensity response function was obtained by stimulating the photoreceptor once each minute with a 6-s step of light of increasing intensity . The intensity response function in the presence of 2apb was obtained starting 10 min after first exposing the cell to 2apb . The absolute values of the peak of the initial transient and of the steady - state before turning off the light stimulus was measured at each light intensity . The values for log10i / i0 = 5.0 and 2.0 include the data in fig . The data are plotted as the mean sd . To determine whether 2apb inhibited the light response for the highest intensities it was necessary to examine the effects of concentrations higher than 100 m . To go to higher 2apb concentrations and still have reversibility, cells, impaled with only one microelectrode used for current clamp, typically survive much better than cells impaled with two microelectrodes . Measurements made in current clamp underestimate the desensitization caused by 2apb as a result of inhibition of the voltage gated outward current, thereby increasing the input resistance of the cell for depolarizing current responses (wang et al ., 2002). 2apb inhibits the light - activated current but since it increases the input resistance of the cell the inhibition of the receptor potential will be less than that of the light - activated current, hence the desensitization will be underestimated . Cells were exposed to varying concentrations of 2apb for 10 min and the effect on the sensitivity to a 40 ms flash of light was determined (fig . At 10 m 2apb the photoreceptors were desensitized about threefold and at 100 m the desensitization was 100-fold . This degree of desensitization is significantly less than what was measured under voltage clamp at these same concentrations (wang et al ., 2002), which is consistent with current clamp measurements giving an under estimate of the desensitization caused by 2apb . At 300 m 2apb 3 b juxtaposes dark - adapted light responses at and above threshold in the presence and absence of 300 m 2apb . It took this cell 1 h and 45 min to fully recover from exposure to 300 m 2apb . The light response for a 40-ms flash of intensity log10i / i0 = 0.0, the maximum intensity available from the light source, is reduced to only 20 mv (fig . 3 b), indicating that 2apb inhibits the light response at all light intensities . 3 b) was a consistent finding at all concentrations of 2apb that desensitized the photoreceptor . In contrast to this slowing of the light response by 2apb, desensitization of the photoreceptor by light or calcium injection is associated with a speeding up of the entire light response (fein and charlton, 1977). The change () in sensitivity was measured as the log10 of the change in light intensity needed to evoke a 10-mv criterion response to a 40-ms flash of light at different concentrations of 2apb . The change in sensitivity was measured after 10 min of exposure to 2apb . The recovery time from exposure to 2apb varied from 15 min at 10 m 2apb to 1 h and 45 min at 300 m 2apb . (b) dark - adapted light responses at and above threshold in the presence and absence of 300 m 2apb . These light responses correspond to the circled data point in a. the role of a light - induced cai increase in visual excitation of limulus ventral photoreceptors has been intensely investigated independent of whether or not the increase results from ip3-induced calcium release . Pharmacological means have been used to either empty the intracellular calcium store or to block the rise in cai . Intracellular injection of calcium buffers, to inhibit the light - induced rise in cai, greatly inhibit the light response for dim light flashes and slows the time course of the response at all light intensities (lisman and brown, 1975; payne and fein, 1986; frank and fein, 1991; shin et al ., however, no matter how much calcium buffer is injected into the photoreceptor, the light response for intense flashes persists, although the time course of the response is greatly slowed . 1991), also inhibits the response to a flash at dim intensities and slows the response to intense flashes (ukhanov and payne, 1995; dorlochter et al ., 1999; payne and demas, 2000). If intracellular - injected calcium buffers and exposure to cpa are only partially effective at blocking the light - induced rise in cai near the plasma membrane then the light response remaining in their presence might result from a residual cai increase that is greatly slowed by these agents . Assuming that the light response remaining in the presence of these agents is in fact the result of a residual ip3-induced cai increase, then the residual response should be blocked by 2apb . 4, a and b, were obtained from two ventral photoreceptors that were injected with the calcium buffer bapta . 4 b. the light responses labeled before were obtained immediately after bapta injection and are typical of the light responses observed in cells loaded with calcium buffers (lisman and brown, 1975; payne and fein, 1986; frank and fein, 1991; shin et al ., 1993). The rising and falling phases of the responses are greatly slowed (compare with the time course of the responses in fig . 1) and the initial transient is decreased in amplitude, whereas the amplitude of the steady - state component of the response is greatly increased in amplitude (compare with the data in fig . 2 for the same light intensity). 4 b was injected with bapta until one could not distinguish the initial transient from the steady - state of the response . During exposure to 100 m 2apb the light - induced currents were greatly reduced in amplitude in their entirety, and upon return to asw the responses partially recovered . Similar results were seen in 4 other cells, and in all cases there was only partial recovery of the light response upon returning to asw after exposure to 2apb . This finding is consistent with the idea that the light responses in cells injected with calcium buffers are the result of ip3-induced calcium release giving rise to a cai increase . The cells in a and b were impaled with two microelectrodes, a current passing electrode containing 2 m kcl, and an injection electrode containing the injection solution (see materials and methods) to which 100 mm bapta was added . The cells were repeatedly stimulated once a minute by a 6-s step of light of intensity log10i / i0 = 4.0, the occurrence of which is indicated by the bar above the superimposed responses in a and b. the cells were injected with bapta until the responses labeled before were obtained . These light responses are typical of those obtained from cells injected with bapta or other calcium buffers . The responses labeled 100 m 2apb were obtained 10 min after switching to asw + 100 m 2apb and the responses labeled recovery were obtained 20 min after returning to asw . In these two cells and in another four cells studied similarly there was only partial recovery from the desensitization caused by exposure to 100 m 2apb . The same protocol as used previously (ukhanov and payne, 1995; dorlochter et al ., 1999; payne and demas, 2000) to try and empty the intracellular calcium stores was used in the experiment illustrated in fig . After obtaining a stable recording, the cell was repeatedly stimulated once a minute with an intense (log10i / i0 = 2.0) 40-ms flash and switched to a bathing solution of 0 ca + 1 mm egta (see materials and methods). After 15 min in this solution the cell was bathed for an additional 45 min in the same 0 ca + 1 mm egta solution to which 100 m cpa was added to try and empty the ca stores . After 45 min in cpa, as expected, a large slow light response was obtained (response 1 in fig . The cell was then exposed to a bathing solution of 0 ca + 1 mm egta + 100 m cpa to which 100 m 2apb was added . After 10 min in this solution the light response was dramatically suppressed (response 2 in fig . 15 min after returning the cell to a bathing solution of 0 ca + 1 mm egta + 100 m cpa the light response recovered substantially, albeit not completely (response 3 in fig . 5 were seen in four other cells, and in all cases there was only partial recovery of the light response . This experiment was done in current clamp because cells impaled with only one electrode exhibited significantly better recovery after these exposures than cells impaled with two electrodes . This finding is consistent with the idea that the light response in cells treated with cpa, to empty the ca stores, is actually the result of residual ip3-induced calcium release giving rise to an increase in cai . 2apb inhibits the response to a light flash in a photoreceptor treated with cpa to empty the ca stores . The cell was impaled with a 2 m kcl containing microelectrode that was used to record the light response to a 40-ms flash (indicated by the black arrow below the superimposed traces) of intensity log10i the cell was then exposed to the indicated bathing solutions for the times indicated in a. the times at which each of the superimposed light responses labeled 1, 2, and 3 in b were recorded are indicated in a. the purpose of the experiments described in this study was to determine whether ip3-induced calcium release is necessary for generating the entire light response of limulus ventral photoreceptors . For this purpose 2apb has been shown to inhibit calcium release by the ip3-r in limulus ventral photoreceptors and also to inhibit the current activated by pressure injection of calcium into the light sensitive lobe of the photoreceptor (wang et al ., 2002). Thus, it is an excellent tool for investigating the role of ip3-mediated calcium release in visual excitation of the photoreceptor . In accord with the hypothesis being tested, 2apb was found to inhibit the response to a flash of light at all light intensities (see fig . 3) and to inhibit the entire light response to a step of light, that is both the initial transient and the steady - state components of the response, at all intensities tested (see figs . 1 and 2). 2apb has been found to inhibit ip3-mediated calcium release in the concentration range from 10300 m in intact cells and broken cells of both vertebrates and invertebrates (maruyama et al ., 1997; ma et al ., 2000 this is precisely the concentration range over which 2apb inhibits the light response in limulus ventral photoreceptors (wang et al ., 2002) and this finding suggests that the effects of 2apb in ventral photoreceptors result in part from its ability to block ip3-mediated calcium release . As mentioned in results, the intracellular injection of calcium buffers has been used to examine the role of a rise in cai in generating the light response of limulus ventral photoreceptors . In a number of cases the inability of calcium buffers to block the response to bright lights has been interpreted to indicate that a rise in cai is not necessary for generating the light response of limulus ventral photoreceptors (lisman and brown, 1975; payne and fein, 1986; frank and fein, 1991; faddis and brown, 1993). This interpretation was reconsidered under the assumption that calcium release during steady light in limulus ventral photoreceptors is sufficiently great to saturate the calcium buffers even when the buffers are injected to concentrations greater than 20 mm (shin et al ., 1993). With mathematical modeling of the effects of calcium buffers on the rise in cai in a well - mixed compartment, together with the assumption that calcium influx into the compartment is sufficient to saturate the calcium buffer, these authors proposed that a rise in cai is necessary for generating the light response of limulus ventral photoreceptors . 4, which show that light responses obtained in the presence of the calcium buffer bapta are reversibly inhibited by 2apb, indicating that these light responses result from ip3-mediated calcium release giving rise to an increase in cai . The inability of treatment of limulus ventral photoreceptors with cpa, an inhibitor of endoplasmic reticulum calcium pumps, to block the light response for bright flashes has been interpreted to indicate that a rise in cai is not necessary for generating the light response of limulus ventral photoreceptors (ukhanov and payne, 1995; dorlochter et al . This interpretation was dependent on the finding that treatment with cpa blocked the flash - induced rise in cai, detected with calcium - sensitive dyes, yet failed to block the membrane depolarization resulting from the flash (ukhanov and payne, 1995; payne and demas, 2000). Just because a rise in cai is not detected does not necessarily imply that a rise in cai is not occurring, it might be that the method used is not sensitive enough to detect the reduced rise in cai after treatment with cpa . 5 that show that the light response obtained after cpa treatment is reversibly inhibited by 2apb, indicating that the light response results from ip3-mediated calcium release and a consequent rise in cai . How can it be that the rise in cai that activates the ion channels in the plasma membrane still occurs in the presence of calcium buffers injected to concentrations> 20 mm and after treatment with cpa, which makes the cai rise itself undetectable? The answer most likely lies in the structure of the light - sensitive r - lobe of limulus ventral photoreceptors (calman and chamberlain, 1982). The r - lobe is specialized for light sensitivity and is covered by visual pigment containing microvilli over its external surface . For this discussion the other important structure of the r - lobe is the palisade of closely apposed endoplasmic reticulum that lies just below and within a distance of 0.1 m of the microvillar membrane . Narrow cytoplasmic bridges connect the narrow compartment between microvilli and the endoplasmic reticulum to the rest of the cytoplasm . In response to light, ip3 is produced in the microvilli from which it diffuses to the endoplasmic reticulum causing calcium to be released into the narrow space between the endoplasmic reticulum and the microvilli . Under normal circumstances the released calcium diffuses from this space throughout the cytoplasm of the r - lobe (payne et al ., 1988). However, it is only the cai rise at the plasma membrane in this narrowly confined space that is the actual signal responsible for the opening of the light - activated ion channels in the plasma membrane . Calcium released from the endoplasmic reticulum only needs to saturate the calcium buffer present in this narrowly confined space in order to open the ion channels in the plasma membrane . Furthermore, the laser beam, which fails to detect the cai rise after exposure to cpa, is measuring the average cai in a much greater volume of the cytoplasm than this narrowly confined space . Previously, the only really significant evidence against the suggestion that ip3-induced calcium release is necessary for generating the entire light response of limulus ventral photoreceptors was the evidence with cpa and calcium buffers discussed above . If the results of this study are accepted then the evidence reviewed below, together with these results, imply that ip3-induced calcium release is necessary for generating the entire light response of limulus ventral photoreceptors . It should be kept in mind that the experimental findings in this study are totally dependent on the specificity of 2apb . First, calcium injection appears to activate the light - sensitive conductance, and the light - induced rise in cai has the necessary properties for it to play the role of an intracellular messenger of visual excitation . (a) the light - induced rise in cai has been detected with a variety of experimental methods (brown and blinks, 1974; brown et al . 1995), and this rise in cai is largely confined the r - lobe (payne and fein, 1987) and is dominated by calcium release from intracellular stores (brown and blinks, 1974). (b) the rise in cai precedes the electrical response to light over a wide range of light intensities (ukhanov and payne, 1995; payne and demas, 2000). (c) the light - induced rise in cai during steady illumination is graded with the intensity of light over a wide range of light intensities (levy and fein, 1985; ukhanov et al ., 1995). (d) reduction of the amount of calcium in the intracellular stores reduces the sensitivity to light (bolsover and brown, 1985; dorlochter et al ., 1999). (e) intracellular pressure injection of calcium activates a conductance with reversal potential and sodium permeability similar to that of the light sensitive conductance (payne et al . (f) intracellular pressure injection of calcium buffers with free calcium of 5 or 45 m irreversibly activate sustained inward currents with reversal potentials similar to that of the light - sensitive conductance (shin et al ., 1993). (g) rapid release of calcium by flash photolysis of caged calcium activates an inward current within a few milliseconds (ukhanov and payne, 1997). Second, the light - induced release of calcium from intracellular stores in limulus ventral photoreceptors appears to result from ip3-induced calcium release . Moreover, ip3-induced calcium release appears to activate the light - sensitive conductance via a rise in cai . (a) there is a light - induced rise in ip3 (brown et al ., 1984). (b) intracellular pressure injection of ip3 causes a transient rise in cai (brown and rubin, 1984; payne et al ., 1986b). (c) 2apb reversibly inhibits both light- and ip3-induced calcium release (wang et al ., 2002). (d) intracellular pressure injection of ip3 transiently activates a conductance with reversal potential and sodium permeability similar to that of the light - sensitive conductance (brown et al ., 1984; fein et al ., 1984; payne et al ., 1986b), and prior injection of calcium buffer inhibits the activation of the conductance by ip3 (payne et al ., 1986b). Although the evidence strongly supports the conclusion that ip3-induced calcium release is necessary for generating the entire light response of limulus ventral photoreceptors, these findings should not be interpreted to indicate that ip3-induced calcium release is also sufficient for generating the entire light response . Stimulation of limulus ventral photoreceptors with a step of light results in a steady elevation of cai and a maintained depolarization (levy and fein, 1985). When measured under voltage clamp a steady inward current is found to be responsible for the maintained depolarization (see fig . If ip3-mediated calcium release is sufficient for generating the entire light response then one might predict that it should be possible to mimic the maintained depolarization and maintained rise in cai by intracellular pressure injection of ip3 into the photoreceptor . In contrast to this prediction, intracellular injection of ip3 in limulus ventral photoreceptors often induces discrete bursts of depolarization (brown et al ., 1984; fein et al ., 1984) that are accompanied by discrete bursts of increases in cai (corson and fein, 1987). Likewise, injection of hydrolysis - resistant analogs of ip3 result in the production of similar bursts of depolarization that are also accompanied by bursts of increases in cai (payne and potter, 1991; vallet and fein, 1997). In all of these studies neither a maintained steady depolarization nor a steady elevation of cai was ever observed . Until the reason for this discrepancy is determined it cannot be concluded that ip3-induced calcium release is sufficient for generating the entire light response of limulus ventral photoreceptors . It is possible that the discrepancy arises somehow from differences in the way that light and intracellular pressure injection elevate the concentration of ip3 in the cytoplasm . For light, one would expect the ip3 concentration to be raised near the plasma membrane in the vicinity of each rhodopsin that effectively absorbs a photon . Whereas pressure injection of ip3 delivers a large bolus of ip3 to one location in the cytoplasm.
Anterior cervical discectomy and fusion is a commonly performed surgery for the treatment of spondylosis, radiculopathy, myelopathy, and trauma . Esophageal perforation is an exceedingly rare complication following anterior cervical discectomy and fusion (acdf). The incidence of these complications ranges from 0.02 to 1.52% although is higher when it is a result of trauma . We describe a case of a 24-year - old man who underwent acdf and corpectomy following a motor vehicle accident who developed delayed onset aspiration pneumonia and dysphagia requiring surgical repair of an esophageal perforation . To the best of our knowledge there has been no prior literature discussing airway management in patients who underwent esophageal repair for perforation following cervical spine surgery . We believe this paper will provide a deeper understanding to the intensivist in regards to postoperative airway management in this type of patient . A 24-year - old man presented to an outside hospital following a motor vehicle accident with cervical spine fractures of c5 - c7, anterolisthesis of c6 and associated spinal cord transection with resulting quadriplegia . The patient was taken to the operating room and underwent anterior cervical decompression and fusion (acdf) of c5 - 7, c6 corpectomy with polyetheretherketone (peek) cage and c4 - t1 posterior fusion [figure 1a]. Postoperatively the patient did well and was discharged to a rehabilitation center at our institution . Lateral cervical x - ray shows c4-t1 posterior fusion with c5-c7 acdf and peek cage at the level of c6 with no apparent hardware defects (a) ct neck demonstrated air surrounding the implant at c6 as well as the anterior fusion plate (b) barium swallow study showed a posterior esophageal barium leak at c5-c6 and a te - fistula . The contents of the fistula are seen tracking inferiorly t1 and is seen anterior to the fusion plate (c) barium swallow study done ten days postoperatively shows resolution of perforation (d) approximately four months following his surgeries the patient began to develop increased sputum production, cough and fever ., the aspiration was thought to be due to the patient's poor pulmonary clearance from his immobility and quadriplegia . While on antibiotic therapy for aspiration pneumonia the patient developed acute dysphagia . Computed tomography (ct) scan demonstrated air surrounding the implant at c6 as well as the anterior fusion plate [figure 1b]. Barium swallow revealed an esophageal defect with contrast tracking down the prevertebral space to the level of t1 anterior to the cervical fusion plate as well as a tracheo - esophageal fistula [figure 1c]. The patient underwent removal of the anterior plate, which was visualized in the pharyngoesophagus during intraoperative video - assisted laryngoscopy, removal of peek cage and placement of antibiotic impregnated bone cement, primary repair in conjunction with a sternocleidomastoid muscle flap being placed on the esophageal defect [figure 2]. Postoperatively, the patient remained intubated with the ngt to remain in place for one week . The patient was extubated over a soft 22-french exchange catheter without incident and repeat barium swallow study demonstrated resolution of the esophageal perforation [figure 1d]. Anterior cervical discectomy and fusion (acdf) has been the mainstay treatment of patients with radiculopathy or myelopathy attributed to cervical spine disease, particularly herniated nucleus pulposus . In the trauma setting, vertebral body fracture may require corpectomy in which acdf is typically performed in conjunction with posterior instrumentation . Esophageal perforation is a more rare and potentially life threatening complication occurring in 0.02 - 1.52% of patients . Identifying patients with esophageal perforation can be difficult as the clinical presentation and initial onset is highly variable . Presentation with dysphagia, choking, aspiration, pain, fever or subcutaneous emphysema can all be postoperative complaints typically seen in up to 9.5% of patients . The placement of an anterior cervical plate improves fusion rates and reduces risk of graft migration . Additionally, chronic compression of the esophagus against the anterior cervical plate during swallowing can result in pressure necrosis and eventually perforation and fistula formation . Diagnosis of esophageal perforation can be challenging due to the delayed and variable clinical presentation . In addition to computed tomography (ct) scan, upper endoscopy, barium contrast studies, and bronchoscopy are the most informative studies to determine the location and extent of perforation . Proper management of esophageal perforation is very important as its associated mortality rate is high . A conservative approach including nil per os (npo), with temporal parenteral nutrition by either ng or peg tube and broad - spectrum intravenous antibiotics may be appropriate in a very select group of patients where perforation is incidentally found and are asymptomatic . Spontaneous healing of these injuries may take four to twelve weeks however, this conservative approach is associated with a 20 - 45% rate of abscess formation . The use of a sternocleidomastoid (scm) muscle flap has been considered the gold standard to achieve and maintain perforation closure as without it esophageal sutures will invariably fail . The scm is a highly mobile and vascularized medium that can improve antibiotic delivery, wound healing and provides a physical barrier between the esophagus and the cervical spine . Important considerations when extubating is the degree of healing following esophageal perforation repair, mallampati grade, as well as the possible need and risks of reintubation in an airway emergency . Although most reports describe waiting approximately 10 - 14 days postoperatively before resuming oral feeds, our patient was successfully extubated and tolerated oral feeds suggesting this period of time to be sufficient for would healing . In our patient, although rare, esophageal perforation can occur following accidental esophageal intubation and is of clear concern in patients who underwent esophageal repair . Risk of perforation is higher when inexperienced individuals attempt intubation, difficult intubation requiring multiple attempts, as well as in emergency scenarios . When the patient has satisfied all weaning parameters and has a present cuff leak we strongly recommend that an experienced anesthesiologist be present for extubation and have all appropriate airway devices available including a fiberoptic bronchoscope . The more rigid and thicker bougie should be avoided due to their risk of trauma . A small hole should be made in the facemask such that the exchange catheter may pass through while the patient receives 8 - 10 l of oxygen for typically 30 - 60 minutes . This will allow for a more controlled and safer reintubation in the event the patient fails extubation and therefore reduce the potential risk of reperforation . Greater vigilance is required in the event reintubation is required as perforation of the surgical repair site is of great concern . Therefore, it is our recommendation that an experienced anesthesiologist be present for extubation and that all appropriate airway devices are available including a fiberoptic bronchoscope.
A mobile aortic thrombus in a non - atherosclerotic, non - aneurysmal aorta and is not a common finding . A mobile aortic thrombus is a potential source of visceral, cerebral and peripheral embolism . The management of a mobile aortic thrombus is not well established because of its rare occurrence . Management of a mobile aortic thrombus includes systemic anticoagulation, aortic thromboendarterectomy or covered stenting . Here we describe a case of acute mobile aortic thrombus with renal infarction, which was successfully treated with hybrid surgery using wire - directed balloon catheter thrombectomy . A 44-year - old woman was diagnosed with advanced gastric cancer (t4n3) for which total gastrectomy was performed . She received cisplatin (92 mg / day for 4 days) and 5-fluorouracil (1,530 mg / day for 1 day). Two days after the 1st chemotherapy, the patient presented with a sudden onset of right flank pain and dizziness . A large thrombus was identified in the abdominal aorta at the origin of the renal arteries, and it involved the right renal artery causing renal infarction (fig . The ct scan prior to the chemotherapy showed a normal aorta at the origin of the renal arteries . Initial laboratory findings were within normal limits; prothrombin time international normalized ratio 1.01, activated partial thromboplastin time 33.7 seconds, protein c activity 125%, antithrombin iii 108%, blood urea nitrogen 13.8 mg / dl, creatinine 0.74 mg / dl, except for protein s activity 56% . Only protein s activity was lower than the normal limit (71 to 103%). A therapeutic intravenous infusion of unfractionated heparin was commenced . To minimize surgical burden to the patient who was on her 17th day after major surgery a transbrachial aortic angiogram was performed, which revealed a large filling defect in the aorta just at the origin of the renal arteries and there was no flow to the right renal artery . A cut - down of the right common femoral artery and a puncture of the left common femoral artery were performed . After gaining percutaneous access, a 10 40 mm balloon (ev3 inc ., plymouth, mn, usa) was placed to occlude the left iliac artery to prevent contralateral embolization . And then, a 5 20 mm balloon (cordis co., miami lakes, fl, usa) was used to occlude the left renal artery (fig . Wire - directed balloon catheter thrombectomy was performed using a 5f over - the - wire fogarty catheter (lemaitre vascular inc ., the aortic thrombus was macerated using a trerotola mechanical thrombectomy device (arrow international inc ., reading, pa, usa). A wire - directed balloon catheter thrombectomy was then performed using a 27 mm equalizer balloon catheter (boston scientific, cork, ireland, usa). The completion angiogram demonstrated no residual thrombus with no embolus in the left renal artery or in the bilateral lower extremity arterial systems (fig . 3). Left renal balloon occlusion was maintained for 41 seconds and the left kidney function was preserved after reperfusion . We used about 150 ml of contrast media (visipaque injection, 270 mgi / ml; amersham health, cork, ireland) and the postoperative creatinine level was 0.98 mg / dl . Chemotherapy was stopped after thrombectomy and the patient received systemic heparinization for 1 week and then received antiplatelets including aspirin, cilostazol, and atorvastatin calcium, indefinitely . Follow - up ct scan 7 days after the procedure showed complete resolution of the thrombus (fig . Eighteen days after the procedure, chemotherapy was restarted with only 5-fluorouracil, because cisplatin has renal toxicity and can cause another thrombus . Mobile aortic thrombus is a rare pathology and is an important source of arterial emboli . Mobile aortic thrombus mostly occurs in the distal aortic arch in the presence of severe diffuse atherosclerotic disease and has been reported in hypercoagulable patients . In our case, however, the mobile aortic thrombus is thought to have developed due to the chemotherapy as there was no evidence of atherosclerotic disease, aneurysmal dilatation of the aorta . Because protein s activity was diminished, there is the possibility of protein s deficiency . But chemotherapy agents have been documented as possible causes of acute arterial thrombosis licciardello et al . Reported that cisplatin induced increase in the von willebrand factor concentration, which increases the risk of arterial occlusive complications . Unfortunately, the von willebrand factor concentrations in this patient were not investigated before chemotherapy . While there are increasing number of reports on thoracoabdominal aortic thrombus as a cause of embolism, the optimal treatment is remains controversial . Systemic anticoagulation, aortic thromboendarterectomy or placement of stent graft were reported as treatments of a mobile aortic thrombus [5 - 8]. Complete disappearance or a reduction in the size of the thrombus has been reported with the use of anticoagulation alone . Kim et al . Suggested a strategy beginning with low molecular weight heparin as the first line of treatment, followed by surgical thrombus removal if the thrombus persists or recurrent embolism occurs during anticoagulation therapy . In contrast, other investigators have recommended an aggressive surgical approach using aortic thromboendarterectomy . The management of mobile aortic thrombus is not well established because of its rarity, and there are few comparative studies . Recently, some cases were reported in the literatures that support the endovascular approach of aortic thrombus . They attempted to manage mobile thrombus of the thoracic aorta with endovascular approach, specifically with stent graft, and showed successful results . However, our case could not be treated with a covered stent because the aortic thrombus was in the aorta right at the origin of the renal arteries . So, we performed thrombectomy using a wire - directed balloon catheter with occlusion balloons . Another method to prevent distal embolization is using a filter, which was not available in our institution . In our case, therefore, we used a mechanical thrombectomy device for maceration of the aortic thrombus; trerotola device (arrow international inc .) With a 5f rotating nitinol basket fragmentation cage . We intended the wires of the basket directly contact the thrombus, not injuring the aortic wall, and we carefully performed maceration of the aortic thrombus . Yet, it has risks of peripheral embolization of the clot particles and vessel wall injury . Because of the irreversible infarction of the right kidney at more than 29 hours, we did not perform wire - directed thrombectomy for the right renal thrombus . In our case, chemotherapy was discontinued after hybrid treatment and the patient took systemic heparinization for 1week, then oral antiplatelets . Antiplatelets have a proven efficacy in acute treatment and prevention of arterial thrombosis because a thrombus that forms in arteries are rich in platelets, as opposed to a fibrin - rich thrombus that forms in veins . In conclusion, we report here on the successful treatment of a mobile abdominal aortic thrombus by hybrid treatment performing balloon catheter thrombectomy . Our case shows that this technique is a feasible, minimally invasive treatment for a symptomatic mobile abdominal aortic thrombus.
The utilization of hospital beds by alc patients can contribute to a decrease in acute care capacity, emergency department overcrowding, increase wait times for elective surgical procedures, surgical cancellations, and patient flow inefficiencies throughout the entire health - care system . According to the canadian institute of health information (cihi), alc patients account for 14% of all hospital days, with 5,200 acute beds in canadian hospitals being occupied by alc patients on any given day . The median length of hospital stay for alc patients was 26 days, which included both the acute and alc portion of the hospitilization . While alc patients can compromise an acute care hospital s ability to operate efficiently, little is known about who these patients are and the factors that contribute to their alc designation . Although cihi has provided a number of informative reports and briefs on alc in recent years, these reports are limited to those alc patients who have been discharged from hospital or have died . Data about a patient s functional, cognitive, and health status before and during their hospitalization are limited . In addition, information pertaining to their living arrangements and health - care utilization prior to hospital admission is lacking . A better understanding of these factors may help to identify strategies to support these patients to remain in the community and to avoid acute care hospitalization . Given the projected increase in the prevalence and incidence of dementia across canada, there is a sense of urgency to better understand how dementia relates to alc patients . Dementia is known to be a risk factor for institutionalization and it is expected that many of the alc patients waiting in hospital have dementia . Costa and hirdes reported that non - alzheimer s dementia accounted for just over 30% of their alc sample, and those with alzheimer s disease comprised 10% of their sample . Because little is known about the alc population that continues to wait in hospital, the purpose of this study was to systematically identify select social and health characteristics of hospitalized patients who were designated as alc . A retrospective design was used to obtain data on patients designated as alc in two hospitals . All patients identified by discharge planners as being alc in the hospitals on july 1, 2009 were included . One hospital was a 104-bed facility that offers specialized in - patient geriatric services, including a geriatric evaluation and management unit (21 beds), a restorative care unit (21 beds), a cognitive assessment and management unit (20 beds), and two transitional care units (42 beds). These facilities service a population of approximately 173,000, of whom 27,150 are over the age of 65 . The charts were reviewed and data were extracted using a data collection tool designed specifically for this study . A group of content experts, including a geriatrician, a nurse specialized in geriatric care, and an academic nurse, participated in the development of the tool . Data collected included demographics, living arrangements and home supports prior to admission, instrumental and basic activities of daily living prior to and during hospitalization, hospital admissions and emergency room visits one year prior to admission, reasons for the hospitalization, diagnosis of dementia, past medical history, in - hospital falls, and in - hospital transfers . One of the authors (pn) and a research assistant extracted the data from the charts . Twenty - two charts were randomly selected by one of the authors (rm) for determination of inter - rater reliability . Means of quantitative variables were compared through a one - way anova, while categorical variables were analyzed using chi - square methods . This study was approved by the research ethics boards of horizon health network and the university of new brunswick saint john . There were 181 patients identified as being alc, which comprised 33.0% of all hospital beds within the two facilities . Of these, 57 were in the specialized geriatric hospital (104 beds) occupying 54.8% of the beds, and 124 patients were in acute care beds in the tertiary care hospital (444 beds), occupying 27.9% of these hospital beds . Charts were unavailable for two patients in the tertiary hospital . The final sample consisted of 179 patients . There were 116 (64.8%) females in the sample, and the average age of all patients was 79.3 (sd 12.7) years . The tertiary care hospital had more alc patients who were older than 94 years and younger than 65 years, compared to the specialized geriatric facility . A total of 162 (90.5%) patients in the sample were admitted from home and 42.4% (n=76) were living alone (table 1). A total of 75 (41.9%) had a notation in their chart indicating that they were receiving formal supports (paid) in their home prior to admission (table 2). Of those who received formal supports prior to admission, 43 (57.3%) had support seven days a week and 20 (26.7%) had 24-hour care . There was documentation in 61 (37.7%) of the charts indicating that the patient and/or family did not believe the supports in place prior to admission were adequate to meet the needs of the patient . There was no significant difference between the patients in the two hospitals with respect to the number of home supports in place prior to the admission (table 2). The majority, or 148 (83.7%) of the sample, were admitted to hospital through the emergency department . The most common reason for admission was related to a general medical illness such as weakness, diarrhea, and infections . The next most common reasons for admission were falls and dementia (figure 1). While 18 (10.1%) were admitted with a diagnosis of acute confusion, 123 (68.7%) had documentation of increased confusion or delirium at the time of the admission . Of the total sample, 81 (45.3%) had a diagnosis of dementia prior to admission and 33 (18.4%) were diagnosed during their hospitalization . Only 28 (34.6%) of those with a diagnosis of dementia prior to admission were taking a cholinesterase inhibitor . A diagnosis of dementia was common, affecting 114 (63.6%) of the sample . When the sample was stratified into three groups (diagnosis of dementia prior to admission, diagnosis of dementia during hospitalization, and no dementia), there was a significant difference in the mean ages (p .0001) and the average number of medications taken (p = .003) among the three groups (table 3). Within the total sample, the patients had a mean of 4.6 (sd 2.1) (range 010) chronic health conditions . Hypertension was the most common (55.3%), followed by ischemic heart disease (41.0%), diabetes (25.7%), chronic obstructive pulmonary disease (20.7%), and stroke (26.2%) (table 3). Patients were on a mean of 6.9 (sd = 4.2) scheduled medications at home prior to admission . Only 11 (6%) of the patients were on no medications, 30 (17%) were taking 13 medications, 32 (18%) were taking 45 medications, 61 (34%) were taking 69 medications, and 45 (25%) were taking 10 or more medications . The mean length of stay in hospital, from the date of admission until july 1, 2009, was 379.6 days (sd = 687.7). The median length of stay was 182 days, with a minimum of 5 days and maximum of 6,856 days . Less than 2% of the sample had a length of stay less than 1 month and 5% had a length of stay greater than 10 years (figure 2). During their hospitalization, 75 (41.8%) of the participants fell at least once . Of those who fell, 25 (33.3%) fell once, 34 (45.3%) fell 24 times, 12 (16.0%) fell 58 times, and 4 (5.3%) fell more than 10 times . During their hospital stay, only four participants remained on the same nursing unit where they were originally admitted to . Participants were transferred on average 4.2 times (range 122) between nursing units . At the time of admission to hospital, 138 (77.1%) were independent ambulators with or without a walking aid . More than half (59.2%) used either a cane or walker prior to admission . With respect to activities of daily living, 115 (64.2%) were independent for toileting, 83 (46.3%) independent for bathing, and 125 (69.8%) were independent for feeding . Overall, there were declines in mobility and activities of daily living within the sample (figure 3). A total of 111 (62%) of the sample had not been hospitalized (figure 4) and 73 (40.8%) had not been in the emergency room in the year prior to their current alc hospitalization (figure 5). The majority of the sample 154 (86.0%) were approved and waiting for a nursing home bed, 7 (3.9%) were waiting for a special care home, and 6 (3.4%) were waiting for home services . Data were not available about discharge plans on 12 (6.7%) of the patients (table 1). Alc patients occupied 27.5% of acute care beds in the tertiary care hospital and 54.8% of the hospital with specialized geriatric services on the particular day that this study was conducted . While not completely comparable, these rates appear to be higher than what cihi reports as 14% of all hospital bed days being occupied by alc patients . This may be explained by the fact that cihi reports only on patients who are discharged from hospital or who have died in hospital . It is also possible that alc patients in new brunswick wait longer in hospital before being transferred to an appropriate level of care in the community . Comparing the number and availability of long - term care beds across canada is difficult because there are variations across provinces with respect to what long - term / supportive care options are available in the community, and there are also differences in the terminology and admission criteria used in the various facilities / services available in each province . The canadian health services research foundation did report in 2010 that the national average number of long - term care beds available in canada was 93.6 per 1,000 population 75 years and older, compared to 80.9 in new brunswick . Alc were waiting for a long - term care facility, which exceeds the 46% reported in the paper by costa et al . This suggests that the supply of long - term care beds in new brunswick is not meeting demand and likely contributes to the large number of alc patients waiting in hospital . The majority of alc patients admitted from home had paid home care seven days a week with many having 24-hour paid care . Even with these supports in place, over one - third had documentation in their charts indicating that the patient and/or family were aware that the home support was inadequate prior to admission . What is not clear from the data is whether or not these patients / families sought assistance to increase their home care prior to the hospitalization . Coleman and colleagues previously reported that older patients and their families do not always seek additional supports even when they recognize changing or unmet needs . The use of community - based interdisciplinary teams to provide integrated health and social care to frail older have been shown to reduce the number of alc admissions by 50% . The intervention tested by beland and colleagues was based on a collaborative model where a team of interdisciplinary professionals monitored frail older adults in the community and promptly mobilized resources in response to any changes in medical or social needs . A more recent study by markle - reid et al . Also demonstrated the benefits of using collaborative interdisciplinary teams in the community to support frail older adults living at home . Our study showed that 63.6% of the alc population had a diagnosis of dementia . This percentage is higher than the 36.3% reported by costa et al . And the 25% reported by cihi . Our findings show that 33.7% of the alc patients did not receive a diagnosis of dementia until after they were admitted to hospital, and this number is considerably less than the estimated 64% of people living in the community with an undiagnosed dementia . A systematic review by aminzadeh et al . However, early detection and treatment of dementia is important at both an individual and system level . At the individual level, initiation of treatment, engaging in home supports, and planning for future care can begin once a diagnosis of dementia has been made . At the system level, awareness of the prevalence of dementia in the community can assist policymakers in planning for adequate care in the community . Early diagnosis of dementia, coupled with appropriate care in the community, may help to curtail the number of patients with dementia who end up in hospital as alc patients . Even though this study does not report on the total length of stay in hospital, it did report on the length of stays up to the time of data collection . The mean length of stay for these alc patients was just over one year, with a median length of stay of 182 days . This median length of stay is more than 7 times the median length of stay of 26 days as reported by cihi . The differences in the mean and median length of stays indicate that the length of stay is positively skewed, with some patients having excessively long hospital stays . This suggests that limiting data collection to only those who have left hospital may not be adequate to fully understand the magnitude of the problem of alc patients within acute care hospitals . Capturing alc patient data, based on current occupancy in hospitals, may provide more accurate information about how alc patients are impacting the health - care system . It has been long known that hospitalization can be harmful for older patients and this was also demonstrated in our study . Overall, the patients in the study showed a decline in their mobility and activities of daily living during their hospitalization . It is possible that the functional abilities of these patients were over - reported at the time of admission; however, it is equally plausible that their functional decline was secondary to their hospitalization . This highlights the inconvenient truth that the use of hospitals for waiting areas for supportive living arrangements in the community may be counterproductive . Hospitals may actually be contributing to the functional decline experienced by these patients as they wait, leading to an increase in the level of care needed by patients when they return to the community . This underscores the fact that alc is not just a hospital - based issue, but it is also an issue for community - based services, including long - term care facilities . Hospitals and long - term care services must come together to explore the issue of alc and identify ways to ensure that those patients requiring supportive services in the community can access them in a timely manner . In addition, hospitals with alc patients should adopt better strategies to focus on the care of these patients, paying particular attention to enhancing or maintaining functional abilities such as mobility and other activities of daily living . When the reason for admission to hospital is considered, most of the patients in this study were admitted with a medical illness, or because the patient and/or family could no longer manage in the community . The rate of emergency department visits and the acute care hospital admissions in the year prior their alc admission appears low . This suggests that targeting interventions to the older population that have frequent hospitalizations and/or emergency department visits may not be an effective strategy in reducing the number of alc patients . Since this study was conducted, attempts have been made across canada, including the atlantic provinces, to respond to the impact that alc patients have on hospitals and the entire health - care system . These include the introduction of in - patient alc units, expansion of home care / community services, and the construction of new long - term care facilities . Despite these efforts, the number of people designated as alc remains on the rise, and national and regional media reports continue to highlight the negative impact alc has on hospitals, patients, and the entire health - care system . These facts strongly suggest that the results of this study remain relevant today and underscore the need to continue to work towards finding a solution to this problem . Although this study does provide important information about alc patients in two new brunswick hospitals, it is not without its limitations . Data in this study were obtained from retrospective chart reviews; therefore, the information is limited to that which was available on the hospital chart . The two hospitals used in the study were located within the same city and within the same health region which may limit generalizability . Significant differences may exist in the availability / accessibility of community services and in the characteristics of alc patients in other regions within the province and across the country . This data was collected in 2009, thus raising question as to whether this remains true today . Since this study was conducted, there has not been a significant increase in the number of long - term care beds available in this city, and there have been no fundamental changes in the community services offered . This study suggests that the number of alc patients in acute care hospitals is a much larger issue within the canadian health - care system than reported by cihi . Findings point to the need for community - based strategies that appropriately target those at risk . In addition, an adequate supply of community - based services, including an adequate supply of long - term care beds, needs to be considered as part of the solution . Better hospital - based care for frail adults may also limit the amount of functional decline experienced by these patients while they wait in hospital . In the short term, hospitals and community - based services must work together to identify more effective ways of identifying people at risk in the community; those at risk may require additional supports . Interventions are needed to ensure people are able to transition to higher levels of care within the community . The high rates of dementia seen in this study suggest the issue of alc is closely connected to a diagnosis of dementia . Improved comprehensive care of dementia in primary care settings is needed and may help to mitigate the need for hospital admission for some people.

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.